Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
referring first to fig1 , an actuator assembly 100 usable in an aircraft is shown . the actuator assembly 100 includes an actuator housing 110 . an input shaft 120 is coupled to an output shaft 130 in a coaxial relation . providing a connection between the input shaft 120 and output shaft 130 is a no - back device 140 . the output shaft 130 is locked by the no - back device 140 to prevent external loads from back driving the actuator assembly 100 into a potentially hazardous position in the event of a structural failure or disconnect of the input shaft to the actuator . the input shaft 120 may be driven either clockwise or counterclockwise . when the no - back device 140 is functioning properly and the input shaft 120 is stationary , the output shaft 130 is automatically locked against back driving , in either the clockwise or counterclockwise directions . no - back devices are known and a person having ordinary skill in the art would be able to select a no - back device appropriate for the particular application . positioned adjacent an external surface of the no - back device 140 is a no - back output gear 142 , such as a sun gear for example . a reaction gear 146 is coupled with the no - back output gear 142 . in one embodiment , the reaction gear 146 is directly coupled to the no - back output gear 142 . in an alternate embodiment , the reaction gear 146 is indirectly coupled to the no - back output gear 142 through a planetary gear assembly 144 having at least one additional gear . a check device 150 engages the reaction gear 146 , such that rotation of the check device 150 while the output shaft 130 is locked determines whether the no - back device 140 is functioning properly . in a first embodiment of the invention , shown in fig2 a and 2b , the check device 150 includes a drive feature 152 , extending through a hole 114 in the actuator housing 110 , allowing rotation between a first position and a second position . a first end 152 a of the drive feature 152 is accessible from outside the actuator by a person , such as a mechanic for example . the first end 152 a is positioned adjacent the outer surface 112 of the actuator housing 110 . in one embodiment , this first end 152 a of the drive feature 152 includes a head , such as a hex head , that allows a mechanic to easily apply a rotational torque to the drive feature 152 . a stop device 144 , such as a lock washer for example , is disposed between the first end 152 a of the drive feature 152 and the actuator housing 110 to prevent unwanted rotation of the drive feature 152 when a mechanic is not checking the functionality of the no - back device . the body of the drive feature 152 between the first end 152 a and the second end 152 b includes a first groove 156 . an axial retention feature 157 , such as a c - clip for example , connects to drive feature 152 and is positioned within the first groove 156 to prevent the drive feature 152 from sliding vertically relative to the actuator housing 110 . disposed along the body of the drive feature 152 between the first groove 156 and the first end 152 a is a circumferential second groove 158 . a seal 159 fits between the second groove 158 and the actuator housing 110 to prevent moisture from entering the actuator assembly 100 . the second end 152 b of the drive feature 152 includes an eccentric feature that extends into a slot 148 in the reaction gear 146 . in one embodiment , the drive feature 152 is an eccentric pin , wherein the central axis z of the first end 152 a of the pin is offset from the central axis y of the second end 152 b of the pin . when a rotational force or torque is applied to the first end 152 a of the drive feature 152 , the eccentric feature of the second end 152 b moves with respect to the slot 148 . this movement of the second end 152 b creates a rotation of the reaction gear 146 which in turn causes a magnified rotation of the no - back output gear 142 . in an alternate embodiment of the check device 150 , shown in fig3 a - 3c , a threaded insert 160 is threadably engaged with hole 114 of the actuator housing 110 . the threaded insert 160 includes a flange attached to a body having a plurality of threads on an external surface 162 of the threaded insert 160 . the threaded insert 160 extends substantially from the reaction gear 146 to the actuator housing 110 such that when the threaded insert 160 is seated in position , the top surface of the flange is substantially flush with the outer surface 112 of the actuator housing 110 . disposed within the threaded insert 160 is a drive feature 152 having a first end 152 a accessible from the actuator housing 110 and a second end 152 b extending into a slot 148 of reaction gear 146 . coupled to the drive feature between the first end 152 a and the second end 152 b is a bearing 164 to minimize the drag of the drive feature 152 as it rotates within the threaded insert 160 . a seal 158 is located between the threaded insert 160 and the actuator housing 110 . an additional seal exists between the threaded insert 160 and a cover plate 170 of the check device 150 to prevent moisture from entering the actuator assembly 100 . a cover plate 170 having at least one fastener 172 attaches to the outer surface 112 of the actuator housing 110 . positioned between each fastener 172 and the housing 110 may be a washer 174 . removal of the cover plate 170 from engagement with the actuator housing 110 exposes the first end 152 a of the drive feature 152 . a stop device 144 is incorporated into the cover plate 170 . the surface of the cover plate 170 facing the drive feature 152 includes a protrusion 144 having a shape complementary to the first end 152 a of the drive feature 152 . in one embodiment , the first end 152 a of the drive feature 152 is square . when the cover plate 170 is attached to the actuator housing 110 , the first end 152 a of the drive feature 152 aligns with the inner edge of the protrusion 144 such that the first end 152 a is confined within the protrusion 144 and is thereby prevented from freely rotating . to check the functionality of the no - back device 140 , an aircraft mechanic first adjusts the actuator assembly 100 such that the output shaft 130 is locked and the input shaft 120 is free to rotate . the mechanic then removes the stop device 144 of the check device 150 so that the drive feature 152 can rotate . in the illustrated embodiments , removal of the stop device 144 includes removing either a lock washer or a cover plate from engagement with the drive feature 152 . the first end 152 a of the drive feature 152 is then rotated clockwise ninety degrees from a normal to a first “ check - clockwise ” position . after the mechanic performs a check of the no - back device 140 with the drive feature 152 in the first position , the first end 152 a of the drive feature 152 is rotated back to the normal position . the mechanic then rotates the drive feature 152 ninety degrees in counterclockwise to a second “ check - counterclockwise ” position where the mechanic again evaluates the functionality of the no - back device 140 . after the functionality of the no - back device 140 has been verified in both the clockwise and counterclockwise positions , the drive feature 152 is returned to the normal position , and the stop device 144 is re - engaged . the rotation of the drive feature 152 to each of the first and second positions results in a specific amount of rotation of the reaction gear 146 . dependent on the gear ratio between the reaction gear 146 and the no - back output gear 142 , the generally small amount of rotation of the reaction gear 146 will result in a substantially magnified angular rotation of the no - back output gear 142 . this rotation of the no - back output gear 142 is used to verify the functionality of the no - back device 140 . if the no - back device 140 has no lost motion , braking of the no - back output gear should result if the no - back device 140 is functioning correctly . if the no - back device 140 includes lost motion , the no - back output gear 142 must be sufficiently rotated beyond the lost motion threshold for braking of the no - back output gear 142 to result , thereby demonstrating the proper functioning of the no - back device 140 . if , however , the no - back device 140 is not functioning properly , regardless of whether it includes lost motion , rotation of the no - back output gear 142 will result in visible rotation of input shaft 120 , and service is required . while the invention has been described in detail in connection with only a limited number of embodiments , it should be readily understood that the invention is not limited to such disclosed embodiments . rather , the invention can be modified to incorporate any number of variations , alterations , substitutions or equivalent arrangements not heretofore described , but which are commensurate with the spirit and scope of the invention . additionally , while various embodiments of the invention have been described , it is to be understood that aspects of the invention may include only some of the described embodiments . accordingly , the invention is not to be seen as limited by the foregoing description , but is only limited by the scope of the appended claims .	5
embodiments of the present invention will be described with reference to the accompanying drawings . fig1 is a circuit diagram of a voltage regulator having an inrush current protection circuit according to a first embodiment . the voltage regulator of the first embodiment is constituted of a reference voltage circuit 101 , a differential amplifier circuit 102 , an output transistor 104 , resistors 105 and 106 of a voltage - dividing circuit , an inrush current protection circuit 103 , and an output voltage detection circuit 213 . the output voltage detection circuit 213 is formed of pmos transistors 202 and 203 , a constant - current circuit 204 , an amplifier with offset 201 , and a capacitor 205 . the inverting input terminal of the differential amplifier circuit 102 is connected to one terminal of the reference voltage circuit 101 , while the non - inverting input terminal thereof is connected to the connection point of the resistors 105 and 106 , and the output terminal thereof is connected to the gate of the output transistor 104 and the output terminal of the inrush current protection circuit 103 . the other end of the reference voltage circuit 101 is connected to a ground terminal 100 . the amplifier with offset 201 has a non - inverting input terminal thereof connected to one terminal of the reference voltage circuit 101 , an inverting input terminal thereof connected to the connection point of the resistors 105 and 106 , and an output terminal thereof connected to the gate of the pmos transistor 203 . the pmos transistor 203 has a drain thereof connected to the input terminal of the inrush current protection circuit 103 and a source thereof connected to a power supply terminal 150 . the pmos transistor 202 has a gate thereof connected to the input terminal of the inrush current protection circuit 103 , a drain thereof connected to the power supply terminal of the amplifier with offset 201 , and a source thereof connected to the power supply terminal 150 . the constant - current circuit 204 has its one terminal connected to the input terminal of the inrush current protection circuit 103 and one terminal of the capacitor 205 and its other terminal connected to the power supply terminal 150 . the other end of the capacitor 205 is connected to the ground terminal 100 . the operation of the voltage regulator according to the present embodiment will now be described . the resistors 105 and 106 divide an output voltage vout , which is the voltage of an output terminal 180 , and output a divided voltage vfb . the differential amplifier circuit 102 compares an output voltage vref of the reference voltage circuit 101 with the divided voltage vfb to control the gate voltage of the output transistor 104 such that the output voltage vout remains constant . if the output voltage vout is higher than a predetermined voltage , then the divided voltage vfb will be higher than the reference voltage vref . further , the output signal of the differential amplifier circuit 102 ( the gate voltage of the output transistor 104 ) will be high and the output transistor 104 turns off , causing the output voltage vout to fall . thus , the output voltage vout is controlled to remain at a constant level . if the output voltage vout is lower than the predetermined voltage , then a reverse operation from the above is performed to increase the output voltage vout . thus , the output voltage vout is controlled to remain at the constant level . the following will describe the operation at the startup of the supply voltage of the voltage regulator according to the present embodiment . immediately after the power is turned on , the voltage at the output terminal of the output voltage detection circuit 213 is a ground voltage , so that the pmos transistor 202 turns on , supplying power to the amplifier with offset 201 . the output voltage vout has not yet risen , so that the divided voltage vfb is lower than the reference voltage vref , and the amplifier with offset 201 outputs a hi signal , causing the pmos transistor 203 to turn off . this causes the capacitor 205 to be charged with the current of the constant - current circuit 204 , gradually increasing the voltage at the output terminal of the output voltage detection circuit 213 . the inrush current protection circuit 103 operates to prevent an inrush current as long as it receives a lo signal from the output voltage detection circuit 213 . the startup time of the output of the output voltage detection circuit 213 depends on the current value of the constant - current circuit 204 and the capacitance value of the capacitor 205 . the startup time is set to be longer than the startup time of the voltage regulator such that the operation of the inrush current protection circuit 103 will not stop while the voltage regulator is being started up . the operation of the inrush current protection circuit 103 is stopped when the output of the output voltage detection circuit 213 has risen to a certain level and no longer consumes current after the voltage regular has been started up . further , the pmos transistor 202 of the output voltage detection circuit 213 turns off to stop the operation of the amplifier with offset 201 , so that no current will be consumed after the voltage regulator starts up . the amplifier with offset 201 adds an offset to the non - inverting input terminal such that the divided voltage vfb becomes higher than the reference voltage vref . this makes it possible to prevent the inrush current protection circuit 103 and the output voltage detection circuit 213 from repeatedly turning on / off when the divided voltage vfb reaches a level in the vicinity of the reference voltage vref . as described above , the voltage regulator according to the first embodiment is capable of isolating the inrush current protection circuit promptly and timely immediately following the startup of the voltage regulator , thus making it possible to reduce current consumption by interrupting the supply of power to the output voltage detection circuit after isolating the inrush current protection circuit . fig2 is a circuit diagram of a voltage regulator according to a second embodiment . the voltage regulator according to the second embodiment differs from the one illustrated in fig1 in the provision of an output voltage detection circuit 513 , which has a different configuration from that of the output voltage detection circuit 213 . the following will describe the configuration of the voltage regulator according to the second embodiment . the description of the same part as that of the first embodiment will be omitted . a pmos transistor 203 has a drain thereof connected to the input of an inrush current protection circuit 103 , a source thereof connected to a power supply terminal 150 , and a gate thereof connected to a source of an nmos transistor 506 and a drain of an nmos transistor 507 . a pmos transistor 202 has a gate thereof connected to an input of the inrush current protection circuit 103 , a drain thereof connected to a gate of the nmos transistor 506 and one terminal of a constant - current circuit 508 , and a source thereof connected to the power supply terminal 150 . the other terminal of the constant - current circuit 508 is connected to a ground terminal 100 . a constant - current circuit 204 has one terminal thereof connected to the input of the inrush current protection circuit 103 and one terminal of a capacitor 205 , and has the other end thereof connected to the power supply terminal 150 . the other end of the capacitor 205 is connected to the ground terminal 100 . a constant - current circuit 501 has one terminal thereof connected to a drain of the nmos transistor 506 and the other end thereof connected to the power supply terminal 150 . the nmos transistor 507 has a gate thereof connected to a non - inverting input terminal of a differential amplifier circuit 102 and a source thereof connected to the ground terminal 100 . the operation of the voltage regulator according to the second embodiment will now be described . a constant - current source 501 and the nmos transistor 507 constitute a single - ended amplifier . an inversion threshold value of the single - ended amplifier is set to be slightly lower than a feedback voltage vfb . immediately after the power is turned on , the voltage at the output terminal of the output voltage detection circuit 513 is an earth voltage , so that the pmos transistor 202 turns on . the voltage at the gate of the nmos transistor 506 becomes high , so that the nmos transistor 506 turns on , thus activating the single - ended amplifier . the voltage at an output terminal 180 is also the earth voltage , so that the single - ended amplifier outputs a hi signal , turning the pmos transistor 203 off . hence , the current from the constant - current circuit 204 charges the capacitor 205 , gradually increasing the voltage at the output terminal of the output voltage detection circuit 513 . the inrush current protection circuit 103 operates to prevent an inrush current as long as it continues to receive a lo signal from the output voltage detection circuit 513 . the startup time of the output of the output voltage detection circuit 513 depends on the current value of the constant - current circuit 204 and the capacitance value of the capacitor 205 . the startup time is set to be longer than the startup time of the voltage regulator such that the operation of the inrush current protection circuit 103 will not stop while the voltage regulator is being started up . when the voltage at the output terminal 180 further increases until the feedback voltage vfb exceeds the inversion threshold value of the single - ended amplifier , the output of the single - ended amplifier inverts and the lo signal is issued . the pmos transistor 203 turns on , causing the voltage at the output terminal of the output voltage detection circuit 513 to be switched to a hi level , which in turn causes the inrush current protection circuit 103 to turn off . at the same time , the pmos transistor 202 also turns off , so that the voltage at the gate of the nmos transistor 506 is brought to the earth voltage by the constant - current circuit 508 . the pmos transistor 202 and the nmos transistor 506 turn off , and therefore , the output voltage detection circuit 513 no longer has a current path and therefore stops consuming current . as described above , the voltage regulator according to the second embodiment is capable of isolating the inrush current protection circuit promptly and timely to interrupt the supply of power to the output voltage detection circuit after isolating the inrush current protection circuit , thus making it possible to reduce power consumption .	6
refer to fig1 a block diagram schematically showing the architecture of an electronic vital - sign system with a manual vital - sign data input function according to one embodiment of the present invention . as shown in fig1 , the electronic vital - sign system with a manual vital - sign data input function 10 of the present invention comprises a detection unit 11 , a vital - sign recording unit 15 , a calculating / processing unit 12 , a display unit 14 , a transmission unit 13 , and a power unit 16 . the detection unit 11 detects first vital - sign information . the user uses the vital - sign recording unit 15 to input second vital - sign information manually . the calculating / processing unit 12 connects with the detection unit 11 and the vital - sign recording unit 15 and processes the first vital - sign information or the second vital - sign information . the display unit 14 connects with the calculating / processing unit 12 and displays the first vital - sign information or the second vital - sign information . the transmission unit 13 connects with the calculating / processing unit 12 and transmits the first vital - sign information or the second vital - sign information to a cloud database 20 . the power unit 16 connects with the detection unit 11 , the calculating / processing unit 12 , the display unit 14 , the transmission unit 13 and the vital - sign recording unit 15 , and provides power for these units or charges the system . in one embodiment , the vital - sign recording unit 15 is realized by a function button , which can be pressed or rotated to adjust the value so as to input one or more types of the second vital - sign information . in one embodiment , the vital - sign recording unit 15 is realized by more than one function button , which can be pressed or rotated to adjust the value so as to input one or more types of the second vital - sign information . in one embodiment , the vital - sign recording unit 15 is realized by a touchscreen . the user clicks on the option items of the touchscreen to adjust the value so as to input one or more types of the second vital - sign information . in one embodiment , the transmission unit 13 is a wired transmission interface , such as a usb port or an rs232 port . in one embodiment , the transmission unit 13 is a wireless transmission interface , such as a 2 . 4g or wifi transmission interface . in one embodiment , the electronic vital - sign system with a manual vital - sign data input function 10 is connected with an id scanner , such as a bar - code scanner , a card reader , an rfid ( radio frequency identification ) reader , or an nfc ( near field communication ) device . in one embodiment , the electronic vital - sign system with a manual vital - sign data input function 10 is a pulse , heart rate and blood pressure measurement system . the detection unit 11 detects the pulse or heart rate information of a patient or a testee . the calculating / processing unit 12 processes the pulse or heart rate information to obtain an electrocardiograph , a heart spectrum or a blood pressure . the user may use the vital - sign recording unit 15 ( such as a touchscreen or one or more function buttons ) to input one or more pieces of information of respiration rates of patients or testees . the obtained information of pulse , heart rate , electrocardiography , blood pressure , or respiration rate is transmitted via the calculating / processing unit 12 and the transmission unit 13 to the cloud database 20 for fully automatic integration and analysis of the vital - sign data and personal data . the cloud database 20 is an ordinary cloud database , a cloud his ( hospital information system ) or a cloud nis ( nursing information system ). after receiving the vital - sign information , the cloud database 20 undertakes data processing and establishes records , which are to be browsed by testees , family members , physicians or nursing personnel . the obtained information of electrocardiographs , heart spectra , blood pressures , and or respiration rates can be presented on the display unit 14 , such as an lcd device or an led display device . the power unit 16 is an alkaline battery assembly , a rechargeable battery assembly , a capacitor or a power supply device , providing power for these units or charging the system . besides , the electronic vital - sign system with a manual vital - sign data input function 10 may be a single - function vital - sign measurement system or a multi - function patient monitor . refer to fig2 a block diagram schematically showing the architecture of an electronic vital - sign system with a manual vital - sign data input function according to another embodiment of the present invention . as shown in fig2 , the electronic vital - sign system with a manual vital - sign data input function 10 of the present invention comprises a detection unit 11 , a calculating / processing unit 12 , a connection interface 17 , a power unit 16 , and an external electronic device 18 able to transmit information . the detection unit 11 detects first vital - sign information . the calculating / processing unit 12 connects with the detection unit 11 and processes the first vital - sign information . the connection interface 17 connects with the calculating / processing unit 12 . the power unit 17 connects with the detection unit 11 , the calculating / processing unit 12 and the connection interface 17 , and provides power for these units or charges the system . the external electronic device 18 is able to transmit information and connected with the calculating / processing unit 12 via the connection interface 17 . the user uses the external electronic device 18 to input second vital - sign information manually . further , the user uses the external electronic device 18 to transmit the first vital - sign information or the second vital - sign information to a cloud database 20 . in one embodiment , the external electronic device 18 able to transmit information includes a function button , which the user uses to input one or more types of the second vital - sign information . in one embodiment , the external electronic device 18 able to transmit information includes more than one function button , which the user uses to input one or more types of the second vital - sign information . in one embodiment , the external electronic device 18 able to transmit information includes a touchscreen , which the user uses to input one or more types of the second vital - sign information . in one embodiment , the external electronic device 18 able to transmit information is a notebook computer or a tablet computer . in one embodiment , the external electronic device 18 able to transmit information is pda ( personal digital assistant ) or a smart phone . in one embodiment , the electronic vital - sign system with a manual vital - sign data input function 10 is connected with an id scanner , such as a bar - code scanner , a card reader , an rfid ( radio frequency identification ) reader , or an nfc ( near field communication ) device . in one embodiment , the electronic vital - sign system with a manual vital - sign data input function 10 is a pulse , heart rate and blood pressure measurement system . the detection unit 11 detects the pulse or heart rate information of a patient or a testee . the calculating / processing unit 12 processes the pulse or heart rate information to obtain an electrocardiograph , a heart spectrum or a blood pressure . further , the user uses the external electronic device 18 able to transmit information to input the respiration rate of a patient . for example , the external electronic device 18 is realized by a touchscreen or one or more function buttons , which the user uses to input one or more pieces of information of respiration rates . the obtained information of pulse , heart rate , heart spectrum electrocardiograph , blood pressure , or respiration rate is transmitted via the calculating / processing unit 12 , the connection interface 17 and the external electronic device 18 to the cloud database 20 for fully automatic integration and analysis of the vital - sign data and personal data . the cloud database 20 is an ordinary cloud database , a cloud his ( hospital information system ) or a cloud nis ( nursing information system ). after receiving the vital - sign information , the cloud database 20 undertakes data processing and establishes records , which are to be browsed by testees , family members , physicians or nursing personnel . the obtained information of pulse , heart spectrum , electrocardiograph , blood pressure , or respiration rate can be presented on the external electronic device 18 , such as an lcd device or an led display device . the power unit 16 is an alkaline battery assembly , a rechargeable battery assembly , a capacitor or a power supply device , providing power for these units or charging the system . besides , the electronic vital - sign system with a manual vital - sign data input function 10 may be a single - function vital - sign measurement system or a multi - function patient monitor . as described hereinbefore , the present invention adds a function of manually inputting second vital - sign information and a function of transmitting information to an ordinary electronic vital - sign system . thereby , the present invention can instantly provide the vital - sign measurement data of patients , elders or other testees who need routine healthcare or immediate medical assistance . further , the cloud database 20 enables the testees , family members or nursing personnel to track vital - sign information in a wired or wireless way ( such as via the internet ), whereby is realized a far - end healthcare system . the present invention proposes an electronic vital - sign system with a manual vital - sign data input function 10 , which can fast and precisely detect and record vital - sign data of patients , elders or testees who need routine healthcare or immediate medical assistance and can instantly provide the vital - sign data for family members , telecare centers , personnel of nursing stations or physicians . suppose that an abnormal state appears in a patient whose vital signs are being continually monitored by the electronic vital - sign system with a manual vital - sign data input function 10 , such as a blood pressure monitoring system , a blood oxygen monitoring system , a blood glucose monitoring system , a patient monitoring system or an electrocardiograph monitoring system . in such a case , the related personnel should enquire the patient about his feeling as soon as possible and instantly input the abnormal vital - sign values into the system manually . the related personnel should send the patient to a large - scale hospital or medical center for further examination if necessary . in conclusion , the present invention proposes an electronic vital - sign system with a manual vital - sign data input function , wherein a vital - sign detection function , an information transmission function , a manual vital - sign data input function and a far - end healthcare function are integrated in a system to provide appropriate assistance for patients , elders and testees .	0
as noted above , an animal may be cloned ; however , the ability of a cloned animal to make a particular antibody having a particular specificity is a learned response . furthermore , the cloning process has not been demonstrated to also transfer the immunologic memory from the founder animal to the cloned animal . therefore , in order to increase the odds in favor of producing a cloned animal with the capability to produce the desired antibody having a defined specificity , a different methodology must be utilized such as that of the present invention . in particular , the present invention encompasses a method whereby lymphoid cells or lymphocytes ( e . g ., from whole blood , blood - derived cells , peripheral blood lymphocytes , splenocytes , lymph node lymphocytes or bone marrow cells including stem cells ) may be obtained from an animal ( i . e ., the founder ) having a desirable immunological profile ( e . g ., the demonstrated ability to produce an antibody having a particular specificity ). a founder animal is one that is known , following experimentation , to produce a unique immune response that is difficult to duplicate in other animals of the same or different species . fresh whole blood or cells derived from blood , lymphatic tissue or bone marrow are then suspended in freeze media containing nutrients ( e . g ., fetal calf serum ) and dmso ( dimethyl sulfoxide ) as a cryoprotectant and stored frozen in liquid nitrogen . once a cloned animal is available ( created by using the founder animal ), it may then be injected with fresh or preserved cells from the founder animal . since the transfused cells are genetically identical to the clonal host or founder animal , they should not invoke immune rejection and are expected to successfully repopulate the lymphoid organs in the host or cloned animal . as such cells contain immunologically competent memory cells , the stimulation thereof in the cloned animal , by in vivo challenge , will produce the desired anamnestic immune response of the founder animals . the need for the present invention is significant . such a need may be , for example , illustrated as follows : an essential and critical component of a diagnostic assay for t4 is sheep anti - t4 serum that is immobilized onto a solid phase ( e . g ., microparticles ). in combination with a conjugate made up of t3 ( triiodothyronine , an analog of t4 ) and alkaline phosphatase , the sheep serum confers basic critical quality attributes required to generate a distinct standard calibration curve and allow for an estimate of ft4 in patient samples . the serum is developed by immunizing sheep with t4 - tg complex . thyroxin ( t4 ) is coupled onto a protein carrier molecule ( porcine thryoglobulin or tg ), then emulsified in an adjuvant prior to injection into sheep . this is a classical approach to raising needed immune responses in experimental animals . historically , however , this method of immunization produced antibodies recognizing t4 molecules ; yet , in the great majority of instances , the resulting sera does not perform adequately in diagnostic tests . success of adoptive transfer requires that the source and the destination animals either be genetically compatible ( as in identical twins , clones , highly inbred species as is the case in some mice ) or the recipient animal ( destination ) be immunologically suppressed through the use of chemical agents and radiation . it is not readily understood if such a rare and unique immune response is dictated solely by the animal &# 39 ; s genetic background or to what degree the response is confounded by a variety of presently unknown factors . on the basis of theory alone , however , a large contributor to the uniqueness of such a response is the genetic make up of these responders . the low efficiency and unpredictable response is an obstacle to providing long - term resources and reagent safety stock and therefore jeopardizes the availability of test material . however , if an immunologic responder animal is cloned , in accordance with the present invention , the probability of raising a clone with immunologic potential similar to that of the founder animal is significantly enhanced . moreover , the adoptive transfer of immunologically competent lymphoid cells from the founder to the clone will further enhance the opportunity of duplicating the immune competency of the founder animal without the risk of immune rejection . in view of the above , one purpose of the present invention is to produce a cloned animal with the same immune capacity and immunological identity , as the founder animal with respect to a specific antigen . the transfusion may be preceded by , followed by or concurrent with immunization and / or boosting by an immunogen that has been demonstrated to illicit a particular immune response to yield the desired antibody specificity . other manipulations may also be attempted to increase the likelihood of producing the needed antibody depending on the success of this transfusion approach . for instance , one possible manipulation is to boost a sheep which has previously been immunized using t4 - tg immunogen , with t4 coupled to a different carrier molecule such as klh ( keyhole limpet hemocyanin ). the antibodies produced by the cloned animal may be used for many purposes . for example , the antibodies may be utilized in diagnostic assays as well as for therapeutic purposes . the present invention therefore will allow for the production of an endless supply of such antibodies without the concern of maintaining the desired immunological response of the founder animal . the present invention may be illustrated by the use of the following non - limiting examples : initially , fucosyl transferase transgenic mice ( or a group of animals of the same species ) are immunized with an antigen such as t4 - tg . the immunized mice are then cloned using fibroblast cells as nuclear donors . at adulthood , the cloned mice are then divided into two groups . immune splenocytes from the immunized mice are then obtained and transferred to the group i mice ( adoptive transfer group ). in contrast , naïve splenocytes are obtained from un - immunized mice and transferred to group ii ( negative control group ). both groups of mice are challenged with t4 - tg antigen . the antibody response or titer produced against the t4 hapten is measured in both groups and compared . if adoptive transfer is successful , group i mice ( animals transfused with immunologically trained cells ) show a secondary immune response ( high titer specific ) while group ii mice ( animals transfused with immunologically naïve cells ) show only a primary immune response ( low titer and less specific ), such as in vaccination . in particular , a vaccine is designed to train the immunologically naïve cells to become “ educated ” immune cells . once immune ( or educated ) cells counter a real infection , they respond more rigorously ( e . g ., higher antibody level , i . e ., higher titer ) and more specifically than an otherwise un - educated or naïve cell .	0
this cooling tunnel system is useful for rapid cooling objects with a shortened tunnel length . it &# 39 ; s useful for cooling foods such as , fruits , vegetables , meat and poultry . the tunnel simply uses an appropriate conveyor belt for each object cooled . the tunnel system is most advantageous for eggs where processors demand effective cooling of eggs though high - velocity packaging lines . although the cooling system is useful for rapid cooling multiple objects , the figures illustrate the cooling tunnel for eggs . in fig1 a cooling system 10 is schematically shown and comprises an egg sorting head 12 , a cooling tunnel 14 and a carton loading / closing mechanism 16 . a conveyor system 18 receives eggs from sorting head 12 and carries them into cooling tunnel 14 in file arrangements . more particularly , egg conveyor 18 is arranged so that the sorted eggs enter cooling tunnel 14 as a plurality of files and ranks , much like a group of soldiers marching in parallel files . egg conveyor 18 is constructed so that the individual eggs are continuously rotated as they are conveyed through cooling tunnel 14 . a plurality of fans 20 are positioned within cooling tunnel 14 and enable recirculation of the coolant employed therein . most advantageously , the conveyor 18 enters and exits through the top of the cooling tunnel 14 . this reduces the amount of atmospheric gases , including water vapor , infiltrating into the cooling tunnel 14 . referring to fig2 and 3 , details of cooling tunnel 14 are illustrated that are not shown in fig1 . more particularly , cooling tunnel 14 comprises a tunnel enclosure 22 on which are mounted a plurality of fan motors 24 which drive fans blades 26 . a pair of conveyors 18 are positioned within tunnel enclosure 22 and are identical in structure . each conveyor 18 is enclosed by a shroud 28 that exhibits : ( i ) an open bottom portion 30 that communicates with a lower plenum 32 ; and ( ii ) a slotted portion 34 that is adjacent to and communicates with an upper plenum 36 . slotted portion 34 , comprises a plurality of slots 38 , with each slot 38 oriented along and parallel to the length of cooling tunnel 14 . when cooling other foodstuffs , the slots may have alternative shapes , such as circular , helical or slotted perpendicular to the belt . most advantageously , the slots direct and accelerate cooling fluid toward an aligned file of objects traveling on the conveyor 18 . each slot 38 has an opening orifice positioned directly over a file of eggs being moved therebeneath . slots 38 preferably are comprised of an opening 40 ( see fig3 ) that communicates with a pair of opposed walls 42 that lead to an outlet 44 . outlet 44 is positioned directly over a file of eggs 46 so as to enable a cryogen coolant exiting therefrom to impinge directly upon eggs 46 . as above indicated , conveyors 18 are constructed so as to enable the cryogen coolant to pass therethrough into lower plenum 32 . there , under the influence of fan blades 26 , the cryogen coolant moves up through flow region 48 and into upper plenum 36 , pressurizing upper plenum 36 , passing through slots 38 and down past the eggs 46 on conveyor 18 . to achieve proper cryogen snow / vapor velocities through slots 38 , the positioning of fan blades 26 is important . it is preferred that fan blades 26 be positioned in approximately the same plane as the plane that defines the upper surface of slotted portion 34 of shroud 28 . this positioning enables fan blades 26 to provide a cryogen vapor flow into upper plenum 36 that achieves a substantially uniform cooling across the width of conveyor belts 18 . it has been found that if fan blades 26 and the upper surface of the slotted portion 34 of shroud 28 are raised too high , velocity of the cryogen snow / vapor off the tips of the blades produces a high pressure region at the outermost walls of upper plenum 36 . this uneven pressure distribution results in higher vapor velocities flowing through the outermost slots 38 , as opposed to the slots 38 that are closest to the fan blades . in addition to the importance of vertical position of fan blades 26 , the width of slots 38 , where the high velocity cryogen vapor escapes from upper plenum 36 , affects the distribution of the cryogen vapor through the innermost and outermost slots 38 . the narrower the slot ( i . e ., the spacing between walls 42 ), the more back pressure is created in upper plenum 36 . this tends to even out the flow in the system . but if the slots are made too narrow , the back pressure can be too high . this degrades the system &# 39 ; s efficiency by demanding higher fan horsepower requirements . in addition , if slots 38 are made too narrow , they may have a tendency to collect water and to eventually plug up with ice . it has been found that slots 38 should exhibit a width of greater than 0 . 25 inches ( 0 . 64 cm ). in the structure shown in fig1 - 3 , maximum heat transfer is realized when sufficient cryogen snow / vapor velocities impinge on eggs 46 to wipe away the warm boundary layer that normally surrounds eggs passing through cooling equipment . it is preferred that the cryogen snow / vapor velocities escaping from slots 38 fall within a range of about 10 meters per second to 20 meters per second , with a most preferred value being about 15 meters per second . at these flow rates , direct impingement of the cryogen snow / vapor on the eggs is ensured . furthermore , when the lengths of slots 38 are oriented above associated files of eggs , approximately equal impingement flow velocities are experienced by all eggs in a file . the distance from outlet 44 of a slot 38 and the top of the eggs to be cooled has a direct bearing on the cryogen snow / vapor velocities seen by the eggs and the rate of cooling thereof . it is preferred that these distances be adjustable and tuned in accordance with the amount of cooling required for the eggs , considering the residence time of the eggs in cooling tunnel 14 . the arrangement of slots 38 and the eggs ensures that complete and continuous high velocity cryogen snow / vapor impingement occurs along the entire length of cooling tunnel 14 . it is preferred that the residence time of the eggs in the cooling tunnel be less than two minutes and , preferably , 80 seconds or less . the cooling tunnel 14 operates with cryogenic and mechanical types of refrigeration . when using mechanical types of refrigeration , it is advantageous to add carbon dioxide to the atmosphere . the carbon dioxide appears to protect against egg degradation . advantageously , the direct impingement of a cryogen such as solid carbon dioxide or liquid nitrogen enhances heat transfer . referring to fig4 a , 5 and 5 a , three methods for the introduction of a carbon dioxide cryogen into the conveyor region will be described . referring first to fig4 a conduit 60 carries a liquid carbon dioxide supply . liquid carbon dioxide is fed to an injector 62 and then into a “ snow ” tube 64 . as the liquid carbon dioxide exits from injector 62 , it experiences a first pressure expansion to create a flow of carbon dioxide snow and vapor . a further expansion of the carbon dioxide occurs at ejection end 66 of snow tube 64 , which , in this case , is positioned within slot 38 and directly above a file of eggs . accordingly , a combination of carbon dioxide snow and vapor is directed upon the eggs passing beneath slots 38 . the arrangement shown in fig4 maintains the velocity of the carbon dioxide snow / vapor and the resulting higher velocities cause improved heat transfer , but only in a localized region due to the confining effect of nozzle 66 . referring to fig4 a , the design shown in fig4 has been altered so as to move nozzle portion 66 from within slot 38 and to position it just beneath upper panel 70 of upper plenum 36 . this arrangement enables the carbon dioxide snow / vapor to disperse throughout upper plenum 36 . since the carbon dioxide snow is allowed to spread above slots 38 , impingement is spread out over a greater linear length of slots 38 than for the arrangement shown in fig4 . while the arrangement of fig4 a does not achieve the same impingement velocities as the arrangement of fig4 it does provide more uniform cooling along the entire length of a file of eggs . velocities of the carbon dioxide snow particles are still substantial , since they are accelerated through slots 38 by fan generated cooling vapor flow . referring to fig5 most advantageously , a series of tubes 64 injects cryogen directly adjacent a plurality slots 38 and eggs 46 . the cryogen exits through a plurality of openings or micro - holes in tubes 64 through the slots 38 . these micro - holes inject solid and vapor carbon dioxide in the direction of vector 65 . furthermore the fans ( not illustrated ) direct the cryogen along vectors 71 into slots 38 . although it is possible to align tubes 64 perpendicular to the direction of the belt or in any other direction , most advantageously , these tubes have a longitudinal axis parallel to the belt &# 39 ; s direction . referring to fig5 a , tube 64 advantageously injects 300 psig ( 2 mpa ) liquid carbon dioxide 71 through a plurality of openings or micro - holes 73 into a plenum having a pressure of 0 psig ( 0 . 1 mpa ) forms a stream of solid and vapor carbon dioxide 75 . advantageously , the stream 75 flows toward and directs cryogen at the warm objects , such as food items to improve impingement . the velocity of the stream 75 allows the impingement cooler &# 39 ; s fans to operate with a lower speed . this in turn introduces less energy into the cooler and serves to increase the cooler &# 39 ; s efficiency . the micro - holes advantageously operate with a diameter of 0 . 001 in . to 0 . 050 in . ( 0 . 025 mm ) to ( 1 . 7 mm ) and a length of at least three times diameter . most advantageously , the micro - holes have a 1 inch ( 2 . 54 cm ) pitch and a diameter of about 0 . 006 inches ( 0 . 015 cm ). it is to be understood that various snow tube configurations can be utilized with this invention . in this regard , u . s . pat . no . 5 , 765 , 394 , entitled “ system and method for cooling which employs charged carbon dioxide snow ” discloses a nozzle arrangement wherein carbon dioxide snow and vapor is brought into contact with a conductive surface within the snow tube . the snow thereby achieves a charge as a result of frictional engagement with the conductive surface . a reference potential is applied to the conveyor and attracts the carbon dioxide snow to aid in the impaction thereof on the foodstuffs being cooled . a further nozzle arrangement is described in co - pending u . s . pat . no . 5 , 868 , 003 , entitled “ apparatus for producing fine snow particles from a flow of liquid carbon dioxide ”. there a nozzle described that is provided with a porous member that includes multiple pore - size pathways for passage of liquid carbon dioxide into a region of lower pressure . in the preferred embodiment , the carbon dioxide enters both the solid and vapor phase within the porous member , thereby enabling the solid phase to exit as a fine snow particulate . the disclosure of the two aforementioned patents is incorporated herein by reference . turning now to fig6 and 7 , further details of conveyor 18 will be described . fig6 illustrates a pair of conveyor rollers 72 and 74 that form a portion of conveyor 18 . the edges of rollers 72 and 74 are conveyed along support rails 76 and are thereby caused to rotate as they move through cooling tunnel 14 . the rotation of conveyor rollers 72 and 74 cause a continuous rotation of eggs supported therebetween throughout the entire length of cooling tunnel 14 . accordingly , all surfaces of the eggs supported by conveyor rollers 72 and 74 are subjected to the high velocity cryogen snow and vapor that exits from slots 38 . [ 0051 ] fig7 shows further details of rollers 72 and 74 and their method of interconnection via chains 78 and 80 . each conveyor roller includes a plurality of indented regions 82 which , in combination with similarly aligned indented regions 82 of an adjoining conveyor roller , act to support eggs in file and rank arrangements . chains 78 and 80 are operated to move conveyor rollers 72 and 74 along in lock - step over support rails 26 so that the eggs positioned between indented regions 82 are both confined to their respective files and are rotated as the respective conveyor rollers rotate . referring to fig8 the arrangement of fan blades 26 and top panel 70 enable the cryogen flow to bounce off panel 70 so that velocities and mass flow are balanced at slots 38 . however , to achieve a more precise balance of flows through slots 38 , baffles ( or spoilers ) 80 may be mounted to upper panel 70 directly above the discharge region of fan blades 26 . the angles of baffles 80 can be used to divert or bounce the main vapor velocities back towards either the inner slots 38 or the outer slots 38 , to balance the flow . [ 0053 ] fig9 illustrates an embodiment of the invention wherein , in lieu of the provision of cryogen injection nozzles , a pair of refrigeration coils 82 are introduced into cooling tunnel 14 to provide the source of refrigeration for cooling vapors present therein . either cooled air or expanded carbon dioxide can be introduced into cooling tunnel 14 and , thereafter , maintained at a cryogenic temperature by the action of refrigeration coils 82 , as the vapors are recirculated by fan blades 26 . [ 0054 ] fig1 illustrates apparatus configurations that both minimize air infiltration into cooling tunnel 14 and allow advantage to be taken of the density of the cold cryogenic vapors and their tendency to pool . as shown in fig1 , conveyor 18 enters cooling tunnel 14 via a three - sided vapor dam 90 and then proceeds downwardly into the accumulated cryogenic vapor region . an exhaust pick - up 92 draws cryogenic vapors from within cooling tunnel 14 and prevents an inflow of air thereinto . a baffle 94 is positioned between the upper and lower sections of conveyor 18 to further isolate the interior of cooling tunnel 14 from external air infiltration . [ 0055 ] fig1 is a graph showing the performance of a cryogenic egg cooling arrangement , as described above , in comparison to a traditional carbon dioxide cooling tunnel ( designated “ u4 ”). the graph of fig1 charts heat removed versus dwell time of the eggs within the cooling tunnel . using a computational fluid dynamics analysis , with cold vapor only and ignoring solid carbon dioxide impingement , curves 100 , 102 and 104 are predicted relationships between heat removed and dwell time for vapor flow velocities of 5 meters per second , 10 meters per second and 15 meters per second , respectively . when solid carbon dioxide impingement is considered , the curves should exhibit at least about 10 to 20 percent higher heat removal . [ 0056 ] fig1 illustrates a similar chart to that shown in fig1 , except that it is assumed that the carbon dioxide vapor exhibits a temperature of − 110 ° f . (− 79 ° c .). in addition to air infiltration , there are typically 3 additional areas of concern with respect to cryogenic cooler designs . they are : accumulation of excess cryogen in an inactive area of the cooler ; taking advantage of the cold vapor refrigeration value ; and fan horsepower requirements . the major operational problem of a typical cryogenic carbon dioxide freezer is an accumulation of excess amounts of carbon dioxide snow . this accumulation usually occurs in low pressure areas of the freezer ( e . g ., the freezer floor ) due to a lack of vapor flow . dry ice has a temperature of − 109 ° f . (− 79 ° c .) thus , as a freezer &# 39 ; s operational temperature drops below − 95 ° f . (− 71 ° c . ), there is a tendency to deposit carbon dioxide snow in the lower velocity areas of the freezer . the prior art ( e . g ., u . s . pat . no . 5 , 444 , 984 ) has utilized a second set of lower fans to keep the amount of carbon dioxide snow accumulation in check . the invention described above makes efficient use of centrally located fans to address this carbon dioxide snow accumulation problem . any snow that falls to the floor of cooling tunnel 14 is subject to exposure to a relatively high velocity vapor flow that moves along the floor of lower plenum 32 . this action tends to recirculate any free snow back around through the blower system , through upper plenum 36 and back down through slots 38 , directly to the eggs therebeneath . note that while the above description describes the use of cryogenic carbon dioxide , the invention is also usable with liquid nitrogen . the design of cooling tunnel 14 and the apparatus present therein makes good use of the available btu &# 39 ; s in the sublimated carbon dioxide or vaporized liquid nitrogen . this is especially true when nitrogen is used because of the high btu content of the cold vapor . using high velocity impingement vapor flow , warmer freezer temperatures ( e . g ., − 80 ° f . (− 62 ° c .) versus − 95 ° f . or (− 71 ° c .)) can be used to obtain similar heat transfer , when compared to those designs that do not have high velocity flows available . the invention delivers heat transfer on the order of 5 , 625 btu &# 39 ; s per hour per square foot ( 17 , 743 w / m 2 ) of active conveyor belt . this is a 50 % increase of heat transfer performance as compared to the traditional cryogenic tunnel freezer example above . a 2 horsepower ( 1 . 5 kw ) fan motor may be required every 1 . 5 feet ( 0 . 46 m ) along the length of cooling tunnel 14 to achieve optimum performance . calculations similar to those described above will indicate that such an arrangement enables 14 , 465 btu &# 39 ; s per hour ( 4 . 24 kj ) of heat transfer performance for every one fan horsepower ( 0 . 75 kw ). the objective of this example was to evaluate the heat transfer performance of impingement egg cooling for test - scale operation . the pilot tunnel was designed to enable the c0 2 vapor to “ pool ” in the cooling chamber , thus improving performance efficiency . it incorporated the sintered metal injection and linear high velocity vapor nozzle designs . two separate belts and drives allowed the production from two packing heads to be cooled with separate operating conditions . the active cooling length of the unit was 12 ft . ( 3 . 66 m ) and the overall length was approximately 15 . 5 ft . ( 4 . 72 m ). fig2 shows the cross sectional design of the pilot tunnel . the parameters that were varied for this series of tests were operating temperature , fan speed and dwell time . standard large table eggs were heated in a water bath for at least one hour to about 95 ° f . ( 35 ° c .). four eggs were used per calorimeter test and were placed across the test belt leaving the innermost and outermost positions empty . each calorimeter point is an average of the performance across the belt — tests conducted on a 6 ft ( 1 . 8 m ) prototype tunnel indicated that the egg position across the conveyor was not a significant factor effecting the cooling rate . for each data point the cooling tunnel operating parameters were set and stabilized , the eggs were carried from the water bath in an insulated box and then placed directly on the conveyor . one side was used for the tests with direct snow impingement and the other operated with only cold vapor . the results of the calorimeter tests are also listed in table 1 . the test results are summarized in fig1 and 14 . the heat transfer rates at two operating temperatures with the fans operating at about 100 % ( 3450 rpm ) are summarized in fig1 . as expected , the data indicate that the rate increases as the operating temperature is lowered — operating at − 100 ° f . (− 73 ° c .) resulted in a faster cooling rate than operating at − 90 ° f . (− 68 ° c . ), 77 vs . 89 seconds . this assumed that 44 btu / lb ( 102 kj / kg ) was removed to cool the eggs from 95 ° f . ( 35 ° c .) to 42 ° f . ( 5 ° c . )— this is considered the maximum . [ 0068 ] fig1 confirms an increased heat transfer rate due to direct impingement with solid and gas versus cold vapor . these data indicate an 8 to 9 % increase in heat transfer rate results from the direct impingement of solid co 2 plus vapor impingement in comparison to sole co 2 vapor impingement . it should be understood that the foregoing description is only illustrative of the invention . various alternatives and modifications can be devised by those skilled in the art without departing from the invention .	5
in the following description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the invention . it will be apparent , however , to one skilled in the art that the invention can be practiced without these specific details . reference in this specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the invention . the appearances of the phrase “ in one embodiment ” in various places in the specification are not necessarily all referring to the same embodiment , nor are separate or alternative embodiments mutually exclusive of other embodiments . moreover , various features are described which may be exhibited by some embodiments and not by others . similarly , various requirements are described which may be requirements for some embodiments but not other embodiments . broadly , embodiments of the present invention disclose a field programming method for programming a magnetic memory device . as used herein , the term “ magnetic memory device ” refers to a broad class of memory devices that use a magnetic storage element or bit for data storage . a magnetic random access memory ( mram ) device that uses a mtj as the magnetic storage element is one example of a magnetic memory device and will be the exemplary device used in the rest of this description to illustrate aspects of the present invention . however , it is to be understood that the aspects of the invention thus disclosed may equally be applied to any other type of magnetic memory devices from the class of magnetic memory devices . as will understood by one skilled in the art , a mram device , when it leaves a production line will typically comprise an array of magnetic storage elements ( mtjs ) coupled to addressing logic and read / write circuitry . typically all the magnetic storage elements will have a default resistance defined by the properties of the magnetic storage elements . thus , it is expected that all the magnetic storage elements will have the same default resistance . one skilled in the art will also understand that each of the magnetic storage elements will have the same threshold operating voltage . generally , during operation the threshold operating voltage is never exceeded . in one embodiment , the programming method disclosed herein comprises selecting a subset of the magnetic storage elements / cells of a mram device / circuit and deliberately subjecting those cells to a programming voltage ( vpp ) that exceeds the threshold operating voltage . the programming voltage is applied for a predetermined amount of time and the effect is that irreversible breakdown of the magnetic storage elements that are subjected to the programming voltage ( vpp ) occurs . because of this irreversible breakdown , the magnetic storage elements that were subjected to the programming voltage ( vpp ) will now have an altered resistance that is different than the original default voltage . advantageously , the resistance of the magnetic storage elements , whether default or altered , can be sensed be a simplified / compact read circuit that comprises a single diode connected in series to each magnetic storage element . aspects of the programming method of the present invention will now be described with reference to fig2 of the drawings , which shows a mram array 200 , in accordance with one embodiment of the invention . the mram array 200 comprises a 3 × 3 array of magnetic storage elements . it is to be understood that the invention is not limited to a 3 × 3 array as other array sizes are possible . the array 200 comprises a plurality of magnetic storage elements / memory cells , e . g . the cell 202 shown in fig2 . each cell comprises a magneto - resistive element . in accordance with difference embodiments of the invention , the magneto - resistive element may comprise a giant magnetoresistance ( gmt ) stack or a tunnel magnetoresistance ( tmr ) stack . in fig2 , the gmr or tmr stack is shown as variable resistor 204 . as will be seen , each stack is connected in series with a diode shown as 206 , which forms part of a read circuit ( not shown ). the 3 × 3 array comprises three word lines ( 208 , 210 , 212 ) and three bit lines ( 214 , 216 , 218 ) disposed so that a memory cell lies at each of the intersections of word lines and bit lines . the magnetic memory cells as fabricated each have a fixed or default resistance which can be sensed by a read circuit as a logical high or a “ 1 ”. when a voltage above a critical or threshold operating voltage , typically above 3v , is applied across the selected memory cell for a predetermined amount of time , the resistance value of the magnetic memory cell is reduced or altered . cells with the altered resistance can be read by passing a read current through the read circuit as a logical low or a “ 0 ”. for writing to memory array , the cells that need to be sensed as a logical low are selected and then the programming voltage is applied to the selected cells as described above . the memory cell 202 is written by applying a voltage above the threshold operating voltage between line 210 and line 216 where line 216 is at ground potential . the unselected lines 208 and 208 can have zero volts applied to them . at the same time zero volts is applied to line 216 , whereas lines 214 and 218 can be left floating . when the voltage above the threshold operating voltage is applied to line 210 , the default resistance value exhibited by magnetic stack ( resistor 204 ) in bit cell 202 undergoes reduction . since the programming method disclosed herein is voltage - based as opposed to current - based , the circuitry required to apply the programming voltage to the selected cells is much simpler than current drivers used in traditional mram memories . this results in smaller and more cost effective mram memories . one additional benefit of memory disclosed herein is that the operating voltage can be applied across a selected magnetic stack during the write operation from a pin other than vdd . another high voltage pin , such as vpp , may be employed to provide the programming voltage . this allows for scaling down of regular vdd supply voltage , without compromising higher voltage requirement for write operations . the voltage used during read operations are similar to that used for write operations , except that bias voltage applied to selected word line 210 is of lower value , typically about 1v . sensing circuitries are well known in the art , which can detect change of resistance to determine “ 0 ” or “ 1 ” state of bit cell . the voltage for write and read operations described herein are one illustration of how to implement this invention . it will be obvious to those knowledgeable in the field that same invention can be easily implemented by different variants of voltage conditions . the programming method disclosed herein is ideally intended to by used only once . however , in the case of programming errors , it may be possible to “ erase ” or “ reset ” the memory so that the programming method may be applied de novo , to erase / reset the memory , a first programming voltage is applied to the remainder cells in the memory array that were not selected during the first write operation . thus , all the cells will now have a new default resistance . the programming method can now be applied to apply a new and higher programming voltage to selected cells , as described above . embodiments of the present invention also cover a magnetic memory circuit / device that includes cells with data programmed in accordance with the programming method disclosed herein . embodiments of the present invention also cover electronic devices with a control element ( micro - controller or central processing unit ( cpu )) coupled to a magnetic memory circuit / device that includes cells with data programmed in accordance with the programming method disclosed herein . examples of such electronic devices include mobile phones , tablet computers , laptop computers , digital cameras , desktop computers , etc . although the present invention has been described with reference to specific exemplary embodiments , it will be evident that the various modification and changes can be made to these embodiments without departing from the broader spirit of the invention . accordingly , the specification and drawings are to be regarded in an illustrative sense rather than in a restrictive sense .	6
fig1 shows a partially cut - away exploded view of a steering wheel assembly generally indicated by reference numeral 10 . the steering wheel assembly 10 is adapted to be snap fit onto a hollow steering column shaft 12 . the steering column shaft 12 includes splines 14 at its top end and a groove 16 . a circular snap or split ring 18 is inserted in the groove 16 and includes a sloped engagement surface 22 and extending flange 20 . split or snap rings such as 18 are circular springs which can be compressed inwardly and then spring outwardly to its unstressed configuration upon removal of the load . the steering wheel assembly includes a steering wheel 30 having a central hub 32 defining a central opening 34 and a plurality of ribs 35 extend outwardly from the hub 32 to a rim 36 . the steering wheel assembly 10 includes an air bag housing 38 formed integrally with the hub 32 . the air bag housing 38 includes side walls 40 upward from the hub 32 . a frangible cover 42 having sides 44 is attached to the side walls 40 . the cover 42 includes a tear seam 46 of known construction and hinge portion 48a , b . an air bag 50 is stored in a folded condition within the steering wheel beneath the cover 42 . upon inflation of the air bag the cover is torn at its seam and parts of the cover rotate about the hinges 48a , b . the steering wheel assembly further includes a hollow insert 60 having a hollow , narrow , protruding , center part 62 . the insert may be formed integral with the hub or as a separate part . the center part 62 includes a flanged portion 63 defining an inflator receiving center opening 66 . the center part also includes a first fastening part such as internal threads 64 or for example a bayonet mount . the insert 60 additionally includes a radially extending flange 70 having a flat first surface 72 matingly engaging a flat second surface 74 of the hub . an axially extending walled portion 76 of the insert 60 includes a plurality of splines 78 which matingly engage the splines of the column 12 . as can be seen the diameter across the splines 78 is greater than the inflator receiving opening 66 . as can be appreciated other means can be provided to interlock the insert and column splines such as a bayonet mount or a keyed interface . positioned below the insert 60 is a collar 80 having a ) a first radial portion 82 abutting a corresponding radial part 84 of the insert , b ) an axial extending part 86 positioned about the walled portion 76 of the and c ) an inwardly extending end cap 88 including an inwardly directed circular flange 90 ending in a blunt edge 91 . the circular flange defines an additional opening 92 in which an inflator and sleeve are received . the collar 80 and insert 60 are removably secured to the hub 32 by a plurality of thread fasteners 92 such as bolts . a pyrotechnic cylindrically shaped inflator 100 is received and supported within the insert 60 . as in known inflators for air bags , provide inflation gas by the burning of solid propellant such as sodium azide , or provide heated inflation gas as in the case of a hybrid inflator or gas as a result of combusting burnable fluids . the inflator 100 includes a plurality of gas exits ports 102 situated at an end 104 thereof . the inflator also includes a fastener portion such as threaded portion 105 engagable with the threads 64 or other type of fastener used on the insert 60 . the cylindrical lower body 106 extends outwardly from the insert 60 and is protected by a plastic , reinforced plastic sleeve 108 . the sleeve 108 is shown is cup shaped metal but can also be an open ended cylinder . as can be seen only the narrow upper part 104 of the inflator 100 extends into the hub advantageously resulting in a small package ( cover , air bag and part of the inflator ) size . the propellant , inflation gas or liquid is typically stored in the body 106 . the sleeve , in addition to protecting the exterior of the inflator 100 , also protects the ignition wires 110 . as is known the ignition wires serve to communicate an electric signal to activate the inflator . in the embodiment shown the wires extend upwardly between the sleeve and the body of the inflator and exit through an opening 112 in the axial part 86 of the collar . one advantage of the present invention is that during assembly the air bag 50 and cover 42 may be attached to the steering wheel 30 independent of the inflator 100 . the inflator 100 may if desired be installed during the last phases of assembly . the air bag is attached to its housing or to the hub and folded in compact configuration . thereafter the cover 42 is attached to the air bag housing 38 by fasteners or other known means . the inflator is threaded into the insert 60 and the collar 80 is slid over the inflator body and the insert 60 . if the insert is a separate part from the hub , the insert and inflator are fitted into the center opening 34 of the hub 32 . the clearance between the insert and the hub can be one of a press fit , interference fit or a loose fit . thereafter the collar 80 is positioned about the insert 60 . the fasteners 92 are received within openings in the collar and insert and received within a threaded tapped holes in the hub and secure the collar , insert and inflator to the steering wheel completing the assembly of the steering wheel assembly . thereafter the steering wheel assembly is attached to the steering column 12 . this is accomplished by inserting the extending portion of the body 106 of the inflator into the hollow body of the steering column and aligning the splines 78 of the insert and the splines 14 of the column . as the steering wheel assembly is pushed down upon the column the flange 90 engages and compresses the sloped surface 22 of the snap ring 18 . further movement of the steering wheel pushes the slit ring into the groove 16 permitting the flange 90 to slide passed the ring 18 . once the end cap 88 of the collar is positioned below the split ring 18 the ring expands locking the steering wheel in place . after assembly , if the steering wheel or inflator need to be removed from the column this can be accomplished without having to compress the split ring . as can be appreciated from the above , the steering wheel can be removed simply by removing the fasteners 93 and lifting the steering wheel upwardly away from the collar . to reinstall the steering wheel and inflator the process is reversed . many changes and modifications in the above described embodiment of the invention can , of course , be carried out without departing from the scope thereof . accordingly , that scope is intended to be limited only by the scope of the appended claims .	1
as was noted above , it is an objective of the invention to overcome the disadvantages described above and to provide a binding apparatus for binding the front of a shoe or boot onto a ski . the binding is preferably for use in cross - country or mountaineer skiing wherein the skier lifts or raises his heel in the course of moving his legs . the binding is generally characterized by the fact that the front of the boot is connected to the ski by a flexible flexion element . a pivot means ia also provided which is journalled to pivot around a transverse axis . the pivot means may comprise an abutment shoulder or surface to block the pivoting thereof at the end of a certain extent of lifting of the heel . further lifting of the heel results in flexion of the flexible flexion element . according to one aspect of the invention , the first phase of the lifting of the heel occurs freely , and is accompanied by rotation around a transverse axis . however , rotation or pivoting beyond a certain extent is blocked by a shoulder , and further lifting of the heel results in flexion of the flexion element . it is another characteristic of the invention that the flexion and rotation occur beyond the front end of the boot . according to other aspects of the invention , the flexion element can be either journal - mounted on the ski or be attached to the ski in a rigid manner , in which case it is the boot which is journalled with respect to the flexion element . the first phase of the lifting of the boot occurs freely without consuming the energy of the skier ( the extent of lifting may be 0 - 2o ° with respect to angular lifting ). subsequently , lifting of the heel occurs against the elastic force of the flexion element which exerts a frontwardly directed moment on the ski , which is necessary for proper skiing . in this way , the ski is pressed against the snow as a result of the lifting of the heel , once the heel has been lifted beyond a predetermined extent . thus , the desired effect is achieved without tiring the skier by requiring him to work against flexional forces throughout his entire gate . fig1 - 6 illustrate a first embodiment of the invention . in this embodiment , binding apparatus 1 for connecting the front of the boot 2 to ski 3 comprises a binding 4 , shown as being mounted on a level surface of the ski , in cooperation with he front portion 5 of the boot . binding 4 comprises a movable and flexible flexion element 6 positioned in a base plate body 7 attached to the ski by virtue of screws 80 . flexion element 6 is substantially parallelpipedic and extends from the front to the rear of base plate body 7 . the base plate has two uprights , or lateral walls 70 and 71 extending vertically on both sides of the lateral edges of the flexion element . the flexion element is at least partially deformable and is mounted at its front portion to pivot around a transverse axis s . however , the pivoting of element 6 is angularly limited , as will be noted below . the front of the boot is secured onto element 6 by a retention apparatus 9 . the retention apparatus is described in french patent application no . 2 , 447 , 731 , the disclosure of which is hereby incorporated by reference , and need not be described in detail , particularly since this apparatus is given by way of example only . it need only be noted that element 6 extends rearwardly and comprises a support element 10 extending upwardly and that the front end 5 of boot 2 comprises a frontal support zone 11 as well as a latching element 12 which is spaced from the zone and extends in front of the boot . furthermore , a movable latch 13 is connected to element 6 by a stirrup 14 which may be journalled . the upper portion 15 of stirrup 14 is positioned in slot 16 comprising an elastic element 17 . slot 16 is formed in movable latch 13 which is pivotably mounted on stirrup 14 around upper portion 15 . insertion of the boot into the binding occurs by introduction of support element 10 between latching portion 12 and support zone 11 of the boot , and the retention is achieved by action of latch 13 on latching portion 12 , which thus forces support zone 11 against abutment zone 18 of support element 10 . fig1 illustrates the apparatus in the inactive position before insertion of the boot , and fig2 - 4 illustrate the apparatus in the active position with the boot inserted where the boot is to be retained . fig5 and 6 illustrate two phases of movement during lifting of the boot heel . the first phase involves a rotation around axis 8 , which is followed by a second phase which is accompanied by flexion of the flexion element . to pass from the first phase to the second phase , an abutment system is provided which blocks rotation beyond a certain extent . to achieve this , the front end of the flexion element comprises an abutment surface 19 which is inclined upwardly ( relative to the front of the binding ). fig5 illustrates the end of the first phase of movement during which the boot is lifted along direction f 1 by rotation around axis 8 until abutment surface 19 abuts against upper surface 20 of plate 21 of base plate body 7 . further pivoting of the flexion element is thus no longer possible , and any further lifting of the foot along direction f 1 results in flexion of the flexion element , as is shown in fig6 . movement along the direction f 1 thus occurs by pivoting of the flexion element around axis 8 , and subsequent movement along f 2 is accompanied by flexion of the flexion element . fig6 - 12 illustrate an alternative abutment system . in this embodiment , the same elements are against present ; namely , flexion element 6 &# 39 ; on which the boot is attached by virtue of the same apparatus as was previously described . flexion element 6 &# 39 ; is pivotably journalled around transverse axis 8 of base plate body 7 &# 39 ; which is attached to the ski . body 7 &# 39 ; comprises two lateral walls , 70 &# 39 ; and 71 &# 39 ;, which support pivot axis 8 and are connected at their upper portions by a horizontal wall member 72 . as may be seen from fig8 horizontal upper wall member 72 is upwardly spaced by a distance h from upper surface 60 of flexible element 60 &# 39 ;. this spacing allows for the free pivoting of element 6 &# 39 ; around axis 8 until upper surface 60 abuts against portion 73 of wall 72 ( see fig1 ). further pivoting is then blocked , and further movement of the boot occurs by flexion of flexion element 6 &# 39 ;. movement along f 1 thus occurs by pivoting of flexion element 6 &# 39 ; around axis 8 , and movement along direction f 2 occurs by flexion of flexion element 6 &# 39 ;. fig1 - 16 illustrate another embodiment in which it is not the flexion element which is journalled on the ski , but rather the end of the boot which pivots with respect to the flexion element . to achieve this , flexion element 6 &# 34 ; is attached to the ski at its front end by a body 7 &# 34 ; and a screw 8 . at its rear end , flexion element 7 &# 34 ; comprises a shaped element having a rounded slide surface 60 which is transverse and in the shape of a semi - circle of radius &# 34 ; r &# 34 ;. movable latch 61 is journalled around a transverse axis 62 . latch 61 is in the form of a stirrup which is configured and made of steel spring wire having a circular cross - section whose free ends 63 and 64 act as a journal axis for the upper portion 65 , which serves as a manipulation element . the free end of the boot comprises projection 30 , whose lower portion comprises a shaped slide member which has an arcuate surface extending in the transverse direction 31 , and has a shape which is complementary to the configuration of surface 60 and which cooperations therewith . the upper portion comprises a groove 32 which is adapted to receive horizontal arms 66 and 67 of latching element 61 . the lower frontal portion comprises an abutment surface 33 constituted by a surface which is inclined upwardly and frontwardly . fig1 illustrates the boot in the inserted position . movement along direction f 1 occurs by rotation of the boot with respect to the flexion element around the fictional transverse axis xx &# 39 ;, which passes through the center of the shaped projection having radius &# 34 ; r &# 34 ;. when surface 33 abuts against upper element 60 &# 39 ; of the flexible element , further rotation is no longer possible , and movement along direction f 2 occurs by flexion of the flexion element ( see fig1 ). fig1 illustrates an alternative embodiment in which flexion element 6 is definitively rendered integral with the boot , and remains permanently affixed thereto . it is thus possible , according to the invention , to provide for the flexion element to be either permanently or detachably secured to the boot with respect to each of the embodiments discussed above . the example set forth above illustates a number of ways of achieving such attachment although other techniques for accomplishing this aim are obviously possible . in all of the embodiments shown above , the binding is mounted on a level surface of the ski . also , the pivoting and flexional movements occur around real or virtual axes which are transverse and perpendicular to the longitudinal plane of symmetry . however , it is self - evident without going beyond the scope of the invention , that the journal axes . could also be skewed ( non - transverse angle ), as shown in french patent application no . 82 , o7758 , the disclosure of which is hereby incorporated by reference . thus , the invention is not limited to the transverse pivot axes disclosed and may be used with bindings having pivot axes which are other than transverse to the general logitudinal orientation of the ski , boot , and binding . it should also be noted that although an attempt has been made to include reference to all shoes and boots used in the manner of the invention , it is to be understood that the invention is not limited to any one particular shoe structure and extends to all equivalents within the scope of the claims . likewise , the application refers to &# 34 ; pivoting &# 34 ; and &# 34 ; flexion &# 34 ; as representing two different types of motion . it is to be understood , however , that what these terms intend to imply is that during &# 34 ; pivoting &# 34 ; there is a relatively free lifting of the heel , while during &# 34 ; flexion &# 34 ; the flexion element presents a resistance to further lifting which results in a moment forcing the front tips of the skis downwardly . finally , although the invention has been disclosed and described with reference to particular means , embodiments , and materials , it is to be understood that the invention is not limited to the particulars disclosed but extends to all equivalents within the scope of the claims .	0
referring more particularly to the drawing by characters of reference , fig1 - 5 disclose a sun tracking solar collector platform 10 comprising a stationary base 11 , a secondary support 12 pivotally mounted to base 11 , a collector mounting frame 13 rotatably mounted to secondary support 12 , an optical sensor element 14 mounted on the frame 13 , an electrical control box 15 , actuating motors 16 and 17 and a motor control swtich 18 . base 11 comprises a horizontal member 19 , an inclined member 21 , two vertical members 22 and 23 and two horizontal feet 24 and 25 . vertical members 22 and 23 are perpendicularly secured , respectively to the centers of feet 24 and 25 . member 23 is somewhat longer than member 22 . horizontal member 19 has one end secured to the top of member 22 and its other end secured to the side of member 23 at an elevation equal to the height of member 22 . inclined member 21 has one end secured with the one end of member 19 to the top of member 22 ; the other end of member 21 is secured to the top of member 23 . members 19 - 23 thus form a vertical framework held upright by feet 24 and 25 . the inclined top member 21 serves as a base for secondary support 12 . support 12 comprises a long horizontal member 26 and two short vertical members 27 and 28 . member 27 is perpendicularly attached to one end of member 26 and member 28 is perpendicularly attached to the other end of member 26 . member 26 is positioned directly over member 21 of base 11 in parallel relationship therewith and the end of member 26 to which member 28 is attached is pivotally secured to the elevated end of member 21 by means of a hinge 29 . through the action of the hinge 29 , member 26 may be permitted to rest driectly upon member 21 , or its free end may be raised vertically in a pivoting motion about hinge 29 . frame 13 comprises a rectangular frame 31 , an axle 32 and a sensor mounting bar 33 . axle 32 is secured to the underside of frame 31 along the longitudinal centerline of frame 31 and bar 33 is secured to the top side of frame 31 along the lateral centerline of frame 31 . the ends of axle 32 extend somewhat beyond the ends of frame 31 and are rotationally mounted between the upper ends of members 27 and 28 of support 12 . frame 31 is thus rotatable with axle 32 between the upper ends of members 27 and 28 . frame 13 serves as a mounting platform for any of the various types of solar collectors . sensor element 14 as shown most clearly in fig4 comprises a printed circuit board 34 , a directional light pickup tube 35 and an enclosure 36 . mounted on board 34 are a number of electronic components including a photo - transistor 37 . tube 35 comprising a cylindrical shell has a coaxial inner cylindrical tube 39 mounted to extend within its free end . tube 39 is considerably shorter in length and smaller in diameter than the shell of tube 35 and is held in a centered position in one end thereof by means of an open - centered insert or plug 41 . the end of tube 39 may extend a short distance beyond the end of tube 35 . enclosure 36 is of a rectangular configuration having board 34 mounted therewithin in parallel relationship with its base 42 . the photo - transistor 37 is mounted on the top side of board 34 near its center with tube 35 extending perpendicularly through an opening in the center of the top surface 43 of enclosure 36 . its lower end is arranged to extend to board 34 and envelop the body of photo - transistor 37 . when tube 35 is directed toward a light source , rays of light 44 pass through tube 39 and downwardly along the axis of the tube to strike the optically open top surface of photo - transistor 37 . as noted from fig1 of the drawing , the sensor element 14 is mounted at the center of bar 33 with the base 42 of enclosure 36 secured to bar 33 and with tube 35 extending perpendicularly upwardly from the center of frame 13 . actuator motor 16 is secured to the underside of member 19 of base 11 , as shown in fig3 and is positioned directly under the free end of support 12 with its rotor 45 coupled to the end of member 26 by means of two interconnected levers 46 and 47 . as noted , the free end of lever 46 is secured to rotor 45 and its other end is pivotally connected to a first end of lever 47 . the second or free end of lever 47 is pivotally secured to the side of member 26 . motor 16 is designed to turn at the rate of one revolution per minute when energized with the outer end of lever 46 traversing a circle as it is rotated by motor 16 . the lower end of lever 47 follows the circular path taken by the end of lever 46 to which it is coupled . the upper end of lever 47 responds by moving up and down along an arc 49 which is centered at hinge 29 , its total excursion being equal to twice the length of lever 46 as measured between rotor 45 and pivot pin 51 securing the outer end of lever 46 to the lower end of lever 47 . the outer or free end of support 26 is thus moved cyclically up and down with the attached upper end of lever 47 as motor 16 is operated . actuating motor 17 is secured to the underside of a horizontal mounting bar 52 which extends perpendicularly from the side of member 26 at a point near the attachment of hinge 29 . as shown in fig2 the rotor 53 of motor 17 is coupled to frame 13 by means of two pivotally coupled levers 54 and 55 in a manner identical to that provided by levers 46 and 47 for the coupling of motor 16 to support 12 . when motor 17 is energized the outer end of lever 54 traverses a circular path and carries with it the pivotally attached lower end of lever 55 . the upper end of lever 55 , which is pivotally attached to frame 13 , moves responsively up and down causing frame 13 to be cyclically pivoted about axle 32 . the outer edge of frame 13 moves up and down along an arc 56 with the length of arc 56 being determined by the length of lever 54 and by the point of attachment 57 of lever 55 to frame 13 . motor control switch 18 is secured to the top surface of bar 52 at a point near its outer end . as the right hand end of frame 13 , as shown in fig2 approaches the low point of its cyclical excursion , its underside comes into physical contact with the plunger of switch 18 causing switch 18 to close . switch 18 remains closed until the end of frame 13 passes its lowest point and begins its upward motion . the closed condition of switch 18 thus coincides with a period of a few degrees of rotation of motor 17 . control box 15 is attached to the side of base 11 adjacent member 23 with the electrical and electronic controls of frame 10 accomplished by means of its control circuit 60 shown in more detail in fig5 . control circuit 60 comprises motors 16 and 17 , switch 18 , a timer 61 , d - c power supply 62 , an electronic control circuit 63 and a motor control relay 64 . timer 61 receives 50 or 60 hertz power from a utility power source through a cord set 65 and delivers the same voltage at timed intervals to a pair of conductors , 66 and 67 . power supply 62 comprises a step - down transfomer 68 , a bridge rectifier 69 and a filer capacitor 71 . transformer 68 has its primary winding 72 connected between lines 66 and 67 . its secondary winding 73 is connected to the a - c terminals 74 and 75 of bridge rectifier 69 . capacitor 71 is connected across the d - c terminals 76 and 77 of rectifier 69 . the positive terminal 76 is also connected to the positive supply terminal 78 of circuit 63 and the negative or ground terminal 77 is connected to the ground terminal 79 of circuit 63 . electronic control circuit 63 comprises the photo - transistor 37 , an amplifying transistor 81 , a signal relay 82 , a base driver resistor 83 and output terminals 84 and 85 . relay 82 has a coil 86 and a set of normally - open contacts 87 . transistor 37 is an npn photo - transistor and transistor 81 is an npn bi - polar transistor . the collector ( c ) of transistor 81 is connected to terminal 78 and its emitter ( e ) is connected through coil 86 to ground terminal 79 . resistor 83 is connected from the collector to the base ( b ) of transistor 81 . transistor 37 has its collector ( c ) connected to its base and its emitter ( e ) connected to ground terminal 79 . one side of contact 87 is connected to output terminal 84 and its other side is connected to terminal 85 . relay 64 hs a coil 88 and a set of normally - open contacts 89 with coil 88 connected between line 66 and terminal 85 of circuit 63 . terminal 84 of circuit 63 is connected to line 67 . motor 17 is serially connected with contacts 89 of relay 64 across lines 66 and 67 , and motor 16 is serially connected with switch 18 across motor 17 . the timer 61 , power supply 62 and the realy 64 may be housed in control box 15 with circuit 63 mounted on board 34 of sensor element 14 . in the operation of circuit 60 , cord 65 is first connected to an alternating voltage source , typically 120 volts at 60 hertz . timer 61 is set to turn on at sunrise and to turn off again at sunset so that 120 volts a - c is available across lines 66 and 67 during the period of daylight . power supply 62 accepts the 120 volts at the primary 72 of transformer 68 and delivers a filtered d - c voltage at terminals 76 and 77 , the d - c voltage having an amplitude of approximately 24 volts . if no light rays 44 are striking the junction area of transistor 37 , this transistor will exhibit a high impedance between its collector and emitter terminals . current from terminal 78 flows in this case through resistor 83 into the base of transistor 81 turning transistor 81 on so that current from terminal 78 also flows through transistor 81 and through coil 86 to terminal 79 . the excitation of coil 86 causes contacts 87 to close with the result that coil 88 of relay 64 is energized by an a - c current flowing from line 67 through contacts 87 and coil 88 to line 66 . with the energizing of coil 88 , contacts 89 close connecting motor 17 across lines 66 and 67 . the resulting energization of motor 17 causes frame 13 to rock slowly back and forth about axle 32 as described earlier in an altitude mode . for a brief period during each oscillatory cycle of frame 13 about axle 32 , switch 18 is closed causing motor 16 to be energized . during the brief period in which motor 16 is energized , it turns a few degrees at a rate of approximately one - half revolution per minute , thereby raising or lowering support 12 a lesser number of degrees than the movement of frame 13 in an azimuth mode which is in a direction substantially perpendicular to the path of rotation of frame 13 . in this manner , the sensor element 14 is caused to sweep the sky moving back and forth from east to west , advancing at the end of each sweeping cycle to a higher or lower elevation until at some point in the sweeping action a ray of light from the sun will be captured by tube 39 . the captured ray 44 striking transistor 37 causes transistor 37 to switch to a low impedance state whereupon the current from resistor 83 is by - passed through transistor 37 to ground terminal 79 . thus robbed of base current , transistor 81 turns off , coil 86 is de - energized and contacts 87 open to de - energize relay 64 and motors 16 and 17 . as the sun moves westward , the alignment of sensor element 14 with the sun will be lost with the result that insufficient light 44 strikes transistor 37 to sustain its low impedance condition . as transistor 37 turns off , transistor 81 again turns on to energize relays 82 and 64 and motor 17 . if motor 17 has reached the appropriate part of its cycle , frame 13 will begin rotating toward the west and the sun &# 39 ; s rays will be recaptured ; if an eastward rotation occurs , the frame 13 will be rotated to its eastward limit and will then rotate westward until recapture is achieved . subsequent directional corrections will progress westward in the desired manner . it will be recognized that a specific directional orientation of the base 11 is appropriate . in the northern hemisphere the lower or left - hand end of base 11 as shown in fig3 will be directed toward the south . in the winter season the left - hand end of support 12 will have to be lowered to capture the sun ; as the season progresses toward summer support 12 will gradually be raised for sustained solar alignment . at the end of each day the timer 61 will turn off power leaving the sensor 14 directed toward the setting sun . at daybreak the timer again energizes circuit 60 causing frame 13 to rock eastward until capture occurs . at the first adjustment the sensor moves eastward past the sun , then returns westward until recapture is achieved . successive adjustments throughout the day are in an appropriately westward direction . elevational adjustments occur whenever an east - west sweep fails to achieve capture of the sun . a solar collector mounted on frame 13 is thus appropriately directed at all times toward the sun . an extremely simple yet functionally effective mechanical and electrical arrangement is thus provided for continually directing a solar collector toward the sun in accordance with the stated objects of the invention , and while but a single embodiment of the invention has been illustrated and described , it will be apparent to those skilled in the art that various changes and modifications may be made therein without departing from the spirit of the invention or from the scope of the appended claims .	5
fig2 shows a circuit diagram of a buck converter circuit including a mosfet of top drain construction 15 , a synchronous mosfet 25 , the synchronous mosfet 25 being of a directfet ™ type , a flip chip type ic 94 , controlling mosfets 15 and 25 in a pwm mode to obtain a constant output dc voltage , an inductor 10 and a capacitor 11 . the buck converter circuit , sometimes known as a step down converter , is commonly used to reduce voltages . therefore , the input voltage v in is greater than the output voltage v out . the mosfet die 15 , the mosfet die 25 , and the ic die 94 are arranged in a common housing 21 . the die 15 , 25 , 94 are arranged in a planar fashion on a lead frame 20 or other substrate which is both thermally and electrically conductive . the thermal conductivity of the lead frame or other substrate is needed to assure effective transmission of heat away from die 15 , 25 , 94 and toward one or more heatsinks ( not shown ) below the lead frame or other substrate . the electrical conductivity of the lead frame or the substrate is needed to permit electrical connections between the ic 94 and the mosfets 15 , 25 , as will be described in more detail , and to allow transmission of the input voltage v in and an output voltage v 1 , ( see fig2 ), to and from the common housing 21 , respectively . substrates other than lead frames which are thermally and electrically conductive include direct - bond copper ( dbc ), printed circuit boards ( pcb ), printed wiring boards ( pwb ), and flexible circuits . referring to fig3 , ic 94 is directly bonded to the lead frame 20 or other substrate by solder or conductive epoxy ( not shown ). ( as used herein , the term “ flip chip ” denotes a chip which is attached with a surface down directly to the lead frame or other substrate without any wire bonding , the flip chip having appropriately prepared bond pads .) lead frame 20 has contact areas 30 and 31 which receive a gate electrode 32 and a drain electrode 33 , respectively , of the mosfet 15 . the lead frame 20 also has source contacts 40 and 41 to contact source electrodes 43 and 44 , respectively , of mosfet 25 . in addition , the lead frame 20 has a gate contact area 42 to receive the gate electrode 45 of mosfet 25 . the lead frame 20 or other substrate also has traces 52 , shown schematically , patterned in the lead frame or other substrate , connecting the ic 94 to gate contact areas 30 , 42 . gate contact areas 30 , 42 are in turn connected to gate electrodes 32 , 45 , respectively , through solder or conductive epoxy 58 and through solder or conductive epoxy 54 , respectively . likewise , referring to fig5 , source contact areas 40 and 41 are connected to source electrodes 43 and 44 , respectively , through solder or conductive epoxy 62 and solder or conductive epoxy 60 , respectively . the drain contact area 31 is connected to the drain electrode 33 through solder or conductive epoxy 66 . mosfet 25 is of directfet ™ construction manufactured by international rectifier corporation . thus , referring to fig5 , mosfet 25 is passivated on the surface 70 of the die , on which the source and gate electrodes 43 , 44 , 45 are located , in order to prevent shorting between source and gate electrodes and to protect them from moisture and other contamination . the drain contact 74 of mosfet 25 is connected to the source electrode 78 of mosfet 15 through the conductive t - pac type packaging structure 50 , which also provides a pathway to conduct the output voltage v 1 , shown in fig2 , to lead frame 20 or other substrate , as shown schematically in fig5 . in addition , the use of the t - pac type packaging 50 provides improved thermal management . the t - pac type packaging structure 50 is comprised of a connective portion 80 and a web portion 82 . the web portion 82 is connected to the lead frame 20 or other substrate by solder or conductive epoxy 84 . the connective portion 80 is connected to drain contact 74 of mosfet 25 by conductive epoxy or solder 86 , 88 ( see fig4 ), and is also connected to source contact 78 by solder or conductive epoxy ( not shown ). the connective portion 80 and the web portion 82 are integrally formed into a unitary body . in order to implement the circuit of fig2 , both source contacts 40 and 41 are grounded , as shown schematically in fig5 , and v in is supplied , through the lead frame 20 or other substrate , to drain electrode 33 , as also shown schematically in fig5 . a conventional molded housing 90 of resin or other conventionally nonconductive material encapsulates the t - pac packaging structure 50 and all the other components of the circuit package above the lead frame 20 or other substrate . it should be noted that the connective portion 80 of the t - pac packaging structure covers the entire area of the lead frame 20 or other substrate , while the web portion 82 is of sufficient dimension to only make contact with a portion of the upper surface of lead frame 20 or other substrate , the contact portion being shown as a hatched area 92 in fig3 . ( the plan view of fig3 is taken with the t - pac type packaging structure 50 removed in order to simplify the view .) it should be understood , furthermore , that the lower surface of the connector portion 80 is above the upper surface of flip chip ic 94 , and that the nonconductive material 90 composed of resin or other non - conductive material electrically isolates the flip chip ic 94 from the t - pac packaging structure 50 . the extension of the connector portion 80 of the t - pac packaging structure 50 over the entire area of the lead frame 20 or other substrate may provide improved thermal management of the heat generated by the die over other conventional planar , stacked , or superimposed arrangements of die in common housings . additional improvements in thermal management may be obtained by including ridges 96 in the top surface of connector portion 80 of the t - pac packaging structure 50 , as disclosed in fig8 a of u . s . publication no . 2004 / 0061221 a1 , and also shown in fig6 herein . such ridges may not only help dissipate more heat , they may also help connector portion 80 adhere better to nonconductive material 90 . although only the mosfet die 15 , the mosfet die 25 , and the ic die 94 have been described previously as being arranged in a planar fashion on lead frame 20 or other substrate , it can easily be conceived that the inductor 10 of the buck converter circuit of fig2 can also be located on lead frame 20 or other substrate . in such a case , the inductor 10 can be connected to drain contact 74 of mosfet 25 , by traces patterned in the lead frame 20 or another substrate and by the t - pac type packaging structure 50 or other packaging structure , thus implementing yet another portion of the circuit shown in fig2 , without the need for wire bonding . finally , the capacitor 11 could also be placed on the lead frame 20 , and appropriate traces patterned in the lead frame 20 to connect the capacitor 11 to the inductor 10 and to the source contacts 40 and 41 , thus contacting the source electrodes 43 and 44 , respectively , of mosfet 25 , again without wire bonding . the addition of inductor 10 and capacitor 11 to lead frame 20 would complete the implementation of the entire buck converter circuit shown in fig2 on a single lead frame or other substrate . although the foregoing disclosure has focused on the planar packaging of the semiconductor portion of a conventional buck converter circuit in a common housing , it should be appreciated that the invention is not limited to this particular arrangement . on the contrary , the invention can generally be applied to arrange flip chip devices , which are the semiconductor portions of various circuits , in a planar fashion in a common housing without the necessity of wire bonding . in addition , the use of a t - pac packaging structure for the package may allow for improved heat management of the package . it should be understood , of course , that insulating barriers or layers will be present , as needed , in the lead frame 20 or other substrate to prevent shorting between and among contacts of any semiconductor components of the circuit , any t - pac or other packaging structure , and any passive devices on the lead frame 20 or other substrate . although the present invention has been described in relation to particular embodiments thereof , many other variations and modifications and other uses will become apparent to those skilled in the art . it is preferred , therefore , that the present invention be limited not by the specific disclosure herein , but only by the appended claims .	7
various implementations of the invention , which are now described , replace an original uniform resource locator (“ url ”) included in a text message ( embedded or otherwise ) with a replacement url in order to detect and / or prevent access to unwanted , inappropriate or malicious content . fig1 illustrates a text messaging system 100 in accordance with various implementations of the invention . in some implementations of the invention , text messaging system 100 includes a gateway 130 and a carrier network 140 . in some implementations of the invention , carrier network 140 is a wireless carrier network that provides various wireless services to one or more mobile devices 150 ( illustrated in fig1 as a mobile device 150 a and a mobile device 150 b ). carrier network 140 may be a terrestrial cellular network or a satellite network or other carrier network as would be appreciated . carrier network 140 may provide wireless services including voice services and / or data services , including text messaging services , as would be appreciated . in some implementations of the invention , gateway 130 provides entry to carrier network 140 from sources external to carrier network 140 . gateway 130 provides a mechanism by which such sources may provide content to mobile devices 150 , either directly via multimedia messaging (“ mms ”) or other ip based messaging technology or indirectly , such as via a url embedded in a mobile or text message 110 ( illustrated as a text message 110 a and a text message 110 b ) or other mechanisms ( e . g ., urls embedded as a two dimensional image , a bar code , a q - code , etc .). in some implementations of the invention , gateway 130 may provide a connection point to carrier network 140 ( although other connection points to carrier network 140 may exist ). in some implementations , gateway 130 may be operated carrier network 140 or by a third party ( as illustrated ). in some implementations , gateway 130 may be external to carrier network 140 ( as illustrated ) or may be internal to carrier network 140 or may be some combination of external and internal components to carrier network 140 as would be appreciated . in some implementations , gateway 130 may include one or more servers ( not otherwise illustrated ) and related hardware configured to perform various functions as described herein . in some implementations of the invention , some or all of the various functions of gateway 130 may be incorporated into a mobile application operating on mobile device 150 to operate solely with carrier network 140 or in connection with gateway 130 . according to various implementations of the invention , text message 110 may be sent to a user ( also referred to herein as a mobile subscriber ) of mobile device 150 using sms . in some implementations of the invention , text message 110 originates from outside carrier network 140 . in some implementations of the invention , text message 110 originates from inside carrier network 140 . in some implementations of the invention , gateway 130 , as a connection point or entry point to carrier network 140 for external sources , intercepts text message 110 destined for mobile device 150 . in some implementations of the invention , gateway 130 intercepts text messages 110 internal to carrier network 140 as would be appreciated . in some implementations of the invention , gateway 130 intercepts text messages 110 from sources both external and internal to carrier network 140 as would be appreciated . fig2 illustrates a text message 110 with a body 210 of the text message and and an original url 220 embedded within body 210 . with sms , body 210 of text message 110 may include up to 140 characters . as would be appreciated , greater or fewer characters may be included in other text messaging systems or with other messaging protocols . according to various implementations of the invention , before being transmitted over carrier network 140 to and received by mobile device 150 , original url 220 is replaced in body 210 of text message 110 with a replacement url 320 as illustrated in fig3 . according to various implementations of the invention , replacement url 320 has a length less than or equal to a length of original url 220 ( i . e ., replacement url 320 has a length not greater than that of original url 220 ). in some implementations of the invention , original url 220 and replacement url 320 are stored in a data storage 135 . for example , gateway 130 , upon intercepting text message 110 , may create a data record 410 ( or other data structure ), such as that illustrated in fig4 . data record 410 may be stored in a database in data storage 135 . in some implementations of the invention , data record 410 includes a destination url value 420 and an original url value 430 to store replacement url 320 and original url 220 , respectively . in some implementations of the invention , additional information may also be stored in the data record . for example , in some implementations of the invention , a destination address value 440 corresponding to the mobile address or mobile number of mobile device 150 ( also referred to as a destination address ) to which text message 110 is sent may also be stored in data record 410 . in some implementations of the invention , the destination address may be a sim card number , a mobile device number , a device address , an ip address , an email address , a username , a user account , or other destination address identifying mobile device 110 . in some implementations of the invention , an originating address value 450 corresponding to originating address ( or other originating number ) of a source of text message 110 may be stored . in some implementations of the invention , the originating address may include an originating number , an originating virtual number , an originating ip address or other originating address ( e . g ., sim card number , mobile device number , device address , ip address , email address , username , user account or other originating address ) as would be appreciated . in some implementations of the invention , replacement url 320 points to content ( e . g ., a web page or other content ) other than that of original url 220 . in some implementations of the invention , replacement url 320 points to content for rendering on mobile device 110 . in some implementations , the content informs the user that original url 220 was generated by a source outside of carrier network 140 or points to other content outside of carrier network 140 . in some implementations , the content to which replacement url 320 points includes user friendly instructions for proceeding ( or not ) to content linked via original url 220 . in some implementations , the content includes warnings regarding original url 220 . in some implementations of the invention , the content to which replacement url 320 points includes a number of user selectable actions ( e . g ., options , links , etc .) that may be taken by the user . in some implementations , one of the user selectable actions may be to designate and / or report text message 110 ( which may include original url 220 ) as spam . in some implementations , one of the user selectable actions may be to delete and / or close text message 110 . in some implementations , one of the user selectable actions may be to proceed to original url 220 . in some implementations , other user selectable actions may be presented to the user as would be appreciated . in some implementations of the invention , the user &# 39 ; s selection is stored and tracked for purposes of analyzing user behavior . in some implementations of the invention , the user &# 39 ; s selection is stored and tracked for purposes of identifying certain text messages 110 as spam . in some implementations of the invention , the user &# 39 ; s selection is stored ( potentially along with other activity ) and tracked for purposes of identifying malicious urls . in some implementations of the invention , the user &# 39 ; s selection is stored and aggregated with selections made by other users to characterize urls ( i . e ., benign , malicious , etc .). according to various implementations of the invention , once replacement url 320 has replaced original url 220 in body 210 of text message 110 , text message 110 is transmitted over carrier network 140 and delivered to / received by mobile device 150 . in some implementations of the invention , after text message 110 is received by mobile device 150 and upon the user selecting replacement url 320 in body 210 of the received text message 110 , the content referenced by replacement url 320 is rendered on mobile device 150 . when the user opts to proceed to original url 220 , original url 220 is retrieved from data storage 135 using replacement url 320 , and the browser of mobile device 150 is redirected to the retrieved original url . in some implementations of the invention , after replacement url 320 is selected by the user , the destination address ( i . e ., mobile number , etc .) of mobile device 150 associated with replacement url 320 is retrieved from data storage 135 and compared against an address of the mobile device currently attempting to access replacement url 320 to confirm that these mobile devices are the same . in some implementations of the invention , if these destination addresses are different ( i . e ., different mobile devices ), access to replacement url 320 ( and hence the originial url ) may be denied . in some implementations of the invention , if original url 220 is determined to be malicious or include inappropriate content ( e . g ., adult content not appropriate for minor users , etc . ), mobile device 150 may be prevented access to original url 220 either by blocking original url 220 from access by mobile device 150 , removing original url 220 from text message 110 and / or from data storage 135 , or otherwise preventing mobile device 150 with access to original url 220 . in some implementations of the invention , original url 220 may be modified ( either before or after storing it in data storage 135 ), for example , by updating , adding or modifying various name - value pairs within original url 220 or other modifications . for example , various services are available for tracking user click behavior on the internet . these services typically rely on passing name - value pairs in the url strings ( typically at the end ) as would be appreciated . this technique is an important way for advertisers and others to share data and consolidate user activity data at a single collection point . such modifications are well known , as are the purposes for doing so . however , in the context of text messages , one or more iterations of these modifications ( i . e ., of modifying original url 220 ) on a url embedded in a conventional text message may result in the url consuming too many of the allotted 140 characters or being truncated , and hence unable to be resolved . accordingly , some implementations of the invention , through the use of replacement url 320 , permit original urls to approach and / or exceed the 140 character limit of conventional text messages and further to dynamically modify the original url with values observed from the mobile device when it accesses the replacement url 320 or previously known about the mobile device and stored in the name - value pairs . some implementations of the invention scan text message 110 to determine whether text message 110 includes a url . some implementations of the invention scan text message 110 for specific syntax beginning with “ http ://” or “ https ://”. some implementations of the invention scan text message 110 for custom url schemes supported by various mobile devices 150 . for example , such custom url schemes may launch a web browser on the device when clicked , or they may launch other applications available on or accessible to mobile device 150 . some implementations of the invention determine whether original url 220 may be replaced without disrupting such custom url schemes . some implementations of the invention determine whether original url 220 conforms to a valid url based on conventional url syntax requirements . some implementations of the invention determine whether original url 220 corresponds to a known malicious site or known malicious scheme . some implementations of the invention resolve original url 220 to determine a type and / or nature of the content accessed by original url 220 . some implementations of the invention resolve original url 220 to determine whether the content accessed by original url 220 is appropriate for minors or other types of users of mobile device 150 . in some implementations of the invention , original url 220 is evaluated to determine whether to permit access to original url 220 , to automatically prevent access to original url 220 ( e . g ., in the event of known malicious content , etc . ), or to prevent access to original url 220 in some circumstances ( e . g ., prevent access by minors to adult content , etc .). in some implementations of the invention , in addition to replacing original url 220 with replacement url 320 in text message 110 , the originating address may also be replaced with a replacement originating address or code to obscure the originating address from the user of mobile device 150 . in these implementations of the invention , mobile device 150 may be prevented from responding directly to the source of text message 110 , thereby inadvertently revealing their identity to the source . fig5 illustrates a process 500 for handling text messages with embedded urls according to various implementations of the invention . in an operation 510 , gateway 130 receives a text message 110 addressed or otherwise directed to mobile device 150 . in an operation 520 , gateway 130 scans text message 110 to determine whether body 210 includes original url 220 . if so , in an operation 530 , gateway 130 replaces original url 220 with replacement url 320 . in an operation 540 , gateway 130 stores at least original url 220 and replacement url 320 in data storage 135 . in an operation 550 , gateway 130 forwards text message 110 including replacement url 320 to mobile device 150 . in an operation 560 , after a user of mobile device 150 selects replacement url 320 ( and a browser operating on mobile device 150 renders that replacement url ), gateway 130 provides a content ( e . g ., a web page ) that may be rendered on mobile device 150 thereby presenting the user of mobile device 150 with a number of user selectable actions . in an operation 570 , after the user of mobile device 150 selects an option to proceed to the destination ( e . g ., web page ) of original url 220 , gateway 130 redirects mobile device 150 ( in some implementations , its browser ) to the destination via original url 220 . while various implementations of the invention are described above with regard to text messages , the invention may also be applied to various mobile messages including , but not limited to sms , mms , im , chat , social network posts / messages and other mobile messages . while various implementations of the invention are described above with regard to a carrier network , the invention may also be applied to various mobile messages delivered by private messaging communities and accessed via external gateway or api . while various implementations of the invention are described above with regard to urls embedded in text messages , the invention may also be applied to two dimensional bar codes , qr - codes , or other similar image codes that may be captured or scanned by mobile device 150 . any of these image codes may be replaced with a corresponding replacement url to provide similar functionality to that described above with regard to embedded urls as would be appreciated . while the invention has been described herein in terms of various implementations , it is not so limited and is limited only by the scope of the following claims , as would be apparent to one skilled in the art . these and other implementations of the invention will become apparent upon consideration of the disclosure provided above and the accompanying figures . in addition , various components and features described with respect to one implementation of the invention may be used in other implementations as well .	7
in the following detailed description of the preferred embodiments , reference is made to the accompanying drawings which form a part hereof , and in which is shown by way of illustration specific illustrative embodiments in which the invention may be practiced . these embodiments are described in sufficient detail to enable those skilled in the art to practice the invention , and it is to be understood that other embodiments may be utilized and that logical , mechanical and electrical changes may be made without departing from the spirit and scope of the present invention . the following detailed description is , therefore , not to be taken in a limiting sense . fig1 is a block diagram of an illustrative embodiment of the present invention . memory device 100 includes array 102 of cells 104 . array 102 includes a number of word lines ( wl ) and a number of digit lines . the digit lines are provided in complementary pairs as is well know in the art . each cell 104 is coupled to a word line and a digit line such that each cell is independently addressable . each cell 104 includes access transistor 106 and capacitor 108 . a gate of access transistor 106 is coupled to a word line . a first source / drain region of access transistor 106 is coupled to a digit line . a second source / drain region of access transistor 106 is coupled to a first node of capacitor 108 . a second node of capacitor 108 is coupled to cell plate 110 . cell plate 110 is maintained at a substantially constant voltage by voltage generator 112 . typically , voltage generator 112 provides a bias voltage of approximately one - half of the supply voltage as is known in the art . memory device 100 further uses word line decoder 114 and digit line decoder 116 to determine which cell 104 of array 102 is to be accessed . word line decoder 114 first determines the word line that is coupled to the selected cell . further , word line decoder 114 includes circuitry that activates the word line for the selected cell . digit line decoder 116 determines the pair of digit lines to be used for accessing the selected cell . digit line decoder 116 provides this information to sense amplifier 115 . sense amplifier 115 passes data between input / output circuit 118 and array 102 . control circuit 120 is coupled to voltage generator 112 to selectively establish the amount of drive current provided to cell plate 110 . control circuit 120 is also coupled to word line decoder 114 , sense amplifier 115 , digit line decoder 116 and input / output circuit 118 . in operation , memory device 100 stores data on capacitors 108 of cells 104 . prior to normal operation , memory device 100 is tested to identify cells with defective capacitors . various data patterns , known to a person of ordinary skill in the art , are written to and read out from array 102 during the testing operation . based on the output of these tests , defective cells are repaired out with redundant word lines or digit line pairs of array 102 . to aid in the early detection of defective cells , voltage generator 112 provides two different drive currents to cell plate 110 . during normal operation , voltage generator 112 provides a first , higher current level . and , during at least a portion of the test mode , voltage generator 112 provides a second , lower drive current . for example , voltage generator 112 can provide a drive current during test mode that is one - half as much as the normal drive current . advantageously , the lower drive current of voltage generator 112 used during at least a portion of the test mode amplifies the affect of a short circuited capacitor on the cell plate voltage so that cells that will provide unacceptable data during normal operation are identified more quickly during the test . the manner in which the lower drive current amplifies the affect of the short is described with respect to storing a high logic value in an unacceptable cell . when a high logic value is written to the cell , input / output circuit 118 receives the high logic value over the data lines . sense amplifier 115 drives the digit and digit complement lines of array 102 to voltages substantially equal to the power supply and ground potential . word line decoder 114 drives access transistor 106 of cell 104 to pass the voltage on the digit line to capacitor 108 . thus , assuming that the power supply voltage is approximately 3 volts , the voltage on the first node of capacitor 108 is 3 volts . if there were no shorted capacitor in the area of the cell , the voltage on the second node of capacitor 108 ( e . g ., cell plate 110 ) would be one - half of the power supply voltage , or 1 . 5 volts . thus , capacitor 108 would store the high logic value as a 1 . 5 volt difference between the first and second nodes . since there is a short circuited cell in the area , the voltage on cell plate 110 moves from its normal voltage when sense amplifier 115 is active . when this happens , the voltage stored on capacitor 108 will vary from its expected range . the drive current from voltage generator 112 affects the amount by which the short circuit can move the voltage on cell plate 110 . for example , by cutting the drive current of voltage generator 112 in half during the test mode , the shorted capacitor might move cell plate 110 by one volt or more as compared to less than half a volt with the normal drive current . with this change in the voltage of cell plate 110 , the voltage stored on capacitor 108 is reduced to 0 . 5 volts or less ( compared to 1 volt using typical drive current levels ). thus , the decreased drive current allows the test to identify this cell as defective more quickly . fig2 is a schematic diagram of a voltage generator , indicated generally at 200 , that can be used to provide the variable drive current of voltage generator 112 of fig1 . voltage generator 200 includes first and second voltage generators 202 and 204 . first voltage generator 202 includes p - channel transistor 206 and n - channel transistor 208 that are coupled in a voltage divider configuration . the gates of transistors 206 and 208 are coupled together and are coupled to a common node 210 with a source / drain region of transistor 206 and a source / drain region of transistor 208 . a source / drain region of transistor 206 is coupled to the power supply , v cc , and a source drain region of transistor 208 is coupled to ground . second voltage generator 204 includes p - channel transistor 212 and n - channel transistor 214 that are coupled in the same configuration as first voltage generator 202 . a gate of transistor 218 is coupled to receive a control signal from , for example , control circuit 120 of fig1 . a first source / drain region of transistor 218 is coupled to node 210 of first voltage generator 202 . a second source / drain region of transistor 218 is coupled to node 224 as an output of voltage generator 200 . transistor 220 is configured in a similar manner as transistor 218 . a first source / drain region of transistor 220 is coupled to node 216 . a second source / drain region of transistor 220 is coupled to output node 224 . a gate of transistor 220 is coupled to an output of inverter 222 . inverter 222 inverts the control signal from , for example , control circuit 120 of fig1 such that only one of transistors 218 and 220 is on at a given time . in operation , voltage generator 200 selectively applies the output of first and second voltage generators 202 and 204 to output node 224 to drive , for example , the voltage of cell plate 110 . when the control signal from control circuit 120 is high , voltage generator 202 is coupled by transistor 218 to provide the output current . when the control signal from control circuit 120 is low , voltage generator 204 is coupled by transistor 220 to provide the output current . by selecting appropriate widths for the transistors in first and second voltage generators 202 and 204 , the drive current provided by voltage generator 202 can be set as a percentage of the drive current of voltage generator 204 . this allows voltage generator 200 to provide lower drive current during test mode of a memory device so that defective cells can be identified faster and with less strenuous tests . fig3 is a schematic diagram of another embodiment of a voltage generator indicated generally at 300 and constructed according to the teachings of the present invention . voltage generator 300 includes p - channel transistor 302 and n - channel transistor 304 that are coupled in a voltage divider configuration . transistors 302 and 304 are fabricated such that the voltage at node 306 is approximately one - half of the power supply voltage ( v cc ). voltage generator 300 further includes gating transistors 308 and 310 . a source / drain region of each transistor 308 and 310 is coupled to node 306 . further , a second source / drain region of each transistor 308 and 310 is coupled to output node 312 . a gate of transistor 308 is coupled to receive a first control signal from , for example , control circuit 120 of fig1 . similarly , a gate of transistor 310 is coupled to receive a second control signal from control circuit 210 of fig1 . in operation , voltage generator 300 provides an output voltage that is a percentage of the power supply voltage with a variable drive current . first and second control signals from control circuit 120 selectively activate transistors 308 and 310 . for example , transistor 308 can be sized to provide sufficient drive current during normal operation . thus , the control signals from control circuit 120 turn transistor 308 on and transistor 310 off during normal operation . further , during test mode , the control signals turn on transistor 310 , which is sized to provide reduced drive current , during at least a portion of a test mode so that defects may be more readily identified . alternatively , with appropriate sizing of transistors 308 and 310 , transistor 308 can provide the drive current during normal operation and transistor 308 and 310 can provide the drive current during at least a portion of a test mode . although specific embodiments have been illustrated and described herein , it will be appreciated by those of ordinary skill in the art that any arrangement which is calculated to achieve the same purpose may be substituted for the specific embodiment shown . this application is intended to cover any adaptations or variations of the present invention . for example , the teachings of the present invention are not limited to the voltage generators shown and described with respect to fig2 and 3 . other arrangements can be used that provide a variable drive current to the cell plate during normal and test mode operations . further , the cell plate can be maintained at a voltage other than v cc / 2 as specified in fig2 .	6
the present invention is applied to an fm receiver , wherein it is constructed such that the receiver can receive an fm character multiple broadcasting called darc ( data radio channel ) mainly developed by the institute of broadcasting technology of nhk in japan in recent years . the fm character multiple broadcasting of this darc system is a system in which data such as character information or the like are multiplexed to a program of normal audio broadcasting through an fm broadcasting and transmitted . fig1 is a circuit block diagram for showing the receiver for this fm character multiple broadcasting , wherein reference numeral 10 denotes an fm receiver circuit constructed like a synthesizer system , a received signal from an antenna 11 is supplied to an antenna tuning circuit 12 of an electronic tuning system and then a broadcasting wave signal srx of a frequency frx is taken out . then , this signal srx is supplied to a mixer circuit 14 through a high frequency amplifier 13 , an oscillation signal sl0 with a frequency fl0 , for example , where , fif is an intermediate frequency , e . g . fif = 10 . 7 mhz is taken out of vco 21 , this signal sl0 is supplied to the mixer circuit 14 as a local oscillation signal and the signal srx is converted in its frequency into an intermediate frequency signal sif ( an intermediate frequency fif ). further , this intermediate frequency signal sif is supplied to an fm demodulation circuit 16 through an intermediate frequency amplifier 15 so as to cause an audio signal to be demodulated and this signal is supplied to a speaker 18 through an amplifier 17 . at this time , vco 21 constitutes pll 20 together with circuits 22 to 25 . that is , the signal sl0 from the vco 21 is supplied to a variable frequency dividing circuit 22 , its frequency is divided into a frequency of 1 / n , this divided frequency signal is supplied to a phase comparing circuit 23 and at the same time an oscillation signal with a reference signal , for example , a frequency of 100 khz is taken out of the oscillation circuit 24 , this oscillation signal is supplied to a comparing circuit 23 , its comparing output is supplied to the vco 21 as its control signal through a low - pass filter 25 . in addition , an output voltage of the filter 25 is supplied to the tuning circuit 12 as a tuning voltage . accordingly , under a normal state of the device , since a frequency dividing signal obtained from a frequency dividing circuit 22 and an oscillating signal of the oscillation circuit 24 are equal to each other in their frequencies , a frequency fl0 of the oscillation signal sl0 at this time becomes accordingly , if the frequency dividing ratio n is changed from 653 to 793 , the local oscillation frequency fl0 is changed in an interval of 100 khz in 65 . 3 mhz to 79 . 3 mhz , so that a received signal frequency frx is changed by a frequency step of 100 khz in a frequency band of 76 . 0 mhz to 90 . 0 mhz and also in correspondence with a frequency dividing ratio n . further , this fm receiver is provided with a control means , i . e . a micro - computer 30 acting as a system control . this micro - computer 30 is comprised of a cpu 31 , a rom 32 for a program , a ram 33 for a work area , a memory 34 for holding data and a ram 35 for a receiver buffer for character programs . then , the memories 32 to 35 are connected to the cpu 31 through a system bus 39 . in this case , the rom 32 has a main routine 100 shown in fig2 and 3 , for example . although a detailed content of this main routine 100 will be described later , the part not related to the present invention is eliminated in fig2 and 3 . further , the rom 32 has a data table dtbl as shown in fig4 for example , as a data base for frequency data for an area call . that is , in the case of the data table dtbl shown in fig4 the entire area of japan is divided into 14 areas of &# 34 ; hokkaido &# 34 ;, &# 34 ; tohoku 1 &# 34 ; . . . , &# 34 ; kyusyu 2 &# 34 ;. then , this data table dtbl has a data timei indicating a name of area for every divided area and also has a data kyoku indicating a name of broadcasting station capable of practically receiving a program at a certain area . further , this data table dtbl has a data freq of a frequency applied for a broadcasting by the broadcasting station ( a master station ) and a data freq for a frequency applied for a broadcasting operation by the satellite station corresponding to the master station . the frequency data freq has a master station at its leading end and subsequently a satellite station is set . the satellite stations are arranged in an order from a low frequency to a high frequency . more practically , although there is a case in which it can not be discriminated what broadcasting station corresponds to the master station and what broadcasting station corresponds to the satellite station , in such a case as above , its representing broadcasting station is selected as the master station and other stations are selected as satellite stations . in addition , the rom 32 has character data required for various kinds of displays . further , the memory 34 is a rom capable of performing a data deletion and a data writing electrically or a ram backed up with a battery cell , although not shown , that is , the memory 34 is a non - volatile memory and even if a power supply is turned off , the written data can be held and various kinds of data which are required to be held are accessed even if the power supply is turned off . then , this memory 34 , as shown in fig5 for example , has data areas a1 to a7 in correspondence with the tuning key to be described later and the data freq of the frequency of the broadcasting station preset to the tuning key and the data kyoku of a name of the broadcasting station can be stored in each of the data areas a1 to a7 . in addition , to the bus 39 are connected ports 36 , 37 and an interface circuit 38 . then , a frequency dividing ratio n is set from the cpu 31 to the variable frequency dividing circuit 22 through the port 36 so as to perform a tuning and a receiving signal for the receiver circuit 10 . in addition , a demodulated signal from a demodulation circuit 14 is supplied to a decoder circuit 19 , data of the character program is decoded , corrected for its error and taken out of lmsk ( level controlled minimum shift keying ) signal , and this data is accumulated in the ram 35 for the receiving buffer through the port 37 . in addition , to the interface circuit 38 are connected cursor keys ( down - key and up - key ) kd and ku , a determination key ke , a menu key km , a set key ks and seven tuning keys p1 to p7 . the keys kd , ku , ke , km , ks , p1 to p7 are comprised of non - lock type push switches . further , to the bus 39 is connected a font rom ( a character generator ) 41 having font data for converting character data sent by an fm character multiplex broadcasting into display data and at the same time a display controller 42 is connected to it . then , a displaying memory 43 is connected to the controller 42 and an lcd 50 acting as a display element is connected to it . in this case , the lcd 50 is an element for displaying characters or the like under a proper combination of dots , and this has a size of 15 . 5 characters × 4 . 5 lines ( lateral 248 dots × vertical 72 dots ) as shown in fig6 for example . then , an area of the upper - most 0 . 5 line ( vertical 8 dots ) is defined as a header area and an area of the remaining 4 lines ( vertical 64 dots ) is defined as a main area for displaying a text . further , the memory 43 is of a bit - map system in correspondence with a dot displaying system of the lcd 50 and has a capacity of one screen of the lcd 50 . then , either data held at the ram 35 for a receiving buffer or data prepared in advance in rom 32 is read out by the cpu 31 , the read - out data is converted into displaying data under application of the font data in the rom 41 and the displaying data is written into the memory 43 through the controller 42 . at this time , the displaying data of the memory 43 is read out in repetition under an operation of the controller 42 and concurrently the data is converted into a displaying signal and supplied to the lcd 50 . accordingly , at the lcd 50 is displayed either a character of character data read out of the ram 35 by cpu 31 or a character with character data prepared in the rom 32 . with such an arrangement as above , various kinds of processing such as a displaying operation is carried out as follows under the operation of the cpu 31 . in this paragraph , an operation ranging from a turning - on of the power supply of the receiver to a key input waiting under a normal state of the receiver will be described . that is , when the power supply of the receiver is turned on , the processing at the cpu 31 is started to operate from a step 101 in a routine 100 and subsequently at a step 102 , an initialization at each of the sections is executed . for example , a frequency dividing ratio n of a last channel ( a receiving frequency received when the power supply is turned off in a previous time ) is read out of the memory 34 and set to the variable frequency dividing circuit 22 . in addition , the data held in the memory 34 is applied to cause either a name of broadcasting station of the last channel or its frequency to be displayed at the lcd 50 . accordingly , the last channel is received at this time and its audio is outputted from the speaker 18 . subsequently , the processing is advanced to a step 103 and at this step 103 , a satellite flag sflg is set to &# 34 ; 0 &# 34 ;. when the master station is pre - set to the tuning key , this satellite flag sflg is &# 34 ; 0 &# 34 ; and in turn when the satellite station is preset , this satellite flag sflg becomes &# 34 ; 1 &# 34 ;. then , subsequently , the processing is advanced to a step 104 , and at this step 104 , a key input waiting operation is carried out . in this case , if the character multiplex broadcasting is being performed at the last channel , the data of the character program is decoded , corrected in its error and taken out of the decoder circuit 19 and the data is accumulated in the ram 35 for the receiving buffer . then , under this key input waiting state , if a user performs a key inputting operation , each of the processes is carried out as follows in response to the key input . this operation corresponds to the case in which an optional character program is selected from total contents of the programs displayed at the lcd 50 and displayed . in this case , at first the menu key km is depressed . then , the processing at the cpu 31 is advanced from the step 104 to the step 111 and at this step 111 , it is checked whether or not the satellite flag sflg is &# 34 ; 0 &# 34 ;. in this case , since sflg =&# 34 ; 0 &# 34 ; is attained due to the step 103 , the processing is advanced from the step 111 to the step 112 , and at this step 112 , it is checked whether or not the key inputted at the step 104 is the tuning keys p1 to p7 . then , in this case , the key is the menu key km , so that the processing is advanced from the step 112 to the step 120 , wherein at the step 120 , the total contents of the character program ( main menu ) are displayed at the lcd 50 in response to the character data of the ram 35 . then , when either the down - key kd or the up - key ku is depressed , the cursor moves forward or rearward between the items of the total contents displayed at the lcd 50 in response to the keys kd and ku . then , the cursor is moved up to an item to be target of the items of the total contents and when the determination key ke is depressed , that item is selected and the contents at a lower position to that item is displayed at the lcd 50 . subsequently , a similar key operation is carried out , and it is possible to display the character program to be target . in addition , subsequently , the processing at the step 104 becomes a key input waiting state . this operation corresponds to the case in which the broadcasting station ( a master station ) is preset to each of the tuning keys p1 to p7 , this pre - set operation is carried out by the area call . due to this fact , in the case that [ the pre - setting of the broadcasting station ] is carried out , the set key ks is depressed when the key - input waiting is attained at the step 104 . then , the processing at the cpu 31 is advanced from the step 104 through a step 111 to the step 120 through a step 112 . then , at this step 120 , a menu for setting the operation mode of the receiver is displayed at the lcd 50 in response to the key input at the step 104 . then , as the down key kd and the up key ku are depressed , the cursor is moved between the items of the menu displayed at the lcd 50 , resulting in that the cursor is positioned at [ setting of area ] in the menus and as the determination key ke is depressed , the operation mode becomes [ area setting mode ]. under this [ area setting mode ] the area name is displayed at the lcd 50 in reference to the data timei of the area name prepared in the data table dtbl . then , as the down key kd and the up key ku are depressed , the cursor is moved between the displayed area names , so that the cursor is positioned at the area name including a receiving location of a user in the area names and then the determination key ke is depressed . for example , if the receiving location is &# 34 ; tokyo &# 34 ;, the cursor is positioned at &# 34 ; kanto 1 &# 34 ; and then the determination key ke is depressed . then , both data kyoku of a name of broadcasting station and a frequency data freq included in &# 34 ; kanto 1 &# 34 ; are read out of the data table dtbl and written into the areas a1 to a7 of the memory 34 . in this case , as per the broadcasting station having data about the master station and the satellite station as the frequency data freq , the frequency data freq of the master station is written . in addition , the data timei of the name of area at this time is held in the memory 34 . in this way , as the determination key ke is depressed while the cursor is positioned at the area name to be target , data kyoku of the name of the broadcasting station in the corresponding area and the frequency data freq are read out of the data in the data table dtbl and then written into the areas a1 to a7 in the memory 34 . in addition , in the case that the data kyoku of the name of the corresponding station and the frequency data freq are not present in numbers corresponding to those of seven stations , certain data of certain broadcasting stations are overlapped and used . upon completion of the aforesaid processing , the processing is returned from the step 120 to the step 104 and the key input waiting is set again . accordingly , the broadcasting station is pre - set to the tuning keys p1 to p7 through an area call . the broadcasting station pre - set at this time is a master station . this operation corresponds to the case in which the broadcasting stations preset in the tuning keys p1 to p7 are selected in accordance with [ pre - setting of the broadcasting station ]. in this case , when the key input waiting is carried out at the step 104 , the preset tuning key pm ( any one of m = 1 to 7 , similarly applied to the following description ) to be target is depressed for a short period of time . then , although the processing at the cpu 31 is advanced from the step 104 to the step 112 through the step 111 as described above , in this case , since the tuning key pm is depressed , the processing is advanced from the step 112 to the step 131 and at the step 131 , it is checked subsequently whether or not the tuning key pm depressed at the step 104 is also being depressed for more than 2 seconds , for example . then , in the case of [ tuning of the pre - set broadcasting station ], since the tuning key km is depressed for a short period of time , the processing is advanced from the step 131 to the step 132 , and at the step 132 , the frequency data freq written in the area am corresponding to the tuning key pm of the data areas a1 to a7 in the memory 34 is read out , the read - out data freq is converted into the frequency dividing ratio n in accordance with the equation ( 3 ) and at the same time this frequency dividing ratio n is set in the variable frequency dividing circuit 22 . accordingly , the frequency indicated by the read - out data freq becomes a receiving frequency frx of the receiving circuit 10 , that is , the broadcasting station preset in the tuning key pm is selected . subsequently , the processing is advanced to the step 133 , and at the step 133 , the data kyoku of a name of the broadcasting station written in the area am corresponding to the tuning key pm in the data areas a1 to a7 in the memory 34 is read out and the read - out data kyoku is converted into the displaying data in reference to data in the rom 41 , supplied to the controller 42 , and for example , as shown in fig7 a , the name of the broadcasting station is displayed at the lcd 50 . in addition , at this time , the frequency data freq read out at the step 132 is similarly converted into the display data and supplied to the controller 42 and the receiving frequency frx at this time is displayed in digital form at the lcd 50 . subsequently , the processing is advanced to the step 134 and at the step 134 , the data table dtbl is referenced with the frequency data freq and the data kyoku of the name of broadcasting station used for displaying in fig7 a , for example , thereby it is checked if the satellite station is prepared for the broadcasting station receiving signal at present and when the satellite station is prepared , a mark &# 34 ;&# 34 ; indicating a presence of the satellite station is displayed after the number indicating the frequency as shown in fig7 a , for example . after this operation , the processing is returned back to the step 104 , and the key input waiting state is applied again . accordingly , as the tuning key pm is depressed , it is possible to select the broadcasting station pre - set in the tuning key pm . in addition , either the name of the broadcasting station or the frequency is displayed at the lcd 50 . further , if the satellite station is prepared in the broadcasting station receiving a signal , this is displayed with the mark &# 34 ;&# 34 ;. as already described in the aforesaid item of [ pre - set of the broadcasting station ], a master station is pre - set in the areas a1 to a7 in the memory 34 and even if the satellite station is present , the satellite station is not pre - set . then , the master station sometimes shows a poor received state in a certain receiving location . in such a case as above , the pre - set processing of the satellite station in place of the master station corresponds to this [ pre - set of the satellite station ]. in the case that this processing is carried out , the master station is at first selected in accordance with the item of [ tuning of the pre - set broadcasting station ]. at this time , if the satellite station is prepared for the master station , a mark &# 34 ;*&# 34 ; indicating a presence of the satellite station is displayed after a number indicating a frequency as described above ( as indicated in fig7 a ). after this operation , when the key input waiting state occurs at the step 104 , the tuning key pm when the master station is selected is continued to be depressed for more than 2 seconds , for example . then , although the processing at the cpu 31 is advanced from the step 104 to the step 131 through the steps 111 and 112 , in this case , since the tuning key pm is continued to be depressed for more than 2 seconds , the processing is advanced from the step 131 to the step 141 . then , at the step 141 , the satellite flag sflg is set to &# 34 ; 1 &# 34 ; and at the step 142 , a list of the frequencies of the satellite stations for the master station being selected at present is displayed at the lcd 50 . in this list of the frequencies , a frequency data freq in the column of the broadcasting station receiving signal at present in the frequency data freq in the data table dbtl is applied and displayed . for example , if the broadcasting station ( a master station ) being received at present is &# 34 ; nhk - fm &# 34 ; in &# 34 ; kanto 1 &# 34 ; in the data table dtbl , the frequency data freq prepared in the data table dtbl in respect to this &# 34 ; nhk - fm &# 34 ; has frequencies of &# 34 ; 82 . 5 &# 34 ;, &# 34 ; 80 . 7 &# 34 ; . . . &# 34 ; 85 . 1 &# 34 ;, so that these frequencies re displayed as shown in fig7 b . at this time , the number &# 34 ; 82 . 5 &# 34 ; indicating a first frequency is inverse displayed meaning a cursor ( in fig7 b , the inverse display is indicated by a slant line for a sake of drawing and this is similarly applied to the following description ). then , the processing is returned back from the step 142 to the step 104 , the key input waiting is attained . in view of the foregoing , as either the down key kd or the up key ku is depressed , although the processing is advanced from the step 104 to the step 111 , at present , a relation of sflg =&# 34 ; 1 &# 34 ; is attained at the step 141 , resulting in that the processing is advanced from the step 111 to the step 151 . at this step 151 , it is discriminated if the key depressed at the step 104 is the up key ku or the down key kd and at present , since the key is either the key kd or keu , so that the processing is advanced from the step 151 to the step 152 . at this step 152 , when the key depressed at the step 104 is the down key kd , a cursor ( an inverting display ) displayed at the lcd 50 is moved from a position of number indicating the frequency up to now a next position of number indicating a next frequency and when the key depressed at the step 104 is the down key kd , the display is controlled in such a way that the cursor is moved from the position of the number indicating the frequency up to now to the next position of the number indicating a previous frequency . then , at the step 152 , as the displaying position of the cursor is moved by a distance corresponding to one kind of frequency , the processing is returned back from the step 152 to the step 104 and the key input waiting state is attained . accordingly , either the down key kd or the up key ku is depressed to enable the cursor to be positioned at an optional number of the numbers of frequencies for the satellite station displayed at the lcd 50 . in view of the foregoing , as the determination key ke is depressed when the cursor is positioned at a frequency number of an optional satellite station ( or a master station ), &# 34 ; 81 . 9 &# 34 ; of the frequency number as shown in fig7 c , for example , the processing is advanced from the step 104 through the step 111 and through the step 151 to the step 161 and at the step 161 , it is discriminated if the key depressed at the step 104 is the determination key ke and in this case , this is the determination key ke , the processing is advanced from the step 161 to the step 162 . then , at the step 162 , the satellite flag sflg becomes &# 34 ; 0 &# 34 ; and at the next step 163 , the frequency data freq at a position where the cursor is displayed , of frequency numbers of the satellite stations displayed at the lcd 50 is taken out of the data table dtbl and the taken - out frequency data freq is written into the data area am corresponding to the key pm ( a tuning key km which becomes a trigger of execution subsequent to the step 131 ) which is continued to be depressed for more than 2 seconds in data areas a1 to a7 of the memory 34 . then , at the step 164 , the frequency data freq written into the data area am in the memory 34 at the step 163 , i . e . the frequency data freq at a position displayed by the cursor is converted into a frequency dividing ratio n and this frequency dividing ratio n is set in the variable frequency dividing circuit 22 . accordingly , the receiving frequency frx of the receiving circuit 10 becomes from this time a frequency of number where the cursor is positioned when the determination key ke is depressed . for example , when the determination key ke is depressed from the state shown in fig7 c , the receiving frequency frx is set to the frequency of 81 . 9 mhz due to the fact that the cursor is positioned at the number &# 34 ; 81 . 9 &# 34 ;. subsequently , the processing is advanced to the step 165 and as shown in fig7 d , for example , the display of the received frequency at the lcd 50 is changed to a displayed frequency tuned at the step 164 and after this operation , the processing is returned back to the step 104 and the key input waiting state is attained . in this case , when the key input waiting state is attained , a relation of sflg =&# 34 ; 0 &# 34 ; is already set at the step 162 , so that even if the keys kd , ku or ke are depressed , the processing is not advanced to the step 151 and then the processing [ such as tuning of the pre - set broadcasting station ] is carried out by the steps subsequent to the step 112 . accordingly , when the master station is selected [ by the tuning of the pre - set broadcasting station ] and the satellite station to be target is selected , the satellite station can be pre - set in place of the master station . then , the satellite station pre - set in this way can be selected by the tuning key pm in the same manner as that for the master station [ at the tuning of the pre - set broadcasting station ]. as described above , in accordance with the aforesaid receiver , the broadcasting station can be pre - set to the tuning keys p1 to p7 through an area call and in the case that the receiving state of the pre - set master station is poor , the pre - set master station can be replaced with the satellite station . accordingly , it is possible to perform a receiving operation at the best state for every and all broadcasting programs . further , at this time , it is not necessary to perform a manual tuning operation . in addition , since the master station showing a bad receiving state is replaced with the satellite station , the number of tuning keys p1 to p7 is not increased and it is possible to pre - set only the broadcasting station capable of receiving the tuning keys p1 to p7 in a superior manner . further , as shown in fig7 a - 7d , for example , a list of the frequencies of the satellite station is displayed and the station is selected from it , its selection may easily be carried out . in addition , the keys kd , ku , ke and lcd 50 used for selecting and determining of the satellite station are originally arranged for receiving the character multiplex broadcasting , so that it is not necessary to arrange a new key for selecting and determining the satellite station . in the forgoing description , it is satisfactory that the data in the last channel may be held in the memory 34 at the steps 132 and 164 , respectively . in addition , selection or area at the step 120 and tuning of station at the step 132 or the like can be performed by a rotary encoder . further , the frequency data freq in the data table dtbl and the memory 34 can also have a frequency dividing ratio n in the variable frequency dividing circuit 22 . in addition , in the foregoing description , the present invention is applied to the case that the receiver circuit 10 receives an fm broadcasting program and a similar configuration may also be attained for the case in which either an am broadcasting or a television broadcasting is received . in accordance with the present invention , since the master station pre - set to the tuning key can be replaced with the satellite station , every and all broadcasting programs can be received under the most - suitable state . further , at that time , it is not necessary to perform a manual tuning operation and correspondingly it is not necessary to arrange many tuning keys . further , when the satellite station is pre - set , the station is selected from the list and pre - set , resulting in that the pre - setting operation may easily be carried out .	7
an exemplary multiple - antenna communication system 100 with static and differential precoding codebook is schematically shown in fig1 - 2 . a transmitter 110 transmits from t transmitting antennas 111 . 1 - 111 . t over a fading channel 130 to r receiving antennas 121 . 1 - 121 . r coupled to a receiver 120 . a channel estimator 125 provides an estimate of the channel 130 to the receiver 120 . the channel estimate is also quantized and provided to the transmitter 110 via a quantized rate control feedback channel 135 . for a multiple - antenna system with r receive and t transmit antennas the baseband channel model can be expressed as follows : y = hx + w , ( 1 ) where y is the r × 1 received column vector , h is the r × t channel matrix , x is the t × 1 transmit column vector , and w is the r × 1 noise column vector . the input is subject to an average power constraint p , i . e , tr ( q )≦ p , where q = e [ xx h ], e [.] denotes the expected value and tr (.) represents the trace of a matrix . in an exemplary multi - rank beamforming scheme in accordance with the present invention , channel state information ( csi ) is available to the transmitter ( csit ) as well as the receiver ( csir ). where perfect csit and csir are assumed , the capacity of the multiple - antenna fading channel 130 can be achieved through power adaptation over time ( one average power for each channel state ) and water - filling power control over multiple eigenvectors of the channel for each block of transmission . in systems that employ beamforming such as the mimo systems , the beamforming matrix ( referred to herein as a codeword ) generated in response to perceived channel conditions is computed and quantized at the receiver first , and then is provided to the source transmitter ( e . g ., via feedback ). a conventional approach to reduce the overhead associated with this feedback is to provide matrix codebook ( s ) at each of the transmitter and the receiver , each of the codebook ( s ) comprising a plurality , or set , of potential beamforming matrixes that may be used depending on the channel conditions perceived at the receiver . when the receiver has identified the appropriate matrix codebook ( s ), the receiver will typically feed back only an index ( instead of the actual matrix entries ) that points to the appropriate codeword in the codebook ( s ) stored at the transmitter . turning now to fig3 , an exemplary process to generate the codebook is shown . in this process , a random codebook is generated ( 200 ). next , the process partitions channel state information into a set of nearest neighbors for each codebook entry based on a distance metric ( 210 ). the process then updates the codebook by finding a centroid for each partition ( 220 ). in the mimo system of fig1 with t transmit antennas at the base station and a user each with r receive antennas , the complex baseband signal model is given by where x is the t × 1 transmitted signal vector , h is the r × t channel matrix , w : n c ( 0 , i ) is a circularly symmetric complex additive white gaussian noise vector , and y is the r × 1 received signal vector . a block fading channel model is used in which the channel remains constant during the transmission of each packet ( or codeword of length t ) and it changes independently from one block to another , where the distribution of the channel state is known a priori . the average power constraint is given by e [ x h x ]≦ p . in maximizing the throughput in single user ( su -) mimo systems ( or sum - rate throughput for multiple user ( mu -) mimo systems ) which is usually the primary goal in downlink transmissions , the following assumptions can be used : ( 1 ) the user feeds back the quantized channel state via a limited feedback link ; ( 2 ) based on the feedback information , the base station performs a linear precoding ( and only linear precoding is allowed ) of the transmitted streams . let udv * be the singular value decomposition ( svd ) of the channel matrix h . with b bits of feedback , the user quantizes the first n column of v ( where n ≦ min ( r , t )) is a fixed number predetermined by the base station ) using a quantization codebook q ={ q 1 , q 2 , . . . , q 2 b } q i εc t × r , as follows where d (•,•) is some distance metric . the codebook design problem and the appropriate choice of the distance metric have been considered in prior art . the columns of the quantized precoding matrix v ( 1 : n ) correspond to possible different streams for this user . the transmitted signal x from the base station then consists of l data streams , u 1 , u 2 , . . . , u l , sent through column vectors g 1 , g 2 , . . . , g l , of a linear precoder g . we have in su - mimo systems , we have l = n while in mu - mimo systems we have l ≧ n where one or more than one streams may be intended for each user . next , a codebook design will be discussed which is static and predesigned and does not adopt to the changes in the average channel condition . the first design considers rank specific codebook design where for each transmission rank a separate codebook is designed . the second design is based on transformation which generates the codebooks for all ranks based on a set of vector codebook . for a given transmission rank n and b bits of pmi feedback , the codebook design problem is formulated as finding the set q ={ q 1 , q 2 , . . . , q 2 b } of ( t × n ) semi - unitary matrices that is a solution to the optimization problem given by let udv * be the partial svd of h obtained by retaining only the n right singular vectors that correspond to the n largest singular values of h . for a given h the optimal ( t × n ) precoder that maximizes the instantaneous mutual information is v , thus , for large enough codebook size : the approximation in ( 5 ) is based on the observation that a well designed large enough codebook can closely sample the set of all possible v . next , an approximate upper bound on c is determined by considering channel realizations whose norms are bounded , i . e ., h such that ∥ h ∥ f 2 = tr [ h * h ]= tr [ d * d ]≦ β . for such channels : considering the low snr approximation of the bound in ( 6 ), i . e ., letting p → 0 , the inner maximization in the bound in ( 7 ) is equivalent to minimizing the chordal distance between the dominant right eigenvectors of the channel and the corresponding quantized vectors , where the chordal distance is defined as on the other hand , considering the high snr approximation of ( 6 ), i . e ., p →∞: the inner maximization in the bound in ( 9 ) is equivalent to minimizing the fubini - study ( fs ) distance between the dominant right eigenvectors of the channel and the corresponding quantized vectors , where the fs distance is defined as this is so because log (.) is a monotonically increasing function and arccos (.) is a monotonically decreasing function . for finite snrs , since the transmitted signals are the linear combination of the columns of the precoder q , the precoding codebook design used here relies on a metric that measures the distance between the subspaces spanned by different precoders . while there is no known distance metric directly associated with the capacity expression ( 5 ), the inner maximization in the bound in ( 6 ) is equivalent to minimizing the following p - metric with between the subspaces defined by v and q on the grassmanian manifold g ( n t , r ) which in turn is the space of all r dimensional subspaces of an n t dimensional vector space . the design based on the p - metric depends on the snr level . the choice of β is discussed next . p - metric is in fact a valid distance metric in the grassmanian manifold . moreover , it can be readily verified that if p → 0 , the p - metric is equivalent to the chordal distance ; and if p →∞, the p - metric is equivalent to the fubini - study distance . therefore , the codebook design based on the p - metric bridges the gap between the design for low snr and that for high snr . in this section , the design of an independent codebook for each rank r is discussed . the design algorithm is based on the generalized lloyd - max algorithm that is a widely used for solving a variety of vector quantization problems . given the quantization codebook q ={ q 1 , q 2 , . . . , q 2 b }, the optimal partitioning satisfies v k ={ vεc t × n : d p ( v , q k )≦ d p ( v , q j ),∀ j ≠ k } ( 12 ) to satisfy the centroid condition , the following problem is solved for the k th partition since an analytical solution for the above optimal centroid problem does not exist , this is solved numerically . to employ the gradient - descent search algorithm , the real representation of the matrix q denoted by q is defined as the real representation h , v of the matrices h , v , respectively , are similarly defined . also , the system can parameterize the semi - unitary matrix qεc t × n by using n φ = 2 ( t − n + 1 ) n independent real parameters φ i , i = 1 , . . . , n φ . therefore , an unconstrained problem can be obtained in terms of the vector φ =[ φ 1 , φ 2 , . . . , φ n φ ]: the derivative of the objective function ( 15 ) with respect to φ k is given by f = det ⁡ ( i + p ⁢ v _ t ⁢ q _ ⁢ ⁢ q _ t ⁢ v ) ( 1 + p ) r ⁢ . ∂ q _ ⁡ ( φ ) ∂ ϕ k ⁢ can be found using standard techniques . the gradient - descent search algorithm can be used with the following update formula φ ( l + 1 ) = φ ( l ) − μ l ∇ φ j ( q ( φ ))\| φ ( l ) ( 19 ) where μ l is the sequence of the step sizes . upon convergence , φ is used to find the corresponding unitary matrix q ( φ ). in sum , as shown in fig4 , the precoder codebook design algorithm is as follows : input : snr ave , μ i , codebook size 2 b , iteration max , rank r output : the codebook q = { q 1 , q 2 , . . . , q 2 b } generate an evaluation set { h ( l ) } l = 1 size based on the channel distribution . initialize the codebook q ( 0 ) = { q 1 ( 0 ), q 2 ( 0 ), . . . , q 2 b ( 0 )} randomly ; given q ( i − 1 ), find { v k ( i ), k = 1 , 2 , . . . , 2b } using ( 12 ); calculate the centroid { q k ( i ), k = 1 , 2 , . . . , 2b } using ( 16 )-( 19 ); in this embodiment , the system imposes a structure on the codebook which facilitates implementation of the precoding scheme in a practical system by reducing the computational complexity as well as the memory requirement . denote e k = [ 1 ; 0 ; … ⁢ ; 0 ] ︸ k - 1 . note that by applying a series of successive rotations , any semi - unitary matrix qεc t × n can be expressed as where k : c t - k + 1 → c ( t - k + 1 )×( t - k + 1 ) is a mapping that for any unit - norm vector q ( k ) εc t - k + 1 returns a rotation matrix k ( q ( k ) ) such that k ( q ( k ) ) q ( k ) = e t - k + 1 . therefore , instead of designing the codebook of precoding matrices q , the vector codebooks contains all the vectors q ( k ) . consider n t − 1 sets of unit - norm vectors in q ( 1 ) ={ q i ( 1 ) } i = 1 k 1 ⊂ c t , q ( 2 ) ={ q i ( 2 ) } i = 1 k 2 ⊂ c t - 1 , . . . , q ( t - 1 ) ={ q i ( t - 1 ) } i = 1 k t - 1 ⊂ c 2 . if q ( t ) = 1 , for rotations , the householder transformation defined by ψ ⁡ ( x ) = i - 2 ⁢ xx *  x  2 ⁢ to have a valid householder transformation in the complex domain , the first element of the vector x has to be real valued . the codebook of rank r consists of the set of π i = 1 r k i precoding matrices of size t × n generated using the vector codebooks defined above . the size of the vector sets , i . e ., k 1 , k 2 , . . . , k t - 1 , are the design parameters and are usually chosen such that k 1 ≧ k 2 ≧ . . . ≧ k t - 1 . for example , to design a set of 12 precoders of rank 2 , k 1 = 4 and k 2 = 3 . by choosing the indices i 1 , i 2 , . . . , i r , i j ε { 1 , 2 , . . . , k j } of the vectors from q ( 1 ) , q ( 2 ) , . . . , q ( r ) , any precoder of rank r r = 1 , 2 , . . . , t − 1 , is generated as the optimization is performed over the vector codebooks q ( 1 ) , q ( 2 ) , . . . , q ( t - 1 ) . the partitioning and centroid steps for the first vector codebook are given by partitioning : given the quantization codebook q ( 1 ) ={ q 1 ( 1 ) , q 2 ( 1 ) , . . . , q k 1 ( 1 ) }, the optimal partitioning satisfies v k ( 1 ) ={ vεc t × 1 : d p ( v , q k ( 1 ) )≦ d p ( v , q j ( 1 ) ),∀ k ≠ k } ( 23 ) centroid : the centroid for the k th partition is given by for the second codebook , a set of doubly indexed partitions can be used , where each partition is identified by two vectors in the first and the second vector codebooks q ( 1 ) and q ( 2 ) . the partitioning and centroid steps are then as follows . partitioning : given the quantization codebooks q ( 1 ) ={ q 1 ( 1 ) , q 2 ( 1 ) , . . . , q k 1 ( 1 ) } and q ( 2 ) ={ q 1 ( 2 ) , q 2 ( 2 ) , . . . , q k 2 ( 2 ) }, the optimal partitioning satisfies centroid : the centroid corresponding to index i 2 is given by where the expectation is over the first two dominant eigenvectors , i . e ., v ( 2 ) and i (.) denotes the indicator function . in general , in finding the partitioning for the r th vector codebook q ( r ) , a set of r - tuple indexed partitions is defined and the partitioning and centroid conditions follows the same structure as above . a design procedure similar to algorithm of fig3 can be used to find the vector codebooks . when the channel is correlated in time ( or in frequency , e . g ., across different tones in ofdm systems ), the correlation can be used to considerably reduce the feedback requirement without loss in performance . the idea of differential codebook is to feedback only the variation in the channel , since typically quantizing the channel variations requires a smaller codebook than quantizing the channel itself . let v ( s ) denote the quantized version of the first n right eigenvectors of the channel matrix h ( s )= u ( s ) d ( s ) v ( s ) at time s using the static quantized codebook design previously discussed . for time s + 1 , we then find v ( s + 1 )= ov ( s + 1 ) by using a t × t unitary transformation matrix o . with b bits of feedback , the differential codebook design is formulated as finding the set of o ={ o 1 , o 2 , . . . , o 2 b } unitary matrices such that the average quantization error defined by ε = e [∥ o ( v ( s ), v ( s + 1 )) v ( s )− v ( s + 1 )∥ f 2 ] ( 27 ) is minimized where o ( v ( s ), v ( s + 1 )) denotes the transformation as a function of the right eigenvectors of the channel for two consecutive time slots . in order to employ the lloyed - max algorithm , the system finds the optimal partitioning and the centroid for each partition . the optimal partitioning for the quantizer o ( v ( s ), v ( s + 1 )) satisfies v k ={( { circumflex over ( v )}, v ) ε c t × r × c t × r :∥ o k { circumflex over ( v )}− v ∥ f 2 ≦∥ o j { circumflex over ( v )}− v ∥ f 2 ,∀ j ≠ k }, ( 28 ) where { circumflex over ( v )} and v denote the quantized and the actual right eigenvectors of the channel for two consecutive time slots , respectively . to satisfy the centroid condition , the following problem for the k th partition is solved : since ∥ o { circumflex over ( v )}− v ∥ f 2 =∥ v ∥ f 2 − 2 etr { v { circumflex over ( v )} o }+∥{ circumflex over ( v )}∥ f 2 , the following is maximized where θσφ = svd ( e └ v { circumflex over ( v )}\|({ circumflex over ( v )}, v ) εv k ┘) and t =[ s ij ]= φ o * θ is a unitary matrix . thus , ( 30 ) is maximized when all s ii = 1 , i . e ., when o = θφ . it should be noted that since the final solution depends only on θφ , it can be obtained directly through the polar decomposition of e └ vv *\|({ circumflex over ( v )}, v ) εv k ┘ instead of the svd . the idea behind differential quantization is to use b 1 bits for the main quantizer and b 2 & lt ; b 1 bits for the differential quantizer . for example , in ofdm systems , when the precoder is used for a chunk of adjacent ofdm tones , the precoding is usually much more effective if the chunk size is smaller . hence , if b bits are available for precoding across a large chunk of adjacent ofdm tones , the chunk is usually broken into several smaller , e . g ., 3 sub - chunks of the same sizes where the precoder for each sub - chunk is specified with b / 3 bits . however , considering the correlation between the adjacent sub - chunks , we can use a main quantizer with b 1 & gt ; b / 3 bits for quantizing the center sub - chunk and use a differential codebook with b 2 & lt ; b / 3 bits for quantizing of each of the other two sub - chunks , where b = b 1 + 2b 2 , and b 2 & lt ; b 1 . depending on the correlation structure we can usually pick b 2 & lt ; b 1 such that the precoding performance of all three sub - chunks is almost similar . the invention may be implemented in hardware , firmware or software , or a combination of the three . preferably the invention is implemented in a computer program executed on a programmable computer having a processor , a data storage system , volatile and non - volatile memory and / or storage elements , at least one input device and at least one output device . each computer program is tangibly stored in a machine - readable storage media or device ( e . g ., program memory or magnetic disk ) readable by a general or special purpose programmable computer , for configuring and controlling operation of a computer when the storage media or device is read by the computer to perform the procedures described herein . the inventive system may also be considered to be embodied in a computer - readable storage medium , configured with a computer program , where the storage medium so configured causes a computer to operate in a specific and predefined manner to perform the functions described herein . the invention has been described herein in considerable detail in order to comply with the patent statutes and to provide those skilled in the art with the information needed to apply the novel principles and to construct and use such specialized components as are required . however , it is to be understood that the invention can be carried out by specifically different equipment and devices , and that various modifications , both as to the equipment details and operating procedures , can be accomplished without departing from the scope of the invention itself .	7
sport utility vehicle 10 has a liftgate 12 that is attached to the aft end of the vehicle roof by two hinge assemblies 13 so that liftgate 12 pivots about a generally horizontal hinge 15 axis from a closed position shown in fig1 and 2 to a raised open position shown in fig3 and 4 . hinge axis 15 is generally substantially horizontal and liftgate 12 is generally permitted to pivot about 90 ° about the pivot axis between a generally horizontal open position and a generally vertical closed position . however , the range of movement can be varied substantially from one model of vehicle to another . liftgate 12 is opened and closed by a power operating system that includes at least one and preferably two identical lift mechanisms 22 that are installed in the aft end of the vehicle at the d - pillars that define the width of the rear opening to the cargo area that is closed by liftgate 12 . one typical lift mechanism 22 is shown in detail in fig5 and 7 . lift mechanism 22 comprises an annular , square shaped linear channel 24 having an longitudinal slot 26 in an upper portion of side wall 28 of the annular channel . channel 24 has a window 30 in an opposite side wall 32 that is aligned with the bottom portion of slot 26 as best shown in fig6 . a rack bar 34 is disposed in channel 24 for linear movement in the channel 24 which serves as a guide or track for rack bar 34 . rack bar 34 has teeth 36 on one side facing side wall 32 so that window 30 provides access to teeth 36 . a ball stud 38 is attached to the opposite side of rack bar 34 at the upper end so that ball stud 38 extends through slot 26 . rack bar 34 preferably has a u - shaped shoe 39 of low friction material adjacent each end to facilitate sliding movement of rack bar 34 in channel 24 . lift mechanism 22 includes a link 40 that has a ball socket 42 at the lower end and a ball socket 44 at the upper end . ball stud 38 is disposed in ball socket 42 so that the lower end of link 40 is universally attached to rack bar 34 . the opening of ball socket 44 is perpendicular to the opening of ball socket 42 . ball socket 44 is used to attach the upper end of link 40 to liftgate 12 for universal movement relative to the liftgate 12 by means of a ball stud that is generally perpendicular to ball stud 38 as further explained below . lift mechanism 22 includes a power unit 46 for raising and lowering rack bar 34 in channel 24 . power unit 46 comprises an electric motor 48 , a first gear set 50 , an electromagnetic clutch 52 and a second gear set 54 , that includes an output pinion gear 56 . electric motor 48 has a worm gear output 49 that drives gear set 50 which changes the drive axis 90 ° and includes an output pinion gear 51 . output pinion gear 51 drives the input side of electromagnetic clutch 52 ; the output side of which drives gear 53 . gear 53 drives gear set 54 which as indicated above has an output pinion gear 56 . power unit 46 is attached to a side wall of channel 24 so that pinion gear 56 projects into window 30 and meshes with teeth 36 of rack bar 34 as best shown in fig6 . the housing cover of gear set 54 preferably includes a combined guard and bearing support 58 for pinion gear 56 . lift mechanism 22 is installed in vehicle 10 with channel 24 fixed to the vehicle at the d - pillar 60 by suitable brackets , fasteners , weldments or the like ( not shown ). the channel 24 is supported in a generally vertical orientation and preferably as vertical as possible in both the longitudinal direction and the transverse direction of the vehicle . the vertical deviation will depend on the shape for the particular vehicle model . for instance , in the illustrated vehicle , the channel 25 tilts forward in the longitudinal direction about 10 degrees as best shown n fig2 and 3 . on the other hand , channel 24 tilts inward in the lateral direction about 10 degrees as best shown in fig1 and 4 . lift mechanism 22 is also installed so that the ball stud 38 faces rearwardly on an axis that is substantially parallel to the longitudinal axis of the vehicle . teeth 36 are on the opposite side of the square rack bar 34 and face forwardly . power unit 46 is attached to the outboard side of channel 24 . link 40 is universally attached to the rearward facing ball stud 38 at the lower end by ball socket 42 which is open in the longitudinal direction . the upper end of link 40 is universally attached to a ball stud 62 at a side edge of liftgate 12 by upper ball socket 44 which is open in the transverse direction . ball stud 62 is attached to a side edge of the lift gate 12 so that the axis of ball stud 62 is spaced from hinge axis 15 and essentially perpendicular to the longitudinal axis of the vehicle or a longitudinal axis parallel to it . thus link 40 is free to pivot in any direction with respect to rack bar 34 and with respect to liftgate 12 . this freedom of movement reduces side loads on ball stud 38 that tend to twist rack bar 34 so that the substantially twist - free rack bar 34 slides in channel 24 smoothly and does not bind with the channel 24 or pinion gear 56 . the power operating system further includes a conventional power source such as the vehicle battery ( not shown ) and a suitable motor control for energizing and shutting off the reversible electric motor 48 . motor controls are well known to those skilled in the art and thus need not be described in detail . the power operating system operates as follows . assuming that the liftgate 12 is closed as shown in fig1 and 2 , electric motor 48 and electromagnetic clutch 52 are energized to open liftgate 12 . when energized , electric motor 48 rotates pinion gear 51 clockwise via gear set 50 . pinion gear 51 in turn rotates output gear 53 clockwise via the engaged electromagnetic clutch 52 . gear 53 drives gear 56 clockwise via gear set 54 until rack bar 34 is driven from the retracted position shown in fig1 and 2 to the raised position shown in fig3 and 4 . this raises liftgate 12 from the closed position shown in fig1 and 2 to the raised open position shown in fig3 and 4 via link 40 . when the liftgate 12 is fully opened , a limit switch or the like is actuated to shut off electric motor 48 and electromagnetic clutch 52 . liftgate 12 is closed by reversing electric motor 48 so that gear 56 drives rack bar 34 back to the retracted position shown in fig1 and 2 . the liftgate 12 can be moved manually in the event of a power failure easily because the deenergized clutch 52 allows the clutch output gear 53 to free wheel with respect to electric motor 48 and gear set 50 . the power operating system can be designed to work alone or in conjunction with gas cylinders which are well known in the art with the primary adjustment being the size of the electric motor 48 . the power operating system described above preferably includes two identical drive units 22 for balanced operation and reduced manufacturing costs . however , the drive units need not be identical and in some instances , a single drive unit may be sufficient . while the preferred embodiment has the ball stud 38 facing rearwardly to minimize twist on the rack bar 34 , the ball stud 38 may face in any direction . in one aspect , it is an advantage to face the ball stud 38 inwardly . this allows the lift mechanism 22 to be moved outwardly to save space . moreover , the preferred embodiment also includes an electromagnetic clutch . however , it is possible to eliminate the electromagnetic clutch and use a back driveable electric motor to lower the cost . in other words , many modifications and variations of the present invention in light of the above teachings may be made . it is , therefore , to be understood that , within the scope of the appended claims , the invention may be practiced otherwise than as specifically described .	4
fig3 is a partial cross - sectional view of a multi - layer printed circuit board 100 in accordance with the present invention . the multi - layer pcb 100 includes dielectric layers 102 – 107 , with at least one of the dielectric layers having a conductive trace 110 formed on a surface in a conventional manner , such as by photolithography . the conductive trace 110 is adapted for carrying a high speed signal and has a conductive pad 112 connected thereto for facilitating electrical connection to the conductive trace 110 . a non - conductive via 111 in the form of a non - plated hole extends through at least a portion of the dielectric layers 102 – 107 to intersect at least one conductive trace on an inner layer of the pcb 100 . in the illustrative embodiment of fig3 , the non - conductive via 111 extends through the entire pcb 100 and intersects the conductive pad 112 of the conductive trace 110 , thereby exposing a portion of the pad 112 along the walls of the non - conductive via 111 . as will be described in greater detail with respect to fig4 a – 4e and 5 , a conductive body 120 is introduced into the non - conductive via 111 and attaches to the exposed portion of the pad 112 to provide a reliable electrical connection between an electrical component 130 mounted on the pcb 100 and the conductive trace 110 . with this arrangement , electrical connection between the component 130 , such as a connector or an integrated circuit , and an inner layer conductor 110 is achieved with a non - conductive via 111 which does not have plated via portions that can form a resonant stub . note that each of the dielectric layers 102 – 107 of the multi - layer pcb 100 can be fabricated by conventional techniques . as one example , one or more of the dielectric layers 102 – 107 is made of fiberglass - reinforced epoxy resin with copper cladding . the copper is photolithographically processed to form a desired circuit pattern of conductive traces and pads on the surface of the layer . the individually processed layers 102 – 107 are stacked and pressed into the printed circuit board 100 by known techniques . this is shown in fig4 a , where the conductive trace 110 and the pad 112 are formed on the dielectric layer 104 ( or dielectric layer 105 ) of the pcb 100 . referring now to fig4 b , a hole is drilled in the pcb 100 , as may be done by a conventional drill bit , by using laser drilling , by water jet drilling or other techniques , in order to form the non - conductive via 111 . note that it may be desirable to remove the insulator material of the layers 102 – 107 that may be spread along the walls of the via hole 111 during drilling , at least in the vicinity of the inner layer conductor 110 . various techniques are suitable for this purpose , including plasma and chemical etching . as one example , the epoxy resin material of the layers is removed from the walls by a known cleaning process , such as a chemical reduction process using potassium permanganate . removing resin in the vicinity of the inner layer conductor serves to expose some of the trace 110 and may leave a small tab of the trace sticking into the via hole 111 . such a tab would be engaged by the conductive body 120 when it is introduced into the non - conductive via 111 , thereby resulting in a better electrical connection . fig4 c is a partial cross - sectional view of the multi - layer pcb 100 of fig4 b with a conductive body 120 being introduced into the non - conductive via 111 . the conductive body 120 may be made from a fusible alloy , a conductive adhesive or other material that provides the desired characteristics described herein . in the preferred embodiment , the conductive body 120 is made from powdered solder in liquid flux ( also referred to as solder paste ). the conductive body 120 is introduced into the non - conductive via 111 in an activated state . as used herein , “ activated state ” refers to the conductive body in an uncured or liquid or other form to allow the conductive body to migrate . in fig4 d , the activated state conductive body 120 is shown being effected to migrate in the direction of the conductor 110 . arrow 113 indicates the direction of migration of the activated state conductive body 120 . the migration of the conductive body 120 can be caused by action of gravity , heat , or other external means known in the art . when the activated state conductive body makes contact with the pad 112 of the conductive trace 110 , it adheres to the pad 112 . it appears to the inventors that this is due to the action of surface tension . based on experiments performed by the inventors using solder paste as the material for the conductive body , the activated state conductive body remains adhered to the pad even if the external influence ( e . g ., gravity ) is not abated for some time after the activated state conductive body has come into contact with the pad . thus , an added benefit of the present invention is that this characteristic accommodates variabilities inherent in the process and the materials . after the activated state conductive body 120 adheres to the pad 112 , the activated state conductive body is effected to a deactivated state to affix the conductive body 120 to the pad 112 . “ affix ” as used herein is not intended to convey a sense of physical permanence in attachment but rather , is only intended to convey a sense of better attachment or adhesion of the conductive body to the pad than when the conductive body is in an activated state . fig4 e illustrates the conductive body 120 adhering to the pad 112 . note that the conductive body 120 in the non - conductive via 111 of fig3 and 4 is generally spherical in shape ( with meniscus created by surface tension ). however , the shape of the conductive body is not limited to a generally spherical form . as will be described with respect to fig6 , the conductive body can also assume a generally oval ( or perhaps , rounded rectangle ) form . referring now to fig5 , following the affixing of the conductive body 120 to the pad 112 of the conductor 110 , an activated state conductive material 122 is introduced into the non - conductive via 111 . the conductive material 122 may be made from a fusible alloy , a conductive adhesive or other material that provides the desired characteristics described herein . in the preferred embodiment , the conductive material 122 is made from solder paste . the conductive material 122 may be disposed directly onto the conductive body 120 or may be effected to move in the direction of the conductor 110 . if effected to migrate , the migration of the conductive material 122 can be caused by action of gravity , heat , or other external means known in the art . the activated state conductive material 122 will migrate until it makes contact with the conductive body 120 . a conductive element , such as a contact pin 124 of the electrical component 130 , is introduced into the non - conductive via 111 so that the conductive element makes an electrical connection with the conductive material 122 . preferably , the conductive element 124 is introduced into the non - conductive via 111 with the conductive material 122 in the activated state . after the electrical component 130 is mounted on the pcb 100 , the conductive material 122 is effected to a deactivated state . in order to repair or replace the conductive element 124 of the electrical component 130 , the conductive material 122 is subjected to an external factor , such as the application of heat , to allow the conductive element 124 to be removed from the conductive material 122 . for example , where the conductive material used is solder paste , the application of heat will soften the solder paste to allow the conductive element 124 to be removed from the non - conductive via 111 . multi - layer pcbs generally include many vias — sometimes hundreds . it is within the scope of the invention that a pcb , such as the pcb 100 , includes both non - conductive vias and conventional plated vias or through - holes . non - conductive vias might be drilled after conventional plated through - holes are drilled and plated . alternatively , the non - conducting vias might be masked off during the electroless deposition process step to ensure that no conductive material builds up on the inside walls of the holes . it should be noted that in an alternative embodiment ( not illustrated ), the activated state conductive material 122 may be disposed directly into the non - conductive via to make electrical contact with the pad 112 of the conductor 110 . no conductive body 120 would need to be first introduced into the non - conductive via . this alternative embodiment may be preferable when the non - conductive via does not extend through the entire thickness of the pcb . fig6 is a partial cross - sectional view of a multi - layer printed circuit board 150 in accordance with another embodiment of the present invention . the multi - layer pcb 150 includes dielectric layers 132 – 138 , with at least two of the dielectric layers having a conductive trace 140 , 144 formed thereon . the conductive traces 140 , 144 are adapted for carrying high speed signals and have conductive pads 142 , 146 connected respectively thereto . a non - conductive via 143 in the form of a non - plated hole extends through at least a portion of the dielectric layers 132 – 138 to intersect the conductive traces 140 , 144 on the inner layers of the pcb 150 . in the illustrative embodiment of fig6 , the non - conductive via 143 extends through the entire pcb 150 and intersects the conductive pads 142 , 146 of the conductive traces 140 , 144 , respectively , thereby exposing a portion of the pads 142 , 146 along the walls of the non - conductive via 143 . a conductive body 148 is introduced into the non - conductive via 143 and attaches to the exposed portion of the pads 142 , 146 . compared to the generally spherical conductive body 120 in fig3 , the conductive body 148 in fig6 is much more elongated in shape ( oval or rounded rectangle ). this is caused by controlling the amount of the conductive body being introduced into the non - conductive via relative to the size of the via . the arrangement of fig6 is desirable where the conductors 140 , 144 are desired to be in electrical contact with one another . referring now to fig7 , there is shown a partial cross - sectional view of a multi - layer pcb 190 in accordance with still another embodiment of the present invention . the multi - layer pcb 190 includes dielectric layers 162 – 169 , with at least two of the dielectric layers having a conductive trace 170 , 174 formed thereon . the conductive traces 170 , 174 are adapted for carrying high speed signals and have conductive pads 172 , 176 connected respectively thereto . a non - conductive via 173 in the form of a non - plated hole extends through at least a portion of the dielectric layers 162 – 169 to intersect the conductive traces 170 , 174 on the inner layers of the pcb 190 . in the illustrative embodiment of fig7 , the non - conductive via 173 extends through the entire pcb 190 and intersects the conductive pads 172 , 176 of the conductive traces 170 , 174 , respectively , thereby exposing a portion of the pads 172 , 176 along the walls of the non - conductive via 173 . conductive bodies 180 , 182 are introduced into the non - conductive via 173 and attach to the exposed portion of the pads 172 , 176 , respectively . preferably , the conductive bodies 180 , 182 are introduced from opposite ends of the non - conductive via 173 . the arrangement of fig7 provides for greater circuit board density , as an electrical component can be mounted on either end of the non - conductive via 173 . it should be noted that rather than a single through - hole 173 , two non - conductive vias drilled on opposite sides of the pcb can also function in a similar manner . however , this approach will add process steps . it should be appreciated that the number of layers of the illustrated multi - layer printed circuit boards is selected for simplicity of illustration and is not a limitation on the invention . however , the invention will be most useful with thicker boards carrying high speed signals . for example , a 3 gigabits per second digital signal has significant frequency components in the range of 0 to 6 ghz . a stub 5 mm long in an fr - 4 epoxy resin / glass pcb will act as a quarter wavelength stub at approximately 6 to 7 ghz . the reflective characteristics of this resonance extend for a band above and below this frequency of at least +/− 1 ghz . thus , a 5 mm stub creates a noticeable problem at rates of 4 gigabits per second and an extreme problem at rates of between 5 and 10 gigabits . of course , at higher frequencies , proportionately shorter stubs will cause problems . thus , the invention will typically be used in applications in which high speed signals of greater than approximately 2 . 5 gigabits per second are carried by boards . having described the preferred embodiment of the invention , it will now become apparent to one of ordinary skill in the art that other embodiments incorporating their concepts may be used . it is felt therefore that these embodiments should not be limited to disclosed embodiments but rather should be limited only by the spirit and scope of the appended claims . all publications and references cited herein are expressly incorporated herein by reference in their entirety .	7
referring first to fig7 the light source 2 is intermittently lighted by means of a lighting circuit 11 . in this case , the light source 2 can be a light - emitting diode ( led ) or a tungsten - filament lamp paired with a filter , both having a peak near the wavelength suitable for the sample , and the like . it does not matter whether the light source 2 lights intermittently or whether its flux of light is interrupted . initially , a standard 12 of known reflectivity is set beneath the transparent plate 9 beneath the integrating sphere 1 . on depression of the correction switch 19 , the analog switch 14 is connected to the amplifier 13 by a command from the microcomputer 18 . the output signal r on from detector 6 during lighting of the light source 2 and the output signal r off from detector 6 during darkening of the light source 2 is a - d converted by the a - d converter 17 and is stored in the memory of the microcomputer 18 . the output signal r off during the darkening of light source 2 is composed of outputs arising from the dark current in the optical detector 6 , the offset voltage of the amplifier 13 , and the outer stray rays , which factors remain constant and can be eliminated through the substraction of output signal r on from output signal r off -- i . e . the generation of the standard difference output signal . in this standard difference output signal ( r on - r off ), however , is included a component ( the inner stray rays output signal ) attributable to the inner stray rays produced in the interior of the integrating sphere 1 , as shown in fig8 . the inner stray rays output signal d is a chief cause of the shifting of the characteristics of the analyzer . what remains after the subtraction of the inner stray rays output signal d from the standard difference output signal ( r on - r off ) is the standard output signal r -- the end object of reflectivity measurement , as is seen in fig8 . in the same fashion , what is left after the subtraction of the inner stray rays output signal d from the measured difference output signal ( s on - s off ) produced by using the test paper 5 in place of the standard 12 is measured output s . s on and s off are the output signals during the lighting and darkening of the light source respectively , during irradiation of the test paper . the deviation of the inner stray rays output signal will now be set forth . as described above , the intensity of inner stray rays varies as a result of changes in the setting angle of the test paper and the material used in the transparent plate 9 ( such as sheet glass ) which is attached to the integrating sphere 1 , the shape of the interior of the integrating sphere 1 , the deflection of the optical axis of the light source 2 and the intensity of light therefrom and also varies as the intensity of the light source changes due to fluctuations in the supply voltage , temperature , aging and so on . since there are no changes in the relative positions of the structural elements of the photometric section ( i . e ., the integrating sphere 1 , the light source 2 , the measuring window 4 , the transparent plate 9 , the optical detector 6 , and so on ), and since there is no change in the reflection characteristics inside the integrating sphere 1 , it is only the intensity of light from the light source which changes with the passage of time . thus , this change occurs both in the standard difference output signal ( r on - r off ) during measurement of the standard 9 and also in the inner stray rays output signal d included therein . however , ratio k of the inner stray rays output signal d to the standard difference output signal ( r on - r off ) is kept constant . having this fact in mind , the solution of the second problem has been accomplished . assuming that the analyzer is properly adjusted , its output will be zero when the reflectivity of the specimen is zero , or where , for example , nothing is put on the measuring section of the analyzer and the analyzer is placed intact in a dark room . on the other hand , the output of the analyzer when irradiating the standard yields a given standard value . when the analyzer is properly adjusted , the measured difference output signal ( s on - s off ) during measurement of a reflectivity of zero expresses the inner stray rays output signal d exactly ; and the standard difference output signal ( r on - r off ) is equivalent to the sum of the inner stray rays output signal d and the standard output signal r ( fig8 ). in this case , the ratio k of the inner stray rays output signal to the standard difference output signal ( r on - r off ) can be expressed as a percent by the following equation : ## equ1 ## conversely , when k is already known , then the magnitude of the inner stray rays output signal d can be found by the following equation : ## equ2 ## in case there are a plurality of analyzers ( even though they are properly adjusted ) the standard difference output signal will assume different values ( r on , 1 - r off , 1 ), ( r on , 2 - r off , 2 ), ( r on , 3 - r off , 3 ) . . . using only one standard owing to the variation between the respective light sources , optical detectors , etc . in separate devices . likewise , the measured difference output signal of a sample having a reflectivity equal zero will vary since the inner stray rays output signal d can be d1 , d2 , d3 and so forth . hence , the value of k does not generally stay constant and can be k1 , k2 , k3 . . . on account of the relative positions between the light source , optical detectors , etc . likewise , if the value of k is already known for an individual analyzer , d1 , d2 , d3 . . . can be determined separately on the basis of the following equations : ## equ3 ## thus , k can be found directly from both the measured difference output signal ( s on - s off ), measured with a reflectivity equal zero and from the standard difference output signal ( r on - r off ) during measurement of the standard . however , there is a simpler way to obtain k . this may be done by providing a second standard having a reflectivity different from the first standard , determining the reflectivity of the second standard relative to the first with the analyzer adjusted in advance , and using this result as the reference value to determine k . on the other hand , the reflectivity of the second standard relative to the first standard may be found on an arbitrary analyzer for which k is unknown . the value of the potentiometer k may then be adjusted empirically so that the measured reflectivity may coincide with the above - described reference value . the reflectivity of the standard is not subject to any limitation and can have any suitable value at will , provided only that some common value is used for all individual analyzers . when the intensity of light changes after an adequate value of k has been once established in a given analyzer , the standard difference output signal from the standard varies from the value ( r on - r off ) reg at the time of the first adjustment to the value ( r on - r off ) in proportion to the change , as shown in fig9 and the inner stray rays output signal also changes from d reg to d . however , the proportion of d reg to ( r on - r off ) reg or d to ( r on - r off ) respectively has a constant value of k in either case , and conversely , when k is stored , it is possible to find the standard difference output signal ( r on - r off ) at the time it is corrected by the standard reflecting piece prior to measurement of the sample , and the inner stray rays output signal d can also be found through the ratio k . in the inventive apparatus , k is made variable on the potentiometer k 15 , and after the determination of the standard difference output signal ( r on - r off ), the resistance of potentiometer k 15 ( which has been established in advance at an adequate value ) is a - d converted by operating the analog switch 14 . the product of k and the standard difference output signal ( r on - r off ) is computed by the microcomputer 18 on the basis of the following equation : ## equ4 ## the inner stray rays output signal d thus obtained is stored in the memory of the microcomputer 18 . next , after the test paper 5 ( painted with or impregnated in the liquid to be examined ) is set beneath the transparent plate 9 beneath the integrating sphere 1 , the measuring switch 20 is operated . the analog switch 14 is then thrown under the control of the microcomputer 18 , the output signal s on ( during the new lighting of the light source 2 ) and the output signal s off ( during the darkened period of the light source 2 ) are a - d converted by the a - d converter 17 , thus enabling the measured difference output signal ( s on - s off ) to be obtained . the subtraction of the inner stray rays output signal d stored in the above memory from the measured difference output signal yields the measured output signal . afterwards , the relative reflectivity ( r %) is calculated on the basis of the following equation : ## equ5 ## the relative reflectivity calculated in this way is independent on the influence of the dark current in detector 6 or the offset voltage of amplifier 7 and can correct the inner stray rays output ( which is different in each analyzer ) so that it becomes possible to obtain an analyzer which has no instrumental error for quantitative analysis with test paper . the coloration characteristics of various kinds of test papers were investigated on the basis of many experimental results . the results of several tests on the calibration curve expressing the correlation between the concentration of the specimen substance and the reflectivity of the test paper , are shown in fig1 to 12 . using these , a further study was undertaken to approximate these calibration curves by a simple function . fig1 gives the correlation between the concentration ( mg / dl ) of grape sugar and the reflectivity ( r %) of the test paper used for its analysis . grape sugar is oxidized by an oxidizing enzyme of grape sugar to be changed into gluconic acid and hydrogen peroxide . the coloration indicator is oxidized and colored by hydrogen peroxide thus produced and peroxidase . two graphs separately express wavelengths of λp = 670 nm and λq = 660 nm , which were used . fig1 shows the correlation between the concentration ( mg / dl ) of bilirubin and the reflectivity ( r %) of the test paper used for its analysis . here , bilirubin acts on a diazo reagent in an acidic condition and the coloration of the thus produced azobilirubin is measured by light having a wavelength of 550 nm . fig1 shows the correlation between the concentration ( mg / dl ) of urea nitrogen and the reflectivity of the test paper used for its analysis . here , urea is decomposed into ammonium carbonate by the use of urease , and the indicator is then colored through the utilization of the changeability of hydrogen ion concentration by dint of ammonium thus produced . the wavelength used here is 620 nm . in the analysis dependent on the coloration , the transmission of the light through the coloring substance is frequently measured to determine the degree of extinction . if the incident light on the coloring substance is io and the light transmitted therethrough is i , the latter is expressed by the equation : i = ioe ecl ( an exponential function ) in which c denotes the concentration , e denotes the degree of extinction and l denotes the optical path length . the degree of extinction e is expressed by the equation : e = ln ( io / i )= ecl , and is proportional to the concentration c . in comparison , the light reflected from the test paper is composed both of the light returned to the surface of the test paper and the light diffused on the surface of the test paper as a result of absorption into or scattering over the test paper . it follows that , unlike the transmitted light i , this reflected light cannot be expressed as an exponential function since it has been absorbed , at least to a degree . however , when the definition of the approximation function was modified and the range of concentration was limited to that needed for practical use by way of experiment , the calibration curves shown in fig1 - 29 all fit an exponential function in the form of y = αe - βr + γ , wherein y denotes the concentration of the specimen substance , r denotes the reflectivity and α , β , γ are constants . further , under these conditions ( namely , where the definition of the approximation function was modified and the range of concentration was limited to that needed for practical use ) it was found that the calibration curves shown in fig1 to 12 could be regarded as segments of a hyperbola in a simple form , and that the relationship between concentration y and reflectivity , r , could be expressed as : ## equ6 ## a , b and c being constants . thus , the correlation between the concentration y and the reflectivity r corresponding to fig1 to 12 can be approximated by assigning appropriate values to each of the constants a , b , and c in equation ( ii ), as shown in tables 1 to 4 , and the conversion of the reflectivity r into the concentration y can be performed in this way with an error of plus or minus only several percent . in tables 1 to 4 , the concentration shown is the theoretical concentration of a solution , the approximate value is the concentration found by the use of the appropriate approximation equation from the reflectivity r of the solution , and the percentage of error is the difference between the approximate concentration and the theoretical concentration in proportion to the theoretical concentration . in the examples , each percentage error exhibits a good approximation -- under 4 %. even if the calibration curves decrease monotonically among test papers used in the other measurements , the calibration curves can be approximated by the use of equations in the form of equation ( ii ), wherein r denotes the reflectivity after correction by an adequate standard output signal , and a , b , c are the constants which define the forms of the calibration curves . table i______________________________________ approximateconcentration reflectivity value percentagemg / dl % mg / dl of error______________________________________25 85 24 . 9 - 0 . 4075 56 74 . 3 - 0 . 93100 47 102 . 0 2 . 00200 30 199 . 3 - 0 . 35300 22 296 . 5 - 1 . 17400 17 403 . 1 0 . 78______________________________________ test paper for analysis of grape sugar ( fig1 ) measuring wavelength λp = 670 nm approximate equation : ## str1 ## table 2______________________________________ approximateconcentration reflectivity value percentagemg / dl % mg / dl of error______________________________________25 80 25 . 6 2 . 4075 52 72 . 9 - 2 . 80100 43 100 . 5 0 . 50200 26 200 . 4 0 . 20300 18 305 . 1 1 . 70400 14 395 . 7 - 1 . 08______________________________________ test paper for analysis of grape sugar ( fig1 ) measuring wavelength λq = 660 nm approximate equation : ## str2 ## table 3______________________________________ approximateconcentration reflectivity value percentagemg / dl % mg / dl of error______________________________________2 . 5 97 2 . 5 05 . 0 85 5 . 2 4 . 007 . 5 78 7 . 4 - 1 . 3310 . 0 72 9 . 8 - 2 . 0015 . 0 63 15 . 3 2 . 0020 . 0 58 19 . 9 - 0 . 50______________________________________ test paper for analysis of bilirubin ( fig1 ) measuring wavelength λ = 550 nm approximate equation : ## str3 ## table 4______________________________________ approximateconcentration reflectivity value percentagemg / dl % mg / dl of error______________________________________10 86 10 . 0 020 63 20 . 4 2 . 0030 51 29 . 3 - 2 . 3340 41 40 . 4 1 . 0050 35 49 . 8 - 0 . 4060 30 60 . 2 0 . 33______________________________________ test paper for analysis of urea nitrogen ( fig1 ) measuring wavelength λ = 620 nm approximate equation : ## str4 ## here , referring to the correlation between the concentration y and the reflectivity r , it is possible to shift the origin of the appropriate equation of the calibration curve to the coordinates by varying the constants an and / or c , as shown in fig1 , and to make the calibration curve pass parallel to the coordinate axis , or else to make the shape of the calibration curve variable by changing the constant b , as shown in fig4 . these constants a , b , and c , like the constant k , are held in analog form in potentiometer a 16 1 , potentiometer b 16 2 , and the potentiometer c 16 3 , respectively . the values of these constants a , b , and c are variable depending on the sorts of items to be measured and the test papers , thereby enabling the slight difference between the calibration curves to be corrected with facility . this effectively equips an analyzer with a plurality of calibration curves simultaneously when correcting instrumental errors caused by shifting of the wavelength of the light source although only one kind of test paper is used . this produces satisfactory results and helps to produce an analyzer of simple construction and of great versatility . however , the constants a , b , and c change , accordiang to the kinds of specimens and test papers , so that it is necessary to use several sets of potentiometers 16 1 , 16 2 , and 16 3 in order to analyze a plurality of specimens in the same analyzer simultaneously . it may be remarked in this connection that when complex functions are programmed into the microcomputer 18 and other computers , it becomes difficult to reduce the number of program steps , or to shorten the operation time , since the capacity of memory decreases . consequently , it is far better to perform the calculations using equation ii as compared with using the exponential function y = αe - βr + γ . where the reflectivity r has been calculated without any instrumental error , as mentioned above , each of the constants a , b , and c are a - d converted under the control of the microcomputer 18 as in the case of k . the concentration y is determined by equation ( ii ) and is indicated as a directly readable digital value on an indicating means such as the numerical indicator 21 . at this time , the instrumental error of the calibration curve produced by a slight difference from the wavelength used can be eliminated if each of the constants a , b , and c has been adjusted at the time of manufacture by using a color standard which has a standard coloration , thereby enabling the concentration to be directly readable in a simple operation and without any instrumental error . even if constants a , b , and c in a device have been properly adjusted , there is still the possibility that the wavelength will vary slightly during use , e . g . by changes of supply voltage or ambient temperatures . in such a case , it is only necessary to adjust either constant a or c on the potentiometer a 16 1 , or c 16 3 . these examples show the cases where all of the constants k , a , b , and c are stored in the potentiometers in analog form . it does not matter whether these constants are held beforehand in the memory of the microcomputer as a plurality of numerical tables in digital form , or directly inputted from external memory elements , such as magnetic cards together with other data . the invention can also be used where a means for the measurement of reflected light other than the integrating sphere , for example , such as a means for measuring the quantity of reflected light in a fixed direction by impinging the flux of light on the reflecting surface at a specified angle , is employed in the photometric section . further , the correction for the effect of inner stray rays performed according to the invention can be applied when reflectivity in general is to be measured , and is not limited merely to the measurement of reflectivity with colored test papers . the method of analysis according to the invention makes it possible to achieve exact measurement of the relative reflectivity while eliminating the influence of the inner stray rays in finding the reflectivity of a colored test paper painted with or impregnated in the liquid to be examined , by calculating the inner stray rays output signal at the time of measurement from the proportion of the inner stray rays output signal to the standard reference output signal stored beforehand and the quantity of standard difference output signal at the time of the correction prior to the measurement , and by applying the correction to both the standard and the measured difference output signals . the method according to the invention makes it further possible to correct the fluctuation of the calibration curves due to scattering and change of wavelengths of the source , and to convert the reflectivity into the concentration accurately without any scattering by approximating the calibration curves to be parts of hyperbolae , and by adjusting the constants in the formula of the conversion . the device according to the invention is able to correct the proportion of the inner stray rays output signal to the standard difference output signal and also each of the constants in the formula of the conversion as the approximate equation at the time of storing both of them in the potentiometers in analog form , thereby making possible the accurate quantitative measurement of the concentration of the specimen substance in the form of a digital display , by entirely eliminating the influence both of the inner stray rays produced in the photometric section and the influence of the fluctuation of the intensity of light from the light source , by completing the set of characteristics in the capacity of the reflectivity meter without any instrumental error , and by removing the instrumental error caused by scattering of the wavelength of the light from the light source .	6
fig1 schematically illustrates the setup of a processing station in a texturing apparatus according to the invention . the texturing apparatus comprises a plurality of processing stations , with the processing units of the processing stations being mounted in one or more machine frames . to texture a yarn 1 , a processing station comprises at least one first feed system 5 , a heating device 6 , a cooling device 7 , a false twist unit 15 , a second feed system 14 , and a takeup device 16 . the processing units are arranged , serially one after the other , to form a yarn path . in the process , the first feed system 5 withdraws a yarn 1 from a feed yarn package 2 via a yarn guide 4 . the feed yarn package 2 is creeled on a mandrel 3 of a creel ( not shown ). the first system 5 advances the yarn 1 into a so - called false twist zone , which extends as far as the false twist unit 15 . the false twist unit 15 produces in the yarn 1 a false twist , which returns in the yarn within the false twist zone . to this end , the false twist unit 15 may comprise , for example , a plurality of overlapping friction disks , which produce a false twist in the yarn . within the false twist zone , the false twist returns in the yarn , and in so doing it is heated in the heating device 6 and subsequently set in the cooling device 7 . the second feed system 14 withdraws the yarn from the false twist unit 15 and advances it to the takeup device 16 . in the takeup device 16 , the yarn 1 is wound to a package 17 . to cool the yarn 1 within the false twist zone , the cooling device 7 comprises a cooling tube 8 that connects via a line 10 to a coolant source 9 . associated to the cooling tube 8 is at the one end an inlet yarn guide 18 , which advances the yarn 1 to the cooling tube 8 . at the opposite end , an outlet yarn guide 19 is arranged . the end of the cooling tube 8 in the region of inlet yarn guide 18 is called the feed end 20 , and the opposite end of the cooling tube 8 is called the delivery end 21 . the coolant is supplied via the feed end 20 , which connects via the line 10 to the coolant source 9 . the coolant cools the wall of the cooling tube 8 . in the region between the inlet yarn guide 18 and the outlet yarn guide 19 , the cooling tube 8 mounts on its circumference a yarn lifter 11 . the yarn lifter 11 is formed by an annular segment 12 , which is arranged on the circumference of the cooling tube 8 . the annular segment 12 includes an outer guide edge 13 , which extends in spaced relationship with the surface of the cooling tube 8 substantially in the radial direction . fig2 is a schematic view of the cooling device of the texturing apparatus of fig1 . the inlet yarn guide 18 and the outlet yarn guide 19 are made pivotal , so that the degree of the looping and thus the spiral cooling zone on the circumference of the cooling tube 8 are adjustable . in the region of the yarn lifter 11 , the yarn 1 is guided over the guide edge 13 of the annular segment 12 . with that , the contact between the yarn 1 and the surface of the cooling tube 8 is discontinued over a partial length . the size of the partial length is dependent on the spacing between the guide edge 13 and the surface of the cooling tube 8 , as well as on the degree of slope of the spiral cooling zone on the circumference of the cooling tube 8 . in this connection , it is possible to adjust the annular segment 12 on the circumference of the cooling tube 8 both in the axial direction and in the circumferential direction . when the slope of the spiral cooling zone remains unchanged , the spacing between the guide edge 13 and the surface of the cooling tube 8 can be adjusted by displacing the annular segment 12 . to this end , the annular segment 12 has an elliptic or stepped shape , as shown in fig3 . by adjusting the annular segment 12 on the cooling tube 8 , it is thus possible to change the relative position of the yarn 1 on the guide edge 13 , and with that the distance from the surface of the cooling tube 8 . the configuration of the annular segment 12 is arbitrary , so that any spacing of the yarn is realizable . for example , the annular segment 12 may have a range , in which the yarn maintains a contact with the cooling tube 8 . the annular segment 12 is secured to the circumference of the cooling tube 8 by a fastening means 29 . by releasing the fastening means 29 , the annular segment 12 can be moved to any desired position on the circumference of the cooling tube 8 . fig4 illustrates a further embodiment of a cooling device 7 , as could be used , for example , in the texturing apparatus shown in fig1 . in this embodiment , a yarn lifter 11 is associated to the cooling tube 8 between the inlet yarn guide 18 and the outlet yarn guide 19 . the yarn lifter 11 is formed by a holder 22 and a yarn guide 23 . the holder 22 is arranged on the side next to the cooling tube . the yarn guide 23 is in the form of a pin , and extends into the plane of the yarn path along the cooling tube 8 . this arrangement causes the yarn 1 to advance within the cooling zone in the region of the cooling tube 8 over the yarn guide 23 , so that in one section of the cooling zone , the yarn 1 is not in contact with the surface of the cooling tube 8 . fig5 and 6 illustrate a further embodiment of a cooling device 7 , as could be used , for example , in a texturing apparatus of fig1 . illustrated is only a section of the cooling tube 8 with a yarn lifter 11 . in this connection , fig5 is a cross sectional view of the cooling device 7 , and fig6 a side view thereof . the following description will apply to both figures , unless express reference is made to one of the figures . the yarn lifter 11 is formed by an annular holder 24 , which is slipped over the circumference of the cooling tube 8 . the annular holder 24 includes an external groove 25 , with the yarn 1 advancing in the bottom thereof . between the bottom of the groove 25 and the surface of the cooling tube 8 , a spacing is formed , so that the yarn 1 advances in one section of the spiral cooling zone without contacting the cooling tube 8 . in the path of the advancing yarn , a yarn brake 26 precedes the yarn lifter 11 . the yarn brake 26 is formed by a brake pin 27 , which is adjustably connected via a support 28 to the annular holder 24 . in the path of the advancing yarn , the brake pin 27 is arranged upstream of the groove 25 , with the position of the brake pin 27 being variable relative the bottom of the groove 25 . with that , it becomes possible to guide the yarn 1 within the cooling zone along the circumference of the cooling tube 8 with or without an additional looping about the brake pin 27 . the looping of yarn 1 about the brake pin 27 causes an additional yarn friction , which leads to a further decrease of the twist oscillations in the yarn 1 within the cooling zone . as a result , it is possible to texture in an advantageous manner in particular fine - denier yarns with a small total looping of & lt ; 360 °. even in the case of small looping angles within the cooling zone on the cooling tube 8 , the yarn brake 26 associated to the yarn lifter 11 allows an adequate decrease of the twist oscillations to be realized as far back as the inlet into the heating device 6 . many modifications and other embodiments of the invention set forth herein will come to mind to one skilled in the art to which the invention pertains having the benefit of the teachings presented in the foregoing descriptions and the associated drawings . therefore , it is to be understood that the invention is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims . although specific terms are employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation .	3
referring now to fig1 there is shown a portable battery operated wire stripper 10 embodying the present invention . the stripper 10 is of a type generally available which has a battery pack to operate the device which may be recharged by plugging into a suitable charging device . stripper 10 has an on / off switch 12 and a wire guide / safety cover 14 removably attached at the cutter head end of the stripper 10 to guide the wire end to be stripped properly into the cutter head and to protect the operator from the rotating cutter head . a prior art stripper of this type is shown in u . s . pat . no . 4 , 987 , 801 . as may be seen in fig2 the device consists generally of the power pack 16 , the drive motor assembly 18 which has a gear reducer ( not shown ) and drive receptacle 20 in the driven end thereof adapted to receive therein the hexagonal , rectangular , square , or other shaped projection 22 on the bottom of the cutting head 24 as may be seen more clearly in fig3 herein . referring to fig3 , 5a and 5b , the cutter head 24 includes a frame portion 26 which has a pair of flat plates 27 and 28 joined together to define a radial chamber adapted to pivotally receive therein a cutting blade carrier block 36 . a yoke portion 30 is mounted on plate 28 and carries on its outer extremity the nut 22 which meshes with the drive unit &# 39 ; s hexagonal , rectangular , square or other shaped receptacle 20 . the other plate 27 carries a central wire guide member 32 which extends into one side of the cutting aperture of the cutting head 24 to form a support against which the cutting action takes place . the hole in the central wire guide member 32 through which the wire is inserted may be round , or may have inside corners in order to aid in locating the wire to be cut . the axis of this hole is radially offset towards the cutting blades 61 in order to provide a wire end supporting surface which positions the axis of the wire to be cut in axial alignment with the wire stripper 10 . the yoke 30 has threadably inserted through the hexagonal , rectangular , square or other shaped projection 22 an adjustable threaded stop 34 which may be adjusted to limit the distance the wire end can be inserted into the cutting head 24 . a counterbalance weight 52 and standoffs 31 , 31 &# 39 ; are secured to the plates 27 and 28 by screws . mounted between the plates 27 and 28 is a cutting blade carrier block assembly 36 which can be seen in more detail in fig4 a and 5b . the carrier block assembly 36 includes a generally central rectangular opening 42 which surrounds the wire cutting operational area and allows the wire end from outside of the stripper 10 to be inserted to contact the stop 34 when the device is not energized . a blade clamping and mounting block 38 is fashioned on one side of the opening 42 and a centrifugal weight 40 is mounted by bolts on the opposite side . the block 38 can carry anywhere from one to four blades , as desired , and has a series of support and clamping devices as shown in fig5 a and 5b and as will be described in detail in connection therewith . the assembly 36 is pivotally mounted by a pin 104 between the plates 27 and 28 in the cutting head 24 and is spring - biased to the position shown in fig5 b by a spring 44 . a stop formed by the standoff 31 &# 39 ;, as may be seen in fig5 a , is provided to limit the movement of the cutting blade carrier block assembly 36 . referring now to fig4 a and 5b , there is shown a cutting block assembly 36 . the blade clamping and mounting end 38 has one or more cutting blades 61 mounted in slots 60 and located at one end by stop screws 50 . parallel and offset walls 100 , 101 in blade clamping and mounting end 38 interact with angled ends of cutting blades 61 to allow cutting blades 61 to slide to different radial locations upon turning stop screws 50 . a resilient material 105 , such as closed cell silicon foam , is provided at an end of blades 61 opposite stop screws 50 to hold blades in place against stop screws 50 . the blades 61 are accurately positioned in the slots 60 by stop screws 50 , resulting in the precise position of the cutting blades to permit slitting to the exact desired depth . precise depth of cut is extremely important in coaxial cables for data transmission and similar uses as described above . a first blade 61 may be fixed to cut through the insulation and shielding layers of the wire end to form cut 76 in the wire end without nicking the center conductor 78 ( fig6 and 7 ). a second blade 61 adjacent to first blade 61 is positioned to make cut 80 which leaves the inner insulation layer 81 intact , but cuts the shield 82 and outer covering 84 . a third blade 61 can cut only the outer covering 84 at 86 to expose the shield 82 . it will be understood that each blade 61 will be set to cut to the desired depth and the spacing between the blades will be set for the particular wire end termination desired . referring now to fig5 b , the cutter blade carrier block 36 is shown in the de - energized position with clear access for the wire end to be inserted through the cutting head 24 in supporting alignment in wire guide 32 to abut adjustable stop 34 . the blade assembly is spring urged into the position shown in fig5 b by the spring 44 as previously described . this position is limited by the abutting of the outside of cutter blade carrier block 36 against the radially inner surface of counterbalance weight 52 . this position is not critical , as long as the cutting blades 61 are withdrawn from the opening in guide 32 . counter - balance weight 52 is chosen to counter - balance the centrifugal weight 40 when the head 24 is rotated to cause the cutting blades 61 to move to the full cutting position shown in fig5 a , to cut the insulation and shielding of the wire end . when being rotated , the cutting blades 61 are in the position shown in fig5 a as the carrier block 36 has been moved to the other end of its pivotal motion by the centrifugal force of rotation . the centrifugal weight 40 , in response to rotation of the cutting head , causes the cutting block assembly 36 to move to the position of fig5 a , forcing the cutting blades 61 through the slots 103 in a central sleeve 106 of guide 32 and into the various layers of covering of the wire end . the stop formed by the standoff 31 &# 39 ; is positioned to limit the penetration of the cutting blades 61 in the guide 32 , to make an annular slit around the wire to the desired depth for cutting the various layers of insulation and shielding for later removal without nicking or damaging the next inner layer . in operation , a wire end is inserted into the device through the cover 14 until the wire end abuts the stop screw 34 . at this point the switch 12 is actuated and the cutting head 24 is rotated which , as previously described causes the centrifugal weight 40 to pull the cutting blades 61 into cutting contact with the insulation and shielding layers of the wire end . this results in a series of annular slits being cut in the wire end as may be seen in fig6 which slits sever the various layers to the desired depth . the switch 12 is deactivated and after the rotation stops , the wire end is removed . when rotation of cutting head 24 stops , the spring 44 retracts the cutting blades 61 from the insulation and this allows the wire end to be removed without attempting to pull off the cut &# 34 ; slugs &# 34 ; which might damage the cutting blades or become jammed between the cutting blades , causing problems in the next cutting operation . after the wire end is withdrawn from the cutting head , the slit layers of insulation and shielding can be easily removed by hand or by another device to prepare the wire end for termination . the present invention provides a very fast , accurate and precise cutting head for slitting insulation and shielding layers about a wire end to a precise depth to permit stripping thereof in preparation for termination in a connector device . while the invention has been described in the specification and illustrated in the drawings with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements of the invention without departing from the scope of the claims .	7
given the above context , the system and method of the present invention for guiding next step adaptive behavior rests on several fundamental assumptions of human nature . ( 1 ) personal truths lie within each individual . ( 2 ) individuals by nature wish to express these truths . ( 3 ) individuals can express these truths through projection , an exercise in which subconscious thoughts and feelings can be expressed in response to ambiguous stimuli like a shadow or an inkblot . ( 4 ) when individuals discover previously unappreciated subconscious truths , ‘ aha !’ insight is generated and with it new energy to inspire and motivate next step adaptive behavior . ( 5 ) this ‘ heart of the matter ’ information is more valuable in guiding next step adaptive behavior than ‘ top of mind ’ information more familiar to consciousness . and ( 6 ), the phenomenological and structural nature of the emotion at the ‘ heart of the matter ’ can be deconstructed to provide specific guidance to inspire and motivate the next step to take with regard to any topic presented as ‘ how does any topic make you feel ?’ the system and method of the present invention for guiding next step adaptive behavior is grounded in clarified emotional responses expressed by the individual . such clarified emotional responses can be generated in the manner described in u . s . pat . no . 4 , 931 , 934 , the teachings of which are incorporated herein by reference . referring now to fig1 , the clarified emotional response data is derived in step 12 , and in steps 14 and 16 such data is displayed on a polar graph 100 as shown in fig2 and fig3 . this polar graph 100 is demarcated in clarified intensities ranging from 0 at the center 102 to 20 at the outmost concentric circle 104 on the grid . in the graph of fig2 , the circular demarcation lines are not shown , but would be identical to the circular demarcation lines 106 shown in fig3 . each demarcation line represents two data points so that clarified emotions will range from 0 to 20 . clarified emotion values that are negative numerical values are graphed in the region of opposite emotion . for example , a clarified intensity of 5 for the emotional response secure is displayed one quarter of the way from the center to the perimeter of the polar graph in the area for secure . on the other hand , if the clarified intensity for secure is − 5 , then the data point would be displayed one quarter of the way from the center to the perimeter of the polar graph in the area for insecure . when the baseline intensity of a clarified emotion is 0 or a negative number ( meaning the baseline intensity recorded for that emotional response was between 0 and − 10 ), the data point is operationally defined as a subconscious response ( meaning less biased , more unique and more subconscious than the conscious responses described below ). when the baseline is equal to or exceeds the response intensity then the data point is operationally defined as a predisposition response ( overwhelmingly biased , not at all unique , not at all subconscious ). all other data points that are in between are operationally defined as conscious responses ( meaning more biased , less unique and more conscious than the subconscious responses described above ). that a conscious emotional response is operationally defined and found to be more biased , less unique , and more conscious than a subconscious response means that whatever the clarified intensity of the conscious response ( a positive number ), it is partly contributed to by a positive ( biasing , familiar - to - consciousness - though - irrelevant ) baseline intensity . on the other hand , a subconscious emotional response is always operationally defined by a 0 or negative baseline intensity , meaning that the response is not biased ( the emotion does not show up as net positive in the timed graph determination of baseline intensity ). radial placement of the data points is determined according to a model that utilizes all the emotion words representing feelings in a language . over 4000 emotion words exist in the english language . the model is four dimensional . while the polar graph is two dimensional on paper , its 32 labels represent 4 dimensions that are structurally embedded in the 2 dimensions . a given emotional word is either pleasant or unpleasant , outwardly directed or inwardly directed , actively committing or passively assessing , and finally passionate ( sublime or extreme ) or dispassionate ( common or mundane ). for example , in the 8 channel emotion area motivated , the sublime emotion represented is joyful , the extreme emotion represented is proud , the common emotion represented is confident , and the mundane emotion represented is energized . for their opposite negative emotions , in the 8 channel emotion area depressed , the sublime emotion represented is sorrowful , the extreme emotion represented is embarrassed , the common emotion represented is depressed , and the mundane emotion represented is tired . sublime emotions typically relate to experiencing something , extreme emotions typically relate to leading something , common emotions typically relate to sharing something , and mundane emotions typically relate to valuing something . as a result , the 8 channel model shown in fig2 can be further divided into 32 dimensions or channels of emotion shown in fig3 . the 8 channel model of emotional data is generally displayed first because its 8 summarizing labels — impressed , helpful , motivated , contented , fearful , rejecting , uneasy , depressed — are simplified and popular enough for the individual to most easily begin to recognize his or her story in the portrayed data . in view of the fact that engagement and transformation of the individual is all important in the method and system of the present invention , this step of presenting a visual display of emotional results in these simplified channels is the best way to ensure and help the individual transition , perhaps , from common fear , cynicism , skepticism and doubt regarding the results to curiosity , intrigue , openness , mirth , insight and imagination regarding the implications of the results for next step adaptive behavior . the individual &# 39 ; s data points are also displayed in the more fully dimensionalized 32 channel model shown in fig3 . the emotion labels of the 32 channels enable more precise recognition of the individual &# 39 ; s personal story . the more refined information conveys detail where previously existed only overwhelming complexity . of greater importance , the 32 channel model establishes the basis for the guidance described below that are at the core of the system and method of the present invention . the placement of emotion words in the emotion model behind the polar graph was done intuitively based on extension of the classical , academic , and scientific work that has preceded this model . it is certainly possible to alter the labels shown in fig2 and 3 , but the model itself would not change . the model that serves as the output grid for this system and method is programmed to recognize any recognizable emotional response and record it in the appropriate area of the model . if a response word is not recognized by the model — the emotion word is misspelled , or the word is not an emotion word , or the response is a phrase made up of two or more words , or the word is an emotion word not yet programmed into the model — then the respondent can re - type or go to a visual tree of the most common emotion words to find the emotion word that most closely captures the feeling felt . work on the structural phenomenology of emotion can be traced from classical times when it was reasoned there are 7 basic emotions in human nature : fear , greed , envy , happy , anger , sorrow , and surprise . in 1986 ekman ( a new pan cultural facial expression of emotion , motivation and emotion , 10 ( 2 )) confirmed the universality of these classical emotions in finding that the facial depiction of these emotions could be recognized to represent the same feelings in many cultures around the globe . elaboration of the structural phenomenology of emotions began with mehrabian and russell in 1974 ( an approach to environmental psychology , cambridge mass ., mit press ), and continued with contributions , developments , and refinements offered by derivera in 1977 ( a structural theory of the emotions , new york , international universities press ), plutchik in 1980 ( emotion : a psycho - evolutionary synthesis , new york , harper & amp ; row ), and holbrook and o &# 39 ; shaughnessy in 1984 ( the role of emotion in advertising , psychology and marketing , 1 ( 2 )). the latter groups reported validations of three - dimensional versions of the model by semantic differential and real world advertising assessment methodologies , respectively . one example of how the overall model is constructed is the following : calm , relaxed and peaceful might be emotional responses expressed by three different people . however , all three emotions are phenomenologically identical in the structural model of emotion embedded in this system and method . that is , all three emotions are pleasant , all are in the 8 channel model area labeled contented , and all are in the 32 channel model area labeled serene . in each 8 channel model area there are four 32 channel model areas . for example , in the 8 channel model area contented , serene is phenomenologically and structurally coupled with worthy , contented and secure . it is the 32 channel model that provides the necessary and sufficient differentiation required to produce actionable value in population segment and organizational group applications , and the same is expected to be true for individual applications addressed by this system and method . in step 18 , the subconscious clarified intensities associated with the 6 to 8 emotional responses in an individual &# 39 ; s response profile are ranked and displayed high to low . once this is completed , only the subconscious data points are processed ( or only the conscious data points if there happen to be no operationally defined subconscious data points present ) to identify and highlight the ‘ heart of the matter ’ in step 20 . as described above , the ‘ heart of the matter ’ is comprised of one or more emotional responses above the highest threshold established in the manner described below to separate the most salient , least biased , most unique , most subconscious ( even if derived from only conscious data points ) emotional responses the individual has expressed to the question ‘ how does any topic make you feel ?’ the system and method of the present invention work on the range of possible clarified intensities 20 to − 9 described in u . s . pat . no . 4 , 931 , 934 issued to snyder . 1 or 2 or 3 ( or up to 8 ) actual clarified intensity numbers are used in order to highlight the ‘ heart of the matter ’. the threshold for the ‘ heart of the matter ’ is established by mathematically identifying the top number or numbers that also represent the smallest set that can be separated from the remaining numbers to which the process is applied . the purpose is to mathematically and visually provide the strongest , simplest evidence to make the most compelling case to the individual respondent that the ‘ heart of the matter ’ is the most unappreciated but recognizable emotional core of his or her response to ‘ how does any topic make you feel ?’ and is the necessary and sufficient core of information to focus on to inspire and motivate next step adaptive behavior . referring to fig5 , the system and method determine the ‘ heart of the matter ’ from a set of n clarified intensities , sorted from highest to lowest in step 30 . in step 32 , the system and method determine the value x , between 1 and n − 1 , that best indicates how many of the n intensities should be considered part of the ‘ heart of the matter ’. 1 . for each possible value of x , a “ quality value ” is calculated in step 34 as shown below . the lower the quality value , the better . 2 . the value or values of x that have the best ( minimum ) quality value are then identified in step 36 . 3 . if it is determined in step 38 that there is a single value of x attaining the best quality value , then that value is retained in step 40 . 4 . in the case of a tie ( multiple values of x attaining the best quality value ): a . sort the tied values in step 42 from lowest to highest to find the lowest and highest value of x that attain the best quality value (“ lowest tie ” and “ highest tie ”) b . searching from lowest tie to highest tie , return the first value that does not separate two identical clarified intensities in step 44 , i . e ., the first value x between lowest tie and highest tie such that ci ( x ) is not equal to ci ( x + 1 ). c . if there is no such value , return the highest tie . given ci i for 1 between 1 and n define for given x between 1 and n − 1 quality value ( x )= q hi −( s hi 2 / n )+ q lo −( s lo 2 /( n − x )), where s is the sum of the clarified intensities above and below the candidate dividing line and q is the sum of the standard deviations above and below the candidate dividing line . the position of the candidate dividing line = x . an example of the derivation of the ‘ heart of the matter ’ will further aid in the understanding of the present invention . if an individual &# 39 ; s response profile includes clarified intensities represented by subconscious numbers 20 , 18 , 14 and conscious numbers 12 , 11 , 6 , 3 , 2 , then 20 and 18 are identified as the ‘ heart of the matter ’. on the other hand , in the special case with a response profile of only conscious numbers 6 , 5 , 4 , 3 , 2 , 1 , then 6 is identified as the ‘ heart of the matter ’. in the infrequent case where a subconscious number is exceeded by a conscious number , preference is given to the subconscious number in identifying the ‘ heart of the matter ’. referring to fig4 , after the ‘ heart of the matter ’ is determined , it is shown to the user and highlighted ( in color or otherwise ) with the entire dataset shown in table 62 and graph 64 ( see table below ): original feeling , designated perception ( subconscious , conscious or predisposition ), response intensity ( ri ) ( 1 to 10 ), baseline intensity ( bi ) (− 10 to 10 ), clarified intensity ( ci ) (− 9 to 20 ), final emotion word ( sometimes the same as the original feeling ), and association phrase . the ‘ heart of the matter ’ is composed of at least one , often two , sometimes three , or rarely even more ( even up to all eight ) rows of data . it is the ‘ heart of the matter ’ that is now meant to consume essentially all of the individual &# 39 ; s attention to generate insight ( s ) to inspire and motivate next step adaptive behavior . after the dataset is shown to the individual , the individual is invited to assess and rate the value of the personal insight ( the size of the ‘ aha !’) generated by the ‘ heart of the matter ’ in box 60 . this rating is especially made in comparing the information at the bottom of the ranking which typically represents more biased , conscious , familiar , commonplace , rational , top of mind information . this assessment uses a simple 5 point likert scale such as : 1 not at all valuable , 2 somewhat valuable , 3 valuable , 4 very valuable , or 5 extremely valuable . making this assessment serves as another step in engaging and transforming the individual , that is , opening and preparing the individual &# 39 ; s conscious self for the behavioral guidance , emotional preparedness , and social readiness soon to be a realized and acted upon in an adaptive matter . after the individual allows the first wave of insight to settle around the identification , discovery , and evaluation ( and perhaps already emerging implications ) of the ‘ heart of the matter ’, the individual is presented the option to click to reveal the directional guidance pertaining to each emotion and row of data in the highlighted ‘ heart of the matter ’. directional guidance is based on the structural model of emotions previously described . phenomenological deconstruction of the structural model of emotions permits the positing of automated word labels which are universal , fundamental , simple and recognizable enough to be helpful as directional guidance in this system and method . a directional guidance label is assigned to each of the 32 channels and pertains for all of the emotions in each of the 32 channels . if a pleasant emotion is at the ‘ heart of the matter ’, then the next step in adaptive behavior is to ‘ do ’ something . if an unpleasant emotion is at the ‘ heart of the matter ’, then the next step in adaptive behavior is to ‘ stop doing ’ something . if an outward directed emotion is at the ‘ heart of the matter ’, then the next step in adaptive behavior is to do something in relation to an external person , thing , or event . if an inward directed emotion is at the ‘ heart of the matter ’, then the next step in adaptive behavior is to do something in relation to one &# 39 ; s internal condition . if an actively committing emotion is at the ‘ heart of the matter ’, then the next step in adaptive behavior is to do something that amounts to committing to new behavior . if a passively assessing emotion is at the ‘ heart of the matter ’, then the next step in adaptive behavior is to do something that amounts to further reflection . finally , if a sublime emotion is at the ‘ heart of the matter ’, then the next step in adaptive behavior is to do something ‘ sublime as in experiencing something ’. if an extreme emotion is at the ‘ heart of the matter ’, then the next step in adaptive behavior is to do something ‘ extreme as in leading something ’. if a common emotion is at the ‘ heart of the matter ’, then the next step in adaptive behavior is to do something ‘ common as in sharing something ’. if a mundane emotion is at the ‘ heart of the matter ’, then the next step in adaptive behavior is to do something ‘ mundane as in valuing something ’. for example , a final emotion word that is pleasant , outward directed , actively committing , and extreme dictates that the guidance sentence is ‘ do something outward that is active and extreme as in leading something ’. on the other hand , a final emotion word that is unpleasant , inward directed , actively committed , and common dictates that the guidance sentence is ‘ stop doing something inward that is active and common as in sharing something ’. the guidance sentence ( s ) is ( are ) offered to stimulate specific insight ( s ) into what next adaptive step to take with regard to the topic . because the terms in the guidance sentences are necessarily automated , universal , fundamental , simple and only , perhaps , recognizable enough , practical definitions and descriptions of how to think about and use these terms are provided as popup help . for example , if the individual were to click on outward in the above example , then the following popup message would appear : ‘ outward refers to doing something outward directed , like considering the world of people , things and events going on around you ’. similarly , for inward , ‘ inward refers to doing something inward directed , like considering the condition of your mind , heart and body going on within you ’. likewise , for active , ‘ active refers to doing something actively committing , like considering becoming more actively involved in something than you are at present ’. similarly , for passive , ‘ passive refers to doing something passively assessing , like considering being more thoughtful and reflective before becoming more involved with or in something ’. again likewise , ‘ sublime as in experiencing something refers to doing something sublime , like considering the overall quality of an experience ’. similarly , ‘ extreme as in leading something refers to doing something extreme , like considering taking the lead in advancing a cause ’. similarly , ‘ common as in sharing something refers to doing something common , like considering what you have in common with other people ’. finally , similarly , ‘ mundane as in valuing something refers to doing something mundane , like considering the emotional resources you value and have available ’. as automated and formalized as the directional guidance needs to be , it is important to realize the labels , words , and explanations offered are generalizations at best and therefore are not expected to speak to , and be helpful to , all individuals in all circumstances at all times . to crystallize and memorialize the beneficial outcome of the present system and method , the individual is lastly provided a limited space to type his or her imagined next step pertaining to each emotion in the highlighted ‘ heart of the matter ’. because this activity can spawn additional thoughts , ideas , insights , implications , and action possibilities which are personally valuable to record , expandable space is provided to type these additional reflections . with perhaps the entire sequence of fear , cynicism , skepticism , doubt , curiosity , intrigue , openness , mirth , insight , and imagination traversed , the individual can click ‘ save ’ to save his or her next step and additional reflection information . this information can later be reviewed for purposes of further insight generation , self understanding , decision making , action taking , and personal development . while the foregoing invention has been described with reference to its preferred embodiments , various alterations and modifications will occur to those skilled in the art . all such variations and modifications are intended to fall within the scope of the appended claims .	6
to avoid the cross - contamination failure problem of the prior multi - point flame sense circuit without increasing the cost significantly over the prior circuit , the circuit of fig5 was developed . as will be described below , this circuit is immune from cross - contamination of a failure of one of the flame sense electrodes . that is , while a failure of a flame sense electrode for a particular burner will not allow that burner to operate , other burners within the system whose flame sense electrodes are not failed will be able to continue to operate properly . that is , their flame sense electrodes will continue to properly sense flame when present so that the electronic controller will operate those burners and their associated spark electrodes and gas solenoids correctly . this circuit will also greatly reduce the amount of time required to diagnose and repair a failure of one of the flame sense electrodes since the failure will be detected when the burner associated with that failed electrode is operated . in this way the field personnel will be able to immediately inspect the electrode of the suspect burner with confidence that a latent failure located elsewhere in the system could not have caused the field problem . this greatly reduces the amount of time required for the service personnel , especially considering that the burners and their associated flame sense electrodes are physically located in different areas of the oven compartment . this reduces the overall cost of ownership and increases the customer satisfaction . turning now to the fault - resistant multi - point flame sense circuit of the present invention illustrated in fig5 it can be seen that , from a total part count point of view , this fault tolerant circuit adds only two passive components to the number of parts required by the flame circuit of fig1 which is subject to the cross - contamination failure problem . as such , its slight increase in cost over the prior circuit is far out weighed by the reduce service time and increased overall reliability provided by this circuit . it should be noted that while this circuit of fig5 illustrates the usage of only two flame sense electrodes 150 , 152 , one skilled in the art will recognize that multiple flame sense electrodes may be included in this circuit as required by the particular installation into which it is to be used with appropriate balancing of component values . in this improved circuit of fig5 the line input l 1 is coupled to each of the flame sense electrodes 150 , 152 through different channels . the channel for flame electrode 150 utilizes capacitor 154 , resistor 158 , and is coupled through resistor 169 to the gate 170 of jfet 172 through resistor 164 . for flame sense electrode 152 , the channel includes capacitor 156 , resistor 160 , and is coupled through resistor 169 to the gate 170 of jfet 172 through resistor 162 . this resistor 169 is also coupled to an rc network ( including capacitor 166 and resistor 168 ) to ground . the source 176 of jfet 172 is also coupled to ground , and the drain is coupled through resistor 174 to a 5 volt supply . as may be apparent from this description , additional flame sense electrodes may be added to this circuit by providing a capacitive coupling to source l 1 and a resistive coupling to the resistor 169 and the gate 170 of jfet 172 . as may also be apparent from this fig5 operation of this circuit with no flame present at any of these sensed burners results in jfet 172 remaining in its conducting state allowing current to flow therethrough . that is , the forward and reverse current flow during each of the positive and negative half cycles of source l 1 flows equally through capacitors 154 and 156 and resistors 162 and 164 to the node coupled to the resistor 169 and gate 170 , and through the rc network 168 , 166 to ground . as a result of this equal forward and reverse current flow , a sufficient negative charge cannot develop across capacitor 166 to pinch off jfet 172 . as a result , the jfet 172 remains conducting and the electronic controller ( not shown ) senses a flame off or no - flame condition . during a normal flame sense condition , the flame sense circuit of the present invention may be represented as illustrated in fig6 . in this fig6 the flame is represented as resistor 124 and diode 126 coupling the flame sense electrode 150 to ground . current flow during the positive cycle of source l 1 will flow primarily through the resistor 158 , flame sense electrode 150 , and flame ( represented by resistor 124 and diode 126 ) to ground . while positive current will also flow through the rc network 166 , 168 , this current will be small as a result of the relative sizing of resistor 158 and 164 . during the negative half cycle of source l 1 , current flow through flame sense electrode 150 is precluded by the rectification effect of the flame sensed thereby . as a result , all of the reverse current flow during the negative half cycle of source l 1 is forced to flow through the rc network 166 , 168 and is then divided equally between the paths including resistor 162 and capacitor 156 and the path including resistor 164 and capacitor 154 to source l 1 . since the proportion of current flow through rc network 166 , 168 during the negative half cycle is much greater than that flowing in the opposite direction during the positive half cycle , a net negative charge develops across capacitor 166 . this net negative charge is applied to gate 170 of jfet 172 , which pinches off the jfet 172 halting current flow therethrough . the electronic controller then senses that the jfet 172 has turned off , and processes this information as a flame present condition . if a latent failure exists with one of the other flame sense electrodes as illustrated by the circuit of fig7 as a short 128 from the flame sense electrode 152 to ground , the ability of the other flame sense electrodes to properly sense the presence of flame at their associated burners is not affected . of course , the faulted flame sense electrode 152 will not be able to sense the presence of flame as a result of the short 128 . as a result , the electronic controller will not allow that associated burner to operate for safety reasons , and will properly log a failure with regard to that burner . operation of this circuit with a flame sensed at flame sense electrode 150 and with a failure 128 on an unassociated flame sense electrode 152 during the positive half cycle of source l 1 proceeds in much the same way as the unfaulted circuit in fig6 . that is , only a very small portion of the current from source l 1 is allowed to flow through the rc network 166 , 168 during this positive half cycle . the majority of the current during this positive half cycle flows instead through the two flame sense electrode branches . while more of the current flows through the faulted flame sense electrode 152 due to the short 128 , as opposed to the presence of the flame represented by resistor 124 and diode 126 , the effect from the standpoint of the rc network is nearly the same , i . e . not much positive current flows therethrough during the positive half cycle . operation of the fault - tolerant multi - point flame sense circuit of the present invention during the negative half cycle of source l 1 with a failure of an unassociated flame sense electrode 152 varies significantly from the prior multi - point flame sense circuit discussed above . specifically , while current is allowed to flow through the short circuit 128 of flame electrode 152 during the negative half cycle of source l 1 , a net negative charge across capacitor 166 is still generated sufficient to pinch off the current flow through jfet 172 . this allows the electronic controller to sense a flame condition at flame sense electrode 150 . during this negative half cycle of source l 1 , the circuit of fig7 may be redrawn as illustrated in fig8 to simplify the understanding of the operation of this circuit . during the negative half cycle of source l 1 , the current will flow from ground through the short 128 of flame sense electrode 152 and its associated resistor 160 through capacitor 156 to source l 1 . current will also flow from ground through the rc network 166 , 168 through resistor 162 and capacitor 156 to l 1 . however , current is also allowed to flow through the channel associated with the flame sense electrode 150 , that is through resistor 164 and capacitor 154 to source l 1 . as may be seen from a comparison of this fig8 with the prior circuit illustrated in fig4 the addition of the extra channel for current flow during the negative half cycle ( resistor 164 , capacitor 154 ) allows a sufficient negative charge to be developed across capacitor 166 as coupled to gate 170 so that the jfet 172 may still be pinched off , halting current flow therethrough . the electronic controller ( not shown ) will detect this as a flame present condition , which is proper because of the flame present at flame sense electrode 150 . if no flame were present at this flame sense electrode 150 , there would not be the unbalance current flow through the rc network 166 , 168 that will result in a net negative charge being developed across capacitor 166 sufficient to pinch off jfet 172 . only when the flame is present and current is allowed to flow through the associated unfaulted flame sense electrode 150 does this current flow unbalance result in the development of a charge sufficient to pinch off the switch 172 . in one embodiment of the present invention , the circuit is balanced as follows : capacitors 154 and 156 are 0 . 01 microfarads , resisters 158 and 160 are 1 . 0 megaohms , resistors 162 , 164 , and 169 are 4 . 7 megaohms , resistor 168 is 22 megaohms , and capacitor 166 is 0 . 1 microfarads . preferably , the ratios of resistor 158 to resistor 162 , and of resistor 160 to resistor 164 are equal and a minimum of ¼ to 1 . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context .	8
as a preliminary matter , it will readily be understood by one having ordinary skill in the relevant art (“ ordinary artisan ”) that the present invention has broad utility and application . as should be understood , any embodiment may incorporate only one or a plurality of the above - disclosed aspects of the invention and may further incorporate only one or a plurality of the above - disclosed features . furthermore , any embodiment discussed and identified as being “ preferred ” is considered to be part of a best mode contemplated for carrying out the present invention . other embodiments also may be discussed for additional illustrative purposes in providing a full and enabling disclosure of the present invention . as should be understood , any embodiment may incorporate only one or a plurality of the above - disclosed aspects of the invention and may further incorporate only one or a plurality of the above - disclosed features . moreover , many embodiments , such as adaptations , variations , modifications , and equivalent arrangements , will be implicitly disclosed by the embodiments described herein and fall within the scope of the present invention . accordingly , while the present invention is described herein in detail in relation to one or more embodiments , it is to be understood that this disclosure is illustrative and exemplary of the present invention , and is made merely for the purposes of providing a full and enabling disclosure of the present invention . the detailed disclosure herein of one or more embodiments is not intended , nor is to be construed , to limit the scope of patent protection afforded the present invention , which scope is to be defined by the claims and the equivalents thereof . it is not intended that the scope of patent protection afforded the present invention be defined by reading into any claim a limitation found herein that does not explicitly appear in the claim itself . a disclosed solar power unit may be used in many situations . as a stand alone unit , the solar power unit may be a portable power source used to power an electronic device or charge a battery . the solar power unit may also be integrated into a building structure , for example , a residential deck or exterior wall , a commercial building exterior wall , or public structure , such as a cinderblock wall in a park or public club house , for generating a renewable power source . fig1 is an example illustration of an implementation of a disclosed solar power unit 100 . the solar power unit 100 comprises a solar panel 102 , a frame 103 and a front cover 101 . the solar panel 102 , for example , a photovoltaic panel , converts the sun &# 39 ; s solar energy to an electric signal , e . g ., a direct current ( dc ) power signal . in a preferred implementation , the solar panel 102 is supported in place within the front cover 101 , preferably by slots or grooves on the rear of the front cover 101 that prevent the solar panel 102 from moving . once the solar panel 102 is held within the front cover 101 , the front cover 101 is be attached to the frame 103 preferably using screws , but any means of attaching the front cover 101 to the frame 103 can be used . the front cover 101 preferably may be removed and re - attached as required . example illustrations of the frame 103 and front cover 101 are shown in fig4 and 5 . referring to fig5 , the front cover 101 includes a panel opening 106 for allowing the solar panel 102 to receive the solar energy from the sun while the solar panel 102 and front cover 101 are attached to the frame 103 . in a preferred solar power unit 100 , the front cover 101 further includes a front cover output opening 105 for receiving a power output device 104 , for example an electrical outlet , usb port , etc . the frame 103 includes a front panel 131 , a left and right side panel 132 , a top panel 133 and a bottom panel 134 . the front panel 131 includes an access opening 111 to allow a component , for example a charge controller , inverter , or power output device , to be coupled to the output of the solar panel 102 , to be disclosed in greater detail below . in a preferred implementation , the front panel 131 further includes at least one power output device opening 136 for providing an opening to insert a power output device , wherein one of the at least one front panel output device openings 136 is lined up with the front cover output opening 105 . the left and right side panels 132 are attached to the left and right edges of the front panel 131 . in accordance with the disclosed solar power unit 100 , the right and left side panels 132 are shaped such that when attached to the front panel 131 , the front panel 131 is positioned at an angle relative to the ground . the angle at which the front panel 131 is situated preferably depends upon the angle best suited to allow the solar panel 102 to receive as much of the sun &# 39 ; s solar energy as possible , i . e ., receive the most direct sun light for the longest period of time during the day . those having skill in the art know that differing locations require different angles due to the sun &# 39 ; s positioning in the sky over that location . this angle is referred to as the tilt angle . the top panel 133 is attached to the top edges of the front panel 131 and the right and left panels 132 such that the top panel 133 is parallel to the ground . preferably , the top panel 133 is a flat piece of material that extends beyond the back edge of the right and left side panels 132 . in a preferred implementation of the solar power unit 100 , the top panel 133 is perforated , illustrated in fig2 , to be disclosed below . alternatively , the material of the top panel 133 that extends beyond the back edge of the right and left side panels 132 may be bent upwards 90 °, for example , such that the solar power unit 100 may be attached to an existing building structure , as illustrated in fig3 , to be disclosed in further detail below . referring back to fig5 , the bottom panel 134 is attached to the bottom edges of the front panel 131 and the left and right panels 132 . in accordance with the disclosed solar power unit 100 , and it alternatives , the bottom panel 134 is similar to the top panel 133 . an example illustration of how the frame 103 of the disclosed solar power unit 100 may be fabricated is shown in fig6 . a flat panel made of any type of material for the frame and front cover may be used . in accordance with the disclosed solar power unit , the material of the frame and front cover is sheet metal , but other materials may be used , for example , plastic . a stencil of the frame and front cover are set on the flat panel and cut out . once the frame and front cover are cut from the flat panel , the flat frame and flat front covers are cut and folded along the specified lines to form the frame and front cover used in the solar power unit . as stated above , the power signal generated by the solar panel may be coupled to a power component that utilizes the output power signal . fig7 illustrates an example power component 710 included in the solar power unit 700 . as a standalone solar power unit 700 , the solar panel ( not shown ) may be coupled to the power component 710 , which includes an inverter 716 . the inverter 716 converts the received dc power signal from the solar panel to an ac power signal . in this implementation , a power outlet 704 is coupled to the power component 710 . when an electronic device is plugged into the solar power unit 700 , the generated ac power signal is used to power the electronic device . in this implementation of the disclosed solar power unit 700 , the power component 710 further includes a charge controller 719 and a battery 711 . the charge controller 719 , coupled to the solar panel 702 and the battery 711 , receives the dc power signal generated by the solar panel 702 and forwards the dc power signal to the battery 711 . the battery 711 then stores the dc power received for later use or forwards the signal to the inverter 716 when the power output device 704 is being used . the charge controller 719 , as those having skill in the art know , also regulates the charging of the battery 711 to prevent over charging when the power generated by the solar power unit 700 is not being used by a device or other power sink . the battery 711 , coupled to the charge controller 719 and the inverter 716 , stores the dc power generated by the solar power panel and forwards the stored dc power signal to the inverter 716 . as disclosed above , the inverter 716 then converts the stored dc power signal to an ac power signal when the power output device 704 is being used . although this implementation of the power component is disclosed as including a battery , charge controller and inverter , if should be noted that the power component may only include a battery or an inverter , with or without the other . the power component 710 is preferably secured within the frame 703 of a standalone unit 700 by a back panel , not illustrated . alternatively , the power component 710 may float within the frame 703 . as a standalone unit , the disclosed solar power unit may be used as a power source anywhere . with or without a power outlet , a device or battery may be coupled directly to the solar panel of the solar power unit through the back access opening of the frame and operated accordingly . in an alternative implementation of the disclosed solar power unit , the solar power unit may be integrated into an existing wall or building structure , or included in a new building structure as it is being built . for example , the solar power unit may be integrated into an existing exterior wall or other building or landscape structure , wherein the wall may be made up of building blocks . the building blocks may be made of any building material used for this purpose , for example , concrete , stone blocks , bricks , etc . for purposes of this disclosure , the building blocks are cinder blocks . as illustrated in fig9 , the frame 803 is fabricated to fit over the cinder block 807 . accordingly , the solar power unit 800 may be slid over a cinder block and used in a pre - existing or newly built wall . fig8 illustrates an example method of integrating the disclosed solar power unit 800 with a cinder block 807 . in accordance with this disclosed implementation , the frame 803 and the front cover 801 are designed to fit over a cinder block 807 . the top and bottom panels 809 , 808 are flat and preferably include perforations . the solar power unit 800 also includes a battery and inverter , not shown . a power output source 804 is coupled to the inverter , receives the ac power signal from the inverter , and provides power to a device coupled to the power output source 804 , e . g ., an electronic device . in an implementation , the solar power unit 800 may be installed by sliding the frame 803 , including the solar panel 802 and front cover 801 , over the cinder block 807 such that the top and bottom panels 809 , 808 are covering a portion of the top and bottom of the cinder block 807 . in accordance with this implementation , the battery and inverter are situated within the frame 803 such that when the cinder block 807 is slid into the frame 803 , the battery and inverter are housed freely between the front panel ( not shown ) and the front of the cinder block 807 . alternatively , a back panel may be included in the frame 803 such that the top and bottom panels 809 , 808 hang over the back panel and the cinder block 807 slides against the back panel . as disclosed , the top and bottom panels 809 , 808 are perforated such that when cinder blocks are placed above and below the integrated solar power unit 800 , the bonding material used to build the wall , i . e ., mortar , may still bond with the cinder block 807 while within the frame 803 . an example illustration of this disclosed implementation is shown in fig1 . this implementation of the solar power unit may also be integrated into an existing wall wherein the frame of the solar power unit is slid into cutouts in the existing building structure , such as an exterior concrete wall . an example illustration of this implementation can be seen in fig1 . further , the alternative solar power unit illustrated in fig3 may be installed on a preexisting wall as well . in accordance with this implementation , the top and bottom panels are bent to allow the solar power unit to be attached to a building structure . in fig1 , the building structure is a pre - existing cinder block wall . once attached to the wall , the power output source 1104 may be used to power an electronic device . referring to fig1 , a cross - sectional view of the solar power unit illustrated in fig1 , it is preferable that the solar power unit 1100 includes a battery 1111 and inverter 1116 , as described above . as illustrated in fig1 , the solar power unit 1100 may be attached to the existing wall using screws 1190 . accordingly , the screws 1190 are drilled through the top 1133 and bottom 1134 panels and into the mortar 1127 between each cinder block 1126 . although , screws have been disclosed as the manner for attaching the alternative solar power unit to an existing wall , other means know to those having skill in the art may be used , e . g ., an adhesive glue or tape . in another disclosed implementation , a plurality of solar power units are included in a solar power system , as illustrated in fig1 . as illustrated , solar power system 1500 comprises a plurality of solar power units 1510 1 . . . 1510 n . the solar power system 1500 may provide power to the building in which the wall supports or to any devices that may be able to connect thereto . this solar power system 1500 therefore may or may not include a storage device , depending on the purpose of the system 1500 . as such , the power being generated by the solar power system 1500 and not used by the building , may then be sold to the electric power company , providing the owner of the building with an additional income stream . each solar power unit 1510 in the disclosed implementation may be coupled to one another in series or parallel , depending on the implementation . for example , if the solar power system was being used as a power source to a building , the solar power units 1510 1 . . . n may be electrically coupled in series . an example circuit diagram of serially connected solar power units 1510 can be seen in fig1 . referring back to fig1 , if the solar power system 1500 was to provide more than a single source of power , the solar power system 1500 may be sectioned off such that the groups of the plurality of solar power units 1510 are electrically coupled in parallel to one another . an example circuit diagram of this implementation can be seen in fig1 . fig1 illustrates an example solar power system 1800 including a plurality of alternative solar power units 1801 1 . . . n . each solar power unit 1801 includes a positive lead (+) 1823 and negative lead (−) 1824 . an example solar power unit in accordance with this implementation is illustrated in fig1 . as illustrated in fig1 , the solar power unit 1800 comprises lead cavities 1833 and 1834 and a positive lead 1823 and negative lead 1824 . in accordance with this disclosure , lead cavities 1833 and 1834 are female connectors for additional solar power units 1800 to electrically connect to one another as shown in fig1 . referring back to fig1 , each of a plurality of solar power units 1801 n in the solar power system 1800 may be coupled to a solar power unit 1801 n above it through its positive lead 1823 n or negative lead 1824 n , and below the unit through the lead cavities . as disclosed above , depending on how the energy generated by the solar power system may be coupled to one another in series or parallel . example circuit diagrams of the solar power units 1801 connected in series and parallel in accordance with this disclosed implementation are illustrated in fig2 and 21 , respectively . in accordance with this implementation , each solar power unit 2210 of the solar power system 2200 may be installed as illustrated in fig2 . as illustrated in fig2 and disclosed above , the frame 2203 includes a perforated top and bottom panel 2207 , 2208 , respectively . once the lower section of the wall is installed including the solar power unit 2210 1 , mortar or other bonding substance 2240 can be spread over the cinder block 2217 1 . because the top panel 2207 1 is perforated , the bonding material is able to adhere to the cinder block 2217 1 . the solar power unit 2210 2 is then installed on top of the solar power unit 2210 1 . again , because the bottom panel of the solar power unit 2210 2 , the bonding substance 2240 is able to bond to the cinderblock 2217 1 . depending on the how the solar power units 2210 are electrically connected , the lead 2224 1 , 2223 1 are connected to lead cavity ( ies ) 2233 2 , 2234 2 accordingly . in this implementation , it is a preferred feature to include additional perforations 2253 2 in the angled portion of a solar power unit &# 39 ; s 2210 2 bottom panel 2208 2 . similarly , perforations may be added to the portion of the top panel 2210 1 that is not engaged with the cinder block 2217 1 of this disclosed implementation . the inclusion of these perforations allow air to flow through the solar power units 2210 to cool the solar power unit 2210 and assist in drying the unit 2210 after wet weather . fig2 illustrates a cross - sectional view of the disclosed solar power system in a building structure shown in fig1 , including a plurality of building blocks 1807 1 , 1807 2 , 1807 3 . as shown in fig2 , solar power units 1800 1 , 1800 2 , 1800 3 are each slid over building blocks 1807 1 , 1807 2 , 1807 3 , and electrically connected to each other at leads 1824 1 and 1824 3 through lead cavities 1825 1 and 1825 2 . fig1 also illustrates the building of a building structure 1800 including a plurality of building blocks 1807 1 . . . 1807 n , and a plurality of solar power units 1801 1 . . . 1801 n electrically connected to one another to provide power to electrical outlet 1804 included in solar power unit 1801 1 . once the building structure is complete , a user may then connect an electronic device , requiring a dc power source , to be powered through outlet 1804 of solar power unit 1801 1 , using the power generated by the plurality of solar power units 1801 1 . . . 1801 n . in accordance with an alternative implementation , a solar wall module is disclosed . fig2 illustrates an example solar wall module 2400 in accordance with this implementation . the solar wall module 2400 comprises a plurality of solar power units 2410 1 . . . n and wall assembly 2420 . as disclosed above , the solar power unit 2410 may include top and bottom panels that are bent 90 ° up and down , respectively , such that the solar power units can be attached to an existing wall . in accordance with this implementation , each of the plurality of solar panel users are attached to the wall assembly for integrating with a building wall . an example cross - sectional illustration of the solar wall assembly 2400 is shown in fig2 . as illustrated in fig2 , the solar power units 2410 are attached to each other and to the wall assembly 2420 using screws 2460 . although screws have been disclosed , it should be noted that any means of supporting the plurality of solar power units on the wall assembly may be used . an example frame for each of the solar power units 2410 included in the disclosed solar wall assembly is illustrated in fig2 . the frame 2415 comprises a top panel 2604 , a bottom panel 2602 , and a face plate 2603 . as disclosed above , the top and bottom panels 2602 , 2604 are bent 90 ° up and down , respectively , to attached the frame 2115 to the wall assembly . it is preferable that the top and bottom panels 2602 , 2604 include perforations in the portions of the panels that are not attached to the wall assembly to allow for air to flow through the unit . the face plate 2603 is attached to the top and bottom panels 2602 , 2604 and supports the solar panel . one or more access openings 2605 are included on the face plate 2603 to allow connections to the one or more solar panels . in accordance with a preferred fabrication of the frame 2415 , the bent portion of the top panel 2603 2 of frame 2415 2 is attached to the bent portion of the bottom panel 2602 1 of frame 2415 1 , and so on . an example illustration of the frames attached in this manner is shown in fig2 . referring back to fig2 , solar panels 2401 1 . . . n are attached to the frame 2415 1 . . . n directly using screws , for example , or a front cover ( not shown ) as disclosed above . the wall assembly 2420 , attached to the plurality of solar power units 2410 1 . . . n , supports the solar power units in the building structure and acts as a part of a wall for the building structure . an exploded view of the solar wall module 2400 is illustrated in fig2 . the wall assembly comprises an outer barrier and an inner barrier . the outer barrier is the portion of the wall assembly that is directly touching the solar power system , and includes a water barrier 2422 , furring strip 2421 and sheathing 2423 . an air and water barrier 2422 material may serve as a drainage plane for water to escape quickly at the bottom of the panel . this material may also prevent water and outside air from penetrating into the building . metal flashing 2424 may also be included in the outer barrier to protect against water entering in the walls . since the disclosed implementation is a wall module that will be fitting within the framework of a building structure , the wall assembly &# 39 ; s 2420 inner barrier includes two studs 2450 , preferably spaced apart the same distance as the studs in the other portions of the building structure , for example 24 ″. the height of the studs 2450 depends on the size selection of the solar wall module 2400 . structural studs could be made of wood or metal and may serve as the structural layer of the assembly 2420 to enable the solar wall module 2400 to be robust and withstand wind loads . the inner barrier further includes a rigid insulation core 2426 that may be used as a thermal barrier and to prevent unwanted hot and cold air from penetrating into the building and significantly lowering utility bills . a moisture barrier 2427 may be used to prevent condensation from building up within the insulation 2426 . gypsum board or sheet rock 2429 may be used to provide an interior rigid material which may be painted or covered with a finishing material like paint , wall - paper , or wood trim , etc . the solar wall module 2400 further includes a power component 2428 . as illustrated in fig2 and 30 , the power component 2428 is preferably enclosed within a cavity in the insulation 2426 and the sheet rock 2429 . the power component 2428 comprises an inverter 3072 , a battery 3073 and charge controller 3071 . the inverter 3072 may be equipped with a traditional 120 volt outlet and can be accessed and plugged directly into from either the interior , as shown in fig3 , or exterior side of the wall , as shown in fig2 . a removable metal panel 2430 may cover the pocket of the wall that holds power components . the panel 2430 may be perforated to allow ventilation to the equipment and accommodates a socket for the outlet . fig3 illustrates an example of a plurality of solar wall modules 2400 1 . . . n installed in a building structure , such as a residential home . the disclosed solar power unit is an improvement over existing building integrated photovoltaic products for several reasons . as disclosed above , the solar power unit may be an all - in - one , plug - n - play system . also , the disclosed solar power units are structurally integrated and may significantly reduce cost by serving as both the structural layer and exterior , finish layer , of the building . the disclosed solar power system replaces , or can be used in conjunction with traditional building material and may be integrated with concrete block or brick in the same wall system . the entire wall does not have to entirely be made out of the solar power systems . for example , a customer may have a specific energy load ( electric lighting ) that they are interested in generating from the solar power systems . the number of units that would generate this electric load would be utilized and the rest of the wall may be constructed with another traditional block material . there are many commercial applications for this product . not only can the solar power units be utilized for new building construction projects ( commercial , residential , industrial , civil , educational , etc . ), they can also be utilized for retrofit applications as well , over existing facades and serve as charging walls for electric devices or vehicles . since the solar power unit is designed to be a modular unit , it may be utilized for many applications at varying scales . the units may become a part of our daily lives . walls of cities and towns may replace power plants . based on the foregoing description , it will be readily understood by those persons skilled in the art that the present invention is susceptible of broad utility and application . many embodiments and adaptations of the present invention other than those specifically described herein , as well as many variations , modifications , and equivalent arrangements , will be apparent from or reasonably suggested by the present invention and the foregoing descriptions thereof , without departing from the substance or scope of the present invention . accordingly , while the present invention has been described herein in detail in relation to one or more preferred embodiments , it is to be understood that this disclosure is only illustrative and exemplary of the present invention and is made merely for the purpose of providing a full and enabling disclosure of the invention . the foregoing disclosure is not intended to be construed to limit the present invention or otherwise exclude any such other embodiments , adaptations , variations , modifications or equivalent arrangements , the present invention being limited only by the claims appended hereto and the equivalents thereof .	8
the detailed description set forth below in connection with the appended drawings is intended as a description of the presently preferred injection devices , which are exemplary embodiments provided in accordance with aspects of the present invention , and is not intended to represent the only forms in which the present invention may be constructed or utilized . the description sets forth the features and the steps for constructing and using the injection devices of the present invention in connection with the illustrated embodiments . it is to be understood , however , that the same or equivalent functions and structures may be accomplished by different embodiments that are also intended to be encompassed within the spirit and scope of the invention . as denoted elsewhere herein , like element numbers are intended to indicate like or similar elements or features . this application is related to ser . no . 10 / 932 , 751 , filed sep . 2 , 2004 , entitled integrated neurotoxin injection sensing and control device , the contents of which are expressly incorporated herein by reference as if set forth in full . referring now to fig1 , there is shown an exemplary schematic cross - sectional view of a skin tissue of a human body , which is generally designated 10 . as is well known in the medical field , the skin tissue 10 comprises a skin layer , which are the epidermis 12 and dermis 14 layers , a superficial fascia layer 16 , a deep fascia layer , and a muscle layer , shown collectively as 18 . in the facial area however , there is no deep fascia layer . instead , facial muscles are embedded in the superficial fascia layer 16 . the superficial fascia layer 16 in the facial area , herein the fascia 16 , thus comprises a loose network of connective tissue bundles , collagen , and elastin , which blend with the dermis . wrinkles have been described as aging , sun - damaged skin , the loss of elastin and / or collagen , etc . whether or not due to one or more of these reasons , from the schematic shown , a wrinkle 20 on the skin outer surface 22 is simply an outward reflection of the movement 24 of muscles underlying the skin along an axis perpendicular to the skin , i . e ., the z axis . thus , as muscles are embedded in the superficial fascia layer 16 in the facial region , wrinkles in the facial region is movement of the fascia layer 16 along the z axis . a void space 26 formed from the original skin contour 22 and the wrinkled skin 20 are thus both formed due to movement of the fascia layer 16 . in one aspect of the present invention , wrinkle treatment involving recovering at least part of the void space 26 is provided by injecting medications , which can be a filler or a neurotoxin , below the skin 22 to either ( 1 ) fill - out the skin to create a more even line with the top skin contour 22 or ( 2 ) paralyze the muscles that cause the skin to wrinkle 20 so that they relax and not contract along the z axis . more preferably , medications are injected in between the dermis layer 14 and the fascia 16 to treat wrinkles . most preferably , medications are injected in a cavity ( not shown ) formed between the dermis layer and the fascia using a device of the present invention for consistent and prolonged wrinkle treatment , as further discussed below . other medications not presently approved for wrinkle treatment but in the future are approved may also be used with the devices of the present embodiment provided they are useable with a syringe . referring now to fig2 , an exemplary injection assembly for delivering an injection in accordance with aspects of the present invention is shown , which is generally designated 28 . in one embodiment , the injection assembly 28 comprises a master controller 30 and an injection module 32 comprising a needle assembly 34 mounted to a housing 36 . in general , the master controller 30 is configured to supply an electrical stimulation to the facial tissue via the needle assembly 34 , a vacuum to the housing 36 to create a pulling force on the skin 22 , and pressurized gas to the needle assembly 34 to inject medications , as further discussed below . the injection module 32 is configured to penetrate the skin , transfer low voltage to provide stimulation to the facial tissue , and deliver medications . in one exemplary embodiment , the master controller 30 comprises a vacuum pump ( not shown ), pressurized gas supply ( not shown ), a power supply device ( not shown ), and electronics for regulating the vacuum pump , gas flow , and either voltage and / or amperage supplied by the power supply device . the injection module 32 comprises a wall enclosure 38 , a cap 40 , and the needle assembly 34 , as previously discussed . the injection module 32 also comprises a nozzle 42 , a first open end 44 comprising a pliable seat 46 , and a second open end 48 comprising a mating connector 50 , which in one exemplary embodiment is a corresponding threaded end for receiving the cap 40 . the nozzle 42 is preferably a hose barb connector for connecting to an air hose and may include a rocker pinch valve as disclosed in u . s . pat . no . 6 , 340 , 096 . the pliable seat 46 is preferably a foam - based gasket but may be a rubber - base gasket removably adhered to the wall enclosure end with adhesive . in one exemplary embodiment , the pliable seat 46 is disposable and comprises pressure sensitive adhesive for providing a vacuum tight seal with the face , as further discussed below . the pliable seat 46 comprises an opening and a configuration that matches the configuration of the wall enclosure 38 , which in one exemplary embodiment is a cylindrical wall enclosure having two open ends 44 , 48 . the cap 40 comprises an o - ring 52 seated in a groove , a mating connector 54 , a vacuum breaker 56 , a receiver ( not shown ) for receiving the needle assembly , a pneumatic connector ( not shown ) for connecting to the pressure source , and a terminal connector ( not shown ) for connecting to the power supply . in one exemplary embodiment , the vacuum breaker 56 is configured for manual opening by turning a valve or a piston to open the housing to atmosphere to enable removable of the housing . as is readily apparent to a person of ordinary skill in the art , any of the various components on the wall enclosure 38 and the cap 40 may be located elsewhere on the wall enclosure and the cap . for example , the vacuum breaker 56 may be located on the wall enclosure 38 instead of on the cap 40 and the nozzle 42 may be located on the cap 40 instead of the wall enclosure 38 . furthermore , instead of using threads to couple the cap 40 and the wall enclosure 38 together , in an alternative embodiment , detents or straps may be used . preferably however , threads are used to enable adjustable engagement of the cap 40 to the wall enclosure 38 to thereby adjust the length of the needle 58 that extends distally of the edge of the pliable seat 46 . in one exemplary embodiment , a reservoir for storing medications is located on the cap and the needle assembly , particularly the dispensing hub 72 ( fig3 ), is in communication with the reservoir . the master controller 30 is placed in communication with the injection housing 36 by connecting the nozzle 42 to the vacuum pump using a hose 60 , connecting the pressurized gas to the pneumatic connector on the cap 40 using a hose 60 , and connecting the terminal connector on the cap to the power supply device using a cable 62 . in one exemplary embodiment , the power supply device and the vacuum pump are both located inside the controller 30 while the pressurized gas supply is external to the controller . however , the pressurized gas supply , which may be an air pump , may also be located inside the controller 30 . preferably , the vacuum source and the gas supply are both external of the controller . for example , the vacuum source can be part of a central vacuum source and the gas supply can be a pressurized gas tank , of either nitrogen or air . the controller 30 preferably controls current flow and pressurized gas to the needle assembly 34 as well as timing of the current flow and the gas flow for reasons further discussed below . referring now to fig3 , a needle assembly 34 provided in accordance with aspects of the present invention is shown . the needle assembly 34 resembles a catheter assembly and comprises a needle 58 having a sharpened needle tip 66 attached to a needle hub 68 , and a tube 70 attached to a dispensing hub 72 . in one exemplary embodiment , the dispensing hub 72 comprises an engagement end 67 configured to engage the receiver on the cap 40 . the dispensing tube 70 and the needle 58 in the present embodiment are both made from a metallic material , preferably of stainless steel . in one exemplary embodiment , the needle hub 68 and the dispensing hub 72 are both co - molded with a metallic insert 74 comprising a metallic strip 76 comprising an exposed lead 78 . the two leads 78 are configured to couple to a power supply device to impart an electric current to the facial tissue for stimulating a cavity , as further discussed below . the metallic inserts 74 may each comprise a cylindrical configuration or an open curved metallic section configured to contact with the needle . in one exemplary embodiment , a gap or space 73 is provided in the annular space between the needle 58 and the dispensing tube 70 . this gap 73 is in communication with an opening or vent port 75 incorporated in the needle hub 68 . thus , when the needle 58 is inserted into a skin tissue , the area of the skin tissue that surrounds the needle tip 66 is in fluid communication with the vent port 75 , which is in communication with the atmosphere . as further discussed below , fluid to be dispensed by the needle assembly 34 is dispensed through the dispensing hub 72 and dispensing tube 70 and out of the end opening 77 of the tube . in an alternative embodiment , a plurality of vent ports 75 are incorporated in the needle hub 68 . in yet another aspect of the present invention , the needle tip 66 of the needle 58 comprises a non - coring tip , which typically includes a bend in the shaft . fig4 is an alternative injection assembly 80 provided in accordance with aspects of the present invention . in the present embodiment , a hand vacuum pump 82 is incorporated for providing a vacuum and a hand activated valve 84 connected to a line 86 and in communication with the needle assembly 34 for regulating medication flow out of the dispensing tube 70 . the valve 84 , when activated to open , is opened on one side to the atmosphere . referring now to fig5 , the injection assembly 28 is shown used on a patient . in an office setting , a subject or patient is first directed to lay down in a supine or semi - recumbent position in a chair and the face to be treated is positioned substantially horizontally . the injection module 32 , with the needle 58 adjusted to extend about 0 . 4 cm to about 1 . 5 cm distally from the end of the pliable seat 46 and the various connectors and lines connected to the master controller 30 , is then placed on the facial skin 22 of the patient . however , the length can vary depending on the treatment and location of injection . the injection module 32 should be placed directly over a wrinkle to be treated . placement of the module 32 results in the needle 58 penetrating the skin at the wrinkled area to a depth set by the position of the needle tip 66 relative to the pliable seat 46 . if the injection module 32 is connected to an external vacuum source , a vacuum is created inside the interior cavity 87 of the wall housing 36 without initiating the master controller 30 otherwise a vacuum power switch 88 on the master controller 30 is activated to initiate the vacuum pump for generating a vacuum in the interior cavity . a soft vacuum of about 7 to about 14 psia should be established inside the interior cavity . a vacuum pressure transducer may be incorporated to verify the vacuum inside the cavity . preferably the vacuum is kept to about 9 - 13 psia . the skin 23 under the vacuum bulges outwardly into the interior cavity 87 of the housing 36 , which is shown exaggerated for discussion purposes . once a sufficient vacuum is established , a current is sent to the needle assembly 34 by activating a power source switch 90 . a current of about 1 . 5 ma to about 5 ma supplied to the needle is preferred with a current of about 2 ma to about 3 ma being more preferred . the higher the current , the more the fascia 16 will contract , as further discussed below . in one exemplary embodiment , the controller 30 has built - in electronics to regulate the amount of current output to the needle 58 , which may be adjusted by turning a dial 92 . the current provided by the controller 30 to the terminal connector ( not shown ) located on the cap 40 and then to the needle 58 and dispensing tube 70 via the leads 78 on the needle hub 68 and dispensing hub 72 causes the muscles adjacent the needle and dispensing tube to contract . the contraction is caused by an electrical stimulation to an area located around the needle that is known as the neuromuscular junction . current discharged in this region produces a muscular response . the contraction is caused by an electrical stimulation to an area located around the needle , and therefore first will stimulate the neuromuscular junction lying within the fascia that is adjacent to the needle body . current discharged in this region produces a muscular contraction following the release of acetylcholine , which initiates an action potential and this then propagates through the rest of the muscles . the muscles , which as previously discussed are embedded in the fascia , move away from the current source , i . e ., the needle . normally this causes the skin 22 to move with the fascia . however , as a vacuum is applied to the skin surface directly over the axis defined by the needle 58 , the fascia 16 separates from the skin , i . e ., from the dermis 14 and epidermis 12 . this separation is facilitated by the vent hole 75 located in the needle hub 68 , which assists in breaking the surface tension between the skin and the fascia . fig6 is a graphical depiction of a cavity 94 created below the skin due to the combination vacuum applied to the skin surface 22 and electrical current supplied to the muscles subjacent the vacuum source . this cavity region is also known in the medical field as a dead space or a bloodless plane . the cavity 94 forms almost instantaneously as the flow of current is applied to the needle . in one exemplary embodiment , a small volume of pressurized gas is sent to the needle assembly 34 to push medications into the cavity shortly following the flow of current . the pressurized gas can be a low pressure gas of about 1 - 3 psig and a flow volume of about 0 . 02 cc to about 0 . 8 cc , which would be equivalent to the volume of medications injected into the cavity 94 from the dispensing tube 70 . in one exemplary embodiment , the controller automatically senses the vacuum inside the interior cavity 87 of the housing 36 , supply a current to the needle 58 and dispensing tube 70 when an appropriate vacuum is sensed , and delivers a quantity of pressurized gas to the needle a short time interval following the supply of current to the dispensing hub 72 to then deliver medications to the cavity 94 . depending on the treatment , medications delivered to the cavity can be any number of products including fillers and neurotoxin . however , medications can be any number of medications depending on the type of treatment or preventative care in question . with reference to fig4 in addition to fig6 , if a different injection assembly is used , such as the injection assembly 80 of fig4 , then the injection process includes placing the injection module 32 over an area to be injected , creating a vacuum using a vacuum pump 82 or other vacuum source , such as a separate vacuum pump , opening the valve 84 connected to the needle assembly 84 , and then sending a current from the controller 30 to the needle . a cavity will form as previously discussed . however , rather than supplying pressurized gas to inject medications to the cavity 94 , medications are automatically drawn into the cavity 94 due to a vacuum that is formed as the cavity is created . the valve 84 may be closed shut following a brief moment , such as 2 - 6 seconds following the flow of current . a second injection can now be made by moving the injection module 32 to a different location to be injected and repeating the described steps . as the housing 36 is under a vacuum , the vacuum breaker 56 should be activated to release the vacuum . referring now to fig7 , a semi - schematic cross - sectional side view of yet another alternative injection assembly 96 provided in accordance with aspects of the present invention is shown . the injection assembly comprises an injection module 98 and a master controller ( not shown ) similar to the controllers previously discussed . in one exemplary embodiment , the injection module 98 comprises a housing 100 comprising a nozzle 42 , a vacuum breaker 56 , and a needle assembly 102 attached to the housing . in one exemplary embodiment , the needle assembly 102 is attached to a top surface 104 of the housing 100 , which may be an integrally formed top surface or a separate cap to be connected to the wall enclosure 106 . the wall enclosure 106 is shown with a break line 108 representing a variable housing length to be determined depending on the needle and needle assembly . a pliable seat 46 is incorporated at the end edge of the wall enclosure 106 to serve as a soft seating surface . in one exemplary embodiment , the needle assembly 102 is similar to the needle assembly shown in fig3 with a few changes . in particular , a second opening 110 is incorporated in the needle hub 68 and an elongated shell 112 comprising a pliable seat 114 is coaxially disposed with the needle 58 . the elongated shell 112 may be attached to the needle hub 68 by either interference fit or threaded engagement . an interior space 116 is defined interiorly of the shell 112 , which is in communication with the first opening 75 and second opening 110 on the needle hub 68 , which is in communication with the atmosphere . when the injection assembly 96 is used on a patient , such as that shown in fig4 and 5 , and the housing is under a vacuum , the space around the needle defined by the shell 112 is not in a vacuum whereas the space outside the shell 112 and inside the housing 100 is under a vacuum . thus , when a current is applied to the leads 78 on the needle hub 68 and the dispensing hub 72 , muscles will contract along the z - axis and will tend to pull the skin located inside the shell 112 in the same direction . the skin , however , is held secured by the vacuum around the area between the shell 112 and the housing 100 . this configuration , as compared to that shown in fig4 and 5 , has been found to effectively stimulate a cavity near the needle tip 66 for depositing medicament stored inside the reservoir 118 defined by the dispensing hub 72 . similar to previously described embodiments , medicament may be dispensed using a pressurized gas source coupled to the reservoir 118 or may be gravity fed using a combination valve and tubing . the interface between the needle hub 68 and the housing 100 , and particularly the top surface 104 of the housing , may be any known prior art attachment means , including interference fit , friction fit , and threaded engagement . preferably , the interface allows adjustment to the needle so that the needle tip extension , and therefore the depth of penetration of the needle , beyond the end edge of the housing 100 may be adjusted . fig8 is a semi - schematic cross - sectional view of the injection assembly 96 of fig7 with an accordion seal 120 attached to the end edge of the elongated shell 112 . the accordion shell 120 may be made from an elastomeric material and may be attached to the shell using detents or tongue and groove arrangement . the accordion seal 120 allows the interior space to remain constant by flexing and compensating for different curvatures of the face as the injection assembly 96 is moved from one injection site to another . fig9 is a semi - schematic cross - sectional side view of the injection assembly 96 of fig7 with a leveling plate 122 attached to the opening of the elongated shell 112 and having an opening 124 . in one exemplary embodiment , the leveling plate comprises a thermoplastic plate . the plate 122 is configured to provide a base line or an injection site that is level relative to the needle tip . thus , when vacuum is applied to the skin for an injection , the area under the needle ensures that any skin that is raised by the vacuum is leveled by the plate 122 . this in turn ensures that the injection site is level from site to site so that the depth of the injection is the same or nearly the same from site to site . fig1 is a semi - schematic side view of yet another injection assembly provided in accordance with aspects of the present invention , which is generally designated 126 . in one exemplary embodiment , the injection assembly 126 comprises a syringe 128 comprising a needle 130 , shown with a needle cap 132 , a barrel 134 , a plunger 136 having a push flange 140 , and a piston 138 . the syringe 128 may be any number of prior art syringe , which may include an integrated needle as shown or a separate needle with needle hub . in the figure , a second piston 138 ′ is shown distally advanced inside the barrel 134 , which depicts an injection wherein the piston 138 is advanced from a proximal position on the barrel 134 to a more distal position . in one exemplary embodiment , the barrel 134 incorporates one or more stoppers 142 located on its external surface for registering the barrel relative to an injection housing , as further discussed below . the injection assembly 126 further comprises an injection module 144 comprising a housing 146 comprising a loading cap 148 and an injection body section 150 . the housing 146 may be made from a rigid thermoplastic material or a metal , such as aluminum or stainless steel . in one exemplary embodiment , the loading cap 148 comprises a bore 152 comprising a tapered cylindrical wall surface , tapers inwardly from a proximal point to a distal point , near a groove for accommodating an o - ring 156 . in one exemplary embodiment , the cap 148 comprises a shoulder comprising a threaded end 158 comprising a second groove for accommodating a second o - ring 156 . the cap 148 is configured to slide onto the barrel from the rear end of the barrel 134 , where the plunger 136 projects through the barrel . the cap is pushed distally forward until the end edge 160 of the cap contacts the one or more stoppers 142 . medication 162 may now be filled into the barrel by aspirating the plunger 136 to draw a vacuum . the injection body section 150 is now threaded to the cap 148 and the split - line between the body section 150 and the cap 148 sealed by a second o - ring 156 . as shown , the injection body section 150 comprises a vent port or opening 164 comprising a nozzle 166 , which may be a barb connector , and an activating piston 168 in dynamic sealing arrangement with the interior wall surface 170 of the body section 150 . the injection assembly 126 is configured to deliver an injection not by pushing the plunger 136 with a finger , such as a thumb , but by activating the activating piston 168 using a vacuum source . in one exemplary embodiment , the nozzle 166 on the body section 150 is connected to a vacuum source using a hose 172 . the vacuum source can be any one of an electric vacuum pump 174 , a manual hand vacuum pump 176 , or a vacuum header 178 , typically in hospitals or other institutions . when the interior cavity 176 of the injection module 144 is subjected to a vacuum , the activating plunger 168 is automatically drawn distally . at some point , the activating plunger 168 will contact the push flange 140 and pushes the push flange and the plunger 136 into the barrel 134 , which in turn , via the piston 138 , pushes medications 162 inside the barrel out of the needle 132 . it has been found that a vacuum of as little as 9 - 14 psia will effectively move the activating plunger 168 to then push the plunger 136 . however , for injecting a more viscous fluid , a vacuum of about 1 - 6 psia may be required . in an alternative embodiment , the piston 168 is fixed to the housing 146 , i . e ., does not move relative to the housing . the piston 168 can thus be an end cap or the like that can either be permanently secured to the open end 169 of the housing 146 or removable from the open end 169 , such as by incorporating threads . in the present alternative embodiment , the barrel 134 of the syringe is configured to move into the housing 146 upon exposing the nozzle 166 to a vacuum source . in one exemplary embodiment , the stoppers 142 on the exterior surface of the barrel 134 are eliminated . hence , when the interior cavity 176 is under a vacuum the barrel 134 and the plunger 136 both move proximally into the housing 146 . at some point , the push flange 140 on the plunger hits the stationary piston 168 while the barrel 134 continues to move . this motion causes the plunger 138 to eventually contact and push medications inside the barrel out of the needle 130 . in short , the present alternative embodiment is configured to discharge fluid out of the needle 130 while at the same time move the barrel 134 proximally relative to the injection module . although limited embodiments of the injection device and methods of using same have been specifically described and illustrated herein , many modifications and variations will be apparent to those skilled in the art . for example , separate controllers for controlling different functions may be incorporated instead of just one , different ways to supply current to the facial tissue using different means instead of via the leads in the needle and catheter hubs as described , and different ways to stimulate a void or cavity instead of using a stimulator in combination with a vacuum . furthermore , it is understood and contemplated that features specifically discussed for one injection assembly may be adopted for inclusion with another injection assembly , provided the functions are compatible . accordingly , it is to be understood that the injection assemblies and their components constructed according to principles of this invention may be embodied other than as specifically described herein . the invention is also defined in the following claims .	0
the present invention will now be described in detail with reference to a few preferred embodiments thereof as illustrated in the accompanying drawings . in the following description , numerous specific details are set forth in order to provide a thorough understanding of the present invention . it will be obvious , however , to one skilled in the art , that the present invention may be practiced without some or all of these specific details . in other instances , well known process steps have not been described in detail in order not to unnecessarily obscure the present invention . in accordance with one aspect of the present invention , improved ignition of a plasma inside an inductive plasma processing reactor at low pressures is achieved by introducing a magnetic field inside the process chamber . typically , ignition of a plasma is difficult at low pressures . as discussed earlier , at low pressures electrons have long mean free paths and are less likely to collide with molecules . the electrons that do not collide with molecules typically hit the chamber wall and recombine , making it hard to ignite the plasma . by introducing a magnetic field inside the process chamber , electrons are temporarily captured by the lorenz force and spiral around the field lines of the magnetic field . the spiraling electrons increase their residence time inside the chamber , thereby increasing the chances of collisions with neutral gas molecules to start the chain reaction that ignites the plasma . in another embodiment , the magnetic field is only used for aiding in plasma ignition . in order to maintain the stability of the plasma , the magnetic field is preferably turned off as soon as the plasma ignites to prevent adverse effects on the etch process . according to another embodiment , the magnetic field is preferably placed in the proximity of the electric field produced by the inductive coils . most of the dissociated electrons inside the process chamber are located in the electric field region . therefore , more electrons can be influenced by the strategic placement of the magnetic field in this region . to facilitate discussion of the features and advantages of the present invention , fig2 a depicts an inductive plasma processing reactor with the inventive addition of a magnetic field producing apparatus , such as solenoid . an inductive plasma processing reactor 300 consists of a chamber 302 with an antenna or inductive coil 310 disposed above a dielectric window 312 . a substrate 314 is disposed above a chuck 316 . the chuck 316 is disposed at the bottom of the chamber 302 . when rf power is supplied to the inductive coil 310 , an oscillating magnetic field 318 is created . this oscillating magnetic field 318 induces an electric current 320 inside the chamber 302 and below the dielectric window 312 . in a manner analogous to the discussion associated with fig1 a & amp ; b , the electric current 320 runs in the opposite direction of the current in the inductive coil . the direction of the current is portrayed by the x and dot inside the inductive coil 310 and the electric current 320 . when rf power is supplied to the inductive coil 310 a voltage drop occurs across the dielectric window 312 and the vacuum chamber volume to electrically grounded surfaces . this voltage initiates the plasma breakdown . generally , the free electrons are accelerated to a high energy by the circulating electric current 320 . the electrons are accelerated in alternating directions ( dependent on rf of the power source ). the accelerated electrons collide with other neutral molecules creating more electrons and positively charged ions . as soon as the creation rate of free electrons exceeds their loss rate , the plasma ignites . a solenoid 324 is disposed outside the chamber 302 . the solenoid 324 is preferably near a high voltage point on the inductive coil 310 . the solenoid induces a dc magnetic field 328 with a dc power source 330 . in one embodiment , the dc power source 330 provide a dc voltage that produces a magnetic field suitable for promoting plasma ignition , e . g ., approximately 200 volts dc power . the dc magnetic field 328 exists inside the chamber 302 in a region 332 , as shown , to trap temporarily electrons 334 and cause them to spiral along the magnetic field lines 336 of the dc magnetic field 328 . because the electrons 334 spend more time in the region 332 , they are more likely to collide with neutral molecules prior to being recombined onto the chamber walls . this greatly increases the likelihood of plasma ignition at low pressures and / or low inductive source power . typically , the accelerated electrons collide with neutral molecules creating more electrons and positively charged ions , initiating a discharge . the dc magnetic field 328 in the region 332 is no longer needed at that point . plasma breakdown occurs and the plasma ignites . as can be appreciated by one skilled in the art , there are many different types of configurations for an inductive plasma processing reactor and plasma ignition may be facilitated by providing a magnetic field producing apparatus proximate to the location where free electrons are initially produced . by way of example , fig2 b is another illustration of the inductive plasma processing reactor as shown in fig1 b with the inventive addition of a magnetic field producing apparatus , such as a solenoid . in fig2 b , a solenoid 424 is disposed outside the chamber 402 . the solenoid 424 is preferably located at a high voltage point of the inductive coil 410 . of course this high voltage point varies with different designs of the inductive coil and may be readily determined by one skilled in the art , either experimentally or by calculation . the solenoid induces a dc magnetic field 428 with a dc power source 430 . in this embodiment , the dc power source 430 operates at a voltage suitable to produce a magnetic field that promotes plasma ignition , e . g ., approximately 200 volts . the dc magnetic field 428 exists inside the chamber 402 in a region 432 . the dc magnetic field 428 temporarily traps electrons 434 , causing them to spiral around the path 436 to increase the residence time of the electrons to promote the start of the cascade that causes plasma ignition . in the preferred embodiment , the magnetic field inside the chamber is induced by a solenoid . the solenoid is preferably powered by approximately 200 volts dc and produces a magnetic flux between about 25 to 500 gauss . however , it is preferred that the magnetic flux be kept as low as possible while still maintaining a high enough flux to ignite the plasma . also , note that the exact voltage level of the dc voltage may vary as needed to a level effective to produce a magnetic flux strong enough to ignite the plasma . a low powered flux is preferable because it offers the least amount of disturbance to the process . in addition , this invention is not limited to a magnetic field produced by a solenoid , any means that can generate a magnetic field effective to ignite the plasma in a given plasma processing reactor can be employed ( e . g ., permanent magnets that can be physically moved upon plasma ignition ). as mentioned , the location of the dc magnetic field is preferably proximate the region in the plasma processing chamber where the electrons are initially accelerated by the high voltage from the induction coil . more preferably , the magnetic field producing apparatus ( such as the solenoid ) is positioned such that the magnetic field is proximate the electric field produced by the inductive coil . this is because most of the electrons initially generated tend to be concentrated in the electric field region . even more preferably , the magnetic field producing apparatus is positioned at a location that allows the magnetic field produced thereby to coincide with the region within the plasma processing chamber where the electric field line concentration is the highest . by way of example , the magnetic field producing apparatus may be placed in between adjacent coils of the inductive coil such that a sufficiently high number of electrons are exposed to the magnetic field when the magnetic field producing apparatus is powered . however , it is also possible to position the magnetic field producing apparatus at other locations , such at atop the coils , or at some location proximate to the coils . fig3 is a top view illustration , in accordance with one embodiment of the present invention , of the approximate location of a solenoid 324 relative to inductive coil 310 of the plasma processing reactor discussed earlier in connection with fig2 a . note that inductive coil 310 does not have to be planar , and may assume other nonplanar shapes . for the plasma processing chamber of fig2 b , the magnetic field producing apparatus may be similarly positioned relative to the inductive coil so as to promote plasma ignition ( e . g ., in between adjacent coils or a top of the coils ). as mentioned , the magnetic field produced by the magnetic field producing apparatus is preferably off after plasma ignition occurs in order to minimize the impact of the magnetic field on the process . in general , the detection of plasma ignition for the purpose of turning off the magnetic field producing apparatus may be performed using any conventional method , including , for example , optical emission detection , sensing of the reflective power in the match networks , or the like . note that although the preferred embodiment contemplates that the magnetic field produced be sufficiently strong to promote plasma ignition without having to raise either the pressure within the chamber or the power to the top electrode , it is possible to employ the inventive ignition technique to reduce , instead of eliminate , the need to raise the pressure within the chamber and / or the power to the top electrode . by way of example , the presence of the magnetic field may raise the residence time of the electrons and the probability of collision such that only a slight increase in the chamber pressure and / or a slight increase in the top power level is required . while this invention has been described in terms of several preferred embodiments , there are alterations , permutations , and equivalents which fall within the scope of this invention . it should also be noted that there are many alternative ways of implementing the methods and apparatuses of the present invention . it is therefore intended that the following appended claims be interpreted as including all such alterations , permutations , and equivalents as fall within the true spirit and scope of the present invention .	7
the dihydrochalcones of this invention have a set chemical structure as shown in formula ( i ). they contain three hydroxyl groups which are placed at the 2 , 6 , and 3 &# 39 ; positions . at the 4 &# 39 ; position they contain a lower saturated alkoxy group selected from the group of methoxy , ethoxy , the propoxies , and the butoxies ; preferably the 4 &# 39 ; substituent is a methoxy or ethoxy , and most preferably , a methoxy . at the 4 position they contain a carboxyl group - substituted methoxy group wherein the carboxyl group is either present as a carboxylic acid group , cooh , or as a cation salt of a carboxylic acid . as cations in the salts may be employed any pharmacologically acceptable cation such as the alkali metal cations , alkaline earth cations , ammonium cations , and the pharmacologically acceptable 4th period transition metal cations such as zinc , copper and nickel cations . preferred among these cations are the calcium cations and the alkali metal cations , especially sodium , potassium and lithium cations . it is most preferred when the carboxyl group of the 4 &# 39 ; substituent is present either as the carboxylic acid group or as the sodium or potassium salt . thus in formula ( i ), m most preferably is h , na , or k . these dihydrochalcones may be produced by at least two routes . in one method , the corresponding 2 , 4 , 6 - trihydroxydihydrochalcone is alkylated with an alkyl haloacetate and then treated with base to yield a mixture of 2 , 4 , and 3 &# 39 ;-( carboxyl - substituted methoxy ) dihydrochalcones , which are then separated . in another method , hesperetin or an equivalent other 4 &# 39 ;- lower alkoxyl material is alkylated with an alkyl haloacetate and then opened and reduced to the desired dihydrochalcone . these two preparative schemes are demonstrated in the examples , where reaction condition ranges and the like are also set out . these dihydrochalcones find application as sweeteners . in this used they are admixed with edible substances such as foods , beverages , medicines , and the like , in amounts effective for imparting a desired degree of sweetness . the amount of dihydrochalcone employed can vary widely , just as the amount of natural sugar sweetener employed varies from person to person and food application to food application . as a general rule , the weight of dihydrochalcone added will be about 1 / 100th - 1 / 1000th the weight of sucrose required to yield the same sweetness . thus , additions of from about 0 . 0001 % up to about 0 . 05 % by weight ( basis edible substance ) may be usefully employed . the present materials offer the advantage that their solubility permits such addition to most food systems . the dihydrochalcones are added to the edible composition by mixing methods known in the art . the dihydrochalcones may be added as solids or as solutions . they may be used alone or as the primary sweetener in a composition , or they may be one of several sweeteners in the final composition ; sucrose , or another natural sweetener or another synthetic sweetener also being added . these dihydrochalcones , their preparation and their use are further described in the following examples . these are to illustrate the invention and are not to be construed as limitations on this invention , which is instead defined by the appended claims . this example describes the production of the dihydrochalcones of this invention via alkylation of corresponding 2 , 4 , 6 - trihydroxydihydrochalcones . a . 2 , 4 , 6 - tribenzyloxyacetophenone is obtained by the common procedure of reacting 2 , 4 , 6 - trihydroxyacetophenone with excess benzyl chloride and excess potassium carbonate in dimethylformamide and giving the reaction mixture an aqueous work up . 3 - benzyloxy - 4 - n - propoxybenzaldehyde is similarly prepared from 3 - hydroxy - 4 - n - propoxybenzyl alcohol , excess benzyl chloride and excess potassium carbonate . a warm solution of 2 . 19 g of the 2 , 4 , 6 - tribenzyloxyacetophenone and 1 . 35 g of the benzyloxy - 4 - n - propoxybenzaldehyde is prepared in 10 ml of absolute ethanol . 15 milliliters of warm aqueous 60 % potassium hydroxide is added all at once . the mixture is stirred and a yellow solid product is formed . 16 milliliters of absolute ethanol is added and the mixture is added to 300 ml of water and extracted three times with ethyl acetate . the extracts are dried and concentrated to yield 3 . 2 g of a solid , which is recrystallized to yield 2 . 6 g ( 75 % yield ) of 2 , 4 , 6 , 3 &# 39 ;- tetrabenzyloxy - 4 &# 39 ;- n - propoxychalcone . ## spc5 ## 1 . 38 grams of this material is dissolved in about 50 ml of ethyl acetate and 200 mg of 5 % palladium on charcoal is added . the reaction flask is flushed with hydrogen and then the mixture is stirred under hydrogen at room temperature for about 35 hours . the product is checked by thin layer chromatography and observed to contain essentially a single product . the reaction mixture is filtered and concentrated to yield 0 . 66 g of a colorless oil , which by nmr is determined to be 2 , 4 , 6 , 3 &# 39 ;- tetrahydroxy - 4 &# 39 ;- n - propoxy dihydrochalcone , ## spc6 ## b . the preparation of part a is substantially repeated with one change : instead of 3 - benzyloxy - 4 - n - propoxy benzaldehyde , 3 - benzyloxy - 4 - methoxybenzaldehyde ( prepared from 3 - hydroxy - 4 - methoxybenzyl alcohol ) is employed as starting material . the final product is 2 , 4 , 6 , 3 &# 39 ;- methoxy dihydrochalcone ## spc7 ## the reactions depicted in parts a and b have been run under very mild conditions . the reaction between the acetophenone and the benzaldehyde could be run at somewhat elevated temperatures , say from room temperature ( 20 ° c ) up to about 75 ° c , if desired . also , any strong base could be employed , such as sodium hydroxide , lithium hydroxide , or tetramethylammonium hydroxide . the hydrogenation may be carried out catalytically as shown , in the presence of a suitable transition metal or precious metal catalyst and molecular hydrogen at pressures from atmospheric up to as much as about 100 psig and temperatures of from about room temperature ( 20 ° c ) to about 125 ° c ; or it may be carried out by reaction with a hydrogen - carrying agent such as diimide . c . the product of part b is alkylated . a solution - suspension of 1 . 5 g of the product of part b and 1 . 4 g of anhydrous potassium carbonate is prepared in 12 . 5 ml of dimethylformamide . while stirring , 680 mg of ethylchloroacetate is added and rinsed in with 7 - 8 ml of dimethylformamide . the mixture is stirred at room temperature overnight and poured into about 100 ml of water . this mixture is saturated with sodium chloride and extracted with ethylacetate . the extracts are washed , dried , and concentrated to yield a mixture of components . this mixture is purified by preparative thin layer chromatography to yield three major alkylation products : 2 , 3 &# 39 ;- dihydroxy - 4 , 6 - dicarbethoxymethoxydihydrochalcone . the desired 2 , 6 - 3 &# 39 ;- trihydroxy - 4 - carbethoxymethoxy material unfortunately comprises only about one - fourth of the total of these three compounds . d . the three compounds of part c are then separately contacted with aqueous base . in a typical reaction , excess 5 % potassium hydroxide is added to the 2 , 6 , 3 &# 39 ;- trihydroxy compound and swirled and permitted to stand overnight to give a green solution of the potassium salt of the 2 , 6 , 3 &# 39 ;- trihydroxy material . the potassium salt solution is rendered acidic ( to ph 2 ) with hydrochloric acid , and a white precipitate forms . this precipitate is separated , washed , analyzed , and found to be essentially pure 2 , 6 , 3 &# 39 ;- trihydroxy - 4 - carboxymethoxy - 4 &# 39 ;- methoxydihydrochalcone ## spc8 ## cation salts such as the potassium , sodium , lithium , or ammonium salts are formed from this acid by titration of the acid with the appropriate base . e . aqueous solutions ( 0 . 009 % by weight ) of a variety of the products and intermediates of this examples are formed . they are tested by volunteers to determine their organoleptic properties , with the following results : ## spc9 ## as can be seen from the above taste data , the compounds of the present invention have desirable sweetener properties . a solution of 1 . 5 g of hesperetin ( sigma chemical co .) and 6 . 1 g of ethylchloroacetate in 20 ml of dimethylformamide is prepared . to this is added 690 mg of anhydrous k 2 co 3 . the mixture is flushed with argon and stirred for 17 hours at room temperature . the product of the reaction is added to about 200 ml of water , acidified to ph 2 with hydrochloric acid , and extracted with ethylacetate . the extracts are dried and concentrated . the concentrate is placed on a preparative thin layer chromatography plate and eluted with dichloromethane : methanol ( 95 : 5 ). a fraction is separated and determined to be hesperetin - 7 - carbethoxy methyl ether ## spc10 ## to a solution of 242 mg of hesperetin - 7 - carbethoxy methyl ether in 5 ml of 5 % potassium hydroxide is added 25 mg of 5 % palladium on charcoal . the resultant solution - suspension is flushed with hydrogen and stirred under a hydrogen atmosphere for 24 hours . it is then filtered through celite and acidfied with 10 % hcl . the resultant precipitate is recrystallized from benzene - methanol to give 198 mg of 2 , 6 , 3 &# 39 ;- trihydroxy - 4 - carboxymethoxy - 4 &# 39 ;- methoxydihydrochalcone as colorless needles . this product has the desirable sweetness properties set forth in example i . it is used to sweeten a variety of edible compositions , suitable sweetness resulting when : 0 . 09 % w of the dihydrochalcone is added to an otherwise sweetener - free soft drink base ; 0 . 05 % w of the product is added to a gelatin dessert base containing 1 / 2 its normal amount of sugar ; 0 . 008 % w of the product is added with 0 . 008 % of saccharin ( less than 1 / 2 the normal amount ) to a chewing gum composition ; and 0 . 008 % w of the product is added as the sole sweetener in a cough elixer . a pair of compounds chemically similar to the compounds of this invention , disclosed in hungarian patent application ci - 1196 , and having the following structure ## spc11 ## wherein r is h and na respectively , are prepared in four steps , starting with condensation ( 42 %) of commercially available 2 , 4 - dihydroxyacetophenone and isovanillin . the resultant chalcone is hydrogenated ( 40 %) to the dihydrochalcone , which is then selectively alkylated ( 41 %) with ethyl chloroacetate . hydrolysis ( 100 %) of this ethyl ester with aqueous base , followed by acidification , then gives the desired compound ( r = h ). titration with naoh gives the r = na compound . taste analysis of these compounds by a panel of investigators indicates the ( r = h ) material to have 76 times the sweetness of sucrose and the ( r = na ) material to have 81 times the sweetness of sucrose ( both on a weight basis ). panel members also indicate the presence of significant amounts of other tastes ( i . e ., bitter , salty ) in both materials .	0
in industrial production systems for gas - phase partial oxidation of a hydrocarbon - containing gas , such as production of ethylene oxide , the mixing of hydrocarbon and oxygen gases in a safe , reliable manner is a continuing problem , particularly when the gases to be mixed go through a flammable zone in the mixing process . the features of this disclosure provide improvements to a gas mixer and method of mixing gases which minimizes the probability of ignition . the mixing of the two gases is performed in a coarse water droplet environment . the coarse water droplet environment can be conceptualized as a rainstorm - like environment in the gas mixer . in a high pressure , high capacity application in which substantial amounts of water are needed , a substantial volume of water droplets are introduced into the gas mixer at high velocity , in effect creating a driving rainstorm environment at the point where the two gases are mixed . several different embodiments of a gas mixer featuring apparatus for producing the coarse water droplet environment will be described in some detail below . applications include ethylene oxide production in a gas mixer featuring a low shear co - axial gas mixing . however , the invention can be practiced in a high shear gas mixer , such as described in wo2009 / 078899 , entitled oxygen / hydrocarbon rapid ( high shear ) gas mixer , particularly for the production of ethylene oxide , the entire content of which is incorporated by reference herein . the purpose of the coarse water droplet environment is to reduce the probability of ignition of the flammable gas envelope where the two gases initially mix , or to quench an ignition should one initiate , by introducing a sufficient quantity of coarse water drops ( sauter mean diameter ( smd ) greater than 200 microns ) into the gas streams at the point of the high flammability gas envelope so as to provide enhanced mixing , wetting of the surface of any entrained particles in either the hydrocarbon stream or the oxygen stream , and a heat sink to transfer any heat generated from particle impact or particle fracture while the particle is still present in the flammable region in the mixer . in general , the gas mixer features atomizers ( coarse water droplet producing nozzles ) which are designed to produce water drops having a size & gt ; 200 microns smd . the term sauter mean diameter ( smd ) is used here to mean the diameter of a drop having the same volume / surface area ratio as the entire spray of the drops . materials of construction of the gas mixer and the water droplet generating devices may be stainless steel , monel , inconel , or other corrosion and ignition resistant metal . such metals may also be used in the highest velocity zones and the gas - distributing pipes . one application of the invention is direct oxidation ethylene oxide process mixers , which mix oxygen at intermediate pressure (˜ 20 bar ) with recycled hydrocarbon - containing gas containing ethylene and other gases . oxygen pressures are approximately ˜ 26 bar . the invention can similarly be used for other partial oxidation processes using pure oxygen or enriched air . the features of this disclosure redefines the oxygen / hydrocarbon mixing process to reduce the potential for ignition in the flammable gas envelope that exists for some distance downstream of the point of injection of oxygen into the hydrocarbon - rich stream prior to complete mixing of the oxygen - hydrocarbon stream . the invention accomplishes this by mixing the gases in the presence of a coarse water droplet environment , to provide a heat sink to dissipate the impact energy of entrained particles in either the hydrocarbon or oxygen gas streams and to quench an ignition should one occur . the invention is particularly useful for mixing oxygen into the recycle gas containing ethylene in an ethylene oxide process . the features of this disclosure provide a number of advantages and satisfy a long - felt need in the art . in particular , it allows for the injection of oxygen into a hydrocarbon - rich gas stream while minimizing the probability of igniting the gas . the advantage is particularly significant for a range of application in which gas mixing occurs at elevated pressures ( e . g . 20 bar ), which are commonly found in partial oxidation processes such as ethylene oxide production . fig1 is a schematic representation of a gas mixer featuring a coarse water droplet environment where the hydrocarbon and oxygen gases meet . the gas mixer 10 includes a hydrocarbon - containing gas manifold 12 receiving recycled gas containing hydrocarbons such as ethylene from a source along an inlet pipe 14 . one or more pipes 16 are connected to the hydrocarbon - containing gas manifold 12 . gas mixing occurs in the pipes 16 , therefore the pipes 16 function as a mixing chamber for the gas mixer 10 . mixed gases are collected in a second manifold 18 . the gas mixer 10 features a means for producing a coarse water droplet environment in the pipes 16 . in particular , water supply lines 20 are provided which supply water to atomizers ( nozzles ) 22 . the atomizers 22 are of a design to produce coarse water droplets having a smd of at least 200 microns . valves 24 are placed downstream of the atomizers 22 . two or more atomizers 22 may be provided per pipe 16 and may be placed around the periphery of the pipe 16 as shown in fig3 . an alternative is to mount the spray nozzles 22 in the wall of the pipe 16 eliminating the valves 24 . the arrangement of the nozzles can take many forms , with the water droplet sprays being coaxial with the cycle gas flow or at some angle with respect to this flow . in any event , a coarse water droplet environment is produced in the hydrocarbon - containing gas pipes 16 . oxygen is supplied to the gas mixer via an oxygen gas manifold 36 . oxygen pipes 38 , sometimes referred to in the art as “ fingers ”, are connected to the manifold 36 . the oxygen pipes 38 are coaxially located within the hydrocarbon pipes 16 . oxygen flows into the pipes 38 from the manifold 36 and flows out the distal end 35 of the pipes 38 . the mixer 10 further includes a water manifold 30 connected to a water source 31 which supplies water to pipes 32 . each of the hydrocarbon pipes 16 has one or more oxygen pipes 38 placed within it , and each oxygen pipe 38 has a water pipe 32 coaxially within it , as shown in fig1 . a nozzle 34 is placed at the end of the water pipes 32 . the nozzle 34 , which may be of a variety of configurations , produces a cone or spray of coarse water droplets . the nozzles 34 are also designed to produce water droplets 28 having a size greater than 200 microns . the tip of the nozzle 34 is positioned a substantially distance “ d ” from the end 35 of the oxygen pipe 38 . this distance d will vary depending on the application but may for example be between 1 - 5 meters for many applications . the distance d can be expressed in terms of multiples of the diameter of the oxygen pipe 38 , such as between 5 and 500 times the diameter of the oxygen pipe 38 . this design thereby ensures that entrained particles in the oxygen gas stream are wetted prior to entering the mixing zone 40 . note that the spray of water drops ( indicated at 28 ) created by the atomizers 22 is injected into the hydrocarbon - containing gas stream upstream of the mixing point 40 . in particular , the position of the nozzles 22 is such that the it is also located a substantial distance “ upstream ” of the open ends 35 of the oxygen pipe 38 to thereby ensure that entrained particles in the hydrocarbon stream are wetted prior to entering the mixing zone 40 . the coarse water drops created in the pipe 16 by both the nozzles 34 and 22 create what could be considered to be a “ driving rainstorm ” environment in the pipe 16 at the mixing zone 40 . fig4 is a more detailed illustration of the hydrocarbon and oxygen gas streams in a configuration where the oxygen pipe 38 has a closed end and the oxygen gas flows out through radial holes 42 formed in the walls of the pipe 38 . fig4 shows the coarse water droplets 28 a and 28 b created in both gas streams . the oxygen pipe 38 has transverse holes 42 through which the oxygen gas and water droplets 28 b flows out of the pipe . the mixing zone where the oxygen gas / water droplet stream mixes with the hydrocarbon - containing gas stream and water droplets 28 a is indicated at 40 . the end 35 of the oxygen pipe 38 is closed and in the form of a cone in this embodiment with the holes 42 providing for egress of oxygen gas and water droplets . the pipes 16 and the manifold 18 may have a drain ( not shown ) for collecting accumulated water and conducting the water from the pipes 16 and the manifold 18 . additionally , downstream there may be a device for removing water injected into the mixed gas stream . in operation , hydrocarbon - containing gas enters manifold 12 where it is divided into one or more independent pipes 16 . an oxygen - containing stream , preferably pure oxygen , enters manifold 36 where the stream is divided into one or more pipes 38 , smaller than and concentric with pipes 16 . concentric pipes 38 extend some distance down the outer pipe 16 as determined by engineering calculations to be optimal for mixing and separation of the mixing zone 40 where the oxygen - containing gas mixes with the hydrocarbon - rich gas . in addition , a water stream enters manifold 30 . the manifold is connected to the proximal ends of one or more pipes 32 . the water pipes 32 are smaller in diameter and concentrically located within the oxygen pipe 38 , which are concentric in pipes 16 . each oxygen pipe 38 has one water pipe 32 located within it . at the end of pipes 32 are affixed atomizing nozzles 34 designed for producing a spray of coarse water droplets having a droplet size of at least 200 microns smd . the nozzle 34 at the end of pipe 32 terminates a substantial distance from the end of pipe 38 so as to cause the oxygen - containing gas to pass through a coarse water droplet environment before it mixes with the hydrocarbon - rich gas in the pipe 16 . as noted above , in addition to the coarse water droplet injected into the oxygen stream , water is introduced into the pipe 16 through one or more atomizing nozzles 22 such that a coarse water droplet environment is present in hydrocarbon - containing gas stream in the pipe 16 at the mixing point 40 . particles traveling with either the hydrocarbon - containing gas stream or the oxygen gas stream are wetted by the coarse water droplets , reducing the impact energy of the particle if it were to strike a surface of either pipe 16 or pipe 38 . the water droplets also enhance heat transfer away from the particle and quench an ignition , if one should occur . the oxygen / hydrocarbon - containing gas mixture is re - gathered in manifold 18 for transfer to an optional downstream water removal processing station for removal of liquid water vapor from the collected gases , prior to entering a reactor located further downstream . fig2 is an end view of two of the pipes 16 carrying the hydrocarbon - containing gas shown in fig1 with coarse water droplets indicated at droplets 28 a present in the hydrocarbon - containing gas stream due to atomizers 22 and also droplets 28 b present in the oxygen gas stream due to nozzles 34 . while in fig2 there is one oxygen pipe 38 per hydrocarbon pipe 16 , this may of course vary , e . g ., depending on the size and number of hydrocarbon pipes 16 in the gas mixer . for example , there may be 2 , 3 or more oxygen pipes per hydrocarbon pipe 16 , each containing a water pipe and nozzle . fig3 is an illustration of an alternative configuration of the nozzles 22 which inject a spray of water droplets into the hydrocarbon - containing gas pipe 16 . in fig3 , the nozzles 22 are distributed around the periphery of the pipe 16 . while three nozzles 22 are shown , the number may vary depending on the size of the pipe 16 and the velocity and distribution of the coarse water droplets produced by the atomizing nozzles 22 . furthermore , nozzles could be spaced along the length of the pipe 16 . the optional downstream water removal processing station may use a pressure vessel column to coalesce water vapor out of the mixed oxygen / hydrocarbon - containing gas stream . the recovered water may be processed by a carbonate scrubber to removed dissolved co 2 from the recovered water and a water wash column to remove particulate matter , salts , and other impurities from the recovered water and recycle the water back into the water supplies of fig1 . suitable nozzles for use as the atomizers 22 and the nozzles 34 are available from suppliers such as bete fog nozzle inc ., greenfield mass ., or spraying systems co ., wheaton ill . a variety of types of devices can use used for creating the coarse water droplets , including single fluid spray nozzles , dual - fluid spray nozzles , ultrasonic devices for creating a spray of drops , or other means known in the art . the preferred nozzles produce water droplets having a size between 200 microns and 3000 microns smd . fig5 is an illustration of a gas mixer 10 having a coarse water droplet environment . the construction and arrangement of the embodiment of fig5 differs from fig1 in several respects , including nozzles producing water drops in a coaxial direction in the hydrocarbon pipes 16 , and a water manifold 30 a which is located within the oxygen gas manifold 36 . in particular , the gas mixer 10 includes a first water manifold 30 a connected to a source of water which is located within the oxygen manifold 36 . water pipes 22 a are connected to the water manifold 30 a and have a spray nozzle 34 placed at the end thereof . the water pipes 22 a are positioned within the oxygen pipes 38 . a second water manifold 30 b is connected to a source of water . a second set of water pipes 22 b are connected to the manifold 30 b and placed within the hydrocarbon pipe 16 adjacent to the oxygen pipes 38 . coarse water drops 28 are injected into the hydrocarbon - containing gas stream by means of nozzles 34 positioned at the end of the water pipes 22 b . coarse water drops 28 are injected into the oxygen gas stream by means of nozzles 34 positioned at the ends of the water pipes 22 a . the water drops serve to wet entrained particles in either the hydrocarbon or oxygen - containing gas streams . thus , mixing of the oxygen - containing gas stream with the hydrocarbon - containing gas stream occurs downstream of the ends of the oxygen pipes 38 in a coarse water drop environment due to the spray of drops produced by the nozzles 34 in the pipe 16 and the nozzles in the water pipes positioned within the oxygen pipe 38 . the gas to liquid mass ratio for the gas mixers of this disclosure is in the range of 0 . 005 to 1 to 3 to 1 . in both example 1 and example 2 , the water drops are preferably injected into hydrocarbon - containing gas stream and into the oxygen gas stream upstream of the mixing point where the oxygen and hydrocarbon - containing gases meet a distance “ d ” which is between 5 and 500 times the diameter of the oxygen pipes 38 . the term “ coarse water droplet ” is intended to encompass water droplets having a size having a size greater than 200 microns smd , e . g ., droplets between 200 microns and 3000 microns smd . in one embodiment , the temperature of the water used to produce the coarse water droplets is at ambient temperature . in an alternative embodiment , the water temperature is heated above ambient . for example , the water is heated to the temperature of the hydrocarbon - containing gas stream . in an eo production scenario , the temperature of the hydrocarbon recycle gas stream is typically between about 35 - 40 degrees c . and 65 - 70 degrees c . the water that is supplied to the spray nozzles can be either at ambient temperature , or water which has been heated to a temperature of between 35 and 70 degrees c . while presently preferred embodiments have been described with particularity , variation from the specifics of the disclosed embodiments may be made without departure from the scope of the invention . all questions concerning scope of the invention are to be determined by reference to the appended claims .	2
the sewage sludge which has been dewatered , e . g . in a chamber filter press , up to a dry solids content of about 25 % will be introduced first into a box - type feeder ( 1 ) serving as temporary storage . this feeder , a drag chain conveyer with box - type top , offers a controlled discharge of the filter cake and thereby determines at the same time the thruput capacity of the installation . the box - type feeder is placed above a furnace which is shown here as an overlying bed kiln ; ( 3 ). the conveying system ( 2 ) following the box - type feeder offers the possibility to by - pass the drier ( 4 ) and to feed the filter cake directly to the kiln ( 3 ). according to the correct operation procedure , there now follows the twin - shaft mixer ( 6 ). here the dry solids content ( ds - content ) which is required for the combustion will be adjusted by adding material ( 7 ) which has been dried up to a content of about 95 % dry solids . with the addition of dried material ( 7 ) the glueing phase can be skipped and thereby the drying process be secured . in the disc drier ( 4 ) which is heated indirectly with thermal oil ( 8 ) only that amount of filter cake material is dried which corresponds to the desired furnace capacity . the thermal oil is heated within the second flue gas recuperator ( 11 ) following the furnace ( 3 ). eventual excess heat within the thermal oil circuit ( 8 ) is carried off within the recooling unit ( 12 ). in the version presented in the flow diagram , the exhaust vapours ( 9 ) of the drier ( 4 ) are introduced jointly with the flue gas / exhaust vapours mixture ( 16 ) and the combustion air ( 13 ) via the first recuperator ( 14 ) into the lowest bed ( 15 ) of the overlying bed kiln ( 3 ). the mixture is pre - heated in the first recuperator ( 14 ) by the flue gas ( 17 ) of the overlying bed kiln ( 3 ). the overlying bed ( 3 ) kiln is equipped with an integrated post - combustion stage ( lowest bed 15 ) for the incineration of the filter cakes . the upper beds of the kiln serve for an additional drying of the filter cakes and the lower beds for the combustion and the cooling of ashes . alternatively to the overlying bed ( 3 ) kiln a fluidized bed furnace can be used . the exhaust vapours ( 9 ) of the drier ( 4 ) heated in the first recuperator ( 14 ) are introduced into the lowest bed ( 15 ) where they cool the ashes . with releasing of the heat included in the filter cakes , the temperature of the flue gas ( 17 ) jumps up to about 900 ° c . the cooling air ( 20 ) necessary for cooling of the tube shaft ( 18 ) and the stirring arms ( 19 ) serves as combustion air . the cooling air ( 21 ) which has a temperature of about 160 ° c ., when leaving the tube shaft , is introduced jointly with the aforementioned exhaust vapours / flue gas mixture into the lowest bed of the kiln with overlying beds via the first recuperator ( 14 ). when a support firing , i . e . additional heat , is required for the incineration , this heat will be introduced into the combustion zone by means of forced - air gas burners ; these are activated and switched off or regulated in capacity automatically in dependance of the pre - set temperature . in order to meet the requirements of the incineration process as well as possible the system provides an adjustable motorized rabble unit . the ashes produced in the overlying kiln ( 3 ) are discharged via a chute ( 22 ) and a screw conveyer ( 23 ) and transported by a bucket elevator ( 24 ) into the ash silo ( 25 ). the flue gas ( 17 ) leaves the combustion zone of the overlying bed kiln ( 3 ) at a temperature of approximately 900 ° c . and serves to heat the air mixture and the thermal oil in the following recuperators ( 11 , 14 ). the flue gas thereby is cooled down to approx . 260 ° c . prior to this , a reduction of nitrogen oxides is initiated by introducing of ammonia ( 26 ) into the combustion zone by means of fuses . the flue dust ( 27 ) escaping with the flue gas ( 17 ) from the overlying bed kiln ( 3 ) is separated in the recuperators ( 11 , 14 ) in a smaller degree and mainly in the following cyclone ( 28 ) and the electric filter ( 29 ). from here the ashes are conveyed via cellular wheel sluices ( 30 , 31 ) and collecting screws ( 23 ) to the bucket elevator ( 24 ) and ash silo ( 25 ). besides dedusting of flue gases in the recuperators ( 11 , 14 ), cyclone ( 28 ) and electric filter ( 29 ) the flue gases are treated further in a two - stage flue gas washer ( 32 , 33 ). the main task of the flue gas washer , besides cooling down the gases from approx . 260 ° c . to approx . 60 °- 80 ° c ., consists in the removal of harmful substances . in the washers which are operated with acidified water ( 32 ) or alkalified water ( 33 ), heavy metals and harmful gases , e . g . hcl , so 2 and mercury , are separated . the flue gas washers have an internal water circuit and are operated with secondary effluent . the water now including a high concentration of ashes , hydroxides and salts , is introduced into a neutralisation tank ( 34 ) and from there continually to a wastewater treatment ( 35 ) from which the resulting residue is delivered to furnace ( 43 ) to be heated together with the high temperature combustion which melts solids . the mercury settles on the bottom of the washers ( 36 , 37 ) and is extracted from there in batch quantities into special collecting tanks . the saturated flue gases ( 38 ) leaving the the washers and being cooled down below dew point temperature are heated to somewhat more than 120 ° c . in a heat exchanger ( 39 ) being placed between the electric filter and the washers . an unduced - draught blower ( 42 ) following the heat exchanger helps to overcome the resistances in the installation and pushes the flue gases through an activated charcoal filter ( 40 ) in the chimney ( 41 ). with the use of an activated charcoal filter ( 40 ), the requirements to limit the dioxine and furane compounds as far as possible are complied with . the charged activated charcoal can be disposed of in the overlying bed kiln ( 3 ). if the activated charcoal shall be regenerated thermally , the vapors originated here are introduced into the high - temperature combustion described above . the ashes and flue dust collected in the silo ( 25 ) are fed to a melting furnace ( 43 ) by means of a proportioning screw ( 51 ). the melting furnace ( 43 ) can be an arc furnace or a furnace with a plasma torch . during melting of the whole ashes all heavy metals ( with the exception of mercury ) are bound into the melted mass . due to the high melting temperature of more than 1200 ° c . it is possible thermally break dioxines and furanes at the same time . the melted ashes are cooled in a following water bath ( 44 ) where they form granules ( 45 ) which then are stored in a temporary storage ( 46 ) before they are discharged . the heat resulting from cooling - down of the granules causes the formation of exhaust vapours . it is possible to recover this heat by means of a condensate cooling unit ( 50 ) and then use it to heat the digestion tower . the exhaust vapours from the melting furnace ( 43 ) are treated again in a two - stage washer ( 47 , 48 ). the resulting wastewater ( 49 ) can be treated in the same treatment plant where the water from the flue gas washers ( 32 , 33 ) is treated . here mercury is settling too and can be discharged from below .	2
the preparation of the mixture of the two active compounds was carried out with the aid of a tumble mixer ( turbula mixer ; w . a . bachofen ag basle ). the soft pellets were prepared by transferring the fine active compounds to the bottom container of a sieve tower for particle size analysis ( retsch , frg ), and the container was exposed to vibrations until round active compound agglomerates resulted . two parts by weight of disodium cromoglycate and one part by weight of reproterol hydrochloride . the soft pellets were obtained according to the procedures of gb 1 , 569 , 612 and gb 1 , 520 , 247 . three parts by weight of disodium cromoglycate and two parts by weight of reproterol hydrochloride . 100 g of formulation are carefully tipped into a measuring cylinder . the volume read off represents the bulk volume . the filled measuring cylinder is attached to a compacted volume meter . 20 compactions are carried out . the volume read off represents the compacted volume ( see also voigt r ., lehrbuch der pharmazeutischen technologie [ textbook of pharmaceutical technology ], verlag chemie , 5th edition , page 148 ). the hausner factor is the ratio of bulk volume to compacted volume . the bed height was determined with the aid of a cylinder of diameter 42 mm , powder slowly being tipped in until a heap of maximum height resulted , whose height was measured . redispersion was determined with the aid of an inhaler and of a cascade impactor , by determining the contents in percent based on the initial weight which had been deposited on the second to fourth cascade . this experiment was carried out using two different volume flows . 266 . 8 g of micronized disodium cromoglycate and 133 . 2 g of micronized reproterol hydrochloride are sieved through a sieve of mesh width 0 . 125 mm and then added to a diosna mixer pwc dierks und söhne , osnabrück frg ). 600 . 0 g of commercially available lactose having a grain size distribution of 100 %& lt ; 800 μm , 12 %- 35 %& lt ; 400 μm and max 7 %& lt ; 200 μm are added thereto . mixing is then carried out for 30 min . the core agglomerates thus resulting are readily flowable and can be filled into an inhaler . the properties of these core agglomerates can be seen from experiment 1 ( page 8 ). 3000 g of micronized disodium cromoglycate and 200 . 0 g of micronized reproterol hydrochloride are sieved through a sieve of mesh width 0 . 125 mm and then added to a tumble mixer ( turbula mixer ; w . a . bachofen ag basle ). 500 . 0 g of commercially available lactose having a grain size distribution of 100 %& lt ; 800 μm , 12 %- 35 %& lt ; 400 μm and max 7 %& lt ; 200 μm are added thereto . mixing is then carried out for 30 min . the core agglomerates thus resulting are readily flowable and can be filled into an inhaler . the properties of these core agglomerates can be seen from experiment 2 ( page 9 ). 266 . 8 g of micronized disodium cromoglycate and 133 . 2 g of micronized reproterol hydrochloride are sieved with the aid of a 0 . 125 mm sieve and then added to a fluidizing mixer ( fukae powtec corporation , japan ). 600 . 0 g of commercially available sodium chloride having an average grain size of 300 μm are added thereto . mixing is then carried out for 10 min . the core agglomerates thus resulting are readily flowable and can be filled into an inhaler . 30 g of micronized budesonide are sieved with the aid of a 0 . 125 mm sieve and then added to a tumble mixer ( tubula mixer ; w . a . bachkofen [ sic ] ag , basle ). 270 g of commercially available lactose having a grain size distribution of 100 %& lt ; 800 μm , 12 %- 35 %& lt ; 400 μm and at most 7 %& lt ; 200 μm are added thereto . mixing is then carried out for 45 min . the core agglomerates thus resulting are readily flowable and can be filled into an inhaler , a cartridge or blister packs . 100 g of micronized salbutanol are sieved with the aid of a 0 . 125 mm sieve and then added to a tumble mixer ( tubula mixer ; w . a . bachkofen ag , basle ). 300 g of commercially available lactose having a grain size distribution of 100 %& lt ; 800 μm , 12 %- 35 %& lt ; 400 μm and at most 7 %& lt ; 200 μm are added thereto . mixing is then carried out for 45 min . the core agglomerates thus resulting are readily flowable and can be filled into an inhaler , a cartridge or blister packs . 20 g of micronized hecclometasone - 17 , 21 - dipropionate are sieved with the aid of a 0 . 125 mm sieve and then added to a tumble mixer ( turbula mixer ; w . a . bachofen ag , basle ). 380 g of commercially available lactose having a grain size distribution of 100 %& lt ; 800 μm , 12 %- 35 %& lt ; 400 μm and at most 7 %& lt ; 200 μm are added thereto . mixing is then carried out for 45 min . the core agglomerates resulting in this way are readily flowable and can be filled into an inhaler , a cartridge or blister packs . 20 g of micronized ipratropium bromide are sieved with the aid of a 0 . 125 μm sieve and then added to a tumble mixer ( turbula mixer ; w . a . bachofen ag , basle ). 380 g of commercially available lactose having a grain size distribution of 100 %& lt ; 800 μm , 12 %- 35 %& lt ; 400 μn and at most 7 %& lt ; 200 μm are added thereto . mixing is then carried out for 45 min . the core agglomerates resulting in this way are readily flowable and can be filled into an inhaler , a cartridge or blister packs .	0
the inspection system illustrated in fig1 and 2 are disclosed in parent application ser . no . : 07 / 890 , 863 filed jun . 1 , 1992 . referring in detail to fig1 there is illustrated a conveyor 10 moving in the direction of arrow a having a plurality of uncapped , open - topped spaced containers c ( e . g . plastic beverage bottles of about 1500 c . c . volume ) disposed thereon for movement seriatim through a test station 12 , reject mechanism 28 and conveyor 32 to a washer system . to achieve higher test rates containers c could be touching each other rather than spaced . the contents of containers c would typically include air , volatiles of residues of contaminants , if any , and volatiles of any products such as beverages which had been in the containers . an air injector 14 which is a source of compressed air is provided with a nozzle 16 spaced from but aligned with a container c at test station 12 . that is nozzle 16 is disposed outside of the containers and makes no contact therewith . nozzle 16 directs compressed air into containers c to displace at least a portion of the contents of the container to thereby emit a sample cloud 18 to a region outside of the container being tested . as an alternative to compressed air , co 2 gas could be utilized as the injected fluid . also the compressed air or co 2 gas could be heated to enhance volatility of the compounds being tested . the column of injected air through nozzle 16 into a container c would be typically of the order of about 10 c . c . for bottle speeds of about 200 to 1000 bottles per minute . a rate of 400 bottles per minute is preferable and is compatible with current beverage bottle filling speeds . the desired test rate may vary with the size of the bottles being inspected and filled . of course the bottles could be stationary or moving slower than 200 bottles per minute and the system would still work . only about 10 c . c . of the container contents would be displaced to regions outside of the bottle to form sample cloud 18 . also provided is an evacuator sampler 22 which may comprise a vacuum pump or the like coupled to a sampling tube or conduit 20 . the tube is mounted near , and preferably downstream ( e . g ., about 1 / 16 inch ) of the air injector 14 so as to be in fluid communication with sample cloud 18 adjacent to the opening at the top of containers c . neither nozzle 16 nor tube 20 contacts the containers c at test station 12 ; rather both are spaced at positions outside of the containers in close proximity to the openings thereof . this is advantageous in that no physical coupling is required to the containers c , or insertion of probes into the containers , which would impede their rapid movement along conveyor 10 and thus slow down the sampling rate . high speed sampling rates of from about 200 to 1000 bottles per minute are possible with the system and method of the present invention . the conveyor 10 is preferably driven continuously to achieve these rates without stopping or slowing the bottles down at the test station . a bypass line 24 is provided in communication with the evacuator sampler 22 so that a predetermined portion ( preferably about 90 %) of the sample from cloud 18 entering tube 20 can be diverted through bypass line 24 . the remaining sample portion passes to a residue analyzer 26 , which determines whether specific substances are present , and then is exhausted . one purpose of diverting a large portion of the sample from cloud 18 is to reduce the amount of sample passing from evacuator sampler 22 to residue analyzer 26 in order to achieve high speed analysis . this is done in order to provide manageable levels of samples to be tested by the residue analyzer 26 . another purpose for diverting a portion of the sample is to be able to substantially remove all of sample cloud 18 by evacuator 22 from the test station area and divert the excess through bypass line 24 . in a preferred embodiment the excess portion of the sample passing through bypass line 24 returned to air injector 14 for introduction into the subsequent containers moving along conveyor 10 through nozzle 16 . however , it would also be possible to simply vent bypass line 24 to the atmosphere . it should be understood that sample cloud 18 could be analyzed in situ without transporting it to a remote analyzer such as 26 . it could also be transported to analyzer 26 by blowing rather than sucking . a microprocessor controller 34 is provided for controlling the operation of air injector 14 , evacuator sampler 22 , residue analyzer 26 , a reject mechanism 28 and an optional fan 15 . container sensor 17 including juxtaposed radiation source and photodetector is disposed opposite a reflector ( not shown ) across conveyor 10 . sensor 17 tells controller 34 when a container arrives at the test station and briefly interrupts the beam of radiation reflected to the photodetector . optional fan 15 is provided to generate an air blast towards sample cloud 18 and preferably in the direction of movement of containers c to assist in the removal of sample cloud 18 from the vicinity of test station 12 after each container c is sampled . this clears out the air from the region of the test station so that no lingering residues from an existing sample cloud 18 can contaminate the test station area when successive containers c reach the test station for sampling . thus , sample carryover between containers is precluded . the duty cycle for operation of fan 15 is controlled by microprocessor 34 as indicated diagrammatically in fig1 . preferably fan 15 is continuously operating for the entire time the rest of the system is operating . a reject mechanism 28 receives a reject signal from microprocessor controller 34 when residue analyzer 26 determines that a particular container c is contaminated with a residue of various undesirable types . reject mechanism 28 diverts contaminated rejected bottles to a conveyor 30 and allows passage of uncontaminated , acceptable bottles to a washer ( not shown ) on a conveyor 32 . an alternative option is to place the bottle test station downstream of the bottle washer in the direction of conveyor travel , or to place an additional test station and sample and residue analyzing system after the washer . in fact it may be preferable to position the test station and system after the washer when inspecting bottles for some contaminants . for example , if the contaminant is a hydrocarbon , such as gasoline which is insoluble in water , it is easier to detect residues of hydrocarbon after the bottles have been washed . this is because during the washing process in which the bottles are heated and washed with water , water soluble chemical volatiles are desorbed from the bottles by the heating thereof and then dissolved in the washing water . certain hydrocarbons , on the other hand , not being water soluble , may then be sampled by a sampler 22 downstream of the washer , to the exclusion of the dissolved , water - soluble chemicals . therefore , the detection of such hydrocarbons can be performed without potential interference from other water soluble chemicals if the bottles pass through a washer before testing . referring to fig2 there is illustrated a specific embodiment of a nitrogen compound detector system for use with the sampling and analyzing system of fig1 wherein like reference numerals refer to like parts . as illustrated , a nozzle 16 is provided for generating an air blast which passes into a container ( not shown ) being inspected . the air passing through nozzle 16 may be heated or unheated it being advantageous to heat the air for some applications . juxtaposed to the nozzle 16 is sample inlet tube 20 including a filter 40 at the output thereof for filtering out particles from the sample . suction is provided to tube 20 from the suction side of pump 82 connected through an analyzer 27 . a portion of the sample ( for example , 90 - 95 % of a total sample flow of about 6000 c . c . per minute ), as described in connection with fig1 is diverted through a bypass line 24 by means of connection to the suction side of a pump 46 . pump 46 recirculates the air through an accumulator 48 , a normally open blast control valve 50 , and back to the air blast output nozzle 16 . a backpressure regulator 54 helps control pressure of the air blast through nozzle 16 and vents excess air to exhaust 57 . blast control valve 50 receives control signals through line 50a from microprocessor controller 34 to normally maintain the valve open to permit the flow of air to the nozzle . electrical power is provided to pump 46 via line 46a coupled to the output of circuit breaker 76 which is in turn coupled to the output of ac filter 74 and ac power supply ps . the detector assembly 27 in the embodiment of fig2 is an analyzer which detects the residue of selected compounds such as nitrogen containing compounds in the containers being inspected by means of a method of chemiluminescence . this type of detector is generally known and includes a chamber for mixing ozone with nitric oxide , or with other compounds which react with ozone , in order to allow them to react , a radiation - transmissive element ( with appropriate filter ), and a radiation detector to detect chemiluminescence from the products of reaction . for example , when no , produced from heating nitrogen compounds ( such as ammonia ) in the presence of an oxidant ( e . g . oxygen in air ), chemically reacts with the ozone , characteristic light emission is given off at predetermined wavelengths such as wavelengths in the range of about 0 . 6 to 2 . 8 microns . selected portions of the emitted radiation of chemiluminescence , and its intensity , can be detected by a photomultiplier tube . accordingly , in the system of fig2 ambient air is drawn in through intake 60 and air filter 62 to an ozone generator 64 . ozone is generated therein , as by electrical discharge into air , and is output through ozone filter 66 and flow control valve 68 to the detector assembly 27 wherein it is mixed with samples from containers input through intake tube 20 , filter 40 , flow restrictor 42 , and converter 44 . the sample from intake tube 20 is passed through a converter 44 , such as an electrically - heated nickel tube , in which the temperature is raised to approximately 800 ° c . to 900 ° c . before being input to detector assembly 27 . temperatures in the range of 400 ° c . to 1400 ° c . may also be acceptable . when nitrogen - containing compounds such as ammonia are so heated , no ( nitric oxide ) is produced , and the nitric oxide is supplied to the chamber of the detector assembly 27 . compounds other than no which may react with o 3 and chemiluminescence may also be produced in converter 44 e . g ., organic compounds derived from heating of gasoline or cleaning residue . a temperature controller 70 supplied with electrical power through a transformer 72 is used to control the temperature of converter 44 . the samples in the detector assembly 27 after passage through its chamber are output through an accumulator 85 and pump 82 to an ozone scrubber 56 , and to an exhaust output 57 in order to clear the residue detector for the next sample from the next container moving along the conveyor 10 of fig1 . ( as indicated above , an ( optional ) fan , not shown in fig2 may be employed to help clear any remaining sample cloud from near the sample inlet tube 20 .) outputs from detector assembly 27 relating to the results of the tests are output through a preamp 84 to microprocessor 34 which feeds this information in an appropriate manner to a recorder 83 . the recorder 83 is preferably a conventional strip recorder , or the like , which displays signal amplitude vs . time of the sample being analyzed . the microprocessor 34 may be programmed to recognize , as a &# 34 ; hit &# 34 ; or the detection of a specific residue , a signal peak from a photodetector of the detector assembly 27 which is present in a predetermined time interval ( based on the sensed arrival of a container at the test station ) and whose slope and amplitude reach predetermined magnitudes and thereafter maintain such levels for a prescribed duration . the microprocessor controller 34 also has an output to a bottle rejector 28 to reject contaminated bottles and separate them from bottles en route to a washer . a calibration terminal 86 is provided for residue analyzer 27 for adjusting the high voltage supply 26a associated with the detector assembly . also provided is a recorder attenuator input terminal 88 connected to the microprocessor controller 34 for adjusting the operation of the recorder . detector assembly 27 receives electrical power from the high voltage supply 26a . additional controls include operator panel 90 including a key pad and display section permitting an operator to control the operation of the detector assembly 27 in an appropriate fashion . dc power is supplied to all appropriate components through dc power supply 78 coupled to the output of power supply ps . an optional alarm enunciator 80a is provided for signaling an operator of the presence of a contaminated container . alarm enunciator 80a is coupled to the output of microprocessor controller 34 via output control line 80c . a malfunction alarm 80b is also coupled to microprocessor controller 34 for receiving fault or malfunction signals such as from pressure switch 58 or vacuum switch 87 when pressures are outside of certain predetermined limits . other safety devices may be provided such as vacuum gauge 89 , and back pressure control valve 54 for ensuring proper operation of the system . most components of the entire system of fig2 are preferably enclosed in a rust - proof , stainless steel cabinet 92 . the cabinet is cooled by a counter - flow heat exchanger 91 having hermetically separated sections 91a and 91b in which counter air flow is provided by appropriate fans . the system illustrated in fig2 is housed within a stainless steel rectangular cabinet 92 for enclosing the majority of the components of fig2 in a hermetically sealed environment . other forms of high speed analyzers , such as electron capture detectors or photoionization detectors , may be suitable in place of the chemiluminescence analyzer described with reference to fig2 . one preferred detector is a pulsed fluorescence gas analyzer of the type described in u . s . pat . no . 3 , 845 , 309 ( helm et al ), whose disclosure is incorporated herein by reference to that patent . in such analyzers gaseous samples drawn into a chamber and illuminated by radiant energy from a flash - tube fluoresce and emit radiation which is detected by a photodetector . as set forth in more detail hereafter , it has been found that an analyzer of the type referred to in the &# 39 ; 309 patent , such as a model 43 pulsed fluorescence so 2 analyzer available from thermo environment instruments , inc . of franklin , mass ., when modified by removal of physical / chemical filters , becomes a highly sensitive detector of certain hydrocarbons such as polycyclic aromatic hydrocarbons present in gasoline and other petroleum products . the modified fluorescent gas analyzer may be used as the residue analyzer 26 in the systems of fig1 and fig2 ( in the latter system no ozone generator 64 or ozone - handling components would be needed , and preferably a converter 44 would also be unnecessary .) also , the sample sucked into the tube 20 may be separated into two or more streams and input to a plurality of analyzers rather than the single analyzer 26 shown in fig1 with each analyzer 26 being used to detect different types of contaminants . it is also possible to use as one or more of the analyzers a different type of analyzers than analyzer 27 ( fig2 ) which pretreats the sample in converter 44 . in that case , if analyzer 27 is employed to detect contaminants in one stream , part of the sample would be routed to the different type of analyzer and part to converter 44 . in addition the materials to be inspected are not limited to substances in containers . for example , the method and system of the present invention could be used to detect volatiles adsorbed in shredded strips or flakes of resins , or plastic stock to be recycled for manufacturing new plastic beverage bottles . this shredded or flaked plastic stock could be placed directly on a conveyor belt 10 and passed through test station 12 of fig1 ; or the plastic stock could be placed in baskets , buckets or other types of containers disposed thereon and inspected in batches . other materials which could be inspected according to the method and system of the invention include various foodstuffs such as fish being monitored for amines , pharmaceutical products and herbicides being checked for reagents , rubber products such as tires being monitored for chemicals such as blowing agents , web materials such as paper in a paper mill being checked for acids , and even clothing worn by persons being inspected for volatile compounds such as explosives or drugs . such materials may be inspected while passing through a test station on a conveyor , either within open containers or in the absence of containers . in the latter case high flow rates and / or heating of the compressed air or other fluid directed at the material by the nozzle 16 may be in order to obtain desired samples of the volatile substances to be detected . still further the bottles being tested may be new bottles that have never been filled with a beverage . thus , new bottles could be tested for excessive acid aldehyde content , which may be a byproduct of the manufacturing process . in the system of fig2 a suction pump or by - pass pump 46 is used to pull approximately 8 liters / minute of sample air into a sampling head and past the inlet tubes 20 of the chemiluminescence subsystems . two chemiluminescence subsystems may also be employed , each aspirating 0 . 25 to 0 . 5 liters / minute of air sample through flow lines ( split from tube 20 ) and preferably through separate converters . the rest of the 8 liters / minute passes through the by - pass pump 46 and is not analyzed . the intended purpose of the system of fig2 is to detect a variety of contaminants , including nitrogen compounds such as salts of ammonia and amines , and hydrocarbons such as gasoline , diesel fuel , and heating oil , in returned plastic beverage bottles on a conveyor . in a two subsystem arrangement one of the chemiluminescence channels may be selective for the detection of nitrogen compounds ; the other responds to a variety of hydrocarbons . the detection system illustrated in fig3 is a two subsystem arrangement which includes pulsed fluorescence enhancements to provide increased response to aromatic hydrocarbons , such as benzenes and xylenes , that occur in petroleum products such as gasoline , diesel fuel , and heating oil , without interference from residues of the beverage products such as carbonated colas . with reference to fig3 a pulsed fluorescence detector assembly is disposed between the by - pass line 24 and a vacuum pump 114 . the pump 114 is typically quite large and rests on the floor outside of cabinet 92 . flow from sample inlet 20 is split between converter 44 leading to chemiluminescence detector assembly 27 and line 24 to the pulsed fluorescence detector assembly . the pulsed fluorescence detector assembly includes a fluorescence cell 100 , a flash lamp 102 , a high voltage supply 104 connected between the flash lamp 102 and controller 34 , a photomultiplier detector 106 connected to cell 100 , a pre - amp connected between detector 106 and controller 34 , and a high voltage supply for the detector 106 . the vacuum pump 114 draws sample vapors along line 24 through a flow restrictor 115 and cell 100 to exhaust . a line from pressure switch 58 to a pressure sensor ps in the sample inlet line 20 just downstream of filter 40 feeds a signal from that sensor to switch 58 . operation of the pulsed fluorescence detector assembly of fig3 can be readily understood by reference to the more detailed showing in fig4 of the detector assembly and its connections to the microprocessor 34 . excitation wavelengths for a xenon flash lamp 102 and detection wavelengths of the fluorescing sample are chosen to optimize sensitivity and selectivity for aromatic hydrocarbons , and to avoid detecting beverage product residues . preferred excitation wavelengths of radiation from lamp 102 are chosen to be approximately 205 nanometers by passing the radiation emitted by the xenon flash lamp through optic assembly 108 and a bandpass filter 110 . the wavelength of radiation passing to photomultiplier 106 is limited to about 320 nanometers by a bandpass filter 112 . pulsed bursts of radiation entering cell 100 through filter 110 impinge upon aromatic hydrocarbon ( ahc ) vapor molecules , and excite those molecules causing them to fluoresce . radiation of wavelength about 320 nanometers is detected by photomultiplier 106 , and this information is processed in microprocessor controller 34 to determine the presence and quantities of these aromatic hydrocarbons in the sample . a control signal can then be generated to reject contaminated containers in a system such as illustrated in fig1 . a pulsed fluorescence detector assembly of the type generally described and illustrated in connection with fig4 is similar to a commercially available unit manufactured and sold by thermo environment instruments inc . of franklin , mass . as a &# 34 ; model 43 pulsed fluorescence so 2 analyzer &# 34 ;; however , with modifications to detect aromatic hydrocarbons rather than so 2 ( sulfur dioxide ). the sample inlet system to the cell 100 includes an orifice of inner diameter about 0 . 04 cm to 0 . 3 cm , connected to the optical cell 100 at 100a by metal tube of typical inner diameter 0 . 6 cm and typical length 1 meter . downstream of the optical cell 100 is a throttle valve 113 leading to vacuum pump 114 with typical displacement 150 to 300 liters / minute . the diameter of the inlet orifice and the setting of the throttle valve 113 may be adjusted to achieve a typical mass flow rate through the cell 100 of 3 to 20 standard liters / minute at a cell pressure of 0 . 03 to 0 . 3 atmospheres . this mass flow rate also satisfies the requirements for the by - pass pump 114 and does not adversely affect the flow through , and performance of the chemiluminescence subsystem of fig3 . the pulsed fluorescence subsystem of fig3 has been found to provide sensitivity to aromatic hydrocarbons about 100 times greater than that of the chemiluminescence - based system of fig2 . discrimination against product residues of carbonated beverages is also extremely effective . under conditions where a trace level of aromatic hydrocarbon gives a signal to noise ratio of 100 , the signal from beverage product volatiles is virtually indistinguishable from background noise . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	8
the periscopic apparatus shown in the drawings comprises a stabilised gunsight head 1 associated with an aiming and observation sight tube 3 connected to the head 1 either by a ferrule 2 or by a sleeve 4 , whereby the interchangeable ferrule and sleeve traverse a supporting wall 11 belonging to a combat vehicle structure . the gunsight head 1 projects upwards in the manner of a periscope and the sight tube 3 located inside is accessible to a hidden observer . the gunsight head 1 contains a mirror 5 which is able to pivot about a sight axis 7 and which can assume any useful orientation and can then pivot about a bearing axis 8 without limitation . this mirror is controlled by a stabilisation gyroscope contained in a box 6 located in head 1 . this assembly is contained in head 1 within a casing 9 thereof , said casing being provided in front of mirror 5 with a transparent window 10 which can be closed . casing 9 is mounted so as to rotate about bearing axis 8 and pivots by servo - control under manual drift action and automatic stabilisation action about the said axis . other than stabilisation , the result of the servo - control action can be to pivot the casing 9 by an angle equal to that by which the observer has rotated mirror 5 for bearing purposes , for example by causing a precession of the corresponding gyroscope about an appropriate axis . casing 9 and all that is contained therein is pivoted relative to sight tube 3 and ferrule 2 or sleeve 4 integral with the structure 11 of the vehicle , by any desired servo - mechanism which is not shown and which will not be described in detail here . in addition to a fixed prism 3a which bends the axis of vision which coincides with the bearing axis 8 in the direction of an optical axis 12a directed towards the eyepiece or eyepieces , sight tube 3 contains a pechan prism 12 located between the said prism 3a and the said fixed eyepiece of eyepieces of sight tube 3 . the function of such a pechan prism is to maintain the horizontality of the countryside observed no matter what the sighting direction compared with the axis of travel of the vehicle in the fixed eyepieces . the servo - control means which actuate the pechan prism will be described with regard to fig5 . head 1 contains a movable galilean member 13 which can be occulted outside the path formed by the optical sighting path of axis 20 which coincides with the bearing axis 8 . when this galilean member 13 is placed on this axis between mirror 5 and prism 3a , it divides the magnification of the sight tube by it own magnification thus increasing the field of vision in the same ratio . however , when it is removed therefrom the field of observation is reduced but the nominal magnification of the sight tube is restored . thus , the optical apparatus may comprise solely the gunsight head 1 , sight tube 3 and ferrule 2 which joins the same and supports them on structure 11 in the case that the function to be fulfilled is limited solely to daytime observation with a variation of the field for successive surveillance observations and more detailed observations of the points of interest . to ensure other functions the ferrule 2 can be substituted by a sleeve 4 , whereby a nocturnal vision means 14 is contained in the same sleeve and which via a connection interface 15 can receive an external range finding unit 16 . this interface is a flanged base to which can be connected a linked flange 16a causing a lateral opening in sleeve 4 and an identical outlet opening in unit 16 to face one another . unit 16 comprises a box containing a laser emitter 17 , a laser receiver 18 and associated optical elements 19 which will be described in greater detail hereinafter . the lateral opening of base 15 faces an occultable dichroic sheet 24 and a fixed trihedron which will be described in detail hereinafter . the precise connection between flange 16a and base 15 makes it possible to install or remove the ranging unit 16 without involving any difficult problem of coincidence between the sighting axis defined by the projection of a reticule in the eyepieces of sight tube 3 and the laser light reception and emission axes , as will be shown hereinafter . moreover , sleeve 4 and its ancillary means are arranged in such a way that it is simple to combine and select ranging functions , diurnal vision and nocturnal vision . in accordance with the axis of opening 23 of base 15 and in accordance with the axis 20 of the optical path which coincides with the axis of vision in the sleeve , the feature of the dichroic sheet 24 is that it is transparent , therefore permitting the passage of visible light beams in the direction of the eyepiece of eyepieces of sight tube 3 , but reflects the laser light beams , i . e . not only directs the beam 21a from emitter 17 ( fig2 ) in the direction of mirror 5 which then directs the said beam onto a target parallel to the sighting axis , but also reflects towards receiver 18 the laser light beam returning from the target after reflection on mirror 5 . as can be seen in fig2 emitter 17 and receiver 18 offer parallel optical axes 25 and 37 . on axis 25a rhombohedron 26 reduces the centre to centre distance between the emission beam and the reception beam whose initial spacing results from the necessary physical dimensions of the emitter 17 and the receiver 18 . on the emission beam path a divergent lens 27 is followed by a total reflection prism 29 and then by a convergent lens 28 , thus forming an objective which makes afocal the laser emission path of axis 21a falling on the dichroic sheet 24 . the optical return path of axis 22b parallel to bearing axis 8 has on the corresponding optical axis 22a after reflection on sheet 24 a first convergent lens 30 , then after a semi - transparent mirror 33 and behind a subsequent diaphragm 32 a second convergent lens 31 on axis 37 which thus makes the reception path afocal . diaphragm 32 placed in the object focal plane of this reception objective defines the reception field and prevents multiple echoes in the reception of ranging signals . a source 34 located behind a condenser 35 lights up a reticule 36 placed on the focal plane of condenser 35 which coincides which that of the convergent lens 30 viewed through the semi - transparent mirror 33 . the illumination of reticule 36 forms a beam traversing sheet 24 with deflection parallel to itself returned by a trihedron 38 and then reflected by the rear face of said sheet 24 exactly onto axis 8 as shown in fig2 . such an optical diagram is suitable for an arrangement of emitter 17 and receiver 18 with their optical axes 25 and 37 located in the incident plane of dichroic sheet 24 and parallel to axis 20 . however , for dimensional reasons it may be necessary to position emitter 17 and receiver 18 differently whilst retaining their optical axes 25 and 37 in the incident plane but placing the optical axes perpendicular to axis 20 . this is shown in fig3 where prism 29 is eliminated but where the rhombohedron 26a for bringing together axes 25a and 37a , divergent lens 27a and convergent lens 28a coaxial for the emission objective , convergent lenses 30a and 31a coaxial for the reception objective , a diaphragm 32a on axis 37a as well as a semi - transparent mirror 33a , reticule system 36a , condenser 35a and the source 34a having its optical axis perpendicular to axis 37a facing mirror 33a are retained . the function of mirror 33a is the opposite to that of mirror 33 ; thus , it permits the passage of coherent light to the laser receiver but reflects the projection of the reticule . fig4 partly shows intermediate sleeve 4 and its content beneath the lower portion of the gunsight head 1 in which are solely shown mirror 5 and galilean member 13 constituted by two lenses 39 and 40 fixed in mountings perpendicular to a pivot pin 41 parallel to sighting axis 20 . these mountings are integral with the ends of pin 41 which rotates in a bearing 41a connected to the inner frame of head 1 and which can therefore move in the manner shown from position 13 into position 13a perpendicular to the said axis . pivot pin 41 is integral with a toothed segment 41b with which meshes a pinion 42a carried by the shaft of a control motor 42 which serves to insert or remove from the optical path lenses 39 and 40 . insertion corresponds to diurnal observation with an extensive field and removal to diurnal observation with a reduced field but with greater magnification . this situation of occulting the galilean system is maintained in the case of nocturnal observation both for sighting or aiming and for ranging on a target . in order to put into service the nocturnal observation function the above - mentioned device 14 is used which is mounted on a pin 47 parallel to sighting axis 20 by two arms 46a , 46b which support body 45a of said means 14 . one of the arms 46b carries a toothed segment 48b with which cooperates a pinion 48a carried by the shaft of a motor 48 . in addition , one of the arms 46a , 46b supports a geared motor 49 whose output shaft carries a drum 50 onto which can be wound a special band 51 . on winding and unwinding this band is flexible with regard to the drum but it is rigid when it is free and rectilinear . in body 45a there is slidingly mounted an intermediate bush 45b wherein slides a tube 45c which is attached to band 51 . it contains a micro - channel light amplifier 45 of per se known construction and able to detect low level light signals and to restore them in amplified manner on a rear screen 45 . the end of tube 45c carries an objective 53 and cooperates with articulated locking clamps 57 facing an armature 58 associated with a magnetic coil 56 and which is able to swing clamps 57 towards tube 45c when the telescopic device is extended . moreover , at the opposite end of the telescopic device body 45a carries a convergent optical system 55 which makes the nocturnal vision path afocal and optionally divides the magnification of the sight tube by its natural magnification in order to obtain that which is adapted to nocturnal vision . in order to permit the insertion of the nocturnal vision device 14 in sighting axis 20 which coincides with bearing axes 8 , dichroic sheet 24 is occultable and is supported by an arm 43a integral with a pivot 43 to which is fixed a toothed segment 43b which meshes a pinion 44a mounted on the shaft of a motor 44 . as can be seen in fig5 the pechan prism 12 of sight tube 3 is mounted in a toothed rim 59 which is able to rotate in all appropriate not shown guides under the action of a pinion 60 integral with the output shaft of a motor 61 . a second pinion 62 carried by the shaft of a detector 63 meshes with pinion 60 . the detector is connected by a line 64 to an amplifier 65 which controls motor 61 with the interpositioning of a changeover relay 66 placed between the outputs of detector 63 and the inputs of amplifier 65 . another detector 67 is located in gunsight head 1 with connection by toothed wheels ( only one wheel 68 is shown ) with the rotary casing 9 or any other member integral therewith or which will be directly or indirectly connected therewith in head 1 , whereby the ratio of the gear train is equal to unity . detector 67 is electrically connected to detector 63 . the gear ratio between pinions 60 and 62 is equal to unity whilst that provided between pinion 60 and rim 59 is equal to 1 / 2 . for all diurnal observations , to which correspond a first position of changeover relay 66 , prism 12 is servo - controlled in the ratio 1 / 2 to the rotation in bearing of mirror 5 and in corresponding manner erects the image viewed in the eyepiece or eyepieces . in this situation assembly 14 is obviously contracted and occulted outside the path of the light rays of the observation path whose axis coincides with axis 20 and axis 8 . for nocturnal observation device 14 is inserted in axis 20 with lateral occulting of sheet 24 , extension by the force of band 51 and members 45a , 45b and 45c followed by the locking of a member 45c in armature 58 by clamps 57 which prevents any undesired movements resulting from external accelerations or vibrations . changeover relay 66 can remain in the above position if image intensifier 45 does not introduce an optical inversion compared with diurnal vision . if inversion occurs the electrical changeover relay 66 is operated and changes position which leads to a rotation of the pechan prism 12 by a quarter of a turn . for this purpose , it is merely necessary to electrically connect the coil of relay 66 to the supply system of motors 44 , 48 , 49 when the latter are controlled in insertion and extension of the nocturnal vision system . on a signal to return to diurnal vision the reverse actions take place , i . e . the pechan prism is returned to the initial position , the telescopic members of assembly 14 are retracted and the latter is laterally occulted and , if necessary , sheet 24 is returned on axis 8 . optical inversion by controlled rotation of the pechan prism is a simpler and more advantageous solution than the introduction into system 14 of an optical erecting device which would complicate the internal arrangement of members 45a , 45b and 45c of device 14 . in order to obtain the displacement by a quarter of a turn of prism 12 it is merely necessary to displace the electrical servo - mechanism by 180 ° in accordance with the ratio 1 / 2 provided between prism 12 and detector 63 . as will be gathered from what has been stated hereinbefore , this equipment can be used for simple diurnal observation functions with double magnification if head 1 is connected to sight tube 3 by a ferrule 2 , whereby it is possible to add to these functions that of nocturnal observation by substituting for ferrule 2 a sleeve 4 which is internally provided with an occultable device 14 . in addition , such a system can be provided with an aiding or sighting and ranging function by combining with sheeve 4 a laser emitter and receiver system 16 with a reticule projector , whereby this system may or may not be linked with the existence in sleeve 4 of the nocturnal observation system 14 . if this system is present , sheet 24 is mounted on a movable support 43a which permits occulting . it is thus possible to satisfy the requirements of the least demanding users as well as users having greater or even maximum demands whereby maximum adaptability is provided . the invention is not limited to the embodiments described hereinbefore and various modifications can be made thereto without passing beyond the scope of the invention .	5
referring now to the drawings , wherein similar reference characters designate corresponding parts throughout the several views , there is generally indicated at 10 an adjustable interconnected lock assembly which can be used with the remote unlocking feature of the present invention . referring specifically to fig1 and 2 , lock assembly 10 comprises a first or lower interconnected lock assembly 18 comprising outside housing assembly 12 , rose 14 , and outside knob / lever 16 , attached from the outside of a door ( not shown ) through a first or lower bore in the door , and through a back plate assembly 20 positioned on the inside of the door , to inside housing assembly 22 . interconnect cam 24 , escutcheon assembly 28 , and inside knob / lever 26 are attached to inside housing assembly 22 on the inside of the door . although not shown , a latch assembly could be operably connected between outside housing assembly 12 and inside housing assembly 22 . interconnected lock assembly 10 also comprises a second or upper interconnected lock assembly 40 comprising a deadbolt housing assembly 42 and a deadbolt latch assembly 44 . deadbolt housing assembly 42 is attached from the outside of the door through a second or upper bore and operably connected to deadbolt latch assembly 44 , and through back plate assembly 20 and secured thereto by deadbolt plate 46 and mounting screws 48 . deadbolt housing assembly 42 is operably connected to a deadbolt pinion 50 which engages a deadbolt rack 52 connected to back plate assembly 20 as discussed in detail below . the lower interconnected lock 18 and upper interconnected lock 40 are standard configurations that are well - known in the art , and as such , the workings of these locks will not be described in detail , except as they relate to the present invention . referring now to fig3 interconnected lock 10 shown with escutcheon assembly 28 removed . back plate assembly 20 comprises a carrier component 54 vertically movable on , a slidably attached to a black plate 56 by a plurality of tangs 58 . deadbolt rack 52 is oriented vertically and fixedly attached to a carrier component 54 such that it engages pinion 50 . interconnected lock 10 is adjustable in that upper lock assembly 40 can move up or down to properly fit the upper bore of the door . deadbolt plate 46 is movable within a slot 62 in back plate 56 to allow the proper positioning of upper lock assembly 40 . upper lock assembly 40 is then secured to deadbolt plate 46 by mounting screws 48 which secure upper lock assembly 40 in a fixed position . deadbolt assembly 42 is operably connected to deadbolt pinion 50 by a driver bar 60 which is co - rotatingly attached to deadbolt pinion 50 . carrier component 54 is shown in a raised , or unlock position . when carrier component 54 is in a lowered , or locked position , a mating cam surface 64 of carrier component 54 engages cam 24 . cam 24 is attached to knob / lever 26 in a co - rotating manner such that rotation of knob / lever 26 rotates cam 24 which engages mating cam surface 64 , causing carrier component 54 to move vertically , upwardly to a raised , or unlock position . the rack 52 attached to carrier component 54 causes deadbolt pinion 50 to rotate as carrier component 54 moves either upward or downward . driver bar 60 co - rotates with deadbolt pinion 50 . rotation of driver bar 60 causes retraction and extension of a deadbolt 90 of deadbolt latch assembly 44 in a standard fashion . accordingly , as carrier component 54 moves upward , deadbolt 90 of deadbolt latch assembly 44 is retracted , allowing the door to be opened . deadbolt 90 is distinguished from standard deadbolts in that deadbolt 90 includes a cam surface at a distal end . while this cam surface is similar to cam surfaces used in standard spring latch assemblies , this cam surface only partially extends along the extended deadbolt 90 . accordingly , the door cannot be closed when the deadbolt 90 is in an extended position . however , when the deadbolt 90 is partially extended , the door can be closed as the cam surface will engage a strike plate forcing deadbolt 90 to retract . it should be noted that depression of deadbolt 90 results in deadbolt latch 44 rotating deadbolt pinion 50 in a standard manner , moving carrier component 54 to a raised position . referring now to fig4 a and 4b , escutcheon assembly 28 comprises escutcheon 30 , thumbturn 32 , and thumbturn link component 34 . thumbturn 32 is coupled to thumbturn link component 34 in a co - rotating manner through an aperture in escutcheon 30 . thumbturn link component 34 comprises at least one pin 36 which engages an aperture 38 in rack 52 , linking thumbturn 32 to carrier component 54 . it is noted that rack 52 can be positioned on either side of carrier component 54 such that a pin 36 will engage an aperture 38 in rack 52 , allowing thumbturn 32 to be appropriately attached for right and left - hand opening doors . movement of the carrier component 54 results in rotation of thumbturn 32 , and conversely , rotation of thumbturn 32 causes movement of carrier component 54 and extension and retraction of said deadbolt 90 . referring now to fig5 the back plate assembly 20 is shown in greater detail . interconnected lock 10 utilizes carrier component 54 which is biased in a downward , or locked position . accordingly , a spring carriage 72 is attached to carrier component 54 . spring carriage 72 houses a spring 74 such that one end of spring 74 is attached to the assembled spring carriage 72 / carrier component 54 and the other end of spring 74 is fixedly attached to back plate 56 . spring 74 is of sufficient strength to cause carrier component 54 to move downward to locked position and cause extension of deadbolt 90 of deadbolt latch assembly 44 . backplate assembly 20 further comprises an electronic module 66 housing a power component 68 shown as a plurality of batteries to operate an automatic locking solenoid 70 and a signal receiver 75 . electronic module 66 may also be used to power a speaker 78 or status lights 91 . in order to prevent spring 74 from returning carrier component 54 to a locked position , back plate assembly includes a catch mechanism 80 comprising a catch component 82 , a catch release 84 , and a spring trigger rod 86 as shown in fig6 a and 6b . catch component 82 and catch release 84 are each pivotally attached to back plate 56 by a pin 88 . catch release 84 is biased toward catch component 82 by catch release spring 83 . spring trigger rod 86 is affixed to carrier component 54 and moves along a guide portion 92 in catch component 82 . spring trigger rod 86 is also biased toward spring 74 . the operation of interconnected lock 10 is best described in a dynamic manner starting with carrier component 54 position in a lowered , or locked position . interconnected lock 10 includes a keyless exit feature in which enables automatic locking actuation . movement of carrier component 54 from a locked position to an unlocked position can be accomplished by either rotating inside knob / lever 26 , rotating thumbturn 32 , or by turning a key to rotate the rotating driver bar 60 of deadbolt assembly 42 , typically with a key . as carrier component 54 moves upward , spring trigger rod 86 moves upward along guide portion 92 of catch component 82 from its initial position a , shown in fig6 a . movement of carrier component 54 and attached rack 52 causes rotation of pinion 50 and driver bar 60 , retracting deadbolt 90 of deadbolt latch assembly 44 . at the end of the carrier component 54 travel , the deadbolt 90 of deadbolt latch assembly 44 is fully retracted : spring trigger rod 86 , now at position c , and catch release 84 , biased by catch release spring 83 , force a tab feature 93 of catch 82 to move underneath spring carriage 72 in a manner locking carrier component 54 in an unlocked position . spring 74 is now in an extended position , storing energy needed to extend the deadbolt 90 . at this point , further opening enclosing of the door will not affect catch mechanism 80 as the guide path of the spring trigger rod 86 does not release the spring carriage 72 . spring trigger rod 86 will move upward from position a to position c along guide path 92 of catch component 82 . when carrier component 54 moves downward , trigger spring rod 86 will move downward from position c , through position b , back to position a . spring trigger rod 86 deviates from guide path 92 in the downward direction . guide path 92 of catch component 82 is configured with a ramp portion between lowered portions generally corresponding to positions a and c . between positions a and c , trigger spring rod 86 moves up a ramp portion to a drop - off 76 shown generally adjacent to position b . in the downward direction , spring trigger rod 86 is forced by the wall of drop - off 76 to move off of catch component 82 to a position below a portion of catch release 84 . in normal operation of the lock 10 , spring trigger rod 86 will continue downward from position b and return to position a . accordingly , standard operation of the lock does not affect the catch mechanism . in order to actuate the keyless exit feature , when deadbolt 90 of deadbolt latch assembly 44 is retracted , thumbturn 32 is rotated to an intermediate position . rotation of thumbturn 32 causes thumbturn link component 34 to rotate . at least one pin 36 of thumbturn link component 34 engages rack 52 , such that rotation of thumbturn 32 causes carrier component 54 to move partially downward , partially extending deadbolt 90 . in addition , spring trigger rod 86 moves from position c to a position adjacent catch release 84 , shown as position b . referring now to fig6 b , operation of the keyless exit feature is shown . the deadbolt 90 is in a partially extended position . when a cam surface of deadbolt 90 is driven back by a strike plate of the door jamb ( not shown ) such as when the door is closed , linear movement of deadbolt 90 within deadbolt latch 44 is converted to rotation of deadbolt pinion 50 in a standard manner . rotation of deadbolt pinion 50 causes carrier component 54 to move upward , moving spring trigger rod 86 to position d , forcing catch release 84 to rotate and free catch 82 . this action allows spring carriage 74 / carrier component 54 to move downward under the force of spring 72 . as carrier component 54 moves downward , the deadbolt 90 of deadbolt latch assembly 44 is fully extended via the interaction of the deadbolt pinion 50 and rack 52 . when the keyless exit function is not in use , interconnected lock 10 will operate as a normal , or standard , interconnected lock . the remote unlocking feature of the present invention is shown in fig7 - 11 . inside housing assembly 22 houses remote unlocking mechanism 110 as best shown in fig7 . remote unlocking mechanism 110 comprises a solenoid 112 housed in an inside spindle 211 of inside housing assembly 22 . referring now to fig8 solenoid 112 includes a solenoid plunger 124 attached to a coupling bar 114 which is selectively coupled to coupling driver 116 . coupling driver 116 is coupled to an inner cam 209 by a tab portion 134 of coupling driver which matingly engages an aperture 136 on inner cam 209 . inner cam 209 is coupled through outside housing assembly 12 to outside handle 16 such that rotation of outside handle 16 causes rotation of inner cam 209 and coupling driver 116 . coupling bar 114 is biased by spring 118 away from solenoid 112 . coupling bar 114 is coupled at a first end 122 to solenoid plunger 124 . coupling bar 114 has a coupling driver engaging portion at a second end 126 . coupling driver 116 has a first recess 128 and a second interior recess 130 . second end 126 of coupling bar 114 is biased by spring 118 into second interior recess 130 of coupling driver 116 . second interior recess 130 allows coupling driver 116 . second interior recess 130 allows coupling driver 116 to be rotated without engaging second end 126 of coupling bar 114 as best shown in fig9 . in this state , the door cannot be unlocked by rotation of outside handle 16 . electrical wires 120 provide power from power component 68 of electronic module 66 to solenoid 112 . a remote signal device 98 is utilized with the remote unlocking mechanism 110 , shown in fig1 as a standard keychain transmitter of the type used to unlock cars , garages , etc . when the remote unlocking signal is received by signal receiver 75 , electrical power is provided through electrical wires 120 to solenoid 112 , actuating solenoid plunger 124 which axially moves away from coupling driver 116 . the solenoid plunger 124 axially pulls coupling bar 114 such that second end 126 engages first recess 128 of coupling driver 116 . second end 126 mates with first recess 128 to couple coupling bar 114 to coupling driver 116 in a co - rotating manner as best shown in fig1 . at this point outside handle 16 is coupled to inside handle 26 such that rotation of outside handle 16 unlocks interconnected lock 10 in the same manner as if operated by inside handle 26 . although the present invention has been described above in detail , the same is by way of illustration and example only and is not to be taken as a limitation on the present invention . accordingly , the scope and content of the present invention are to be defined only by the terms of the appended claims .	4
the invention summarized above and defined by the enumerated claims may be better understood by referring to the following description , which should be read in conjunction with the accompanying drawings in which like reference numbers are used for like parts . this description of an embodiment , set out below to enable one to practice an implementation of the invention , is not intended to limit the preferred embodiment , but to serve as a particular example thereof . those skilled in the art should appreciate that they may readily use the conception and specific embodiments disclosed as a basis for modifying or designing other methods and systems for carrying out the same purposes of the present invention . those skilled in the art should also realize that such equivalent assemblies do not depart from the spirit and scope of the invention in its broadest form . referring to the drawings , fig1 and 2 show a conduit - cutting device , indicated generally as 10 , according to the present invention . the cutting device 10 comprises a handle portion 13 and a pivotable cutting portion 15 . the handle portion 13 includes a trigger switch 18 and a housing 21 for a battery 24 . the cutting portion 15 includes a blade 27 operationally connected to a reciprocating motor 30 , and an opening 33 that enables a piece of conduit tubing to be urged into the opening 33 while cutting . in some embodiments , the motor 30 enables variable speed operation of the blade 27 . the motor 30 is powered by battery 24 through trigger switch 18 that controls power to the motor 30 . the battery 24 is connected to the motor 30 through the switch 18 . in a preferred embodiment , the battery 24 is a lithium polymer rechargeable battery or a nickel - cadmium rechargeable battery . other types of batteries can be used . a charging port for the battery 24 may also be provided . the cutting portion 15 is pivotably connected to the handle portion 13 by means of a hinge 36 so that the cutting portion 15 can be conveniently adjusted to enable cutting of conduit at any desired position . a release lever 39 on the handle portion 13 operationally engages the cutting portion to lock or release the pivotable cutting portion 15 from its in - line position . in a preferred embodiment , the release lever 39 enables the cutting portion to be locked in any desired angled position from 0 ° to 90 °. to ensure complete cutting of a conduit , a viewing window 42 may be provided in the cutting portion 15 . an operator can view the conduit through the viewing window 42 to see that the blade 27 has penetrated completely through the conduit . in some embodiments , a light 45 may be included to illuminate the viewing window . the light 45 should also be powered by the battery 24 and operate simultaneously with operation of the blade 27 . in some embodiments , the light 45 can operate independently of the blade operation . an accessory bolt - cutting device 48 may also be provided . the bolt cutting device 48 comprises a substantially crescent - shaped holding plate 51 pivotally attached to the cutting portion 15 . the holding plate 51 includes a plurality of apertures 54 sized and configured to enable bolts of varying sizes to be engaged by at least one of the apertures 54 . in a preferred embodiment , the apertures 54 may be internally threaded to hold a bolt in place . a pin 57 is provided on the holding plate 51 to enable an operator to rotate the plate about hinge 60 , so the blade 27 can engage the bolt for cutting . in use , an operator places a bolt in an appropriate aperture 54 and rotates the holding plate until the bolt engages the blade 27 . the motor is started to begin operation of the blade 27 and the operator continues to urge the bolt against the blade 27 to cut through the bolt . in a preferred embodiment , the holding plate 51 may be biased to return to the disengaged position by a spring or other means . the invention has been described with references to preferred embodiments . while specific values , relationships , materials and steps have been set forth for purposes of describing concepts of the invention , it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the basic concepts and operating principles of the invention as broadly described . it should be recognized that , in the light of the above teachings , those skilled in the art can modify those specifics without departing from the invention taught herein . having now fully set forth the preferred embodiments and certain modifications of the concept underlying the present invention , various other embodiments as well as certain variations and modifications of the embodiments herein shown and described will obviously occur to those skilled in the art upon becoming familiar with said underlying concept . it is intended to include all such modifications , alternatives and other embodiments insofar as they come within the scope of the appended claims or equivalents thereof . it should be understood , therefore , that the invention may be practiced otherwise than as specifically set forth herein . consequently , the present embodiments are to be considered in all respects as illustrative and not restrictive .	1
the present invention relates to a multimedia broadcast multicast system , and more particularly , to including configuration information of transport channels on which no service is mapped in a physical channel configuration sent to a ue , such that at the start of new services using such transport channel configurations , only the ues interested in the new services need to read configuration information related to the new services . the present invention also relates to the presence of a mac header , used for multiplexing different services onto the same transport channel , being controllable via explicit signaling , such that the mac header is included in a physical channel configuration sent to the ue when it is foreseen that the same transport channel can be shared between different services . for mbms , two additional control channels are introduced . they are the mcch and the mich ( mbms notification indicator channel ). as explained above , the mcch is mapped on the fach . the mich is a physical channel and is used to notify users to read the mcch channel . the mich is designed to allow the ues to perform a drx ( discontinuous reception ) scheme . drx allows the reduction of battery consumption for ues while allowing the ues to still be aware of any service for which a session is starting . the mich may be used to inform the ue of a change in a frequency convergence scheme , change of a configuration of a point - to - multipoint ( ptm ) bearer , switch between the ptm bearer and a point - to - point ( ptp ) bearer , etc ., which all require the mcch to be read . the mcch channel periodically transmits information regarding active services , mtch configuration , frequency convergence , etc . the ue reads the mcch information to receive the subscribed services based on different triggers . for example , the ue may be triggered after cell selection / reselection , when the ue is notified of a given service on the mich , or when the ue is notified via the dcch channel . the configuration of the mcch channel is broadcast in the system information . the mich configuration ( i . e . spreading code , scrambling code , spreading factor and other information ) is either fixed in the standard , given in the system information or broadcast on the mcch . the mcch information is transmitted based on a fixed schedule . the schedule identifies a transmission time interval ( tti ) containing the beginning of the mcch information . the transmission of the information may take a variable number of ttis . the utran transmits the mcch information in consecutive ttis . the mobile terminal ( ue ) continues to receive the sccpch until : 1 ) the ue receives all of the mcch information ; 2 ) the ue receives a tti that does not include any mcch data ; or 3 ) the information contents indicate that further reception is not required ( e . g . there is no modification to the desired service information ). based on this behavior , the utran may repeat the mcch information following a scheduled transmission in order to improve reliability . the mcch schedule is common for all services . the entire mcch information is transmitted periodically based on a “ repetition period ”. a “ modification period ” is defined as an integer multiple of the repetition period . the mbms access information may be transmitted periodically based on an “ access info period ”. this period is an integer divider of the “ repetition period ”. mcch information may be categorized as critical and non - critical information . the critical information is made up of mbms common p - t - m rb information , mbms current cell p - t - m rb information , mbms general information , mbms modified services information , mbms neighboring cell p - t - m rb information , mbms scheduling information and mbms unmodified services information . the non - critical information corresponds to the mbms access information . changes to critical information are only applied at the first mcch transmission of a modification period . at the beginning of each modification period , the utran transmits the mbms change information including , amongst others , information on mbms services whose mcch information is modified at that modification period . mbms change information is repeated at least once in each repetition period of that modification period . changes to non - critical information may take place at any time . fig9 illustrates a schedule with which the mbms change information and radio bearer information sent on mcch are transmitted . different patterned blocks indicate potentially different mcch content . an mbms notification mechanism is used to inform ues of an upcoming change in critical mcch information . notifications are based on service groups . the mapping between service ids and service groups is based on a hashing mechanism . mbms notification indicators are sent on an mbms specific pich , called the mich . a single mich frame is able to carry indications for every service - group . critical mcch information can only be changed at the beginning of a modification period . the mbms notification indicator corresponding to the service group of every affected service is set continuously during the entire modification period preceding the first change in mcch information related to a given service . subsequent changes in the mcch information in the next modification period related to the same service can be signaled on the mcch . ues which are not receiving any mbms service on mtch or p - t - p channel are free to read the mbms notification at any time . upon detecting the mbms notification indication for a service group , ues interested in a service corresponding to this group start reading the mcch at the beginning of the next modification period . the ue reads at least mbms modified services information . fig1 illustrates the timing relation between the setting of the mich and the first mcch critical information change . a diagonal line - patterned block for the mich indicates when the ni is set for the service . for the mcch , different patterned blocks indicate mcch content related to the notification of different services . ues , which are receiving mbms service ( s ) on mtch in idle mode or in a ura_pch , cell_pch , or cell_fach state read the mcch at the beginning of each modification period to receive the mbms modified services information . the mbms modified services information indicates mbms service ids and optionally an mbms session id whose mcch information is modified at that modification period . if the mbms service id , and optionally , the mbms session id , which the ue has activated , is indicated in the mbms modified services information , the ue shall read the rest of the mcch information . when a ue in cell_fach state wants to receive a ptm radio bearer , the ue first needs to receive the system information on the bcch channel , which is sent on the p - ccpch channel , to know the mcch configuration of the cell the ue has selected . therefore , the ue must know the primary scrambling code . once the ue knows the mcch channel , the ue then reads the mcch channel to obtain configuration information of the ptm radio bearers . to obtain a first starting cell , the ue may receive the primary scrambling code of the cell by dedicated messages . the ue may also perform a cell search or read stored information . alternatively , for a ue that has already selected or camped on a cell , the ue may use information regarding neighboring cells found in the system information of the cell the ue has already selected . referring to fig1 , for mbms , different mbms bearer services are mapped to different radio bearers . as shown , this is possible on different levels , e . g . by using mac multiplexing or transport channel multiplexing . in order to receive a service , it is necessary that the receiver know the configuration of the physical channels , the transport channels and the logical channels / services in case the configuration is changed due to new services being multiplexed on the same physical / transport channel . accordingly , the new services may potentially impact the reception of the already ongoing services . the mac layer allows different logical channels ( i . e . different radio bearers ) to be multiplexed onto the same transport channel . the mac layer further controls access to the physical channels , i . e . decides on the transport format combination . when different radio bearers / logical channels are multiplexed onto one transport channel , a mac header carrying an identity of the mbms service is added to distinguish the origin of the packet . presence or absence of the mac header normally impacts the size of the transport block size , and therefore the configuration of the transport formats . fig1 illustrates a case where only packets from the same logical channel are multiplexed onto a transport channel . accordingly , it is unnecessary for mac headers to be included to distinguish the origins of the different packets . fig1 illustrates an example of mac multiplexing where different services are multiplexed onto the same transport channel . this implies that for each pdu a mac header must be included to indicate the services the packet is related to , and thus the size of the packet to be transported becomes larger . fig1 illustrates and example of mac multiplexing of one logical channel including a mac header . although it is not necessary in principle , it is possible that the mac header would be included although only one service is multiplexed on the same transport channel . for different streams with different qos ( e . g . delay , block error rate , etc . ), different transport channels using specific mechanisms ( e . g . tti , coding , physical layer mechanisms ) for fulfilling the qos requirements will be used . referring to fig1 , different transport channels are shown . for each of the transport channels , different transport formats are defined that allow to adapt to , for example , the amount of data that can be sent in one tti and / or the number of blocks that can be sent . as shown in fig1 , different transport channels are multiplexed to a physical channel in a predefined scheme depending on the transport formats of the data coming from the different transport channels . in order to allow the data to be decoded , the combination of the transport channels multiplexed together must be signaled to the receiver . this is done using a tfci ( transport format combination indicator ). one different tfci value is assigned to each allowed tfc in the tfcs ( transport format combination set ), as shown in table 1 . the tfci value is sent in parallel to the transmitted data to allow the receiver to demultiplex the data in order to decode it correctly . as can be seen in table 1 , the possible combinations depend on the number of transport channels and the number of transport formats . accordingly , when the number of transport channels changes , the number of transport formats also changes . the above - stated scenario is shown in fig1 . as shown , a newly started service 2 is setup using a different transport channel and multiplexed on a physical channel already used by a service 1 . however , by setting up a new transport channel , the tfcs and the tfcis need to be changed . consequently , all ues that are only interested in the service 1 need to read the new configuration to be able to interpret the tfci correctly . the same principle applies when the service 2 is multiplexed together with the service 1 on the same transport channel . initially , a mac header is , in principle , not necessary when only one service is multiplexed onto one transport channel , as shown in fig1 . however , when another service is added , the mac header becomes necessary . accordingly , to be able to transport the same payload , the transport block size must be increased , thus making necessary a reconfiguration of the transport channel parameters . similar to the case where multiplexing is done via separate transport channels , it is necessary for a ue that is only interested in service 1 to read the new configuration when the service 2 starts . this is so even if the ue is not interested in receiving the new service ( service 2 ) at all . a physical channel configuration is sent according to a scheme , as shown in fig1 . in fig1 , a physical channel configuration is given , including a list of transport channels that are mapped onto the physical channel . for each transport channel , a list of radio bearers ( which is similar to the mbms services ) using the particular transport channel is configured . this principle is generally used to indicate the configuration of the current cell and the neighboring cell . whether a mac header is used or not is either defined in standard specifications , e . g . mac header is always used / is never used for mtch type of transport channels , or is used depending on whether one service is mapped ( in which case the mac header is not necessary ) or whether it is never used . currently , it is not possible to include configurations of transport channels that do not carry an mbms service in the physical channel configuration sent to the ue . therefore , when a new service using such a transport channel begins , the ue must read the transport channel configuration and configuration information for the new service even if the ue is not interested in the new service . it is also not possible to indicate the use of a mac header for multiplexing different services onto one transport channel when only one mbms service originally uses the one transport channel ( except for when it is decided that the mac header is never used ). accordingly , when a new service is multiplexed onto a transport channel previously used by another service , the ue must read an additional transport channel configuration to account for the new service even if the ue is not interested in the new service . therefore , what is needed is a method that reduces the number of times the ues read configuration information for services they are not interested in . in the prior art , it is not possible to indicate the configuration of transport channels on which no radio bearers ( mbms services ) are mapped , neither in the configuration information of the current cell ( mbms current cell p - t - m rb information ) nor in the configuration information of the neighboring cell ( mbms neighboring cell p - t - m rb information ). also , it is not possible to signal whether the mac header for multiplexing different services is necessary or not . it is only possible to specify a rule wherein the mac header is always / never present , or present depending on whether multiple logical channels are multiplexed onto the transport channel or not , for example . the present invention , therefore , overcomes all of these deficiencies . fig1 illustrates a method for communicating transport channel configurations from a network to a ue in accordance with one embodiment of the present invention . referring to fig1 , a physical channel configuration is shown comprising a list of transport channels that are mapped onto the physical channel . as shown , configuration information for a transport channel 1 is included in the physical channel configuration and is configured according to a list of mbms services using the transport channel 1 . the physical channel configuration also comprises configuration information for a transport channel 2 , wherein no mbms services are mapped to the transport channel 2 . similarly , configuration information for a transport channel 3 is included in the physical channel configuration , wherein no mbms services are mapped to the transport channel 3 . although three transport channel configurations are shown in fig1 , the present invention allows for more transport channel configurations to be included in the physical channel configuration . preferably , the configurations of the physical channel and the transport channels indicate the configuration of a current cell and a neighboring cell . preferably , in order to configure a system where transport channels , having no mbms services mapped to them , are included in a physical channel configuration sent to a ue , the ue is informed that no mbms services are multiplexed onto such transport channels . the ue may also be informed that mbms services being multiplexed onto such transport channels may optionally occur . in operation , when the physical channel configuration is sent from the network to the ue , the ue not only learns of configuration information for transport channels currently having mapped mbms services , but also learns of configuration information for transport channels currently having no mapped mbms services . preferably , the transport channels currently having no mapped mbms services will potentially have new mbms services mapped to them at the start of the new mbms services . thus , the ue may configure the transport channels for the new services prior to their start . when the ue learns of new configuration information for new mbms services which have not yet started , and which will be mapped on the already configured transport channels , the ue may determine to receive the new mbms services before their start if the ue is interested in the services . accordingly , at the start of the new mbms services , which are mapped onto the transport channels previously having no mapped mbms services , the ue reads the new configuration information if the ue is interested in the new mbms services . if the ue is uninterested in the new mbms services , then the ue need not read the new configuration information . thus , the problem of the ue having to read configuration information for services the ue is not interested in is avoided . fig2 illustrates the start of a new service being mapped onto a transport channel in accordance with one embodiment of the present invention . as shown in fig2 , a newly started service 2 may be setup using the same transport channel configuration a multiplexed onto a physical channel currently being used by service 1 already including a transport channel on which no service was formerly sent . in accordance with the present invention , a ue will have already learned of the configuration information of the new service 2 before the start of the service 2 . accordingly , when the service 2 starts , the ue will read the configuration information if it is interested in the service 2 . if the ue is not interested in the service 2 , the ue will not read the configuration information for the service 2 . referring back to fig1 , information for indicating whether a mac header is used for multiplexing a number of mbms services onto one transport channel may be included in the configuration information of a transport channel . as shown , for a transport channel 1 , use of a mac header is preferably signaled as a parameter of the transport channel 1 . conversely , for a transport channel 3 non - use of a mac header is preferably signaled as parameter of the transport channel 3 . preferably , for a transport channel 2 , use of a mac header is preferably signaled as a parameter of the transport channel 2 even though no mbms services are currently mapped to the transport channel . in operation , when the physical channel configuration is sent from the network to the ue , the ue learns whether a mac header is being used by a particular transport channel . use of the mac header indicates that at least two mbms services may be multiplexed onto the same transport channel . thus , upon receiving the configuration information for a transport channel , the ue may anticipate the transport channel being shared between different mbms services although the transport channel currently has no mbms services or only one mbms service mapped to it . referring back to fig2 , a newly started service 2 may be setup using a transport channel configuration a and multiplexed onto a physical channel currently being used by service 1 . preferably , in accordance with one embodiment of the present invention , the newly started service 2 is mapped onto the same transport channel currently being used by the service 1 . preferably , a ue will have anticipated the new service 2 being mapped onto the same transport channel as the service 1 before the start of the service 2 via the existence of the mac header for the service 1 in the configuration information for the currently used transport channel . accordingly , when the service 2 starts , the ue will read the mac header of the new service 2 . if the ue is interested in the new service 2 , the ue will read the configuration information for the service 2 . if the ue is not interested in the new service 2 , the ue will not read the configuration information for the service 2 . although the present invention is described in the context of mobile communication , the present invention may also be used in any wireless communication systems using mobile devices , such as pdas and laptop computers equipped with wireless communication capabilities . moreover , the use of certain terms to describe the present invention should not limit the scope of the present invention to certain type of wireless communication system , such as umts . the present invention is also applicable to other wireless communication systems using different air interfaces and / or physical layers , for example , tdma , cdma , fdma , wcdma , etc . the preferred embodiments may be implemented as a method , apparatus or article of manufacture using standard programming and / or engineering techniques to produce software , firmware , hardware , or any combination thereof . the term “ article of manufacture ” as used herein refers to code or logic implemented in hardware logic ( e . g ., an integrated circuit chip , field programmable gate array ( fpga ), application specific integrated circuit ( asic ), etc .) or a computer readable medium ( e . g ., magnetic storage medium ( e . g ., hard disk drives , floppy disks , tape , etc . ), optical storage ( cd - roms , optical disks , etc . ), volatile and non - volatile memory devices ( e . g ., eeproms , roms , proms , rams , drams , srams , firmware , programmable logic , etc .). code in the computer readable medium is accessed and executed by a processor . the code in which preferred embodiments are implemented may further be accessible through a transmission media or from a file server over a network . in such cases , the article of manufacture in which the code is implemented may comprise a transmission media , such as a network transmission line , wireless transmission media , signals propagating through space , radio waves , infrared signals , etc . of course , those skilled in the art will recognize that many modifications may be made to this configuration without departing from the scope of the present invention , and that the article of manufacture may comprise any information bearing medium known in the art . the foregoing embodiments and advantages are merely exemplary and are not to be construed as limiting the present invention . the present teaching can be readily applied to other types of apparatuses . the description of the present invention is intended to be illustrative , and not to limit the scope of the claims . many alternatives , modifications , and variations will be apparent to those skilled in the art . in the claims , means - plus - function clauses are intended to cover the structure described herein as performing the recited function and not only structural equivalents but also equivalent structures .	7
as shown in fig2 , the half - controlled silicon - controlled rectifying system according to the first embodiment of the invention comprises : a first detection unit 201 , a silicon - controlled rectifying unit 101 , a dc bus 102 connected to the silicon - controlled rectifying unit 101 , a second detection unit 203 connected to the dc bus 102 , a control unit 202 , a first resistor 112 , and an inductor 130 . herein , the first detection unit 201 is provided with a first input port 204 , which receives the triphase ac , to detect the zero cross phase at 0 degree and 180 degrees of the triphase ac from the first input port 204 which the preference point for the phase angles 0 degrees and 180 degrees are the phases of the 1 st zero value of each sine wave of the triphase ac within one period . the silicon - controlled rectifying unit 101 includes a plurality of silicon - controlled rectifiers 111 and a plurality of diodes 121 , and is provided with a second input port 205 receiving the triphase alternating current in synchronization with the first input port to determine whether to conduct the output of the triphase ac from the second input port 205 . the dc bus 102 includes a charging capacitor c and a second resistor 113 . the second detection unit 203 is used to detect the voltage of the charging capacitor c of the dc bus 102 . the control unit 202 is used to receive the detection results from the first detection unit 201 and the second detection unit 203 , and to determine whether to send a trigger signal to the silicon - controlled rectifying unit 101 depending on the detection results of the first detection unit 201 and the second detection unit 203 , thereby conducting the silicon - controlled rectifying unit 101 to enable the triphase ac from the second input port 205 to be circulated . the control unit 202 executes by a software control , and the flowchart of its control process is shown in fig3 . when the triphase ac flows through the first input port 204 , the first detection unit 201 detects the zero cross phase of the voltage of the triphase ac and sends a signal indicating the zero cross phase of the voltage into the control unit 202 ( step 301 ), and the control unit 202 sends a trigger signal to conduct one of the silicon rectifiers 111 in the silicon - controlled rectifying unit 101 ( step 302 ). then the control unit 202 determines whether the detected voltage value concerning the charging capacitor c of the dc bus 102 from the second detection unit 203 is greater than a threshold conducting voltage ( step 303 ). if the detected voltage value is greater than the threshold conducting voltage , the control unit 202 sends a trigger signal to conduct all the silicon - controlled rectifiers 111 of the silicon - controlled rectifying unit 101 ( step 304 ). if not , the control unit 202 sends out a trigger signal to conduct a silicon rectifier 111 of the silicon - controlled rectifying unit 101 in the next time when the input triphase ac is close to the zero cross phase . in the step 303 , suppose that the detected voltage value , concerning the charging capacitor c of the dc bus 102 , from the second detection unit 203 is not greater than the threshold conducting voltage . the control unit 202 sends a trigger signal to conduct one of silicon - controlled rectifier 111 of the silicon - controlled rectifying unit 101 in the next period , when the triphase ac is close to the zero cross phase . thus , in the process of repeated determination , each of silicon rectifiers 111 of the silicon - controlled rectifying unit 101 is gradually made conductive in advance in each period , thereby prolonging the overall conduction duration of the silicon - controlled rectifying unit 101 , so that the voltage of the charging capacitor c of the dc bus 102 is increased gradually . until the voltage of the charging capacitor c of the dc bus 102 is greater than the threshold conducting voltage , the control unit 202 sends a trigger signal to conduct all the silicon - controlled rectifiers of the silicon - controlled rectifying unit 101 , so that the effect of soft actuation is achieved . in addition , the zero cross phase is chosen at 0 ° or 180 °. furthermore , the first detection unit 201 , as shown in fig4 , comprises : a comparator 401 , a first voltage source 411 connected to the negative input terminal of the comparator 401 , a second voltage source 412 connected to the calibration terminal of the comparator 401 , a third voltage source 413 connected to the negative terminal of the comparator 401 , a fourth voltage source 414 connected to the output terminal of the comparator 401 , a first resistor 431 connected between the comparator 401 and the first voltage source 411 , a second resistor 432 connected between the comparator 401 and the first resistor 431 , a third resistor 433 connected between the positive terminal of the comparator 401 and the ground , a fourth resistor 434 connected between the comparator 401 and the fourth voltage source 414 , a first capacitor 421 connected between the positive terminal of the comparator 401 and the ground and connected in parallel with the third resistor 433 , and a second capacitor 422 connected between the negative terminal of the comparator 401 and the second voltage source 412 . when the input terminal 402 receives the voltage of the triphase ac from the first input port 204 , the voltage is compared with the predetermined voltage set in the comparator 401 . while the voltage value of the received triphase ac reaches the zero cross phase , the comparator 401 outputs a signal with a high voltage level to inform the control unit 202 that the voltage of the input signal has reached the zero cross phase . knowing the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the present invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	7
embodiments of the invention relate to inductively - coupled plasma chamber having improved uniformity , especially gas distribution uniformity . the within - wafer uniformity is improved by embodiments of the invention wherein provisions are made to redirect the gas injected by injectors and / or nozzles so as to improve the gas distribution within the chamber . an embodiment of the invention will now be described in detail with reference to fig2 . fig2 illustrates a plasma processing apparatus 200 according to one embodiment of the invention . the elements illustrated in fig2 which correspond to elements illustrated in fig1 are given the same reference numbers , except that they are in the 2xx series . it will be appreciated that the apparatus 200 is merely exemplary and that the apparatus 200 may include fewer or additional components and the arrangement of the components may differ from that illustrated in fig2 . fig2 illustrates a cross - section of an icp chamber design implementing a gas diversion feature according to one embodiment of the invention . icp chamber 200 has a metallic sidewall 205 and a dielectric ceiling 207 , forming a tight vacuum enclosure that is pumped by vacuum pump 225 . the dielectric ceiling 207 is provided only as one example , but other ceilings can be used , e . g . a dome ceiling , a metallic ceiling with dielectric window , etc . a pedestal 210 supports a chuck 215 , which holds the substrate 220 to be processed . bias power is generally applied to the chuck 215 , but is not shown in fig2 , as it is not pertinent to the disclosed embodiment . rf power from rf power supplier 245 is applied to antenna 240 , which is generally in the form of a coil . processing gas is supplied from gas source 250 via pipelines 255 into the chamber to ignite and sustain plasma , and thereby process the substrate 220 . in this embodiment , the gas is supplied into the vacuum enclosure by circumference injectors or nozzles 230 , but additional gas may optionally injected via central nozzle 235 . if gas is supplied from both injectors 230 and nozzle 235 , the amount of gas supplied from each may be arranged to be independently controlled . any of these arrangements for injecting gas may be referred to as plasma gas injector arrangement . in fig2 , a baffle 270 is situated within the chamber so as to restrict and / or redirect the flow of gas emanating from injectors 230 . as shown in the callout , in this embodiment the baffle is generally in the form of a disk with central hole or opening . the baffle is positioned below the gas injection point , but above the level of the substrate . in this manner , the gas is restricted to flow further towards the center of the chamber before it can flow downwards towards the substrate , as shown by the dotted - line arrows . in general , baffle 270 may be made of metallic material , such as anodized aluminum . fabricating the baffle from metallic material may be advantageously employed to restrict the plasma to the area above the baffle , as the rf from the coil will be blocked by the baffle . on the other hand , the baffle 270 may be fabricated of a dielectric material , such as ceramic or quartz . in an embodiment using a dielectric baffle the rf from the coil may pass through the baffle , such that plasma may be maintained below the baffle ( illustrated in broken - lines ), depending on the amount of gas reaching below the baffle . in some circumstances it may be needed to further restrict the gas flow and cause the gas to spend more time over the center of the wafer to ensure full dissociation over the wafer . an embodiment beneficial for such applications is illustrated in fig3 . the elements of fig3 that are similar to that of fig2 are noted with the same reference number , except in the 3xx series . as shown in fig3 and the callout of fig3 , the baffle 372 of this embodiment is made in the shape of a disk having a vertical ring extension 373 , generally in the shape of a cylindrical section . the vertical extension creates a gap 374 through which the gas can flow to the side , i . e ., to the area of the chamber beyond the circumference of the substrate . the size of the gap 374 determines the flow of the gas above the substrate and the time the gas spends above the substrate so as to be dissociated by the plasma . in the embodiment shown in fig3 , the diameter of the ring opening , d , may be sized to equal the diameter of the substrate , or be larger or smaller than the diameter of the substrate . the diameter of the opening can be set depending on the desired flow restriction . also , since the vertical ring extension is set to be orthogonal to the disk , the diameter at the opening of the ring extension 373 is the same as the diameter at the opening of the ring 372 itself . on the other hand , sometime it is desirable to restrict the exit of the gas from the ring towards the substrate , but once the gas flows towards the substrate it is sometime desirable to enhance the flow in the horizontal direction towards the periphery of the chamber . an arrangement beneficial for such situations is illustrated in fig4 . in fig4 the baffle 475 is structured of a ring with a conical - section extension 476 . the conical - section 476 has an upper opening diameter d , which is smaller than the lower opening diameter d ′, wherein the lower opening is in close proximity to the substrate . the lower opening is position so as to define gap 477 , through which gas flows horizontally towards the chamber &# 39 ; s walls . the sidewall of the conical section makes and angle φ with the ring , angle φ being less than 90 degrees . in any of the above embodiments it may be desirable to let some gas flow out prior to it reaching the central opening of the baffle . fig5 illustrates an embodiment that is somewhat of a modification of the embodiment of fig2 . as shown in fig5 , the baffle 578 is in the shape of a disk with a central opening , somewhat similar to the baffle 272 of fig2 . the central opening may be of the same or different diameter as that of fig2 . in addition , auxiliary or secondary opening 589 are provided about the central opening , so as to enable some gas to escape prior to reaching the central opening . the secondary openings may be of smaller diameter than the central opening . the auxiliary opening can be applied to any of the embodiments shown above , and may be distributed evenly around the central opening . for example , the second callout in fig5 illustrates a modified baffle 580 that is similar to that illustrated in fig3 , except that auxiliary opening have been added around the extension to enable some gas to flow out prior to reaching the central opening and flowing into the extension . in the embodiments disclosed above , the baffle is used to control the flow of the processing gas . additionally , the baffle can be used to passively control the plasma . in general , plasma can diffuse through the holes on the baffle to the lower portion of the chamber . the larger the holes , the higher the plasma density becomes . by changing the number and location of the holes , the plasma density distribution within the chamber can also be changed . the baffle can also be used to actively control the plasma . such an example is illustrated in fig6 . in the embodiment of fig6 , the baffle 680 is used to actively control the plasma . as illustrated , a secondary antenna 682 is embedded within the baffle 680 . secondary antenna may be in the form of a coil . in the example shown in the callout the antenna is in the form of a single loop ( shown in broken line ), but other designs may be employed . the secondary antenna may be energized using the same power source 645 as the main antenna ( illustrated as broken - line arrow ), or it my be energized from a different rf power supplier 647 . regardless of the power source used , the amplitude of the power applied to the secondary antenna 682 may be controlled independently of the power applied to the main antenna 640 . according to one embodiment , the baffle 680 is made of a dielectric material and the coil is embedded within the dielectric . for example , the baffle 680 may be made by sintering ceramic material with the metallic coil embedded within the ceramic . in this manner , the power from the secondary coil is applied to the plasma above the baffle and to the plasma below the baffle . on the other hand , according to another embodiment , the baffle 680 is made with dielectric on one side and conductor on the other side , such that the rf power applies only to one side of the baffle . for example , the top of the baffle 680 may be made of conductive material , so that the rf power from the secondary coil 682 is applied only to the plasma below the baffle . such an arrangement is illustrated in the second callout of fig6 , wherein the coil 682 is embedded within ceramic disk 685 such that the rf energy from the coil can be applied to the plasma below the baffle , but a conductive disk 683 is provided on top of the ceramic disk 685 , such that the energy from coils 682 cannot be applied to the plasma above the baffle . additionally , in such an arrangement the baffle also blocks the rf power from the main antenna 640 from being applied to the plasma below the baffle 680 . consequently , the rf power to the main antenna 640 can be tailored ( e . g ., frequency , power , etc .) to controlled the plasma above the baffle 680 , while the rf power to the secondary antenna 680 can be tailored to control the plasma below the baffle . any of the above embodiments can be further modified by making the baffle movable . such an arrangement is schematically illustrated in fig6 . in fig6 a step motor 690 is coupled to the baffle 680 by , e . g ., rack and pinion arrangement , such that the step motor 690 can be energized to move the baffle vertically so as to lower or raise the baffle 680 , such that the gap between the baffle 680 and substrate 620 can be changed . it should be understood that processes and techniques described herein are not inherently related to any particular apparatus and may be implemented by any suitable combination of components . further , various types of general purpose devices may be used in accordance with the teachings described herein . the present invention has been described in relation to particular examples , which are intended in all respects to be illustrative rather than restrictive . those skilled in the art will appreciate that many different combinations will be suitable for practicing the present invention . moreover , other implementations of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . various aspects and / or components of the described embodiments may be used singly or in any combination . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims .	7
1 . identify list of connector model on the sut ; 2 . for each connector identified in 1 , determine the opposite mating connector ; 3 . determine of the mating connector in 2 is available on an existing interface cable in the inventory ; 4 . if none are found in 3 , create a new interface cable ; 5 . create an identification of the mating assembly so that it can be recognized by an ate by any or a combination of the following methods : a . a standard number for the mating assembly ; b . a unique serial number to the mating assembly ; c . incorporating a medium to read the information about the mating assembly ; this identification method can be done manually or it can be created into a database ; 6 . except if 5c was performed , the final mating assembly must be registered so that it can be recognized by the ate in order to be able to use it on the sut . it can be done manually or it can be created by a software in various ways , including : a . adding the mating assembly to the ate library the design layout of the mating assembly ; b . adding the mating assembly to a standard database ; 7 . once recognizable by the ate as described in step 9 , the mating assembly can be shipped to the location where it is needed by the technician for the test / maintenance on the sut , and at that point , it will generally need to be validated prior to the first utilization to make sure that it respects the specifications of connector on the sut ; 8 . another step generally required to operate the ate is to use a test program that incorporates one or many interface mating cables and requires engineering or technician skills to ensure that the test signals sent to the sut are appropriately sequenced on the specific connections points of any or all of the connectors ; 9 . the test program must also be identified in a matter similar to point 8 ; 10 . the test program must also be delivered to the location of the test / maintenance and validated prior to its first utilization to ensure that it respects the specifications of the test requirements and that it was made by an approved entity listed in point 11 ; 11 . the ate can then perform the test by : a . identifying each mating connector hooked to the ate and related mate ; b . send test signals , one at a time to one originating connection and capture the signal by the receiver method on each of the terminating connections , repeating the operation to each of the connections as an originating connection until all connections have been tested ; c . merging the test results to create a netlist of connections ; d . make a resistance measurement of all of the connections ; e . create a report . one driver of the embodiments described below is the ability for an ate to detect and identify a link between 2 connection points of an electrical circuit with only one of the 2 connections , the originating node , being directly connected to the ate by an interface cable , the terminating node being connected to an electronic slave connector that has embedded eeprom ( electrically erasable programmable read - only memory ), the memory containing the layout characteristics and other information about the connector under test so that the link can be positively identified to a specific electrical node of the circuit . it should be noted that even though embodiments described above use an eeprom as an identifier for a connection point , the eeprom can be replaced by other types of electrically - accessed memories . non - volatile memories such as read - only memories or flash memories can be used as identifiers , as well as magnetic memories . other identification means , such as circuit elements having very precise characteristics ( such as a precise resistance or inductance ) can be used as an identifier on a circuit . many types of electronic identifiers are therefore suited for the identification of a connection point . now referring to fig1 , the testing method can be described as follows : first , the ate will interrogate one by one each of the originating node , by sending a signal into the wire , to determine if a link can be made with an eeprom ( step 110 ); then , if a link can be made with an eeprom , the ate will read eeprom and identify the link of the terminating connection ( step 120 ), either by : reading the information of the termination connection on the eeprom ; or by retrieving the information associated with the eeprom identification of the termination connection from a central database ; the ate will compile a list of termination connections with an eeprom list for merging into a netlist database ( step 130 ); the ate will use conventional methods of driving signals to all originating connections who have been determined not to have a connection with the eeprom list to determine other interconnections within the electrical circuit ( step 140 ); the ate will compile a list of termination connections of the type wire - to - wire or wire - to - ground that have not an eeprom on the circuit ( step 150 ); the ate will merge the result obtained in steps 130 and 150 to create a final netlist configuration of the electrical circuit ( step 160 ); in the case in which there is a slave connector connection , the ate will execute a command to remove the eeprom from the circuit to make a direct connection to the ground ( step 165 ). the ate will proceed to read the resistive values of each node to determine quality of connection ( step 170 ), by measuring resistance on a wire - to - wire or wire - to - to ground connection ,; ate will merge the results in steps 160 and 170 to produce a final netlist configuration of the electrical circuit with resistive values of wire - to wire or wire - to ground connections ( step 180 ); according to an embodiment , the connector 200 for performing the method on a wire harness 290 can be described as follows , referring to fig2 . the slave connector 200 has an eeprom 210 for each connection point , or at least for each one of a portion of the connection points . the eeprom has a unique id and may contain any other information that can be used to identify the specific position of the slave connector contact layout . according to an embodiment , the slave connector 200 itself has an id 201 so it can be identified prior to , during or after testing . a switch 220 to provide the ability to connect the node to the eeprom or to a direct ground 250 , in the first case to identify the wire , and in the second case to be able to measure the resistive value to ground 250 ; this switch 220 may take the form of a manual or electronic switch ( e . g . a transistor , a mems switch or the like ), or be embedded in an electrical circuit board with other functions . in other words , for a given wire linking two terminal connections of the wire harness 290 , an ate is placed at one of these terminal connections , and a slave connector is placed at the other one . for each one of the wires being tested , a signal is sent by the ate into the circuit comprising the wire , and goes through an identifier ( such as an eeprom ) to the electrical ground 250 ( if no slave connected is provided at a given terminal connection , the conventional testing procedure applies ). when the identifier is provided on the circuit , it allows extracting information therefrom , that can be used in a database to verify the identity or position of the connector . after this is done , a switch can bypass the identifier so that the ate is directly linked to the electrical ground 250 ( i . e . the signal does not go through the identifier ). the resistance ( or any other electrical characteristic ) of the circuit can be measured . this measure allows evaluating the quality of the link between the two terminal connections , for example if there is a defect in the circuit by comparing resistance thresholds in a database , for example . according to an embodiment , there is an option to connect all the wires of the slave connector to a generic mating interface cable 230 , also known as a standard interface cable , that would have on one hand , a generic connector for the slave connector , and on the other hand , a connector to mate with the connector of another ate . the option would permit the use of the slave connector as if it was a standard mating interface assembly to be used with such another ate . this way , ates can be used in a conventional manner . according to an embodiment , the slave connector 200 is not connected to the usual ground 250 , but rather to another reference which differs from the ground 250 from a constant voltage or a known value . generally speaking , the slave connector 200 is thus said to be electrically connected to a reference . while preferred embodiments have been described above and illustrated in the accompanying drawings , it will be evident to those skilled in the art that modifications may be made without departing from this disclosure . such modifications are considered as possible variants comprised in the scope of the disclosure .	6
the preferred embodiments of the present invention will be described with reference to examples . it will be understood that the present invention will not be limited by the examples below ; modifications are possible without departing from the scope of the present invention . nickel , cobalt , and aluminum were co - precipitated to have nickel - cobalt - aluminum hydroxide . lithium hydroxide was added to the nickel - cobalt - aluminum hydroxide , followed by baking at 700 ° c ., thus obtaining lithium nickel composite oxide containing cobalt and aluminum ( lini 0 . 8 co 0 . 15 al 0 . 05 o 2 ). the element contents of the lithium nickel composite oxide were analyzed by icp - aes ( inductive coupling plasma emission analysis ). the lithium nickel composite oxide and water were mixed together , and this mixture was kneaded in water . then , the water was removed and the lithium nickel composite oxide was washed with water . the washed lithium nickel composite oxide was then dried , thus obtaining the positive electrode active material . the positive electrode active material was sampled into a vial bottle . then , 5 ml of hydrochloride ( hcl ) solution of 0 . 05 m ( mole / liter ) was injected into the bottle and mixed with the positive electrode active material . after the mixture was settled for some period of time , resulting gas was sampled by 0 . 1 ml and measured by gas chromatography . the amount of lithium carbonate was 0 . 1 mass % relative to the positive electrode active material . this reaction can be expressed as follows : ninety mass parts of the positive electrode active material , 5 mass parts of carbon powder as a conducting agent , 5 mass parts of polyvinylidene fluoride ( pvdf ) as a binding agent , and n - methyl - 2 - pyrrolidone ( nmp ) were mixed together , thus preparing a positive electrode active material slurry . this positive electrode active material slurry was applied to both surfaces of a positive electrode current collector ( 20 μm thick ) made of aluminum by doctor blading , followed by drying to form a positive electrode active material layer on the positive electrode current collector . then , the resulting product was rolled with a compressive roller , thus preparing a positive electrode . al 2 o 3 , lithium carbonate , and polytetrafluoroethylene ( ptfe ) as a binding agent were mixed in water in which carboxymethyl cellulose ( cmc ) as a thickening agent was dissolved , thus obtaining an inorganic oxide slurry . the mass ratio of al 2 o 3 , lithium carbonate , cmc , and ptfe was 85 : 10 : 3 : 2 . this slurry was applied to the surface of the positive electrode active material layer and dried , and on the positive electrode active material layer , a porous layer of 2 μm thick was formed . an area of the positive electrode with the porous layer was removed to measure the amount of lithium carbonate in the above - described manner . the lithium carbonate content in the porous layer was 0 . 5 mass % relative to the positive electrode active material . ninety - five mass parts of a negative electrode active material made of natural graphite , 5 mass parts of polyvinylidene fluoride ( pvdf ) as a binding agent , and n - methyl - pyrrolidone were mixed together , thus preparing a negative electrode active material slurry . the negative electrode active material slurry was applied to both surfaces of a negative electrode current collector ( 18 μm thick ) made of copper , followed by drying . then , the dried electrode plate was rolled , thus preparing a negative electrode . the potential of graphite is 0 . 1 v on the basis of lithium . the amounts of the active materials filled in the positive electrode and the negative electrode were adjusted such that the charge capacity ratio ( negative electrode charge capacity / positive electrode charge capacity ) would be 1 . 1 at the potential of the positive electrode active material ( 4 . 3v on the basis of lithium in this example , while the voltage being 4 . 2 v ), which served as a design reference . the positive electrode and the negative electrode were wound with a separator made of a polypropylene porous film therebetween , thus preparing a flat electrode assembly . ethylene carbonate and diethyl carbonate were mixed together at a volume ratio of 3 : 7 ( 25 ° c . ), and then lipf 6 as electrolytic salt was dissolved therein at a rate of 1 . 0 ( mol / liter ), thus obtaining a non - aqueous electrolyte . a sheet - formed laminate material was prepared having a five - layer structure composed of resin layer ( polypropylene )/ adhesive layer / aluminum alloy layer / adhesive layer / resin layer ( polypropylene ). then , the laminate material was folded to make a bottom portion , thus forming a cup - formed electrode assembly housing space . in a glove box with an argon atmosphere , the flat electrode assembly and the non - aqueous electrolyte were inserted into the housing space . then , the outer casing was depressurized to cause the separator to be impregnated with the non - aqueous electrolyte , and the opening of the outer casing was sealed . thus , a non - aqueous electrolyte secondary cell according to example 1 with a height of 62 mm , a width of 35 mm , and a thickness of 3 . 6 mm was prepared . a non - aqueous electrolyte secondary cell according to comparative example 1 was prepared in the same manner as in example 1 except that no porous layer was formed . a non - aqueous electrolyte secondary cell according to comparative example 2 was prepared in the same manner as in comparative example 1 except that the washing step was controlled to make the amount of lithium carbonate 0 . 2 mass % on the surface of the positive electrode active material . a non - aqueous electrolyte secondary cell according to comparative example 3 was prepared in the same manner as in comparative example 1 except that no washing step was carried out and the amount of lithium carbonate on the surface of the positive electrode active material was made 0 . 5 mass %. a non - aqueous electrolyte secondary cell according to comparative example 4 was prepared in the same manner as in comparative example 3 except that a change was made in the lithium content during preparation of the lithium nickel composite oxide to make the amount of lithium carbonate 0 . 6 mass % on the surface of the positive electrode active material . a non - aqueous electrolyte secondary cell according to comparative example 5 was prepared in the same manner as in comparative example 3 except that a change was made in the amount of the lithium source during preparation of the lithium nickel composite oxide to make the amount of lithium carbonate 0 . 8 mass % on the surface of the positive electrode active material . a non - aqueous electrolyte secondary cell according to comparative example 6 was prepared in the same manner as in example 1 except that no lithium carbonate was contained in the porous layer . each of the cells was charged at a constant current of 650 ma to a voltage of 4 . 2 v , then at a constant voltage of 4 . 2 v to a current of 32 ma ( all at 25 ° c .). each of the charged cells was preserved in a thermostatic chamber of 85 ° c . for 3 hours to measure the thickness before and after preservation . the swelling rate of each cell was calculated from the following formula : each of the cells was repeatedly charged and discharged under the following conditions to calculate the cycle characteristic from the following formula : charging : in a room of 25 ° c ., each of the cells was charged at a constant current of 650 ma to a voltage of 4 . 2 v , then at a constant voltage of 4 . 2 v to a current of 32 ma . discharging : in a room of 25 ° c ., each of the cells was charged at a constant current of 650 ma to a voltage of 2 . 75 v . table 1 shows that as the amount of lithium carbonate on the surface of the positive electrode active material increases , the swelling rate tends to increase and the cycle characteristic tends to improve ( see comparative examples 1 to 5 ). a possible explanation for this is as follows . the larger the amount of lithium carbonate on the surface of the positive electrode active material , the more of the lithium carbonate is decomposed to generate carbon dioxide gas during the high - temperature preservation , thereby swelling the cell on a large scale . meanwhile , the charge and discharge reactions gradually decompose the lithium carbonate to generate carbon dioxide gas . this carbon dioxide gas moves to the negative electrode to react therewith to form a stable covering film on the surface of the negative electrode . this improves the cycle characteristic . table 1 also shows that comparative example 6 , whose porous layer contains no lithium carbonate on the surface of the positive electrode , has a cycle characteristic of 74 %, which is superior to 50 % for comparative example 1 , which contains lithium carbonate at the same mass . a possible explanation for this is as follows . since the porous layer keeps therein the non - aqueous electrolyte in a preferable manner to supply the non - aqueous electrolyte to the positive electrode active material , the amount of the non - aqueous electrolyte around the positive electrode active material increases . thus , comparative example 6 has higher cycle characteristic than that of comparative example 1 . table 1 also shows that example 1 , which contains lithium carbonate in the porous layer , has a cycle characteristic of 82 %, which is superior to 74 % for comparative example 6 , which contains no lithium carbonate in the porous layer . a possible explanation for this is as follows . in example 1 , the charge and discharge reactions decompose the lithium carbonate contained in the porous layer to generate carbon dioxide gas . this makes the amount of carbon dioxide gas larger than in comparative example 6 . this makes denser the covering film of example 1 , which is formed by the reaction between the negative electrode and the carbon dioxide gas . thus , the cycle characteristic improves in example 1 over comparative example 6 . a non - aqueous electrolyte secondary cell according to example 2 was prepared in the same manner as in example 1 except that the amount of lithium carbonate contained in the porous layer was 0 . 3 mass % relative to the positive electrode active material . a non - aqueous electrolyte secondary cell according to example 3 was prepared in the same manner as in example 1 except that the amount of lithium carbonate contained in the porous layer was 5 . 0 mass % relative to the positive electrode active material . a non - aqueous electrolyte secondary cell according to example 4 was prepared in the same manner as in example 1 except that the amount of lithium carbonate contained in the porous layer was 10 . 0 mass % relative to the positive electrode active material . a non - aqueous electrolyte secondary cell according to example 5 was prepared in the same manner as in example 1 except that the amount of lithium carbonate contained in the porous layer was 20 . 0 mass % relative to the positive electrode active material . the cells according to examples 1 to 5 and comparative example 6 were subjected to the above - described high - temperature preservation test and cycle characteristic test . the results are shown in table 2 . table 2 shows that as the amount of lithium carbonate in the porous layer increases , the swelling rate tends to increase ( see comparative example 6 , examples 1 to 5 ). a possible explanation for this is as follows . the larger the amount of lithium carbonate contained in the porous layer , the more of the lithium carbonate is decomposed to generate carbon dioxide gas during the high - temperature preservation , thereby swelling the cell on a large scale . table 2 also shows that when the amount of lithium carbonate contained in the porous layer is 5 . 0 mass % or less relative to the positive electrode active material , as the amount of lithium carbonate contained in the porous layer increases , the cycle characteristic tends to improve ( see comparative example 6 , examples 1 to 3 ). table 2 also shows that when the amount of lithium carbonate contained in the porous layer exceeds 5 . 0 mass % relative to the positive electrode active material , the cycle characteristic tends to be degraded ( see examples 4 and 5 ). a possible explanation for these is as follows . the charge and discharge reactions decompose the lithium carbonate to generate carbon dioxide gas . this carbon dioxide gas moves to the negative electrode to react therewith to form a stable covering film on the surface of the negative electrode . this improves the cycle characteristic . however , too large a content of the lithium carbonate generates a large amount of carbon dioxide gas , which is detained between the positive and negative electrodes . this is detrimental to the opposing relation between positive and negative electrodes , resulting in degraded cycle characteristic . in view of this , the amount of lithium carbonate contained in the porous layer is preferably 0 . 5 to 10 mass % relative to the positive electrode active material , more preferably 0 . 5 to 5 . 0 mass %. a non - aqueous electrolyte secondary cell according to example 6 was prepared in the same manner as in example 1 except that mgo was used instead of al 2 o 3 as the inorganic oxide used for the porous layer . a non - aqueous electrolyte secondary cell according to example 7 was prepared in the same manner as in example 1 except that zro 2 was used instead of al 2 o 3 as the inorganic oxide used for the porous layer . a non - aqueous electrolyte secondary cell according to example 8 was prepared in the same manner as in example 1 except that tio 2 was used instead of al 2 o 3 as the inorganic oxide used for the porous layer . the cells according to examples 1 , 6 to 8 were subjected to the above - described high - temperature preservation test and cycle characteristic test . the results are shown in table 3 . as has been described above , the present invention realizes a non - aqueous electrolyte secondary cell that has high capacity and excellent cycle characteristic . thus , the industrial applicability of the present invention is considerable .	7
the system shown in fig1 provides a strictly controlled bi - directional data connection between a user alfa who can be at any one of several remote terminals and an authorisation centre 1 which is typically a computer with data storing and processing capacity . the authorisation centre 1 keeps a database of a predetermined number of basic graphical symbol selection and / or modification algorithms . a basic graphical symbol selection algorithm is an algorithm , which generates one or more graphical symbol ( s ) as output from a multiplicity of graphical symbols as input . a basic graphical symbol modification algorithm is an algorithm , which generates a graphical symbol as output from another graphical symbol ( s ) as input . a complex graphical symbol set generating algorithm is a multiplicity of simple graphical symbol selection and modification algorithms to be performed one by one according to the result of the previous operation . a graphical symbol may be the visual representation of any object , person , form , shape , idea , concept — including numbers , letters and signs — or anything else what may be visually represented . in addition to the basic visual appearance a graphical symbol can have different further features . such further feature of a graphical symbol may comprise any property by the changing of which two graphical symbols of the same form may be distinguished ( such as size , colour , pattern , direction , movement , attached voice or sound , etc .). the authorisation centre 1 keeps a further database of user identification codes or in short user id &# 39 ; s which can be in combination numbers , symbols , character chains , etc . within the authorisation centre 1 each user is uniquely identified by an associated id . linked to the user id database the authorisation centre 1 also comprises a further database storing symbol set generating algorithms . in the database each user id is associated with a predetermined graphical symbol set generating algorithm . the graphical symbol set generating algorithms are , however , not unique and may be assigned to different users . the assignment of user id - s and symbol set generating algorithms may occur by a system administrator that can either be a natural person or an automated assignment system . the user may interactively participate in creating his graphical symbol set generating algorithm . the users may change their graphical symbol selection algorithms any time they wish to do so . the authorisation centre 1 stores furthermore an algorithm capable of generating a cryptographic key of a certain length from any set of graphical symbols that have the same or smaller length . it is preferable but not always required that different multi - digit numbers represent the different graphical symbols . in such a case the cryptographic key generating algorithm may be any kind of message digest function . message digest functions are known in the art of cryptography , and they are capable of generating a unique cryptographic key of predetermined length from every multi digit number of much longer length so that one cannot retrieve the multi digit number from the generated key . besides the cryptographic key generating algorithm the authorisation centre 1 can also store a cryptographic algorithm generating process used to generate the unique encryption algorithms which are further used for encrypting and decrypting messages sent or received by a remote terminal . such cryptographic algorithms generated can be variables of different symmetric key algorithms ( ecb , cbc , cfb , ofb ). as a further means of security , the authorisation centre may also store a higher level encryption algorithm , which may be a symmetric key algorithm or a combined public key and symmetric key algorithm . typical representations of such high level symmetric key algorithms are the conventionally known des and triple des algorithms . a typical example for the combination of a public key and symmetric key method is encrypting the original message with a symmetric key using des algorithm at the remote terminal . when this step is completed , the symmetric cryptographic key is encrypted by using the public key of the authorisation centre 1 . the original message may be recovered by decrypting the cryptogram of the symmetric key by the private key of the authorisation centre and decrypting the message with the newly decrypted symmetric key . as a means to decrease the processing need associated to the encryption - decryption of the whole message of the user , it is possible to create a digital fingerprint ( message authentication code , mac ) from the message and to encrypt and decrypt only the digital fingerprint while the message may be transferred unencrypted . this method alone does not provide for the privacy of the message , however authenticates the person of sender , the receiver and the integrity of the message . a digital fingerprint is a chain of alphanumeric characters generated from a file or text by a one way hash function ( for example md5 ). the main characteristic of a one way hash function is that it is easy to create a character chain from a text or a file but it is extremely difficult or impossible to regain the text or the file from the character chain . as the one way hash functions generate very different character chains from slightly different texts ( more than 50 % of the characters in a character chain are different if one letter is different in an entire page of text ) they may be used to control the integrity of a file or a text transferred via the internet . an algorithm to create a digital fingerprint from a message ( for example md5 ) may be stored both in the authentication centre and on the remote terminal . a remote terminal is typically a computer with temporary data storage and data processing capacity . the remote terminal either stores an algorithm generating a cryptographic key of a certain length from any set of graphical symbols , or receives it from the authorisation centre each time a user wishes to gain access to the system . in the examples such cryptographic key generating algorithm are the same as those defining the algorithms stored by the authorisation centre . the remote terminal either stores a cryptographic algorithm encrypting and decrypting messages to be sent by the user to the authorisation centre , or receives it from the authorisation centre each time a user wishes to communicate with the authorisation centre or stores a cryptographic algorithm generating process also known to the authorisation centre by means of which it generates a unique cryptographic algorithm from each set of graphical symbols selected by the user . it is preferable if such cryptographic algorithm is the same as the algorithms stored or generated by the authorisation centre . a user is typically a natural person with average sensory and cognitive capacity who wishes to gain access to the services of a limited access system . the user shall store or know his unique identifier or id and the graphical symbol set generating and / or modification algorithm stored at the authorisation centre in the symbol set generating algorithm database associated with his id . such an algorithm is generally a few of specific geometrical or selection rules , which the user can easily memorise . typically , the authorisation centre and the remote terminal are connected to each other via a wide area network of extreme dimensions — such as the internet — and they are communicating with each other using common communication protocols such as tcp / ip . the physical means of communication may be any method capable of transferring digital data from one geographic location to another such as telephone lines , optical cables , satellites , broadcasting , etc . the main means of communication between the remote user and data authorisation centre can be the internet . [ 0062 ] fig3 shows a pictorial representation of a typical screenplay used by the user to perform the user &# 39 ; s symbol set generating task in a preferred embodiment of the invention . such a screenplay is displayed to the user at the remote terminal . in this embodiment the user &# 39 ; s id consists of an alphanumeric character chain . the graphical symbol set of the user consists of at least three graphical symbols that has to be selected as well . in this example the graphical symbols used are basic geometric shapes ( such as regular triangle , square and circle ). each basic graphical symbol of a definite form and shape may be further characterised by two further selection criterions i . e . one of two colours and one of four numbers written on the objects . a ) using the object selection table shown at the left field of the screen , which determine twenty four different symbols categorised by their basic shape e . g . rectangle , triangle , circle etc ., their colour and the number written on them ( the user has to use the mouse or the arrows on the keyboard and the enter at any line ), b ) using the random arrangement of graphical objects ( the user may use the mouse to click on any symbol or on any alphanumeric character shown at the side of each radius to select a group of symbols ), c ) using the keyboard to enter any alphanumeric characters identifying groups of symbols and when the selection criterion is met , he can press the ok button or the enter key . any wrong selection may be repeated after using the cancel key on the keyboard . the significance of the suggested way of symbol selection lies in that humans can well memorise complex shapes including the listed features , and by doing this a comparatively small amount of symbol set elements can represent a huge choice , of which the required selection represents only a single possibility , and it is practically impossible for anyone to find it out without the knowledge of the selection criteria of the user . in this specific embodiment the number of basic graphical symbols is three , each being represented by one of two possible colours and one of four possible numbers being written on them . as there are 108 symbols in the random arrangement , 36 alphanumeric characters at the end of the radiuses plus the user may enter any of the 36 alphanumeric characters also by using the keys of the keyboard , the total number of different three click selections is (( 3 * 2 * 4 = 24 )+ 108 + 36 + 36 = 204 ) 3 = 8 ′ 489 ′ 664 . the user shall identify himself by an alphanumeric character chain . as the number of different character chains is unlimited , in this embodiment the number of users of the system is theoretically not limited . in this preferred embodiment the arrangement of graphical symbols provided by the authorisation centre to the user shall be three concentric circles containing 36 graphical symbols each . in the preferred embodiment the graphical symbol selection algorithms shall consist of subtypes a ) selecting graphical symbol ( s ) by location ( sl ), with variants of absolute location related to a starting symbol and relative location related to an other graphical symbol , or b ) selecting the first , second , etc . graphical symbol by form or feature ( colour , shape , number written on the object or the result of a comparison of two symbols ). the scope and direction of the selection shall be provided ( the whole arrangement , from the starting symbol to one location , from one location to an another location , from one location to the ending symbol ), searching from the direction of the starting symbol toward the ending symbol or from the direction of the ending symbol toward the starting symbol . in this preferred embodiment the graphical symbol modification algorithms shall consist of algorithms changing one form or feature at a time to another specific form or feature ( such as changing any shape to a predetermined shape , changing any colour to a predetermined colour , changing any pattern to a definite pattern ). as an example , the complex graphical symbol selection algorithms may include any of the following commands : select the last two red symbols anticlockwise in the third quarter of the second and third circles , select the first symbol with a 4 digit written on it in the first circle clockwise selected from the radius signed by the character 1 , select the symbols of the second and third circle located on the same radius as the first red symbol in the first circle selected from the radius signed by the character q clockwise , select the symbols being located immediately bellow , above and to the direction of the clock of the first green symbol in the second circle selected in clockwise direction from the radius signed by the character g , etc . with these selection algorithms one may provide 204 * 204 * 204 = 8 ′ 489 ′ 664 different sets of three mouse clicks or key hits from any given random arrangement consisting of 3 concentric circles of 36 symbols . as any set of three mouse clicks or key hits may be reached by many different symbol selection algorithms ( the same symbols may be found on different selection criteria and from different directions ) therefore the number of applicable symbol selection operations is higher by magnitudes . it should be understood that the implementation of other variations and modifications of the invention in its various aspects will be apparent to those of ordinary skill in the art , and that the invention is not limited by the specific embodiments described . the present examples were given only for the illustration how easy thoughts lie behind the sophisticated definitions used hereinabove . with the explanations given above fig2 a shows a flow chart representing the first embodiment of the invention and illustrating how the communication between a user and an authorisation centre is built up required for providing secure access to a limited access system . the user begins the process in step 2 a 1 by communicating his wish to access . in step 2 a 2 the authorisation centre in response to the request to access generates an arrangement of randomly selected graphical symbols and via the remote terminal communicates it to the user . in steps 2 a 3 and 2 a 4 the user uses the randomly selected symbols displayed to him to apply his own unique symbol set generating algorithm and defines ( generates ) his user id which is e . g . a character chain and makes the required symbol selection . in doing this he uses the remote terminal and his selection is entered at the same time in the system . in step 2 a 5 the remote terminal generates a cryptographic key — a multi digit number consisting of a predetermined number of digits — from the set of graphical symbols entered by the user and communicates the key with the authorisation centre . there is a one - to - one correspondence between the selected symbols and the key . in step 2 a 6 , the authorisation centre searches its user id database to verify that the entered user id is valid . in step 2 a 7 , if the user id is not found in the database , access is denied and the system asks the user to try access again . if the reported id is found , the authorisation centre continues with step 2 a 8 , and the valid user id is used to locate the users corresponding symbol set generation algorithm . based on this algorithm and the arrangement of graphical symbols communicated to the user , in step 2 a 9 the authorisation centre generates a corresponding symbol set , i . e . the centre performs the same task on the graphical symbols sent to the user as the user did at steps 2 a 3 and 2 a 4 . in step 2 a 10 the authorisation centre generates a cryptographic key from the corresponding symbol set using the same algorithm as the remote terminal did in step 2 a 5 . in step 2 a 11 the authorisation centre compares the cryptographic key generated by the remote terminal with the corresponding cryptographic key produced in step 2 a 9 . if no matching occurs , the authorisation centre denies access and returns to step 2 a 1 . if a match is detected , the authorisation centre acknowledges access and qualifies the user as an authorised one . once the authorisation centre has granted access , the access procedure is terminated and the user then may continue with the desired transactions . in this example the graphical symbol set displayed to the user was sent to the remote terminal before the identification and control of the user &# 39 ; s id . this can impose certain limitation to the user regarding the freedom of selecting any symbol set algorithm . in the second example illustrated by the flow chart of fig2 b the order of steps are slightly different . this version of user &# 39 ; s authorisation differs from the previous example in steps 2 b 2 and 2 b 6 , whereby the authorisation system first receives the user id of the user and then , instead of generating an arrangement consisting of randomly selected graphical symbols as in step 2 a 2 , the authorisation system generates an arrangement of graphical symbols taking into consideration the best performance of the symbol set generating algorithm assigned to the user id of the user wishing to gain access . the term “ best performance ” designates a graphical symbol sets by which the individual symbol set algorithm can be carried out . really , this can be done easily because after identification the authorisation centre knows the symbol set algorithm selected previously by the user and can generate a set of symbols for display on the screen of the remote terminal , which fits to this selected algorithm . the communication of the user id in step 2 b 2 can take place by using and typing in a pre - selected code by the user , or in the same way as in the previous example , i . e . by the selection of two symbols from an initially displayed set of graphical representations . in this embodiment the graphical symbol set displayed to the user in step 2 b 7 is generally different from the one displayed in step 2 b 2 . in steps 2 b 8 and 2 b 9 the user carries out the selection according to his individual selection algorithm . if a higher degree of security is required , this step can be a symbol set selection and modification step , if the user &# 39 ; s individual algorithm comprises a modification after the selection . the modification can be very simple , e . g . after the selection of a property in a list , the algorithm can be the use of the immediately next or previous property in the list . by this , the number of possible choices increases by a substantial extent . in step 2 b 10 a cryptographic key is generated from the selected ( e . g . three ) symbols . in steps 2 b 11 and 2 b 12 the authorisation centre reproduces the symbol set entered by the user by using the user &# 39 ; s individual algorithm and applying it on the graphical symbols displayed to the user earlier , and generates the cryptographic key by using the same transformation as it occurred at the remote terminal . in steps 2 b 13 the two keys are compared , and login is accepted in case of matching keys only . while in the embodiments shown in the previous two examples the authorisation process was finished by providing access for the authorised user , who then had to send his message of substance to the centre , the embodiment shown in the flow chart of fig2 c combines the transmission of the message with the authorisation process . the steps 2 c 1 to 2 c 10 are identical with the steps of 2 b 1 to 2 b 10 , respectively . in step 2 c 10 the remote terminal generates a cryptographic key — a multi digit number consisting of predefined digits — from the set of graphical symbols entered by the user . in step 2 c 11 the user enters his message and the remote terminal encrypts the users login message with the newly generated cryptographic key . if necessary , the remote terminal can encrypt the whole message again by using a symmetric key or by a combined public key symmetric key cryptographic method . the actual way of this additional encryption does not form part of the present invention . in step 2 c 12 the remote terminal sends the encrypted login message to the authorisation centre . in step 2 c 13 the authorisation centre — based on the user &# 39 ; s symbol set generating algorithm and the arrangement of graphical symbols communicated to the user — generates the corresponding symbol set . in step 2 c 14 the authorisation centre generates a cryptographic key from the symbol set using the same algorithm as the remote terminal in step 2 c 10 . upon creating the cryptographic key , in step 2 c 15 the authorisation centre tries to decrypt the cryptogram of the user &# 39 ; s login message received from the remote terminal . if the message is further encrypted with a symmetric key or a combined public key — symmetric key method , the authorisation centre first decrypts the cryptogram with this method , and upon regaining the original cryptogram — encrypted only with the cryptographic key generated from the symbol set of the user — tries to decrypt the message . in step 2 c 16 the authorisation centre decides whether the result of the decryption fulfils certain conditions known to the remote terminal and to the authorisation centre ( for example the message is written in normal alphanumeric characters or contains a predefined key word , etc .) or not . if the result does not fulfil these conditions , the authorisation centre denies access and continues back to step 2 c 1 . if the result fulfils these conditions , the authorisation centre acknowledges access , and accepts the user as an authorised sender of the whole message . once the authorisation centre grants access and authenticates the user as the sender of the login message , the authorisation procedure is terminated as indicated by step 2 c 17 . in this embodiment by the end of the authorisation process the message of substance is already available for the authorisation centre . if further communication is required between the user and the centre , the so established encryption method can further be used . in the fourth embodiment of the invention represented by fig2 d not only a unique encryption key is generated from the graphical symbol set generated by the user but also a unique cryptographic algorithm . as most of the different encryption methods belonging to block cipher algorithms are — in a simplified way — not more than the repetition of the logical xor operation , permutation and shift operation on the bits of a block of plain text and / or a block of ciphertext in a particular order , it is relatively easy to generate unique cryptographic algorithms to each different graphical symbol set represented by a certain set of multidigit numbers . for example the number of the repetition of each operation ( xor , permutation , shift ) and the parameters of the operation ( in which direction the bits of the text are shifted and by how many places , etc .) may be determined by the actual digits being at certain predefined positions of the multidigit numbers representing the graphical symbol set . according to the above , in step 2 d 11 the remote terminal generates a unique encryption algorithm from the symbol set generated by the user , while in step 2 d 16 the authorisation system generates a corresponding encryption algorithm from the graphical symbol set generated by the authorisation system from the arrangement of graphical symbols communicated to the user and in step 2 d 17 the authorisation system tries to decrypt the cryptogram received from the remote terminal using the cryptographic key and the cryptographic algorithm generated at the authorisation centre . in all other aspects the procedure is done as explained by the description of the previous embodiment . in the fifth embodiment of the invention represented by fig2 e a further way of how to use the basic concept of the invention is represented . in this embodiment not the entire message of the user is encrypted , but a digital fingerprint ( message authentication code , mac ) of the message prepared by he remote terminal . the digital fingerprint is encrypted by using the cryptographic key and the cryptographic algorithm generated on the basis of the graphical symbol set generated by the user . when the authorisation centre receives the message and the encrypted digital fingerprint of the original message , it may generate the same cryptographic key and algorithm as the user , may decrypt the cryptogram of the digital fingerprint received from the user , may create the digital fingerprint of the message received from the user and may compare the digital fingerprint of the message received and the digital fingerprint received in encrypted form . if the two digital fingerprints are identical , the authorisation centre may declare the user authorised and the message authentic . according to the above , in step 2 e 12 the remote terminal generates a digital fingerprint of the message of the user while in step 2 e 13 the remote terminal encrypts the digital fingerprint with the encryption key and encryption algorithm generated in steps 2 e 10 and 2 e 11 . in step 2 e 18 it encrypts the cryptogram of the digital fingerprint received from the user while in step 2 e 19 the authorisation centre generates the digital fingerprint of the message received from the user . in step 2 e 20 the authorisation centre compares the two digital fingerprints and if they are identical it accepts the user and the message as authenticated otherwise denies the login and does not accept the message as authentic . in all other aspects the procedure is done as explained by the description of the previous embodiment . the invention provides a highly secure authorisation and user identification system , which is closely associated to the person of the user , it does not require that the user should use any device for carrying out the identification process . no one can learn the user specific symbol selection and / or modification algorithm even after the watching of several transactions . furthermore , a very reliable and user specific message encryption is provided between the user and the centre . this high degree of reliability allows the use of the internet as a basic and everywhere available tool of communication . these powerful features are basically the results of the fact that graphic symbols can be remembered easily , and the memorising of a symbol selection algorithm is just as easy .	6
the track of this invention consists of a pair of horizontally spaced rail members 10 and 11 composed of ferromagnetic material laminated to reduce eddy currents as illustrated at the numeral 12 . each of the rail members 10 and 11 is attached to a continuous support member 16 which may also be composed of ferromagnetic material but does not need to be so . the support members 16 are in turn fastened to spaced support pillars 17 . the base of each of the support members 16 terminates in a continuous strip member 48 to give an l - shaped cross - sectional configuration to the members 16 and 48 as shown in fig1 and 2 . centered between the rails 10 and 11 are a plurality of spaced cobalt - rare earth magnets 13 which have alternate transverse polarity orientation as indicated by the letters &# 34 ; s &# 34 ; and &# 34 ; n &# 34 ;. there is a small air gap between each pole and the nearest vertical surface of the rails 10 and 11 . thus , as indicated by the arrowed line in fig3 magnetic flux from the north pole of the magnet 13 illustrated at the left in fig3 crosses the air gap to the rail 10 , proceeds along the rail 10 to the south pole of the magnet 13 at the right , thence to the rail 11 and along the rail 11 to the south pole of the magnet 13 at the left , and back to the north pole of this magnet to complete a magnetic circuit . cobalt - rare earth magents have become well known and commercially available during the past fifteen years . their magnetic field strength is so great that a kilogram of such magnets can hold fifty kilograms of ferromagnetic material against the pull of gravity . the technology of such magnets will not be discussed herein as it plays no part in the present invention . of course , other permanent magnets possessing magnetic field strength comparable to that of cobalt - rare earth magnets could be used in place of the cobalt - rare earth magnets . as an example of the effectiveness of cobalt - rare earth magnets , a 20 , 000 - pound vehicle with 100 passengers requires about 500 pounds of high - magnetic - strength ( 25 million gauss - oersteds ) rare earth magnets . this provides for a safety factor of 2 and allows 11 / 2 centimeter gaps on either side of the magnets -- an important feature . with this large a gap , variations in roadbed have negligible effect on operations . the influence of roadbed variations is of course minimal anyway because they only affect the area of the gap and not the length of the gap . a hanger member 14 connects a cargo - carrying vehicle 15 to the magnets 13 . the weight of the vehicle 15 exerts a downward force on the magnets 13 producing a vertically off - center position of the magnets as illustrated in fig1 and 4 . if there were no such downward force , the magnets 13 would seek a vertically centered position with respect to the closest faces of the rails 10 and 11 . the magnets 13 resist either an upward or a downward force from this centered position . thus , the system of this invention is inherently stable with respect to vertical forces . of course , an applied force can be sufficiently great to cause fall - out . for this reason , the system must be designed so that the maximum likely applied force will be insufficient to cause fall - out . in addition , a mechanical limiting arrangement with a set of wheels 21 is incorporated as a safety measure to limit vertical movement downward . the vertical stability afforded by the present system overcomes problems of roll and pitch present in other systems and enables safe high - speed operation of the vehicle 15 . this may be perceived by reference to the embodiment of fig4 . superficially , it appears that this embodiment is the magnetic equivalent of a conventional wheeled system but it operates in a significantly safer manner . if a very severe side wind strikes the side of a wheeled vehicle the windward wheels can be raised from rail contact and the weight of the vehicle thrown on the leeward wheels . if the wind force persists the vehicle can be pushed beyond a critical angle and gravity will then aid the wind force to pull the vehicle over on its side . in the embodiment of fig4 the same application of wind force will raise the magnets on the windward side of the vehicle and lower those on the leeward . but as the windward magnets rise above their vertically centered position with respect to the rails 10 and 11 , they will exert a downward force on the windward side of the vehicle which -- combined with the increased upward force applied by the magnets on the leeward side of the vehicle -- will offer to the wind force a resistance tending to restore the vehicle 15 to normal operating position . by providing inherent vertical stability rather than inherent horizontal stability as in other maglev systems the present invention converts a difficult problem -- vertical stability - into a rather simple one . horizontal destabilizing forces are much smaller than vertical ones and a plurality of wheels 20 mounted on a shaft 22 , which are not under load ( except in embodiments where they are used for propulsion ) can readily contain them . in the embodiment illustrated in fig1 a plurality of spaced coils 19 are run through the rails 10 and 11 . these coils are used for synchronous propulsion of the vehicle 15 after the manner of sawyer u . s . pat . no . 4 , 061 , 089 . while the system has inherent vertical stability , it does not have inherent horizontal stability and for this reason the wheels 20 serve to maintain the magnets 13 in a horizontally centered position with respect to the rails 10 and 11 . the structure of fig3 illustrates an electromagnetic means for centering the magnets 13 with respect to the rails 10 and 11 . it may be used alone or -- preferably -- to supplement the action of the wheels 20 . in this embodiment , centering of each magnet 13 between the rails 10 and 11 is maintained or aided by electromagnets . a set of extensions 18 is fixedly connected one at each end to the magnets 13 . each extension 18 has a set of electromagnets such as 26 , 28 and 31 , 33 positioned in spaced relation with the vertical inner walls of the rails 10 and 11 . associated with the electromagnet 26 is a gap sensor 27 positioned in spaced relation with the inner vertical surface of the rail 11 . a typical gap sensor is a hall effect device that senses a change in air gap dimension by producing a voltage error signal which can be used to energize an electromagnet . when the gap sensor 27 senses that it is getting too close to the inner vertical surface of the rail 11 , it sends an energizing signal along an electrical connector 39 to a coil 35 which activates the electromagnet 26 to pull the magnet 13 back toward centered position between the rails 10 and 11 . the electromagnets 28 , 31 and 33 with their respective gap sensors 29 , 32 and 34 , their respective electric cables 40 , 41 and 42 , and their respective coils 36 , 37 and 38 operate in a complementary fashion . thus , the fast - acting electromagnetic controls of fig3 operate to prevent any contact between the magnets 13 and the rails 10 and 11 . fig4 illustrates the invention as applied to a rail - below - vehicle system . while the illustration of this embodiment shows a double track system it could also be used as a single track system provided the vehicle 15 included a gyroscope to maintain it in upright position . the levitation mechanism of fig4 operates in the same manner as the levitation mechanisms of fig1 and 2 . in this embodiment the coils 19 are recessed so as not to protrude above the rails 10 and 11 and the safety wheels 21 are mounted on a shaft 22 &# 39 ; above the rails 10 and 11 so as to make contact with the tops of these rails in the event of an emergency magnetic fall - out . in fig1 - 4 dimensions have been exaggerated in order to promote clarity of illustration . each vehicle has at least two sets of magnets like the magnets 13 of fig1 and they may be swivel - mounted in order to accommodate to track curvature . typical propulsion means used in maglev systems are linear induction motors and linear synchronous motors such as are described in the aforementioned sawyer u . s . pat . no . 4 , 061 , 089 which issued dec . 6 , 1977 . such propulsion systems , however , are not necessary to the practice of the present invention . utilizing conventional electric motors to rotate the wheels 20 is quite satisfactory . thus , it can be seen that this invention is subject to many variations which can properly be considered as falling within its scope . accordingly , the scope of the invention should not be limited other than as may be necessitated by the scope of the appended claims .	1
the following examples further specifically illustrate the improved electrophoretic imaging system provided by this invention . parts and percentages are by weight unless otherwise indicated . the following examples are intended to illustrate various preferred embodiments of the present invention . all of the examples are carried out in an apparatus of the general type illustrate in fig1 . a 500 watt quartz iodine light source is used to illuminate a black and white negative transparency , the image being projected by a lens through the tin oxide coated glass on which the particular photoconductor is coated . the suspension is formed by dispersing finely divided particles of the specific material in an insulating liquid . the suspension is milled until the particles are less than about 2 microns in cross - section and are uniformly dispersed . a source of high potential is connected to a roller electrode which has a one inch diameter steel core and a 3 / 4 layer of polyurethane having a resistivity of 5 × 10 8 ohm cm forming a 2 . 5 inch diameter roller . a paper sheet is placed over the polyurethane surface to receive the images . the other lead of the source of high potential is connected to the conductive surface of a nesa glass plate . a 1 micron layer of selenium is vacuum evaporated onto the conductive surface of the nesa glass plate to form the photoconductive electrode . approximately two parts of magenta dyed resin type r103 - 6 available from the radiant color co ., richmond , california is suspended in about 5 parts of sohio odorless solvent 3454 , a mixture of kerosene fractions available from standard oil co . of ohio . this suspension is coated onto the selenium surface using a no . 4 mayer coating rod . the roller electrode is rolled across the suspension at a rate of about 2 inches per second with a potential of about 3500 volts applied . the roller is held at a negative potential with respect to the photoconductive electrode . as the roller traverses the suspension , the photoconductor is exposed to light projected through a negative transparency . on completion of roller traverse a positive image is found adhering to the paper on the roller electrode and a negative image is found on the photoconductor surface . the experiment of example i is repeated except that prior to roller traverse and imagewise illumination the suspension is subjected to a source of corona from a corona generating electrode held at a negative 7000 volts with respect to ground . the image formed on the paper is compared to the image formed in example i . the image formed in this example is found to have a decreased background . the experiment of example ii is completed except that the selenium is coated with a 0 . 5 micron protective layer of poly ( n - vinyl carbazole ) ( pvk ). the coating is applied by dissolving about 2 parts by weight pvk in 60 parts dioxane and 40 parts cyclohexanone and coating the solution on the selenium using a no . 4 mayer rod . the coating is allowed to dry . the suspension is placed on this coating . pvk is an example of an active transport dielectric . on completion of roller traverse , a positive image of excellent quality is found adhering to the paper . in the following examples iv - vi , the particles are dispersed in a solid binder which is dissolved just prior to imaging by application of a solvent . these layers have an advantage in that colored liquids need not be handled . a photoconductive layer is formed by dispersing about one part by weight of the x - form of metal - free phthalocyanine made as shown in u . s . pat . no . 3 , 357 , 989 in a mixture containing 3 parts of pe - 200 ( a polyester resin available from goodyear tire and rubber co . ), about 15 parts of methyl ethyl keytone , and about 10 parts of toluene . the slurry is coated on a 2 . 0 mil mylar film , a polyester available from dupont using a no . 6 wire wound rod producing a photoconductive layer of about 4 - 5 microns dry thickness . this mylar backed photoconductive layer is then overcoated with an ink suspension of about 2 parts by weight lawter cyan blue ( b - 2858 hi - viz pigment available from the lawter chemicals inc . chicago , ill .) and about one part eicosane , and 15 parts sohio 3454 , a mixture of kerosene fractions available from standard oil of ohio using a no . 8 wire wound rod providing a 5 - 6 micron layer dry . this combination of photoconductor , substrate and particle - binder layers is placed on a nesa glass plate , the photoconductive layer in contact with the conductive nesa glass coating . the photoconductor is exposed and traversed by the roller as in example i except that the paper on the roller is wetted with sohio 3454 which dissolves the binder for the lawter cyan blue pigment . on completion of roller traverse , a positive image is formed on the paper on the roller electrode . in this embodiment the photoconductive layer can be varied from about 1 to about 50 microns and the particle - binder layer can be varied from about 3 to about 20 microns with satisfactory results . the experiment of example iv is repeated except that the photoconductive layer is replaced with a photoconductive layer made by coating about one part by weight monastral red b , a quinacridone pigment available from dupont , one part by weight pe - 200 , about 6 parts by weight methyl ethyl ketone and about 4 parts by weight toluene on 2 . 0 mil myler as in example iv . an image is formed as in example iv . the experiment of example iv is repeated except that the photoconductive layer is made by coating a slurry of about 2 parts indofast yellow lake y - 5713 , available from harmon color , division of allied chemical and dye company about one part pe - 200 , about 15 parts by weight methyl ethyl ketone and about 10 parts by weight toluene on 2 mil mylar as in example iv . a cyan image is formed as in example iv with the exception that the roller is held at a positive about 3500 volts with respect to the nesa glass . the experiment of example iii is repeated except that the magenta dyed resin particles are replaced by particles of iron oxide , mapico eg3 , available from columbia carbon co ., new york , new york , overcoated with melamine - formaldehyde resin . the paper receiver sheet is also replaced by a mylar sheet available from dupont . the image formed may then be magnetized and used as a ferromagnetic master as shown , for example , in ferrography by atkinson and ellis , journal of the franklin institute , volume 252 , no . 5 , november , 1951 . it may also be used as a record in machines equipped for the automatic reading of magnetic patterns , for example , printed on a bank check and read in an automatic magnetic check sorter . the experiment of example iii is repeated except that the magenta dyed resin particles are replaced with particles of luxol fast black l , a spirit soluble dye available from dupont . the image formed on the paper receiver sheet may then be used as a spirit master . spirit masters are made in these examples as in example viii except that in example ix the particles are grasol fast brilliant red bl , available from geigy chemical co ., in example x the particles are luxol fast scarlet c and in example xi the particles are gentian violet available from hartman - leddon co . in this example a full color image is prepared by combining yellow , cyan and magenta monochroome images . first , red , yellow and blue separation images are prepared using conventional techniques to provide negative transparencies . a magenta image is made as in example iii using the proper separation image . a cyan image is formed as in example iii using lawter cyan blue b2 , as the particles , exposure being made through the proper separation image . a yellow image is formed as in example iii using strong lemon yellow b2141 , available from lawter chemical inc . in place of the magenta particle . the three images are transferred in register to a receiver sheet . since the particles are all resinous fusible materials fixing is accomplished by radiant or contact heating providing a full color positive image . the experiment of example xii is repeated except that sunset yellow p6000 g , blue r103 - g - 119 and magenta p1700 available from radiant color co ., richmond , california are used as the particles . the image is fixed as in example xii . although specific components and proportions have been described in the above examples , other materials as listed above , where suitable may be used with similar results . in addition , other materials may be added to the various layers to synergize , enhance or otherwise modify their properties . for example , the photoconductive layer may be dye - sensitized to alter its photoresponse . other modifications and ramifications of the present invention will occur to those skilled in the art upon a reading of the present disclosure . these are intended to be included within the scope of this invention :	6
the inventors herein show that it is possible to give a more accurate prediction of the presence of lymph node metastasis of hnscc than currently possible , by measuring mrna expression of a concise set of genes ( the predictor signature ). it appeared possible to give an accurate prediction on basis of a set of 102 genes listed in table i . it appeared that half of these genes have not been directly associated with tumorigenesis or metastasis before . besides expected epithelial marker genes , interesting categories include genes ( putatively ) coding for extracellular matrix components , genes involved in cell adhesion including three members of the plakin family of cytolinkers and the enzyme transglutaminase 3 , which play a role in maintaining tissue integrity ; cell death genes ; cell growth and maintenance genes and genes encoding hydrolyzing activities including proteins involved in degradation of the extracellular matrix ( upa and pai - 1 ) and a metalloproteinase . another feature of the metastasis signature is that there is more down - regulation associated with metastasis ( two thirds ) than up - regulation . it is likely that this involves stromal and immune - regulatory components ( pollard , j . w . ( 2004 ) nat . rev . cancer 4 , 71 - 78 ; chambers , a . f . et al . ( 2002 ) nat . rev . cancer 2 , 563 - 572 ). many of the predictor genes belong to this categories , strengthening the argument for profiling bulk tumour tissue rather than laser - dissected regions densely populated with tumour cells . it is shown herein that a diagnosis / prediction of the presence of metastases can be given using expression data of a set of only five genes from this large set of 102 genes . table 2 indicates 15 of the genes which rank high in predictive value and which can especially be used to give a diagnosis or prediction of metastasis in hnscc . of course , accuracy of prediction will increase when more then five , preferably all 15 and even more preferably all 102 genes will be used on an array for gene expression analysis for the diagnostic / predictive signature . gene expression analysis is preferably done using a micro - array . the techniques for measuring and comparing gene expression on micro - arrays is well established within the art . it should be understood that it is not necessary to have the full length nucleotides encoding the above mentioned genes on said array : a stretch of nucleotides which is sufficient to establish unique hybridisation with the rna expressed from said genes in the tumour cells can be used . such a stretch of nucleotides is hereinafter referred to as ‘ element ’. preferably for the specific use of gene expression analysis for the current invention ( i . e . with relation to detection of the presence of or the risk for metastases of hnscc ) such an array need not contain a large number of ( different ) genes or elements . it would be sufficient for the array to contain the necessary genes , as discussed above , and , preferably , some control genes , as will be discussed below . the array , which can be used for the analysis of the invention thus does not need to contain more than 1000 genes or elements , preferably not more than 500 genes or elements , more preferably not more than 200 genes or elements and most preferably from about 50 to about 150 genes or elements . to investigate a gene expression profile the array should be subjected to hybridisation with target polynucleotide molecules from a clinically relevant source , in this case e . g . a person with hnscc . therefore , preferably a fresh frozen ( within 1 hour from surgical removal ), liquid nitrogen ( at least − 80 ° c .) stored tumour sample needs to be available . said target polynucleotide molecules should be expressed rna or a nucleic acid derived therefrom ( e . g ., cdna or amplified rna derived from cdna that incorporates an rna polymerase promoter ). if the target molecules consist of rna , it may be total cellular rna , poly ( a ) + messenger rna ( mrna ) or fraction thereof , cytoplasmic mrna , or rna transcribed from cdna ( crna ). methods for preparing total and poly ( a ) + messenger rna are well known in the art , and are described e . g . in sambrook et al ., ( 1989 ) molecular cloning — a laboratory manual ( 2 nd ed .) vols . 1 - 3 , cold spring harbor , n . y . in one embodiment , rna is extracted from cells using guanidinium thiocyanate lysis followed by cscl centrifugation ( chrigwin et al ., ( 1979 ) biochem . 18 : 5294 - 5299 ). in another embodiment , total rna is extracted using a silica - gel based column , commercially available examples of which include rneasy ( qiagen , valencia , calif ., usa ) and strataprep ( stratagene , la jolla , calif ., usa ). poly ( a ) + messenger rna can be selected , e . g . by selection with oligo - dt cellulose or , alternatively , by oligo - dt primed reverse transcription of total cellular rna . in another embodiment , the polynucleotide molecules analyzed by the invention comprise cdna , or pcr products of amplified rna or cdna . preferably , the target polynucleotides are detectably labelled at one or more nucleotides . any method known in the art may be used to detectably label the nucleotides . preferably , this labelling incorporates the label uniformly along the length of the polynucleotide and is carried out at a high degree of efficiency . one embodiment for this labelling uses oligo - dt primed reverse transcription to incorporate the label ; however , conventional methods hereof are biased toward generating 3 ′ end fragments . thus , in this embodiment , random primers ( e . g . 9 - mers ) are used in reverse transcription to uniformly incorporate labelled nucleotides over the full length of the target polynucleotides . alternatively , random primers may be used in conjunction with pcr methods or t7 promoter - based in vitro transcription methods in order to amplify the target polynucleotides . in a preferred embodiment , the detectable label is a luminescent label . for example , fluorescent labels , bioluminescent labels , chemiluminescent labels and calorimetric labels may be used . in a highly preferred embodiment , the label is a fluorescent label , such as a cy5 or cy3 , fluorescein , a phosphor , a rhodamine , or a polymethine dye or derivative . in another embodiment , the detectable label is a radiolabeled nucleotide . the array may be any nucleotide array which represents five or more of the genes of table 2 or table 1 . to indicate the difference with the existing very large arrays of e . g . affymetrix , the dedicated arrays of the present invention should preferably comprise no more than 50 , or 100 , or 250 or , alternatively 500 or 1000 genes altogether . presence of other genes on the array is allowable and the expression data from such other genes need not necessarily be considered for the present application . the methods of the invention can be applied on the above mentioned dedicated arrays , but can also be performed on arrays that are commercially available ( e . g . from agilent us ; affymetrix inc , ca , usa ; and others ). it is also possible to work with self - made arrays by spotting or synthesizing nucleotides which are known to selectively hybridise to the target genes on a surface . methods to prepare such arrays are well within the skill of the artisan . the microarrays can comprise cdna , but can also comprise short oligonucleotides ( affymetrix and nimblegen ) or long oligonucleotides which are synthesized in situ_ ( agilent ); in another embodiment the arrays comprise long oligonucleotides and are self - made by spotting . nucleic acid hybridisation and wash conditions are chosen so that the target polynucleotide molecules specifically hybridize to the complementary polynucleotide sequences of the array , preferably to a specific array site , wherein its complementary dna is located . optimal hybridisation conditions will depend on the type ( e . g ., rna or dna ) of the target nucleotides and array . general parameters for specific ( i . e ., stringent ) conditions of hybridisation are described in sambrook et al . ( supra ). typical hybridisation conditions for cdna microarrays are hybridisation in 5 × ssc plus 0 . 2 % sds at 65 ° c . four hours , followed by washes at 25 ° c . in low stringency wash buffer ( 1 × ssc plus 0 . 2 % sds ), followed by 10 minutes at 25 ° c . in higher stringency wash buffer ( 0 . 1 × ssc plus 0 . 2 % sds ). when fluorescently labelled probes are used , the fluorescence emissions at each site of the microarray may be detected by scanning confocal laser microscopy . in one embodiment , the arrays is scanned with a laser fluorescent scanner with a computer controlled x - y stage and a microscope objective . fluorescent laser scanning devices are described in e . g . schena et al . ( 1996 ) genome res . 6 : 639 - 645 . signals are recorded and , in a preferred embodiment , analysed by computer using a 12 or 16 bit analog to digital board . in one embodiment the scanned image is despeckled using a graphics program ( e . g ., hijaak graphics suite ) and then analysed using an image gridding program that creates a spreadsheet of the average hybridisation at each wavelength at each site . not all of the genes are evenly contributing to the discriminating effect . as is shown in table 1 , the genes differ in significant expression . although the statistical data presented in the examples are calculated with all of the 102 genetic elements of table 1 , it is submitted that a good distinction between the two groups of patients and therewith a good diagnosing / predicting ability of the signature gene set can also be achieved with only a part of the elements of table 1 . at least 5 ( 5 %) of the elements of table 1 are included in the analysis , more preferably 20 %, more preferably 40 %, more preferably 60 %, more preferably 80 %, more preferably 90 % and most preferably all of the elements . it would be advisable not to randomly choose the elements , but to pick the most discriminating genes in this list . table 2 gives an overview of the top 15 genes out of the 102 genes of table 1 , of which at least 5 , more preferably at least 6 , more preferably at least 7 , more preferably at least 8 , more preferably at least 9 , more preferably at least 10 , more preferably at least 11 , more preferably at least 12 , more preferably at least 13 , more preferably at least 14 , and most preferably all 15 can be used for making up the signature with which the microarray analysis is performed . it furthermore has been found that a more comprehensive set of predicting genes can be compiled by repeatedly calculating a predictive signature via a multiple training approach ( similar to michiels , s . et al ., lancet 365 : 488 - 492 , 2005 ). in this study ( see examples ) it appeared that from the originally more than 2000 differentially expressed genes only 825 ( table 3 ) had a predictive character , and that for these a subgroup of 179 ( table 4 ) genes was used in more than half of the signatures . from this group again a supergroup of 61 genes ( table 5 ) could be distinguished which was predominantly used to discriminate between n + and n0 . it will be understood that preferably an array would comprise at least three , but preferably five , more preferably 10 , even more preferably 25 and most preferably 61 of the genes of table 65 . however , it also appeared possible to classify on basis of genes , which did not occur in table 5 , but in such cases many genes are required to achieve an acceptable prediction . thus , an array could also comprise at least 10 , preferably 25 , more preferably 50 , and most preferably 100 of the genes of table 5 . as indicated above , various combinations of these genes can be used for determining the presence of lymph node metastases in several ways . on dual channel dna microarrays this is performed by determining the expression level ratios of the genes in the primary tumour sample versus expression of the same genes in reference material . the reference material can be derived from a pool of total rna or amplified mrna from a set of hnscc primary tumours with established lymph node metastasis characteristics . the individual gene expression ratios contribute towards the expression ratio signature of a sample . the degree of correlation of a sample &# 39 ; s signature with the signatures of samples with known metastatic status ( preferably calculated by the cosine correlation ( jones , w . p ., & amp ; furnas , g . w . ( 1987 ). pictures of relevance : a geometric analysis of similarity measures . journal of the american society for information science , 36 ( 6 ), 420 - 442 ) as , e . g , provided by the genesis software ; http :// genome . tugraz . at / software / genesis / description . html ) is used to predict the metastatic state of the unknown sample . the correlation threshold for predicting the metastatic state is based on the optimal threshold for discriminating between the metastatic states of the samples with known metastatic states , which can easily be determined by a person skilled in the art other measurements of absolute expression and expression ratios of these genes can also be used . reference material can be derived from other sources than a pool of samples with known metastatic states . preferably , however , samples with known metastatic states are still required to determine the correlation threshold for determining the metastatic status . expression ratios can also be derived from single channel microarray experiments , using as a reference so - called housekeeping genes ( i . e . with stable expression across many different samples ) or a collection of housekeeping genes or any collection of genes or features with stable expression . again here it is preferred to use samples with known metastatic states to determine the correlation threshold for determining the metastatic status . gene expression measurements and the derived ratios can also be obtained by ( quantitative ) reverse transcription pcr or any other assay for gene expression , using as a reference any gene or collection of genes that have stable expression across many samples . in a specific embodiment of this application of the invention , samples with known metastatic states are still required to determine the correlation threshold for determining the metastatic status . in the absence of tumour samples with known metastatic states for calibration of the prediction , the genes or various combinations of the ( expression analysis of the ) genes can still be used to predict the metastatic state . in these embodiments of the invention an absolute or relative measurement of gene expression is determined for example using single or dual channel dna microarrays , or by other methods such as ( quantitative ) reverse transcription pcr . increased expression of the genes in table 1 or 2 with a positive n + correlation will hereby contribute positively towards prediction of the n + status and negatively towards prediction of the n0 status . conversely , increased expression of the genes in table 1 or 2 with a negative n + correlation will contribute positively towards n0 prediction and negatively towards n + prediction . increased expression in both cases indicates an increase relative to a suitable marker gene or feature , set of genes or features or collectively in relation to each other . however , a person skilled in the art is able to obtain the reference data that have been produced in the below example , since this data is available as dataset e - umcu - 11 from the public micro - array database arrayecpress ( http :// www . ebi . ac . uk / arrayexpress /). when desiring to predict or determine the presence of metastases for a certain patient , the practitioner should take a biopsy from that patient , isolate the rna and determine the expression of at least 5 of the elements of table 1 . to normalize these expression data with respect to the data of the reference set e - umcu - 11 , it is possible to correct the data for variations with the help of expression data of a control gene or element which is not affected by the tumour state ( such as a housekeeping gene ), which is present in the reference set e - umcu - 11 and should also be available on the array that has been used to determine the expression profile of the patient to be assessed . in stead of one control gene or element , also the mean value of a poll of control genes or elements can be taken . this correction can , for instance , be done by subtracting the expression level of the control gene ( s )/ element ( s ) from the expression levels of each of the tested genes / elements . preferably , the ratio for every tested gened with respect to the control gene ( s ) is calculated for both the patient &# 39 ; s expression profile as well as for the expression data of the reference set . with these figures , the correlation with the mean value of the n0 values of the reference set should be calculated . if this correlation is negative ( i . e . a value below zero ) it can be concluded that the patient is n + ( i . e . having or prone to develop metastases ). conversely , the correlation can be calculated with respect to the mean value of the n + values of the reference set . then a negative correlation indicates a match with the n0 group . further enablement for a diagnosis / prediction of cancer metastasis on basis of gene expression analyses can be found in wo 03 / 010337 , indicating that methods as have been generally described above are well within the skills of the practitioners in the art . miame 1 compliant data in mage - ml 2 format as well as complete descriptions of protocols , microarrays and clinical parameters have been submitted to the public microarray database arrayexpress ( http :// www . ebi . ac . uk / arrayexpress /) with the following accession numbers : microarray layout , a - umcu - 3 ; hnscc tumour data , e - umcu - 11 ; protocols for sectioning of tumour material , p - umcu - 18 ; rna isolation , p - umcu - 19 ; dnase treatment , p - umcu - 20 ; mrna amplification , p - umcu - 21 ; generating reference pool , p - umcu - 26 ; crna labeling , p - umcu - 22 ; hybridization and washing of slides , p - umcu - 23 and p - umcu - 24 ; scanning of slides , p - umcu - 25 ; image analysis , p - umcu - 11 for the training set , 92 samples were randomly taken from a collection of primary tumours surgically removed between 1996 and 2000 and that fulfilled the following criteria : biopsy - proven hnscc in the oropharynx and oral cavity ; no previous malignancies in the head and neck region ; tumour sections contained more than 50 % tumour cells . of these 92 tumours , 82 passed total rna and crna quality control ( qc ) and were included in this study . for the validation set , 27 tumours were randomly taken from the same collection of tumours , surgically removed between 2000 and march 2001 , and that fulfilled the same selection criteria . of these , 22 passed total rna and crna qc and were included in this study . the diagnostic procedures for clinical staging of cervical lymph nodes was performed according to the netherlands national guidelines for oral cavity and oropharynx carcinomas , by clinical examination ( palpation ) of the neck region , followed by bilateral ultrasound examination , computed tomography ( ct ) and / or magnetic resonance imaging ( mri ). suspected nodes were subjected to aspiration cytology . in this way , patients were pre - operatively classified as either n0 or n +, the latter in the case of aspirates yielding metastatic tumour cells . only in the case of obvious neck involvement , as shown by huge swelling , were the patients classified as n + without additional efforts to prove the presence of metastasis . surgery was aimed at complete tumour removal . with regard to the neck , in the case of clinical n0 only a sohnd was performed 3 . in cases clinically classified as n + a rnd was performed including all five lymph node levels 3 . postoperative irradiation was administered in accordance with current practice and depending on margin status , tumour growth features , number of positive nodes and extracapsular growth . in practice , 36 out of 60 clinically assessed n0 patients and 38 out of 43 clinically assessed n + patients received radiation therapy . this treatment as well as additional clinical information is presented in supplemental data 2 ( for accessibility , see above ). after surgery , patients were periodically checked for development of neck metastasis , and patients initially classified as n0 but showing positive nodes in their surgical specimen or developing neck nodes within a time span of 3 years after surgery without having another head and neck cancer that could be responsible for this metastasis , were retrospectively added to the n + patient group . less than 5 % of patients with hnscc in the oral cavity or oropharynx subsequently develop metastasis after treatment 4 , 5 . here , for the training and validation cohorts , one patient subsequently developed positive neck nodes after surgery . three years is to be considered as a reliable time period , since at least 80 % of the recurrences are known to take place in the first two years after surgery ( takes , r . p . et al . ( 2001 ) j pathol 194 , 298 - 302 ; jones , k . r ., et al ., ( 1992 ) arch . otolaryngol . head neck surg . 118 , 483 - 485 ) fresh tumour tissue was taken from the surgical specimen , snap - frozen in liquid nitrogen immediately after surgical removal and stored at − 80 ° c . frozen sections were cut for rna isolation and immediately transferred to a rnalater solution ( ambion ). a haematoxylin and eosin stained section was prepared for tumour percentage assessment . only samples with at least 50 percent tumour cells were used . for a small number of samples the tumour percentage was increased by removing areas with no tumour cells . total rna was isolated from 2 - 3 sections ( 20 μm ) with trizol reagent ( invitrogen ), followed by a purification using the rneasy mini - kit ( qiagen ) and a dnase treatment using the qiagen dna - free kit . the yield and quality of total rna was checked by spectrophotometry and by the agilent 2100 bioanalyser ( agilent ). total rna quality control criteria were in accordance with the tumour analysis best practices working group 6 , discarding samples with no clear 18s and 28s ribosomal bands . we also removed samples that had a yield lower than 500 ng total rna or showed mycoplasma contamination . mrna was amplified by in vitro transcription using t7 rna polymerase on 1 μg of total rna . first a double stranded cdna template was generated including the t7 promoter . next , this template was used for in vitro transcription with the t7 megascript kit ( ambion ) to generate crna . during the in vitro transcription , 5 -( 3 - aminoallyl )- utp ( ambion ) was incorporated into the single - stranded crna . the yield and quality of the crna was analyzed by spectrophotometry and by the agilent 2100 bioanalyser . samples with a yield less than 5000 ng or with small crna fragments ( median less than 500 bp ) were not used . cy3 or cy5 fluorophores ( amersham ) were coupled to 500 ng of crna . after coupling , free dye molecules were removed using clontech chromospin - 30 columns ( clontech ). the yield and label incorporation ( 5 - 7 %) of the cy - labeled crna was checked using spectrophotometry . before hybridization , 300 ng of cy - labeled crna from one tumor was mixed with an equal amount of reverse color cy - labeled material from the reference sample . the human array - ready oligo set ( version 2 . 0 ) was purchased from qiagen and printed on corning ultragaps slides as described elsewhere 7 . the microarrays contained 70 - mer oligonucleotides representing 21 , 329 genes as well as 3871 additional features for control purposes . before use , the microarray slides were treated with sodium - borohydrate solution to reduce auto - fluorescence in the cy3 - channel 8 . the labelled crna targets were hybridized on the microarray for 10 hours at 42 ° c . using the ventana discovery hybridization station in combination with the chipmap - 80 kit ( ventana europe ). after hybridization the slides were manually washed and scanned in the agilent g2565aa dna microarray scanner ( 100 % laser power , 30 % pmt ). the scanned images were quantified and background corrected using imagene 4 . 0 software ( biodiscovery ). the expression data was normalized for dye and print - tip biases using a lowess per print - tip normalization algorithms applied in the statistical package r 10 . following normalization , variance stabilization ( vsn ) 11 was applied to stabilize variance in the intensity data . both duplicate dye - swap hybridizations of each tumour were averaged and for each gene a tumour - reference ratio was calculated . reference versus reference hybridizations were used to build a gene error model for technical variation . nine reference self - self comparisons were performed in dye - swap ( 18 hybridizations ), resulting in nine reference ratios for each gene on the microarray . these nine reference ratios yield an estimate of the technical variation for each gene . to test whether a gene in a tumour samples shows differential expression , a student &# 39 ; s t - test was applied on the tumour ratio and the corresponding nine reference ratios ( technical variation ). the calculated p - values for differential expression were used to select those genes that show differential expression in the tumour samples . a classifier was constructed to distinguish between n0 and n + patients . of the 21 , 329 genes on the microarray , 6221 were excluded based on aberrant signal and spot morphology in one of the 164 hybridizations . from these remaining 15 , 108 genes , only genes that were significantly different from the reference in at least 31 tumours were selected based on the error model for technical variation ( p & lt ; 0 . 01 ). this resulted in a set of 1 , 986 genes . for these genes the signal - to - noise - ratio ( snr ) 12 was computed and employed to rank the genes ( top ranked genes being genes that are best suited to distinguish the outcome classes ). the optimal gene set to employ in the classifier ( a nearest mean classifier similar to the classifier employed in 13 ), was determined by gradually expanding the gene set starting from the highest ranked gene . at each expansion round the nearest mean classifiers was trained on a training set and tested on a test set . the performance on the test set served as a quality measure of the gene set . the performance was measured as the average of the false positive ( n0 classified as n +) and false negative ( n + classified as n0 ) rates of the test samples . initially the performance increases as the set is expanded . the expansion of the gene set is terminated when the performance deteriorates , i . e . when the optimal performance is reached . the steps of ranking the genes and training and testing the classifier are performed in a 10 - fold cross - validation procedure . the output of this procedure is an optimal number of top - ranked genes and a trained classifier . to ensure independent validation , this process of optimizing the set of genes and training the classifier is wrapped in a second 3 - fold cross - validation loop . this entails that the optimization of the gene set and the training of the classifier is performed on ⅔ of the data , while the classifier is validated on ⅓ of the data . since this ⅓ of the data is never involved in any of the gene selection and training steps , this ensures completely independent validation of the classifier , which avoids selection bias 14 , 15 and therefore results in a reliable performance estimate . this double - loop procedure determined 102 genes to form the final diagnostic classifier . this classifier was trained on the complete set of 82 samples by recalculating the signal - to - noise ratio for all genes and subsequently selecting the top 102 genes . the predictor was trained using the 102 selected genes and the 82 training samples . a decision threshold for this classifier was fixed such that the highest overall predictive accuracy for both n0 and n + tumours . was reached . odds ratios ( or ) were calculated by fitting a logistic regression model on the prediction outcome of the validation set . the predictor had an infinitive or since no false negative prediction was made . to get an estimate of the or for the predictor , one false negative was artificially introduced resulting in a predictor or of 30 ( p = 0 . 006 ) and a clinical or of 4 . 2 ( p = 0 . 15 ). the standard error for predictive accuracy ( fig3 a ) includes the predictions made on the latter half of the training set . a multiple training approach was used to identify a complete set of predictive genes , based on the 66 tumor samples from 1998 to 2001 . the tumor samples were randomly divided into a training set and test set using a 10 - fold cross validation procedure . based on the training set , p - values were calculated for all 3064 differentially expressed genes based on the difference in expression between n + and n0 tumor samples ( student &# 39 ; s t - test ). the set of genes with lowest p - values ( i . e . most - predictive ) was used for prediction of the test samples by calculating the correlation with the average n + and average n0 training profile and , based on these correlations , classifying the test samples as n0 or n +. repeating this resampling procedure a thousand times resulted in multiple predictions for each tumor sample , based on the different predictive gene sets . this approach was repeated three times to determine 1000 predictive gene sets consisting of 50 genes , 1000 gene sets of 100 genes and 1000 gene sets of 200 genes . all gene sets had predictive value ( fig1 ). genes selected at least once are listed in table 3 . this consists of 825 genes with predictive power for detection or prediction of metastasis in head and neck squamous cell carcinoma . small and large sets of genes from this list can be used for prediction ( fig5 ). genes selected more frequently , that is present in more than 50 % of the 200 gene set predictors are listed in table 4 . this consists of 179 genes with strongest predictive power for detection or prediction of metastasis in head and neck squamous cell carcinoma . small and large sets of genes from this list can be used for prediction . genes selected most frequently ( more than 90 %) are listed in table 5 . this consists of 51 genes with the highest predictive power . small and large sets of genes from this list can be used for prediction . this list consists of genes , most / all of which have never before been associated with prediction of metastasis in tumors , especially metastasis in head - neck squamous cell carcinoma . 1 . brazma , a . et al . minimum information about a microarray experiment ( miame )- toward standards for microarray data . nat . genet . 29 , 365 - 371 ( 2001 ). 2 . spellman , p . t . et al . design and implementation of microarray gene expression markup language ( mage - ml ). genome biol . 3 , research0046 ( 2002 ). 3 . robbins , k . t . et al . neck dissection classification update : revisions proposed by the american head and neck society and the american academy of otolaryngology - head and neck surgery . arch . otolaryngol . head neck surg . 128 , 751 - 758 ( 2002 ). 4 . carvalho , a . l ., kowalski , l . p ., borges , j . a ., aguiar , s ., jr . & amp ; magrin , j . ipsilateral neck cancer recurrences after elective supraomohyoid neck dissection . arch . otolaryngol . head neck surg . 126 , 410 - 412 ( 2000 ). 5 . ridge , j . a . squamous cancer of the head and neck : surgical treatment of local and regional recurrence . semin . oncol . 20 , 419 - 429 ( 1993 ). 6 . expression profiling - best practices for data generation and interpretation in clinical trials . nat . rev . genet . 5 , 229 - 237 ( 2004 ). 7 . van de peppel , j . et al . monitoring global messenger rna changes in externally controlled microarray experiments . embo rep . 4 , 387 - 393 ( 2003 ). 8 . raghavachari , n ., bao , y . p ., li , g ., xie , x . & amp ; muller , u . r . reduction of autofluorescence on dna microarrays and slide surfaces by treatment with sodium borohydride . anal . biochem . 312 , 101 - 105 ( 2003 ). 9 . yang , y . h . et al . normalization for cdna microarray data : a robust composite method addressing single and multiple slide systematic variation . nucleic acids res . 30 , e15 ( 2002 ). 10 . ihaka , r . & amp ; gentleman , r . r : a language for data analysis and graphics . j . comp . graph . statist . 5 , 299 - 314 ( 1996 ). 11 . huber , w ., von heydebreck , a ., sultmann , h ., poustka , a . & amp ; vingron , m . variance stabilization applied to microarray data calibration and to the quantification of differential expression . bioinformatics 18 suppl 1 , s96 - s104 ( 2002 ). 12 . golub , t . r . et al . molecular classification of cancer : class discovery and class prediction by gene expression monitoring . science 286 , 531 - 537 ( 1999 ). 13 . van &# 39 ; t veer , l . j . et al . gene expression profiling predicts clinical outcome of breast cancer . nature 415 , 530 - 536 ( 2002 ). 14 . simon , r ., radmacher , m . d ., dobbin , k . & amp ; mcshane , l . m . pitfalls in the use of dna microarray data for diagnostic and prognostic classification . j . natl . cancer inst . 95 , 14 - 18 ( 2003 ). 15 . ambroise , c . & amp ; mclachlan , g . j . selection bias in gene extraction on the basis of microarray gene - expression data . proc natl acad sci usa 99 , 6562 - 6566 ( 2002 ).	8
referring to fig1 and 2 , there is depicted an a vtol / stol free wing aircraft 100 , as disclosed in co - pending application ser . no . 08 / 007 , 130 , now u . s . pat . no . 5 , 395 , 073 , incorporated herein by reference , capable of short field take - offs and landings ( stol ) and straight and level flight , and , with some minor modifications , vertical take - offs and landings ( vtol ) as well . although the features of this invention is described with reference to the embodiment shown in fig1 and 2 and disclosed in the &# 39 ; 073 patent , it is to be appreciated that the invention is equally applicable to the vtol embodiment disclosed in the &# 39 ; 057 patent . the free wing aircraft 100 comprises a fuselage 102 containing a variable pitch propulsion system 104 including an engine mounted to the fuselage rotating a variable pitch propeller 108 . a free wing 110 is connected to the fuselage 102 and is free to rotate or pivot about its spanwise axis 112 located forward of its aerodynamic center . the free wing 110 includes left and right wings 114 and 116 extending from a fixed wing root or center section 117 formed on opposite sides of the fuselage 102 and which left and right wings are coupled together as disclosed in the &# 39 ; 073 patent , to collectively freely pivot about the spanwise axis 112 . the left and right wings 114 , 116 may be adjustable in pitch relative to one another in the manner described in the aforesaid &# 39 ; 057 patent , or may be formed with elevons ( not shown ) to provide for elevator and aileron control . the aircraft 100 further comprises a tail section 118 which is mounted to a boom assembly 120 pivotally connected or articulated to the fuselage 102 for movement relative to the fuselage both into and out of alignment with the thrust line t of the propulsion system 104 to enable stol / vtol operations as well as straight and level flight . preferably , boom assembly 120 includes a pair of parallel booms 134 , each including at the rear end thereof a horizontal stabilizing member 138 and a vertical stabilizing member 140 . the feature of swinging or pivoting the entire boom assembly 120 and tail section 118 out of straight and level alignment with the fuselage 102 and the thrust line t of propulsion system 104 thereon advantageously results in an aircraft 100 capable of taking off and landing in slow flight or stol mode while retaining the advantages of free wing flight . since the tail surfaces 138 , 140 are not subject to any dynamic pressure effects caused by the slip stream of propeller 108 when in the stol flight mode of fig2 it will be appreciated that directional stability and yaw control deteriorates at extremely slow or 0 horizontal speeds as will occur during vtol flight as opposed to stol flight . the fixed wing center section 117 advantageously remain in the slip stream and the dynamic pressure acting thereon tends to provide some degree of directional stability and yaw control . further stability and control may be achieved with additional fins ( not shown ) which may project outwardly from fuselage 102 or fixed wing center section 117 to provide additional surfaces for improved stability and control . as will now occur to one of ordinary skill , such fins may either continuously project from the fuselage or fixed wing section , or may be retractably mounted therein to project from the fuselage and become operational only during vtol flight . the fixed wing root or center section 117 in horizontal flight mode depicted in fig2 performs as a wing by generating lift in association with the left and right free wing sections 114 , 116 . when the tail boom 120 is &# 34 ; raised ,&# 34 ; the fixed wing center section 117 advantageously act as an aerodynamic brake ( see , e . g ., the fig2 position ) to rapidly decelerate the aircraft 100 to slow flight . the operation of the stol free wing aircraft 100 of this invention will now be described . at takeoff , aircraft 100 is initially lifted by the variable pitch propulsion system 104 from the landing field or platform . to transition from vertical or near vertical ( take - off or flight ) to horizontal flight , the pilot or remote controller rotates the boom from its position depicted in fig2 to that depicted in fig1 . as the boom 120 is &# 34 ; lowered &# 34 ; in the direction opposite arrow a , the fuselage 102 pitches toward the horizontal which in turn causes the horizontal speed of the aircraft to increase . this in turn causes the freely rotatable wing 110 to rotate relative to the fuselage 102 in accordance with the relative wind . the effects of the relative wind acting on the freely rotating wing 110 quickly overcome the braking effects of the air flow over the fixed wing center section 117 from the variable pitch propulsion system 104 and , with increasing horizontal speed , the wing 110 develops lift . the aircraft 100 soon transitions into horizontal flight in a free wing straight and level flight mode . assuming the pilot or remote control aircraft operator desires to land the aircraft 100 in a stol free wing flight mode , the reverse procedure is used . the articulated boom is pivoted relative to the fuselage in the counter - clockwise direction a , i . e ., toward the upper surface of the fuselage . in actuality , as the boom is &# 34 ; raised ,&# 34 ; it is essentially maintained in its horizontal or straight and level flight mode of fig1 due to the dynamic pressure acting on its horizontal control surfaces 138 as a result of the straight and level direction of flight , and it is the fuselage 102 and the thrust line t of the propulsion system 104 which essentially rotates towards a vertical orientation with its nose pointed upwardly as best depicted in fig2 . as the fuselage 102 and the thrust line t rotate towards the vertical , horizontal speed is gradually decreased and the vertical thrust vector gradually increases . as a result , the lift generated by variable - pitch propulsion system 104 increases to compensate for the decreasing wing lift . the effect of varying the pitch of the propulsion system 104 on the glide path of the aircraft is schematically illustrated in fig3 . as the aircraft begins the descent for landing , the propellers of variable pitch propulsion system are set in an intermediate pitch position , as shown in ( a ) of fig3 . thus , there is provided by the variable pitch propulsion system 104 &# 34 ; room &# 34 ; for the pitch to change in either direction . when the pitch of the propeller blades is decreased relative to the plane of the propeller , as shown in ( b ) of fig3 the lift is consequently reduced , resulting in a relatively steep glide path . conversely , as shown in fig3 ( c ), increasing the pitch of the propeller blades results in greater lift , i . e ., a relatively shallow glide path . accordingly , if the aircraft is descending at too steep of an angle or too great of a speed , the pilot can increase the pitch of the propeller blades , whereupon the lift of the aircraft is increased with a resulting decrease in both speed and descent angle . similarly , if the aircraft is descending too slowly or at too shallow of an angle , the pilot can decrease the pitch of the propeller blades and accordingly decrease the lift and increase the speed and angle of descent . advantageously , adjustment of the pitch of the propeller is virtually instantaneous , thereby invoking an instantaneous response in the engine . hence , the utilization of a variable pitch propulsion system eliminates the aforementioned problems with spool - up delay . furthermore , the delay in feedback is also eliminated , since a change in the pitch of the propeller results in a virtually simultaneous change in the lift of the aircraft . it will be readily seen by one of ordinary skill in the art that the present invention fulfills all of the objects set forth above . after reading the foregoing specification , one of ordinary skill will be able to effect various changes , substitutions of equivalents and various other aspects of the invention as broadly disclosed herein . it is therefore intended that the protection granted hereon be limited only by the definition contained in the appended claims and equivalents thereof .	1
the scaffolding system generally shown as 1 has a series of upright standards interconnected by generally horizontal ledgers . the upright standards include a rosette at selective vertical spacings which are used for connection of the ledgers to the uprights . a work surface can be provided at different heights and is supported by the ledgers . in the arrangement shown in fig1 , the ladder 4 is connected to the scaffolding system 1 by means of additional horizontal tubular members 100 secured to the scaffolding system 1 , by ladder brackets 102 secured to members . basically the ladder 4 can be produced in a series of discrete segments with these segments connectable in an end to end manner to define a ladder of a desired length . the ladder can be supported in a number of different ways to one side of the scaffolding system 1 . once the ladder is in place and properly supported by the scaffolding system it is usually necessary to assemble a safety cage 2 to one side of the ladder . different labour laws require a safety cage once the ladder exceeds a certain height . with the present system , a series of safety cage sections 6 are secured to the ladder and are spaced in the length of the ladder . the sections do not need to abut one to the other and some vertical spacing between the sections is permitted . each section 6 has a first section component 8 and a second section component 10 . these section components are identical and one section has merely been reversed and assembled to the opposite side of the ladder . these section components are joined at the vertical split 12 by means of an upper connector 14 and a lower connector 14 . the upper connector at fig1 is associated with the right hand section and the lower mechanical connector is associated with the left hand section . the connector 14 is captured on section 8 and includes a t - head for insertion through a slot and rotation to engage the vertical flange of the opposite section . the section components 8 and 10 each include at the free edge 20 thereof , hook connectors 22 and 24 . hook connector 22 is shown as facing downwardly , and hook connector 24 is facing upwardly . connector 24 will form the upper connector when this section is used for defining a left hand section . these hook connectors 22 and 24 allow a worker to carry the section to the appropriate point on the ladder and temporarily secure the section to the ladder by placing the hook connector over a rung of the ladder with the upright portion of the ladder fitted within this connector . with this arrangement , the lower connector which has a u - shaped section , also engages and straddles the upright member of the ladder . once this section has been temporarily secured on the ladder , the worker can then adjust the section and positively secure it to the ladder by pushing the section at the top towards the ladder allowing the pin to be placed behind the upright to close the connector and the wedge driven downwardly to provide positive engagement . once this has been accomplished , the lower connector can also be fastened . the pin is a captured member with a “ t ” shaped bolt head for releasably engaging one side of the upper connector . once a first section has been secured , the opposite section can then be brought up and placed on the ladder . once again , it is temporarily secured and then positively secured to the ladder . once so located , the vertical split between the two sections are generally aligned . the worker can then use the wedges with the t - shaped bolts for securing the vertical split between the sections by means of the two connectors . this can be accomplished in a fast and effective manner and represents a significant labour saving over the construction of an onsite fabricated safety cage which is fabricated each time a ladder is erected . each section includes a top band 50 , a lower band 60 , and a series of interconnected vertical members 55 . each cage section is a fabricated component and allows for quick assembly and disassembly from an access ladder . turning to fig2 , it can be seen that the access ladder 4 extends above the work surface 120 and a full safety cage section 6 is shown with a single section component 8 secured to the right hand side of the ladder without a corresponding section 10 . in this case , access to the work surface 120 is desired . therefore , after section 8 has been assembled to the ladder , a safety cage exit section 74 is secured to the section 8 . the exit section includes an upper band member 76 , a lower band member 78 , a securing tubular member 80 and at least one upright 82 . the exit section includes a vertical securing face 84 for cooperating with the section 8 . a similar mechanical connection is made at the vertical split and the exit section 74 is secured to ledgers 90 and 92 by clamps 86 and 88 . with this arrangement , a safety cage structure is defined and the cage structure provides convenient access to adjacent workspaces while still providing a safe environment . details of the safety cage sections and the various securing brackets are shown in fig3 . the safety cage system , as shown in fig1 through 4 , can be used with many scaffolding systems as the structure of access ladders is similar . in addition , the connectors at the free end of each section can be shaped for specific ladders and scaffolding systems . the system uses the rungs and uprights of the ladder to simplify the securement of the safety cage sections and provides an effective arrangement for many different types of scaffolding systems . in fig5 , a new ladder structure 200 is shown with its own securing arm 250 . the ladder 250 has a series of rungs 202 which interconnect the two upright members 204 . each of these upright members are of an outwardly opening u - shape with the base of the u connected to the rungs 202 . the u - shaped upright members 204 also have the outer edges of the u partially closed by inwardly directing flanges 206 and 208 . this arrangement provides an outwardly opening securing slot which is used with a bolt having a t - head for effecting securement of the ladder as will be more fully described . in addition , each of the upright members 204 has a series of holes 210 extending in the length of the ladder . the securing arm 250 is engagable with the upright members 204 of the ladder at a number of points along the length of the upright member . the securing arm 250 includes a mechanical fastener 260 defined by a bolt 262 which receives the captured wedge 264 with the bolt 262 having a t - head received and retained within the securing slot . in addition , the securing arm 250 includes a projecting stop 266 which is received in one of the holes 210 . as shown , this stop is in engagement with a lower part of the slot 210 . once the arm has been temporarily located at an appropriate point for securement to a rosette , such as the rosette 290 in fig6 , the fastener 260 can be initially brought in engagement with the slot of the upright . the wedge member is generally in a horizontal position such that the t - head of the bolt aligns with the slot opening . it is then inserted in the slot and the wedge is rotated 90 degrees and thus rotates the bolt head 90 degrees . the wedge is then driven downwardly through the bolt and draws the t - head into engagement with the slot . there is no sliding of the securing arm along the upright due to the stop 266 engaging a lower portion of the hole 210 . the securing arm can then be secured to the rosette 290 as shown in fig6 and 8 . the t - head of the bolt is shown at 265 at fig8 . the structure of fig5 through 8 has particular application with scaffolding systems having a series of rosettes as shown in fig1 . the ladder of fig5 through 7 in addition to the engaging of the securing arm 250 is adapted to cooperate with the safety cages shown in the earlier drawings . in this case , the fasteners at the free edge of the safety cage are altered to specifically to cooperate with the modified ladder . a right hand top hook is shown in fig9 , a left hand top hook is shown in fig1 , a bottom right hand clamp is shown in fig1 and a bottom left hand clamp is shown in fig1 . the hook portions are adapted to be received in and retained by one of the series of holes 210 in the upright members . the bottom clamps are adapted to engage the securing slot of the upright members in a manner similar to the securing arm 250 . fig1 shows the safety cage secured to the ladder 250 . the hook fasteners pass through any of the holes 210 and the lower clamping members engage the securing slot . in this case , the ladder safety cage sections do have a left hand component and a right hand component . the actual ladder section without the fasteners at the free edge thereof , is not right handed or left handed but the securing of the clamps will render the section a right hand section or a left hand section . fig1 shows the preferred ladder structure engaging the scaffolding system with a series of cage sections and an exit section . although various preferred embodiments of the present invention have been described herein in detail , it will be appreciated by those skilled in the art , that variations may be made thereto without departing from the spirit of the invention or the scope of the appended claims .	4
the following description is presented to enable any person skilled in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the disclosed embodiments will be readily apparent to those skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the present invention . thus , the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . the data structures and code described in this detailed description are typically stored on a computer readable storage medium , which may be any device or medium that can store code and / or data for use by a computer system . this includes , but is not limited to , magnetic and optical storage devices such as disk drives , magnetic tape , cds ( compact discs ) and dvds ( digital versatile discs or digital video discs ), and does not include computer instruction signals embodied in a transmission medium . fig1 illustrates exemplary databases 100 and 110 in accordance with an embodiment of the present invention . database 100 and database 110 contain the same information . however , database 100 is an unencrypted database comprising table 102 , whereas database 110 is a privacy - enabled database comprising table 112 . as illustrated in fig1 , social security numbers ( ssns ) in table 102 are stored in plain text . hence , anyone who has access to table 102 can view all of the information in table 102 , including the ssns . in contrast , table 112 contains the same data as table 102 , but with hashed ssns . note that generating the hash can involve performing any one of a number of one - way functions , including sha - 1 and md5 . fig2 presents a flowchart illustrating the process of protecting private information in accordance with an embodiment of the present invention . the process starts when the system receives a piece of private information to be stored in the database ( step 202 ). this piece of private information is typically a social security number , driver &# 39 ; s license number , or some other unique piece of information that is used as a key in the database to look up a record associated with an individual . next , the system checks a type value for a column in which the information is to be stored in database 110 ( step 204 ), and if this type value indicates that privacy is enabled for the column , the system creates a hash of the private information ( step 206 ). at this point , the system also throws away the private information , or alternatively stores it in a secure location ( step 207 ). as mentioned previously , any type of one - way function can be used to generate the hash . also note that several pieces of private information can be combined into the hash . once the hash is created , the hash and other related information is stored in a record in database 110 ( step 206 ). in one embodiment of the present invention , the hash is created automatically by the database in a manner that is transparent to the application . a new column attribute can be defined in the database instructing the database to always hash values upon inserting the values into the column . note that performing this hashing automatically provides security without having to modify applications that access the database . these hash values can also be indexed to speed lookups . however , range searches become complicated . one possible method for performing a range search is to generate each value in the range , perform a hash on each value , and then look up each hash in the database . fig3 presents a flowchart illustrating the processing of a query in accordance with an embodiment of the present invention . the process starts when the system receives a query that involves the piece of private information ( step 302 ). next , the system checks the associated column type in database 110 ( step 304 ). if this column type indicates that privacy is enabled , the system creates a hash of the piece of private information ( step 306 ). the system then performs the query using the hash in place of the piece of private information ( step 308 ). for example , the system can perform a “ select ” on the database where the hash is substituted in the “ where ” clause in place of the piece of private information . note that as described previously , the hashing can take place at the database level in a manner that is transparent to the application . for example , the select statement might contain the private information in the “ where ” clause , and the database , knowing that the column referenced by the “ where ” clause is marked as privacy - enabled , would automatically hash the data before performing the lookup . in one embodiment of the present invention , the hashing operations are not performed automatically , but are instead performed by a programmer . in this embodiment , the methods for checking if a column is privacy enabled and for creating the hashes are exposed to programmers through an api . the foregoing descriptions of embodiments of the present invention have been presented for purposes of illustration and description only . they are not intended to be exhaustive or to limit the present invention to the forms disclosed . accordingly , many modifications and variations will be apparent to practitioners skilled in the art . for example , although the present invention is described in the context of a relational database , the present invention is not limited to relational databases . in general , the present invention can be applied to any type of database , including relational databases , hierarchical databases , centralized databases and distributed databases . in one embodiment of the present invention , the present invention is used to hash directory information stored in a lightweight directory access protocol ( ldap ) database . additionally , the above disclosure is not intended to limit the present invention . the scope of the present invention is defined by the appended claims .	6
in all embodiments , the structural unit of the invention has two opposite transverse sides , and two end sides join the transverse sides . the transverse and end sides are each generally in one of four respective planes , and the four planes preferably intersect at right angles . the transverse sides have outer surfaces near the respective intersecting end sides and the outer sides are oriented obliquely to each other . this gives the structural unit of the invention an external or cross - sectional contour in the shape of an octagon . fig1 shows one of the many possible uses for the structural unit of the invention . a bungalow wall with roof trusses and a skeleton construction is shown . it is formed of axially elongated structural units 1 having a bar shape in accordance with the invention . a truss reinforcement 2 , which is inserted in the below described grooves 4 and 5 of the structural units 1 , also forms an upper horizontal wall termination . the frame and sash for a window 3 are also constructed using the structural elements in accordance with the invention . fig2 shows an embodiment of the structural element 1 . the element 1 has longitudinal grooves 4 and 5 extending longitudinally along the opposite transverse sides 7 and 8 . the longitudinal grooves 4 and 5 widen toward the center of the structural unit 1 . thus , the base of each groove is trapezoidal in shape . the longitudinal grooves 4 and 5 also widen toward the outside of the grooves as is shown by groove sections 9 . the side walls of the grooves and 5 first converge and at section 9 , the side walls simply reverse their inclination and diverge . the effect is to make the outward side of the grooves wider than their base portion . along the transverse sides 7 and 8 , alongside the grooves 4 and 5 , the transverse sides are oblique to each other at outer surfaces 12 ; moving toward end sides 14 and 15 of the unit . the outer surfaces 12 extend obliquely between the longitudinal edges 13 of the two opposite , parallel end sides 14 and 15 of the bar and the longitudinal grooves 4 and 5 . the outer surfaces 12 are preferably flat . together with the outer ends of the side walls of the longitudinal grooves 4 and 5 , the surfaces 12 form essentially sharp - edged , longitudinal edges 16 at which the structural unit 1 has its greatest width . it is apparent that the surfaces 12 and the sides 14 , 15 together define an octagonal peripheral profile for the structural element 1 . it is advantageous for many uses of the structural units to provide at least one lengthwise extending longitudinal groove 17 and / or 18 , respectively , on the end sides . the grooves 17 , 18 are preferably identical to each other ; and preferably have the illustrated trapezoidal cross - section , i . e . a cross - section which widens toward the middle of the bar shaped unit 1 . the side walls of the grooves 17 and 18 preferably extend parallel to the respective , adjacent oblique bar outer surfaces 12 . in other embodiments , it is possible to develop the longitudinal grooves 17 and 18 to be similar to or identical to the longitudinal grooves 4 and 5 . as already mentioned , the structural units in accordance with the invention may be fabricated from wood , metal or plastic . solid material is preferred in the case of wood units , and tubular material in the case of metal units . combinations of metal and wood are preferred for certain uses , as will become evident from the description of the following embodiments . fig3 shows another structural unit 19 in accordance with the invention , similar to that of fig2 in use . it is a tubular , metal , profile unit , comprised , for instance , of aluminum or steel . on each of its transverse sides 20 and 21 , there are two laterally spaced apart , longitudinal grooves , viz . 22 and 23 on side 20 and 24 and 25 on side 21 . on the end sides 26 and 27 of the structural unit 19 , respective longitudinal grooves 28 and 29 are formed . these are analogous to grooves 17 and 18 , respectively . fig3 shows diverse possible uses for structural units in accordance with the invention . for example , an intermediate slab 30 , with which a ceiling board 32a is engaged , is inserted into the lower lateral longitudinal groove 23 at one transverse side of the structural unit . in the upper lateral longitudinal groove 24 on the other side of the structural unit , a transverse reinforcement 31 is inserted . the lower lateral longitudinal groove 24 on the other side engages a ceiling board 32 , together with insulating material 33 . into the upper end - side longitudinal groove 28 , roof slabs 34 and 35 are engaged , via corresponding bends . the upper longitudinal groove 28 can serve as a water discharge off the roof . by means of suitable holding members , cover rails or clamps 36 , the slabs placed on the end side 26 are screwed or clamped in the longitudinal groove 28 . the roof slabs 34 , generally of sheet metal or plastic , can be stiffened by transverse ledges 37 , ribbed members 38 , or corrugated plates 39 . a plate 40 has an upper edge that is inserted into the lower end longitudinal groove 29 of the structural element 19 . the plate has a lower edge that is inserted into an upper end - side longitudinal groove 41 of another structural unit 42 , which is another embodiment in accordance with the invention . the plate 40 corresponds to the plate 2 in fig1 and serves both for reinforcing the roof truss and as a wall termination . respective cover plates 45 and 46 are inserted into the lateral side longitudinal grooves 43 and 44 of the structural unit 42 . in a lower end side longitudinal groove 47 of the lower structural element 42 , an insulating member 48 is inserted . inner boards or an inner facing 49 which has a moisture barrier rests against the member 48 . the insulating member 48 is so dimensioned that between the structural element 42 and the inner facing 49 , there is a space which prevents the transmission of cold . the free - space insulation can also be arranged on the outside , depending on the board selected , the outer facing and the k value , with or without external aeration of outer walls or roof constructions . in the case of a bungalow , emergency accommodations , and the like , the so - called breathing of the walls need not be taken into consideration if good short ventilation ( preferably cross ventilation ) of the room in question is possible and the moisture barrier lies behind the first inner board . with this type of construction , the greatest amount of energy is saved . because of the diversified uses of the structural units of the invention , the most suitable and most favorably priced structures can be erected , depending on the climatic zone , always using the same manufacturing technique . fig4 shows further uses of different structural units in accordance with the invention . here a larger and stronger structural unit 50 in accordance with the invention , e . g . of wood , is used as a column or casing . wood does not warp as much as metal under the action of heat , while metal is fireproof . the appropriate material is selected for a structural unit to suit the particular application . the structural unit is provided on the outside , i . e . at the lower end side 51 in fig4 with any desired shape covering member 52 of metal , preferably steel or aluminum , in order to provide greater resistance to weather , sound , and fire . the protective outer shaped member 52 could , however , also consist of plastic . in the longitudinal groove of the inner end side 53 , i . e . that end at the top in fig4 a plate 54 is anchored . fig4 now shows two other advantageous variants for door and window frames . a shaped molding 56 of elastic material , for instance of rubber or neoprene , is contained in a lateral longitudinal groove 55 of the larger structural unit 50 . the molding 56 has an oblique stop surface 57 . on a door 58 , with which the molding cooperates , there is a stop 59 having a beveled surface 60 which rests in sealing fashion against the oblique stop surface 57 of the shaped molding 56 when the door 58 is closed . the frame of the door 58 can also have the form of the structural unit 50 . in that case , the oblique stop surface 60 can be developed similarly to the oblique stop surface 57 by an elastic , shaped member , which is placed into a lateral longitudinal groove of this structural unit . by such a simple arrangement , which results in a tight closure , the previously customary multiple step - shaped sectional members can be avoided , as they take up a large amount of space . on that transverse side of the structural unit 50 which is to the right of fig4 a longitudinally extending stop member 61 is fastened . it has a generally u - shaped end groove which opens to the right . into the end groove 62 , an elastic sealing element 63 is inserted . a similar longitudinally extending stop member 64 has a u - shaped end groove 65 . the stop member 64 is arranged on a shaped member 67 of a separate structural unit 68 , which is also developed in accordance with the invention . within its end groove 65 , the stop member 64 has an elastic sealing member 69 , which cooperates with an oblique side surface 70 of the structural unit 50 . thus , the invention not only permits two multiply sealing oblique surface stops , but also , with the same construction , permits doors and windows which open toward the outside or the inside to be erected . the shaped member 67 is a hollow section of metal , which is connected via an insulating intermediate layer 71 with a shaped wooden strip 72 . the wooden strip 72 can be covered on its outer side with a shaped member 73 , which is plastic or preferably metal . the hollow member 67 and the wooden strip 72 together form the structural unit 68 of the invention . the unit 68 has lateral longitudinal grooves 74 and 75 . as is shown also in fig3 in connection with the structural unit 19 , a wood strip or a steel pipe 76 for serving as a reinforcement or stiffening means , can also be inserted into the hollow member 67 . on the right in fig4 at the members 67 and 72 of the trapezoidal structural unit 68 , insertion of panes of glass is suggested . a pane of glass 77 is inserted in a frame 78 of wood , metal or plastic , using ordinary fastening means , such as putty . the pane frame 78 is placed on the upper oblique outer surface 79 of the wooden strip 72 so that the entire width of the frame , which consists of the elements 68 and 78 , is not substantially greater than the width of the structural unit 68 by itself . in the right side lateral longitudinal groove 75 of the structural unit 68 , an insulating glass pane 81 comprised of two individual panes can , for instance , be inserted . another glazing corresponding to the pane 77 can be arranged on the outside , i . e . in the bottom in fig4 in a mirror - image arrangement with respect to the window 77 , 78 . thus , it is possible in a simple and space - saving manner , for instance , to produce a quadruple glazing . a single elastic profiled member 82 can serve to hold the pane of insulating glass 81 fast and to seal it off from the frame 78 of the pane 77 . in the structural units of the invention , the longitudinal grooves provided on the transverse sides and the longitudinal grooves provided on the end sides are preferably in each case arranged in the centers of the side in question . it is particularly advantageous , furthermore , to use the same shape structural units in different sizes , as required . although the dimensions in themselves may be any desired ones , they are preferably selected in such a manner that in each case , smaller structural units in accordance with the invention can be inserted into larger size , hollow structural units . in this way , a saving in storage and transportation costs is obtained . the drawings show diverse possible uses of structural units of shaped bar form in accordance with the invention . with some varients , fixed structural units having several walls or glass panes can be assembled . further , there is a possibility of providing multiply sealing oblique stops . in this connection , the outer surfaces , which are oblique with respect to each other and extend obliquely to the end sides , play a particular role . in the structural units of the invention , the transverse sides are generally wider than the end sides . the outer longitudinal edges can be fitted substantially better to ceilings , walls , or the like than can flat surfaces . as a whole , it can be said that with the development of the structural unit in accordance with the invention , the same effect is obtained as was possible heretofore only by combining a plurality of individual known special shape structural units . of particular advantage is the amazing simplicity and at the same time diversified utility of the structural unit of the invention . as shown above , many variants and combinations using shaped parts of wood , metal and plastic are possible , so that both better protection and better rigidity and a more pleasant appearance result . by insertion of rubber , sealing and insulating material at desired points , increased acoustic and heat insulation properties are obtained . although the present invention has been described in connection with preferred embodiments thereof , many variations and modifications will now become apparent to those skilled in the art . it is preferred , therefore , that the present invention be limited not by the specific disclosure herein , but only by the appended claims .	4
embodiments of the present invention will hereinafter be described with reference to the drawings . first , an arf - halftone ( ht ) mask was prepared which was a photomask manufactured by an ordinary photomask manufacturing process . a pattern formed on this arf - ht mask is a memory device under a design rule of 55 nm , and places where lithographic margins are low ( referred to as hot spots ) have been extracted in advance from this mask pattern . to extract the hot spots , the places where the lithographic margins are low are specified by a lithographic simulation of a chip from data obtained after an optical proximity effect correction ( opc ) of design data . this time , 64 hot spots were extracted . the prepared arf - ht mask was set on a fine pixel sem ( ngr4000 ) manufactured by topcon corporation , and an sem image of the hot spots was acquired . ngr4000 is an apparatus capable of acquiring a fine pixel image having 8000 × 8000 pixels , and has such a high resolution that one pixel is 2 nm on the mask . that is , the viewing field of the acquired image is 16 μm square , which is a size sufficient to run the lithographic simulation . fig1 a is a diagram showing the sem image of the arf - ht mask , and fig1 b is a diagram showing pattern outline data extracted from the sem image . the outline of the pattern was extracted by outline extraction software manufactured by ngr corporation from the acquired sem image shown in fig1 a , thereby acquiring the pattern outline data shown in fig1 b . then , the sidewall angle of the mask pattern was obtained from the width of a white line forming the pattern outline in the sem image in fig1 a . fig2 is a diagram showing the relation between the sidewall angle of the mask pattern and the signal intensity profile of the sem image . as shown in fig2 , there is a principle that a width ( a part where the signal intensity profile stands out ) w of the white line in the sem image is great when a sidewall angle θ of the mask pattern is small , while the width w of the white line is short when the sidewall angle θ is large . this principle was utilized to obtain the sidewall angle of the pattern of the arf - ht mask . actually , not simply on the basis of the width of the white line , but also on the basis of a subtle difference of intensity profiles of the white lines forming the pattern outlines in the pattern image which is the sem image , the intensity profile is matched with previously obtained intensity profile data per sidewall angle , thereby obtaining a sidewall angle . for the obtained sidewall angle , pattern sidewall angle data and the pattern outline data were stored in association with each other at predetermined intervals ( e . g ., every 100 pixels ) for each outline . fig3 is a block diagram showing the configuration of a photomask evaluation apparatus according to the present first embodiment . a photomask evaluation method in the present first embodiment can be carried out by one photomask evaluation apparatus shown in fig3 . as shown in fig3 , a mask pattern image acquiring unit 1 is connected to a lithographic simulator 4 via a pattern sidewall angle analyzing unit 2 , and also connected to the lithographic simulator 4 via a pattern outline extracting unit 3 . the mask pattern image acquiring unit 1 acquires a pattern image of an arf - ht mask m set in the present apparatus . the pattern sidewall angle analyzing unit 2 generates pattern sidewall angle data which is information on the sidewall angle of the pattern from the acquired pattern image . the pattern outline extracting unit 3 extracts pattern outline from the acquired pattern image and generates pattern outline data . the lithographic simulator 4 runs a lithographic simulation on the basis of the pattern outline data and the pattern sidewall angle data . fig4 is a flowchart showing the procedure of a photomask evaluation method in the present first embodiment . first , in step s 1 , an inspector selects by an sem a place to acquire an sem image in a mask pattern of the arf - ht mask m . in step s 2 , the mask pattern image acquiring unit 1 acquires an sem image ( pattern image ) of the mask pattern . in step s 3 , the pattern sidewall angle analyzing unit 2 calculates a pattern sidewall angle from the pattern image which is the sem image in accordance with the principle described above , thereby obtaining pattern sidewall angle data in step s 4 . after step s 3 , the pattern outline extracting unit 3 extracts in step s 5 a pattern outline from the pattern image which is the sem image , thereby obtaining pattern outline data in step s 6 . next , in step s 7 , the pattern sidewall angle data and the pattern outline data are input to the in - house lithographic simulator 4 , and a lithographic simulation was run under optical conditions used when a wafer was exposed by use of the manufactured arf - ht mask m . as a result , it was calculated in step s 8 that an exposure dose margin was 8 % and the depth of focus was 0 . 21 μm at which desired pattern dimensions could be obtained on the wafer . since it is necessary that the exposure dose margin be 10 % or more and the depth of focus be 0 . 2 μm or more to obtain the desired pattern dimensions , the place of the hot spot of the arf - ht mask m this time does not fulfill the specification in the exposure dose margin , so that the arf - ht mask m is judged as a reject product . it is to be noted that both or one of the exposure dose margin ( exposure dose range ) and the depth of focus necessary to obtain the desired pattern dimensions are called an exposure margin . alternatively , the exposure margin may be defined by pattern dimensions obtained by an optimum exposure dose and an optimum focal position . for comparison , when the pattern outline data alone was used to simply run the same simulation with a fixed sidewall angle , an exposure dose margin obtained was 11 % and a depth of focus obtained was 0 . 23 μm , such that the arf - ht mask m was judged as an acceptable product . thus , this arf - ht mask m was actually used to form a resist pattern on a wafer . an exposure apparatus was a liquid immersion exposure apparatus manufactured by nikon corporation , and na was 0 . 92 . moreover , polarized illumination was employed . as a result , the desired pattern dimensions were obtained with an exposure dose margin of 8 % and a depth of focus of 0 . 22 μm . this reveals that the influence of the sidewall angle of the mask is greater in the light exposure with a high na such as liquid immersion exposure . thus , as in the present first embodiment , considering the fluctuation of the sidewall angle of the mask enables a more faithful lithography simulation and improved accuracy in the judgment of the acceptability of the mask . as a second embodiment , a case will be described in which the pattern outline data is corrected on the basis of the pattern sidewall angle data . the procedure up to the acquisition of the pattern sidewall angle data and the pattern outline data from the sem image of the hot spot is the same as that in the first embodiment described above . the difference is that an outline position of the pattern outline data is corrected on the basis of the pattern sidewall angle data . fig5 is a block diagram showing the configuration of a photomask evaluation apparatus according to the present second embodiment . a photomask evaluation method in the present second embodiment can be carried out by one photomask evaluation apparatus shown in fig5 . in fig5 , the same reference numerals are assigned to the same parts as those in fig3 . as shown in fig5 , a mask pattern image acquiring unit 1 is connected to an outline data correcting unit 5 via a pattern sidewall angle analyzing unit 2 , and also connected to the outline data correcting unit 5 via a pattern outline extracting unit 3 . the outline data correcting unit 5 is connected to a lithographic simulator 4 . the outline data correcting unit 5 corrects a pattern outline position of the pattern outline data generated in the pattern outline extracting unit 3 on the basis of the pattern sidewall angle data generated in the pattern sidewall angle analyzing unit 2 . the lithographic simulator 4 runs a lithographic simulation on the basis of the pattern outline data which has been corrected by the outline data correcting unit 5 . fig6 is a flowchart showing the procedure of the photomask evaluation method according to the present second embodiment . first , in step s 11 , an inspector selects by an sem a place to acquire an sem image in a mask pattern of the arf - ht mask m . in step s 12 , the mask pattern image acquiring unit 1 acquires an sem image ( pattern image ) of the mask pattern . in step s 13 , the pattern sidewall angle analyzing unit 2 calculates a pattern sidewall angle from the pattern image which is the sem image in accordance with the principle described above , thereby obtaining pattern sidewall angle data . in step s 14 , the pattern outline extracting unit 3 extracts a pattern outline from the pattern image which is the sem image to obtain pattern outline data , and the outline data correcting unit 5 corrects the outline position of the pattern outline data on the basis of the pattern sidewall angle data , thereby obtaining corrected pattern outline data in step s 15 . next , in step s 16 , the corrected pattern outline data is input to the in - house lithographic simulator 4 , and a lithographic simulation was run under optical conditions used when a wafer was exposed by use of the manufactured arf - ht mask m , thereby calculating an exposure margin in step s 17 . the processing in step s 14 means that the pattern outline extracted under uniform conditions from the sem image is corrected to an optically significant outline position . the processing in the present second embodiment is effective when the pattern sidewall angle data is not easily taken into the lithographic simulation . fig7 is a diagram showing the outline position of the sem image and an optically significant outline position in the section of a mask pattern . in the case of the outline in an sem image conventionally used , an outline as high as about 50 % of a thickness h of a halftone film is extracted . on the other hand , an optically significant outline in the lithographic simulation which considers the mask as a planar object without a three - dimensional structure is located at about 25 % from the bottom of the halftone film . that is , as shown in fig7 , the optically significant outline position corresponds to an outline shifted outside the outline position acquired from the sem image . a uniform shift amount has only to be added to the outline position from the sem image when the sidewall angle θ is fixed , but a shift amount corresponding to the sidewall angle needs to be added to the outline position from the sem image when the sidewall angle varies depending on the place . for example , the smaller the sidewall angle θ is , the greater the shift amount is . in the present second embodiment , the outline position is corrected with the pattern sidewall angle data . that is , the outline position is shifted in accordance with the sidewall angle . the lithographic simulation was run with this corrected pattern outline data , such that an improvement substantially equal to that in the first embodiment described above was verified in the accuracy of the mask acceptability judgment . as described above , according to the embodiments , the information on the sidewall angle of the mask pattern is acquired from the acquired sem image , and the lithographic simulation is run on the basis of the pattern sidewall angle data and the pattern outline data . alternatively , the outline position of the pattern outline data is corrected on the basis of the pattern sidewall angle data , and the lithographic simulation is run on the basis of the corrected pattern outline data . an exposure margin thus calculated is judged to find out whether this exposure margin is the desired exposure margin , such that it is possible to inspect whether the mask pattern is finished in desired dimensions . thus , it is possible to properly take , into the lithographic simulation , the influence of the sidewall angle of the mask pattern which has heretofore been a problem , and achieve the correspondence between the results of the lithographic simulation and the results of the actual wafer light exposure . it is to be noted that the present invention is not exclusively limited to the embodiments described above , and modifications can be properly made without departing from the spirit thereof . for example , the information on the sidewall angle of the pattern may be acquired separately by a scatterometry method based on an optical technique , rather than from the sem image . moreover , this information may be acquired from an sem which obliquely applies an electron beam . further , while the photomask evaluation method has been described in the embodiments , a photomask judged to satisfy a desired specification by this evaluation method can be used to form a circuit pattern on a semiconductor substrate such that a semiconductor device is manufactured . according to the present embodiments , it is possible to provide a photomask evaluation method , a photomask evaluation apparatus and a semiconductor device manufacturing method capable of achieving the correspondence between the results of the lithographic simulation and the results of the actual wafer light exposure . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .	6
referring to the drawing , there is shown the distal end portion of a stent delivery catheter indicated generally by numeral 10 . the stent 11 itself ( fig2 ) may typically comprise a braided or slotted , non - self - expanding metal or plastic tube whose inside diameter closely conforms to the exterior of the expander member 12 when the expander member is non - inflated ( not shown ). the delivery catheter 13 may be introduced into the vascular system 15 in a conventional way and then advanced through the vascular system until the expander member 12 on the catheter body stock 14 carrying the yet non - expanded stent is juxtaposed relative to a treatment site in the vascular system . once so positioned , the expander member 12 is inflated and , in doing so , the stent is also expanded to a predetermined diameter that is a function of the outside diameter of the expander member 12 at a desired pressure . once the stent has been expanded in the manner described , the expander member 12 is again deflated by aspirating the inflation fluid therefrom and , once deflated , is extracted from the vascular system . it is , of course , desirable that upon aspiration , the expander member 12 deflates so as to closely conform to the outside diameter of the catheter body stock 14 on which it is mounted . so - called winging or pancaking of the expander member is undesirable . furthermore , when the end - use of the balloon catheter is for deploying non - self - expanding stents , it is important that the expander member 12 possess high abrasion resistance so as to prevent rupture as the surface of the expander member 12 frictionally engages the stent during expansion thereof . as shown in fig1 the catheter body stock 14 comprises an elongated , flexible tube having an inflation lumen 16 extending the length thereof . affixed to the distal end portion of the catheter body stock 14 is a generally cylindrical , tubular expander member having conically - shaped end portions as at 18 and 20 which are bonded to the exterior wall of the catheter body stock 14 in zones 22 and 24 to define a hollow chamber 26 when the expander member 12 is inflated . the distal end of the inflation lumen 16 extends beyond the seal zone 22 permitting inflation fluid under pressure to flow into the chamber 26 and expand the expander member . in accordance with the present invention , the expander member 12 is formed by blow - molding and stretching a parison previously formed in a coextrusion process such as is described in the hamlin u . s . pat . no . 5 , 270 , 086 . thus , the resulting expander member 12 has double walls 28 and 30 , respectively . the coextruded parison is designed to have an inner wall comprising pet and an outer wall of polyamide , with nylon - 12 being preferred . several nylons suitable for the expander member are grilamid l25 , ems , vestamide 2101 f , huls and vestamide 1801 f , huls . the pet component may be ici 5822 c or shell traytuf 1006 . when subjected to the stretch / blow - molding operation , both the pet layer and the nylon layer are biaxially oriented within a heated mold until a desired composite wall thickness and outer diameter are attained . typical wall thickness in an unexpanded state may range from about 0 . 0004 - 0 . 0009 , preferably about 0 . 00045 - 0 . 0006 inches . when the end - use of the balloon catheter is stent delivery , it is important that the expander member 12 exhibit a relatively low compliance factor so that the stent will only be expanded to a desired outside diameter . those skilled in the art will recognize that if the expander member is highly compliant , it becomes more difficult to control the extent of expansion of the stent being delivered thereby . it has been determined that if the compliance factor is kept below about 15 percent , and preferably 13 percent or less for pressures in the range of from 18 atmospheres to 18 atmospheres , good control over expanded stent diameter can be realized . it has been determined that when the outer wall 30 of the expander member 12 comprises polyamide , such as nylon - 12 , and when the inner wall 28 is pet , of the percent by weight of the polyamide in the composite is in the range of from 20 to 80 percent , the balloon &# 39 ; s compliance can be maintained in the desired range indicated . the pet layer 28 provides an expander member with a high burst strength while the outer nylon - 12 layer 30 offers excellent abrasion resistance . to improve the conformance parameter of the composite , double - walled expander member , such that upon inflation and subsequent deflation , it conforms closely to the profile of the catheter body stock 14 , temperature annealing of the expander member in accordance with the teachings of the aforereferenced roychowdhury patent application may be used . preferably , a blown expander member is taco - wrapped in a sheath and subjected to a heating cycle at a temperature between 75 ° and 95 ° c . for a period of time in the range of from 1 to 4 hours . the annealed double - walled balloon has been found to closely conform to the outer diameter of the catheter body stock 14 when first expanded to a pressure of about 8 atmospheres and subsequently deflated by aspirating the inflation fluid from the chamber 26 . no appreciable winging results . it has also been found that the distension curve for the composite , double - walled balloon can be tailored based upon the nylon - 12 content and the annealing conditions imposed . an expander member having a diameter of 3 . 0 mm and comprising coextruded pet , and nylon - 12 in ratios from about 55 - 45 to 65 - 35 were formed and during the stretch / blow - molding thereof were stretched a distance of from 5 : 1 to 8 : 1 in the radial direction . the expander members exhibited a wall thickness in the range of from 0 . 0005 to 0 . 001 inches and in an unexpanded state and were found to exhibit the following composite hoop stresses and burst pressures for the indicated wall thicknesses . hoop stress was calculated as a σ = pd / 2t , wherein t is the balloon wall thickness measured in an unexpanded state , p is the burst pressure measured at 37 ° c ., and d is the diameter at 10 atmospheres and room temperature . ______________________________________ hoop stresswall ( in .) nylon (%) burst ( psi ) ( psi ) ______________________________________ . 00058 38 . 2 441 . 8 44 , 941 . 0007 38 . 5 436 . 4 36 , 782 . 0009 41 . 7 483 . 0 35 , 621______________________________________ fig3 a and 3b are graphs reflecting the variation in the compliance characteristics of average value for five groups of five samples each of catheter expander members when each group of five was subjected to annealing temperatures varying from 75 ° for the first group to 95 ° c . for the fifth group in each case for one hour . the expander members were each 3 . 0 mm in diameter and 20 mm in length . they comprised 40 % nylon , 60 % pet coextrusions . these curves show that by proper control of annealing temperatures , it is possible to tailor the expander members to exhibit desired compliance characteristics in a range of from 10 % to 18 % between 8 and 18 atmospheres . the relative percentages of nylon and pet in the co - extrusion also has an effect on the compliance characteristics . measurements were taken at room temperature and using water as the inflation medium . a summary of the results is shown in table 1 below . table i__________________________________________________________________________1 hour @ 75 ° c . 1 hour @ 80 ° c . 1 hour @ 85 ° c . 1 hour @ 90 ° c . 1 hour @ 95 ° c . psi average psi average psi average psi average psi average__________________________________________________________________________14 . 7 2 . 921 14 . 7 2 . 879 14 . 7 2 . 805 14 . 7 2 . 754 14 . 7 2 . 64929 . 4 2 . 935 29 . 4 2 . 893 29 . 4 2 . 827 29 . 4 2 . 783 29 . 4 2 . 67244 . 1 2 . 946 44 . 1 2 . 905 44 . 1 2 . 847 44 . 1 2 . 797 44 . 1 2 . 68758 . 8 2 . 953 58 . 8 2 . 915 58 . 8 2 . 861 58 . 8 2 . 809 58 . 8 2 . 69873 . 5 2 . 960 73 . 5 2 . 925 73 . 5 2 . 864 73 . 5 2 . 821 73 . 5 2 . 71088 . 2 2 . 970 88 . 2 2 . 939 88 . 2 2 . 886 88 . 2 2 . 830 88 . 2 2 . 719102 . 5 2 . 982 102 . 5 2 . 956 102 . 5 2 . 902 102 . 5 2 . 850 102 . 5 2 . 732117 . 6 2 . 996 117 . 6 2 . 976 117 . 6 2 . 916 117 . 6 2 . 864 117 . 6 2 . 748132 . 3 3 . 013 132 . 3 2 . 997 132 . 3 2 . 937 132 . 3 2 . 892 132 . 3 2 . 769147 . 0 3 . 029 147 . 0 3 . 018 147 . 0 2 . 967 147 . 0 2 . 923 147 . 0 2 . 806161 . 7 3 . 042 161 . 7 3 . 034 161 . 7 2 . 996 161 . 7 2968 161 . 7 2 . 857176 . 4 3 . 056 176 . 4 3 . 047 176 . 4 3 . 022 176 . 4 3 . 002 176 . 4 2 . 919191 . 1 3 . 069 191 . 1 3 . 061 191 . 1 3 . 046 191 . 1 3 . 036 191 . 1 2 . 978205 . 8 3 . 082 205 . 8 3 . 079 205 . 8 3 . 065 205 . 8 3 . 061 205 . 8 3 . 019220 . 5 3 . 101 220 . 5 3 . 089 220 . 5 3 . 065 220 . 5 3 . 079 220 . 5 3 . 054235 . 8 3 . 116 235 . 8 3 . 104 235 . 8 3 . 101 235 . 8 3 . 095 235 . 8 3 . 079249 . 9 3 . 132 249 . 9 3 . 118 249 . 9 3 . 118 249 . 9 3 . 115 249 . 9 3 . 104264 . 6 3 . 153 264 . 6 3 . 135 264 . 6 3 . 138 264 . 6 3 . 136 264 . 6 3 . 123279 . 3 3 . 173 279 . 3 3 . 151 279 . 3 3 . 154 279 . 3 3 . 155 279 . 3 3 . 141294 . 0 3 . 192 294 . 0 3 . 171 294 . 0 3 . 170 294 . 0 3 . 179 294 . 0 3 . 160308 . 7 3 . 214 308 . 7 3 . 192 308 . 7 3 . 189 308 . 7 3 . 197 308 . 7 3 . 184323 . 4 3 . 234 323 . 4 3 . 215 323 . 4 3 . 208 323 . 4 3 . 222 323 . 4 3 . 209338 . 1 3 . 250 338 . 1 3 . 233 338 . 1 3 . 227 338 . 1 3 . 237 338 . 1 3 . 228__________________________________________________________________________ this invention has been described herein in considerable detail in order to comply with the patent statutes and to provide those skilled in the art with the information needed to apply the novel principles and to construct and use such specialized components as are required . however , it is to be understood that the invention can be carried out by specifically different equipment and devices , and that various modifications , both as to the equipment details and operating procedures , can be accomplished without departing from the scope of the invention itself .	0
the following description relates to various embodiments of methods a for a vehicle system which includes an exhaust fluid sensor . in one example embodiment , a method comprises indicating degradation of an exhaust fluid sensor positioned upstream of an exhaust injector based on a first exhaust fluid concentration when exhaust fluid is present at the sensor and a second exhaust fluid concentration after exhaust fluid is evacuated away from the sensor . the first exhaust fluid concentration may be determined when the engine is on and after an exhaust gas treatment system is started . the second exhaust fluid concentration may be determined when after the engine is shutdown and the exhaust gas treatment system is shutdown . by comparing the first exhaust fluid concentration and the second exhaust fluid concentration measured under different conditions , for example , degradation of the exhaust fluid sensor may be indicated . for example , the first exhaust fluid concentration may be expected to be higher than the second exhaust fluid concentration because is exhaust fluid is present only when the first exhaust fluid concentration is measured . in this way , degradation of the exhaust fluid sensor may be determined . fig1 shows a schematic diagram of engine system 100 . engine system 100 includes engine 102 which may be included in a propulsion system of a vehicle . engine 102 may be controlled at least partially by a control system including controller 104 and by input from a vehicle operator via an input device ( not shown ). intake air is inducted into engine 102 via intake passage 106 , an exhaust gas resulting from combustion in engine 102 is exhausted via exhaust passage 108 eventually leading to a tailpipe ( not shown ) that eventually routes exhaust gas to the atmosphere . as shown , exhaust gas treatment system 110 including exhaust gas treatment device 112 is shown arranged along exhaust passage 108 . in the example embodiment of fig1 , exhaust gas treatment device 112 may be a selective catalyst reduction ( scr ) system , for example . in other examples , exhaust gas treatment system 110 may additionally or alternatively include a three way catalyst ( twc ), a no x trap , various other emission control devices , or combinations thereof . further , as depicted , exhaust fluid injector 114 is disposed upstream of exhaust gas treatment device 112 . exhaust fluid injector 114 injects an exhaust fluid into the exhaust stream for reaction with no x in exhaust gas treatment device 112 responsive to signals received from controller 104 . the exhaust fluid may be a reductant , for example , such as urea or ammonia . in the example depicted in fig1 , exhaust fluid injector 114 is supplied with exhaust fluid from exhaust fluid storage tank 116 . exhaust fluid storage tank 116 may be a reservoir suitable for holding the exhaust fluid throughout a range of temperatures , for example . the exhaust fluid is pumped from exhaust fluid storage tank 116 via pump 118 . pump 118 pumps exhaust fluid from exhaust fluid storage tank 116 and delivers the exhaust fluid to exhaust fluid passage 120 at a higher pressure . a pressure in exhaust fluid passage 120 may be measured by pressure sensor 122 , for example , disposed in exhaust fluid passage 120 . as shown , exhaust fluid passage 120 fluidically couples pump 118 and injector 114 . further , reverting valve 124 is mechanically coupled to pump 118 such that a flow of fluid through the pump may be reversed . as an example , it may be desired to reverse the flow through the pump after engine shutdown such that exhaust fluid passage 120 may be drained of exhaust fluid . a concentration of the exhaust fluid which passes through exhaust fluid passage 180 may be determined via exhaust fluid sensor 126 , which is positioned upstream of injector 114 . for example , the concentration of the exhaust fluid may be determined so that it may be determined whether or not the exhaust fluid storage tank is holding the correct fluid or fluid mixture . thus , the exhaust fluid sensor may output a first reading indicating a first exhaust fluid concentration during engine operation when the exhaust fluid line is full and exhaust fluid is present at the exhaust fluid sensor . the exhaust fluid sensor may further output a second reading indicating a second exhaust fluid concentration after engine shutdown when the exhaust fluid line is empty and exhaust fluid is not present at the sensor . the first reading may be compared to the second reading in order to test the functionality of the exhaust fluid sensor , for example , as will be described in greater detail below with reference to fig2 - 5 . controller 104 may be a microcomputer including the following , although not shown in fig1 : a microprocessor unit , input / output ports , an electronic storage medium for executable programs and calibration values ( e . g ., a read only memory chip ), random access memory , keep alive memory , and a data bus . storage medium read - only memory may be programmed with computer readable data representing instructions executable by the microprocessor for performing the methods described below as well as other variants that are anticipated but not specifically listed . for example , the controller may receive communication ( e . g ., input data ) from the various sensors , process the input data , and trigger the actuators in response to the processed input data based on instruction or code programmed therein corresponding to one or more routines . example routines are described herein with reference to fig2 - 5 . controller 104 sends signals to communications system 128 , such as a wireless network or controller area network ( can ). as an example , after processing data from exhaust fluid sensor 126 and determining that exhaust fluid sensor 126 is degraded , controller 104 send may set a fault code and send a message to communications system 128 indicating degradation of exhaust fluid sensor 126 . communications system 128 may then notify the operator of the vehicle via an operator interface , such as a dashboard or other vehicle display , for example . in some examples , communications system 128 may additionally or alternatively send a message to a third party 130 , such a selling dealership of the vehicle or another service center . thus , the vehicle system includes an exhaust gas treatment system which includes an exhaust fluid sensor . the exhaust fluid sensor measures an exhaust fluid concentration and sends a signal to the controller indicating the concentration . as will be described below , based on the exhaust fluid readings , degradation of the exhaust fluid sensor may be determined . fig2 - 5 show flow charts illustrating routines for an engine system , such as engine system 100 described above with reference to fig1 . specifically , fig2 shows a routine for controlling start - up and shutdown of an exhaust gas treatment system which includes an exhaust fluid sensor . fig3 shows a routine for starting - up an exhaust gas treatment system while the engine is on and measuring a first exhaust fluid concentration . fig4 shows a routine for shutting down the exhaust gas treatment system after the engine is shutdown and measuring a second exhaust fluid concentration . fig5 shows a routine for diagnosing the exhaust fluid sensor based on the first and second exhaust fluid concentrations . further , fig6 shows a graph illustrating various parameters of the exhaust gas treatment system while the exhaust gas treatment system is shutting down . fig2 shows a flow chart illustrating routine 200 for controlling start - up and shutdown an exhaust gas treatment system which includes an exhaust fluid sensor , such as exhaust gas treatment system 110 described above with reference to fig1 . specifically , the routine determines when to run start - up and shutdown of the exhaust gas treatment system based on whether the engine is running . at 202 of routine 200 , it is determined if the engine is on . as an example , it may be determined if the engine is on if the engine is spinning . further , it maybe determined if the engine was recently started . for example , it may be determined if the coolant temperature is less than a threshold temperature or if a time since engine start is less than a threshold . if it is determined that the engine is not on , the routine ends . on the other hand , if it is determined that the engine is on , the routine proceeds to 204 where start - up of the exhaust gas treatment system is carried out according to routine 300 of fig3 . as will be described in greater detail below , once the exhaust gas treatment system is operation , a first exhaust fluid reading may be determined . at 206 of routine 200 , it is determined if the engine is shutdown . as an example , it may be determined if the engine is not spinning . further , it may be determined if the engine was recently shutdown . for example , it may be determined if the coolant temperature is greater than a threshold temperature or if the time since engine shutdown is less than a threshold . if it is determined that the engine is still on , the routine moves to 212 and current operation is continued . on the other hand , if it is determined that the engine is off ( e . g ., shutdown ), routine 200 continues to 208 where shutdown of the exhaust gas treatment system is carried out according to routine 400 of fig4 . as will be described in greater detail below , once the exhaust gas treatment system is shutdown , a second exhaust fluid reading may be determined . at 210 of routine 200 , exhaust gas fluid sensor diagnostics are carried out according to routine 500 of fig5 . as will be described in greater detail below , the first exhaust fluid reading determined in routine 300 and the second exhaust fluid reading determined in routine 400 are compared such that degradation of the exhaust fluid sensor may be determined . continuing to fig3 , a flow chart illustrating routine 300 for estimating a first exhaust fluid concentration during engine operation is shown . specifically , the routine starts - up the exhaust gas treatment system measures the second exhaust fluid concentration via an exhaust fluid sensor disposed in an exhaust fluid passage once the exhaust gas treatment system is in operation . at 302 of routine 300 , it is determined if the engine is on . as an example , it may be determined if the engine is on if the engine is spinning . further , it maybe determined if the engine was recently started . for example , it may be determined if the coolant temperature is less than a threshold temperature or if a time since engine start is less than a threshold . if it is determined that the engine is not on , the routine ends . at 304 , it is determined if a temperature of an exhaust gas treatment device of the exhaust gas treatment system is greater than a threshold temperature . for example , the exhaust gas treatment device may need to be to have warmed - up to a certain temperature ( e . g ., the threshold temperature ) before exhaust fluid is injected in the exhaust passage upstream of the exhaust gas treatment device in order to reduce a possibility of degradation of the exhaust gas treatment device . if it is determined that the temperature of the exhaust gas treatment device is less than the threshold temperature , the routine waits to proceed until the temperature has reached the threshold temperature . once it is determined that the exhaust gas treatment device temperature is greater than the threshold temperature , routine 300 continues to 306 where the pump pressure is increased . for example , the controller may turn the pump on or increase a voltage supplied to the pump to increase the pump pressure . by increasing the pump pressure , an amount of exhaust fluid drawn from the exhaust fluid storage tank and supplied to the exhaust fluid passage may be increased , thereby increasing a pressure in the exhaust fluid passage . at 308 , the injector is opened . the injector may be opened such that the system fills with the exhaust fluid , for example , and air bubbles are cleared from the exhaust fluid passage . once the injector has been opened for a threshold duration , the injector is closed at 310 . once the injector is closed , pressure may build in the exhaust fluid passage so that the injector is ready to inject the exhaust fluid into the exhaust passage at a desired pressure when exhaust fluid injection is requested . thus , at 312 , it is determined if the pump pressure is greater than a threshold pressure . the threshold pressure may be a desired pressure at which to inject exhaust fluid into the exhaust passage , for example . if the pump pressure is not greater than the threshold pressure , the system waits to proceed until the pump pressure reaches the threshold pressure . once it is determined that the pump pressure is greater than the threshold pressure , routine 300 continues to 314 where a first exhaust fluid concentration is determined . thus , the first exhaust fluid concentration is measured when the exhaust fluid passage is filled with exhaust fluid and the system is ready to inject exhaust fluid into the exhaust passage . as such , a possibility that air bubbles might be in the exhaust fluid passage and affect the exhaust fluid concentration measurement is decreased . the first exhaust fluid reading may be obtained via exhaust fluid sensor 126 described above with reference to fig1 , for example . the first exhaust fluid concentration may correspond to an amount of urea or ammonia in the exhaust fluid mixture . for example , the urea may be aqueous urea which contains water . by determining the exhaust fluid concentration when the exhaust fluid passage is full and the exhaust gas treatment system is ready for operation , a vehicle operator and / or third party may be notified if the exhaust fluid concentration is too high or too low and the exhaust fluid is not suitable for use in the exhaust gas treatment system , for example . further , in some embodiments , the routine may further include adjusting an exhaust fluid injection to the exhaust passage based on the first exhaust concentration reading obtained when exhaust fluid is present at the exhaust fluid sensor . for example , if the measured concentration of the exhaust fluid is less than expected , a greater amount of exhaust fluid may be injected to the exhaust passage such that a desired amount of exhaust fluid is received by the catalyst . as another example , if the measured concentration of the exhaust fluid is greater than expected , a lesser amount of exhaust fluid may be injected to the exhaust passage such that a desired amount of exhaust fluid is delivered to the catalyst . thus , after start - up of the exhaust gas treatment system during engine operation , a first exhaust fluid concentration may be determined . the first exhaust fluid concentration corresponds to an exhaust fluid reading when the exhaust fluid passage is full and there is exhaust fluid present at the exhaust fluid sensor . as such , the first exhaust fluid concentration may be measured at any time while the engine is on and after the exhaust gas treatment system has been started - up and is in operation . the first exhaust fluid reading may indicate whether a suitable exhaust fluid is being used by the exhaust gas treatment system , for example . further , as will be described below , the first exhaust fluid concentration may be compared to a second exhaust fluid concentration to diagnose the exhaust fluid sensor . fig4 shows a flow chart illustrating routine 400 for estimating a second exhaust fluid concentration after engine shutdown . specifically , the routine shuts down the exhaust gas treatment system after engine shutdown and evacuates exhaust fluid from an exhaust fluid passage in which an exhaust fluid sensor is disposed . for example , exhaust fluid may be drained from a pump , exhaust fluid passage , and injector of the system after engine shutdown such that degradation of the system due to freezing , corrosion , or the like is reduced during while the engine is off . once the exhaust fluid is drained from the exhaust fluid passage , a second exhaust fluid concentration is determined . at 402 of routine 400 , it is determined if the engine is shutdown . as an example , it may be determined if the engine is not spinning . further , it may be determined if the engine was recently shutdown . for example , it may be determined if the coolant temperature is greater than a threshold temperature or if the time since engine shutdown is less than a threshold . if it is determined that the engine is still on , the routine ends . on the other hand , it if is determined that the engine is shutdown , routine 400 continues to 404 where it is determined if the pump pressure has decreased below a threshold pressure . for example , the pressure in the system may be decreased such that the system may be shutdown and the flow of exhaust fluid from the exhaust fluid storage tank may be reduced . as an example , curve 602 in fig6 shows the pump pressure over time after an engine shutdown . although the pump pressure is decreased , the pump may remain on . for example , curve 604 of fig6 shows pump dc . if it is determined that the pump pressure is not less than the threshold pressure , routine 400 of fig4 waits until the pump pressure has decreased below the threshold pressure before proceeding . once it is determined that the pump pressure is below the threshold pressure , a reverting valve is actuated . the reverting valve may be actuated such that a flow through the pump may be reversed , for example . actuation of the reverting valve is depicted by curve 606 in fig6 , for example . in this manner , exhaust fluid that is in the pump may be sent back to the exhaust fluid storage tank and , additionally , exhaust fluid may be drained from the exhaust fluid passage via the pump . further , once the reverting valve is actuated , the injector is opened for a threshold duration . curve 608 in fig6 shows the opening of the injector after the pump pressure has decreased . as such , some exhaust fluid may be evacuated from the exhaust fluid passage via the injector and a pressure in the exhaust fluid passage may be further reduced . once the injector has been closed , routine 400 proceeds to 410 and a second exhaust fluid concentration is determined . thus , the second exhaust fluid concentration is measured after the exhaust fluid has been evacuated from the exhaust fluid passage and exhaust fluid is not present at the exhaust fluid sensor . as such , the second exhaust fluid reading may correspond to a concentration of a component of the exhaust fluid mixture , such as urea or ammonia , in air or exhaust gas . the second exhaust fluid reading may be obtained via exhaust fluid sensor 126 described above with reference to fig1 , for example . in some examples , the second exhaust fluid concentration may be measured to determined if exhaust fluid has been evacuated from the exhaust fluid passage , for example . an amount of fluid injected to the exhaust passage may not be adjusted responsive to the measured second exhaust concentration , however . for example , the second exhaust concentration is obtained when exhaust fluid is not present at the sensor and is not representative of the exhaust fluid concentration when exhaust fluid is present at the sensor and ready for delivery to the exhaust passage . in some embodiments , the second exhaust fluid concentration may be determined immediately subsequent an engine key - on , or other start request ( such as key - less entry and / or key - less push - button start ), before the exhaust gas treatment system is pressurized . for example , the second exhaust fluid concentration may be determined at engine key - on if the time the engine has been shutdown ( e . g ., key - off ) or soak time is greater than a threshold duration . in such an embodiment , the exhaust fluid passage may still be drained and exhaust fluid is not present at the sensor , as the system has not yet pressurized the exhaust fluid in the exhaust gas treatment system . thus , after the engine is shutdown and exhaust fluid is drained from the exhaust fluid passage , pump , and injector , a second exhaust fluid concentration may be determined . the second exhaust fluid concentration corresponds to an exhaust fluid reading when the exhaust fluid passage is empty and there is not exhaust fluid present at the exhaust fluid sensor . the second exhaust fluid reading may indicate whether the exhaust fluid has actually drained from the exhaust fluid passage , for example . further , as will be described below , the second exhaust fluid concentration may be compared to the first exhaust fluid concentration to diagnose the exhaust fluid sensor . fig5 shows a flow chart illustrating routine 500 for diagnosing an exhaust fluid sensor , such as exhaust fluid sensor 126 described above with reference to fig1 . specifically , the routine indicates degradation of the exhaust fluid sensor based on a first exhaust fluid concentration obtained when an exhaust fluid passage between a pump and an injector is full ( e . g ., the first exhaust fluid concentration determined in routine 300 ) relative to a second exhaust fluid concentration obtained after the exhaust fluid passage is has been cleared of exhaust fluid ( e . g ., the second exhaust fluid concentration determined in routine 400 ). at 502 of routine 500 , the second exhaust fluid concentration is compared to the first exhaust fluid concentration . for example , the controller may determine a difference between the first exhaust fluid concentration and the second exhaust fluid concentration . curve 612 in fig6 shows an exhaust fluid concentration signal . as depicted , when the pump pressure is high before the reverting valve is actuated and the injector is opened ( e . g ., when the engine is on ), the exhaust fluid concentration signal has a higher value than after the pump pressure has decreased , the pump direction has been reversed by actuation of the reverting valve , and the injector has been opened ( e . g ., after engine shutdown ). this is because there is exhaust fluid present in the exhaust fluid passage when the first reading is obtained and there is no exhaust fluid present in the exhaust fluid passage when the second reading is obtained , for example . area 612 in fig6 shows a time when the first exhaust fluid concentration may be determined and area 614 in fig6 shows a time when the second exhaust fluid concentration may be determined . thus , at 504 of routine 500 it is determined if the difference between the first exhaust fluid concentration and the second exhaust fluid concentration is greater than a threshold difference . as an example , the threshold difference may be the difference between a minimum exhaust fluid concentration during engine operation and a concentration of an exhaust fluid component in air or exhaust gas . if it is determined that the difference is not greater than a threshold difference , the routine moves to 512 and it is indicated that the sensor is not degraded . on the other hand , if the difference between the first exhaust fluid concentration and the second exhaust fluid concentration is greater than the threshold difference , routine 500 proceeds to 506 and degradation of the exhaust fluid sensor is indicated . indicating degradation of the exhaust fluid sensor may include setting a fault code in the controller at 508 . further , indicating degradation of the controller may additionally or alternatively include sending a message to an operator interface at 510 . for example , the vehicle operator may be notified that the exhaust fluid sensor is degraded via a message or indicator lamp on a vehicle display such as a dashboard . as another example , a third party , such as a vehicle service center , may be notified of the degraded exhaust fluid sensor such that the third party may inform the vehicle operator to bring the vehicle in for service . thus , by comparing a first exhaust fluid concentration sensed while the engine is on and there is exhaust fluid present at the exhaust fluid sensor and a second exhaust fluid concentration sensed after the engine is shutdown and there is not exhaust fluid present at the exhaust fluid sensor , degradation of the exhaust fluid sensor may be determined . the vehicle operator may be notified of the degraded sensor via the vehicle interface , for example , and the vehicle may be taken to a service center such that the exhaust fluid sensor may be replaced or repaired . note that the example control and estimation routines included herein can be used with various engine and / or vehicle system configurations . the specific routines described herein may represent one or more of any number of processing strategies such as event - driven , interrupt - driven , multi - tasking , multi - threading , and the like . as such , various acts , operations , or functions illustrated may be performed in the sequence illustrated , in parallel , or in some cases omitted . likewise , the order of processing is not necessarily required to achieve the features and advantages of the example embodiments described herein , but is provided for ease of illustration and description . one or more of the illustrated acts or functions may be repeatedly performed depending on the particular strategy being used . further , the described acts may graphically represent code to be programmed into the computer readable storage medium in the engine control system . it will be appreciated that the configurations and routines disclosed herein are exemplary in nature , and that these specific embodiments are not to be considered in a limiting sense , because numerous variations are possible . for example , the above technology can be applied to v - 6 , i - 4 , i - 6 , v - 12 , opposed 4 , and other engine types . the subject matter of the present disclosure includes all novel and nonobvious combinations and subcombinations of the various systems and configurations , and other features , functions , and / or properties disclosed herein . the following claims particularly point out certain combinations and subcombinations regarded as novel and nonobvious . these claims may refer to “ an ” element or “ a first ” element or the equivalent thereof . such claims should be understood to include incorporation of one or more such elements , neither requiring nor excluding two or more such elements . other combinations and subcombinations of the disclosed features , functions , elements , and / or properties may be claimed through amendment of the present claims or through presentation of new claims in this or a related application . such claims , whether broader , narrower , equal , or different in scope to the original claims , also are regarded as included within the subject matter of the present disclosure .	8
referring to fig1 a and 1b , an arbitration controller apparatus is shown , such apparatus being shown in a duplex form . the present application teaches duplex arbitration control . simplex arbitration control is taught in co - pending sister application ser . no . 163 , 045 . each central processing unit ( cpu ) 0 - 15 , 0 &# 39 ;- 15 &# 39 ;, 16 - 31 and 16 &# 39 ;- 31 &# 39 ; is shown connected via a tri - state bus to a corresponding arbitration circuit 0 - 15 , 0 &# 39 ;- 15 &# 39 ;, 16 - 31 and 16 &# 39 ;- 31 &# 39 ; respectively . cpus 0 and 0 &# 39 ;, 1 and 1 &# 39 ;, etc . constitute duplex pairs , having one cpu of the pair active and the other a ready - standby for fault failure of the active one . each cpu of the pair has its buses cross connected to the other arbitration circuit of the pair . ( that is , cpu 0 is connected via buses to arbitration circuits 0 and 0 &# 39 ;, cpu 0 &# 39 ; is connected via buses to arbitration circuits 0 &# 39 ; and 0 . cpu 1 is connected to arbitration circuits 1 and 1 &# 39 ;, cpu 1 &# 39 ; is connected to arbitration circuits 1 &# 39 ; and 1 , etc .) however , only one cpu of the pair is active at one time . the buses are enabled only from the active cpu via tri - state driver elements . due to physical constraints , cpus 0 - 15 and 0 &# 39 ;- 15 &# 39 ; each comprise one subgroup and cpus 16 - 31 and 16 &# 39 ;- 31 &# 39 ; each comprise another . each arbitration circuit 0 - 15 , 0 &# 39 ;- 15 &# 39 ;, 16 - 31 and 16 &# 39 ;- 31 &# 39 ; is in turn connected via a corresponding common tri - state bus to memory a and to its duplicate copy memory a &# 39 ;. arbitration circuit 0 is connected to arbitration circuit 1 with arbitration circuit 1 being connected to the last arbitration circuit 15 of the subgroup and the last arbitration circuit connected back again to arbitration circuit 0 , thereby forming a completed ring connection . arbitration circuit 0 &# 39 ; is connected to arbitration circuit 1 &# 39 ; with arbitration circuit 1 &# 39 ; being connected to the last prime arbitration circuit 15 &# 39 ; of the subgroup and the last prime arbitration circuit 15 &# 39 ; connected back again to arbitration circuit 0 &# 39 ;, thereby forming a second parallel and synchronously operated ring connection . arbitration circuit 16 is connected to arbitration circuit 17 with arbitration circuit 17 being connected to the last arbitration circuit 31 of the subgroup and the last arbitration circuit 31 connected back again to arbitration circuit 16 . arbitration circuit 16 &# 39 ; is connected to arbitration circuit 17 &# 39 ; with arbitration circuit 17 &# 39 ; being connected to the last arbitration circuit 31 &# 39 ; of the subgroup and the last arbitration circuit 31 &# 39 ; connected back again to arbitration circuit 16 &# 39 ;, thereby forming two parallel and synchronously operated ring connections . there is an exact correspondence between each group of arbitration circuits . the number of arbitration circuits of each ring connection is in direct relation to the number of cpus in the configuration . the configuration may contain as many as 32 pairs of central processing units ( each may comprise an intel 8086 or similar device ) and therefore , 32 pairs of arbitration circuits . the number of cpus is expandable from 2 pairs to a total of 32 pairs in this implementation . as a practical matter , at least two pairs of cpus are required for the function of telephone central office switching . when an initialization signals is applied to arbitration circuit 0 , 0 &# 39 ;, 16 and 16 &# 39 ; bus available signals are derived and each is propagated along to successive arbitration circuits of its subgroup ultimately returning to arbitration circuit 0 , 0 &# 39 ;, 16 , and 16 &# 39 ; where it is again propagated . when , for example , cpu 0 requests access to memory a and a &# 39 ;, arbitration circuit 0 and 0 &# 39 ; each receive a request signal via their respective buses . and as the bus available signal is propagating through the logic of arbitration circuit 0 and synchronously through the logic of arbitration circuit 0 &# 39 ;, arbitration circuit 0 and 0 &# 39 ; will each temporarily block the propagating of the bus available signal . as a result , cpu 0 will have control of each of the common buses between the arbitration circuits 0 and 0 &# 39 ; and can access memory a and a &# 39 ; synchronously . cpu 0 then performs parallel memory accesses to memories a and a &# 39 ; of a duration of one memory cycle while simultaneously re - propagating the bus available signal in each ring connection to the next sequential arbitration circuit 1 and 1 &# 39 ;. this operation is analogous for cpu 16 and arbitration circuits 16 and 16 &# 39 ; accessing memory a and a &# 39 ;. the bus available signals travel along each ring connection of arbitration circuits 0 - 15 , 0 &# 39 ;- 15 &# 39 ;, 16 - 31 and 16 &# 39 ;- 31 &# 39 ; at a relatively high rate of speed , so that the probability of any active cpu gaining access to memory a and a &# 39 ; is relatively equal among the active cpus . each arbitration circuit of a subgroup slows the propagation of the bus available signal only by the time required to propagate this signal through a high speed gating arrangement of each ring connection . when two or more active cpus of duplex pairs in one subgroup simultaneously request access to memory a and a &# 39 ;, a conflict situation arises . this conflict is arbitrated by means of the two parallel ring connections of arbitration circuits . the bus available signal propagates along each ring connection of arbitration circuits . if an arbitration circuit pair ( 0 and 0 &# 39 ;) has an active request for access to the common bus of memory a and a &# 39 ;, cpu 0 associated with these arbitration circuits is then given control of each common bus enabling the memory transfer to occur . since , the conflict was with a subgroup and arbitrated by the ring connection of arbitration circuits , subgroup switching circuits a and a &# 39 ; operate only to gate through the bus connections to common memories a and a &# 39 ;. if cpu 0 &# 39 ; is the active one of the pair the transfer will occur as above except that cpu 0 is replaced by cpu 0 &# 39 ;. during this time , each bus available signal is re - propagated to the next succeeding arbitration circuit pair 1 and 1 &# 39 ; of each ring , so that cpus 1 or 1 &# 39 ; may establish their priority to obtain the common buses next . the associated cpu of this arbitration circuit pair then has control of each common bus and associated memory a and a &# 39 ;. then the active cpu of the duplex pair performs its memory transfer operation . the arbitration occurs sequentially as described above until all outstanding requests for access to memory a and a &# 39 ; have been serviced . while a particular cpu has been granted access to memory a and a &# 39 ;, the bus available signals will be re - propagated by each of its corresponding arbitration circuits of the subgroup . other active cpus will have the opportunity to establish a priority for service before a memory request will be granted to the same cpu of the subgroup . if the bus available signal returns to the arbitration circuit pair presently in control of the duplicate memories , grant signals will automatically pass control of the grant of access to the next sequential arbitration circuit pair . thereby , a particular active cpu does not utilize its arbitration circuit to monopolize memory a and a &# 39 ;. when two cpus of duplex pairs located in different groups and subgroups , for example cpu 0 and cpu 16 , simultaneously request access to the memories a and a &# 39 ;, arbitration of this conflict is resolved by subgroup switching circuits a and a &# 39 ;. switching circuits a and a &# 39 ; synchronously operate to select cpu 0 or 16 randomly and then alternates access to memories a and a &# 39 ; from one subgroup to the other subgroup , for example first cpu 0 , next cpu 16 , next cpu 1 , next cpu 17 , etc . the order within a subgroup need not be sequential . if only one cpu is requesting , switching circuits a and a &# 39 ; simply allocate memories a and a &# 39 ; to that cpu . when switching circuits a and a &# 39 ; must choose between cpus of different subgroups , the initial choice is established by a periodic pulse input signal selecting one group . access is then alternately allocated between groups . however , optionally each active cpu of a duplex pair may lockout other active cpus for more than one memory cycle . such conditions are limited and closely monitored . referring now to fig2 a schematic diagram of three arbitration circuits of one subgroup of a group is shown . these circuits correspond to a first a second and a last arbitration circuits of one of the two parallel ring connections . a particular implementation may include up to 16 pair of arbitration circuits per subgroup , one pair for each cpu pair equipped in the configuration . thereby , a maximum configuration of 32 pair of cpus and 32 pair of arbitration circuits is capable of implementation via this scheme . the operation will be explained for one arbitration subgroup of ring connection for simplicity . it is to be noted the same operation synchronously occurs in a corresponding parallel arbitration group . that is , arbitration circuits 0 - 15 and 0 &# 39 ;- 15 &# 39 ; operate synchronously forming duplex subgroups . in addition , arbitration circuits 16 - 31 and 16 &# 39 ;- 31 &# 39 ; operate synchronously forming another pair of duplex subgroups . thereby , both memory copies a and a &# 39 ; are written to or read from simultaneously . in the operation either cpu of the pair may be active , for example , cpu 0 or 0 &# 39 ; and 16 or 16 &# 39 ;. each arbitration circuit includes a gating arrangement composed of an and - or gate 200 , which may be implemented via an integrated circuit part number 74s51 or similar device . a ring connection of gates 200 , 210 , etc . propagates the bus - avail signal from one arbitration circuit to the next at a relatively high rate of speed so that the signal is not inhibited by any single arbitration circuit for a substantial period of time . d - type flip - flop 201 , 211 and 351 are each connected between a respective cpu and its respective arbitration logic . gates 201 , etc . may be implemented via integrated circuit part number 74s74 . jk flip - flop 204 , 214 , etc . are each connected between their corresponding d - type flip - flops 201 , 211 , etc . and their corresponding and - or gate 200 , 210 , etc . as a portion of the system clear and initialization , cpu 0 pulses the reset lead which is connected to jk flip - flops 204 , 214 , etc . as a result the bus - avail signal is generated through and - or gate 200 and propagates along the ring connection to and - or gate 210 , 350 and back gain to gate 200 . a 12 mhz clock signal , from a clock ( not shown ) is transmitted to all flip - flops ( d - type and jk ) via the clk lead to operate each of these flip - flops . an example will best serve to illustrate the granting of control of the common bus to a particular cpu . when active cpu 0 signals via the reset lead , flip - flop 204 is preset enabling gate 200 to transmit the bus available signal via the bus - avail lead to each successive gate 210 , etc . when cpu 0 requests access to the common memory , cpu 0 raises the sel 0 lead via the bus connected between cpu 0 and arbitration circuit 0 . at the next clock cycle , the clock signal is transmitted to flip - flop 201 which becomes set and the q output of this flip - flop temporarily disables gate 200 from passing the bus - avail signal . the q output of flip - flop 201 is passed through gates 202 and 203 and sets flip - flop 204 , which causes it to toggle and produce a signal on the grant 0 lead and simultaneously enables gate 205 . the grant 0 lead is returned to cpus 0 and 0 &# 39 ; and this signal also enables tri - state elements ( not shown ), gating cpu 0 bus onto the common bus of memory a . the above simultaneously occurs in arbitration circuit 0 &# 39 ;. while this memory access takes place , the bus available signal is re - propagated via the output of j - k flip - flop 204 through the lower portion of gate 200 , so that the successive arbitration circuits may establish their respective priority for memory access . if the bus available signal returns to arbitration circuit 0 via the bus - avail lead while the access is in progress , the grant signal is transmitted via the take - grant lead automatically to the next sequential arbitration circuit 1 , so that if sel 1 is set , cpu 1 access request will be given the grant on the next clock cycle . this scheme distributes determination of which is the next available memory request to be given access on a rotational basis ; and this scheme further keeps memory access equal when cpu access requests are sporadic . in this way , a cpu may not make successive memory requests . cpu 0 may now completes its data transfer to memory a and a &# 39 ;. if another arbitration circuit pair has established its priority , that circuit pair will receive control of the common buses next . in this way , while one cpu is accessing memories a and a &# 39 ;, the next cpu is establishing its priority for service . all buses are bidirectional and each directional link includes tri - state bus drivers which may be implemented via integrated circuit part number 74ls245 . all above mentioned integrated circuits are manufactured by texas instruments incorporated and various other manufacturers . the cpu having the memory access grant may signal via the lock lead ( normally high ) to halt the re - propagation of the bus available signal and thereby hold memory access for longer than one cycle . this optional use is a rare circumstance and is closely monitored by the cpus . referring to fig3 a schematic diagram of subgroup switching circuit a and a &# 39 ; of fig1 a is shown . j - k flip - flop 370 is connected via the clk lead to a clock ( not shown ) providing an 12 mhz cycle clock signal , flip - flop 370 is further connected to each of and - or gates 380 and 381 and or gate 390 . if , for example , a cpu of subgroup a is the only one requesting , the upper and gate of gate 380 is enabled and the cpu of subgroup a has its tri - state bus ( not shown ) enabled to access memory a . when two cpus , one from each subgroup ( cpu 0 and cpu 16 , for example ), simultaneously request access to the memory , the upper portion of gate 380 and lower portion of gate 381 are disabled . on the next clock cycle via the clk lead , flip - flop 370 will toggle to enable the lower portion of gate 380 or the upper portion of gate 381 , thereby selecting subgroup a or b respectively . only one subgroup is enabled to access memory and on the next clock cycle the remaining subgroup is enabled . although the preferred embodiment of the invention has been illustrated , and that form described in detail , it will be readily apparent to those skilled in the art that various modifications may be made therein without departing from the spirit of the invention or from the scope of the appended claims .	6
the invention is described hereinbelow by way of example in a sheet - fed printing press , the device according to the invention being introducible into any type of printing press wherein a part must be aligned at a predetermined adjustment line and then picked up from the side of the adjustment line and moved forward . referring now to the drawings and , first , particularly to fig1 thereof , there is shown therein a feeding table 3 with a front lay 1 in working position . in the working position , a contact plate 20 of the front lay 1 is disposed at a front edge 47 of the feeding table 3 so that the contact plate 20 protrudes upwardly beyond a supporting surface 49 of the feeding table 3 and is disposed parallel to the front edge 47 on a predetermined alignment or adjustment line 46 ( note fig2 ). the contact plate 20 has an intercepting surface 48 , which , in the working position , is oriented approximately perpendicularly to the supporting surface 49 of the feeding table 3 . the contact plate 20 extends beneath the feeding table 3 into a first region 51 following a bend 50 . as shown in fig1 in the working position of the contact plate 20 , also shown in phantom at 25 in fig4 the first region 51 is realized approximately parallel to the supporting surface 49 and extends in a direction towards an adjusting device 4 . the first region 51 merges into a second region 52 , which is disposed approximately perpendicularly to the first region 51 . the second region 52 merges via a third region 53 into a fourth region 54 . the third region 53 has an asymmetrical u shape , and the fourth region 54 extends approximately parallel to the second region 52 . the fourth region 54 is in contact with a contact surface 55 of a shaft 6 . the fourth region 54 is fixedly screwed to the shaft 6 by a first screw 14 . the contact surface 55 is advantageously oriented perpendicularly to the feeding table 3 . the shaft 6 is formed with a centrally oriented borehole 56 which is oriented parallel to the contact surface 55 . thus , in the working position , the borehole 56 is oriented perpendicularly to the feeding table 3 . in the borehole 56 , a rod 19 having a lock disk 7 at the top end thereof , as viewed in fig1 for example , is rotatably mounted . the lock disk 7 lies on the shaft 6 . above the lock disk 7 , a stop element 8 in the form of an eccentric disk is provided . a side margin 57 of the stop element 8 is disposed parallel to the longitudinal axis of the rod 19 . the stop element 8 has a substantially cylindrical construction , with an axis of rotation situated outside the midpoint of the cross - section of the cylinder formed by the stop element 8 . the axis of rotation of the stop element 8 is coaxial with the axis of rotation 59 of the rod 19 . the stop element 8 has an upper side , as viewed in fig1 for example , which is oriented parallel to the underside of the feeding table 3 , and is formed with an opening 58 , which is bounded by an interior wall 9 of the stop element 8 . the interior wall 9 is advantageously constructed as a contact surface in the shape of an interior hexagon . the feeding table 3 is formed with a second recess 5 above the opening 58 . the second recess 5 is constructed so that a tool can be guided into the opening 58 through the feed table 3 from above , in order to vary the rotational position of the stop element 8 . a hex or hexagon key is preferably used as the tool . in its simplest form , the second recess 5 is a cylindrical recess . the lock disk 7 is disposed centrosymmetrically to the axis of rotation 59 of the rod 19 . lock recesses 13 are provided at the outer perimeter of the lock disk 7 . a lock element 12 is provided in the shape of a leaf spring , which is screwed to the shaft 6 by the first screw 14 , the lock element 12 having a lock nose 23 in the shape of an outward bend at the top end thereof , as viewed in fig1 . the lock nose 23 is disposed in a region of the outer perimeter of the lock disk 7 and engages in a respective lock recess 13 . interaction of the lock recesses 13 and the lock element 12 ensures a precise rotation of the stop element 8 into predetermined angular positions . the second region 52 of the front lay 1 is braced , via a contact part 15 , against a side edge of the stop element 8 , which represents the outer perimeter 57 thereof . the contact part 15 is advantageously constructed in the shape of a nut 16 through which a threaded adjusting screw 17 is guided . the nut 16 is secured at the second region 52 of the front lay 1 via a second weld or joint 44 . the front end of the adjusting screw 17 is in contact with the side edge 57 of the stop element 8 . the front lay 1 is shaped by the third region 53 thereof so that the second region 52 of the front lay 1 has a tensioning bias acting in a direction towards the stop element 8 . in the second region 52 , a borehole is formed , through which the other end of the adjusting screw 17 extends . the contact part 15 is thus clamped between the second region 52 and the outer perimeter 57 . the contact part 15 serves for setting or establishing a defined spacing between the outer perimeter 57 and the second region 52 and thus a defined position of the intercepting surface 48 . by turning the adjusting screw 17 , the position of the intercepting surface 48 relative to the feeding table 3 can be adjusted . the adjusting screw 17 and the nut 16 represent an adjusting mechanism . by the adjusting mechanism 16 , 17 , a basic setting of the front lay 1 can be executed . with the basic setting , several front lays can be aligned on a predetermined adjustment line . in addition , due to the eccentric shape of the stop element 8 , the position of the intercepting surface 48 can be set by turning the stop element 8 . the shaft 6 with the rod 19 and the stop element 8 represent an adjusting device 4 by which the position of the intercepting surface 48 can be adjusted from the basic setting that was previously set using the contact part 15 and the adjusting screw 17 . the rod 19 has a connecting element 60 at the bottom end thereof , as viewed in fig1 to which an elastic shaft 11 is attached . the elastic shaft 11 is connected to a controllable servomotor 10 . the rod 19 and thus the stop element 8 are turned , via the elastic shaft 11 , by actuating the servomotor 10 accordingly . in this manner , the intercepting surface 48 can be displaced , regardless of the accessibility of the front lay 1 , by actuating the servomotor 10 accordingly . because a servomotor 10 is used , the front lay 1 can be adjusted by remote control . the remote control can be accomplished via programs of a control computer of the sheet - fed printing machine . of course , this is also possible during the printing - machine cycle . in a relatively simple embodiment , the front lay 1 comprising the contact plate 20 , and the first , second , third , and fourth regions 51 , 52 , 53 and 54 , is constructed in the shape of a suitably bent thin plate . advantageously , the front lay 1 is produced from spring steel . because the front lay 1 is biased in the direction towards the stop element 8 in the second region 52 , due to the shape and the connection thereof to the shaft 6 , additional devices for biasing the contact plate 20 can be dispensed with . this ensures a cost - effective and compact construction . the lower end of the rod 19 has an axial guard 61 which limits the axial mobility of the rod 19 in the shaft 6 . the shaft 6 , the screw 14 and the rod 19 , together , represent a holding device 2 for the front lay 1 and the adjusting device 4 . [ 0062 ] fig2 shows the arrangement of fig1 as viewed from above and from the perspective of the feeding table 3 , which is represented only diagrammatically , in phantom . the feeding table 3 is formed with notches 45 in the region of a front lay 47 , through which respective contact plates 20 are guided from below . the intercepting surfaces 48 of the contact plates 20 are aligned at the adjusting line 46 . the notches 45 permit the arrangement of the adjustment line 46 in the region of the support surface 49 . thus , a sheet that is situated on the feeding table 3 , with the leading edge of the sheet abutting the intercepting surface 48 , is located in the region of the support surface 49 , so that the whole surface of the sheet is held by the feeding table 3 . the first region 51 and the third region 53 of the front lay 1 are clearly visible in fig2 . the adjusting screw 17 contacts the outer perimeter 57 of the stop element 8 . the shape of the lock nose 23 of the lock element 12 is also clearly visible . in this exemplifying embodiment , the lock nose 23 is locked in the first lock recess 13 . the lock disk 7 is formed with a recess which is bounded by first and second stop surfaces 21 and 22 . installed in the shaft 6 is a stop bolt 18 , which is disposed in the region of the recess of the lock disk 7 , so that rotation of the stop element 8 is limited by the fact that the first or second stop surface 21 , 22 strikes the stop bolt 18 . the lock disk 7 can be rotated only within a predetermined angular range due to the stop bolt 18 and the first and second stop surfaces 21 and 22 . a maximum permissible angular range for rotating the adjusting device 4 is thereby prescribed . fig2 clearly shows the shape of the lock disk 7 , which has a central opening through which the stop element 8 extends . the lock disk 7 is firmly connected to the stop element 8 . [ 0064 ] fig3 shows a device with two front lays 1 , which are affixed onto a common shaft 6 . the front lays 1 are aligned so that the stop plates 20 of the two front lays 1 are arranged on a common adjustment line 46 . in the same way , additional front lays 1 on the shaft 6 can also be distributed along the front or leading edge 47 of the feeding table 3 . a drive is also provided for rotating the shaft 6 , by the aid of which the shaft 6 shown in fig4 for example , is rotatable . the shaft 6 is mounted in a bearing support 76 and connected to the sheet - fed printing machine . [ 0065 ] fig4 shows a device similar to that of fig1 but with a slide ring 28 disposed between the adjusting screw 17 and the stop element 8 for reducing sliding friction . the slide ring 28 prevents wear of the stop element or the adjusting screw 17 and additionally accomplishes a precise adjustment of the position of the intercepting surface 48 due to low - frictional movement of the stop element 8 relative to the adjusting screw 17 . the slide ring 28 is rotatably mounted on the stop element 8 and secured against axial movement . the adjusting screw 17 is braced against the outer circumference of the slide ring 28 , and is resiliently prestressed against the slide ring 28 . [ 0066 ] fig4 shows the front lay 1 in the neutral or inactive position thereof at 26 , wherein the contact plate 20 is tilted about a central axis 63 over a pivot angle 27 relative to the working position 25 of the contact plate 20 , which is represented in phantom . the pivot angle 27 is so dimensioned that , in the neutral or inactive position 26 of the contact plates 20 , the latter are tilted far enough away from the front or leading edge 47 in the forward and downward directions so that the feeding table 3 and , thus , the sheet 64 lying thereon can be accessed freely in the region of the front or leading edge 47 . this is necessary because the sheet 64 is seized by a gripper in the region of the front or leading edge 47 and moved off the feeding table 3 . the gripper seizes the sheet 64 between the individual front lays . how the device according to the invention operates or functions is described hereinafter in detail with reference to fig1 and 4 . a sheet 64 coming from the righthand side , as represented in fig1 and 2 , is transported in a direction towards the intercepting surface 48 . the leading edge 65 of the sheet 64 strikes the intercepting surface 48 . the sheet 64 is stopped and aligned , with the leading edge 65 thereof on the adjustment line 46 . after the sheet 64 is aligned and settled on the feeding table 3 , it is seized by a gripper . the front lays 1 are then tilted away forwardly over the pivot angle 27 by rotating the shaft 6 about the central axis 63 , as is represented in fig4 and the sheet is drawn off and away from the feeding table 3 . the shaft 6 is then tipped back into the working position thereof , so that the front lay 1 again assumes the working position thereof , as represented in fig1 . because the front lay 1 is always in contact with the stop element 8 during the movement of the front lay 1 from the working position thereof into the neutral or inactive position thereof and back into the working position thereof again , the front lay 1 , with respect to the stop element 8 , is always at a defined spacing and always returns to the working position thereof at the same instant of time . because it is unnecessary to take into account any time reserve for undefined swinging - away and returning , more time is available for aligning and stabilizing the sheet . [ 0069 ] fig5 illustrates an additional embodiment of the invention wherein the adjusting screw 17 engages the stop element 8 via an anti - friction bearing 66 . in this regard , the adjusting screw 17 engages an exterior ring 67 of the anti - friction bearing under prestressing . [ 0070 ] fig6 shows an additional embodiment of the invention wherein the front lay 1 has a different shape than that of fig1 . in fig6 the first region 51 is longer and , shortly before the stop element 8 , the first region 51 buckles downwardly in a direction towards the shaft 6 and merges into a fifth region 68 . the fifth region 68 extends to a location beneath the shaft 6 , and merges into a sixth region 69 , which is disposed approximately parallel to the feeding table 3 and abuts a lower contact surface 70 of the shaft 6 . the sixth region 69 is formed with an opening out of which the rod 19 extends in a downward direction . a hexagon screw 35 that has been bored through is provided for bolting the sixth region 69 to the lower contact surface 70 and thus fixes the front lay 1 in position . the rod 19 extends through the hollow hexagon screw 35 and is secured against axial movement . the hexagon screw 35 additionally has an exterior thread mating with an interior thread of the second borehole 56 . also provided is a clamping or retaining nut 29 which is connected to the underside of the first region 51 of the front lay 1 via a weld 30 . the clamping nut 29 has an inner thread through which a bolt 71 , which extends through a corresponding opening in the fifth region 68 of the front lay 1 to the exterior perimeter 57 of the stop element 8 , is screwed . the bolt 71 is screwed so far into the clamping nut 29 in the direction towards the stop element 8 that the basic adjustment of the intercepting surface 48 of the contact plate 20 is correctly performed . the shapes of the first , fifth and sixth regions 51 , 68 and 69 of the front lay 1 are selected so that the fifth region 68 is biased in the direction towards the stop element 8 in the region of the bolt 71 . in this embodiment , the lock element 12 is fixed to the shaft 6 laterally opposite the fifth region 68 by a second screw 34 . accordingly , the lock disk 7 also is formed with the lock recesses 13 on the side of the lock element 12 . in this embodiment also , the rod 19 extends downwardly through the hexagon screw 35 and has a connecting element 60 for connecting the servomotor 10 thereto . [ 0073 ] fig7 is a top plan view of an embodiment like that of fig6 but with the stop element 8 constructed in the shape of an archimedes &# 39 ; spiral 31 . the archimedes &# 39 ; spiral 31 is constructed approximately in the shape of a plate , with the distance from the spiral wall 74 to the axis of rotation varying in dependence upon the rotational position of the disk . in this way , the spacing between the bolt 71 and the axis of rotation of the archimedes &# 39 ; spiral 31 can be varied in dependence upon the rotational position of the spiral 31 . the illustrated embodiment of the archimedes , spiral 31 is formed with a bolt opening 32 and has a graduated or index ring shape extending over a predetermined angular range at a defined distance from the axis of rotation . the two side edges of the bolt opening 32 are formed by first and second stop surfaces 21 and 22 . the stop bolt 18 extends through the bolt opening 32 and serves to limit the permissible rotational angular range of the archimedes &# 39 ; spiral 31 . [ 0074 ] fig8 shows an additional embodiment of the front lay 1 , which includes a connecting part 37 and a plate 36 . the connecting part 37 is mounted in a holding arm 42 parallel to the feeding table 3 and is movable parallel to the feeding table 3 . the holding arm 42 is formed with a guide borehole 72 which is disposed parallel to the feeding table 3 . the connecting part 37 is disposed so as to be axially movable in the guide borehole 72 . an end of the connecting part 37 protrudes from the guide borehole 72 at an exterior side of the holding arm 42 , and the connecting part 37 is connected at this end to the plate 36 , which is disposed perpendicularly to the connecting part 37 . the plate 36 , at the top thereof , as viewed in fig8 extends beyond the plane of the supporting surface 49 of the feeding table 3 , and the interior side surface of the plate 36 serves as the intercepting surface 48 . the connecting part 37 protrudes from the borehole 72 in the direction towards the stop element 8 , in like manner . at this end of the connecting part 37 , a second adjusting screw 39 is screwed into the connecting part 37 via an inner thread formed therein . the second adjusting screw 39 includes a stop 40 in the form of a nut engaged by a tension spring . the tension spring 41 is placed in contact with the holding arm 42 , as well , so that the second adjusting screw 39 is prestressed in the direction towards the stop element 8 . the intercepting surface 48 of the plate 36 is also prestressed in the direction towards the stop element 8 . the holding arm 42 is fixed to the shaft 7 through the intermediary of a bushing 73 through which the rod 19 extends . in this regard , a second contact surface 43 of the bushing 73 comes into contact with a correspondingly assigned supporting surface of the shaft 6 . the second contact surface 43 is expediently disposed parallel to the feeding table 3 . the bushing 73 is fixed to the shaft 6 by a hollow - bored hexagonal screw 35 . the hexagonal screw 35 has an exterior thread , which is suitably mated with an interior thread of the bushing 73 . the rod 19 , which is connected to the stop element 8 , extends downwardly through the hollow - bored hexagonal screw 35 and out of the shaft 6 and the hexagonal screw 35 . the bottom end of the rod 19 has a connecting element 60 for connecting a flexible shaft 11 and a servomotor 10 thereto . the device in fig8 has a leaf spring 12 located opposite to the second adjusting screw 39 , which is fixed to the bushing 73 of the holding arm 42 by a third screw 75 . a lock nose 23 of the lock element 12 is assigned to lock recesses 13 of a lock disk 7 . [ 0078 ] fig9 is a top plan view of the device of fig8 as viewed from the perspective of the feeding table 3 . the shape of the archimedes &# 39 ; spiral , which is formed with lock recesses 13 opposite the second adjusting screw 39 , can be clearly recognized therein . in this embodiment , the function of the lock disk and the function of the stop element 8 are integrated in a single component . this permits the construction of a low building structure . the shape of the recess 58 , which is bounded by an interior hexagonal form 24 , can also be readily recognized . the embodiment of fig8 differs from the embodiment of fig6 with respect to the development of the front lay 1 . an essential core of the invention is in constructing the front lay 1 and the stop element 8 as one internally stressed entity which is moved from a working or operating position in order to release the leading edge 65 of a sheet 64 , into a neutral or inactive position wherein the contact plate 20 releases the leading edge 47 . to accomplish this , the component can be moved , swung or rotated in any manner whatsoever . the shaft 6 used in the foregoing description , to which the stop element 8 and the front lay 1 are fastened , merely represents a preferred embodiment . the invention is not limited to using a shaft 6 . for example , the front lay 1 and the stop element 8 can also be fastened onto a component which is swung away from the leading edge 47 of the sheet by using lever arms in order to release the leading edge 47 . furthermore , the invention is exemplarily described as having a rotary element as the adjusting device 4 . but other shapes can be used to adjust the position of the front lay relative to the edge of the sheet . the holder 2 , e . g ., formed of the shaft 6 and the screw 14 , can be displaceably mounted . by this measure , all front lays can be displaced jointly in or opposite to the direction of sheet transport , i . e ., at an angle .	1
the present inventors have developed a new class of coagulants which exhibit enhanced performance in dewatering of mineral slurries . these coagulants are copolymers of dadmac and trialkoxysilanes . such hydrophobically associating copolymers have an enhanced performance with replacement ratios on the order of about 0 . 35 to about 0 . 50 over commercially available poly ( dadmac ) treatments . the mineral slurries are preferably treated with coagulants and optionally with flocculants . it has been discovered that surface charge neutralization of colloidal particles in the mineral slurries can be enhanced by the use of a copolymer which has been modified to incorporate a certain degree of hydrophobicity . such a modification can be accomplished by copolymerizing a diallyldimethylammonium halide , particularly diallyldimethylammonium chloride ( dadmac ) with vinyl alkoxysilane , preferably vinyl trimethoxysilane . the vinyl alkoxysilane monomers useful in the copolymer composition of the invention contain an alkyl group of from 1 - 4 carbon atoms . as such vinyl trimethoxy , triethoxy , tripropoxy and tributoxysilanes , and combinations thereof , may find use in the subject invention . while vinyl trialkoxysilanes are preferred , the monomers may be mono or di - substituted as well , or mixtures of mono -, di - and tri - alkoxy substituted silanes may be used . a preferred vinyl trialkoxysilane for use in this invention is vinyl trimethoxysilane , commercially available from hals america , piscataway , n . j . diallyldimethylammonium halides , especially diallyldimethylammonium chloride ( dadmac ) are well - known and commercially available from a variety of sources . one method for the preparation of dadmac is detailed in u . s . patent no . 4 , 151 , 202 , the disclosure of which is hereinafter incorporated by reference into this specification . the mole ratio of dadmac to the vinyl trialkoxysilane ranges from 99 . 99 : 01 to 80 : 20 and , preferably from 99 . 9 : 0 . 1 to 85 : 15 . most preferably , the mole ratio of dadmac to the vinyl trialkoxysilane range from 99 . 9 : 0 . 1 to 95 . 0 : 5 . 0 . the polymers may be prepared as in conventional vinyl polymerization techniques . these techniques include conventional solution polymerization in water , and polymerization in water - in - oil emulsion form , such as that described in u . s . pat . no . 3 , 624 , 019 , the disclosure of which is hereinafter incorporated by reference into this specification . the polymers of the invention may also be prepared in so - called dispersion form , such as that described in u . s . pat . nos . 4 , 929 , 655 and 5 , 006 , 590 the disclosures of which is also hereinafter incorporated by reference into this specification . the polymers of the instant invention may be in solid , dispersion , latex or solution form . conventional free radical catalysis may be used , including both free radical initiators and redox systems . such polymerizations are within the purview of those skilled in the art and as such will not be elaborated on in this specification . the molecular weights of the copolymer prepared hereunder can vary greatly . generally , copolymers of diallyldimethylammonium chloride and vinyl trimethoxysilane produced hereunder will have a molecular weight of from 50 , 000 to 5 , 000 , 000 , and preferably 75 , 000 to 2 , 500 , 000 , and most preferably from 100 , 000 to 1 , 000 , 000 . the polymers of this invention will accordingly have a reduced specific viscosity for a one percent by weight polymer solution as measured in one molar sodium nitrate of from 0 . 2 - 5 dl / gm and preferably from 0 . 5 - 4 . 0 dl / gm . a most preferred reduced specific viscosity range is from 0 . 7 - 3 . 0 dl / gm . while discussed herein as copolymers of diallyldimethylammonium halides and vinyl alkoxysilanes , other monomers may be incorporated into the resultant polymers without detracting from the spirit and intent of the invention . possible monomers that may be incorporated include , but are not limited to nonionic and cationic vinyl monomers . these materials are exemplified by acrylamide , and such cationic monomers as dimethylaminoethylmethacrylate and dimethylaminoethyl acrylate and their respective water soluble quaternary amine salts . the copolymers of this invention may be used alone , or in combination with a high molecular weight anionic or non - ionic water soluble or dispersible flocculant . such polymers include polyacrylamide , and copolymers of acrylamide with acrylic acid and its water soluble alkali metal or ammonium salts . as used herein , the term acrylic acid is meant to encompass such water soluble salts . also useful are such polymers as sulfomethylated acrylamides as exemplified in u . s . pat . nos . 5 , 120 , 797 and 4 , 801 , 388 , the disclosures of which are hereinafter incorporated by reference into this specification . other commercially available anionic flocculant materials may also be utilized . a preferred class of flocculants for use in this invention includes copolymers of acrylamide and acrylic acid having a mole ratio of acrylamide to acrylic acid of from 99 : 1 to 1 : 99 and preferably 99 : 1 to 50 : 50 . most preferably , the mole ratio of acrylamide to acrylic acid will be 95 : 5 to 60 : 40 . an especially preferred flocculant for use in this invention has a mole ratio of acrylamide to acrylic acid of about 70 : 30 . the flocculants of this invention may be prepared in solution form , or in water - in - oil emulsion form . the preparation of such flocculants is known to those skilled in the art . the flocculants generally have molecular weights ranging from as low as 1 , 000 , 000 to 20 , 000 , 000 or higher . preferred flocculants have a molecular weight of about 10 , 000 , 000 . the upper weight of molecular weight is not critical so long as the polymer is water soluble or dispersible . the flocculant is believed to cause the aggregation of the neutralized colloidal particles which are suspended in the tailings suspension . aggregation is the result of either entrapping agents ( i . e ., inorganic flocculants ) or bonding agents ( i . e ., organic flocculants ) bringing the neutralized particles together . the coagulants and flocculants can be added at several points along the feed line to the thickener and in different sequences . the flocculants may be added either prior to or subsequent to coagulant addition . a typical thickener is a gravity sedimentation unit which is a cylindrical continuous thickener with mechanical sludge raking arms . the tailings ( i . e ., a solids / liquid dispersion ) enter the thickener at the centerwell . the coagulants and / or flocculants are added at points in the feed line and / or centerwell . the number of addition points , sequence , flocculant , coagulant , etc . are determined by laboratory cylinder tests for each particular application . the flocculated solids settle to the bottom of the thickener . the mechanical arms rake the sludge and it is discharged . the clarified water overflows into a launder surrounding the upper part of the thickener . the copolymer of diallyldimethylammonium chloride and vinyl trialkoxysilane is generally added to the thickener or mechanical filter device at a rate of about 0 . 01 to about 0 . 3 lb / ton of slurry , and preferably 0 . 075 to about 0 . 25 lb / ton . most preferably from about 0 . 1 to 0 . 25 lb of polymer is used per ton of slurry . the amount of coagulant will vary according to the particular stream to be dewatered . flocculant may also be added to the thickener in an effective amount , generally between about 0 . 01 to about 0 . 25 lb / ton of slurry . after treatment of the slurry with sufficient coagulant and optional flocculant , the thickener underflow or refuse ( i . e ., concentrated tailings ) are removed from the bottom of the thickener , while water and / or other liquids are taken out overhead . the water can thereafter be recycled as process water for use in the beneficiation process or disposed of in impoundment ponds . the concentrated tailings or refuse from the thickener can be thereafter disposed of , generally as landfill . in most instances , adding a given amount of flocculant in two or more increments results in better performance than adding the same amount of flocculant in one increment . it is not unusual to be able to reduce the amount of flocculant required by as much as 30 - 40 % by multi - point addition and still achieve the required settling rate . multi - point addition may also provide improved clarity ( i . e ., lower suspended solids ) at a given settling rate . this practice is implemented in a beneficiation plant process by adding the flocculant at different points in the feed line to the thickener . the improvement results from reducing the amount of surface area that the second or third portion of flocculant actually contacts when added to the system , as well as improved distribution of the flocculant . the present invention can best be understood by reference to the following working and comparative examples . a 90 : 10 mole copolymer of diallyldimethylammonium chloride ( dadmac ) and vinyl trimethoxysilane ( vtms ), at 20 % actives , was prepared for use as a coagulant . the following reactants were used to form the hydrophobically modified polyelectrolyte copolymer coagulant : ______________________________________312 . 91 grams diallydimethylammonium chloride dadmac ( a 58 % solution ) 18 . 89 grams vinyl trimethoxysilane ( a 98 % solution ) 200 . 0 grams deionized water1 . 80 grams [ 2 , 2 &# 39 ;- azobis ( 2 - amidinopropane )] dihydrochloride initiator20 . 0 grams sodium chloride446 . 20 final solution water0 . 1 grams versene______________________________________ a 1 . 5l reactor equipped with a mechanical stirrer a thermocouple , nitrogen inlet / outlet tubes , condenser and two syringe pumps was set up . vinyl trimethoxysilane was taken in the first pump set at a delivery rate of 4 . 5 cc / hr . the second pump contained an aqueous solution of 2 , 2 &# 39 ; azobis ( 2 - amidinopropane ) dihydrochloride ( 1 . 2 g in 48 . 8 g di water ), and the pump was set at 12 . 5 cc / hr . the dadmac , sodium chloride , and versene were charged into a polymerization reactor and heated to 52 ° c . the reaction mixture was purged with nitrogen . vtms and initiator - containing pumps were started and the polymerization was allowed to proceed . a thick polymer started forming after about 2 hours . at the end of two and a half hours , the viscosity increased to a point where continued agitation was difficult . 200 ml of deionized water was then added . the reaction continued for a period of 5 hours , and then subjected to a post treatment at 82 ° c . for 5 hours . product phase separated in two days and indicated extensive crosslinking as shown below : ## str1 ## a 99 . 5 / 0 . 5 mole ratio copolymer of diallyldimethylammonium chloride ( dadmac ) and vinyl trimethoxysilane ( vtms ), at 20 % actives , was prepared for use as a coagulant . the following reactants were used to form the hydrophobic polyelectrolyte copolymer coagulant : ______________________________________321 . 13 grams dadmac ( a 62 % solution ) 1 . 00 grams vtms ( a 98 % solution ) 0 . 2 grams versene258 . 8 grams deionized water1 . 20 grams 2 , 2 &# 39 ;- azobis [ 2 ( 2 - imdazolin - 2yl ) propane dihydrochloride initiator61 . 00 grams sodium chloride356 . 87 grams dilution water______________________________________ a batch process was used to prepare the dadmac / vtms copolymer . a reactor similar to the one described in example 1 was used . the dadmac , vtms , versene , sodium chloride and deionized water were charged into a polymerization reactor at a temperature of 58 ° c . thereafter , the initiator ( 0 . 6 grams in 49 . 4 grams deionized water ) was charged into the reactor dropwise via a syringe pump at 12 . 5 cc / hour . a thick polymer started forming after about 1 . 0 hour . at the end of 1 . 5 hours , the mixture was difficult to stir . at this point , deionized water addition was started using a syringe pump set at 70 ml / hour . the reaction continued for a period of 5 . 5 hours . after that , initiator ( 0 . 6 grams in 19 . 4 grams of deionized water ) was added . the reactor was heated to 82 ° c . and held at that temperature for 3 hours . the reaction product was then diluted with 356 . 87 grams of water and stored . reduced specific viscosity and intrinsic viscosity measurements were determined on a 1 % polymer solution in nano 3 ( sodium nitrate ) and found to be 2 . 02 and 1 . 3 dl / gm respectively . a 99 . 0 / 1 . 0 mole ratio dadmac / vtms copolymer was prepared using the procedure of example 2 . 2 . 0 g of vtms and 355 . 07 g of di water were used in place of the amounts in example ii . all other quantities were the same . rsv / iv for a 1 % by weight solution of the polymer in sodium nitrate were 2 . 2 and 1 . 2 dl / g , respectively . this material is hereinafter referred to as example 3 . the gravity dewatering test is a tool for reliably screening products and evaluating application variables for dewatering . results obtained in testing can generally be directly translated to the plant process . the following procedure outlines suggested steps in performing a thorough test program . 1 . an apparatus consisting of a 500 ml graduated cylinder , powder funnel , and plastic collar which retains a filter cloth on the top of the powder funnel , all supported by a ringstand and appropriate clamps was constructed . the filter cloth used was a nylon filterlink ® 400 mesh round orifice cloth of a type similar to that used in commercial practice . 3 . using a spatula , hand mix the slurry to uniformly disperse any coarse solids present . immediately sample and transfer 200 ml of underflow slurry into a 500 ml graduated cylinder . re - mix the underflow slurry prior to filling each new cylinder . 4 . measure in a syringe and set aside the desired amount of coagulant as 1 % solutions . measure and add the desired amount of anionic polymer flocculant stock solution to a 50 or 100 ml graduated cylinder , dilute to a total of 20 ml ( or 10 % of the underflow slurry volume ) with process water , mix thoroughly , and set aside . 5 . invert the 500 ml graduate cylinder containing the 200 ml of underflow slurry 4 times to thoroughly disperse the solids , then immediately add the pre - measured flocculant solution from step 3 , re - stopper the cylinder and invert 4 times . duplicate the mixing motion as closely as possible in each test . 6 . immediately add the pre - measured coagulant solution , re - stopper and invert 2 additional times . 7 . pour the conditioned slurry into the plastic collar section of the test apparatus and immediately start a stopwatch . record the drainage volumes collected every 10 seconds for a time period greater than actual commercial plant process time for gravity drainage . after removing the plastic collar , note the dewatered cake stability and thickness . if the thickness is significantly different from plant conditions , adjust the initial test slurry volume in step 2 accordingly . 8 . repeat testing , adjusting products and dosages to obtain maximum free drainage volumes in the process time allowed . turbidity was measured with a hach ratio / xr turbidimeter . the results of the testing performed at a midwestern mine are tabulated below in table i . the blank is included for comparison purposes to demonstrate that the turbidity of the untreated mineral slurry is very high . the settling rate results indicate comparable settling may be achieved by polymers of the instant invention to settling rates achieved with conventional poly ( dadmac ) treatment . however , the polymers of the instant invention are much more active , as demonstrated by lower dosages utilized . table i__________________________________________________________________________taconite field trial results cationic flocculant dosage dosage ( mls of 0 . 1 % ( mls of 0 . 1 % turbidity settling ratecationic polymer sol &# 39 ; n .) flocculant sol &# 39 ; n .) ( ntu ) ( inches / min ) __________________________________________________________________________none 0 . 00 poly 0 . 45 439 8 . 8 ( acam / aa ). sup . 2latex 0 . 20 poly 0 . 45 173 15 . 0poly ( dadmac ) ( acam / aa ). sup . 2 0 . 20 0 . 45 197 13 . 3 0 . 20 0 . 22 246 7 . 6 0 . 10 0 . 22 392 7 . 6 0 . 06 0 . 15 460 5 . 0 0 . 06 0 . 15 504 4 . 1 0 . 06 0 . 10 618 4 . 5example 3 . sup . 3 0 . 03 poly 0 . 15 778 3 . 8 ( acam / aa ). sup . 2 0 . 04 0 . 15 628 4 . 9 0 . 04 0 . 10 530 3 . 9 0 . 06 0 . 05 411 4 . 4poly ( dadmac ). sup . 1 0 . 8 496 3 . 3 2 241 4 . 7 blank 1832 0 . 8__________________________________________________________________________ . sup . 1 = commercially available dry polymer of polydiallyldimethylammoniu chloride having approximately the same intrinsic viscosity as polymer of example 3 . product is commercially available from nalco chemical company , naperville , illinois . . sup . 2 = the anionic poly ( acam / aa ) with a 70 : 30 molar ratio of acrylamide to acrylic acid . . sup . 3 = 99 : 1 mole ratio of poly ( dadmac / vtms ) synthesized according to th procedure of example 3 . a standard filter test leaf procedure which generates a filter cake whose weight and thickness thereafter are determined was utilized at a southwestern mining facility to obtain the results of table ii . the slurry sample size in each test was 600 mls of mineral slurry with a 30 second form time and a 90 second drying time . the results indicate that the polymer of the instant invention works as well as conventional poly ( dadmac ) treatments , yet at much lower concentrations . table h__________________________________________________________________________copper processing field trial results lb / ton latex lb / ton lb / ton increase poly ( dadmac ) example 3 . sup . 1 poly ( dadmac ). sup . 2 % yield % yield 40 % polymer 20 % polymer 40 % polymer wet dry % weight #/ sq . vs . polysample actives actives actives wt . wt . moisture changes ft ( dadmac ). sup . 2__________________________________________________________________________ # 1 0 0 0 114 . 1 98 . 4 13 . 8 -- 2 . 17 --# 2 0 0 1 82 . 6 72 . 2 12 . 8 & lt ; 20 . 0 %& gt ; 1 . 59 --# 3 0 . 25 0 0 177 . 7 153 . 7 13 . 5 50 % 3 . 39 113 . 0 %# 4 0 . 5 0 0 252 . 7 220 12 . 0 124 % 4 . 85 205 . 00 %# 5 0 . 75 0 0 288 . 7 251 . 6 12 . 8 156 % 5 . 55 249 %# 6 0 0 . 25 0 137 . 7 118 . 4 14 21 2 . 61 64 %# 7 0 0 . 5 0 176 . 7 153 . 7 12 . 9 56 % 3 . 39 113 . 00 %# 8 0 0 . 75 0 246 . 7 216 12 . 4 120 4 . 76 199 % __________________________________________________________________________ . sup . 1 = 99 : 1 mole ratio of poly ( dadmac / vtms ) synthesized according to th procedure of example 3 . . sup . 2 = commercially available dry polymer of polydiallyldimethylammoniu chloride having approximately the same intrinsic viscosity as polymer of example 3 . product is commercially available from nalco chemical company , naperville , illinois . while we have shown and described several embodiments in accordance with our invention , it is to be clearly understood that the same are susceptible to numerous changes apparent to one skilled in the art . therefore , we do not wish to be limited to the details shown and described but intend to show all changes and modifications which come within the scope of the appended claims .	1
referring now to the drawings in detail , fig1 illustrates a somewhat simplified longitudinal section of a typical gamma ray sensor of the axial heat flow type disclosed in prior u . s . pat . no . 4 , 298 , 420 , aforementioned , generally referred to herein by reference numeral 10 . in this type of sensor , which is suitable for a pressurized water reactor installation , an elongated cylindrical body 12 is made of a gamma radiation absorbing material such as stainless steel and is enclosed by a tubular heat sink jacket 14 which is cooled by water inside a guide tube 16 . heat generated within the body 12 in response to absorption of gamma radiation produces radial heat flow except for the axial heat flow pattern occurring within reduced diameter portions 20 of the body . the portions 20 form spaces 22 of high thermal resistance within jacket 14 to produce deviations in heat flow in thermal as well as electrical resistance of the elongated body 12 . by measuring the difference in internal body temperature between a location in portion 20 and a location outside but adjacent to the space 22 , the heat flow rate may be determined which reflects local power generation for the measurement zone within which the space 22 is located . the temperature difference is measured by means of a differential temperature sensing device generally referred to by reference numeral 26 mounted within a central bore 28 formed within the body 12 . in accordance with one embodiment of the present invention , the differential temperature sensing device 26 is of the multiple junction thermocouple type wherein electrical signal producing junctions between dissimilar metals , such as cromel and alumel , are positioned within each measurement zone . the measurement zone includes a hot region substantially coextensive with the space 22 having a predetermined axial length ( 2l ) and two cold regions on either side of the hot region . the four thermocouple junctions associated with each measurement zone are connected in series and consist of a first junction 30 located on one axial side of a second junction 32 which is located midway within the portion 20 . the third junction 34 at the tip of the thermocouple device is located on the other axial side of the junction 32 and spaced therefrom in an axial direction equal to the spacing of the first junction 30 from junction 32 . the fourth junction 36 is axially aligned with the second junction 32 . thus , junctions 32 and 36 are hot junctions for the same hot region of the measurement zone while the junctions 30 and 40 are cold junctions sensing the temperature of the body 12 within cold regions of the measurement zone on both axial sides of the space 22 . heat flow to the heat sink at the axial locations of the thermocouple junctions is often distributed by asymmetrical axial heat flow through the portion 20 of the body 12 because of irregular or intermittent thermal contact in gap 18 resulting , for example , from deposits of foreign matter therein . such asymmetrical heat flow conditions within the measurement zone produces a non - symmetrical temperature gradient as depicted by curve 38 in fig2 wherein the peak temperature at point 40 is offset by an amount ( d ) from the otherwise symmetrical location of the hot junctions 32 and 36 . where a single differential thermocouple device is utilized , the hot junction temperature ( t2 ) and only one cold junction temperature ( t1 ) are sensed to produce a differential temperature signal ( δts ). under the asymmetrical heat flow condition aforementioned , a signal error is therefore introduced as indicated by the following equation derived from the laws of thermal conduction : ## equ1 ## ( w ) is the volumetric heat generation rate , ( a ) is the cross - sectional area of the body and ( k ) is its thermal conductivity constant in the foregoing equation . the expression ( wadl / 2k ) represents the signal error . however , since the double differential thermocouple device 26 associated with the present invention senses temperatures ( t1 and t3 ) through cold junctions 30 and 34 on both sides of the hot junction , a differential temperature signal ( δt ) is obtained because of the series connection of the junctions in accordance with the following expression : ## equ2 ## it will therefore be apparent that the double differential thermocouple device produces a differential temperature signal that is twice the signal strength of a single differential thermocouple device . furthermore , the signal error ( wadl / 2k ) cancels out , so that to enable one to accurately determine the heat flow rate ( w ) from the differential temperature signal ( δt ) whether or not heat flow is symmetrical . it will be apparent that changes in temperature differential signal will lag changes in power in accordance with a thermal response time ( t ) which depends on a thermal time constant ( υ ) as indicated in the following equation : ## equ3 ## where ( θ ) is the change in ( δt ). it was discovered that this response time factor ( υ ) is directly related to the mass of the body 12 in the measurement zone or the axial length of the axial thermal resistance space 22 ( 2l ). this relationship between axial space length and thermal response time is useful in designing a sensor with a rapid thermal response by reducing the axial length of the reduced diameter portion and yet maintain the signal large enough above noise level to measure heat rate . fig3 illustrates schematically , an embodiment in which the advantages of the present invention may be extended by interconnecting in series the thermocouple junctions associated with two adjacent reduced diameter portions of the sensor body for a single measurement zone . each reduced diameter portion is one - half the axial length of the portion 20 for the independent double differential thermocouple type sensor 10 of fig1 . the following chart compares various thermocouple arrangements hereinbefore referred to with respect to the relationships between response time , space length and signal change . ______________________________________ ( θ ) ( t ) ( 2l ) change in response total space signal timetype of thermocouple length ( mm ) ( degrees ) ( seconds ) ______________________________________single differential 8 71 / 2 21 / 2double differential 8 15 21 / 2 ( fig1 ) two double in series 8 ( 4 + 4 ) 71 / 2 3 / 4 ( fig3 ) ______________________________________ fig4 illustrates another type of gamma ray sensor to which the improvement of the present invention may be applied through a thermocouple device having series connected junctions enclosed in a single cable 44 . as shown in fig5 the cable 44 extends through a heat conductive body 46 of the sensor constituting a hot region of the measurement zone . four parallel spaced loop portions of the cable containing four hot junctions are embedded in body 46 while cold junctions at the loop ends are positioned within cold regions of the measurement zone . the same advantages of eliminating signal error because of asymmetrical heat flow and increasing signal strength are applicable to this embodiment . fig6 shows a radial heat flow type of gamma sensor 10 &# 39 ; wherein the heater body 12 &# 39 ; is exposed to coolant throughout its external surface at which a uniform heat sink temperature is established . accordingly , the cold region of the measurement zone is established coextensive with the reduced diameter portion 20 &# 39 ;, while hot regions are formed on both axial sides thereof , as depicted by the temperature gradient curve 38 &# 39 ; in fig7 . a thermocouple device 26 &# 39 ; similar to that shown in fig1 for sensor 10 is utilized for sensor 10 &# 39 ; and is mounted within central bore 28 &# 39 ; of sensor body 12 &# 39 ;. the thermocouple device 26 &# 39 ; has also four signal producing junctions 30 &# 39 ;, 32 &# 39 ;, 34 &# 39 ; and 36 &# 39 ; interconnected in series to produce a signal output of twice the level of a two junction type of thermocouple device . however , no signal error correction is involved herein because there is no axial heat flow pattern subject to asymmetrical heat flow errors as is the case of sensor 10 hereinbefore described . the advantage of utilizing the plural differential thermocouple arrangement for a radial heat flow type of gamma sensor , resides in the increase in the signal output obtained without increasing the mass of the sensor body and the achievement of a faster signal response at a suitable signal level . this is particularly desirable for a boiling water reactor installation utilizing a radial heat flow type of sensor having an intrinsically lower signal level output as compared to an axial heat flow type of sensor . the significance of the present invention is illustrated in fig8 graphically showing signal level vs . signal response time curves determined for a constant heat flow rate . curve 48 represents the signal characteristic obtained from a single double junction thermocouple arrangement heretofore utilized for gamma sensors . at some point 50 on curve 48 , a minimum signal level is determined , below which power measurement accuracy is unreliable . also , point 50 on curve 48 represents the maximum desirable time limit above which signal response is too slow for safety system operation . when utilizing a thermocouple arrangement for the sensor of the type shown in fig6 a signal curve 52 is obtained as shown in fig8 . curve 54 in fig8 represents the signals obtained from a four differential junction pair type of thermocouple such as that shown in fig3 . thus , signal ranges reflected by curves 52 and 54 within the response time limit may be selected above the mimimum signal level by practice of the present invention .	6
the preferred low density polymeric labels are made of polypropylene which is commercially available . the preferred density is 0 . 55 to 0 . 85 , an especially preferred density is 0 . 6 to 0 . 75 , as distinguished from the conventional polypropylene label stock which has a density above 0 . 9 . these materials are sometimes referred to as cavitated , micro voided or foamed polypropylene . other polymers which may be used include polyethylene , polyester , polystyrene , polycarbonate or compatibilized polymer blends . it is preferred to utilize a hydrophilic material in conjunction with the low density polymeric label to allow for more rapid escape of water from the water based adhesive that is placed on the back of the low density polymeric label . hydrophilic materials are selected so that their thickness and modulus of elasticity when applied to a polymer film will result in a polymeric film facestock that will have hydrophilicity , absorbtivity , wet tack and drying properties that will permit the polymer film to be applied to polymeric or glass containers via water based wet labeling techniques on standard paper labeling equipment . the apparatus which is used to apply paper labels is well known to those in the art . the polymeric label substrate with the hydrophilic coating will demonstrate sufficient “ wet tack ” during the label application period and the label drying period to permit containers to be handled and processed . the polymeric film based facestock will provide a label with printability , chemical and dimensional stability , resistance to cracking , tearing , creasing , wrinkling or any other degradation of the sort experienced by paper labels due to physical or environmental extremes . as used herein , the reference to “ a container ” includes a surface of an object made of glass , plastic or metal , such a dishes , toys , beer bottles , building materials and the like . optionally , if a metalized coating of a thin metal film is deposited on the polymeric sheets or rolls , premium quality decorative labels with all of the advantages set forth above will be provided . the hydrophilic component or blends containing the hydrophilic component will be applied in the present invention to the selected polymeric sheet in a continuous or patterned layer to provide the absorptive , wet tack and drying properties that are necessary to enable polymeric sheets to be successfully used as label substrates on polymeric or glass containers when applied with water based wet labeling techniques . the hydrophilic layer which may be applied by either a coating or an extrusion technique has the function of absorbing moisture to activate the layer , thus causing the hydrophilic layer to function as an adhesive without any additional adhesive or to absorb the moisture from an adhesive if used and to pass the moisture thru the hydrophilic layer and micro voided substrate to cause the polymer film to adhere to the glass , metal or plastic container and to set up rapidly and positively . the choice of polymeric substrate for the label film will determine the rigidity , deformability or conformability , regrindability , printability and expansion or contraction characteristics required for application to the selected container without the problems associated with paper labels . the term “ film facestock ” or “ polymeric label substrate ” as used herein should be taken for purposes of the present invention to refer to a monolayer , coextruded , coated or laminated material compatible in terms of rigidity , deformability or conformability , regrindability if a plastic container and expansion or contraction characteristics with the plastic , metal or glass container to be labeled . similarly , the “ hydrophilic layer ” previously mentioned has the properties of wet tack , absorbtivity , drying , sufficient adhesion to the polymeric label substrate and affinity and adhesion to the labeling adhesive if used in the wet or dry form . it is contemplated that selected hydrophilic layers can be wet or remoistened without adhesive for use on a glass or plastic container or a water based adhesive can be used to affix the polymeric label substrate with the hydrophilic layer to the glass or polymeric container . for deformable containers , the adhesive if used , can be selected from those commercially available that are characterized by the ability to form a bond with the container and a hydrophilic layer such that when dry , the strength of the container wall - adhesive interface and the hydrophilic layer - adhesive interface and the cohesive strength of the adhesive itself are all greater than the forces required for deformation of the label . as used herein and in the appended claims , the term “ hydrophilic ” is used to describe materials or mixtures of materials which bind , pass or absorb water . the preferred “ hydrophilic ” materials are those acrylic polymers which bind or absorb water . the especially preferred “ hydrophilic ” material is dp6 - 6006 , a sodium polyacrylate available from ciba specialties . it is also an aspect of the present invention to use crosslinkable ( reactive ) components in the hydrophilic layer that can cure with a catalyst supplied in the hydrophilic layer , rewetting water or adhesive ( if used ) that will promote adhesion to the labeled container along with chemical and moisture resistance . examples of cross - linkable materials include carboxylated synthetic resins . the catalyst can also be added to the adhesive which could have reactive components which would cure the adhesive and hydrophilic layer together . examples of crosslinkable components include zirconium salts of mineral acids , polyfunctional aziridine , water soluble polyamide - epichlorohydrin material such as polycup 172 , zinc ammonium carbonate and the like which may be used at a level of 0 . 2 - 8 % by weight of the adhesive composition . the coated , extruded or coextruded hydrophilic layers functionality can be defined as a substance capable of combining two surfaces by the formation of a bond whether it is a moist hydrophilic layer to glass or polymer or a dry hydrophilic layer to a wet labeling adhesive which as an intermediate layer that bonds to both the hydrophilic layer and glass or polymer of the container when dry . the use of the proper hydrophilic layer for a given polymeric labeling substrate and container to be labeled will have a direct effect on the speed which the labeling line can be run . when considering the choice of the material which forms the hydrophilic layer , which may be applied by coating , coextrusion or extrusion , one must consider the label substrate , container to be labeled , labeling machinery , water or adhesive application technique and down stream processing requirements such as filling , conveying and packing . generally a thickness of from 0 . 1 to 8 mils of the hydrophilic layer , when dried , may be employed on the polymeric film layer , depending on the particular hydrophilic material that is selected . it is critical to the successful application of a hydrophilic polymeric film label to control how the water or water based adhesive is applied to the hydrophilic layer , how deposition ( weight or thickness ) is controlled and how the resultant combination with the container is pressed together . generally , from 0 . 25 to 6 mils of water or water based adhesive is applied to the hydrophilic layer with 100 % coverage of the label . if a grid or other pattern of adhesive is employed , then the overall amount of adhesive consumed is reduced . if a grid pattern is employed , the hydrophilic layer may be applied to be substantially in register with the adhesive layer . it will generally be possible to reduce the typical amount of adhesive applied to a label when using the hydrophilic layer of the invention to an amount which 20 - 80 % of the amount that is typically employed for affixing paper labels to a surface . the choice of the hydrophilic layer and the type of label substrate and container to be adhered together , as discussed above , the plant processing conditions after labeling , storage requirements and the end use requirements that must be met such as high temperature resistance or ice proofness and the choice of an intermediate adhesive layer are important considerations . there are many more specific variables within these considerations all of which influence the formulation of the proper hydrophilic layer and adhesive ( if used ) for a specific application . mechanical adhesion is defined as the bonding between surfaces in which the adhesive holds the parts together by inter - locking action and actual physical penetration . specific adhesion is the bonding between surfaces which are held together by molecular forces wherein the surfaces are non porous and no penetration is possible . these forces are related to the polarity and size of the molecules and the initial action in obtaining a bond when the hydrophilic surface is wet and a bond develops through molecular forces . in mechanical as well as specific adhesion , the optional hydrophilic layer with optional intermediate adhesive layer must “ wet ” both surfaces completely or weak bonded areas will develop as it dries or “ sets ” resulting in a poor bond . not only is wetting of the surfaces critical , penetration is also important . penetration is important since most combinations of surfaces to be adhered together involve at least one porous or absorptive surface which controls the “ setting ” characteristics . to facilitate specific adhesion , wetting of the surface and penetration are critical for the hydrophilic layer or hydrophilic layer with intermediate adhesive which must be in a fluid state . for purposes of this invention , this is accomplished by applying water or water based adhesive to the selected hydrophilic layer which when applied to the container to be labeled brings the hydrophilic layer and container wall into intimate molecular contact . by using a wet hydrophilic layer or intermediate adhesive which also wets and penetrates the hydrophilic layer as well as the container surface , a fluid region is created that flows to cover the surface as completely as possible . this is critical to the invention where even an apparently smooth surface in reality is composed of a random network of hills and valleys . when the hydrophilic layer is in the wet condition , with or without adhesive , it serves as a wetting bridge to promote adhesion . various commercially available adhesives can be utilized to provide good adhesion of polymeric film layers to a plastic , metal or glass surface . these materials include starch based adhesives or casein based adhesives now predominantly used for glass applications since they do not bond well to plastic or metal . specific adhesives that may be employed include eva based materials which have free carboxyl groups , converted starch solutions , pva based adhesives , casein based adhesives , synthetic resin dispersions for metal or plastic containers or blends of synthetic and starch based products and the like . it is clear that one specific hydrophilic layer may not fit all applications but hydrophilic layers can be tailored to particular applications based on the conditions and requirements for wet pml labeling of polymeric substrates . if an adhesion promoting tie layer or primer is employed to promote hydrophilic layer adhesion or adhesive adhesion , materials such as maleic anhydride , ethyl acrylic acid , carboxylated polyurethane resin and the like may be employed at levels of 0 . 1 - 3 lb / 3 , 000 sq . ft . if a cross - linking catalyst is added to the adhesion promoting tie layer , the ratio of catalyst to adhesion promoting tie layer may be an amount that is sufficient to cure the adhesion promoting tie layer . an excess of the catalyst , i . e . 5 - 25 % in excess of the amount of the catalyst that is required to cure the adhesion promoting tie layer may be used to provide a portion of the catalyst at the interface of the adhesion tie promoter and the hydrophilic layer to increase the moisture resistance of the hydrophilic layer without decreasing the moisture absorbtivity of the hydrophilic layer . additionally , excess catalyst can also be available to aid in curing of the adhesive . plasticizers such as n - di - octylphthalate may be employed at a level of 0 . 5 - 3 % by weight of the adhesive composition to prevent the polymeric film label from losing flexibility . the slip aids and anti - blocking compounds prevent excessive friction between the hydrophilic layer and the adhesive layer and also control the effect of ambient moisture levels which may tend to interfere with the operation of high speed automated machinery which is used for apply labels . these materials may be used at a level of 0 . 5 - 3 % by weight of the hydrophilic composition or may be coextruded or coated with the low density film and include materials such as microcrystalline wax emulsions , erucamide disp , polytetrafluoroethylene compositions , silicone beads , modified silicone solutions , parafin wax emulsions , high melting polypropylene emulsions , carnauba wax emulsions , oxidized ethylene / eva compositions , micronized polyethylene wax / ptfe emulsions , micronized polypropylene , micronized fluorocarbons such as ptfe ( teflon ), micronized polyethylene , silica and talc . if an antistatic agent is employed , it may be present at a level of 0 . 5 - 3 % by weight of the hydrophilic formulation . these materials include quaternary ammonium salts such as ethaquad c12 , sulfonated styrene maleic anhydride , sulfonated polystyrene , sulfonated vinyl toluene maleic anhydride conductive polymers and organo modified silicones such as silwet 77 . protective coatings may be used to protect the exposed polymer film of the label when applied at a level of 0 . 25 - 4 lbs / 3000 sq . ft . using conventional application techniques . these materials include styrenated acrylics such as oc1043 from o . c . adhesives , inc ., flexon release varnish from manders - premier . if desired a humectant may be added to the hydrophilic layer at a level of 0 . 5 - 3 % to provide curl resistance and to impart layflat properties to the polymeric film labels . these humectants include urea , polyethylene glycols ( such as peg400 ), polyvinyl alcohol , glycerine and the like . 2 . 2 mil white oriented polypropylene ( opp ) product code opalyte from mobil chemical with a nominal density of 0 . 62 was coated at 4 lb ./ 3000 sq . ft . dry with a 50 % solids water based solution . the solution consisted of a mixture of 50 parts dry of dextrin 2723625 from findley adhesives and dextrin compatible polyvinyl acetate homopolymer emulsion binder resin 25 - 1072 from national starch and chemical . the coated substrate was printed and cut into individual patch labels which were applied to high density polyethylene containers on a high speed water based labeler using water based resin - starch adhesive oc363 - 20 from oc adhesives corp . at a deposition of 1 . 5 dry mils in a corn row pattern . there was sufficient wet tack to prevent label swimming immediately after labeling through conveying and bulk packing . the labeled containers dried sufficiently after 8 hours to ship bulk packed to a filling plant 20 miles away by truck where they were conveyed through a filling system and packed in cases . when it was attempted to remove the labels after 3 days , the bond of the label was stronger than the cohesive strength of the cavitated layer of film which fractured and left a thin layer of voided opp over 55 % of the labeled area of the container . it was noted that the adhesive had penetrated the cellular structure of the voided opp because the tack of the adhesive could be felt on top of the fractured area . nominal 3 mil white oriented polypropylene ( opp ) product code iml - 333 from applied extrusion technologies , with a density of 0 . 7 was coated at 2 lb ./ 3000 sq . ft . with a 40 % solids water based solution . the solution consisted of a mixture of asp400p clay from engelhard industries and dp6 - 6066 sodium polyacrylate binder polymer as a hydrophilic layer in the dry ratio of 2 : 1 clay to binder . the clay binder mixture was catalyzed with cx - 100 polyfunctional aziridine at a level of 0 . 25 % based on the total dry weight of the hydrophilic layer to promote adhesion of the coating to the substrate and improve water resistance without eliminating the hydrophilic nature of the coating . the coated substrate was printed and coated with a protective over lacquer prior to being cut into individual patch labels which were applied to coextruded polyester based containers on a high speed water based labeler using water based starch - resin adhesive 10 - 7302 from henkel adhesives at a deposition of 2 dry mils in a corn row pattern . there was sufficient wet tack to prevent label swimming immediately after labeling through packing . the labeled containers dried sufficiently at the edges after 3 days at room temperature to permit handling and use . when it was attempted to remove the labels , the bond of the label was stronger than the cohesive strength of the cavitated layer of film which fractured and left a thin layer of voided opp over 70 % of the labeled area of the container . a laminate was made which consisted cavitated polypropylene of trade name ( wtl a 2 mil cavitated oriented polypropylene ( opp ) from applied extrusion technologies with a density of 0 . 7 ) was permanently adhered to the underside of a 0 . 48 mil metalized polyethylene terephthalate from advanced web products . the composite structure was assembled using a urethane - acrylic laminating adhesive ( as284 - 16 from adhesion systems inc .) applied at 1 . 5 lb ./ 3000 sq . ft . and 2 % of cx - 100 aziridine cross - linker from zeneca resins using conventional laminating techniques . the opp side of the laminate was primed with a reactive primer consisting of a carboxylated polyurethane resin sancure 1301 from sancure industries that was catalyzed with excess ( 5 % wet on wet ) cx - 100 polyfunctional aziridine from zeneca resins at a deposition of 0 . 1 - 0 . 2 lb ./ 3000 sq . ft . a coating at 2 dry lb ./ 3000 sq . ft . was applied over the primed surface from a 40 % solids water based solution . the solution consisted of a mixture of asp400p clay from engelhard industries and dp6 - 6066 sodium polyacrylate binder polymer in the dry ratio of 1 . 5 : 1 clay to binder . a portion of the excess aziridine in the primer is available on the surface of the cured primer to react with active sites in the dp6 - 6066 / clay matrix ( hydrophilic layer ) to promote adhesion of the coating to the substrate and improve water resistance without eliminating the hydrophilic nature of the coating . the coated substrate was printed and cut into individual patch labels which were applied to glass containers on a high speed water based labeler using water based adhesive 10 - 7026 from henkel adhesives at a deposition of 3 dry mils in a corn row pattern . there was sufficient wet tack to prevent label swimming immediately after labeling through packing . the labeled containers dried sufficiently at the edges after 1 day at room temperature or 3 days in cold storage to permit handling and use . when it was attempted to remove the labels , the bond of the label was stronger than the cohesive strength of the cavitated layer of film which fractured and left a thin layer of voided opp over 75 % of the labeled area of the container . in areas where the metalized pet could be separated from the opp , it was noticed that the adhesive had penetrated the cellular structure of the voided opp . this was noticed because the moist surface and wet tack of the adhesive drying through the cellular structure could be felt on top of the opp fractured area . a cavitated polypropylene film from applied extrusion technologies , ( iml 333 ) with a density of 0 . 7 was coated on one side of the film with clay filled acrylic resin at a ratio of 3 parts clay to 1 part resin ( pd959 - 400 from process resources corp .) at a coating level 1 . 5 lb / 3 , 000 sq . ft . using 2 % cx - 100 aziridine as a cross - linker . the film is printed with label indicia on the uncoated side and patch labels were cut and applied to glass bottles using a water based starch - resin adhesive with zinc cross - linker ( as692 - 1 from adhesion systems , inc .). after two weeks , it was determined that the labels were fully dried and adherent to the glass bottles .	2
the practice of the techniques described herein may employ , unless otherwise indicated , conventional techniques and descriptions of organic chemistry , polymer technology , molecular biology ( including recombinant techniques ), cell biology , biochemistry , and sequencing technology , which are within the skill of those who practice in the art . such conventional techniques include polymer array synthesis , hybridization and ligation of polynucleotides , and detection of hybridization using a label . specific illustrations of suitable techniques can be had by reference to the examples herein . however , other equivalent conventional procedures can , of course , also be used . such conventional techniques and descriptions can be found in standard laboratory manuals such as green , et al ., eds . ( 1999 ), genome analysis : a laboratory manual series ( vols . i - iv ); weiner , gabriel , stephens , eds . ( 2007 ), genetic variation : a laboratory manual ; dieffenbach , dveksler , eds . ( 2003 ), pcr primer : a laboratory manual ; bowtell and sambrook ( 2003 ), dna microarrays : a molecular cloning manual ; mount ( 2004 ), bioinformatics : sequence and genome analysis ; sambrook and russell ( 2006 ), condensed protocols from molecular cloning : a laboratory manual ; and sambrook and russell ( 2002 ), molecular cloning : a laboratory manual ( all from cold spring harbor laboratory press ); stryer , l . ( 1995 ) biochemistry ( 4th ed .) w . h . freeman , new york n . y . ; gait , “ oligonucleotide synthesis : a practical approach ” 1984 , irl press , london ; nelson and cox ( 2000 ), lehninger , principles of biochemistry 3 rd ed ., w . h . freeman pub ., new york , n . y . ; and berg et al . ( 2002 ) biochemistry , 5 th ed ., w . h . freeman pub ., new york , n . y ., all of which are herein incorporated in their entirety by reference for all purposes . note that as used herein and in the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include plural referents unless the context clearly dictates otherwise . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . all publications mentioned herein are incorporated by reference for the purpose of describing and disclosing devices , formulations and methodologies that may be used in connection with the presently described invention . where a range of values is provided , it is understood that each intervening value , between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention . the upper and lower limits of these smaller ranges may independently be included in the smaller ranges , and are also encompassed within the invention , subject to any specifically excluded limit in the stated range . where the stated range includes one or both of the limits , ranges excluding either both of those included limits are also included in the invention . in the following description , numerous specific details are set forth to provide a more thorough understanding of the present invention . however , it will be apparent to one of skill in the art that the present invention may be practiced without one or more of these specific details . in other instances , well - known features and procedures well known to those skilled in the art have not been described in order to avoid obscuring the invention . the present invention is drawn to measuring the level of expression of fel d 1 from cat saliva . the methods of the invention are noninvasive and allow for accurate measurement of fel d 1 expression by measuring mrna levels , most preferably through reverse transcription of the mrna into cdna , then quantifying the cdnas using qpcr , dpcr or next generation ( massively parallel ) sequencing . to date , an elisa assay has been developed to measure fel d 1 protein directly ; however , the elisa assay requires administration of a salivant to the cat to produce the large amount of saliva needed to run the assay . the methods of the present invention require a greatly reduced amount of saliva — as much as 100 - fold less or more — to measure fel d 1 expression . sample collection for the present invention is straightforward . sterile cotton swabs can be used , or , alternatively , saliva collection kits known in the art can be used , where such devices typically comprise a sterile absorbent device or swab or “ sponge ”, and a sterile container in which the device can be placed once it has been used and before sample processing . the methods of the present invention typically are used without first administering a salivant to the cat — instead , the methods of the present invention utilize collection of saliva that is naturally produced by the cat . however , because mrna is used to quantify the expression of the felis domesticus 1 ( fel d 1 ) protein , extreme care needs to be taken to assure that ribonucleases ( rnases ) are avoided . though studies show that saliva has natural stabilizing enzymes that keep mrna intact for up to three months at room temperature ( wong , et al , clinical chemistry , 57 ( 9 ): 1295 - 302 ( 2011 )), rnases are very stable and active enzymes that generally do not require cofactors to function , making rnases difficult to inactivate . because even minute amounts are sufficient to destroy rna , plasticware or glassware should never be used without first eliminating possible rnase contamination . that is , great care should be taken to avoid inadvertently introducing rnases into the rna sample during or after the isolation procedure . in order to create and maintain an rnase - free environment , precautions should be taken . for example , use of sterile , disposable polypropylene tubes is recommended , and glassware , e . g ., should be cleaned with a detergent , thoroughly rinsed , and oven baked at 240 ° c . for four or more hours . additionally , gloves , a lab coat , sterile face mask and goggles should be worn , and preferably , all prep work should be performed in an area that has been scrubbed down and preferably is dedicated to working with rna . the present methods are drawn to collection of saliva and are noninvasive ; however , alternative methods may employ sample collection from the sebaceous glands of the cat . mrna can be isolated by any one of many methods known in the art . for example , poly ( a )- rna preparation can be accomplished using cellulose - bound oligo - dt , but several other reagents have been developed , e . g ., streptavidin - coupled magnetic beads used in combination with biotinylated oligo - dt or oligo - dt - coupled polystyrene - latex beads . the oligo - dt / carrier combinations are available separately from several manufacturers ; however , one may find it more convenient to use a kit which has the advantage of containing most of the necessary reagents pre - packaged in rnase - free quality , e . g ., polyattract ® from promega , polya spin ™ from new england biolabs or oligotex ™ mrna kit from qiagen . alternatively , one can simply treat the sample with rnase - free dnase to eliminate the dna in the sample , thereby enriching the sample for rna . rt - pcr ( reverse transcription pcr ) is used to clone expressed genes by reverse transcribing mrna into its dna complement through the use of the enzyme reverse transcriptase . subsequently , the newly synthesized cdna is quantified using qpcr , dpcr or next generation ( aka massively parallel ) sequencing . the quantification of mrna using rt - pcr can be achieved as either a one - step or a two - step reaction . the difference between the two approaches lies in the number of tubes used when performing the reverse transcription step and the subsequent pcr amplification step . in the one - step approach , the entire reaction from cdna synthesis to qpcr or dpcr amplification occurs in a single tube . in contrast , the two - step reaction requires that the reverse transcriptase reaction and qpcr or dpcr amplification be performed in separate tubes . the one - step approach is thought to minimize experimental variation by containing all of the enzymatic reactions in a single environment . one method for quantifying the cdna resulting from the reverse transcription procedure in a sample is use of quantitative pcr or qpcr . qpcr follows the general principle of the polymerase chain reaction ; the key feature of qpcr being that amplified dna is detected as the reaction progresses in real time as opposed to standard pcr , where amplified dna is detected only after the final reaction cycle . two common methods for detection of products in real - time pcr are the use of non - specific fluorescent dyes that intercalate with any double - stranded dna , and the use of sequence - specific dna primers consisting of oligonucleotides that are labeled with a fluorescent reporter that permits detection only after hybridization of the primer with its complementary dna target . qpcr typically is run in a real - time pcr instrument , where after each cycle levels of fluorescence are measured with a detector . the detection or reporter dye fluoresces only when bound to double - stranded dna , that is , the pcr product and can be detected only when a threshold of pcr product has been produced . the earlier the cycle in which pcr product is detected , the more cdna — hence mrna — there is in the sample . a low ct value correlates with detectable pcr product at an early cycle , and a large ct value correlates with detectible pcr products at a later cycle . the concentration of the qpcr product can then be determined , e . g ., with reference to a standard dilution or concentration can be relative to other samples . an alternative method for quantifying cdna in a sample is digital pcr or dpcr . with dpcr , the cdna sample is partitioned so that individual nucleic acid molecules within the sample are localized in separate small volumes , such as in micro - well plates , capillaries , a phase emulsion , or in arrays of very small - volume chambers , typically in a dilution of only one molecule in every two chambers . as a result , each small volume will contain one or no molecules , resulting in a positive or negative pcr reaction , respectively . the separation of the nucleic acids allows for counting of individual molecules , resulting in a more reliable and sensitive measurement of nucleic acids than can be obtained by standard pcr or by qpcr , as amplification bias is effectively eliminated . after amplification , the nucleic acids are quantified by counting the number of locations that contain a pcr end - product ; for example , by using differently - labeled oligonucleotide probes ( see , e . g ., vogelstein and kinzler , pnas usa , 96 : 9236 - 41 ( 1999 )). a third method for quantifying the cdna in a sample is next generation sequencing ( ngs ), also known as massively parallel sequencing ( mps ), which also allows for single molecule counting , and thus increased accuracy . current ngs methods and systems that allow for single molecule counting include pyrosequencing , as commercialized by 454 life sciences ; sequencing by ligation , as commercialized in the solid ™ technology , by life technology , inc ., carlsbad , calif . ; sequencing - by - synthesis methods using modified nucleotides , as commercialized in truseq ™ and hiseq ™ technology by illumina , inc ., san diego , calif . ; pacbio rs by pacific biosciences of california , inc ., menlo park , calif . ; sequencing by ion detection technologies , as commercialized by ion torrent , inc ., south san francisco , calif . ; and sequencing of dna nanoballs , commercialized by complete genomics , inc ., mountain view , calif . it should be noted that many techniques for sample collection , sample processing , mrna isolation or enrichment and nucleic acid quantification are known in the art , and the present invention should not be limited by the exemplary methods mentioned above , or in the examples , below . the following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention , and are not intended to limit the scope of what the inventors regard as their invention , nor are they intended to represent or imply that the experiments below are all of or the only experiments performed . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive . efforts have been made to ensure accuracy with respect to numbers used ( e . g ., amounts , temperature , etc .) but some experimental errors and deviations should be accounted for . unless indicated otherwise , parts are parts by weight , molecular weight is weight average molecular weight , temperature is in degrees centigrade , and pressure is at or near atmospheric . saliva was obtained from adult cats using an rnase free technique with sterile gloves . cats were gently wrapped in blankets , containing their bodies while exposing their heads . a sterile buccal swab was inserted into the cat &# 39 ; s mouth and gently brushed against each of the cat &# 39 ; s four cheek pouches in a circular motion . the buccal swab was then inserted under the tongue , contacting all salivary glands possible . the buccal swab was then inserted into an rnase free 1 . 7 ml microcentrifuge tube and cut at the base of the cotton tip with scissors sterilized with ethanol . the tube containing the swab was then labeled . studies show that saliva has natural stabilizing enzymes that keep mrna intact for up to three months at room temperature , but samples were refrigerated to inhibit the growth of bacteria until transported to the lab ( wong , et al , clinical chemistry , 57 ( 9 ): 1295 - 302 ( 2011 )). in order to acquire a large enough sample , each cat was swabbed two times to obtain a sufficient starting volume of saliva . the swabbing process is the extent of cat participation in the methods of the invention , and the process itself took under a minute . the swabs were centrifuged at 8 , 000 × g for one minute and then carefully inverted with two sets of sterile tweezers and replaced in the microcentrifuge tubes . the tweezers were sterilized with 70 % ethanol between inversions among samples of different test subjects . once the swabs were inverted , the samples were centrifuged again at 8 , 000 × g for an additional minute to pull remaining saliva out of the cotton swab . the swabs were then discarded , and the supernatant in the microcentrifuge tube was centrifuged briefly . anywhere from 30 μl to 200 μl of feline whole saliva was collected depending on the cat &# 39 ; s mouth size and varying production of saliva . primers were created using ncbi and idt ( integrated dna technologies ) online databases and services . the following primers were used : immediately after the pooling of samples , preparations for reverse transcription were made . the resulting cdna was then used as a template for qpcr . throughout the procedure , rnase free techniques were used . a lab coat , goggles , and gloves were worn for the duration of the experiment and rnase - zap was utilized to clean surfaces , pipets , and gloves throughout experimentation . to prepare for reverse transcription , 10 mm dntp , edta , 10 × buffer , 5 × buffer , and 0 . 1 m dtt ( all from qiagen ) were taken out of the − 20 ° c . freezer and set on the bench to thaw . when the reagents were fully thawed , each was vortexed , centrifuged , and put on ice . the primers for the genes of interest ( fel d 1 - 2 , feline gapdh , and / or feline rps7 ) were also taken from the freezer and set to thaw . the enzymes rnase out ™ ( life technologies , inc . ), superscript iii ® ( ssiii ) ( life technologies , inc . ), and dnase out ™ ( life techologies , inc .) were left in the freezer until needed . 200 μl rnase - free tubes were clearly labeled with the rna sample id ( the cat ), the target gene , negative or positive , and the date . the negative reverse transcription control tubes did not receive the ssiii . a negative and positive control reaction was run for each gene for each sample . two genes were tested , so each cat required a feline gapdh or rps7 negative and positive reaction , as well as a fel d 1 - 2 negative and positive reaction . when the primers were fully thawed , each was vortexed and centrifuged three times . then 5 μl forward and 5 μl reverse primers were added into a 1 . 7 ml microcentrifuge tube . the primer stock was 100 mm concentration , and the inner primer solution used for reverse transcription was 50 mm . if more inner primer solution was needed for a larger sample size , 5 μl more of both forward and reverse primers were added in equal parts until desired volume was obtained . the primer stock was then returned to the freezer and the inner primers were vortexed vigorously and centrifuged three times . the primers were then set on ice . the saliva samples were vortexed and centrifuged at & gt ; 4 , 000 × g three times . 12 . 6 μl rnase free water was then added to each 200 μl microcentrifuge tube , then 4 μl of sample was added to the microcentrifuge tubes . a total starting volume of 16 . 6 μl was achieved for each reaction tube . the reactions were then vortexed and centrifuged at & gt ; 4 , 000 × g three times . to each reaction , 1 μl rnase out ™ ( life technologies , inc ), 1 . 6 μl 10 × dnase buffer , and 5 μl dnase out ™ ( life techologies , inc .) were added . the dnase out ™ was added last , and the reactions were quickly pipetted up and down to mix the reaction . a timer was then set for six minutes and the reactions were incubated at room temperature . during incubation , the thermocycler was turned on and the program “ 70 hold ” was selected and set for a volume of 25 μl . immediately after six minutes , 1 . 2 μl 25 mm edta was added to each reaction ( to inhibit the dnase digestion ) and the tube was then flicked to mix . all reactions were then centrifuged & gt ; 4 , 000 × g . the samples were then incubated in the thermocycler at 70 ° c . for five minutes . after incubation the reactions were set on ice for a few minutes to cool and then centrifuged at & gt ; 4 , 000 × g to collect any condensation . the thermocylcer was then reset to “ 70 hold ” once more . 2 μl of inner primer was then added to each sample . feline gapdh or rps7 primer was added to its specified tubes and fel d 1 - 2 was added to its corresponding tubes . 1 μl 10 mm dntp was then added to each reaction , and tubes were then vortexed and centrifuged at & gt ; 4 , 000 × g . samples were incubated once again in the thermocycler for five minutes . reactions were put on ice for several minutes , and then centrifuged once more . while the reactions incubated in the thermoclycler , a mix was made in a 1 . 7 ml microcentrifuge tube . the number of reactions ( plus one extra for pipet error ) were multiplied by 6 μl 5 × rt buffer , 1 μl rnase out , and 1 μl 0 . 1 m dtt . the mix was then vortexed and centrifuged three times . 8 μl of the mix was then added to each reaction . next 1 μl ssiii was added to the positive reactions only . 1 μl of rnase free water was added to negative reactions only to make up for the volume difference . the samples were then vortexed and centrifuged at & gt ; 4 , 000 × g and incubated in the thermocycler under the program “ rt 50 ” ( volume set for 40 μl ). the reactions then incubated for about an hour . in the program “ rt 50 ” incubation temperatures are as follows : 50 ° c . for 50 minutes , 85 ° c . for 5 minutes , and 4 ° c . until samples were removed for further experimentation . the 4 ° c . mode acts as a freezer to preserve the samples . samples were then stored in the − 20 ° c . freezer . the unique aspect of the modified reverse transcription developed in this invention is the low sample volume required for experimentation . only 4 μl of feline saliva is needed for analysis , whereas elisa technology requires hundreds of microliters if not milliliters of starting sample . qpcr is the process where cdna is amplified within the qpcr thermocycler and specific gene expression is quantified using sybr green . cdna was taken from the − 20 ° c . freezer and set on the bench top to thaw . diluted primer mixes ( 10 μl forward primer , 10 μl reverse primer , 80 μl rnase free water , all vortexed and centrifuged three times ) were also set on the bench top to thaw . 200 μl microcentrifuge tubes were labeled with the test subject , gene of interest , negative or positive , and the date . two 1 . 7 ml tubes were labeled as “ fel d 1 mix ” and “ gapdh mix ” or “ rps7 mix ”. once the cdna completely thawed , all samples were centrifuged at & gt ; 4 , 000 × g and vortexed three times . 4 μl of cdna was then pipetted into corresponding tubes according to labels . 36 μl of rnase free water was then added to each sample . cdna was returned to the freezer and the samples were centrifuged at & gt ; 4 , 000 × g and vortexed three times once again . the qpcr primer mixes were then made in the following manner : 5 μl sybr green , 0 . 5 μl primer , and 1 . 5 μl rnase free water . a primer mix was created for each gene of interest multiplying the ingredients by the number of reactions plus one extra . once primer mixes were made , each was centrifuged at & gt ; 4 , 000 × g and vortexed three times . the diluted primers were then returned to the freezer . each sample was tested in triplicate . to begin , 3 μl of rnase free water was pipetted into all water reactions . each gene had two water reactions treated as a control to monitor erroneous amplification of primer dimers . next 3 μl of the corresponding cdna was pipetted into the well plate . then 7 μl of the corresponding primer mix ( fel d 1 primer for fel d 1 reactions and the appropriate housekeeping gene ) was pipetted into all wells including water reactions . the plate was then sealed and set in the qpcr thermocycler . qpcr analysis was run for two hours using sybr green as a fluorescent dye indicator . the entire qpcr experiment took approximately two hours , at which point cycle times and melt temperatures were recorded and graphs were created ( data not shown ). in addition , a melt curve was attached to the end of the amplification cycles to indicate product similarities . the cycle times and melt temperatures were recorded and δδct calculations are done ( data not shown ). amplification plots and melt curve graphs were stored on a flash drive for further use . δδct calculations were used to analyze all data . as all experiments were run in triplicate and therefore produced three ct values , the first step was to average and find the standard deviation for both the positive and negative ct values . this is done for both fel d 1 ( target gene ) and gapdh / rps7 ( the endogenous control / housekeeping gene ). negative controls should always have higher ct values than positive ct samples as larger ct values correlate to lower levels of expression . a table was created recording ct values along with averages and standard deviation values ( data not shown ). this table was then referred to throughout calculations . the next step was to normalize the amount of mrna in the reactions by subtracting the average ct value for gapdh or rps7 from the average ct value of fel d 1 ( 1 ). the standard deviation was calculated by finding the square root of the standard deviations for fel d 1 squared plus gapdh or rps7 squared ( 2 ). this was done for each cat saliva sample tested . this calculation is called the δct calculation as it compares or normalizes the expression of the target gene to the endogenous control gene in preparation to compare multiple cats side by side ( see livak and schmittgen , ( 2001 ), available from doi : 10 . 1000 / meth / 2001 . 1262 ). √{ square root over ( s 2 fel d 1 + s 2 gapdh )} ( 2 ) to compare the expression of fel d 1 amongst multiple cats , a δδct equation was used ( 3 ). this was accomplished by subtracting the “ calibrator ” cat &# 39 ; s δct value from the other cat &# 39 ; s δct value . the calibrator was always the hypoallergenic cat test subject . the standard deviation value used in δδct was the same value used for each δct value . the last mathematical step was calculating the relative quantity ( rq ) value ( 4 ). this calculation shows the fold difference of expression of fel d 1 among multiple cats . a maximum and minimum rq value was also calculated to express the error which is not proportionate due to the exponential nature of ct values . melt curves displayed a graphical representation of the melting temperature of the product of the qpcr reaction ( data not shown ). if the triplicates are aligned , only one product is being amplified . if multiple peaks appear on the graph , more than one product is being amplified or primer dimers are present ( primers binding to themselves ) and the qpcr experiment for that gene is deemed unsuccessful . a 1 . 5 % gel was run with a ladder and the product of qpcr reactions to see if the product size of the primer matched its intended target . the fel d 1 - 2 primer used was supposed to have a product length of 72 bp , and by running a gel with a ladder , this product length was confirmed ( data not shown ). fel d 1 , gapdh , and rps7 were all successfully detected and quantified in feline saliva . in one example , the amplification curve obtained represented the expression of fel d 1 and gapdh . on the x - axis was the cycle time ( ct ). larger cts indicate lower expression levels and smaller cts indicate higher expression levels . on the y - axis was a measurement of fluorescence . in the case of cat subject a , there was more fel d 1 relative to gapdh . each reaction was run in triplicates , with a tight amplification curve indicating a more precise experiment . δδct calculations were processed using the raw data represented in the amplification curves and allowed creation of relative comparisons among cats . as an alternative in some experiments , rps7 was used as an alternative to gapdh as the housekeeping gene . the preceding merely illustrates the principles of the invention . it will be appreciated that those skilled in the art will be able to devise various arrangements which , although not explicitly described or shown herein , embody the principles of the invention and are included within its spirit and scope . furthermore , all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art , and are to be construed as being without limitation to such specifically recited examples and conditions . moreover , all statements herein reciting principles , aspects , and embodiments of the invention as well as specific examples thereof , are intended to encompass both structural and functional equivalents . additionally , it is intended that such equivalents include both currently known equivalents and equivalents developed in the future , i . e ., any elements developed that perform the same function , regardless of structure . the scope of the present invention , therefore , is not intended to be limited to the exemplary embodiments shown and described herein . rather , the scope and spirit of present invention is embodied by the appended claims .	2
referring now to the figures of the drawing in detail , all the data cables 2 which are described below are cables preferably for symmetrical signal transmission in which the signal is transmitted over one line of a line pair , and an inverted signal is transmitted over the other line of a line pair . the data cable 2 is preferably a non - screened data cable 2 , that is to say , it does not have any screening . it has a comparatively simple structure . the data cable 2 in the exemplary embodiments has only a single conductor pair as a transmission core 4 . the conductor pair is composed here of two conductors 6 which are each formed by a line 8 and a conductor insulation 10 which surrounds it concentrically . the two conductors 6 are stranded to one another , that is to say twisted together , with a lay length . the conductor insulation 10 is preferably composed of polypropylene , and the line 8 is , in particular , a stranded conductor . the individual wires of the stranded conductor are embodied , in particular , as copper wires and are preferably tin - plated . as an alternative , the transmission core 4 can be formed by a quad stranded assembly , in particular a so - called star quad , in which two conductors 6 which are located diagonally opposite one another define the conductor pair for the symmetrical data transmission . the four conductors 6 are stranded to one another . the conductors 6 bear with their conductor insulations 10 directly against one another . a filler strand can be arranged in the center in order to ensure the high level of symmetry which is desired for an interference - free signal transmission . overall , a high degree of symmetry with such a non - screened data cable 2 is sought and realized , in order to ensure an interference - free signal transmission . in the first basic variant illustrated in fig1 , the transmission core 4 is first surrounded directly by an intermediate sheath 12 which is in turn surrounded by a foamed outer sheath 14 . the data cable 2 preferably does not have further layers . the intermediate sheath 12 is preferably a solid intermediate sheath 12 . alternatively , it can also be a foamed intermediate sheath 12 . both the intermediate sheath 12 and the outer sheath 14 are preferably applied by way of an extrusion process . the intermediate sheath is composed , for example , of tpe s ( thermoplastic elastomer , styrenic block copolymers ). in the exemplary embodiment , the foamed outer sheath 14 is composed of polypropylene . owing to the foamed embodiment , the outer sheath 14 forms a jacket with a high proportion of air . the degree of foaming is here , in particular , at least approximately 50 %. the outer sheath 14 has a wall thickness w 1 which is in the range from 0 . 2 to 0 . 8 mm and is preferably in the region of 0 . 5 mm . the intermediate sheath 12 has an average wall thickness w 2 which is in the range from 0 . 3 to 1 mm and is in particular approximately 0 . 5 mm . it is preferably somewhat larger than the wall thickness w 1 of the outer sheath 14 . the average wall thickness w 2 is understood here to be the difference between the radii of the transmission core 4 and the outer radius of the intermediate sheath 12 , as is apparent from fig1 . in view of the desired high degree of symmetry , the intermediate sheath 12 surrounds the transmission core 4 strictly concentrically . in this context , during the extrusion process sheath material of the intermediate sheath 12 also penetrates the interstices between the two conductors 6 . the outer sheath 14 is also arranged strictly concentrically . the entire data cable 2 has an outer diameter d 1 which is defined by the outer diameter of the outer sheath 14 . furthermore , the intermediate sheath 12 has a diameter d 2 , and the transmission core has a diameter d 3 . the latter is usually in the range between 1 . 5 and 2 . 2 mm and is in particular approximately 1 . 8 mm . the diameter d 2 of the intermediate sheath 12 is in the range from 2 . 8 to 3 . 4 mm and is preferably approximately 3 mm . the total outer diameter d 1 is approximately 0 . 8 to 2 mm and in particular approximately 1 mm above that , with the result that overall there is a total outer diameter d 1 of approximately 3 . 6 to 5 . 5 mm and preferably of approximately 4 mm . it is henceforth of particular significance that the diameter d 2 of the intermediate sheath corresponds to a standard outer diameter such as is necessary for standard plugs in such ethernet lines which are used in the field of automobiles . when a plug 16 such as is indicated in a highly simplified form , for example , in fig2 is assembled , firstly only the outer sheath 14 is removed in the end region over , for example , several centimeters and the data cable 2 is only introduced with the intermediate sheath 12 into the plug 16 . for the necessary assembly , the outer sheath 14 is preferably easily separable from the intermediate sheath 12 here . this is achieved , for example , by means of different materials for these two sheaths 12 , 14 and / or by providing a separating layer between these two sheaths 12 , 14 . the data cable 2 which is described in fig1 and 2 provides overall the particular advantage that as a result of the arrangement of the outer sheath 14 with the high proportion of air and the specific dimensioning of the intermediate sheath 12 to the standard measure of 3 mm a data cable 12 which is improved with respect to the signal transmission quality is made available and at the same time it is possible to have recourse to standard assembly elements such as the plug 16 . in particular an input of energy of an interfering source coming from the outside is at least reduced by the outer sheath 14 and the resulting increased dimensioning and surface of the data cable 2 . at the same time , the amount of material required and the additional weight is kept as low as possible by virtue of the foamed outer sheath 14 . the sensitivity with respect to the so - called alien - next is therefore reduced . the embodiment variants which are illustrated in the further figures represent different embodiment variants of a second basic variant in which the jacket with the high proportion of air is arranged directly around the transmission core 4 . in the exemplary embodiment illustrated in fig3 a and 3b , this jacket forms at the same time an outer sheath 18 . the entire data cable 2 is therefore formed merely by the transmission core 4 and the outer sheath 18 thereof . fig3 a also illustrates a four - conductor , starquad cable . it should be understood that the embodiment of fig3 a may also contain two conductors ; at the same time , the embodiment of fig1 may be a starquad cable . the outer sheath 18 is , in particular , a hose - shaped element in the form of a spunbonded fabric 20 which is extruded onto the transmission core 4 . this outer sheath 18 is therefore characterized by individual strands which cross one another and which are therefore embodied , for example , in the form of a grid and enclose free air spaces 22 between them . in this context , a solid or else a foamed hf - compatible plastic is used as the material for the spunbonded fabric 20 . such extruded spunbonded fabrics are known as packing materials . they are produced by two perforated disks which rotate in opposite directions in an extruder . in order to form the structure , in particular two so - called d braiding elements running in opposite directions are bonded to one another at the intersection points . the conductors 6 of the transmission core 4 are basically suitable to be used even without a solid outer sheath . this is exploited by the exemplary embodiment in fig3 a and 3b , since additional protection via a solid outer sheath is not absolutely necessary . at the same time , an improved data transmission owing to relatively low signal attenuation is achieved by virtue of the outer sheath 18 which is embodied as a jacket with a high proportion of air . the dimensions of the data cable 2 are in turn comparable with those according to fig1 . the trans - mission core 4 is here embodied in an identical way and the outer sheath 18 has here a diameter d 2 which corresponds to the diameter d 2 of the intermediate sheath 12 in the embodiment variant of fig1 . the outer sheath 18 according to fig3 a therefore has a diameter d 2 of approximately 3 mm , with the result that the data cable 2 is suitable for standard plugs 16 . the spunbonded fabric 20 forms in total a spacer element . this spunbonded fabric 20 therefore forms a spacer with respect to , for example , adjacent data cables 2 or else ground potentials ( vehicle bodywork ) and other components . as a result of the embodiment of the outer sheath 18 as a spunbonded fabric , material and weight are saved compared to solid outer sheaths . in the further exemplary embodiment according to fig4 a , 4b and 4c , the jacket with a high proportion of air is also additionally surrounded by an , in particular , solid outer sheath 24 . in the embodiment variant according to fig4 a , a foamed intermediate sheath 26 is concentrically applied to the transmission core 4 here before the latter is surrounded by a preferably solid outer sheath 24 . in fig4 b , in order to form the jacket with the high proportion of air a plastic strand 28 is applied which is arranged in a helical shape around the transmission core 4 and therefore keeps the outer sheath 24 at a distance from the transmission core 4 . the intermediate space between the transmission core 4 and the outer sheath 24 is formed by the free air space 22 . as a result of the application of the plastic strand 28 with the opposite lay to the stranding direction of the conductors 6 , the plastic strand 28 is reliably prevented from sagging in an interstice between the conductors 6 . as a result , the desired high degree of symmetry is ensured . subsequently , the outer sheath 24 is connected as a prefabricated hose onto this transmission core 4 which is provided with the plastic strand 28 . overall , this embodiment variant permits a very small usage of material with at the same time a high proportion of air in the jacket . as an alternative to the embodiment of the plastic strand 28 as a spacer element , in a way which is not illustrated in more detail here a hose - like element , similar for example to the spunbonded fabric 20 , is applied around the transmission core 4 . this can be the spunbonded fabric 20 shown in fig3 b or else a mesh or some other hose - like structure with free air spaces 22 . in particular , a so - called c screen as a mesh composed of plastic threads is applied . the outer sheath 24 is also preferably applied in a hose extrusion or semi - hose extrusion here . fig4 c shows an embodiment variant in which individual spacer elements 30 are integrally molded onto the outer sheath 24 so that they extend radially inward . the spacer elements 30 taper here in the direction of the transmission core 4 , with the result that they have a preferably rounded tip , with the result that they make contact with the conductors 6 as far as possible only in a punctiform fashion . in order to form the spacer elements 30 , corresponding protrusions are formed in an extrusion mouthpiece which is used for the extrusion of the outer sheath 24 . these protrusions remain at the identical point during the manufacturing process . at the same time , owing to the stranding the conductor pair rotates , and the rotation of the conductor pair therefore guides said conductor pair precisely in the center of the outer sheath 24 . the conductor pair therefore cannot slip into the gaps in the outer sheath 24 . in order to achieve the highest possible proportion of air , only a small number of spacer elements 30 , in particular at maximum eight and preferably only four spacer elements 30 , are expediently used here . in view of the desired high degree of symmetry , an even number is used here . in terms of manufacturing equipment , this embodiment can be fabricated on conventional extruders , and is defined by a high degree of mechanical stability and good processability , since no additional working steps are necessary for the assembly of a plug 16 . the diameter of the outer sheath 24 preferably corresponds here in turn to the standard diameter of approximately 3 mm . finally , in an alternative embodiment variant , which is not specifically illustrated in more detail , the outer sheath can be embodied as a hollow hose into which the stranded conductor pair is laid in a corrugated shape or zigzag shape . as a result , the transmission core 4 bears against the outer sheath only at the apex points of the recurring deformation . in the embodiment variants described here , an hf - compatible material is selected for the respective jacket . in the embodiment variants with the formed sheath , gas or air is introduced as virtual occlusions through either chemical or physical foaming processes . in particular , in the embodiment variant in fig1 , the foamed outer sheath 14 has at least also a thin skin layer to counteract mechanical stresses . this thin skin layer is sealed . in order to manufacture the foamed sheath , an extrusion line with the possibility of physical foaming or a sheath material which is provided with a blowing agent is used for the extrusion . the data cable 2 which is described here is used , for example with further cables or lines in a common cable harness , in a motor vehicle as part of the on - board power system . the following is a summary list of reference numerals and the corresponding structure used in the above description of the invention :	7
fig1 is a series of histograms showing the reactivity of anti - b1 and anti - b5 monoclonal antibody to splenic b - cells activated with anti - ig antibody ; fig2 is a pair of histograms showing the reactivity of anti - b1 and anti - b5 monoclonal antibody to splenic b - cells before ( a ) and after activation with anti - ig antibody ( b ); fig3 is a series of histograms showing the reactivity of anti - b1 and anti - b5 monoclonal antibody to splenic b - cells unactivated ( a ) and activated with anti - ig antibody ( b ), and unactivated monocytes ( c ); and fig4 is an sds - page characterization of labeled cell surface proteins immunoprecipitated with anti - b5 monoclonal antibody . normal human splenic b - lymphocytes were cultured at 1 . 5 × 10 6 cells / ml in rpmi 1640 supplemented with 10 % fcs , 2 mm glutamine , 1 mm sodium pyruvate in tissue culture flasks for 1 , 3 , and 6 days with four different stimuli . ( 1 ) pokeweed mitogen ( pwm ): at a final concentration of 1 : 300 . for days , 1 , 3 , and 6 whole splenic mononuclear cells were used . ( 2 ) anti - ig : affinity purified rabbit anti - human ig was coupled to affigel 702 beads , specificity was checked by testing affigel 702 beads which has been conjugated to bovine serum albumin , anti - b1 , or anti - b2 antibody , none of which showed any b cell stimulation . for the day 1 and day 3 stimulations , anti - ig beads were incubated with highly purified b cells which were obtained by lysing the e rosette negative fraction of splenic mononuclear cells with anti - mo1 , anti - mo2 , anti - t4 , and anti - t8 followed by complement . the day 6 stimulation utilized unfractionated splenic mononuclear cells . ( 3 ) protein a : protein a was used at a final concentration of 10 g / ml . as described above , highly purified b cells were cultured for 1 and 3 days at a concentration of 1 . 5 × 10 6 / ml . the day 6 stimulation utilized unfractionated splenic mononuclear cells . ( 4 ) ebv : the e rosette negative fraction of splenic mononuclear cells were cultured with ebv ( 1 : 4 diluted supernatant from the ebv - producing marmoset cell line b955 ) for 1 , 3 , and 6 days . prior to phenotypic analysis of all activated samples , the cells were harvested and lysed with anti - mo1 , anti - mo2 , anti - t4 , and anti - t8 followed by complement to clear monocytes and t - cells respectively and enrich the b - cell fraction from the samples . a 6 week old female balb / c mouse was immunized i . p . with 5 × 10 6 cryopreserved b cell diffuse histiocytic lymphoma ( dhl ) cells in phosphate - buffered saline ( pbs ). these tumor cells were of b cell origin in that they expressed monoclonal cell surface igm , k , as well as the b cell associated antigens ia , b1 , and b4 . in contrast , these tumor cells were unreactive with monoclonal antibodies directed against the common acute leukemia antigen ( calla ); t cell antigens t3 , t4 , t8 , and t11 ; and the myeloid / monocyte antigens mo1 , mo2 , and my7 . twenty eight days later , the animal was boosted with 5 × 10 6 tumor cells i . v . and somatic cell hybridization was carried out 4 days later by the method of kohler and milstein ( nature , ( 1977 ) 256 : 495 ) with modifications as described in nadler et al ., j . immunol . ( 1980 ) 125 : 570 . mouse splenocytes ( 1 . 5 × 10 8 ) were fused with 30 % polyethylene glycol and dulbecco &# 39 ; s mem with 2 × 10 7 p3 / ns1 / 1 - ag4 - 1 myeloma cells . after fusion , cells were cultured in aminopterin - containing medium at 37 ° in a 5 % co 2 humid atmosphere . ten to 28 days later , approximately 300 macroscopic clones were identified , 125 of which were reactive with the immunizing dhl cells , measured by indirect immunofluorescence . in brief , 0 . 5 to 1 × 10 6 viable washed dhl cells were treated with 100 ul of supernatant from hybridoma cultures exhibiting growth , incubated at 4 ° c . for 30 minutes and washed three times . the cells were then treated with 100 ul of 1 : 50 dilution of goat anti - mouse igg and goat anti - mouse igm conjugated with fluorescein isothiocyanate incubated at 4 ° for 30 minutes , washed three times , analyzed on an epics v cell sorter . the percent positive cells were determined using the easy immuno - program . producer clones were then screened on a panel of fractionated peripheral blood and tumor cells . one hybrid clone , designated anti - b5 was found to react with the immunizing dhl cells , several other b cell dhl cell lines , but was unreactive with fractionated peripheral blood mononuclear cells . hybrid clone anti - b5 was then subcloned three times by limiting dilution and passaged into balb / c mice to produce a malignant ascites . supernatant and ascites anti - b5 were shown to have a similar reactivity pattern by indirect immunofluorescence . the b5 ascites demonstrated reactivity with the immunizing dhl cells to a dilution of 1 / 20 , 000 that diminished to background at 1 / 50 , 000 . the b5 antibody was determined to be of the murine igm isotype . in all subsequent experiments , b5 ascites were used . the anti - b5 - producing hybridoma cell line , designated hybridoma b5 , has been deposited in the american type culture collection , rockville , md , and given atcc accession no . hb 8716 dated feb . 8 , 1985 . as shown in table i , prior to culturing , cells did not express b5 . in the presence of media alone , approximately 10 - 15 % of cells expressed b5 after three days of culture , although the viability of these cells was only 10 - 20 %. when stimulated with protein a , anti - ig antibody or ebv as shown in fig1 ( viability approximately 70 - 80 %) about 10 - 15 % of cells weakly expressed b5 after 1 day , while 65 % of cells expressed the antigen more intensely by 3 days of culture . the level of expression of b5 by day 6 was similar to day 1 , and by day 10 ( in the presence of anti - ig antibody ), b5 antigen expression was again background level . pwm did not appear to induce cells to express b5 as well as anti - ig antibody , ebv , or protein a , with the number of cells being only two - fold over background . table______________________________________expression of b5 and b1 antigens on splenic bcells stimulated in vitro * antigen % positive cells when stimulated in vitroday tested media protein a anti - igg ebv pwm______________________________________0 b1 80 80 80 80 80b5 & lt ; 5 & lt ; 5 & lt ; 5 & lt ; 5 & lt ; 51 b1 74 68 80 84 56b5 6 38 14 12 183 b1 44 78 90 80 69b5 10 43 68 64 256 b1 46 48 57 71 31b5 2 5 16 24 4______________________________________ * one of three experiments showing identical patterns of induction of b5 expression . in order to further demonstrate that b5 was expressed on activated b cells , splenic mononuclear cells enriched for b cells were stimulated for 3 days with anti - ig conjugated to beads . viable cells were harvested and labelled with directly fluoresceinated anti - b1 and directly biotinylated anti - b5 developed with texas - red - avidin , and then evaluated by dual laser flow cytometric analysis . as shown in fig2 panel a unstimulated cells only expressed the b1 antigen and failed to express b5 . after three days in culture with anti - ig , all cells expressing b5 co - expressed the b1 antigen . b5 is expressed on cell lines and tumor cells of b - cell origin . as shown in table 2 , anti - b5 was reactive with cell lines of b lineage including all ebv transformed lymphoblastoid b cell lines , burkitt &# 39 ; s lymphoma lines , four of five dhl lines and the plasma cell leukemia cell line rpmi 8226 . the non - t - cell all line laz 221 , and the cml blast crisis line nalm 1 , both known to be of early neoplastic b cell origin , were unreactive with anti - b5 . no reactivity was found on t - cell lines or an ia + t - cell clone . these results as well as the lack of expression of b5 myeloid cell lines hl - 60 , kg - 1 , u937 , and su - dhl 1 and the erythroid cell line k562 indicate that anti - b5 has restricted reactivity to cells of b cell derivation . table 2__________________________________________________________________________ degree of positivity with monoclonal antibodycell lines line designation b5 b1 b2 b4 k / l ia__________________________________________________________________________ebv lymphoblastoid 156 + +++ + ++ +++ +++ sb ++ +++ + ++ +++ +++ burkitt &# 39 ; s raji ++ +++ ++ ++ +++ +++ ramos +++ +++ 0 + +++ 0 daudi +++ +++ 0 + +++ +++ non - t cell all laz 221 0 0 0 ++ + ( μ ) +++ cml blast crisis nalm - 1 0 + 0 ++ + ( μ ) +++ dhl su - dhl 1 0 0 0 0 0 0 su - dhl 2 + ++ + 0 0 0 0 su - dhl 4 ++ +++ 0 ++ +++ +++ su - dhl 6 ++ +++ 0 ++ +++ +++ su - dhl 8 + 0 0 ++ + +++ myeloma rpmi 8226 +++ 0 ++ 0 0 +++ mecar 0 ++ 0 ++ 0 +++ t - all hsb 0 0 0 0 0 0 cem 0 0 0 0 0 0ia + t cell el 156 0 0 0 0 0 +++ myeloid hl - 60 0 0 0 0 0 0 kg - 1 0 0 0 0 0 ++ u 937 0 0 0 0 0 0erythroid k 562 0 0 0 0 0 0__________________________________________________________________________ . sup . a degree of positivity was qualitatively assessed by flow cytometry . 0 , no detectable reactivity over background ; +, designated weak to moderate ( b5 on day 1 , fig2 ); ++, designated strong ( b5 on day 3 , fig2 ); +++, strongest reactivity ( b1 on day 3 , fig2 ). the reactivity of anti - b5 with a variety of b - cell malignancies was next investigated ( table 3 ). this series of neoplasms represent stages of normal b cell differentiation . all of the non - t - cell acute lymphoblastic leukemias ( all ) tested were of b - cell origin by expression of ia and b4 . none of these early neoplastic b - cells expressed b5 . about half of the b cell chronic lymphocytic leukemias ( cll ) and dhls examined , expressed b5 , with a smaller percentage of poorly differentiated lymphocytic lymphomas ( pdl ) expressing the antigen . with the lack of expression of b5 on the waldenstrom &# 39 ; s macroglobulinemia cells and myelomas examined , the expression of b5 antigen was limited to cells which correspond to the mid stages of normal b cell differentiation . cells from patients with t cell derived all , cll , and t cell non - hodgkin &# 39 ; s lymphoma , including lymphoblastic lymphoma and dhl were unreactive with anti - b5 . the b5 antigen was also not expressed on cells from patients with acute myeloblastic leukemia ( aml ). these observations confirm the b cell specificity of b5 and indicate that b5 is expressed on populations of b lymphocytes in the mid stages of normal b cell differentiation . table 3______________________________________ # of patients reactive with # of patient monoclonal antibodydisease samples b5 b4 b1 ia t3______________________________________b cellnon - t all 21 0 21 8 21 0b - cll 24 12 24 24 24 0dhl 18 8 18 18 18 0pdl - n 7 5 7 7 7 0pdl - d 8 0 8 8 8 0waldenstrom &# 39 ; s 2 0 2 2 2 0myeloma 2 0 0 0 0 0t cellall 8 0 0 0 nd 8cll 3 0 0 0 0 3nhl * 5 0 0 0 2 5myeloidaml / ammol 12 0 0 0 12 0______________________________________ * waldenstrom &# 39 ; s macroglobulinemia * includes lymphoblastic lymphoma and t cell dhl the reactivity of anti - b5 to unactivated fractionated peripheral blood cells , and normal lymphoid and myeloid tissues was examined . less than 1 % of peripheral blood mononuclear cells ( pbmc ) isolated by ficoll - hypaque density sedimentation expressed the antigen , ( table 4 ) whereas they demonstrated significant reactivity with monoclonal antibodies directed against b - cell , t - cell , and monocyte antigens . table 4__________________________________________________________________________reactivity of anti - b5 with resting lymphoidand myeloid cells % of cells expressing antigencell # of tests b5 b1 t3 mol ia__________________________________________________________________________peripheral bloodpbmc 4 1 ± 1 5 ± 2 50 ± 5 31 ± 8 18 ± 4e + ( t ) 6 1 ± 1 1 ± 1 90 ± 5 8 ± 3 2 ± 1e - nonadherant ( b ) 3 1 ± 1 22 ± 4 2 ± 1 24 ± 3 42 ± 5monocyte 3 1 ± 1 2 ± 1 9 ± 3 54 ± 6 71 ± 5granulocyte 5 0 ± 1 1 ± 1 0 ± 1 88 ± 10 1 ± 1rbc 3 0 ± 1 0 ± 1 0 ± 1 0 ± 0 0 ± 0platelet 3 0 ± 1 0 ± 1 0 ± 1 0 ± 1 0 ± 1__________________________________________________________________________ t - cells isolated by e rosetting similarly lacked detectable b5 expression . the e rosette negative fraction containing b - cells , monocytes , and null cells was further enriched for b - cells by adherence . the b - cell - enriched pbmc were stained with directly fluoresceinated anti - b1 and directly biotin - conjugated anti - b5 developed with avidin texas red . utilizing dual laser flow cytometic analysis , cells were examined as shown in fig3 before ( panel a ) and after 3 days of stimulation with anti - ig antibody ( panel b ). as seen in panel a very few dual labelled cells were observed , whereas in panel b clearly demonstrated b1 + b5 + cells could be detected . in addition , monocytes were stained with directly fluoresceinated anti - mo1 and directly biotin - conjugated anti - b5 developed with avidin texas red ( panel c ) and similarly analyzed . adherent monocytes were noted to weakly express b5 on 10 - 20 % of cells analyzed . however , when monocytes were incubated in 10 % human serum for 1 hour prior to phenotyping , no cells appeared to co - express b5 and mo1 . similarly granulocytes , rbc and platelet preparations lacked reactivity with anti - b5 . the percentage of b5 bearing ficoll - hypaque mononuclear cells within lymphoid tissues is enumerated in table 5 . table 5______________________________________reactivity of anti - b5 with lymphoid tissues % of cells reactive with monoclonal antibodytissue # of tests b5 b1______________________________________lymph node 4 6 ± 2 28 ± 8spleen ( whole ) 7 2 ± 1 45 ± 5spleen ( e -) 3 5 ± 3 72 ± 12tonsil 3 4 ± 2 54 ± 9thymus 3 0 ± 1 0 ± 1bone marrow 3 1 ± 1 6 ± 3______________________________________ mononuclear cells isolated from normal lymph node , tonsil , and spleen were weakly reactive with anti - b5 , with less than 6 % of cells analyzed being positive . the e - population of normal spleen of which 70 - 80 % of cells express the b1 antigen , similarly weakly expressed b5 . mononuclear cells from thymus and bone marrow were unreactive with anti - b5 . reactivity of anti - b5 monoclonal antibody to activated fractionated peripheral blood cells was also determined . b - cells were prepared by e rosetting , adherence , and then lysis of the remaining cells with anti - t - cell ( t4 and t8 ) and anti - monocyte ( mo1 and mo2 ) antibodies and complement . this b cell enriched fraction ( 50 % b1 +) was cultured in the presence of anti - ig antibody conjugated to beads . at 3 days , these cells ( 60 % b1 +) were harvested and the viability ranged between 60 and 80 %. these cells were considered activated since they were proliferating as measured by uptake of h 3 tdr ( stimulation index = 5 - 10 ) and morphologically approximately 2 / 3 of cells now were enlarged with a lymphoblastoid appearance . the cells were then examined by indirect immunofluorescence and flow cytometric analysis for b5 expression . in contrast to resting peripheral blood b - cells , approximately 25 % of cells now expressed b5 . in order to demonstrate that b5 expression was limited to activated b - cells , cells were labelled with anti - b1 directly conjugated to fluorescein and anti - b5 conjugated to biotin then developed with texas - red - avidin . utilizing dual laser flow cytometric analysis , it was clearly shown that the majority of unstimulated cells only expressed b1 with rare cells expressing b1 and b5 ( fig3 ). however , after 3 days of culture with anti - ig antibody , 25 % of cells expressed b5 and all cells expressing b5 co - expressed b1 . in contrast , t cells isolated by e rosetting , were cultured with pha for six days . viable cells were isolated and the cell surface phenotype examined after 2 and 6 days of stimulation . these cells were uniformly t cells by their strong expression of t11 and were activated as determined by their expression of ia ( 30 % of cells expressed ia at day 6 ) and il - 2 receptor ( 90 % of cells expressed il - 2r at day 2 , 70 % at day 6 ). these activated t - cells demonstrated no detectable b5 antigen . similarly monocytes were activated overnight with pha - leukocyte conditioned medium ( pha - lcm ), and although these cells strongly expressed mo1 , mo2 , and ia , they did not express b5 . burkitt &# 39 ; s lymphoma cell line ramos , and the plasma cell leukemia cell line rpmi 8226 , were used for the isolation of the b5 cell surface antigen . a modification of the lactoperoxidase conjugation iodination technique as described by boyd et al ., j . immunol ( 1981 ) 126 : 2461 was used to label cell surface proteins with i 125 . the iodinated cells obtained from this procedure were washed twice with cold pbs and lysed on ice with cell lysis buffer ( 50 mm tris hcl , 0 . 4m nacl , 1 % triton x - 100 , 2 mm dmsf , 5 mm edta , 50 mm iodoacetamide , ph 8 ). after 30 minutes the lysate was centrifuged at 800 g for 10 minutes to remove unlysed cells , nuclei , and other insoluble material . the supernatant was frozen at - 80 ° c . until analyzed by immunoprecipitation . cell supernatants and cell lysates were centrifuged at 10 , 000 g for 30 minutes and transferred to fresh test tubes . prior to immunoprecipitation of cell lysates were mixed with 20 mg of rabbit anti - human ig antibody and pre - cleared four times ; twice , for 1 hour at 4 ° c ., with pansorbin s . aureus cells once with sepharose 4b beads and finally with preformed complex of rabbit anti - mouse antibody and an irrelevant mouse immunoglobulin . the pre - cleared samples were mixed with either : ( 1 ) anti - b5 rabbit anti - mouse ig complexes . ( 2 ) an irrelevant monoclonal igm complex with rabbit anti - mouse ig . ( 3 ) b5 - conjugated sepharose beads or ( 4 ) irrelevant igm - conjugated beads sepharose 4b beads . the mixtures were held on ice for 2 hours at 0 ° c . after which the samples were centrifuged at 10 , 000 g for 5 minutes and the supernatants discarded . the pellets were washed four times in 1 % triton ( octyl phenoxy polyethoxy ethanol ) x - 100 / 0 . 2 % sodium deoxycholate in ripa buffer ( 0 . 2 sodium phosphate , 5 mm edta , 5 mm egta , 1 mm naf , ph 7 . 4 ). as shown in fig4 the precipitates were analyzed by 10 % sds - polyacrylamide gel electrophoresis under non - reducing ( lanes 1 - 5 ) and reducing ( 50 mm dithiothreitol ) ( lanes 6 - 10 ) conditions . ramos cell lines : anti - b5 conjugated to sepharose 4b beads 4b ( lanes 1 and 5 ) was compared with an irrelevant antibody conjugated to sepharose 4b ( lanes 2 and 6 ). rpmi 8226 cell line : anti - b5 rabbit anti - mouse ig preformed complexes ( lanes 4 and 8 ) were compared to irrelevant antibody rabbit anti - mouse ig preformed complexes ( lanes 3 and 7 ). the apparent molecular weights ( m . w .) of b5 at 75 kilodaltons ( kd ) under reducing and 67 kd under non - reducing conditions , reflect the presence of interchain disulfide bonds . ( this biochemical characterization of the b5 antigen shows that it is a single chain cell surface protein .) the monoclonal antibody of the invention can be labeled with a detectable label , e . g ., a radiolabel by conventional procedures , and provide a quantitative measurement of activated b - cells in biological samples or in vivo . because of its specificity for neoplasms of b - cell origin corresponding to the mid - stage of b - cell differentiation , the monoclonal antibody of the invention can be used to detect the presence of these cell types in biological samples . the monoclonal antibody of the invention can be used as a diagnostic aid in characterizing the cell type of various lymphomas and leukemias arising from b - cells . in addition , in vivo imaging using rodiolabeled monoclonal antibody of the invention can provide a noninvasive means for detecting and localizing these cell types , e . g ., lymphoid tumors . the monoclonal antibody of the invention will also be useful in defining the role of activated b - cells in autoimmune diseases , infections and other diseases which are characterized by activated b - cells , e . g ., organ rejection .	8
for better understanding the purposes , technical solutions , and advantages of the present invention , the technical solutions provided in the embodiments of the present invention are illustrated in detail below with reference to the accompanying drawings . a de - registration method is provided in a first embodiment of the present invention . referring to fig1 , the method includes the following steps : step 201 : an hnb gw acquires a message indicating that a ue has moved to another cell . the hnb gw can learn that the ue has moved to another cell by using the following methods . method 1 : the ue initiates a register request to the hnb gw in another cell , and at this time , the hnb gw can know that the ue has moved out of the coverage of the mb ; method 2 : when the hnb gw has a corresponding interface with a radio network controller ( rnc ) of a neighboring macro network or a neighboring hnb gw , and when the ue registers with a cell controlled by the rnc of the neighboring macro network or the hnb gw , the rnc of the neighboring macro network or the neighboring hnb gw can analyze that the ue at one time camps on an hnb in the hnb gw by parsing signaling , and notify the hnb gw that the ue has moved to another cell through a message ( such as a cell update message ). method 3 : the ue will initiate an lau procedure when the ue moves out of the coverage of the hnb , and notifies a core network of updating information about a location area where the ue locates through the lau process so that the core network can know that the ue has moved out of original cell of the ue , and can find corresponding hnb gw according to a location area code of the original cell reported by the ue and send a notification message to the hnb gw to notify the hnb gw that the ue has moved out of the coverage of the hnb . step 202 : the hnb gw detects whether pre - registration resources assigned by the hnb gw for the ue exist , and if the pre - registration resources exist , releases the pre - registration resources , and sends a ue de - register request to the hnb to notify the hnb that the ue has moved to another cell and releases the pre - registration resources assigned by the hnb for the ue . step 203 : optionally , if , in step 202 , the hnb detects that no pre - registration resources exist , the hnb sends a de - register response message to the hnb gw to notify the hnb gw that the pre - registration resources have been released . a second embodiment is similar to this embodiment , with the exception of the time of initiating the de - registration procedure . specifically , the hnb gw sends a ue de - register request to the hnb after a preset period of time when the hnb gw acquires the message indicating that the ue has moved to another cell , to notify the hnb that the ue has moved to another cell and release the pre - registration resources assigned for the ue . to prevent the ue from switching back to the hnb cell again and initiating a register request of the ue from the hnb cell in a short time , that is , reconstructing registration information after releasing the registration resources in a short time , the second embodiment of the present invention sets that the hnb gw sends the de - register request to a corresponding hnb only if the hnb gw does not receive a message sent by the ue from the hnb for a period of time . in the first and second embodiments , the hnb gw detects whether the hnb gw itself has pre - registration resources after receiving indication information indicating that the ue moves to another cell , and if the hnb gw itself has the pre - registration resources , releases the pre - registration resources and sends a de - register request message to the hnb immediately or after a preset period of time . if the hnb does not detect any pre - registration resources , the hnb sends a de - register response message to the hnb gw . fig2 is another de - registration method provided in an embodiment of the present invention . as shown in fig2 , the method includes the following steps . step 301 : an hnb gw receives a message indicating that a ue has moved to another cell . step 302 : the hnb gw sends information indicating that the ue has moved to another cell to an hnb . step 303 : the hnb releases pre - registration resources assigned by the hnb for the ue if the hnb detects the pre - registration resources , and immediately sends a de - register request message to the hnb gw . however , to prevent the ue from switching back to the hnb gw cell again and initiating a register request of the ue from the hnb gw cell in a short time , i . e ., reconstructing registration information after releasing the registration resources in a short time , the hnb can also send the de - register request message to the hnb gw after a period of time . step 304 : if the hnb gw does not detect pre - registration resources assigned by the hnb for the ue at the hnb gw , the hnb gw sends a de - register response message to the hnb to notify the hnb that the pre - registration resources on the hnb gw have been released . fig3 describes a schematic diagram of an hnb gw according to an embodiment of the present invention , which includes a transceiver 401 and a release initiating unit 402 . the transceiver 401 is configured to receive indication information that indicates a ue moves to another cell from a source hnb and is sent by the hnb gw , which includes receiving a register request initiated to the hnb gw by the ue in another cell , a cell update message of the ue sent by an rnc of a neighboring macro network or a neighboring hnb gw , and a message indicating that the ue moves into a macro network sent by a core network . the transceiver may be further configured to receive a de - register response message sent by the hnb . after the hnb gw sends the de - register request message to the hnb , if the hnb does not detect the pre - registration resources of the ue , the hnb sends the de - register response message to the hnb gw to notify the hnb gw that the pre - registration resources assigned by the hnb have been released . the transceiver is further configured to forward the indication information to the hnb , and receive a de - register request message sent by the hnb after receiving the indication information . the release initiating unit 402 is configured to initiate release of the pre - registration resources corresponding to the ue after the transceiver receives the indication information . when the transceiver receives the indication information and pre - registration resources corresponding to the ue exist in the hnb gw , the pre - registration resources in the hnb gw are released , and the hnb is notified of releasing the pre - registration resources corresponding to the ue by sending the de - register request message to the hnb immediately or after a preset period of time through the transceiver . the release initiating unit is further configured to release the pre - registration resources corresponding to the ue in the hnb gw after the transceiver receives the de - register request message . it can be seen from the above that the hnb gw determines whether the ue moves to another cell before sending the de - register request to the hnb and releases the reserved iuh resources , thereby reducing waste of resources . fig4 describes a schematic structural diagram of an hnb according to an embodiment of the present invention , which includes a base station transceiver 501 and a base station release initiating unit 502 . the base station transceiver 501 is configured to receive indication information which indicates that a ue moves to another cell from a source hnb and is forwarded by an hnb gw to the hnb . it includes receiving a register request initiated to the hnb gw by the ue in another cell , a cell update message of the ue sent by an rnc of a neighboring macro network or a neighboring hnb gw , and a message indicating that the ue moves into a macro network sent by a core network . the base station transceiver may further be configured to receive a de - register response message sent by the hnb gw to the hnb . after the hnb sends the de - register request message to the hnb gw , if the hnb gw itself does not detect pre - registration resources , the hnb gw sends the de - register response message to the hnb to notify the hnb that the pre - registration resources have been released . the base station transceiver is configured to receive a de - register request message sent by the hnb gw after receiving the indication information . after the transceiver receives the indication information , the base station release initiating unit 502 is configured to initiate release of the pre - registration resources corresponding to the ue . after the base station transceiver receives the indication information and pre - registration resources corresponding to the ue exist in the hnb , the pre - registration resources in the hnb are released , and the hnb gw is notified of releasing the pre - registration resources corresponding to the ue by sending the de - register request message to the hnb gw immediately or after a preset period of time through the transceiver . after the base station transceiver receives the de - register request message , the base station release initiating unit is configured to release the pre - registration resources corresponding to the ue in the hnb . it can be seen from the above embodiments that the hnb gw receives indication information indicating that a ue moves to another cell and initiates release of the pre - registration resources corresponding to the ue , thereby enabling the hnb gw to acquire the message indicating that the ue has moved out of the coverage of the hnb cell and release the pre - registration resources assigned for the ue in time , reducing waste of resources . it will be clearly understood by those skilled in the art through the above description of various embodiments that , the present invention can be implemented by means of software and a necessary general hardware platform , or , of course , by means of hardware , but the former is preferred in many cases . based on such understanding , the technical solutions of the present invention , or the portions contributing to the prior art can essentially be embodied in form of a software product . the computer software product is stored in one storage medium and includes several instructions to cause a computer device , which may be a personal computer , a server or a network device , to perform the methods described in the embodiments of the present invention . the present invention has been illustrated and described with reference to some exemplary embodiments of the present invention , but it should be understood by those of ordinary skill in the art that various changes can be made thereto in forms and details without departing from the spirit and scope of the present invention .	7
the present application comprises two parts , the group key chaining and key distribution allowing an efficient revocation mechanism . when a group access key is to be renewed , the message containing the new group access key is sent to the decoders of that group . the message is broadcasted so all decoders , even not belonging to that group can receive this message and the encryption will determine which decoders can really obtain the new group access key . let us take the example with a group of 256 decoders and two decoders should be revoked . each decoder contains at least a master group key and a personal key . the new group access key is encrypted by the current group access key and by the keys only available in the decoders that are not revoked . a simple example using a trivial broadcast encryption scheme can be to create firstly a cryptogram containing the new group access key and encrypted by the current group access key . this cryptogram ct is then encrypted with a decoder personal key . the message will then comprises 254 cryptograms , each being encrypted by a personal key of the non - revoked decoders . of course , the inverse method is also applicable , the new group access key is firstly encrypted by the personal key of a non - revoked decoder and then encrypted by the current group access key . for the next renewal of the group access key , so - called further next group access key , even if the revoked decoders still contain the master group key and their personal key , the next message will contain the further next group access key encrypted by the master key only and by the next group access key . since the revoked decoders have not been able to access to the next group access key , this further next group access key is also not accessible for these decoders even if they have the master group key . according to another example , the further next group access key is simply encrypted by the next group access key . the second part of the invention is to propose a scheme that reduces greatly the size of the message when a revocation is to be carried out . one can imagine a group of 5000 decoders and only one is to be revoked . in this case , with the example above , the next group access key should be duplicated 4999 times , each time associated with the personal key of the non - revoked decoders . the fig4 illustrates the process of revocation . the top part shows the audio / video product ( could be one channel or a group of channels ) encrypted by the key successively k 1 , k 2 and k 3 . it is to be noted that this key ( k 1 , k 2 or k 3 ) could be used to decrypt directly the audio / video product or serving as decryption key to decrypt the messages ( ecm ) containing the keys to decrypt the audio / video product . in the example of the fig4 , during the first time period , the decoders t 1 , t 2 , t 3 and t 4 are part of the group . the group access key c 1 is the current one when the message k 1 c 2 is arrived , containing the next group access key c 2 and the key k 1 to access the audio / video product . in fact , the product key k 1 will arrive before this key is used to decrypt the product . the decoders will store the current product key k 1 and when the next is received , the product key k 2 , ready to be applied at the time the product swap from k 1 to k 2 . during the second time period , the group access key c 3 is sent to the non - revoked decoders . these decoders are t 1 , t 2 and t 4 . the message k 2 c 3 is encrypted by the current group access key c 2 and the keys pertaining to the non - revoked decoders t 1 , t 2 and t 4 . the decoder t 3 , having the current group access key c 2 , cannot decrypt this message and have access to the group access key c 3 . during the third time period , the message carrying the next group access key c 4 can be simply encrypted by the current group access key c 3 . the position into the group of formerly t 3 can be reallocated ( to a decoder t 30 ) by transmitting the current group access key c 3 and the key or keys previously distributed to the decoder t 3 . this reallocation can be executed only after the group access key c 3 is active i . e . after the transmission of the message k 2 c 3 . the group is organized by the management system and each position into the group is associated with a position status . this status can comprises three states , namely “ free ”, “ allocated ” and “ transitional ”. at the creation of a group , all positions are marked “ free ”. when a position is allocated to a member , this position is marked “ allocated ”. as soon as a member is withdrawn of the group , the position is marked “ transitional ”. this state indicates that the position was used before and special care is to be taken while reallocating this position . this position can be reallocated as soon as the group access key has been renewed into the members of this group at the exception of this specific member . the time between the revocation of the member until the group access key is changed for all other members is the so - called “ quarantine ” period . after this quarantine period , the position is virtually “ free ” and can be reused . the management of the database of the management center regularly checks the status of the “ transitional ” positions and checks whether the group access key is no longer present into the revoked decoder attached to that position . in this case , the position can be modified from “ transitional ” to “ free ”. in the case that no regular scan of the database is carried out , the status of a specific position is determined when a new member is to be inserted into that group . this is why in the case that the position has the state “ transitional ”, a further check is carried out to determine if the quarantine period is over . the renewal message of the group access key is formed by the group access data ( cgd ) which includes at least the group access key ( cgk ). this key can be used to decrypt the entitlement messages ( ecm ) related to the services for which the group of decoders has access . as a consequence , the group access key serves for the chaining mechanism and to access the services . according to another embodiment , the group access data comprises a session key sk . this session key sk will serves to access the services and decrypt the entitlement messages ( ecm ) related to these services . according to another embodiment , when the group access data comprising the new group access key is received and stored in the non - revoked decoders , another message is sent to the decoders containing the session key sk . this message is then encrypted by the group access key , thus only the non - revoked decoders can decrypt and obtain this session key sk . although the group access key can be distributed according to any broadcast encryption scheme as described above , in order to efficiently generate a revocation message , the present invention will now describe an efficient way to organize the key distribution . the main property of an ideal broadcast encryption system can be summarized for the purpose of this invention : assuming each terminal in the system has been provisioned with a unique set of secrets , a server , knowing the secrets of each terminal , may encrypt a single message in a way that is both efficient ( the message is small ) and that can be decrypted by authorized terminals but not by excluded ( revoked ) terminals even if all revoked terminals collude together . a particular scheme is considered here to illustrate the working principle of the invention . it is described in [ 3 ], however , it is to be noted that due to its severe lack in collusion resistance its use is not recommended in practice and it is only used here for its simplicity and for illustrative purposes . n is the total population of terminals in the broadcast encryption scheme r is the number of terminals revoked in an encrypted message log is the logarithm base 2 k is the size in bytes of keys in the system ( value assumed here is 128 bits = 16 bytes ) each terminal must store ( log ( n )+ 1 )* k bytes of key material the size of the encrypted message is at most : n / 8 + k + payload size bytes the terminal must perform at most r *( log ( n )− 1 ) crypto operations to retrieve the message encryption key the mechanism operates on a population of n = 2 m terminals . a binary tree of keys is built as illustrated in the fig1 for this population using a one way function to derive the key of each branch from the key of the node above . the f ( k , n ) function is a public one - way function ( e . g . hash primitive ) that derives a key from its two parameters . each terminal is assigned a leaf key , as depicted above , however , this key is not given to the terminal , instead , each terminal is given the key of all the other terminals in the group , or the means to compute them . for instance , as illustrated in the fig2 , the keys provided to terminal t 2 are k 10 , k 3 and k 2 . using k 3 , t 2 can compute k 7 and k 8 , and using k 2 , it can compute k 11 to k 14 , through k 5 and k 6 . when joining the group , each terminal then effectively receives log 2 ( n ) keys , plus an additional group key k g used for addressing a message to all members of the group . once this is in place , any message that must be sent to the group or subset of the group is encrypted in the following way : if the message is targeted to all terminals in the group , it is encrypted with the group key , k g which is known to all terminals if the message is targeted to a subset of the terminals in the group , a key is built by hashing together the keys assigned to each excluded terminals , and the message is encrypted with this key : k = hash ( k a , kb , . . . , k z ). for example , if terminals t 0 and t 6 are excluded , keys k 7 and k 13 are hashed together to compute a key and the message is encrypted with it . since t 0 and t 6 do not know their respective keys , they can not compute the final key , while all the other terminals in the group can compute these keys and thus access the content of the message . the resulting encrypted message is essentially the same size as the original , only padding and the use of a session key slightly increase its size . in addition to the message itself , some signaling must be added so that receiving terminals know whether they are excluded or not and how to compute the keys . this is done using a bitmap where each bit corresponds to a terminal and indicates whether that terminal is included in the recipient or not . the bitmap may be compressed under certain conditions . some mechanism must be introduced to reach an addressable population of tens of millions while keeping the number of revoked terminals to a minimum ( and thus the bandwidth to an acceptable level ). the first goal is easily met by splitting the total population into a number of subsets of the adequate size and managing each subset as an independent population . the second goal is more difficult to meet without a dedicated mechanism for revoked population control . the dynamic group management mechanism described below proposes to solve this problem . the content is put up for sale in packages , typically by grouping a number of services in independent products . the unit of sale , and thus the unit of control , is the product . for each product , the population of terminals subscribed to this product is split in a number of groups , for which an independent broadcast encryption system is generated ( for instance using methods well - known in the art ). the number of groups is proportional with the actual population of subscribers for this product ( population divided by the group size ), not with the total population of terminals . upon subscribing to a product , a slot is allocated to the terminal in one of the groups associated to this product ( a new group is created if needed ). the unique set of keys corresponding to this slot is sent to the terminal using a message addressed to this particular terminal . an additional key is also provided , the group access key , which use is described below on a regular basis ( e . g . every day ), a positive addressing message is generated for each group of terminals of each product . this pa message contains all the keys required to access the content of the product over the next period of control ( e . g . the next week or month ). this pa message is encrypted using the broadcast encryption primitive for this group of terminals , and is further over - encrypted with the group access key . upon cancellation of a subscription by the user , the terminal is put in the list of revoked terminals for its group ( for this particular product ). in the next pa message , those terminals that are revoked may decrypt the first layer of encryption using the group access key , however , they are not capable of decrypting the underlying message , by virtue of the broadcast encryption scheme . as a consequence , these terminals cannot retrieve the content keys for the next period of control and are thus unable to access the content . furthermore , they cannot retrieve the next group access key which is covered by the broadcast encryption and are thus effectively definitively excluded from this group . as soon as the last group access key given to a revoked terminal is replaced by a new one , the slot of the revoked terminal may be assigned to a new subscribing terminal . t n indicates a terminal , the solid arrows indicate the ability of the targeted terminal to access the message in the middle layer of the diagram . this message is the pa message addressing a subset of the terminal population with the broadcast encryption scheme , containing the service keys k n and over encrypted with the group access key c n . the first benefit is that the number of the pa emm generated for any product is directly proportional to the number of subscribers to that product , not to the total population of subscribers . thus , if a product is purchased by a minority , the pa bandwidth required to maintain it is small . the second benefit is that the population of receivers targeted by any pa emm is extremely homogeneous : indeed , all receivers have purchased that product and only a small percentage of them have cancelled it . this means that the addressing bit field , which indicates which receivers in the pa group are revoked is essentially composed of bits set to ‘ 1 ’ and thus can be compressed . a simple and efficient compression algorithm will provide a compression ratio of 1 / 14 for a 0 % revocation rate , 1 / 6 for a 2 % revocation rate and still 1 / 3 for a 5 % revocation rate . the third benefit is that slots in the group are recycled : when a terminal is excluded from the group , its slot is reassigned to a new terminal , constantly keeping the number of revoked slots in the group to a minimum ( no more than 2 %- 3 % in the ideal case ). fourth benefit is that any broadcast encryption method can be used , such as previously known in the art , as well as new ones , hence improving even more the efficiency ( bandwidth , terminal key storage and / or encryption / decryption complexity ) of the entire system . all these put together allow for a very efficient use of the broadcast bandwidth . dan boneh , craig gentry , brent waters : collusion resistant broadcast encryption with short ciphertexts and private keys . crypto 2005 dalit naor , moni naor , jeffery lotspiech : revocation and tracing schemes for stateless receivers . crypto 2001 cecile delerablee et al . “ fully collusion secure dynamic broadcast encryption with constant - size ciphertexts or decryption keys ”, pairing 2007 wo 2007 / 138204 a1 ( france telecom , delerablee cecile ) “ cryptographic method with integrated encryption and revocation , system , device and programs for implementing this method ” pan wang et al . “ storage - efficient stateless group key revocation ”, isc 2004 masafumi kusakawa et al . “ efficient dynamic broadcast encryption and its extension to authenticated dynamic broadcast encryption ”, cans 2008 us 2004 / 114762 ( general instrument corp ., alexander medvinsky ) “ subset difference method for multi - cast rekeying ” fr 2 850 822 a1 ( canal plus technolies [ fr ]) “ système de télévision a péage , procédé de révocation dans un tel système , décodeur et cartes à puces associés , et message transmis à un tel décodeur ”.	7
the present invention encompasses several techniques for enhancing the adsorption capacity of commercial activated carbons for odor - causing compounds such as 2 - methylisoborneol ( mib ) and geosmin . the techniques involve heat treatments in gas environments , comprised of one or more of the following gases : hydrogen , steam , methane , and / or natural gas , ammonia , propane , or benzene . these treatments promote favorable chemical and / or physical changes in activated carbon pores and internal surfaces . by carefully controlling the temperature , environment , and time of exposure during these heat treatments , activated carbons can be “ tailored ” to achieve superior adsorption capacities . lab - scale experiments have demonstrated that the treatments herein produce carbons with much higher mib adsorption capacities than current commercial carbons . to date , odorant adsorption experiments conducted by the present inventors have focused on mib uptake , since it was previously established that mib is as difficult or more difficult to remove than geosmin . therefore , an activated carbon exhibiting superior mib uptake should work well for removing geosmin . other adsorption experiments have shown that the tailored carbons included in this invention adsorb more natural organic matter than commercial carbons , and this heightened capacity may apply to a variety of other organic compounds . the bench - scale heat treatments described below were performed in a tubular quartz glass furnace . unless otherwise noted , a sample ( typically 300 – 1100 mg ) of commercially available , lignite - based activated carbon that had been acid - washed ( hereafter identified as “ commercial carbon ”) was suspended within the furnace in a basket constructed of stainless steel mesh . the sample was first heated in a flow of pure nitrogen until the desired temperature was reached . next , while maintaining the target temperature , the “ treatment gases ” were applied to the sample . in general , treatment gas flow rates ranged from 70 to 140 ml / min and the total treatment time ranged from 10 to 60 minutes . upon completion of a treatment , the furnace was again flooded with nitrogen and allowed to cool . samples were stored in a dessicator under vacuum until the adsorption experiments were performed . the pilot - scale heat treatments described below were performed in a cylindrical kiln furnace that rotated about a horizontal axis . these pilot tests employed 1000 – 1500 grams ( initial dry mass ) of lignite - based activated carbon that had been acid - washed . the natural gas heat treatments proceeded for 0 – 10 minutes at 1000 ° c ., and the steam heat treatments proceeded for 0 – 25 minutes at 1000 ° c . when steam was used , the mass ratio of steam - to - initial dry activated carbon was greater than about 0 . 7 : 1 . 0 . when natural gas was used , the mass ratio of natural gas - to - initial dry activated carbon was greater than about 0 . 35 : 1 . 0 . a standardized mini - column mib adsorber test protocol was used to determine the 2 - methylisobomeol ( mib ) adsorption performance of small contactors filled with activated carbon grains . these tests were conducted using treated water that discharged from the clarifiers at the norristown water purification facility of the pennsylvania - american water company ( norristown , pa .) ( hereafter identified as the “ norristown plant ”). this water had previously undergone full - scale chlorination , coagulation ( with ferric chloride ), and clarification through superpulsators ™. the norristown plant utilizes filter - bed adsorbers for odor control , and the water samples utilized herein were collected just prior to these full - scale filter - bed contactors . in other words , the laboratory tests in this work employed the same water as would have been processed by full - scale activated carbon beds . this water contained 3 . 7 mg / l of natural organic matter , measured as total organic carbon ( toc ); other water quality parameters for the norristown water sample are listed in table 1 . in general , the standardized mini - column mib adsorber test protocol could employ any surface water used as a municipal water supply that contains the specified level of natural organic matter ( measured as total organic carbon ). the standardized mini - column mib adsorber test protocol employed 14 c - labeled mib . radiolabeled mib was purchased from american radiolabeled chemicals ( arc ) and it exhibited a specific activity of 55 mci / mm ( mci = millicuries , mm = millimoles / l ). consequently , when this material was spiked into experimental waters , the resultant mib concentrations were directly proportional to the radioactivity of those waters . radioactivity was measured using a scintillation counter ( wallac 1217 rackbeta ), and this required combining samples with scintillation cocktail . for the tests herein , 2 . 5 ml aliquots of sample water were combined with 18 ml of scintillation cocktail . once the radioactivity of an aliquot was determined , the mib concentration could be calculated using the following equation , where dpm stands for “ disintegrations per minute .” due to the inherent variability of the scintillation counter , the detection limit for this protocol ( under the given conditions ) was about 3 – 4 ng / l . unless otherwise indicated , the mib adsorption studies described herein were conducted according to the standardized mini - column mib adsorber ( smcma ) test protocol . this protocol employed mini - columns ( standardized mini - column mib adsorbers ) that were designed to simulate the performance of full - scale filter - bed absorbers , similar to those found at the norristown plant and a number of other full - scale water treatment plants . the norristown adsorbers provide a rated empty - bed contact time ( ebct ) of 7 . 6 minutes , and this is within the range of typical values for systems that employ activated carbon . a comparison of full - scale and standardized mini - column mib adsorber parameters is given in table 2 . for these standardized mini - column mib adsorber tests , the norristown water that is characterized above was spiked with 130 – 140 parts per trillion of 14 c - mib and then processed through a smcma . influent and effluent 14 c - mib concentrations were monitored at regular intervals so as to determine the “ breakthrough profile ” of the carbon being tested . the pore volume and pore size distribution data were collected by means of an argon adsorption density functional theory protocol . this protocol employed a micromeritics asap 2000 or 2010 pore analyzer , which generates argon adsorption isotherms . argon adsorption isotherms were determined in the relative pressure range of 10 − 6 to 0 . 99 , and each isotherm included 60 – 133 data points . for each data point , gaseous argon was pulsed into a sample chamber that contained about 0 . 3 g of activated carbon sample and was immersed in liquid argon ( 87 . 3 k ). following a 0 . 5 to 3 hour equilibration period , the relative pressure in the chamber was recorded . tests began at low relative pressure ( 10 − 6 ) and proceeded to the final pressure of 0 . 99 . completed isotherms were interpreted via the software package provided with the micromeritics equipment , which utilizes the density functional theory in converting isotherm data to pore size distributions . slurry ph measurements were made via a slurry ph protocol . this entailed combining 0 . 5 to 0 . 6 grams of powdered carbon (& lt ; 325 mesh size , or & lt ; 45 micrometers ) with 5 ml of deionized water ( milli - q ™ water system — millipore corporation , bedford , mass .) that had been purged with nitrogen . the slurry was agitated for 24 hours , after which the ph ( considered to be the equilibrium ph ) was measured . previous research suggests that the equilibrium ph of an activated carbon reflects its ph pzc . the ph pzc of a material is the ph at which that material &# 39 ; s net surface charge is zero , as determined by surface titrations . surface charge titrations were conducted using a mettler - toledo dl53 automatic titrator . for these tests , carbon samples were immersed in an electrolyte solution ( either 0 . 01 molar or 0 . 1 molar sodium chloride ), and after adding a fixed volume of 1 . 0 molar sodium hydroxide , this solution was titrated with incremental volumes of 0 . 1 molar hydrochloric acid . titrations were also performed in the absence of activated carbon , and these “ blanks ” were compared to the carbon titrations to determine the surface charge . batch mib adsorption studies were conducted using 40 ml borosilicate vials with teflon - lined closures . in standard tests , the vials were filled with clarified norristown water ( i . e ., the same water as listed above ) that contained the appropriate dose of 14 c - labeled mib . carbon samples were powdered (& lt ; 325 mesh size , or & lt ; 45 micrometers ), combined with deionized water , and added to the batch reactors as slurries . the vials were then sealed so that no headspace remained . each vial contained an equal number of glass beads to promote mixing while the vials were agitated on a rotating tumbler . following a 24 - hour contact period , samples were collected using a syringe and filtered through a 0 . 2 μm cellulose acetate syringe filter . the total organic carbon ( toc ) adsorption studies referenced herein were conducted using filtered water from the cincinnati water works richard miller treatment plant . this water had previously undergone full - scale coagulation ( with aluminum sulfate ), clarification , and filtration . it contained 1 . 2 mg / l toc , 0 . 07 ntu turbidity , 66 mg / l alkalinity ( as caco 3 ), and exhibited a ph of 7 . 9 . batch toc adsorption tests were conducting using 20 - liter polycarbonate containers . these were filled with cincinnati water and dosed with varying amounts of activated carbon . following a one - week equilibration period , the remaining toc in each vessel was measured using a shimadzu toc - 5000a toc analyzer . it was observed that heat treatments in pure hydrogen greatly improved the mib adsorption capacity of the commercial carbon . for example , a one - hour treatment in pure hydrogen at 900 ° c . increased mib removal under standard batch adsorption conditions from 60 % with the untreated carbon , up to 75 % with the treated carbon . the standard batch adsorption experiments referenced herein utilized clarified river water from norristown , pa ., with an initial spiked 14 c - mib concentration of 135 ng / l and an initial background natural organic matter level that exhibited a total organic carbon concentration of 3 . 7 mg / l . a one - hour treatment in pure hydrogen at 1025 ° c . increased mib removal to 95 % under these conditions ( this carbon is identified herein as “ h2 ( 1025 )”). in these treatments hydrogen gas was applied at a rate of 70 ml / min and the sample mass was 220 mg , meaning the ratio of total applied hydrogen to activated carbon ( on a mass basis ) was 1 . 7 : 1 . in standardized mini - column mib adsorber tests h2 ( 1025 ) processed about 5000 bed volumes before initial detectable breakthrough ( i . e ., up to 4 parts per trillion ) occurred and about 10 , 000 bed volumes before the effluent 14 c - mib concentration exceeded 10 parts per trillion ( 10 ppt - breakthrough ) ( fig1 and table 3 ). in comparison , the untreated commercial carbon processed about 2600 bed volumes prior to initial detectable breakthrough and about 5000 bed volumes prior to 10 ppt - breakthrough . heat treatments in steam environments also caused significant improvements in mib uptake by the commercial carbon . for instance , a one - hour treatment in steam at 375 ° c . ( with a ratio of 11 . 7 grams of steam applied per gram of initial dry activated carbon ), followed by ramping in pure nitrogen to 850 ° c . ( 50 ° c ./ min . ), increased mib removal from 60 % to 75 % under the batch conditions described above . the aforementioned steam treatment therefore increased mib adsorption capacity as much as the one - hour hydrogen treatment at 900 ° c . in a standardized mini - column mib adsorber test , this same steam - treated carbon ( identified as “ h2o ( 375 ), n2 ( 850 )” in the accompanying figures ) processed about 4500 bed volumes prior to initial detectable breakthrough and about 7000 bed volumes prior to 10 ppt - breakthrough ( fig2 ). one - hour steam treatments at 600 ° c . ( identified as “ h2o ( 600 )”) produced roughly the same standardized mini - column mib adsorber results as for h2o ( 375 ), n2 ( 850 ). it was also discovered that heat treatments in various combinations of steam and pure methane could improve mib uptake . following a one - hour exposure to a steam / methane mixture ( 6 : 1 molar ratio of steam to pure methane ) at 600 ° c . ( identified as “ ch4 / h2o ( 600 )” in the accompanying figures ), the experimental carbon performed as well as a hydrogen - treated carbon during the first 6000 – 10 , 000 bed volumes of a mini - column test ( fig3 ). in this treatment 9 . 5 grams of steam and 0 . 97 grams of methane were applied per gram of initial dry activated carbon . a similar result was observed following a 23 - minute exposure to steam and methane ( 1 : 1 molar ratio ) at 850 ° c . ( identified as “ ch4 / h2o ( 850 )” in fig3 ). here again , the treated carbon processed about 5 , 000 bed volumes prior to initial breakthrough and about 10 , 000 bed volumes prior to 10 ppt - breakthrough . in preparing ch4 / h2o ( 850 ), 10 . 5 grams of steam and 7 . 5 grams of methane were applied per gram of initial dry activated carbon . favorable mib removal also occurred after exposing the commercial carbon to a combination of steam and methane ( 1 : 1 molar ratio ) at 1000 ° c . this treatment lasted 18 minutes , during which 2 . 9 grams of steam and 2 . 0 grams of methane were applied per gram of initial dry activated carbon . the resultant material ( identified as “ ch4 / h2o ( 1000 )- 1 ” in the accompanying figures ) processed 10 , 000 bed volumes prior to initial breakthrough and 15 , 000 bed volumes prior to 10 ppt - breakthrough ( fig4 ). similar breakthrough performance was observed following separate application of methane followed by steam . in this case , a carbon sample ( identified as “ ch4 / h2o ( 1000 )- 2 ” in the accompanying figures ) was heated to 1000 ° c . and exposed to pure methane until it gained 13 % mass . thereafter it was exposed to steam ( no methane ) until it lost 25 % of its pyrolyzed mass . in this treatment , 0 . 9 grams of methane and 1 . 6 grams of steam were applied per gram of initial dry activated carbon . the authors observed that some residual steam was present during the cooling phase of the above - listed methane / steam trials . one important benefit of the “ methane deposition ” phase of methane / steam treatment is that it offsets the mass loss accompanying the “ steam oxidation ” phase . activated carbons are normally sold according to weight , and for this reason , activated carbon manufacturers may avoid using production protocols that cause excessive mass loss . another potential advantage of the “ methane deposition ” phase is that it promotes important physical / chemical changes within activated carbon . when carbon samples were exposed to steam at 1000 ° c . until 20 – 25 % mass loss occurred ( without prior exposure to methane ), their mib breakthrough performance in norristown water was also improved over existing commercial grades of activated carbon that were tested , but they were less favorable than if methane had also been applied . as shown in fig5 , a carbon exposed solely to steam ( with no methane ) at 1000 ° c . ( identified as “ h2o ( 1000 )”) exhibited almost immediate ( but slight ) mib breakthrough , and it processed 10 , 000 bed volumes prior to 10 ppt - breakthrough . although its breakthrough profile was shallow , this carbon might be considered inferior to a carbon exhibiting more rapid breakthrough , if that carbon achieved a longer period of no detectable breakthrough . water utilities tend to prefer treatments that completely remove mib from finished water , due to its extremely low odor threshold concentration ( 7 – 15 ng / l ). equilibrium ph measurements for hydrogen -, steam -, and methane + steam - treated samples ( as well as for other experimental carbons not discussed herein ) revealed that mib uptake was linked to equilibrium ph . in general , carbons that exhibited high equilibrium ph ( above 9 ) were able to remove more mib in standard batch tests than carbons that exhibited low equilibrium ph ( below 6 ). the equilibrium ph values for steam -, hydrogen -, and methane + steam - treated carbons were all in the range of 10 . 3 to 10 . 6 . pore size distribution measurements for the experimental carbons described above are shown in fig6 . these curves reveal a distinct correlation between the pore volume of hydrogen - and steam / methane - treated carbons and their respective mib breakthrough performance in norristown water . as shown in fig5 , the period of below - detectable - breakthrough for a number of experimental carbons ( some of which are not described herein ) was proportional to pore volume in certain pore size ranges , with the exception of steam - treated carbon ( heated to 1000 ° c ., identified by an “ x ” in fig7 ). the authors suspect that the steam - treated carbon contained more surface acidic groups than carbons that were also exposed to methane . to assess the impact of hydrogen treatment on toc removal , samples of bituminous coal - based carbon were heated to 1000 ° c . and then exposed to hydrogen for one hour . these samples included a virgin ( previously unused ) material , and two carbons that had undergone either 5 or 12 cycles of water treatment service ( for toc removal ) and thermal reactivation . standard batch toc removal tests ( as described above ) revealed that hydrogen treatment enhanced toc adsorption . as shown in fig8 , the toc uptake ( as measured in mg toc / g gac ) of hydrogen - treated (“ surface - modified ”) carbons was 10 – 200 % higher than for untreated (“ as - received ”) samples when the equilibrium toc concentration was between 0 . 1 to 0 . 85 mg / l . surface charge titrations of the “ as - received ” and “ surface - modified ” versions of the virgin sample are shown in fig9 . clearly the “ surface - modified ” sample has a higher net surface charge in the ph range of 4 – 10 , and this indicates that it contains fewer surface acidic groups than the “ as - received ” carbon . moreover , the “ as - received ” activated carbons exhibited zero net surface charge ( ph pzc ) at ph values between 8 . 5 ( for the virgin carbon ) and 9 . 5 ( for the thermally reactivated carbons — not shown herein ), whereas the “ surface - modified ” activated carbons exhibited zero net surface charge at ph values above 10 . 0 – 11 . 0 ( see fig9 ). furthermore , pore size distribution measurements ( fig1 ) revealed that the pore structure of “ surface - modified ” and “ as - received ” virgin carbon was nearly identical . this indicates that surface acidic groups and the ph pzc ( surface chemistry ) were important controlling factors in the toc adsorption tests discussed above . industries that employ activated carbon must routinely face the costs and operational challenges associated with removing and replacing carbon that has lost its capacity for removing contaminants . the invention described herein would facilitate the manufacture of activated carbons requiring less frequent replacement than current commercial carbons . these “ tailored ” carbons could greatly lower the operational costs of many activated carbon applications , particularly for odor control . slurry ph and zeta potential are two useful parameters for characterizing the surface charge and surface properties of activated carbons . zeta potential ( zp ) can represent the external charge of an activated carbon grain immersed in water , and is not affected by charged sites within the grain ( that are remote because of diffusion limitations ). the zeta potential of an activated carbon grain is influenced by the quantity of acidic , oxygen - containing functional groups on the grain &# 39 ; s external surfaces . with this in mind , the zeta potential of several steam - and methane + steam - treated carbons were compared . these included two samples that were prepared in a bench - scale tubular quartz glass furnace , as described in example 1 above , and two samples that were prepared in a pilot - scale rotary kiln furnace . the bench - scale samples are identified as s - 1000 and ms - 11000 , where s - 1000 was treated in steam at 1000 ° c . and ms - 1000 was treated in methane followed by steam at 1000 ° c . the pilot - scale samples are identified as pilot a and pilot b . to assess the relative propensity of these carbons to adsorb oxygen onto their external surfaces , their zeta potential was measured following varying periods of oxygen exposure by means of the mobility - based zeta potential protocol . for this protocol , 50 mg of activated carbon were mixed into 200 ml of distilled - deionized water , and pure oxygen gas was bubbled through the solution . the activated carbon grains had diameters between about 75 and 90 micrometers . at certain time intervals , 25 ml of each carbon / water suspension were collected and mixed with 25 ml of 0 . 2 m nacl . the ph of these suspensions was then adjusted to ph 10 . 5 and the zeta potential of particles in these “ adjusted suspensions ” was determined using a standard model 501 laser zee meter . zeta potential measurements were carried out in the following manner : approximately 25 ml of “ adjusted suspension ” was injected directly into a quartz glass cell ; the cell was placed under a microscope ( nikon su equipped with a 20 ×, 0 . 4 n . a . objective and two 10 × eyepieces mounted on a binocular head ) where it was automatically illuminated by a laser beam . next , an electric field was applied to the cell , and the voltage was adjusted manually until the carbon particles , as observed through the microscope , were stationary . a minimum of three zeta readings were taken for each sample , and the standard deviation in each case was less than 1 . 5 mv . analyses were conducted within one minute of applying voltage , so as to minimize the zeta potential - altering effects of prolonged electrification that are related to diffusion and other phenomena . results are shown in fig1 ( values are listed in table 4 below ) and they indicate that the zeta potential of pilot b and ms - 1000 was relatively unaffected by exposure to oxygen . in contrast , the zeta potential of pilot a and s - 1000 became considerably more negative during the 24 - hour test . the slurry ph of various carbons was measured in accordance with the slurry ph protocol described above . results are listed in table 3 , and these data , along with the results shown in table 4 , indicate that slurry ph , changes in zeta potential , and pore volume distribution ( see table 3 ) are all important parameters for predicting how well an activated carbon will remove mib from water that also contains natural organic matter . it should be understood that the foregoing description is only illustrative of the present invention . various alternatives and modifications can be devised by those skilled in the art without departing from the invention . accordingly , the present invention is intended to encompass all such alternatives , modifications and variances that fall within the scope of the following claims .	1
in fig1 a washing machine is generally shown at 10 which has a tub 12 with a vertical agitator 14 therein , a water supply 15 , a power supply ( not shown ), an electrically driven motor 16 operably connected via a transmission 20 to the agitator 14 and controls 18 including a presettable sequential control device 22 for use in selectively operating the washing machine 10 through a programmed sequence of washing , rinsing and extracting steps . a water level setting control 18 is provided for use in conjunction with control device 22 . a fully electronic control having an electronic display ( not shown ) may be substituted for control device 22 . the control device 22 is mounted to a panel 24 of a console 26 on the washing machine 10 . a rotatable and perforate wash basket 28 is carried within the tub 12 and has an opening 36 which is accessible through an openable top lid 30 of the washer 10 . tub ring 37 is positioned overlying wash basket 28 and tub 12 . the invention disclosed herein is not necessarily limited to implementation in a vertical axis washing machine as shown in the figures . inasmuch as the invention is a washing machine having a unique control and recirculating spray wash arrangement , the invention may be equally applied in a horizontal or tilted axis washing machine . moreover , in the specific application of the invention in a vertical axis washing machine , the invention may be practiced in a variety of machines which may include different motor and transmission arrangements , pumps , recirculation arrangements , agitators or impellers , or controls . a sump hose 40 is fluidly connected to a sump ( not shown ) contained in a lower portion of tub 12 for providing a wash fluid recirculating source . pressure dome 42 receives the recirculating fluid which exits via recirculating spray nozzle hose 48 which is fluidly connected to recirculating spray nozzle 32 . a pressure sensor or transducer 46 detects fluid pressure within pressure dome 42 and provides an output signal via lines 47 to the control , the signal varying dependent upon the sensed dynamic pressure . a second air dome 50 having a deepfill pressure sensor or transducer optionally provides a second pressure signal indicating static pressure to the control via lines 52 . as described herein , a pressure sensor may be a pressure switch having predetermined pressure levels that , within certain limits , will provide one or more signals to control 22 that a certain pressure has been achieved . depending on the presence or absence of such signals , the control will receive and store or process such information , as is well known . alternatively , a transducer may be used to sense pressure and provide a signal of varying frequency or voltage to control 22 indicating the pressure levels detected . in fig2 a schematic diagram further describes an example of a washing machine incorporating the present invention . hot water inlet 11 and cold water inlet 13 are controlled by hot water valve 17 and cold water valve 19 , respectively . valves 17 and 19 are selectably openable to provide fresh water to feed line 60 . a spray nozzle valve 21 is fluidly connected to feed line 60 for selectably providing fresh water to tub 12 when desired . this fresh water is delivered by fresh water spray nozzle 31 via fresh water hose 33 . valves 17 and 19 are openable individually or together to provide a mix of hot and cold water to a selected temperature . upon opening one or both of valves 17 and 19 , fresh water is selectably provided to a series of dispenser valves via feed line 60 . valve 62 selectably provides fresh water to detergent dispenser 63 , valve 64 selectably provides fresh water to bleach dispenser 65 , and valve 66 selectably provides fresh water to softening agent dispenser 67 . as further shown in fig2 the washing machine includes a wash liquid recirculation system . in order to recirculate wash liquid for the recirculating spray wash , tub sump 41 collects wash liquid and is fluidly connected to pump 23 by sump hose 40 . pump 23 is selectably operational to pump liquid from tub sump 41 via pump outlet hose 25 either to recirculating hose 27 or drain hose 29 depending on the position of bidirectional valve 30 . recirculating hose 27 provides recirculating wash liquid to pressure dome 42 , the wash liquid exiting the pressure dome 42 via recirculating spray nozzle hose 48 and being emitted to the wash basket 28 via recirculating spray nozzle 32 . pressure dome 42 provides a head of pressure varying dependent upon the amount of wash liquid contained in the recirculating wash system by maintaining a captured dome of air in communication with the recirculating wash liquid . the pressure dome 42 provides a channel for the captured air to keep in contact with pressure sensor 46 via pressure line 45 . pressure sensor 46 provides optionally either an on / off or a varying or dynamic signal to control 22 via lines 47 , the signal varying dependent on the sensed pressure of the recirculating wash liquid . control 22 also optionally receives a static pressure signal from deepfill transducer dome 50 via lines 52 for signaling the level of wash liquid within wash tub 12 , however the invention disclosed herein may be practiced without use of a deepfill pressure dome . control 22 is further operable to receive input signals via lines 49 , including signals from valves 21 , 62 , 64 and 66 providing on and off times for these valves . by sensing the air pressure within pressure dome 42 , the amount of recirculating wash liquid in the washing machine may be inferred . this information is useful to determine the amount of free water in the washing machine during a recirculating wash . thereby , the amount of clothing in the washing machine may be inferred , which information is useful in order to minimize water and energy usage during a spray pretreatment cycle , stain cycle or other recirculating wash cycle , and further during later or other portions of the cycle . also , the suds lock condition , or absence thereof during portions of a cycle may be determined . suds lock may be prevented by limiting recirculating wash liquid to slightly in excess of clothes saturation . a basic process for the new control scheme of the spray pretreatment portion of the wash cycle is shown in the block diagram 100 in fig3 . the process begins at the commencement of spray treatment 102 by starting monitoring of the suds lock algorithm 104 . the process simply either completes the full cycle if suds lock does not occur or skips through the rest of the pretreatment cycle and onto the next step 106 in the case that suds lock should occur . this process 100 is independent of the method by which the existence of suds lock is determined . several methods can be applied in order to ascertain the existence of suds lock . fig4 a displays a block diagram 108 of the automatic washer containing recirculation hardware where a measure based on the flow rate of the wash liquid recirculation line is used to ascertain when water is added to the recirculation system . the flow rate can be measured in one of a number of known ways . a flow washer 68 contained in detergent dispenser valve 63 controls the flow rate within a predetermined range for a variety of predictable inlet water pressures . limiting flow in this manner allows the flow rate to be inferred based upon the on time of the inlet valve . a flow meter may also be used . finally , the deep fill rate may also be discerned . this intermittent process is due to the dry clothes load absorbing water into the load and thus the system requiring more water to regain the necessary flow rate . a similar approach shown in a block diagram 110 in fig4 b to determine when water needs to be added to the system can be performed by any of various techniques capable of measuring the height of the wash fluid in the sump portion of the tub . alternatively , a pressure sensor may be used to determine whether one or more predetermined pressure levels have been reached . in either case , if the control determines that the necessary wash fluid amount recirculating within the washer is satisfied , the control discontinues adding water by intermittent opening of the water inlet valve . using either of these means shown in fig4 a or 4 b to control the process of adding water to the system , an alternating pattern of the times for the addition of water to the system and not adding water to the system can be gained . fig5 shows such a typical pattern or profile 112 relating to the on and off periods of the inlet valve for the spray pretreatment portion of the automatic wash cycle , based on whether the water level or water pressure detecting means is satisfied . preferably , the control determines the necessary amount of wash liquid as that amount which is slightly in excess of the saturation level for the clothes load . accordingly , as the pretreatment portion of the cycle proceeds as shown in fig5 the control continually monitors the inlet on or off times or both on and off times , or the pressure or water level signals which are used to control the inlet on , off or on and off times . this information , as discussed later herein , may be used to determine whether the clothes washer is experiencing a suds lock condition or some other abnormal condition if the information is outside a certain expected range . as well , however , this information may be used to determine the load size being washed , so that the pretreatment cycle and later portions of the wash cycle may be altered and preferably optimized or adapted to effectively complete the cleaning and rinsing of the clothes , but no more in order to avoid suds lock . by using the measure of load size during the pretreatment cycle , the rest of the pretreatment cycle can be optimized based on the load size information . after the desired water level or pressure is detected as initially satisfied by the control 22 , the washing machine is allowed to continue the normal pretreatment cycle where water is added to the system as requested by the control system for a first predetermined time . the control then identifies the load size in a manner as previously discussed . the inlet valve may be shut off regardless of whether water is called for by the control system when a second predetermined time is reached . this second predetermined time may be defined based on the load size measure . at this time , the pretreatment step is completed and the machine proceeds through the rest of the cycle . the process of not adding water will aid the system in avoiding suds lock which increases the performance of the cycle . in another example of optimizing the rest of the pretreatment cycle based on the load size information , the control system determines the total water fill times at preselected intervals . depending on the total water fill time , a preselected overall cycle time for pretreatment is performed , during which water may be added . the cycle is further optimized by taking into consideration the water level and cycle selected by the user , so that the washer may perform not only according to the load size detected but in accordance with the demands of the user . from the various means of determining load size during the pretreatment portion of the cycle , this information can be applied to control other portions of the cycle . in previous washers , the load size or water level input on the console is the input used to control the amount of water added to the system in the deep fill and the relative agitation rate based on the type of cycle chosen . in the present invention , the load size determined from the pretreatment step can be applied in a similar way to determine water amounts and control the agitation performed during the rest of the wash cycle . for example , the load size information can be used to determine the agitation length and rate , to determine the deep fill wash length , spin time and speed , the deep fill or spray rinse length , spin time and speed , or the number of rinses . an automatic washer incorporating the present invention may preferably include traditional user control inputs such as cycle , water temperature and water level . although the input by the consumer may be taken into consideration to affect the cleaning cycle , the control selectively processes the previously mentioned inlet on , off or on and off , water level or pressure information independently of such user input to determine the size of the clothes load . it is noted that the type of clothes , particularly the variety of materials providing the makeup of the clothes is not of critical importance once the pretreatment cycle is completed , since the load size information gained during the pretreatment cycle is all that is needed to continue the wash process . however , the user input may be considered as part of an algorithm such that the performance of the washer , for example the length of wash time , is not greatly different than consumer expectations for a selected input . in another example of optimizing the rest of the wash cycle based on detected load size , it is a known problem in a vertical axis washer to turn over a large clothes load approaching 17 pounds during a deep fill wash . one difficulty is that after filling the washer to the maximum level and beginning agitation , the large items in the load such as sheets , tablecloths or towels may be displaced above the waterline by the agitator , which physically lowers the water level in the tub . the lowering of the water level in the tub can be anticipated by control 22 or detected via a pressure sensor 46 or 50 and compensated for by adding water to return to the maximum level . alternatively , to address the aforementioned problem , a delayed fill may be used . when the user selects a heavy duty cycle along with maximum water level , for example the water level in the deep fill wash is initially brought to a level slightly below the maximum . the clothes load will be partially submerged , with a portion of the load remaining dry or at most partially saturated on the surface . at this water level , the agitator is allowed to commence turning and will easily pull the dry clothing from the top of the load , moving the clothes down the center of the basket and up the outside in the normal motion . after an initial preselected period , long enough to allow the load to be fully wetted and largely submerged , the washing machine may be filled to the maximum level followed by additional agitation or while continuing to agitate . the preceding process assures that normal rollover of the wash load is achieved as quickly as possible despite the large load . [ 0043 ] fig6 displays a block diagram 118 of the general process for determining whether suds lock has occurred based on selected criteria and suds lock measure information . this diagram is independent of chosen measurement technique . several sets of criteria are satisfactory for the case of using information about the inlet water valve cycling information measurement of suds lock . the following table contains several functional criteria : table suds lock criteria table for inlet water valve based measures . suds lock measure suds lock criteria case ( 1 ) t on ( 0 ) 10 - 20 sec . case ( 2 ) t on ( 0 )/( t on ( 1 )) n case ( 3 ) t on ( 0 )/( t on ( 1 ) + t on ( 2 )) n case ( 4 ) t on ( 0 )/( t on ( 1 ) + t on ( 2 ) + t on ( 3 )) n as part of the suds lock criteria , note that if t on ( 2 ), t on ( 3 )= 0 , then let t on ( 2 )= t on ( 3 )= t on ( 1 ). the optimum value for n is approximately 2 . the algorithm also incorporates a minimum time , t min — check , which to start checking for suds lock to occur . this time could be set between 0 sec and 40 sec . in addition to satisfying the suds lock criteria , there also is a time t on — min which sets a minimum time of addition which it must be above to be considered as suds lock condition . typical ranges for this are between 2 to 4 sec . other ways exist for detecting suds lock in the washing machine . fig7 displays a block diagram 120 that shows the components which make up the drive system and the corresponding means for detecting the existence of suds lock through each component . for the basket , the means for detecting the existence of suds lock 122 may be summarized as follows . a first suds lock detection method is by measurement of the basket rpm ( by magnetic , optical or ultrasonic means ) after the basket is brought up to normal operating speed . when basket reduces rpm by 70 % from the steady state value , suds lock has occurred . a second suds lock detection method is by measurement of the basket or tub acceleration after the basket is brought up to normal operating speed . vibration of the basket or tub should be fairly constant or increasing during the spray pretreatment portion of the cycle unless suds lock occurs . for the drive system , the means for detecting the existence of suds lock 124 may be summarized as follows . a first suds lock detection method is by measuring the temperature of the clutch . when a suds lock condition occurs , the temperature of the clutch will increase significantly during suds lock condition . a second suds lock detection method is by measuring torque on drive components . when a suds lock condition occurs , a significant drop in torque will occur . for the motor , motor control and supply power , the means for detecting the existence of suds lock 126 , 128 and 129 may be summarized as follows . a first suds lock detection method is by measurement of motor rpm using a tachometer which is built into the motor . when the basket reduces rpm by 70 % from steady state value , suds lock has occurred . a second suds lock detection method is by measurement of the current or wattage going to the motor measured at motor . when current or wattage increase by a given percentage , suds lock has occurred . a third suds lock detection method is by measurement of total current or wattage going to the entire machine , since motor current is by far most significant component . when current or wattage increase by a given percentage , suds lock has occurred . a fourth suds lock detection method is by measurement using an opto coupler for obtaining information about drop in the torque draw of the motor . a fifth suds lock detection method is by measurement using a ferrite core sensor for obtaining information about the drop in the torque draw of the motor . in the latter two methods , when torque drops by a given amount , suds lock has occurred . in addition to measurements which can be made on the drive system , measurement of the height of the suds in the system can be made . fig8 displays a block diagram 130 illustrating the components which are to be observed , that is the tub or the basket , and the means for detecting the existence of suds lock through each component . specific embodiments of such techniques to measure the height of the suds during a spray pretreatment portion of the wash cycle may include a ) providing a conductivity strip along the side of the basket ; b ) ultrasonic measurement , or c ) optical measurement . feedback provided to the control in each case indicates an oversuds condition , from which it may be inferred that suds lock has occurred . in addition to the occurrence of suds lock , there are a few special conditions which can as be detected by the control . although other detection means may be used , in these examples the control monitors the inlet valve on time over a prescribed check time . one such condition occurs when the machine is started in pretreatment portion of the cycle with much more water than necessary . fig9 displays the process by which the inlet valve is controlled based on measure information for the special case of having too much added water in the system at the start of the cycle . this condition can occur for the reasons that the user starts the machine into normal deepfill ( without prefill ), then stops the machine after a good amount of water has filled the machine ( over 2 gallons ) and the machine is switched and restarted in pretreatment cycle ; the user puts a very soggy clothes load into the machine or the user physically adds water into the machine with the load . for all these conditions , the time by which the machine calls for water will be very small . thus by monitoring the time by which the control system calls for water with respect to some length of checking time , this condition can be ascertained . if such a case should occur , the pretreatment cycle may be ended and the rest of the cycle is continued . another special condition can be detected by the primary means of monitoring the inlet valve on time over a prescribed check time . one such condition may occur when the washing machine is in the recirculating spray pretreatment portion of the cycle and the machine continuously calls for water without stopping . [ 0056 ] fig1 displays a graphic depiction 140 of the process by which the inlet valve is controlled based on measured information in the special case where the recirculation flow in the system at the start of the cycle is not satisfied for some finite period of time . in addition to sensing this condition based on the recirculation flow being not satisfied , additional information can be gained from the deepfill pressure transducer for the air dome 50 in the tub . for the case where the deepfill pressure transducer does not sense the existence of a sizable amount of water in the tub , a variety of machine conditions may be a cause . under the category of washing machine component failures , the failures can include a sizable leak in the tub or the recirculation or drain hose system ; one or more bad inlet valves not adding water to system , or a recirculation diverter valve failed or stuck in the drain direction . under the category of non - washing machine component failures might be a long fill due to very low line pressure . for the case where the deepfill pressure transducer is sensing the existence of a sizable amount of water in the tub , the following machine conditions may be a cause , all of which are washing machine component failures . the failures can include a bad recirculation pressure switch , a pump or motor failure , a severe recirculation line clog or the recirculation pressure hose is disconnected . in case of such failure , the control 22 will end the cycle and indicate the failure condition to the consumer . as is apparent from the foregoing specification , the invention is susceptible of being embodied with various alterations and modifications which may differ particularly from those that have been described in the preceding specification and description . it should be understood that we wish to embody within the scope of the patent warranted hereon all such modifications as reasonably and properly come within the scope of the contribution to the art .	3
a method and a system are provided for managing packet data interconnections in mobile communications . the method and system help to avoid a pdsn handoff in ms data communications when an ms moves between areas associated with different pcfs . in a first general approach , each ms has a permanently assigned pdsn . the pcf obtains this address ( and backup addresses ) from the home location register ( hlr ) for a mobile subscriber when the subscriber registers and authenticates with the network . in such a case , all of the network providers interconnect the ip radio networks between all pcfs and pdsns regardless of geographical or administrative concerns / boundaries . changes are made to the hlr and to the messaging between the bsc / msc ( hlr proxy ) and the pcf . a static mapping between mobile subscribers and available pdsns is maintained . the hlr may also identify a backup pdsn address for each ms in case the primary pdsn for an ms is not available . in a second general approach , an administratively cooperative group of pcfs use a signaling scheme among themselves to identify an appropriate pdsn to service each a10 / a11 mobile subscriber session . a large amount of per session storage and complex signaling is involved ; each pcf is aware of every currently established ms session within an administrative domain . in a simplification , each pcf within an administrative domain is configured with a complete list of available pdsns and each pcf applies the same or effectively the same hashing function that maps mobile session identification information onto the list of pdsns . information that may be used to identify a potential mobile session includes the following “ three number set ”: mn type , mn id , and mn session reference id . in a specific implementation , each pcf selects the primary pdsn to terminate a ms session by hashing the three number set onto the list of pdsns and first offering the session to the selected pdsn ; if the session is not accepted by the selected primary pdsn , any other available pdsn can be used ( the pcf may give a preference to a pdsn suggested by the original pdsn that did not accept the offered session ). in such a case , non - overlapping administrative pcf areas are defined , and it may be necessary to address how to handle taking pdsns in and out of service , and how to handle dynamic load balancing with a lack of feedback from pdsns . an inter - pcf signaling protocol may be used , or new pcf - pdsn signaling messages may be provided so that the pcf has access to information available only within the pdsn , such as user profile and pdsn administrative state information , which may be needed or helpful . in a third general approach , described in more detail below , existing capabilities of pcfs are used by enhanced pdsn software to allow the pdsn software to help avoid inter - pdsn handoffs . in particular , in a specific implementation , the r - p registration request error code 0 × 88 ( indicating “ registration denied == administratively denied ”), is used by the enhanced pdsn software to help avoid pdsn handoffs . when this error code is returned by the pdsn in response to the pcf issuing a registration request , the pdsn may suggest another pdsn to try instead of itself . using this mechanism , the pdsn can suggest a specific pdsn to terminate a session for a mobile subscriber . a variety of techniques are described below for selecting a specific pdsn to suggest to a pcf performing a registration request . the techniques allow an ongoing data call that has changed pcfs to continue to be directed to the same pdsn , which helps to avoid pdsn handoffs . a first technique for selecting a specific pdsn to suggest to a pcf includes configuring each pdsn with two addresses ( also known as ports ): an r - p redirection address and an r - p service address . the pcfs are configured only with the addresses that correspond to r - p redirection addresses . when a pcf contacts the pdsn for the first time , the pdsn selects the specific pdsn to handle the new session for the mobile subscriber based on the three number set ( mn type , mn id , and mn session reference id ). the three numbers are used in a pdsn selection procedure to select an “ optimal ” pdsn . the pdsn selection procedure may be or include a hashing function to a preconfigured ( or discovered ) list of pdsn service addresses . an example follows : both pdsns are configured with a pdsn service address list as follows : the hashing function computes an index into the pdsn service address list ( an index of 0 corresponds to 10 . 1 . 1 . 1 ; an index of 1 corresponds to 10 . 2 . 2 . 1 ). a pcf is configured with the following list of pdsn addresses : ( 10 . 1 . 1 . 2 , 10 . 2 . 2 . 2 ). a call for ms # 1 comes in , having the following characteristics : the pcf sends an r - p registration request to the first pdsn in its list : pdsn - a ( 10 . 1 . 1 . 2 ). pdsn - a computes h ( 1 , 978851110 , 1 )= 0 , which indicates that the service address for the call is to be 10 . 1 . 1 . 1 . the service address 10 . 1 . 1 . 1 represents pdsn - a itself , which therefore accepts the call . a call for ms # 2 comes in , having the following characteristics : the pcf sends an r - p registration request to the first pdsn in its list : pdsn - a ( 10 . 1 . 1 . 2 ). pdsn - a computes h ( 1 , 978851111 , 1 )= 1 , which indicates that the service address for the call is to be 10 . 2 . 2 . 1 . since the service address 10 . 2 . 2 . 1 does not correspond to pdsn - a , a registration reject message with error code 0 × 88 is sent back to the pcf with the home agent field of the message set to 10 . 2 . 2 . 1 . the pcf sends a new registration request to pdsn - b 10 . 2 . 2 . 1 . since the request is sent to the service address , pdsn - b does not execute the hashing function ; instead , pdsn - b starts r - p service if sufficient resources are available . an example procedure is illustrated in fig4 - 5 . ( for simplicity , fig4 does not show the elements between the ms and the pcf shown in fig3 .) each of pdsns pdsn1 , pdsn2 , pdsn3 , pdsn4 has an r - p redirection address and an r - p service address ( such as , in the case of pdsn1 , address a and address b , respectively ). pcf1 and pcf2 are configured to use only the r - p redirection addresses for initial contact with the pdsns . each pdsn runs software sw that operates as now described . initially , ms is in an area covered by pcf1 . when a data call involving ms is initiated , pdsn1 receives a connection request ( an a11 - registration request message ) from pcf1 at pdsn1 address a ( step 1010 ). the pdsn corresponding to ms ( pdsn2 in this example ) is determined ( step 1020 ). if the pdsn corresponding to ms is the current pdsn ( in this example , if the corresponding pdsn were pdsn1 ), the connection request is accepted and the procedure ends ( step 1030 ). a response ( an a11 - registration reply with a reject result code ‘ 88h ’) is transmitted to pcf1 indicating the r - p service address ( here , address d ) of the corresponding pdsn . ( step 1040 ). if ms roams to the area served by pcf2 , pcf2 sends a connection request to one of the pdsns ( here , pdsn4 , at address g ). software sw on pdsn4 determines , as the same software sw on pdsn1 did above , that the pdsn corresponding to ms is pdsn2 , and responds to pcf2 indicating a redirection to address d of pdsn2 . thus , ms remains associated with pdsn2 despite having moved from an area served by pcf1 to an area served by pcf2 . in at least two ways , the arrangement described above helps to reduce or prevent unnecessary redirection communications between the pcfs and the pdsns . first , by accepting a connection request when the pdsn corresponding to ms is the current pdsn , the software sw avoids causing the pcf to redirect the request back to the same pdsn . second , by providing for separate redirection and service addresses on each pdsn , the software sw can be enhanced to detect when a request is the result of a redirection , and thereby avoid causing the pcf to perform another redirection , back to the same pdsn . according to the enhancement , since the pcfs are configured with the redirection addresses only , when a request comes into the pdsn via the service address instead of the redirection address , the software sw accepts the request without further analysis , because it is assumed that the pcf generates a request to the service address only as a result of a redirection response . an alternative pdsn selection procedure includes dynamic management of the key - space generated by the hashing function . the following is a description of a procedure 6000 ( fig6 ) suitable for the dynamic management of key space . a key space may consist of a finite integral range 0 . n . this key space may correspond directly to the three number set ( mn type , mn id , and mn session reference id ) or to the result of a hash function applied to the three number set . first , the pdsns within a domain are directed to discover each other ( step 6010 ) and agree on membership to the administrative pdsn domain ( step 6020 ). next , the key space is evenly partitioned among the operationally active pdsns within the administrative domain ( step 6030 ), keeping intact any active sessions . each pdsn maintains a complete view of the partitioned key space ( step 6040 ) and attempts to minimize or reduce the number of holes in the space ( step 6050 ) by acquiring key space from peers as sessions are added locally . an example follows : both pdsns are configured with an available pdsn service address list ( 10 . 1 . 1 . 1 , 10 . 2 . 2 . 1 ), a pdsn service list having 65536 entries ( 10 . 1 . 1 . 1 & lt ; repeats 32768 times & gt ;, 10 . 2 . 2 . 1 & lt ; repeats 32768 times & gt ;), and a hashing function the hashing function computes an index into the 65536 entry pdsn service list . to join the existing two pdsns , another pdsn solicits a list of free entries from each pdsn , intersects the lists , and asserts ownership of unused slots by sending an request ownership message to each pdsn . after receiving a positive acknowledgement from each pdsn , the other pdsn may send an assert ownership message to each pdsn . as pdsns are added or removed or added and removed , and as load changes , it may be necessary or helpful to re - partition the key space dynamically among the pdsns . in a specific implementation , such re - partitioning is performed in a centralized fashion by a procedure 7000 ( fig7 ) as follows . a designated “ master ” pdsn is directed to propose various repartitions of the key space ( step 7010 ). in such a case , each pdsn informs the master pdsn how many key conflicts the pdsn would have with a proposed partition ( step 7020 ) and , depending on the circumstances , the master pdsn proposes further refinements of the key space ( step 7030 ) by further splitting contentious key ranges . when an acceptable repartition of the key space is reached , each pdsn switches to the new key space ( step 7040 ). it is desirable to avoid unresolved key conflicts , which may result in failure to achieve transparent inter - pdsn mobility in the simple ip case . a second technique for selecting a specific pdsn to suggest to a pcf shares some aspects with the first technique . in this case , according to a procedure 8000 ( fig8 ), an external server such as a remote authentication dial - in user service ( radius ) server is used to select an “ optimal ” pdsn to handle an r - p session ( step 8010 ), and return the “ optimal ” pdsn selection back to the pcf ( step 8020 ). an advantage is that this technique takes advantage of the existing radio resource records that identify the last pdsn that handled a session corresponding to a particular three number set ( mn type , mn id , and mn session reference id ). an external server may also provide load balancing services or map specific users to specific pdsns . the technique ( including one or more of the procedures described above ) may be implemented in hardware or software , or a combination of both . in at least some cases , it is advantageous if the technique is implemented in computer programs executing on one or more programmable computers , such as a line - card or a control processor of a pdsn or a pcf , or a radius server , hlr , or vlr running on a general purpose computer , or a computer running or able to run microsoft windows 95 , 98 , 2000 , millennium edition , nt , xp ; unix ; linux ; or macos ; that each include a processor such as an intel pentium 4 , a storage medium readable by the processor ( including volatile and non - volatile memory and / or storage elements ), at least one input device such as a keyboard , and at least one output device . program code is applied to data entered using the input device to perform the method described above and to generate output information . the output information is applied to one or more output devices such as a display screen of the computer . in at least some cases , it is advantageous if each program is implemented in a high level procedural or object - oriented programming language such as c , c ++, java , or perl to communicate with a computer system . however , the programs can be implemented in assembly or machine language , if desired . in any case , the language may be a compiled or interpreted language . in at least some cases , it is advantageous if each such computer program is stored on a storage medium or device , such as rom or magnetic diskette , that is readable by a general or special purpose programmable computer for configuring and operating the computer when the storage medium or device is read by the computer to perform the procedures described in this document . the system may also be considered to be implemented as a computer - readable storage medium , configured with a computer program , where the storage medium so configured causes a computer to operate in a specific and predefined manner . other embodiments are within the scope of the following claims . for example , one or more of the actions performed by the software sw may be performed by another entity , such as the pcf or the msc . in such a case , the other entity may determine the pdsn corresponding to the ms .	7
the following description is of the best embodiments presently contemplated for carrying out this invention . this description is made for the purpose of illustrating the general principles of this invention and is not meant to limit the inventive concepts claimed herein . referring now to fig1 , there is shown a disk drive 100 embodying this invention . as shown in fig1 , at least one rotatable magnetic disk 112 is supported on a spindle 114 and rotated by a disk drive motor 118 , all of which are mounted within a housing 101 . the magnetic recording on each disk is in the form of annular patterns of concentric data tracks ( not shown ) on the magnetic disk 112 . at least one slider 113 is positioned near the magnetic disk 112 , each slider 113 supporting one or more magnetic head assemblies 121 . as the magnetic disk rotates , slider 113 moves radially in and out over the disk surface 122 so that the magnetic head assembly 121 can access different tracks of the magnetic disk where desired data are written . each slider 113 is attached to an actuator arm 119 by way of a suspension 115 . the suspension 115 provides a slight spring force which biases slider 113 against the disk surface 122 . each actuator arm 119 is attached to an actuator means 127 . the actuator means 127 as shown in fig1 may be a voice coil motor ( vcm ). the vcm comprises a coil movable within a fixed magnetic field , the direction and speed of the coil movements being controlled by the motor current signals supplied by controller 129 . during operation of the disk storage system , the rotation of the magnetic disk 112 generates an air bearing between the slider 113 and the disk surface 122 which exerts an upward force or lift on the slider . the air bearing thus counter - balances the slight spring force of suspension 115 and supports slider 113 off and slightly above the disk surface by a small , substantially constant spacing during normal operation . the various components of the disk storage system are controlled in operation by control signals generated by control unit 129 , such as access control signals and internal clock signals . typically , the control unit 129 comprises logic control circuits , storage means and a microprocessor . the control unit 129 generates control signals to control various system operations such as drive motor control signals on line 123 and head position and seek control signals on line 128 . the control signals on line 128 provide the desired current profiles to optimally move and position slider 113 to the desired data track on disk 112 . write and read signals are communicated to and from write and read heads 121 by way of recording channel 125 . with reference to fig2 , the orientation of the magnetic head 121 in a slider 113 can be seen in more detail . fig2 is an abs view of the slider 113 , and as can be seen the magnetic head including an inductive write head and a read sensor , is located at a trailing edge of the slider . the above description of a typical magnetic disk storage system and the accompanying illustration of fig1 are for representation purposes only . it should be apparent that disk storage systems may contain a large number of disks and actuators , and each actuator may support a number of sliders . fig3 and 4 show a schematic view of a magnetic read head 300 . fig3 is a view of the sensor 300 as seen from the air bearing surface ( abs ), and fig4 is a side cross sectional view as seen from line 4 - 4 of fig3 . the magnetic read head 300 includes a sensor stack 302 that is sandwiched between upper and lower magnetic shields 304 , 306 that can be constructed of an electrically conductive , magnetic material such as nife so that they can function as electrical leads as well as magnetic shields . the sensor stack 302 includes a first sensor stack portion ( lower portion ) 308 and a second sensor stack portion ( upper portion ) 310 . as shown in fig3 , the lower portion 308 has a width that defines a sensor track - width tw , whereas the upper portion 310 can be much wider . the lower sensor portion 308 can include a magnetic free layer 312 that can be formed on a seed layer 314 . the magnetic free layer 312 can include materials such as nife , cofe and / or a heusler alloy . a non - magnetic spacer or barrier layer 316 can be formed over the magnetic free layer 312 . the non - magnetic spacer layer 316 can be a magnetically insulating material such as mgo , if the sensor 300 is a tunnel junction sensor or can be an electrically conductive spacer layer such as agsn if the sensor 300 is a giant magnetoresistive ( gmr ) sensor . the lower sensor portion 308 also includes a first portion of a first magnetic pinned layer ( ap1 first portion ) 318 a , which can be constructed of a magnetic material such as nife or cofe . the layer 318 a will be discussed in greater detail herein below . the sensor stack 302 includes a pinned layer structure 320 that include a first pinned magnetic layer ( ap1 ) 318 and second pinned magnetic layer 322 and an antiparallel coupling layer 324 sandwiched between the ap1 layer 318 and ap2 layer 322 . the antiparallel coupling layer 324 can be formed of a material such as ru . as seen in fig3 , the ap1 layer 318 is formed as two magnetic layers , a first layer 318 a and a second layer 318 b . the first layer 318 a is part of the lower sensor stack portion 308 , while the second layer 318 b is part of the upper sensor stack portion 310 . also , it can be seen that the first layer 318 a has a width that is within the track - width tw , whereas the second layer 318 b extends laterally beyond the track - width tw . a method for manufacturing such pinned layer structure 320 with the novel bi - layer ap1 layer 318 will be described in greater detail herein below . both the ap1 and ap2 layers can be constructed of one or more magnetic materials such as cofe , nife or combinations of these . with reference to fig4 , the upper sensor stack portion 310 includes layer of antiferromagnetic material afm layer 326 that is formed over the pinned layer structure 320 , opposite the free layer 312 . as seen in fig4 , the afm layer 326 is recessed from the abs , and a magnetic pedestal 402 is disposed between the afm layer 326 and the abs and also between the ap2 layer 322 and the upper shield 306 . the afm layer 326 can be a material such as irmn or ptmn and is exchange coupled with the ap2 layer 322 . the exchange coupling between the afm layer 326 and the ap2 layer 322 pins the magnetization of the ap2 layer in a direction that is perpendicular to the abs . the antiparallel coupling between the ap1 layer 318 and ap2 layer 322 pins the magnetization of the ap1 layer 318 in a direction that is also perpendicular to the abs and that is opposite to that of the ap2 layer 322 . a capping layer 328 can be formed over the afm layer 326 to protect the underlying layers during manufacture and to magnetically decouple the sensor stack 302 from the upper shield 306 . the space behind the first sensor stack portion 308 can be filled with a non - magnetic , electrically insulating fill layer such as alumina 404 . the magnetic pedestal 402 can be constructed of a material similar to that of the upper shield 306 , such as nife . the magnetic pedestal 402 can be magnetically coupled with the magnetic shield 306 so that it functions as part of the magnetic shield . as a result , the afm layer 326 and capping layer 328 advantageously do not contribute to the read gap , resulting in increased data density . therefore , the read gap g is the distance between the top of the lower shield 304 and the bottom of the pedestal 402 as shown fig4 . with reference again to fig3 , the sensor 300 can include magnetic bias layers 330 , 332 at either side of the sensor stack 302 . the bias layers 330 , 332 provide a magnetic bias field that biases the magnetization of the magnetic free layer 312 in a direction parallel with the air bearing surface ( abs ). the bias layers 330 , 332 can be separated from the sensor stack 302 and bottom shield by a thin , non - magnetic , electrically insulating material such as alumina 334 . the magnetic bias structures 330 , 332 can be constructed of a high coercivity , hard magnetic material that keeps its magnetization as a result of its intrinsic hard magnetic properties . alternatively , the bias layers 330 , 332 can be constructed of a soft magnetic material . in that case , the magnetization of the bias structure can be maintained by an exchange coupled layer of antiferromagnetic material formed there - under . for example , a layer of nonmagnetic material such as ru 336 , a layer of antiferromagnetic material such as irmn 338 formed over the nonmagnetic material 336 and a magnetic layer 340 formed over the layer of antiferromagnetic material 338 . the non - magnetic layer 336 magnetically decouples the layer 338 from the bottom shield 304 . the antiferromagnetic layer 338 is exchange coupled with the magnetic layer 340 to pin its magnetization . this pinned magnetization of the layer 340 then maintains the magnetization of the bias layers 330 , 332 in a desired direction parallel with the air bearing surface . fig5 - 25 illustrate a method for manufacturing a magnetic sensor such as the sensor 300 , and further illustrate the advantages provided by such a sensor structure . with particular reference to fig5 , a bottom magnetic shield 502 is formed of a material such as nife . then , an optional series of layers can be deposited to maintain magnetization of a yet to be formed bias structure . these layers can include : a non - magnetic decoupling layer such as ru 504 deposited onto the bottom shield ; a layer of antiferromagnetic material 506 deposited over the decoupling layer 504 ; and a layer of magnetic material such as nife 508 deposited over the layer of antiferromagnetic material 506 . after depositing the optional layers 504 , 506 , 508 , a first series of sensor layers 510 is deposited . this first series of sensor layers 510 can correspond to the bottom sensor stack portion 308 described above with reference to fig3 . the first series of sensor layers 510 can include : a seed layer 512 ; a magnetic free layer 514 formed over the seed layer 512 , a non - magnetic barrier or spacer layer 516 deposited over the magnetic free layer 514 and a first portion of a magnetic first pinned layer ( first portion of an ap1 layer ) 518 formed over the non - magnetic spacer or barrier layer 516 . then , a first mask structure 520 is formed over the first series of sensor layers . the configuration of the mask 520 can be better understood with reference to fig6 which shows a top down view as seen from line 6 - 6 of fig5 . as can be seen in fig6 the mask 520 extends over an air bearing surface plane denoted abs and extends to a back edge 522 that is configured to define a lower sensor stack stripe height . with reference now to fig7 , a first ion milling is performed to remove layers not protected by the mask 520 . the ion milling can be performed until the bottom shield 502 has been reached . then , a non - magnetic , electrically insulating fill layer such as alumina 802 is deposited and a planarization process performed , leaving a structure as shown in fig8 . the planarization can include performing a chemical mechanical polishing and may include a mask liftoff process . as can be seen from the above , the masking and milling process that defines the track - width tw is performed on a much thinner structure ( the series of sensor layers 510 ) than would be the case if rest of the pinned layer structure and antiferromagnetic pinning layer were to be included . this advantageously allows the masking and ion milling to define a much smaller track with than would otherwise be possible . with reference now to fig9 and 10 , a second mask structure 902 is formed . fig1 is a top down view as seen from line 10 - 10 of fig9 . the mask 902 has an opening 904 that is configured to define a stripe height of a lower sensor stack portion . then , with reference to fig1 , a second ion milling is performed to remove material not protected by the mask 902 . this ion milling can be terminated prior to removal of layers 504 , 506 , 508 as shown in fig1 . with reference to fig1 , a thin , nonmagnetic , electrically insulating layer 1202 is deposited . the layer 1202 can be a material such as sin and is preferably deposited by a conformal deposition process such as atomic layer deposition or ion beam deposition . then , with reference to fig1 , a directional material removal process such as ion milling is performed in such a manner to remove horizontally disposed portions of the insulation layer 1202 leaving vertical insulation side walls as shown in fig1 . then , with reference to fig1 , a magnetic bias material 1402 is deposited followed by a cmp stop layer / bias capping layer 1404 . the bias material 1402 can be nife and the capping layer can be carbon or diamond like carbon . the insulation side walls 1202 passivate the sensor layers 510 , while leaving the magnetic layer 508 exposed to exchange couple with the magnetic bias layer 1402 . then , a chemical mechanical polishing ( cmp ) can be performed to planarize the structure and remove the second mask 902 , leaving a structure as shown in fig1 . with reference now to fig1 , a glancing angle mill , such as at an angle of 50 degrees - 75 degrees is performed to expose layer 518 then a second series of sensor layers 1602 is deposited . these layers 1602 can correspond with the upper sensor stack portion 310 described above with reference to fig3 and 4 . the series of sensor layers include a magnetic layer 1604 that forms a second portion of the ap1 layer . an anti - parallel coupling layer such as ru 1606 is deposited over the magnetic layer 1604 . another magnetic layer ( ap2 ) layer 1608 is deposited over the anti - parallel coupling layer 1606 . a layer of antiferromagnetic material ( afm layer ) such as irmn or ptmn 1610 is deposited over the ap2 layer 1608 , and a capping layer 1612 is deposited over the afm layer 1610 . the capping layer can include one or more of ta and ru . then , with reference to fig1 , a third mask structure 1702 is formed over the second series of sensor layers 1602 . the configuration of the mask 1702 can be seen more clearly with reference to fig1 , which shows a top - down view as seen from line 18 - 18 of fig1 . the mask 1702 defines the outer boundaries ( stripe height and width ) of the second series of sensor layers 1602 . then , with reference to fig1 , a third ion milling is performed to remove material not protected by the third mask 1702 . the third ion milling can be performed until the bottom shield 502 has been reached . then , an electrically insulating , nonmagnetic fill layer 2002 is deposited and a planarization process such as chemical mechanical polishing is performed , leaving a structure as shown in fig2 . with reference now to fig2 and 22 , a fourth mask structure 2101 is formed having an opening 2104 located in a region at the air bearing surface . fig2 is a side cross sectional view as seen from line 22 - 22 of fig2 . with reference to fig2 , an ion milling is performed just sufficiently to remove portions of the capping layer 1612 and afm layer 1610 that are not protected by the mask 2102 , stopping at the ap2 layer 1608 . then , a magnetic material 2402 is deposited and a planarization process such as chemical mechanical polishing is performed , leaving a structure as shown in fig2 with the magnetic material 2402 forming a pedestal . then , with reference to fig2 , an upper magnetic shield 2502 is formed , such as by electroplating . the upper magnetic shield 2502 is stitched to and magnetically connected with the magnetic pedestal . 2402 . while various embodiments have been described above , it should be understood that they have been presented by way of example only and not limitation . other embodiments falling within the scope of the invention may also become apparent to those skilled in the art . thus , the breadth and scope of the invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents .	7
referring to fig1 , a transmitter system 10 may include a distributed laser 12 coupled to a data signal source 14 that supplies a modulation signal encoding binary data . the laser 12 may be a distributed bragg reflector ( dbr ) laser , distributed feed back ( dfb ) laser , or other laser having one or more reflectors formed using a grating formed in or adjacent to a waveguide . the output of the laser 12 may be transmitted through an optical spectrum reshaper ( osr ) 16 . the output of the osr 16 may be transmitted through a fiber 18 to a receiver 20 . the osr 16 converts a frequency modulated signal from the laser 12 to an amplitude modulated signal . in some embodiments , the output of the laser 12 is both frequency and amplitude modulated , such as adiabatically chirped pulses produced by a directly modulated dbr laser or distributed feedback ( dfb ) laser . the output of the osr may also remain somewhat frequency modulated . the osr 16 may be embodied as one or more filters , including , but not limited to , a coupled multi - cavity ( cmc ) filter , a periodic multi - cavity etalon , a fiber bragg grating , a ring resonator filter or any other optical element having a wavelength - dependent loss . the osr 16 may also comprise a fiber , a gire - tournois interferometer , or some other element with chromatic dispersion . in some methods of use the laser 12 is modulated between a peak and a base frequency in order to encode a data signal in the output of the laser 12 . in some embodiments the output of the laser 12 will also be modulated between peak and base amplitudes . the osr 16 has a transmission function aligned with the base and peak frequencies such that the base frequency is attenuated more than the peak frequency in order to improve the extinction ratio of the output of the osr 16 . referring to fig2 and 3 , various dbr lasers 12 may be used with the present invention . although fig2 and 3 illustrate two examples , they are not limiting of the type of dbr lasers that may benefit from embodiments of the present invention . referring specifically to fig2 , a dbr section 22 receives light from a gain section 24 . the laser 12 may include other sections such as a phase control section 26 and / or electro - absorption section 28 . the gain section 24 and other sections such as the phase control section 26 and electro - absorption section 28 may be positioned between the dbr section 22 and a filter 30 . in some embodiments the filter 30 may be embodied as another dbr section . referring to fig3 , another example of a dbr laser is a tunable twin guide sampled grating dbr ( ttg - sg dbr ), which includes a dbr section 22 embodied as two sampled gratings 22 a , 22 b . the sampled gratings 22 a , 22 b are coupled to the gain section 24 by means of a multi - mode interface ( mmi ) 32 . the sampled gratings 22 a , 22 b preferably have reflection peaks having a different free spectral range such that the reflection peaks of the combined sampled gratings 22 a , 22 b may be tuned using the vernier effect . in a dbr laser , such as those shown in fig2 and 3 , a grating structure within the dbr section 22 defines reflection peaks that control which wavelengths of light are reflected back into the gain section 24 . the dbr section 22 therefore determines the output spectrum of the laser . the reflection peaks of the dbr section 22 may be shifted by means of current injection or heating due to the thermo - optic effect in order to control the output spectrum of the laser . although current injection is a widely used means for tuning , it tends to degrade the materials of the dbr section over time , which limits the useful life of transmitters using current injection . temperature tuning does not shorten the useful life of a dbr laser to the same extent as current injection . however , prior temperature tuning systems and methods have high power requirements , slow frequency response , and narrow tuning bands . referring to fig4 , in some embodiments , a dbr section 22 may be formed in a waveguide 38 that is separated from a base substrate 40 by an air gap . in the illustrated embodiment , the waveguide 38 is formed in a raised substrate 42 supported above the base substrate by pillars 44 . the pillars have a height 46 that defines the height of the air gap between the raised substrate 42 and the base substrate 40 . the separation 48 between the pillars 44 is preferably much larger than the width 50 of the pillars 44 such that a majority of the length of the dbr section 22 is separated from the base substrate by an air gap . in a preferred embodiment , at least 90 percent of the length of the dbr section 22 parallel to the direction of propagation of light within the dbr section 22 is separated from the base substrate by an air gap . the material forming the pillars 44 may be the same as , or different from , the material forming the base substrate 40 and / or raised substrate 42 . for example , the pillars 44 may be formed of indium phosphide ( inp ), indium gallium arsenide phosphide ( ingaasp ), or the like . in some embodiments 1 . 3 q ingaasp is used for the pillars 44 due to its highly insulative properties . the raised portion 42 of the substrate may include a heated portion 52 and a non - heated portion 54 . the dbr section 22 is preferably located in the heated portion whereas the gain section 24 , phase section 26 , and / or electro - absorption section are located in the un - heated portion 54 . in some embodiments , the dbr section 22 includes a sampled grating including gratings formed only at discrete areas 56 along the waveguide 38 . in such embodiments , heaters 60 may be formed only on the discrete areas 56 . the heaters 60 may be embodied as platinum stripe heaters . in such embodiments , metal layers 62 , such as gold , may be deposited between the discrete areas 56 to reduce heating of other portions of the waveguide 38 . in one embodiment , parallel to the optical axis of the waveguide 38 , the heaters 60 have a length of about 10 μm and the metal layers 62 have a length of 70 μm . in some embodiments , the pillars 44 are located at or near a mid point between discrete areas 56 , such as between 40 and 60 percent of a distance between the pillars . the air gap insulates the waveguide 38 from the base substrate 40 and reduces the power required to raise the temperature of the waveguide 38 in order to tune the response of the dbr section 22 . it also reduces the time required to raise the temperature of the waveguide 38 . referring to fig5 a through 5g , an air gap may be created between the raised substrate 42 and the base substrate 40 by performing the illustrated steps . referring specifically to fig5 a , an n - inp substrate 70 is formed having an ingaasp layer 72 and n - inp layer 74 formed thereon . the ingaasp layer 72 may be about 0 . 1 μm thick and the n - inp layer is preferably 30 nm thick , however other thicknesses are also possible . the ingaasp may have a bandgap wavelength of 1 . 3 μm . referring to fig5 b , silicon oxide ( sio 2 ) areas 76 may then be formed on the upper n - inp layer 74 . a gap 78 between adjacent areas 76 may have a width of 3 μm . as is apparent below , the width of the gap determines the width 50 of the pillars 44 . the areas 76 have a length 80 that defines the length of the air gap between the raised substrate 42 and base substrate 40 . thus , the width of the gap 78 may be less than 90 percent of the length 80 . in the illustrated embodiment , the areas 76 have a width of about 10 μm perpendicular to the optical axis of the waveguide 38 formed in subsequent steps and a length of about 30 μm parallel to the optical axis of the waveguide 38 . in the illustrated example , the gap 78 is about equal to 3 μm in the direction parallel to the optical axis of the waveguide 38 . other values may be used depending on the pillar size and air gap length desired . referring to fig5 c , the layers of the previous figures are then selectively etched to form the structure of fig5 c , wherein portions of the n - inp layer 74 and ingaasp layer 72 that are not covered by the sio 2 areas 76 are etched away . referring to fig5 d , another n - inp layer 82 is grown over the remaining layers . in some embodiments the sio 2 areas 76 are also removed . referring to fig5 e , layers for formation of the dbr laser 12 may then be formed on the n - inp layer 82 . various layers may be grown as known in the art to form any of various types of lasers and grating structures known in the art . as an example , a multi - quantum well ( mqw ) layer 84 and p - inp layer 86 are grown as illustrated . in the illustrated example , the n - inp layer 86 has a thickness of about 3 μm . referring to fig5 f , an active mqw portion 88 and passive dbr portion 90 may then be formed coupled to one another by a butt joint according to known methods . fe - inp blocking portions 92 a , 92 b may be formed along the mqw portions 88 and passive dbr portion 90 as known in the art . the passive dbr portion 90 may be embodied as a sampled grating dbr . however , other structures may be formed as known in the art to form other laser and / or grating types referring to fig5 g , the layers may then be selectively etched on either side of the dbr portion 90 . the etching may be performed using dry etching , deep reactive ion etching , or the like . the volume removed during the etching step preferably extends up to and including the ingaasp layer 72 . the remaining ingaasp layer 72 is then selectively removed in a wet etching step , such as by using an etchant that dissolves ingaasp substantially faster than other materials forming other layers that are exposed to the etchant , such as inp . upon removal of the ingaasp layer , portions of the inp layer 82 between the remaining areas of the ingaasp layers then become the pillars 44 . referring to fig6 a , in an alternative embodiment , the pillars 44 include ingaasp , rather than only inp . such embodiments provide the advantage of having improved insulative properties , which further reduce power consumption . in such embodiments , the sio 2 areas 76 illustrated in fig5 b are replaced with areas 94 a , 94 b having an area 96 positioned therebetween . the area 96 is narrower than the areas 94 a , 94 b and is separated from the areas 94 a , 94 b by a small gap . for example , parallel to the optical axis of the waveguide 38 , the area 96 is separated from each area 94 a , 94 b by a gap of between 10 and 25 percent of the length of the area 96 . the length of the area 96 parallel to the optical axis of the waveguide 38 may be between five and ten percent of the lengths of the areas 94 a , 94 b . perpendicular to the optical axis of the waveguide 38 , the area 96 may have a width that is between 20 and 50 percent of the width of one of the areas 94 a , 94 b . in the illustrated example , parallel to the optical axis of the waveguide 38 , the area 96 is separated from each area 94 a , 94 b by a gap of 0 . 5 μm and has a length of 3 μm . perpendicular to the optical axis of the waveguide 38 , the area 96 may have a width of 3 μm whereas the areas 94 a , 94 b have widths of 10 μm . the other steps of fig5 c through 5f may then be performed as described above . referring to fig6 b , when the dry etching step of fig5 g is performed up to the lines 98 , area 100 of inp remains and shields the portion of the ingaasp layer 72 that was beneath area 96 from etching whereas the portion of the ingaasp layer 72 that is beneath areas 94 a , 94 b is exposed and is etched away . thus a pillar 44 having an ingaasp center remains to support the raised substrate 42 . referring to fig7 a through 7c , in some laser designs , an ingaasp contact layer 102 is formed as part of the dbr laser 12 formed in step 5 f , or in another step prior to performing the steps of fig5 g . in such embodiments , the wet etching step of fig5 g using an etchant that removes ingaasp may damage the contact layer 102 . accordingly , in such embodiments , an sio 2 layer is formed to protect the contact layer prior to the etching step of fig5 g , in one embodiment , the protective sio 2 layer is formed by forming the structure illustrated in fig7 a , having a thick sio 2 etching mask 104 deposited on the contact layer up to the boundary where dry etching occurs in the dry etching step of fig5 g . a slight undercut is formed in the contact layer 102 . the undercut may have , for example , a depth less than the thickness of the contact layer 102 . referring to fig7 b , an sio 2 overcoat 106 is then formed over the sio 2 etching mask 104 and surrounding exposed surfaces . referring to fig8 , sio 2 growth at the gap between the sio 2 etching mask 104 and a layer 108 supporting the contact layer 102 projects beyond the mask 104 and 108 , such that a barrier spanning the gap is formed effective to protect the ingaasp contact layer 102 . referring to fig7 c , the dry etching step of fig5 g progresses downwardly through the layers , removing some of the sio 2 overcoat 106 , especially portions on horizontal surfaces . however , vertical portions of the sio 2 overcoat 106 remain and protect the ingaasp contact layer 102 whereas the lower ingaasp layer 72 is exposed to wet etching . referring to fig9 , in an alternative embodiment , a waveguide 38 having a distributed bragg reflector formed therein is embedded within a high - mesa structure that isolates the waveguide 38 in order to improve thermal tuning efficiency . in the illustrated embodiment , the waveguide 38 is formed in an upper layer 120 of a multi layer structure . an insulative layer 122 is formed between the upper layer 120 and a lower layer 124 . in some embodiments , the upper layer 120 and lower layer 124 are formed of inp whereas the insulative layer 122 includes 1 . 3q ingaasp , which has much lower thermal conductivity than inp . in the illustrated embodiment , the insulative layer 122 has a height of 0 . 8 μm and a width of 3 μm , whereas the upper and lower layers 120 , 124 have widths of 5 μm . the combined height of the layers 120 , 122 , 124 is 5 μm in the illustrated example . areas 128 one either side of the waveguide 38 are etched , such as by dry etching to expose vertical faces of the upper layer 120 and lower layer 124 . in some embodiments , only layers 120 and 122 such that the lower layer 124 does not include exposed faces parallel to the exposed vertical faces of the upper layer 120 . the insulative layer 124 may be etched to form an undercut 129 between the upper layer 120 and lower layer 124 to further decrease the thermal conductivity therebetween . a heater 130 , such as a platinum stripe heater , may be deposited on the upper layer 120 to control the temperature of the waveguide 38 . referring to fig1 a , the high - mesa structure of fig9 may be formed by first forming a 1 . 3q ingaasp layer 132 on an inp substrate 134 . a second inp layer 136 is then formed on the layer 134 . referring to fig1 b , the structure of fig1 a , is masked and etched to form parallel areas 138 a , 138 b of 1 . 3q ingaasp positioned in correspondence to the dbr reflectors of a dbr laser 12 . referring to fig1 c , an inp spacer layer 140 is then formed over the inp layer 134 and 1 . 3q ingaasp areas 138 a , 138 b . one or more dbr sections 142 , a multi - mode interface ( mmi ) 144 , and a gain section 146 may then be formed on the inp spacer layer 140 . an additional inp layer 148 may be formed over the dbr sections 142 and mmi 144 . as is apparent in fig1 c , the dbr 142 and mmi 144 are offset from one another due to the thickness of the ingaasp areas 138 a , 138 b , which may result in some coupling losses . however , the inp spacer layer 140 is preferably sufficiently thick to reduce losses to acceptable levels . referring to fig1 , in an alternative embodiment , alignment between the dbr sections 142 and the mmi 144 may be improved by creating additional areas 150 and 152 of 1 . 3q ingaasp positioned under the mmi 144 and gain section 146 , respectively . inasmuch as the area 152 under the gain section 146 is embedded within surrounding inp layer in the final product , heat is able to dissipate from the gain section not withstanding the presence of the 1 . 3q ingaasp area 152 . referring to fig1 a and 12b , in an alternative embodiment , coupling between the dbr sections 142 and the mmi 144 is improved by performing a planarizing step prior to formation of the dbr sections 142 and mmi 144 . for example , the ingaasp layer 132 and second inp layer 136 , such as are shown in figure 10a , may be selectively etched to leave areas 138 a , 138 b of the ingaasp layer 132 . a mask layer 154 may be formed over the areas 152 . alternatively the layer 154 may include portions of the second inp layer 136 that remain after selective etching . a third inp layer 156 is then selectively grown around the areas 138 a , 138 b and the upper surface of the layers is then planarized . the dbr sections 142 , mmi 144 , and gain section 146 are then formed having the dbr sections formed over the areas 138 a , 138 b . referring to fig1 , in another alternative embodiment , following the selective etching step of fig1 b that forms form parallel areas 138 a , 138 b , areas 158 of a masking material , such as sio 2 , are formed adjacent an area where the mmi 144 and gain section 146 are formed in subsequent steps . a third inp layer 160 is then grown over areas not covered by the areas 158 of masking material , including over the areas where the mmi 144 and gain section 146 are formed and over the parallel areas 138 a , 138 b of 1 . 3q ingaasp . the third inp layer 160 is then planarized and the dbr sections 142 , mmi 144 , and gain section 146 are formed . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .	7
fig1 shows in plan view a motorized vehicle 10 according to a first embodiment of the present invention , the vehicle 10 taking the form of a walk - behind motorized crawler cart . the motorized crawler cart 10 generally comprises a vehicle frame or body 11 , batteries 12 mounted on the vehicle body 11 , left and right electric motors 13 l , 13 r powered with the batteries 12 , left and right driving axles 14 l , 14 r rotatably mounted on the vehicle frame 11 and independently driven by the left and right electric motors 13 l , 13 r , respectively , left and right driving wheels 15 l , 15 r attached to an end of the left and right driving axles 14 l , 14 r , respectively , left and right crawler belts 16 l , 16 r each stretched between the driving wheel 15 l , 15 r and a driven wheel 15 ′ l , 15 ′ r and driven by the driving wheel 15 l , 15 r , and left and right brakes 17 l , 17 r for independently applying a braking force to the left and right driving wheels 15 l , 15 r , respectively . in the illustrated embodiment , the left and right brakes 17 l , 17 r are associated with the left and right electric motors 13 l , 13 r , respectively , for independently braking the motors 13 l , 13 r to vary the speeds of the left and right driving wheels 15 l , 15 r . the driven wheels 15 ′ l , 15 ′ r are rotatably mounted on opposite ends of a front axle 14 ′ rotatably mounted on the vehicle body 11 . the vehicle 10 further has a load - carrying platform 20 mounted on the vehicle body 11 , an operator control panel 21 mounted to a rear end of the load - carrying platform 20 , and left and right operation handlebars 30 l , 30 r extending from a rear portion of the operator control panel 21 obliquely upward in a rearward direction of the motorized crawler cart 10 . the handlebars 30 l , 30 r may be so arranged to extend from the vehicle body 11 or the platform 20 . the operator control panel 21 is provided with an accelerator lever 22 . the operation handlebars 30 l , 30 r have handgrips 25 l , 25 r at free ends thereof for being gripped with hands of the operator . left and right turn control levers 23 l , 23 r attached to the left and left handlebars 30 l , 30 r so as to extend along the left and right handgrips 25 l , 25 r , respectively , the turn control levers 23 l , 23 r are manually operated to control operation of the corresponding electric motors 13 l , 13 r and the brakes 17 l , 17 r in a manner as described below . the operator manipulates levers and buttons including the accelerator lever 22 on the operator control panel 21 and the turn control levers 23 l , 23 r while walking behind the vehicle 10 so as to move the vehicle forward or backward , turn the vehicle leftward or rightward , and stop 20 the vehicle . a control unit 24 is disposed inside the operator control panel 21 and controls operation of the electric motors 13 l , 13 r and the left and right brakes 17 l , 17 r based on the positions of the accelerator lever 22 and turn control levers 23 l , 23 r . the brakes 17 l , 17 r may be an electromagnetic brake , a hydraulic brake , a mechanical brake , regenerative brake and so on . the accelerator lever 22 is manually actuated to control the direction and speed of movement of the vehicle 10 . the accelerator lever 22 is normally disposed in a neutral position where the vehicle is stopped . the position of the acceleration lever 22 is monitored by an accelerator potentiometer 26 shown in fig2 a . the output from the accelerator potentiometer 26 varies linearly with the amount of angular displacement of the accelerator lever 22 , as indicated by a graph shown in fig2 . in the illustrated embodiment , the output from the accelerator potentiometer 26 is set to vary within a range from 0 to 5 . 0 volts ( v ). a maximum forward speed of the vehicle is achieved when the output from the accelerator potentiometer 26 is + 5 . 0 v . a maximum backward vehicle speed is achieved when the accelerator potentiometer output is 0 volt . the vehicle is stopped when the accelerator potentiometer output is 2 . 5 v . fig3 shows a free end portion of the operation handlebar 30 l , 30 r including the handgrip 25 l , 25 r . the turn control lever 23 l , 23 r is pivotally connected by a hinge pin 31 l , 31 r to the handlebar 30 l , 30 r so as to extend along the handgrip 25 l , 25 r . the turn control lever 23 l , 23 r is firmly connected to one end of an actuator arm 32 l , 32 r of a brake potentiometer 27 a , 27 b so that the actuator 32 l , 32 r angularly moves or turns in unison with the turn control lever 25 l , 25 r . the brake potentiometer 27 l , 27 r is designed such that the output from the brake potentiometer 27 a , 27 b varies linearly with the amount of angular displacement of the actuator arm 32 l , 32 r and turn control lever 23 l , 23 r . as shown in fig3 the turn control lever 23 l , 23 r is angularly movable between an initial zero - brake position ( first position ) p 1 indicated by the solid line and a stroke end position ( second position ) p 2 indicated by two - dot chain line through a full - brake position ( third position ) p 3 indicated by the dashed line . the turn control lever 23 l , 23 r is normally disposed in the solid - lined zero - brake position p 1 by the force of a return spring 33 l , 33 r . fig4 a shows a range of angular movement of the actuator arm 32 l , 32 r of the brake potentiometer 27 l , 27 r , which corresponds to the range of movement of the turn control lever 23 l , 23 r shown in fig3 . as shown in fig4 the actuator arm 32 l , 32 r is angularly movable between the first position ( zero - brake position ) p 1 and the second position ( stroke end position ) p 2 through the third position ( full - brake position ) p 3 . the output from the brake potentiometer 27 l , 27 r varies linearly with the position of the actuator arm 32 l , 32 r and turn control lever 23 l , 23 r , as indicated by a graph shown in fig4 b . in the illustrated embodiment , the output from the brake potentiometer 27 l , 27 r is set to vary within a range from 0 to 5 . 0 volts ( v ). when the turn control lever 23 l , 23 r is in the initial zero - brake position p 1 , the output from the brake potentiometer is nil . when the turn control lever 23 l , 23 r is in the stoke end position p 3 , the output from the brake potentiometer is 5 . 0 v . and when the turn control lever 23 l , 23 r is in the intermediate full - brake position p 2 , the output from the brake potentiometer is vm volts , where vm is greater than 0 and smaller than 5 . 0 . the output voltage vm may be 1 . 5 , 2 . 0 or 2 . 5 volts . as shown in fig4 a and 4b , when the turn control lever 23 l , 23 r ( i . e ., the actuator arm 32 l , 32 r ) moves within a range defined between the zero - brake position p 1 and the full - brake position p 3 , brake control operation is achieved . on the other hand , when the turn control lever 23 l , 23 r ( actuator arm 32 l , 32 r ) moves within a range defined between the full - brake position p 3 and the stroke end position p 2 , turn control operation is achieved . fig5 shows a control system of the motorized vehicle 10 . as shown in this figure , the accelerator potentiometer 26 and the left and right brake potentiometers 27 l , 27 r are electrically connected to the control unit 24 . also connected to the control unit 24 is a vehicle speed sensor 34 for detecting the speed of the vehicle 10 . the control unit 24 is electrically connected to the left and right brakes 17 l , 17 r via left and right brake drivers 28 l , 28 r , respectively , for controlling operation of the brakes 17 l , 17 r based on the position of the corresponding turn control levers 23 l , 23 r in a manner described below . similarly , the control unit 24 is electrically connected to the left and right electric motors 13 l , 13 r via left and right motor drivers 29 l , 29 r , respectively , for controlling operation of the motors 13 l , 13 r based on the position of the accelerator lever 22 in a manner described below . in a practical sense , the brake drivers 28 l , 28 r and the motor drivers 29 l , 29 r are formed as a part of the control unit 24 . when the left turn control lever 23 l is manipulated or otherwise pulled by the operator , the left brake potentiometer 27 l generates an output signal bklv corresponding in magnitude to the amount of angular displacement of the turn control lever 23 l . upon receipt of the output signal bklv from the brake potentiometer 27 l , the controller 24 sends a command signal to the left brake driver 28 l so that the left brake 17 l is driven to apply to the left driving wheel 15 l a brake force corresponding to the position of the left turn control lever 23 l . when the left turn control lever 23 l ( i . e ., the actuator arm 32 l of the left brake potentiometer 27 l ) is in the brake control range defined between the zero - brake position p 1 and the full - brake position p 3 ( fig4 a and 4 b ), brake control operation is achieved , in which the brake force applied from the left brake 17 l to the left driving wheel 15 l varies linearly with the amount of angular displacement of the left turn control lever 23 l . similarly , when the right turn control lever 23 r is manipulated or otherwise pulled by the operator , the right brake potentiometer 27 r generates an output signal bkrv corresponding in magnitude to the amount of angular displacement of the turn control lever 23 r . upon receipt of the output signal bkrv from the brake potentiometer 27 r , the controller 24 sends a command signal to the right brake driver 28 r so that the right brake 17 l is driven to apply to the right driving wheel 15 r a brake force corresponding to the position of the right turn control lever 23 r . when the right turn control lever 23 r ( i . e ., the actuator arm 32 r of the right brake potentiometer 27 r ) is in the brake control range defined between the zero - brake position p 1 and the full - brake position p 3 ( fig4 a and 4 b ), brake control operation is achieved , in which the brake force applied from the right brake 17 r to the right driving wheel 15 r varies linearly with the amount of angular displacement of the right turn control lever 23 r . when the accelerator lever 22 is actuated or otherwise tilted by the operator , the accelerator potentiometer 26 generates an output signal accv corresponding in magnitude to the amount of angular displacement of the accelerator lever 22 . upon receipt of the output signal accv from the accelerator potentiometer 26 , the controller 24 sends a command signal to the left and right motor drivers 29 l , 29 r so that the left and right electric motors 13 l , 13 r rotate the corresponding driving wheels 15 l , 15 r in the forward or backward direction at a speed corresponding to the position of the accelerator lever 22 . thus , the vehicle ( crawler cart ) with crawler belts 16 l , 16 r independently driven by the driving wheels 15 l , 15 r moves in the forward or backward direction at the desired speed . when the left or right turn control lever 23 l , 23 r is pulled to approach the handgrip 25 l , 25 r across the full - brake position p 2 ( fig4 a and 4 b ), turn control operation is achieved under the control of the control unit 24 so as to ensure that the vehicle makes a turn while staying at the same position ( spot turn ). the turn control operation will be described with reference to a flowchart shown in fig6 . at a first step st 01 , a judgment is made to determine as to whether or not the output signal bklv from the left brake potentiometer 27 d ( fig5 ) is greater than vm ( fig4 b ). when the result of judgment is “ yes ” ( bklv & gt ; vm ), this means that the left turn control lever 23 l is disposed in the turn control range defined between the full - brake position p 3 and the stroke end position p 2 ( fig3 and 4 a ). the control then goes on to a step sto 2 . alternately , when the result of judgment is “ no ” ( bklv ,≦ vm ), the control moves to a step sto 7 . at the step st 02 , the output signal v from the vehicle speed sensor 34 ( fig5 ) is monitored so as to determine whether or not the vehicle speed v is not more than v 0 where v 0 represents the vehicle being at halt or moving at a slow speed which allows the vehicle to make an abrupt turn . when the result of judgment is “ yes ” ( v & lt ; v 0 ), the control advances to a step st 04 . alternately when the judgment result is “ no ” ( v ≧ v 0 ), the control moves to a step st 03 . at the step st 03 , slowdown control is achieved in which the control unit 24 ( fig5 ) controls the electric motors 13 l , 13 r via the motor drivers 29 l , 29 r so as to slow down the rotational speed of the driving wheels 15 l , 15 r . this operation continues until the vehicle speed v is below v 0 . at the step st 04 , the left and right brakes 17 l , 17 r ( fig5 ) are released or de - activated to allow rotation of the left and right driving wheels 15 l , 15 r . after the step st 04 , the control goes on to a step st 05 . the step st 05 is achieved on condition that vklv & gt ; vm and v & lt ; v 0 ( that is , the left turn control lever 23 l is in the turn control range defined between the full - brake position p 3 and the stroke end position p 2 , and the vehicle is stopped or moving at a slow speed which allow the vehicle to make an abrupt turn ). at the step st 05 , the left electric motor 13 l ( fig5 ) is rotated in the reverse direction and , at the same time , the right electric motor 13 r is rotated in the forward direction . the term “ forward direction ” is used to refer to a direction to move the vehicle forward , and the term “ reverse direction ” is used to refer to a direction to move the vehicle backward . by thus driving the left and right electric motors 13 l , 13 r simultaneously in opposite directions , the vehicle starts to make an abrupt turn in the leftward direction while staying at the same position ( spot turn ). when the vehicle has turned leftward through a desired angle ( 180 degrees , for example ), the operator releases the left turn control lever 23 l , allowing the lever 23 l to return to its initial zero - brake position p 1 ( fig3 and 4 b ). this causes the output bklv from the left brake potentiometer 27 l to go down to or below vm ( bklv ≦ vm ). this condition is detected at a step st 06 whereupon the control comes to an end and operation of the vehicle returns to a regular operation mode . at the step st 07 , which follows the “ no ” state at the preceding step st 01 , a judgment is made to determine as to whether or not the output signal bkrv from the right brake potentiometer 27 r ( fig5 ) is greater than vm ( fig4 b ). when the result of judgment is “ yes ” ( bkrv & gt ; vm ), the control advances to a step st 08 . alternately , when the judgment result is “ no ” ( bkrv ≦ vm ), this means that either lever 23 l , 23 r ( actuator arm 32 l , 32 r of the brake potentiometer 27 l , 27 r ) is not in the turn control range defined between the full - brake position p 3 and the stroke end position p 2 . accordingly , the control is terminated . at the step st 08 , following the “ yes ” state in the preceding step st 07 , the output signal v from the vehicle speed sensor 34 ( fig5 ) is compared with v 0 so as to determine whether or not v & lt ; v 0 . when the comparison result is “ yes ” ( v & lt ; v 0 ), the control advances to a step st 10 . alternately when the comparison result is “ no ” ( v ≧ v 0 ), the control moves to a step st 09 . at the step st 09 , slowdown control is achieved in which the control unit 24 ( fig5 ) controls the electric motors 13 l , 13 r via the motor drivers 29 l , 29 r so as to slow down the rotational speed of the driving wheels 15 l , 15 r . this operation continues until the vehicle speed v is below v 0 . at the step st 10 , the left and right brakes 17 l , 17 r ( fig5 ) are released or de - activated to allow rotation of the left and right driving wheels 15 l , 15 r . after the step st 10 , the control goes on to a step st 11 . the step st 11 is achieved on condition that vkrv & gt ; vm and v & lt ; v 0 ( that is , the right turn control lever 23 r is in the turn control range defined between the full - brake position p 3 and the stroke end position p 2 , and the vehicle is stopped or moving at a slow speed which allows the vehicle to make an abrupt turn ). at the step st 11 , the right electric motor 13 r ( fig5 ) is rotated in the reverse direction and , at the same time , the left electric motor 13 l is rotated in the forward direction . as a result of simultaneous driving of the left and right electric motors 13 l , 13 r in opposite directions , the vehicle starts to make an abrupt turn in the rightward direction while staying at the same position ( spot turn ). when the vehicle has turned rightward through a desired angle ( 180 degrees , for example ), the operator releases the right turn control lever 23 r , allowing the lever 23 r to return to its initial zero - brake position p 1 ( fig3 and 4 b ). this causes the output bkrv from the right brake potentiometer 27 r to go down to or below vm ( bkrv ≦ vm ). this condition is detected at a step st 12 whereupon the control is terminated and operation of the vehicle returns to the regular operation mode . the speed of the electric motors 13 l , 13 r achieved at the steps st 05 and st 11 may be either fixed at a predetermined value , or alternately variable . in the latter case , the motor speed is set to be proportional to the output accv from the accelerator potentiometer 26 ( corresponding to the position of the accelerator lever 22 ). by thus setting the motor speed , the vehicle can make a spot turn at the same speed as a preceding working operation which the vehicle has done . fig7 a to 7 c are illustrative of the manner in which the vehicle makes a spot turn in the rightward direction through an angle of 180 degrees . in these figures , the left turn control lever is not shown for the purpose of illustration . when the right turn control lever 23 r is manipulated or otherwise pulled so as to approach the handgrip 25 r across the full - brake position p 2 ( fig3 ), the left electric motor 13 l is driven to rotate in the forward direction and , at the same time , the right electric motor 13 r is driven to rotate in the reverse direction . this means that the left crawler belt 16 l is driven to run or travel in the forward direction , while the right crawler belt 16 r is driven to run or travel in the backward direction . as a result of simultaneous running of the left and right crawler belts 16 l , 16 r in the forward and backward directions , respectively , the vehicle 10 starts to turn rightward about a center g 1 common to the left and right crawler belts 16 l , 16 r , with a turning radius r 1 equal to the distance from the turning center g 1 to a front left corner of the load - carrying platform 20 , as shown in fig7 a . continuing operation of the left and right motors 13 l , 13 r will place the vehicle 10 to a position shown in fig7 b where the vehicle 10 has turned about the center g 1 in the rightward direction through an angle of 90 degrees . as the turning operation further continues , the vehicle 10 completes a 180 ° turn while staying at the same position , as shown in fig7 c . then the operator releases the right turn control lever 23 to thereby terminate the spot turn operation . a spot turn in the leftward direction can be achieved in the same manner as described above by pulling the left turn control lever 23 l until it assumes a position located within the turn control range defined between the full - brake position p 3 and the stroke end position p 2 shown in fig3 and 4b . for comparative purposes , description will be made to a normal pivot turn operation of the vehicle 10 with reference to fig5 a and 5b . when a right turn of the vehicle 10 is desired , the right turn control lever 23 r is pulled to assume the full - brake position p 3 ( fig3 and 4b ) or a position immediately before the full - brake position p 3 , whereupon by the effect of a maximum brake force applied from the right brake 17 r to the right driving wheel 15 r , the right crawler belt 16 r is stopped . in this instance , since the left crawler belt 16 l continues its running in the forward direction , the vehicle 10 starts to turn rightward about a turning center g 2 located at a longitudinal center of the right crawler belt 16 r , with a turning radius r 2 equal to the distance from the turning center g 2 to the front left corner of the platform 20 , as shown in fig8 b . as the turning operation further continues , the vehicle 10 completes a 180 ° turn about the turning center g 2 . a comparative review of fig7 c and 8b indicates that a turning area in a circle drawn with the turning radius r 1 achieved by the spot turn operation ( fig7 c ) is much smaller than that in a circle drawn with the turning radius r 2 achieved by the normal pivot turn operation ( fig8 b ). this proves that the spot turn is optimum to minimize the turning area of the vehicle 10 . when the direction of travel of the vehicle 10 is to be adjusted , the left or the right turn control lever 23 l , 23 r is lightly pulled to create a speed difference between the left and right crawler belts 16 l , 16 r due to a brake force applied from the left or right brake 17 l , 17 r to the corresponding driving wheel 15 l , 15 r . thus , the vehicle 10 starts to make a gradual turn in a desired direction . when a rapid direction change is needed , the left or right turn control lever 23 l , 23 r is pulled to an increased extent . in this instance , when the turn control lever 23 l , 23 r is in the brake full - brake position p 3 , the normal pivot turn will be achieved in the same manner as described above with reference to fig8 a and 8b . alternatively , when the turn lever 23 l , 23 r is in the turn control region defined between the full - brake position p 3 and the stroke end position p 2 , the spot turn will be achieved in the same manner as described above with reference to fig7 a to 7 c . it will readily be understood that by merely manipulating the turn control levers 23 l , 23 r in an appropriate manner , the vehicle can make a gradual turn , a normal pivot turn or a spot turn . the turn control levers 23 l , 23 r double in function as brake control levers to achieve gradual turns and a normal pivot turn , and also as spot - turn initiating levers to achieve a spot turn . this obviates the need for the provision of a separate lever used exclusively for achieving different sorts of turn . the motorized vehicle is relatively simple in construction and can easily be operated even by an un - skilled operator . fig9 shows a motorized vehicle 10 a taking the form of a walk - behind motorized crawler cart according to a second embodiment of the present invention . the vehicle 10 a is structurally and operationally the same as the vehicle 10 of the first embodiment shown in fig1 with the exception that the left and right turn control levers 23 l , 23 r serve only as brake control levers , and left and right spot turn switches 35 l , 35 r are provided separately to achieve a spot turn . due to this similarly , these parts which are identical to those shown in fig1 are designated by the same reference characters and further description thereof can , therefore , be omitted to avoid duplicate description . as shown in fig9 the left and right spot turn switches 35 l , 35 r are provided on an operator control panel 21 and electrically connected to a control unit 24 disposed inside the operator control panel 21 . the left and right turn control levers 23 l , 23 r ( hereinafter referred to as brake control levers ) are electrically connected to the control unit 24 via left and right brake potentiometers 27 l , 27 r ( fig1 a and 11 ). the potentiometers 27 l , 29 l each have an actuator arm 32 l , 32 r ( fig1 a ) directly connected to the corresponding brake control lever 23 l , 23 r . as understood from fig1 a , the brake control levers 23 l , 23 r ( i . e ., the actuator arms 32 l , 32 r of the brake potentiometers 27 l , 27 r ) are angularly movable between an initial zero - brake position ( first position ) p 1 and a full - brake position ( second position ) p 2 . the output from the brake potentiometer 27 l , 27 r varies linearly with the position of the actuator arm 32 l , 32 r ( i . e ., the position of the brake control lever 23 l , 23 r ), as indicated by a graph shown in fig1 b . in the illustrated embodiment , the output from the brake potentiometer 27 l , 27 r is set to vary within a range from 0 to 5 . 0 volts ( v ). when the brake control lever 23 l , 23 r is in the initial zero - brake position p 1 , the output from the brake potentiometer is nil . when the turn control lever 23 l , 23 r is in the full - brake position p 2 , the output from the brake potentiometer is 5 . 0 v . in terms of the output , the full - brake position p 2 in this position corresponds to the stroke end position p 2 of the first embodiment shown in fig4 b . fig1 shows a control system of the motorized vehicle 10 a . the control system structurally differs from the control system of the first embodiment shown in fig5 in that the spot turn switches 35 l , 35 r are provided separately from the brake control levers ( turn control levers ) 23 l , 23 r . due to this similarity , these parts which are identical to those shown in fig5 are designated by the same reference characters , and no further description thereof is needed . with the control system arranged as shown in fig1 , when the left brake control lever 23 l is manipulated or otherwise pulled by the operator , the left brake potentiometer 27 l generates an output signal bklv corresponding in magnitude to the amount of angular displacement of the brake control lever 23 l . upon receipt of the output signal bklv from the brake potentiometer 27 l , the controller 24 sends a command signal to the left brake driver 28 l so that the left brake 17 l is driven to apply to the left electric motor 13 l a brake force corresponding to the position of the left brake control lever 23 l . by thus braking the electric motor 13 l , the rotating speed of the left driving wheel 15 l decreases linearly with the amount of displacement of the left brake control lever 23 l . when the brake control lever 23 l is pulled so as to assume the full - brake position 22 ( fig1 a ), a maximum brake force is applied from the left brake 17 l to the left motor 13 l , thereby stopping rotation of the left motor 13 l . thus , the left driving wheel 15 l is stopped . similarly , when the right brake control lever 23 r is manipulated or otherwise pulled by the operator , the control unit 24 controls operation of the right brake 17 r via the right brake driver 28 r so that the right motor 13 r is braked with a brake force variable linearly with the output bkrv from the right brake potentiometer 27 r . when the right brake control lever 23 r is in the full - brake position p 2 ( fig1 a ), the output bkrv from the right brake potentiometer 27 r has a maximum value . this makes the right motor 13 r to stop rotation by the effect of a maximum brake force applied from the right brake 17 r . when the accelerator lever 22 is actuated or otherwise tilted by the operator , the accelerator potentiometer 26 generates an output signal accv corresponding in magnitude to the amount of angular displacement of the accelerator lever 22 . upon receipt of the output signal accv from the accelerator potentiometer 26 , the controller 24 sends a command signal to the left and right motor drivers 29 l , 29 r so that the left and right electric motors 13 l , 13 r rotate the corresponding driving wheels 15 l , 15 r in the forward or backward direction at a speed corresponding to the position of the accelerator lever 22 . thus , the vehicle ( crawler cart ) with crawler belts 16 l , 16 r independently driven by the driving wheels 15 l , 15 r moves in the forward or backward direction at the desired speed . when the left or right spot turn switch 35 l , 35 r is activated , turn control operation is achieved under the control of the control unit 24 so as to ensure that the vehicle makes a turn while staying at the same direction ( spot ). the turn control operation will be described with reference to a flowchart shown in fig1 at a first step st 01 , a judgment is made to determine as to whether or not the left spot turn switch 35 l is in the “ on ” state . when the result of judgment is “ yes ”, the control then goes on to a step st 02 . alternately , when the judgment result is “ no ”, the control moves to a step st 06 . at the step st 02 , the output signal v from the vehicle speed sensor 34 ( fig1 ) is monitored so as to determine whether or not the vehicle speed v is not more than v 0 where v 0 represents the vehicle being at halt or moving at a slow speed which allows the vehicle to make an abrupt turn . when the judgment result is “ yes ” ( v & lt ; v 0 ), the control advances to a step st 04 . alternately when the judgment result is “ no ” ( v ≦ v 0 ), the control moves to a step st 03 . at the step st 03 , slowdown control is achieved in which the control unit 24 ( fig1 ) controls the electric motors 13 l , 13 r via the motor drivers 29 l , 29 r so as to slow down the rotational speed of the driving wheels 15 l , 15 r . this operation continues until the vehicle speed v is below v 0 . the step st 04 is achieved on condition that vklv & gt ; vm and v & lt ; v 0 ( that is , the left spot turn switch 35 l is in the “ on ” state , and the vehicle is stopped or moving at a slow speed which allows the vehicle to make an abrupt turn ). at the step st 04 , the left electric motor 13 l ( fig1 ) is rotated in the reverse direction and , at the same time , the right electric motor 13 r is rotated in the forward direction . by thus driving the left and right electric motors 13 l , 13 r simultaneously in opposite directions , the vehicle starts to make an abrupt turn in the leftward direction while staying at the same position ( spot turn ). when the vehicle has turned leftward through a desired angle ( 180 degrees , for example ), the operator deactivates the left spot turn switch 35 l , causing the output bklv from the left brake potentiometer 27 l to go down to or below vm ( bklv ≦ vm ). this condition is detected at a step st 05 , and upon detention of this condition , the control comes to an end and operation of the vehicle returns to a regular operation mode . at the step st 06 , which follows the “ no ” state at the preceding step st 01 , a judgment is made to determine as to whether or not the right spot turn switch 35 r is in the “ on ” state . when the result of judgment is “ yes ”, the control advances to a step st 07 . alternately , when the judgment result is “ no ”, this means that either switch 35 l , 35 r is not activated . accordingly , the control is terminated . at the step st 07 , following the “ yes ” state in the preceding step st 06 , the output signal v from the vehicle speed sensor 34 ( fig1 ) is compared with v 0 so as to determine whether or not v & lt ; v 0 . when the comparison result is “ yes ” ( v & lt ; v 0 ), the control advances to a step st 09 . alternately when the comparison result is “ no ” ( v ≧ v 0 ), the control moves to a step st 08 . at the step st 05 , slowdown control is achieved in which the control unit 24 ( fig1 ) controls the electric motors 13 l , 13 r via the motor drivers 29 l , 29 r so as to slow down the rotational speed of the driving wheels 15 l , 15 r . this operation continues until the vehicle speed v is below v 0 . the step st 09 is achieved on condition that vkrv & gt ; vm and v & lt ; v 0 ( that is , the right spot turn switch 35 r is in the “ on ” state , and the vehicle is stopped or moving at a slow speed which allows the vehicle to make an abrupt turn ). at the step st 09 , the right electric motor 13 r ( fig1 ) is rotated in the reverse direction and , at the same time , the left electric motor 13 l is rotated in the forward direction . as a result of simultaneous driving of the left and right electric motors 13 l , 13 r in opposite directions , the vehicle starts to make an abrupt turn in the rightward direction while staying at the same position ( spot turn ). when the vehicle has turned rightward through a desired angle ( 180 degrees , for example ), the operator deactivates the right spot turn switch 35 r , causing the output bkrv from the right brake potentiometer 27 r to go down to or below vm ( bkrv ≦ vm ). this condition is detected at a step st 010 , and upon detention of this condition , the control is terminated operation of the vehicle returns to a regular operation mode . the speed of the electric motors 13 l , 13 r achieved at the steps st 04 and st 09 may be either fixed at a predetermined value , or alternately variable . in the latter case , the motor speed is set to be proportional to the output accv from the accelerator potentiometer 26 ( fig1 ) by thus setting the motor speed , the vehicle can make a spot turn at the same speed as a preceding working operation which the vehicle has done . fig1 a to 13 c are illustrative of the manner in which the vehicle 10 a makes a spot turn in the rightward direction through an angle of 180 degrees . in these figures , the brake control levers are not shown for the purpose of illustration . when the right spot turn switch 35 r is activated , the left electric motor 13 l is driven to rotate in the forward direction and , at the same time , the right electric motor 13 r is driven to rotate in the reverse direction . this means that the left crawler belt 16 l is driven to run or travel in the forward direction , while the right crawler belt 16 r is driven to run or travel in the backward direction . as a result of simultaneous running of the left and right crawler belts 16 l , 16 r in the forward and backward directions , respectively , the vehicle 10 a starts to turn rightward about a center g common to the left and right crawler belts 16 l , 16 r , with a turning radius r equal to the distance from the turning center g to a front left corner of the load - carrying platform 20 , as shown in fig1 a . continuing operation of the left and right motors 13 l , 13 r will place the vehicle 10 a to a position shown in fig1 b where the vehicle 10 has turned about the turning center g in the rightward direction through an angle of 90 degrees . as the turning operation further continues , the vehicle 10 a completes a 180 ° turn while staying at the same position , as shown in fig1 c . then the operator deactivates the right spot turn switch 35 r to thereby terminate the spot turn operation . a spot turn in the leftward direction can be achieved in the same manner as described above by activating the left spot turn switch 35 l . the spot turn switches 35 l , 35 r may be comprised of a push button switch , a self - hold push — push switch , a self - hold toggle switch , or a self - hold dial switch . though not shown , these switches 35 l , 35 r may be mounted to the left and right handlebars 30 l , 30 r adjacent to the handgrips 25 , 25 r . fig1 and 15 show a walk - behind self - propelled crawler snowplow 40 embodying the present invention . the snowplow 40 generally comprises a propelling frame 42 carrying thereon left and right crawler belts 41 l , a vehicle frame 45 carrying thereon a snowplow mechanism 43 and an engine ( prime motor ) 44 for driving the snowplow mechanism 43 , a frame lift mechanism 46 operable to lift a front end portion of the vehicle frame 45 up and down relative to the propelling frame 42 , and a pair of left and right operation handlebars 47 l and 47 r extending from a rear portion of the propelling frame 42 obliquely upward in a rearward direction of the snowplow 40 . the propelling frame 42 and the vehicle frame 45 jointly form a vehicle body 49 . the left and right crawler belts 41 l , 41 r are driven by left and right electric motors 71 l , 71 r , respectively . the crawler belts 41 l , 41 r are each trained around a driving wheel 72 l , 72 r and an idler wheel 73 l , 73 r . the driving wheel 72 l , 72 r is disposed on a rear side of the crawler belt 41 l , 41 r , and the idler wheel 73 l , 73 r is disposed on a front side of the crawler belt 41 l , 41 r . the snowplow mechanism 43 has an auger 43 a , a blower 43 b and a discharge duct 43 c that are mounted to a front portion of the vehicle frame 45 . in operation , the auger 43 a rotates to cut snow away from a road , for example , and feed the cut mass of snow to the blower 43 b which blows out the snow through the discharge duct 43 c to a position far distant from the snowplow 40 . the operation handlebars 47 l , 47 r are adapted to be gripped by a human operator ( not shown ) walking behind the snowplow 40 in order to manwuver the snowplow 40 . an operator control panel 51 , a control unit 52 and batteries 53 are arranged in a verticla space defined between the handlebars 47 l , 47 r and they are mounted to the handlebars 47 l , 47 r in the order named when viewed from the top to the bottom of fig1 . the operation handlebars 47 l , 47 r each have a handgrip 48 l , 48 r at the distal end ( free end ) thereof . the left handlebar 47 l has a parking brake lever 54 disposed in close proximity to the handgrip 48 l . the parking brake lever 54 is of the deadman lever type and is adapted to be gripped by the operator together with the left handgrip 48 l . when gripped , the parking brake lever 54 turns about a pivot pin 54 a in a direction toward the handgrip 48 l . with this movement of the parking brake lever 54 , a brake switch 55 ( fig1 ) is turned on , thereby releasing a brake on the driving wheels 72 l , 72 r . the left and right handlebars 14 l , 47 r further have turn control levers 56 l , 56 r associated with the respective handgrips 18 l , 48 r . the crawler snowplow 40 of the foregoing construction is self - propelled by the crawler belts 41 l , 41 r driven by the electric motors 71 l , 71 r and is also maneuvered by the human operator walking behind the snowplow 40 while gripping the handlebars 47 l , 47 r . in the crawler snowplow 40 , a generator driving pulley 75 is attached to an output shaft 65 of the engine 44 . the diving pulley 75 is connected by an endless belt 77 to a generator driven pulley 76 mounted to the shaft of a generator 69 . thus , rotation of the engine output shaft 65 is transmitted via the belt 77 to the generator 69 . that is , when the engine 44 is running , the generator 69 is driven via the belt drive 75 - 77 so that the batteries 53 ( fig1 ) are charged with electric current supplied from the generator 69 . a second driving pulley 67 a is coupled via an electromagnetic clutch 66 to the output shaft 65 of the engine 44 , and a second driven pulley 68 b is connected to one end of a rotating shaft 68 a . the second driving and driven pulleys 67 a , 68 b are connected by a second endless belt 67 b . the rotating shaft 68 a is connected to a central shaft of the auger 43 a via a worm gear speed reducing mechanism ( not designated ). the rotating shaft 68 a is also connected to the blower 43 b . while the engine 44 is running , the auger 43 a and blower 43 b are drivable through the second belt drive 67 a , 67 b , 68 b when the electromagnetic clutch 66 is in the engaged state . the operator control panel 51 has a lift control lever 60 a for controlling operation of the frame lift mechanism 46 ( fig1 ), a duct control lever 60 b for changing direction of the discharge duct 43 c , an accelerator lever 22 for controlling the direction and speed of travel of the snowplow 40 , and a throttle lever 64 for controlling the speed of the engine 44 . the operator control panel 51 further has a clutch switch 59 disposed adjacent to the right operation handlebar 47 r . the clutch switch 59 is a normally open contact switch and adapted to be turned on and off to achieve on - off control of the electromagnetic clutch 66 . as shown in fig1 , the left and right turn control levers 56 l , 56 r each have an integral pivot pin 56 a by means of which the lever 56 l , 56 r is pivotally mounted to the corresponding handlebar 47 l , 47 r . the pivot pin 56 a serves also as a rotating shaft of a rotary type brake potentiometer 57 l , 57 r which is associated with the turn control lever 56 l , 56 r to monitor the position of the turn control lever 56 l , 56 r . the brake potentiometer 57 l , 57 r are electrically connected to the control unit 52 . left and right brakes 74 l , 74 r are associated with the left and right motors 71 l , 71 r , respectively , for independently applying a brake force to the corresponding motors 71 l , 71 r . the left and right brakes 74 l , 74 r are driven by left and right brake drivers 58 l , 58 r under the control of the control unit 52 based on the amount of angular displacement of the turn control levers 56 l , 56 r detected by the brake potentiometers 57 l , 57 r . the accelerator lever 22 is electrically connected to the control unit 52 via an accelerator potentiometer 26 . the left and right motors 71 l , 71 r are driven by left and right motor drivers 29 l , 29 r under the control of the control unit 52 based on the amount of angular displacement of the accelerator lever 22 detected by the accelerator potentiometer 26 . the operation of the accelerator lever 22 and turn control levers 56 l , 56 r are identical to the operation of those 22 , 23 l , 23 r described above with reference to the first embodiment shown in fig1 - 8 , and further description thereof can be omitted . it will be appreciated from the foregoing description that by virtue of the left and right turn control levers mounted to the left and right handlebars so as to extend along the left and right handgrips , the operator can manipulate the turn control levers while keeping a grip on the handgrips . this enables the operator to steer the motorized vehicle stably and reliably in a desired direction . furthermore , the turn control levers can be easily manipulated with operator &# 39 ; s fingers of the operator . this will lessen the load on the operator . the present disclosure relates to the subject matter of japanese patent applications nos . 2000 - 331554 , 2000 - 331554 and 2001 - 134689 , filed oct . 30 , 2000 , oct . 30 , 2000 and may 1 , 2001 , respectively , the disclosures of which are expressly incorporated herein by reference in their entirety .	8
fig1 illustrates an anchor section 10 of the upper half of a wet connect having the upper connector portion 12 at its upper end . the lower half of the wet connect assembly containing the other connector mate is not shown . an upper string 14 extends into a sub 16 that defines an internal recess 18 with an outlet 20 . a hydraulic line 22 extends from outlet 20 and is connected to in the preferred embodiment to a connection 24 that actuates a lock between the upper portion of the wet connect 12 and the lower portion of the wet connect after they are pushed together and weight is set down on the upper string 14 . fig2 shows how hydraulic pressure is generated locally to lock the wet connect in fig1 in a way other than the prior design that depended on a control line run to connection 24 from the surface . top sub 28 is secured at thread 30 to the upper string 14 , which is not shown in this fig . in this embodiment , the bottom sub 16 and top sub 28 are configured to create a chamber 32 where preferably an incompressible fluid is stored to preferably fill the chamber 32 . outlet 20 communicates with chamber 32 and line 22 which leads to an anchor on the wet connect at a connection 24 . from that point on the operation of the anchor is the same as if the pressure source was from a control line that started at the surface . in essence , the pressure moves a piston in the anchor to actuate it when the wet connect segments are fully pushed together engaging the locking collet threads in the anchor section 10 of the upper connector segment with a matching profile in the lower connector segment in a manner known in the art . chamber 32 is sealed at seals 34 and 36 so that when the wet connect segments are together , setting down weight on top sub 28 will break the shear pin 38 to allow the top sub 28 to advance to reduce the volume of chamber 32 so that pressure builds up in it . that pressure passes through conduit 22 to set a downhole tool such as an anchor for a wet connect that needs to be locked together after being pushed together . it can also serve other purposes . for example , when a wet connect with two ends of a fiber optic cable is being made up , it is good to make sure the abutting exposed ends are free of debris so that the integrity of the optical connection is maintained . in another application of the embodiment shown in fig2 , fluid can be forced out to reach the fiber optic cable ends on the two parts of the wet connect as they come together to clean debris away from the end area of each fiber optic cable segment . this helps to insure the quality of signal transmission through the made up connection . as will be seen below , this can be accomplished with a single reservoir that not only builds pressure in line 22 that can actuate a tool but also ejects fluid through an orifice , for example , to keep the connection in a tool clean as it is being made up downhole . those skilled in the art will realize that wholly unrelated applications are envisioned such as shifting sleeves , holding safety valves open , setting anchors or operating lock mechanisms , to name but a few possible applications . the present invention allows elimination of one or more control lines from the surface . the mechanism of the present invention as shown in fig2 can be adapted for single application or multiple applications . without the optional passage 40 and an associated check valve 42 shown schematically in fig2 , an initial setting down weight will break the shear pin 38 and initiate a one time pressure buildup to operate a tool or perform another downhole function . in that version , once weight is set down the pressure is applied . in systems where some of the pressurized fluid is allowed to escape such as for a purpose of displacing debris before a downhole connection is made , the loss of fluid from the system could mean that an insufficient volume of incompressible fluid could remain to re - establish the initial pressure generated from the original settling down weight and reduction of the volume of chamber 32 . however , it is possible to have a system of being able to recharge the chamber 32 with well or other fluids for example stored in other compartments in sub 28 and a way to do this is to provide a passage 40 which can optionally have a check valve 42 that only allows fluid into chamber 32 when top sub 28 is picked up . in fig2 passage 40 is shown terminating in passage 44 formed by subs 28 and 46 . alternatively passage 40 can lead into the surrounding annulus 48 or to an enclosed compartment of clean fluid within sub 28 or in the string above it . using passage 40 the chamber 32 fills when sub 28 is picked up because such movement reduces pressure in chamber 32 to allow fluids to come in . even without a check valve 42 , pressure can still be built up after recharging chamber 32 through passage 40 by advancing passage 40 beyond seal 34 . this will create a vacuum upon re - charging until the port re - enters the chamber if the other end of the tube is plugged . the preferred alternative is the check valve 42 . alternatively , with the addition of the check valve 42 any subsequent setting down of the sub 28 will close the check valve 42 and allow chamber 32 to be pressurized . those skilled in the art will also appreciate that while a shear pin 38 is shown as holding the relative positions of subs 28 and 46 , other ways of holding them together can be used that also accommodate subsequent relative movement . clearly after the shear pin 38 is broken the sub 28 can be raised and lowered from the surface any number of times . alternatively , a j - slot mechanism of a type known in the art can be supplied to allow relative movement between sub 28 and sub 46 in a defined range any number of times . finally , it is worth mentioning that the embodiment of fig2 because it has seals 34 and 36 is isolated from wellbore hydrostatic pressure increase as the assembly is introduced into the wellbore . the embodiments in fig3 and 4 use a floating piston to balance out wellbore hydrostatic that is an issue in those embodiments due to the different sealing arrangements from fig2 , as will be explained below . in fig3 , a top sub 50 that is supported by a tubing string that is not shown , is inserted into a bottom sub 52 defining chambers 54 and 56 that are divided by floating piston 58 . floating piston 58 has outer seal 60 and inner seal 62 . chamber 54 is not sealed and is exposed to wellbore hydrostatic pressure . chamber 56 has an outlet 64 that goes to a tool to be operated or for flushing purposes as described above or for any other downhole use of pressurized fluid . seal 66 isolates chamber 56 from bore 68 in the subs 50 and 52 . those skilled in the art will appreciate that movement of floating piston 58 allows the increasing hydrostatic pressure to be transferred to chamber 56 to avoid any pressure imbalances from forming inside the tool prior to operation . a shear pin 70 prevents relative movement between subs 50 and 52 until enough set down weight is applied to sub 50 . movement of sub 50 with respect to sub 52 builds pressure in chambers 54 and 56 although some leakage occurs out of chamber 54 into the annulus 72 as sub 50 is moved down . pressure builds up in chamber 56 and is delivered though outlet 64 to perform the downhole operation with the various options again available as earlier described with regard to fig2 . fig4 is similar to fig3 except that in fig4 there is a second floating piston 74 and chamber 54 is isolated from annulus 72 while a new chamber 76 is provided that is not sealed from annulus 72 . setting down sub 50 pressurizes all three chambers 76 , 54 and 56 . discrete fluid paths are made available as between chambers 54 and 56 through separate outlets 64 and 77 . outlet 64 can be used to lock a wet connect together while outlet 77 can be used for a fluid flush of the ends of the fiber optic cable before they are pushed together , for example . it may be desirable to sequence the action of pressure buildup on the end user tools or devices affected by them . for example , in making up a downhole wet connect it is desirable to flush the fiber optic cable ends before the connection is fully pushed together . a way to address these conflicting needs is to put a rupture disc 78 in outlet 77 . that way if outlet 64 is used to flush the ends of the fiber optic cables it can be activated first before the wet connect is fully made up . then when that process completes and more pressure is developed with further movement of sub 50 , at some point , calculated to be when the wet connect halves are abutting and are ready to be locked together , the rupture disc 78 will fail to allow the built up pressure to be communicated through passage 77 to set the anchor that locks the wet connect together . it is worth noting that if a rupture disk is placed in outlet 64 there will be a trapped fluid volume between the disk and piston in the anchor . a better way to do this is to have a low - pressure disk in outlet 77 which shears at a relatively low pressure when compared to the pressure required to shear the commit piston in the anchor . this way there is no trapped fluid volume which cannot be hydrostatically balanced . yet another way to do this is to allow the relative motion between subs 50 and 52 to open a port communicating with outlet 77 first to allow the connection to be washed before it is fully mated up with additional movement then closing access to port 77 so that available pressure can act through port 64 to which access only opens up after access to port 77 is closed or nearly closed to avoid fluid lock in chambers 54 and 56 . fig5 is a variation on fig4 adding an undercut 80 at piston 74 so that seal 82 can initially be bypassed . chamber 54 can be filled with a viscous material such as optical index matching gel to keep it in place as the assembly is run into the hole . when the shear screw 70 is sheared the contents of chamber 54 will be pushed out passage 77 for , for example , cleaning the connection before it is fully made up so that the fiber optic cables can effectively transmit signals . eventually , piston 74 will contact piston 58 after which the contents of chamber 56 will be pushed out through connection 64 . since an actuating piston for the anchor or lock for the wet connect ( not shown ) is also shear pinned , the pressure has to build in chamber 56 with piston 80 against piston 58 and set down weight applied to sub 50 before the shear pin in the anchor or lock can break to actuate that tool . again , the concept being illustrated is sequential operation of two downhole operations the details of which can vary broadly . the invention encompasses this staged actuation as well as simultaneous actuation of different or even an identical downhole device . those skilled in the art will appreciate that the present invention allows the elimination of a control line from the surface and replaces its operation with a pressure generation system that is localized and preferably initiated with string manipulation . designs are presented that allow for single operation for a specific task or the ability to cycle as many times as needed to accomplish the same or different tasks . the reservoirs can be isolated from wellbore hydrostatic or compensated to neutralize its effects . a single or multiple reservoirs can be actuated either at once or in sequential order to meet the well conditions and the desired order of operations downhole . the chambers can be pre - filled for a single time fluid displacement or they can have the capability of being recharged using a passage that passes a seal or a passage with a check valve . recharge fluid can come from the tubing , the annulus or a storage chamber for fluid provided in the string . splines or other rotational locking features can be provided to allow for torque transmission through the subs independent of their ability to move longitudinally relative to each other to create the desired pressure to use downhole . the above description is illustrative of the preferred embodiment and many modifications may be made by those skilled in the art without departing from the invention whose scope is to be determined from the literal and equivalent scope of the claims below .	4
fig1 is a simplified schematic representation of a spectroscopic apparatus 100 constructed in accordance with the invention . as shown in this figure , a first light beam 110 and 112 are propagated to an optical circuit 115 . the light beams are propagated to respective mirrors 120 and 122 whereupon the beams are reflected to a concave reflector 125 . prior to reaching mirrors 120 and 122 , the light beams are split by respective ones of beam splitters 126 and 128 and respective portions of the light beams are redirected to respective mirrors 130 and 132 . upon being reflected by mirrors 130 and 132 , the light beams are focused by a lens 135 onto a crystal 140 , and then focused again by a further lens 142 . the refocused light beam constitutes a reference beam that is propagated in this embodiment toward a mirror 145 and onto concave reflector 125 . concave reflector 125 focuses first beam 110 , second beam 112 , and reference beam 150 onto a sample 155 . the combined beams are reflected from the sample onto a further concave reflector 160 and into a monochromator 165 via a further mirror 167 and a further lens 169 . monochromator 165 issues an optical signal ( not specifically designated ) that is viewed , in this specific illustrative embodiment of the invention , by charge coupled device ( ccd ) camera 170 . as is known , a monochromator is an optical device that transmits a mechanically selectable narrow band of wavelengths of light from a wider range of wavelengths available at the input . fig1 shows a further arrangement 200 for generating a reference beam . reference beam generating arrangement 200 is particularly advantageous as a retrofit for existing spectroscopic equipment . in the embodiment of reference beam generating arrangement 200 , first and second light beams 110 and 112 are propagated to reference beam generating arrangement 200 . first beam 110 is reflected as shown by mirrors 210 and 212 and propagated through a beam splitter 215 . the portion of first beam 110 that propagates through beam splitter 215 is reflected by a further mirror 216 . second light beam 112 is propagated through a beam splitter 220 , which also reflects a portion of first light beam 110 . the 3 second light beam and the portion of first light beam 110 that was split at beam splitter 215 are propagated to a concave reflector 222 and to a crystal 223 . crystal 223 issues the reference beam ( 225 ), which is reflected , in this specific illustrative embodiment of the invention , by reflector 227 and mirrors 229 and 230 . the broad - band vibrational sum frequency generation ( sfg ) spectroscopy arrangement described herein is based on a high power amplified femtosecond ti - sapphire laser system ( spectra physics spitfire sub - 50 fs hp ) ( not shown ). fifty percent ( 50 %) of the 2 mj fundamental output pulse ( 800 nm , fwhm 35 fs ) is used to pump an optical parametric amplifier ( opa ) followed by the signal - idler re - timing with a manual delay stage and difference frequency mixing in a 0 . 5 mm thick aggas 2 crystal producing 4 - 5 μj ir pulses centered at 2900 cm − 1 . the broad - band sfg scheme is employed that uses spectrally broad ( fwhm ˜ 250 cm − 1 ) ir and narrow - band visible pulses obtained using a high - power deposited etalon ( tecoptics ), fwhm 15 cm − 1 . the laser power at the sample 155 is 2 - 3 μj / pulse for ir and up to 10 - 15 μj / pulse for the visible at 1 khz repetition rate . fig2 ( a ) is a simplified schematic representation of a spectroscopic apparatus constructed in accordance with the invention that is useful to describe the operation of the invention , and fig2 ( b ) is a sequence of graphical representations that illustrate the process of data analysis beginning with graphical representation ( a ), which corresponds to a raw interferogram obtained after subtraction of lo , to graphical representation ( b ), which is a time domain spectrum derived by inverse fourier transformation ( ifft ). elements of structure that have previously been discussed are similarly designated . graphical representation ( c ) of fig2 ( b ) illustrates the real part of the result of a fft performed on the time domain spectrum of graphical representation ( b ). the absolute value of the real part shown in the frequency domain representation ( c ) is determined and shown in graphical representation ( d ) of fig2 ( b ). in this embodiment , the local oscillator ( lo ) beam is generated by focusing ˜ 1 % of the visible and ˜ 5 % of the ir beams into a 1 mm thick knbo 3 crystal . the intensity of lo beam is adjusted using a variable density filter ( not shown ). the desired delay between lo and the signal pulse is controlled by a manual delay stage ( not shown in this figure ). the lo beam is recombined with the visible beam , ( parallel with a slight off - set ), using a dichroic beam splitter . ir , visible , and lo beams are focused onto the sample surface in this specific illustrative embodiment of the invention by a 3 ″ diameter , 45 cm - focal length on - axis parabolic mirror 125 to a ˜ 230 μm diameter spot at the sample position . before this mirror , the beams are parallel and vertically offset , such that they spatially overlap at the sample surface with the incidence angles ˜ 65 ° and ˜ 70 ° from the surface normal of the sample . the lo beam is aligned such that the reflected portion of the beam is collinear with the sfg signal produced at the sample surface . the sfg signal is collimated after the sample with a lens 169 , focused onto an entrance slit ( not specifically designated ) of monochromator 165 , then frequency - dispersed through the 300 mm monochromator ( acton spectra - pro 300i ), and detected using a liquid nitrogen cooled ccd 170 ( princeton instruments spec - 10 : 100b , 100 × 1340 pixels ). ssp polarizations were used for the 1 - octanol experiments . the spectra were recorded at the full resolution of ccd 170 , i . e ., 1340 × 100 pixels , without binning , i . e ., without combining the information in adjacent pixels . a set of spectra was recorded for each sample . the lo spectrum ( ir beam blocked ) was measured , then hd signal was measured with visible , ir and lo opened . additionally , the homodyne spectra ( lo beam blocked ) ( and the corresponding background spectra with lo and ir are closed ) was measured for samples with 1 - octanol coverage concentrations 8 % and above . the heterodyne spectrum ( interference fringes ) is then obtained by subtracting the measured lo signal from the measured hd signal . the homodyne spectrum is similarly obtained by subtracting the measured background spectrum from the measured homodyne spectrum . this procedure guarantees that the scattered light from the strong visible pump beam as well as ccd dark noise are subtracted for homodyne and heterodyne spectra . at 100 % 1 - octanol monolayer coverage ( 1 . 0 mm bulk concentration ), the total hd - sfg detected signal was ˜ 22000 counts per pixel , the fringe depth of the spectral interferograms around the ch 3 symmetric stretch peak was 2400 counts , while the homodyne sfg signal level was ˜ 200 counts per pixel for 100 second exposure time ( no binning ). the heterodyne setup herein described was covered with a box ( not shown ) to eliminate the effects of air currents . the box cover increased the phase stability of the present arrangement to λ / 4 over 10 minutes . in this manner , the fringe depth in the spectral interferograms was not affected by the phase drifts over 100 second long ccd collection times . the broad - band vibrational sum frequency generation ( sfg ) spectroscopy set - up test system , that has octanol / deuterated octanol mixture and an air / water interface , is based on a high power amplified femtosecond ti - sapphire laser system ( spectra physics spitfire sub - 50 fs hp ). one half of the 2 mj fundamental output pulse ( 800 nm , fwhm 35 fs ) is used to pump an optical parametric amplifier ( opa ) followed by the signal - idler re - timing with a manual delay stage and difference frequency mixing in a 0 . 5 mm thick aggas 2 crystal producing 4 - 5 μj ir pulses centered at 2900 cm − 1 , temporal fwhm ˜ 80 fs . the broad - band sfg scheme is employed that uses spectrally broad ( fwhm ˜ 250 cm − 1 ) ir and narrow - band visible pulses ( fwhm 15 cm − 1 ) obtained using a high - power deposited etalon ( tecoptics ). the laser power at the sample is 2 - 3 μj / pulse for ir and up to 10 − 15 μj / pulse for the visible at 1 khz repetition rate . the sfg signal is collimated after the sample with a lens , focused onto a monochromator entrance slit , then frequency - dispersed through the 300 mm monochromator ( acton spectra - pro 300i ), and detected using a liquid nitrogen cooled ccd ( princeton instruments spec - 10 : 100b , 100 × 1340 pixels ). ssp polarizations for sfg , visible , and ir beams , respectively , were used in all 1 - octanol measurements . fig3 ( a ) is a schematic representation of the broad - band heterodyne - detected hd - sfg experiment ; fig3 ( b ) is a representation of spectral interferograms ( si , real part shown ) for samples of varying surface coverage of 1 - octanol , from 100 % to 3 % monolayer ; and fig3 ( c ) is an expanded graphical representation of the signal from the 3 % monolayer sample . the reference lo beam in the hd - sfg set - up of fig3 ( a ), 3 ( b ), and 3 ( c ) ( hereinafter fig3 ) is generated by sum - frequency mixing of small portions of the visible and ir beams (˜ 1 % of the visible and ˜ 5 % of the ir ) in a 1 mm thick knbo 3 crystal . the phase matching in the crystal has limited the spectral bandwidth of the lo to ˜ 120 cm − 1 and its time width to ˜ 250 fs . intensity of lo beam is adjusted using a variable density filter to optimize detection of the cross - term . the lo beam is recombined with the visible beam using a dichroic beam splitter . ir , visible , and lo beams are spatially overlapped at the sample surface by a 3 ″ diameter , 45 cm - focal length on - axis parabolic mirror focusing all beams into a ˜ 230 μm diameter spot at the sample with 65 ° incidence angle from surface normal . the lo beam is aligned such that after reflection off the sample surface it propagates collinearly with the sfg signal generated at the sample surface ( fig3 ). in this arrangement , e sfg ∝ x ( 2 ) ∝ n , and i sfg ∝\| x ( 2 ) \| 2 ∝ n 2 . heterodyne detection is performed using spectral interferometry with a time - delayed (˜ 2 . 5 ps , introduced by a manual delay stage ) lo pulse , resulting in a characteristic fringe pattern ∝ e iωr in the frequency domain referred to as spectral interferogram ( fig3 ). this allows one to utilize the broad - band sfg scheme and take advantage of multiplex detection with a ccd chip . also , the fringe pattern is used to compensate for the phase drift between acquisitions using the phasing procedure as described below . the spectral interferograms were recorded at the full resolution of the ccd ( i . e ., 1340 pixels ) without binning . the overall hd signal level was adjusted by tuning the intensity of the lo beam , and is limited only by the dynamic range of the ccd detector ( 65535 counts / pixel ). at 100 % 1 - octanol monolayer coverage ( 1 . 0 mm bulk concentration ), the total hd - sfg detected signal ( 2 ) was typically ˜ 22 , 000 counts per pixel , the fringe depth of the spectral interferograms ( 3 ) around the ch 3 symmetric stretch peak was 2 , 400 counts , while the homodyne sfg signal level ( 1 ) was ˜ 200 counts per pixel for 100 second exposure time . the heterodyne setup is covered to eliminate the air currents , allowing the phase stability of λ / 4 over 10 minutes . thus the depth of the spectral fringes was not affected by the phase drifts over 100 second long ccd collection times used in all measurements . it is demonstrated herein that the hd - sfg technique on a model system , mixed monolayers of 1 - octanol / deuterated 1 - octanol at the air / water interface . the samples were prepared using double - distilled water . 1 - octanol ( c 8 11 18 o , fisher scientific , & gt ; 99 %) and deuterated 1 - octanol ( c 8 13 17 oh , cambridge isotope laboratories , 98 %) were used as received . the overall concentration was kept constant at 1 . 0 mm , corresponding to a saturated gibbs monolayer at the air / water interface , according to literature reports . a period often minutes was allowed for the monolayer to form at the surface before the sfg measurements . evaporation , and the associated lowering of the sample surface , was controlled by covering the sample dish with a plastic film with two holes for beam access . the ch 3 stretch modes in the 2800 - 3000 cm − 1 region were monitored while varying the mole fraction of 1 - octanol , thus changing the surface coverage n of the ch 3 groups without the potential complications of changing molecular orientation and intermolecular packing of the alkane chains . for comparison , both heterodyne - detected and homodyne - detected sfg spectra obtained are presented using the same signal acquisition time on the ccd chip , 100 s . the two main transitions observed , marked by cyan shadows , are ch 3 symmetric stretch (˜ 2880 cm − 1 ) and fermi resonance ( 2940 cm − 1 ), in agreement with the previously reported measurements for ssp polarization . the broad - band hd - sfg spectral interferograms are obtained by recording the total heterodyne - detected intensity spectrum i . d .- sfg , eq . ( 2 ), then subtracting the lo intensity spectrum ( second term in eq . ( 2 )) to reveal the cross - term , eq . ( 3 ). the lo intensity spectrum is recorded on the same ccd detector , in exactly the same experimental configuration , by simply blocking the ir beam such that the sfg signal from sample is not generated . after subtraction of the lo , an inverse fourier transform into the time - domain is performed to filter out the remaining homodyne contribution centered at τ = 0 delay ( center of lo pulse ), since the desired cross - term , eq . ( 3 ), is centered around τ = 2 . 5 ps delay between the lo and sfg pulses . fourier transforming back into the frequency domain yields the “ cleaned - up ” spectral interferogram ( si ) shown in fig3 ( b ) ( real part shown ), with the lo spectral envelope completely removed . clean spectral interferograms can be recorded using the 100 s ccd acquisition time for samples ranging from 100 % 1 - octanol in the monolayer to a fully deuterated monolayer , the signal of which is referred to below as the background signal of the neat interface . fig3 ( c ) shows a blow - up of the spectral interferogram for the 3 % 1 - octanol monolayer sample , demonstrating the signal - to - noise level achievable in this technique . in fact , interferograms for samples below 1 % octanol monolayer can be recorded with similar s / n , but the analysis of the spectra is restricted due to the purity of the d - octanol . fig4 is a graphical representation of the comparison of the power spectra of 1 - octanol ch - stretch vibrations obtained from the heterodyne - detected spectral interferograms ( solid lines ) with the conventional ( homodyne - detected ) sfg spectra ( dotted lines ) for surface coverage ( a ) 100 %, ( b ) 80 %, ( c ) 60 %, and ( d ) 40 % monolayer . absolute value squared of the obtained interferograms , corrected for the spectrum of the local oscillator , accurately reproduce the homodyne - detected sfg spectra as shown in fig4 , thereby validating the hd - sfg measurements . however , the comparison can be made only for samples close to monolayer coverage . below ˜ 40 % monolayer , the homodyne - detected sfg does not produce useful spectra for the chosen 100 s acquisition time . the two main reasons for this are ( 1 ) that the resonant part of the homodyne sfg signal decreases quadratically with the surface coverage n ( see , eq . ( 1 )), quickly reducing the resonant octanol signal below the noise level , and ( 2 ) that at low coverage , the background part of the response ( nonresonant electronic contribution as well as impurities and the broad red - tail of the water oh - stretch band evident in fig6 ( a ) interferes with and masks the weak resonant ch - stretch transitions . heterodyne detection overcomes both of these problems . first , the use of the strong lo beam amplifies the overall signal , improving the signal - to - noise ratio . second , the knowledge of the absolute phase of the hd - sfg signal with respect to the background signal from neat interface ( 100 % deuterated 1 - octanol monolayer ) enables correct subtraction of the background contribution to reveal the resonant 1 - octanol signal . the value of the absolute phase cannot be preserved from experiment to experiment , due to long - term drift and especially when samples are changed . in order to lock the phases in all measurements , the following phasing procedure has been developed . neat interfaces ( in the present case , 100 % deuterated 1 - octanol monolayer at the air / water interface ) are often characterized by predominantly non - resonant response leading to a broad sfg signal spectrum . the region around 3100 cm − 1 is outside the ch 3 vibrational transitions of interest . the neat interface sfg background is nonzero in this region ( fig3 ( b )), resulting possibly from the broad red - tail of the water oh - stretch band . sfg signal in this region does not depend on the 1 - octanol surface coverage ranging from 0 % to 100 %. fig5 ( a ) shows magnified hd - sfg spectral interferograms at approximately 3100 cm − 1 for the neat interface ( n = 0 %) and for a sample with n = 10 % 1 - octanol interface coverage . the shapes of the spectral interferograms for both concentrations are similar in this spectral region , but the phases differ . by adding a phase φ adj to the complex - valued hd - sfg spectral interferogram for the 10 % sample ( i . e ., multiplying it by a e iφ adj factor ), one can achieve nearly perfect overlap in this spectral region ( fig5 ( b )), thus locking the phase of the 10 % sample to the 0 % ( neat interface ) sample ( background ). the accuracy of the obtained phase φ adj is better than ± 5 degrees . using this phasing procedure , one ensures that the absolute phases for all measured samples are locked to the spectral phase of the 0 % reference sample ( 100 % deuterated 1 - octanol ). the ability to retrieve absolute phase for each measured spectrum ( with respect to a chosen “ standard ” zero - phase signal , e . g ., neat interface background ) using simple phasing of the spectral interferograms is a consequence of the phase being locked across the spectrum of the lo pulse , a unique advantage of the broad - band spectral interferometry approach not available , e . g ., in the scanning phase - sensitive sfg detection . after the phasing procedure , the background signal of the neat interface ( 100 % deuterated 1 - octanol ) can be subtracted to reveal the spectral signatures of the analyte ( 1 - octanol ) which are otherwise masked , especially at low concentrations . the extracted background - free hd - sfg power spectra shown in fig6 ( b ) demonstrate that this technique enables vibrational spectroscopy of surfaces at coverage as low as a few % monolayer , greatly exceeding the sensitivity limits of conventional sfg spectroscopy ( fig6 ( a )). as an example , the hd - sfg spectrum for the 6 % monolayer sample ( fig6 ( c )) exhibits the same two main transitions , i . e ., the ch 3 symmetric stretch and fermi resonance , as in the higher concentration samples . the increased noise level on the wings of the spectrum results from the limited bandwidth of the lo pulse in the current set - up ( only ˜ 120 cm − 1 due to phase - matching in the knbo 3 crystal ). the time - domain representation ( fig7 ) naturally separates out the mostly nonresonant ( i . e ., instantaneous ) background signal from the resonant part of the response — the free induction decay ( fid ) which shows the characteristic vibrational quantum beats . the neat interface background signal ( fig7 , bottom trace ) was measured by performing hd - sfg on a fully deuterated monolayer . the clearly discernible non - instantaneous component in the time - dependent signal from the neat interface sample demonstrates our ability to detect impurities in the deuterated 1 - octanol ( 2 % or below , according to the manufacturer ). it is to be noted that the knowledge of the absolute phase allows one to subtract this neat interface signal , i . e ., essentially get rid of the impurities contaminating the 1 - octanol spectrum at low concentrations . for intermediate concentrations ( 8 - 25 %), the fid curves show destructive interference between the background fed signal peaked around t = 0 and the resonant octanol signal , resulting in an apparent “ dip ” in the overall hd . the linear scaling of the resonant ( background - free ) ch - stretch hd - sfg signal with the octanol mole fraction is demonstrated in fig8 which shows peak amplitude of the ch 3 symmetric stretch resonance . this allows extension of the hd - sfg spectroscopy to samples with surface coverage significantly below a single monolayer . in addition , the signal amplitude is much larger for the hd - sfg , which alleviates the problem of the electronic read - out noise . on the contrary , the homodyne - detected sfg intensity of the same transition follows the expected quadratic scaling . note that homodyne sfg signal is zero within the s / n for surface coverages 25 % monolayer and below . the signal - to - noise ratio in the spectral interferograms and the extracted spectra ( fig3 and 6 ) for lower coverage samples permits the suggestion that hd - sfg will enable the obtaining of vibrational spectra for samples at or below 1 % monolayer coverage . in fact , several spectral interferograms were recorded for the 1 - octanol mole fraction of 1 %, 0 . 5 % and 0 . 1 % ( not shown ), with s / n similar to that in fig3 . however , the isotopic purity of the deuterated 1 - octanol provided by the supplier ( cambridge isotope laboratories ) is 98 %. thus , for the chosen model system , testing of the hd - sfg technique at low surface coverages is limited by the chemical purity of the samples rather than by the sensitivity of the spectroscopic detection . heterodyne detection via broad - band spectral interferometry has herein been implemented in accordance with the invention , yielding several significant advantages . first , the reference beam does not have to be scanned across the sfg signal and the whole spectral phase and amplitude can be detected from one ccd reading . this eliminates phase fluctuations that result from wavelength tuning . second , the fft procedures used herein enable the implementation of significant noise filtering . third , the instrument of the present invention is possessed of a phase stability that is long enough to retrieve one sfg spectrum without phase drift - off , thereby enabling retrieval of the sfg spectrum . in addition , the inventive phasing procedure allows the lo phase between different measurements to be locked , thereby solving the problem of phase stability . the recovered spectral phase contains information on absolute molecular orientations and enables recovery of the temporal sfg signal profile , which contains information on molecular dynamics at interfaces . the interface sfg signal results from the second order nonlinear process of two electric fields interacting with the surface / interface . the spectral component of the sfg signal electric field at frequency ω is given by : e sfg ( ω )∝ ∫∫ x ( 2 ) ( ω = ω ir + ω vis , ω ir , ω vis ) e ir ( ω ir ) e vis ( ω vis ) dωv is dω ir , ( a ) here e vis and e ir are spectral components of the visible and ir laser beams at frequencies ω vis and ω ir respectively . x ( 2 ) is the second order nonlinear susceptibility tensor proportional to the monolayer coverage n and to the averaged molecular polarizability tensor β ( 2 ) . sfg is implemented with spectrally narrow nonresonant visible laser pulse and spectrally broad ir pulse resonant with the adsorbant so that equation ( a ) becomes e sfg ( ω )∝ n · e vis ·∫ β ( 2 ) ( ω = ω ir + ω vis , ω ir , ω vis ) . e ir ( ω ir ) dω ir = n · e vis · β ( 2 ) ( c ) i sfg homo ( ω )=\| ê sfg ( ω )\| 2 ∝ n 2 ·\| { tilde over ( β )} \|’ the integral in equation ( c ), denoted as β ( 2 ) , contains the spectral overlap of the ir laser pulse with the average molecular polarizability β ( 2 ) . depends quadratically on the monolayer coverage n . this quadratic dependence strongly limits the sensitivity of the homodyne detection technique at low adsorbant coverage . for instance , if the coverage is reduced by a factor of 10 , the signal to noise ratio would reduce by 100 , and the experimental exposure would time need to be increased by 10 4 to keep the same signal - to - noise ratio . in the heterodyne detection two collinear beams , a lo beam is made to propagate collinearly with the sfg signal generated at the sample surface , such that they interfere at the detector . the heterodyne detected signal intensity is : s sfg hd ( ω )∝ \| ê sfg ( ω )+ ê lo ( ω )\| 2 =\| ê sfg ( ω )\| 2 +\| ê lo ( ω )\| 2 + s sfg hd - cross • term ( ω ), ( e ) s sfg hd - cross • term ( ω )= 2 \| ê sfg ( ω ) ê lo ( ω )\| cos ( φ sfg ( ω )− φ lo ( ω ))∝ n · { tilde over ( β )} ( 2 ) \| ( f ) contains the product of the two fields and depends on the signal phase . in heterodyne detection the cross term is extracted by separately measuring the heterodyne intensity ( e ) and the intensity of the local oscillator ( second term in ( e )), then subtracting one from the other . note that the homodyne intensity of the sfg signal is small compared to that of the lo . the cross - term ( f ) is relatively increased by using intense lo beam and its phase can be measured . the cross term scales linearly with the surface coverage n . thus if the coverage drops by a factor of 10 , as in previous example , its value also drops 10 times and the exposure would have to be increased 100 times to keep the same signal to noise ratio , i . e ., 100 times shorter than in the homodyne detection case . if the lo pulse is temporarily delayed with respect to the sfg signal pulse by a delay τ 0 , it acquires an additional phase ωτ 0 , and the cross term exhibits fast oscillations as a function of frequency , due to the φ sfg ( ω )− φ lo ( ω )− ωτ 0 phase in the cosine term , with period 2π / τ 0 — the so - called “ spectral interferogram .” by applying spectral interferometry ( si ) procedure , both the signal spectral phase and its amplitude can be recovered . moreover , the temporal profile of the signal ( fid ) can be recovered through the fourier transform . finally , most interfaces produce nonresonant sfg background signal even when the adsorbant molecule of interest is not present . this background signal e bgr interferes with the adsorbant signal and strongly limits the sensitivity of the homodyne detection . indeed , the total measured homodyne signal intensity is : \| ê sfg ( ω )+ ê bgr ( ω )\| 2 = ê sfg 2 ( ω )+ ê bgr 2 ( ω )+ 2 \| ê sfg ( ω ) ê bgr ( ω )\| cos ( φ sfg ( ω )− φ bgr ( ω )) ( g ) where e sfg and e bgr are sfg signals from the adsorbant of interest and the neat interface respectively . the phase φ sfg ( ω )− φ bgr ( ω ) is not recoverable in the homodyne experiments . at relatively low adsorbant signal levels , some of its spectral features in the measured homodyne signal may be amplified , while others suppressed due to the interference . heterodyne detection recovers the signal phase , and thus allows subtraction of the separately measured nonresonant interface signal e bgr . this enable extraction of adsorbant signals at levels well below the neat interface sfg background value . although the invention has been described in terms of specific embodiments and applications , persons skilled in the art may , in light of this teaching , generate additional embodiments without exceeding the scope or departing from the spirit of the invention described and claimed herein . accordingly , it is to be understood that the drawing and description in this disclosure are proffered to facilitate comprehension of the invention , and should not be construed to limit the scope thereof .	6
as is apparent from the following detailed disclosure , the prize delivery system of this invention is effectively usable in connection with any desired food or beverage container , holder , wrapper , instrument , or utensil , employed in the food service industry . in this regard , the present invention is equally applicable to all facets or categories of the food service industry , such as fast food outlets , restaurants , contract feeders , vending outlets , recreational outlets , and the like . in one exemplary instance , the prize delivery system of this invention can be employed in fast food outlets in connection with the sale and distribution of hamburgers , hot dogs , french fries , pancakes , eggs , popcorn , ice cream , soda , coffee , hot chocolate and the like . furthermore , products commonly distributed in the food service industry but not employed for holding food products could also incorporate the present invention , such as straws , which are distributed to consumers for drinking various beverages . in the following detailed disclosure , drinking cups , straws , a special game coupon , and food product containers are fully and completely described , as examples of the prize delivery system of the present invention . however , the scope of the present invention is not , in any way , intended to be limited to the specific embodiments , since the present invention is equally applicable to any other holders , containers , wrappers , or utensils employed in the food service industry . in fig1 - 3 , one embodiment of the prize delivery system of the present invention is depicted in the form of a food or beverage holding cup . as shown therein , cup 20 , which may be used for any beverage or food product such as yogurt , french fries , popcorn , ice cream and the like , is constructed to secretly retain prize award 21 in a manner which prevents consumers or employees of the food distributor from being able to distinguish prize bearing cup 20 from conventional non - prize bearing cups . in accordance with this invention , cup 20 is constructed to be completely indistinguishable from non - prize bearing cups , in order to enable prize bearing cup 20 to be randomly distributed with non - prize bearing cups . in this way , complete random distribution of prize award 21 to lucky consumers is assured . in this embodiment , cup 20 comprises a substantially cylindrically shaped , wall defining member 24 and a base 25 . base 25 comprises a substantially circular shaped central portion 26 and a peripherally surrounding , depending flange 27 . in addition , central portion 26 of base 25 comprises an upper surface 28 and a lower surface 29 . base 25 is securely affixed to cylindrically shaped , wall defining member 24 in the generally conventional manner . in this typical construction , the lower terminating end portion 30 of wall defining member 24 is folded about depending flange 27 of base 25 and sealingly glued thereto , thereby securely affixing base 25 to wall member 24 . in this way , an interior food or beverage retaining zone 31 is formed . in addition , upper surface 28 of base 25 is typically constructed , in a manner well known in the art , to incorporate a leak - free construction , thereby assuring the trouble - free retention of the desired food or beverage in retaining zone 31 of cup 20 , without incurring any unwanted leakage therefrom . in order to secretly retain prize award 21 in a manner which is completely undetectable by any individual , prize bearing cup 20 also incorporates a prize award holding plate 34 and a support disk 35 . both prize holding plate 34 and support disk 35 are constructed in a substantially circular shape having a diameter virtually identical to the diameter of central portion 26 of base 25 . in addition , in the preferred embodiment , prize holding plate 34 and support disk 35 are securely bonded to each other , to form a single component for purposes of manufacture , thereby enhancing the speed , efficiency , and ease of manufacturing prize award bearing container 20 of this invention . in the preferred embodiment , prize holding plate 34 incorporates a cut - out zone 36 which is dimensioned for receiving prize award 21 . in addition , the thickness of the material employed for manufacturing prize holding plate 34 is also preferably selected to be precisely equivalent to the thickness of prize award 21 when positioned for retention in cut - out zone 36 . in the preferred embodiment , prize award 21 comprises a cash award in the form of currency , preferably ranging between about $ 1 . 00 to $ 500 . 00 in face value . although any desired denomination of currency can be employed , it has been found that by providing a cash prize award , consumer excitement over the instantaneous winning of a prize is substantially heightened . with prize award 21 comprising cash awards of varying denominations , prize holding plate 34 comprises a thickness which is substantially equivalent to the thickness of the currency , when the currency is folded to a size substantially equivalent to the size of cut - out zone 36 . in this way , prize award 21 conveniently fits directly within cut - zone 36 , substantially filling zone 36 , with the resulting thickness formed by prize award 21 being virtually equivalent to the thickness of prize holding plate 34 . as a result , a smooth , convenient , uniformly shaped prize retaining package is attained for being secretly stowed in the base of cup 20 . in order to provide cost efficient automated manufacturing of prize retaining cup 20 , while also assuring that prize retaining cup 20 is completely indistinguishable from non - prize bearing cups , base 25 and support disk 36 are formed from the identical material . preferably , a large sheet of material having the desired thickness and surface coating is employed . in addition , the sheet of material is printed with the particular desired graphics or words which have been predesigned for the particular promotion . then , a plurality of circular shaped disks are cut from the sheet , with each disk incorporating the printed indicia . preferably , each substantially circular disk comprises an overall diameter which is equivalent to central portion 26 and flange 27 of base 25 . in this way , the pre - printed , pre - cut disks are employed for base 25 in the manufacture of both the prize bearing cup and non - prize bearing cups . in addition , in order to form support disk 35 in a manner which will look identical to central portion 26 of base 25 , a plurality of the cut circular disks are trimmed to remove the material which would form flange 27 . with that material removed , support disk 35 is produced , which will look visually identical to central portion 26 of base 25 . in this way , once support disk 35 has been affixed to the bottom of cup 20 , concealing the presence of prize holding plate 34 , the resulting construction provides visual identity between prize bearing cup 20 and a non - prize bearing cup . in order to further enhance the automated manufacture of prize bearing cup 20 , prize holding plates 34 are formed in a manner substantially identical to the process detailed above in reference to the pre - printed disk members . in this way , a plurality of prize holding plates 34 are formed from a substantially enlarged sheet which is formed from the desired material with the preferred thickness . during the cutting process , wherein the precisely desired dimension for prize holding plate 34 is cut from the enlarged sheet , cut - out zones 36 are also simultaneously cut . as a result , prize holding plates 34 ar formed quickly and efficiently . once prize holding plate 34 and support disk 35 have been formed , these two members are preferably glued together , forming a subassembly . once formed , the positioning and retention of prize award 21 is quickly and easily attained by merely folding the currency and positioning the folded currency in cut - out zone 36 . with the support disk 35 closing one side of cut - out zone 36 , the rapid positioning and retention of prize award 21 in cut - out zone 36 is assured . once prize award 21 has been positioned in the precisely desired manner in cut - out zone 36 of prize holding plate 34 , glue is applied to the top surface of prize holding plate 34 , and the entire subassembly is affixed to lower surface 29 of base 25 of cup 20 . once securely affixed in position , prize award 21 is secretly retained in cup 20 , in a manner which is completely undetectable from observation and comparison of prize retaining cup 20 with non - prize bearing cups . furthermore , since support disk 35 comprises the identical material and identical graphics employed on lower surface 29 of base 25 , visual identity is assured and comparison of prize retaining cup 20 with non - prize bearing cups reveals no discernible differences . in the preferred embodiment , one adjustment is made in manufacturing prize retaining cup 20 in order to further enhance the visual indistinguishable construction thereof . inasmuch as prize holding plate 34 and support disk 35 comprise a fixed overall thickness , cup 20 should be constructed to assure that this added thickness is not discoverable . as shown in fig1 distance &# 34 ; x &# 34 ; represents the substantially vertical distance between the bottom edge of flange 30 and outer visible surface of disk 35 . in nonprize bearing cups , this distance would be between the bottom edge of flange 30 and the lower surface of the cup base . in order to assure that the visual observation of distance &# 34 ; x &# 34 ; appears identical in both prize bearing cups and non - prize bearing cups , the preferred manufacturing procedure for forming prize bearing cup 20 incorporates the positioning of base 25 with the cylindrical wall defining member 24 , in the manner detailed above , at a position which is further away from the bottom edge of terminating end portion 30 than normally employed . as shown in fig1 prize retaining cup 20 is preferably constructed with the distance &# 34 ; y &# 34 ;, forming the vertical distance between lower surface 29 of base 25 and the bottom edge of terminating end portion 30 , with distance &# 34 ; y &# 34 ; being greater than the distance normally found with non - prize bearing cups . in this construction , the difference between distance &# 34 ; y &# 34 ; and distance &# 34 ; x &# 34 ; is equal to the thickness of prize holding plate 34 and support disk 35 . as a result , once prize holding plate 34 and support disk 35 have been securely affixed to base 25 of cup 20 , the distance between the bottom of support disk 35 and the bottom edge of terminating end portion 30 of cup 20 is equivalent to &# 34 ; x &# 34 ;, the precise distance normally found in non - prize bearing cups . in this way , prize bearing cups 20 are visually identical to non - prize bearing cups , and no visual clues exist which would enable someone to conclude that one of the cups retains a prize award . as a result , the precisely desired , secret , completely undetectible , retention of a prize award in cup 20 is assured . in an alternate construction , the base of each non - prize bearing cup is constructed from material having a greater thickness than base 25 of cup 20 . in this alternate embodiment , the thickness of the base of non - prize bearing cups equals the combined thickness of base 25 , holding plate 34 and disk 35 . in this way , all final dimensions of both prize bearing cups and non - prize bearing cups are identical and no discernible difference exists which would enable someone to advance detect the existence of a prize award in advance of actual opening of the cup . in the preferred embodiment , prize retaining cup 20 is seeded or intermixed with non - prize retaining cups at a convenient location , such as a manufacturing facility and then distributed in the normal channels of trade . in this way , any retail outlet desiring to benefit from the enhanced commercial sales attainable by employing the prize delivery system of the present invention would merely purchase cups , wherein prize bearing cups are randomly intermixed with non - prize bearing cups . preferably , the non - prize bearing cups , as well as the prize bearing cups , will all incorporate identical visual indicia printed on the outer surface of cylindrical wall member 24 , which promote the prize delivery system and inform the consumers of the method to use in order to access the prize award holding zone . in this way , all customers purchasing the particular food products would attain visually identical cup constructions , in which the existence of a prize delivery system would be detailed along with instructions on how to determine if a prize has been won . by employing the present invention , the excitement of winning a prize award is enhanced and shared with all of the customers in the retail outlet at the time a prize award is won . since any consumer winning a prize award would certainly exude substantial excitement , this excitement will be carried over to the non - prize winners , causing them to be excited and enticed at the prospect of winning the next time , thereby assuring repeat business for the retail outlet . in fig3 an alternate construction for producing a prize retaining cup is detailed . prize retaining cup 40 employs a dual or multi - wall cup construction to secretly retain the desired prize award . as shown fig3 prize retaining cup 40 incorporates an outer cup member 41 and an inner cup member 42 . outer cup member 41 comprises a substantially cylindrically shaped wall portion 44 and a base portion 45 securely affixed to one end of cylindrical wall portion 44 in the conventional manner detailed above . similarly , inner cup member 42 comprises a substantially cylindrically shaped wall portion 46 and a base portion 47 affixed to one end of cylindrical wall portion 46 in a conventional manner or integrally formed therewith . in order to secretly retain a prize award in cup 40 , a prize holding plate 50 is employed which is constructed substantially identical to prize holding plate 34 . in the manner detailed above , prize holding plate 50 incorporates a cut - out zone 51 in which the desired prize award 21 is securely retained . in assembling prize retaining cup 40 , prize holding plate 50 , with prize award 21 positioned in cut - out zone 51 , is placed on the top surface of base portion 45 of outer cup member 41 . then , inner cup member 42 is telescopically inserted into outer cup member 41 , bringing the bottom surface of base portion 47 into overlying concealing engagement with prize holding plate 50 . preferably , prior to telescopically inserting inner cup member 42 into outer cup member 41 , the walls of inner cup member 42 will be covered with adhesive in order to assure secure , affixed , retained , interengagement of outer cup member 41 with inner cup member 42 . alternatively , cup members 41 and 42 may be integrally affixed to each other using any desired alternate sealing means . once fully assembled , prize award 21 would be completely concealed between base portions 45 and 47 , rendering the presence of prize award 21 completely undetectible from a non - prize bearing cup . in this embodiment , in order to assure complete identity of prize retaining cup 40 with non - prize bearing cups , all of the cups during the promotional period are manufactured with the dual - wall construction described above . however , non - prize bearing cups would not incorporate prize holding plate 50 with the desired prize award . of course , if desired , a prize holding plate 50 could be employed in all cups with a particular message being used to fill cut - out zone 51 , informing the consumer that no award has been won while encouraging the consumer to continue to participate in the prize award game promotion . in this way , all cups would be completely identical and the presence of a prize award in any cup would be incapable of being undetectible . in fig4 and 5 , two alternate embodiments for the prize delivery system of the present invention are depicted . in these two embodiments , the prize delivery system employs drinking straws as the vehicle in which a prize award is randomly distributed to lucky consumers . in the embodiment depicted in fig4 a conventional , elongated , cylindrically shaped drinking straw 55 is employed . in specifically desired , pre - selected drinking straws 55 , a prize award 21 is inserted . preferably , prize award 21 comprises a cash currency award of any desired denomination . as detailed above , prize awards ranging between $ 1 . 00 and $ 500 . 00 bills are preferred . in this embodiment , the prize award is rolled and inserted into one end of drinking straw 55 . once prize award 21 has been inserted into drinking straw 55 , the rolled prize award 21 will unroll , until coming into frictional contact with the inner wall of drinking straw 55 , thereby assuring its secure , retained , frictional engagement therewith . with prize award 21 securely retained in drinking straw 55 , drinking straw 55 is enclosed within a suitable covering or wrapper 56 . wrapper 56 comprises a variety of materials such as foil , polymer films or sheets , heavy wrapping paper , or fiber reinforced paper . regardless of the type of material employed for wrapper 56 , wrapper 56 must be sufficiently dense or thick , as well as opaque , so as to prevent anyone from being able to visually or physically examine straw 55 and determine whether or not prize award 21 is contained therein . in this way , assurance is provided that no individual will be able to determine in advance whether a prize award is retained in a straw , prior to be given that particular straw as part of a purchase . in employing this embodiment , all of the drinking straws to be used during the particular promotion are manufactured in the identical manner , incorporating the identical wrapper 56 . as a result , all of the straws employed are visually identical and incapable of being analyzed in advance to determine which straw contains a prize award . in addition , by employing this prize delivery system , both prize bearing straws and non - prize bearing straws are preferably manufactured simultaneously , with the prize bearing straws being seeded with non - prize bearing straws in a randomly desired fashion , consistent with the desired ratio . as a result , totally random distribution of prize bearing straws are made to the consumers as part of their purchase of a fountain product . in fig5 another embodiment of the delivery system of the present invention is depicted . in this embodiment , an alternate construction for secretly retaining a prize award in a drinking straw is disclosed . in this embodiment , drinking straw 55 incorporates a prize award 21 , securely mounted therein , as detailed above . however , in order to assure that the presence of prize award 21 in drinking straw 55 is incapable of advance detection , drinking straw 55 is retained within elongated tube 60 , which comprises telescopically engageable , mating sections 61 and 62 . in the preferred embodiment , tube 60 comprises a rigid , heavy , opaque material in order to prevent anyone from being able to determine if prize award 21 is present , without separating sections 61 and 62 . preferably , tube 60 comprises cardboard , heavy paper , plastic or the like . however , regardless of the material employed in constructing tube 60 , tube 60 must peripherally surround and encase straw 55 in a manner which prevents any individual from being able to determine whether straw 55 incorporates prize award 21 . in this way , prize bearing straw 55 in tube 60 is randomly seeded with non - prize bearing straws in similar tubes , and distributed in the normal manner , with lucky customers randomly receiving prize bearing straws 55 in tubes 60 . in the preferred embodiment , in order to preserve the integrity of tube 60 and be certain that no individual , including employees , are capable of investigating the supply of straws to determine which straws contain a prize award , sections 61 and 62 of tube 60 are sealingly interconnected by fastening means 63 . preferably , fastening means 63 peripherally surrounds the entire outer peripheral surface of tube 60 , sealingly and integrally interconnecting telescopic sections 61 and 62 together . in this way , dislocation or separation of sections 61 and 62 of tube 60 is prevented . furthermore , if any separation of sections 61 and 62 were to occur , the separation would be immediately apparent , since the integrity of fastening means 63 would be destroyed . consequently , unwanted opening of tube 60 by any individual is prevented and the desired random distribution of prize bearing straws with non - prize bearing straws is assured . in this embodiment , all of the straws being distributed during the promotional time period would be manufactured in the identical manner . consequently , all straws being distributed as part of the promotional contest would comprise straws mounted within tubes 60 . in this way , each and every straw is visually identical in appearance , weight , and feel , with no one straw / tube assembly being capable of being analyzed by any individual as the particular straw / tube combination in which a prize award is contained . as a result , the precisely desired random distribution of prize bearing straws with non - prize bearing straws is efficiently attained and all of the features and inherent consumer excitement generated by the prize delivery system of the present invention are realized . in fig6 - 9 , final alternate embodiments of the prize delivery system of the present invention are depicted . in fig6 and 8 , the prize delivery system of the present invention is shown in one particular construction in the form of a game coupon or game card distributed with any purchase during the sales enhancement promotion . in fig9 the prize delivery system of this invention is depicted in an alternate construction as the wall of a food container , holder , or wrapper . although fig6 - 9 depict alternate structures of the prize delivery system of this invention for different end products , it should be apparent from the following detailed disclosure that the construction for the game card embodiment shown in fig6 - 8 may be employed with equal efficacy in constructing a food product container , holder or wrapper . similarly , the construction for the food product container , holder , or wrapper of fig9 may be employed with equal efficacy in constructing a game card . as a result , fig6 - 9 effectively teach two alternate embodiments for manufacturing both game cards and food containers in a manner which enable these products to incorporate therein a prize award , with the existence of the prize award being completely undetectible by any individual , regardless of extensive observation . in fig6 and 8 , the prize delivery system of the present invention is depicted as comprising a game card , ticket or coupon 70 , which incorporates two mating sections 71 and 72 . in fig7 game card sections 71 and 72 are depicted as independent components , which are integrally bonded together as detailed herein . alternatively , as shown in fig8 game card sections 71 and 72 are formed on a single sheet of material and folded to create game card 70 . regardless of which construction is employed , game card section 71 preferably comprises an outer surface 75 , and an inner surface 76 . similarly , game card section 72 comprises an outer facing surface 77 and an inside surface 78 . in addition , in the preferred construction , at least inside surface 78 of section 72 comprises a recess zone 80 , dimensioned to comprise an overall area substantially equivalent to the area required for nested receiving engagement of prize award 21 therein . if desired , a similar recess zone is formed in inside surface 76 of section 71 . as detailed above , in the preferred embodiment , prize award 21 comprises a cash award ranging between $ 1 . 00 and $ 500 . 00 . in addition , in this embodiment , in order to attain a game card 70 which is the easiest to produce and provides the thinnest construction , prize award 21 , in the form of currency , would merely be folded in half , thereby assuring a thin , overall area to be hidden within the resulting game card . consequently , recess zone 80 need only to be formed to a depth substantially equivalent to the thickness of typical currency . in this way , folded currency is easily retained within recess zone 80 without being detected . clearly , since sections 71 and 72 comprise overall dimensions which are greater than the overall dimension of prize award 21 and prize award 21 , is securely retained within mating recess zone 80 , anyone observing the edge of the game card 70 is completely incapable of determining whether prize award 21 is secretly retained therein . in order to complete the construction of game card 70 , it is preferred that sections 71 and 72 be securely affixed to each other , thereby preventing unwanted tampering with game card 70 in an attempt to determine if a prize award is present . although sections 71 and 72 can be securely fastened to each other in a plurality of alternate constructions , it has been found that one simple and inexpensive construction technique is merely to apply glue means to surface 78 , peripherally about recess zone 80 of card section 72 . then , after positioning prize award 21 in recess zone 80 , section 71 is quickly and easily securely affixed to section 72 by merely abuttingly contacting inside surface 76 with the glue means on inside surface 78 of section 72 . in this way , the final construction of card 70 is quickly and inexpensively attained and prize award 21 is secretly retained in game card 70 , completely unable to be detected prior to opening game card 70 in the manner instructed . as shown in fig7 access to prize award 21 is easily attained by merely separating sections 71 and 72 . in implementing this embodiment of the present invention , a great variety of construction and assembly techniques can be employed . however , it is intended that all of these variations are within the scope of the present invention and not patentably distinct therefrom . in this regard , a plurality of alternate arrangements can be employed for obtaining access to prize award 21 by the consumer . as shown in fig6 and 8 , one alternate technique is to employ a scored zone 85 on section 71 which would enable the consumer , upon receiving card 70 , to easily open a panel formed by score lines 85 , revealing to the consumer the presence of prize award 21 therein . in order to further heighten the excitement of winning a prize award , covered information zones 86 may also be formed on section 71 of card 70 , requiring the consumer to scrape off a concealing film , well known in the art , to reveal a message printed therebelow . this message could inform the consumer that card 70 secretly retains a cash prize award with instructions on how to obtain access to prize award 21 . if desired , scored zone 85 may be used in combination with covered sections 86 as depicted in fig6 . alternatively , these elements can be used separately , or not at all , depending upon the particular card construction desired . in fig9 an alternate embodiment for the prize delivery system of the present invention is disclosed . in this embodiment , the prize delivery system is depicted as a portion of one wall or panel 90 of a typical food product container , holder , wrapper or utensil . in this embodiment , the wall panel 90 comprises two layers 91 and 92 which are in overlying , concealing engagement with prize holding substrate 93 . preferably , prize holding substrate 93 is formed in a manner similar to prize holding plates 34 and 50 detailed above , with cut - out zone 89 formed therein . as depicted in fig9 prize award 21 is securely positioned in cut - out zone 94 of substrate layer 93 , thereby being maintained between outer sections 91 and 92 , assuring that the presence of prize award 21 is completely undiscoverable , without destroying the entire wall assembly 90 . as previously discussed , the thickness of substrate 93 is substantially equivalent to the thickness attained by folding prize award 21 into the desired shape . consequently , prize award 21 substantially fills the entire retaining zone 94 , thereby assuring that prize award 21 is incapable of being detected by either visual or manual analysis of wall panel 90 . if desired , all containers , holders , instruments , or game cards may be manufactured incorporating intermediate prize holding substrate 93 , in order to assure consistency of size , shape and form of all give - aways during the promotional period . furthermore , if desired , all game cards or packages may be manufactured in a virtually identical manner , with cut - out zone 94 of prize holding substrate 93 incorporating a pre - printed message informing the consumer that no prize award has been won , but encouraging the consumer to continue to participate in the promotional contest . in this way , complete uniformity of all game cards , food containers , holders or instruments is maintained and the secrecy of which product contains the prize award is preserved . as detailed above in reference to the game cards , outer section 91 and 92 are securely affixed to opposed surfaces of prize holding substrate 93 , thereby sandwiching prize holding substrate 93 therebetween , and securely retaining prize award 21 in complete , secrecy . in this way , complete secrecy is maintained until a consumer obtains access to the prize holding zone and discovers the presence of prize award 21 . it will thus be seen that the objects set forth above , among those made apparent from the preceding description , are efficiently attained and , since certain changes may be made in the above articles without departing from the scope of the invention , it is intended that all matter contained in the above descriptions or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described and all statements of the scope of the invention in which , as a matter of language , might be said to fall therebetween .	1
the present invention includes two main embodiments , the first embodiment is the multi - range cross - defrosting humidity control system constructed with the cross reverse refrigerant circulation , the second embodiment is the multi - range cross - defrosting humidity control system constructed with the one - body defrost condenser . now referring to fig1 a to fig1 e and table 1 for the first embodiment : the basic operation scheme is shown in fig1 a to fig1 e , the multi - range cross - defrosting humidity control system operates with a control system that change the defrosting methods according to the outdoor temperature and humidity ; when the outdoor temperature is in the range of 20 degree celsius to 0 degree celsius , the control system can apply the first defrosting method , which is also called as the cross - air defrosting process ; when the outdoor temperature is in the range of 10 degree to negative 40 degree or lower , the control system can apply the second defrosting method , which is also called as the high speed cross - reverse defrosting process ; the threshold at which the control system switch between the first defrosting method and the second defrosting method can be adjust at any point between 10 degree celsius to 0 degree celsius ; for the ease of comprehension , the threshold will be set as 5 degree celsius , it should be understood that this threshold value should be adjusted according to the heating need and the humidity of the outdoor environment for the best heating efficiency and the indoor humidity control . as shown in fig1 a , the cross reverse defrosting humidity control system comprising the following basic components : main compressor 101 , main condenser 102 , first evaporator 121 , second evaporator 122 , main expansion valve 103 , first upper - flow valve 131 , second upper - flow valve 132 , first lower - flow valve 171 , second lower - flow valve 172 , first reverse - flow valve 151 , second reverse - flow valve 152 , first expansion valve 141 , second expansion valve 142 , first one - way valve 161 , second one - way valve 162 , first venting fan 191 , second venting fan 192 , separate heat insulation for each evaporator , first indoor - air - intake fan 181 , second indoor - air - intake fan 182 , first outdoor - air - intake valve 195 , second outdoor - air - intake valve 196 , first indoor - air - intake valve 181 , second indoor - air - intake valve 182 , first temperature sensor 193 , second temperature sensor 194 , outdoor temperature sensor ( not shown ). the basic concept of the cross - air defrosting process is to block the refrigerant - flow of the frosted evaporator , and a controlled amount of the outdoor air will flow through that frosted evaporator to heat up the frost thereon , while the other evaporator will operate with the evaporation process to provide the evaporated refrigerant to the main compressor 101 for the pressurization process , the main condenser 102 will carry on the condensation process for the air - conditioning ; the cross - air defrosting process requires a defrost - cycle of alternating operation , a defrost cycle is provided as follows , the first evaporator 121 defrosts with cross - air defrosting process for 5 minute as in fig1 b , and next the second evaporator 122 defrosts with the cross - air defrosting process for 5 minute as in fig1 c , and next the first evaporator 121 and the second evaporator 122 all resume the evaporation process for 10 minute as in fig1 a , and next the control system repeats the defrost cycle or switch to another defrosting method if a change in the outdoor temperature is detected . now referring to fig1 a , in which the first evaporator 121 and the second evaporator 122 are absorbing the heat from the outdoor - air - flow with the evaporation process ; the cross reverse refrigerant circulation is disabled by shutting the first reverse - flow valve 151 and the second reverse - flow valve 152 ; now the refrigerant is circulating as follows , the refrigerant is pressurized in the main compressor 101 and condensed in the main condenser 102 , and next the first evaporator 121 and the second evaporator 122 will be evaporating refrigerant to provide the evaporated refrigerant to the main compressor 101 ; the first indoor - air - intake fan 181 and the second indoor - air - intake fan 182 are stopped to disable the indoor - air - flows of the first evaporator 121 and the second evaporator 122 ; the first outdoor - air - intake valve 131 and the second outdoor - air - intake valve 132 are open to admit the outdoor - air - flow into the first evaporator 121 and the second evaporator 122 . now referring to fig1 b and fig1 c for the first defrosting method of the cross reverse defrosting humidity control system , said first defrosting method is also called as the cross - air defrosting process ; the control system can employ said cross - air defrosting process when the outdoor temperature is between 20 degree celsius and 0 degree celsius ; during the defrost - cycle of the cross - air defrosting process , the control system will defrost each evaporator with a defrost cycle as follows ; the first evaporator 121 defrosts with the cross - air defrosting process for 5 minute as shown in fig1 b , and next the second evaporator 122 defrosts with the cross - air defrosting process for 5 minute as shown in fig1 c , and next the first evaporator 121 and the second evaporator 122 will resume the evaporation process as shown in fig1 a or repeat the defrost - cycle if the condition required . as shown in fig1 b is the cross - air defrosting process of the first evaporator 121 ; the refrigerant - flow of the first evaporator 121 is disabled by shutting the first upper - flow valve 131 and first lower - flow valve 171 , the first venting fan 191 will operate at full speed to draw the outdoor air through the first evaporator 121 to melt the frost thereon ; the second evaporator 122 will operate with the evaporation process to provide a sufficient flow of evaporated refrigerant to the main compressor 101 , the main condenser 102 will continue to generate the heat energy required for the air - conditioning . as shown in fig1 c is the cross - air defrosting process of the second evaporator 122 ; the refrigerant - flow of the second evaporator 122 is disabled by shutting the second upper - flow valve 132 and the second lower - flow valve 172 , the second venting fan 192 will operate at full speed to draw the outdoor air through the second evaporator 122 to melt the frost thereon ; the first evaporator 121 will operate with the evaporation process to provide a sufficient flow of evaporated refrigerant to the main compressor 101 , the main condenser 102 will continue to generate the heat energy required for the air - conditioning . now referring to fig1 d and fig1 e . when the outdoor temperature reaches the threshold , at which the cross - air defrosting method cannot provide enough heat energy with the outdoor air , the control system can switch to the second defrosting method as shown in fig1 d and fig1 e , and said second defrosting method is also called as the high speed cross reverse defrosting process , the applicable range of the high speed cross reverse defrosting process is from 10 degree celsius to negative 40 degree celsius and lower ; the high speed cross reverse defrosting process also operates in a similar defrost - cycle as the first defrosting method , a defrost - cycle is provided as follows ; the first evaporator 121 and the second evaporator 122 operate with the evaporation process to absorb the heat energy from the outdoor - air - flow as shown in fig1 a for 10 minute , and next the first evaporator 121 defrosts with the high speed cross reverse defrosting process as shown in fig1 d for 2 minute , and next the second evaporator 122 defrosts with the high speed cross reverse defrosting process as shown in fig1 e for 2 minute , and next the control system repeats the defrost - cycle until further change in the outdoor environment is detected . the basic concept of the high speed cross reverse defrosting process is to transfer a controlled amount of the indoor air into the heat insulated space of the evaporator that is defrosting , and at the same time a controlled amount of the pressurized refrigerant will be distributed into the evaporator that is defrosting , the accumulated frost on said evaporator will melt by the heat generated from condensation process and the heat energy of the indoor air , therefore , the required time for the defrosting process will be greatly shortened , and the indoor air will be ventilated during this process ; the other evaporator of the system will continue the evaporation process with the outdoor - air - flow , the main compressor and the main condenser will also continue their operations to generate the heat energy for the air - conditioning . the defrost - cycle of the high speed cross reverse defrosting process requires each evaporator to alternate its operation at a time interval , and the detailed control scheme is provide in fig1 d and fig1 e . as shown in fig1 d , the first evaporator 121 is defrosting with the high speed cross reverse defrosting process ; the first evaporator 121 will stop the evaporation process and disable the refrigerant passage from the main expansion valve 103 by shutting the first upper - flow valve 131 and first lower - flow valve 171 . the cross reverse refrigerant circulation will be initiated by opening the first reverse - flow valve 151 , providing a refrigerant passage from the main compressor 101 to the first evaporator 121 , so that the pressurized refrigerant from the main compressor 101 will now be distributed to the main condenser 102 and the first evaporator 121 ; said pressurized refrigerant will condense in the first evaporator 121 to heat up and melt the accumulated ice on the first evaporator 121 , and said refrigerant - flow of the first evaporator 121 will exit through the first expansion valve 141 and the first one - way valve 161 into the second evaporator 122 ; the first outdoor - air - intake valve 195 will be shut to stop the outdoor - air - flow of the first evaporator 121 , the first venting fan 191 will stop or spin slowly to conserve the heat inside the heat insulated space of the first evaporator 121 , thus creating a hot environment inside the heat insulated space of the first evaporator 121 ; the first evaporator 121 will now be defrosting with the heat energy of the condensation process and the indoor - air - flow ; the second evaporator 122 will receive both the refrigerant - flow from the main expansion valve 103 and the refrigerant - flow from the first one - way valve 161 ; in other words , the main condenser 102 and the first evaporator 121 will be condensing refrigerant to generate heat energy for the air - conditioning and the high speed cross reverse defrosting process respectively , while the second evaporator 122 will be operating with the evaporation process by absorbing the heat from the outdoor - air - flow ; the second venting fan 192 will be operating at full speed to provide a sufficient flow of the outdoor air for the evaporating process of the second evaporator 122 . as shown in fig1 e , the second evaporator 122 is defrosting with the high speed cross reverse defrosting process ; the second evaporator 122 will stop the evaporation process and disable the refrigerant passage from the main expansion valve 103 by shutting the second upper - flow valve 132 and second lower - flow valve 172 . the cross reverse refrigerant circulation will be initiated by opening the second reverse - flow valve 152 , providing a refrigerant passage from the main compressor 101 to the second evaporator 122 , so the pressurized refrigerant from the main compressor 101 will now be distributed to the main condenser 102 and the second evaporator 122 ; said pressurized refrigerant will condense in the second evaporator 122 to heat up and melt the accumulated ice on the first evaporator 121 , and said refrigerant - flow of the second evaporator 122 will exit through the second expansion valve 142 and the second one - way valve 162 into the first evaporator 121 ; the second outdoor - air - intake valve 196 will be shut to stop the outdoor - air - flow into the heat insulated space of the second evaporator 122 , the second venting fan 192 will stop or spin slowly to conserve the heat inside the heat insulated space of the second evaporator 122 , thus creating a hot environment inside the heat insulated space of the second evaporator 122 ; the second evaporator 122 will now be defrosting with the heat energy of the condensation process and the indoor - air - flow ; the first evaporator 121 will receive both the refrigerant - flow from the main expansion valve 103 and the refrigerant - flow from the second one - way valve 162 ; in other words , the main condenser 102 and the second evaporator 122 will be condensing refrigerant to generate the heat energy for the air - conditioning and the high speed cross reverse defrosting process respectively , while the first evaporator 121 will be operating with the evaporation process by absorbing the heat from the outdoor - air - flow ; the first venting fan 191 will be operating at full speed to provide a sufficient flow of the outdoor air for the evaporating process of the first evaporator 121 . the first embodiment of the present invention can be further extended with additional evaporators . and the control system can adjust accordingly to the basic concept of the present invention ; when one of the evaporators is frosted and requires to defrost with the second defrosting method , said frosted evaporator will block the refrigerant - flow from the main expansion valve and initiate the refrigerant - flow from the main compressor with its associated control valves , said frosted evaporator will initiate the condensation process with the pressurized refrigerant from the main compressor , and the heat insulated space of said frosted evaporator will block the flow of the outdoor air and admit a controlled amount of indoor air with its associated air - intake means , at the same time all other evaporators can continue the evaporation process to absorb heat energy from the outdoor - air - flow , the main compressor and the main condenser will continue their operation for the air - conditioning ; the control system will also operate in a similar defrost - cycle , a defrost - cycle is as follows , all evaporators operate with the evaporation process for 10 minute , and next the first evaporator defrosts for 2 minute , next the second evaporator defrosts for 2 minute , and next the third evaporator defrosts for 2 minute , and next the fourth evaporator defrosts for 2 minute , and next the control system repeats the defrost - cycle or adjust its operation if further change in the outdoor temperature is detected . for easier maintenance , most control valves can be combined into one single rotary valve or other multi - port control valve means . an alternative scheme of the control valve means is provided as follows , wherein the first reverse - flow valve 151 and the first upper - flow valve 131 are replaced with the first rotary upper - flow valve capable of same functions , the first lower - flow valve 171 and the first one - way valve 161 can be replaced with the first rotary lower - flow valve capable of same functions . many other construction schemes and control valve means are possible to perform the same task based on the principle of present invention and should be considered within the scope of the present invention . now referring to the second embodiment as shown in fig2 a to fig2 e for the multi - range cross - defrosting humidity control system constructed of the one - body defrost condenser . the second embodiment also operate with a control system that changes the defrosting methods according to the outdoor temperature and humidity ; when the outdoor temperature is in the range of 20 degree celsius to 0 degree celsius , the control system can apply the first defrosting method , which is also called as the cross - air defrosting process ; when the outdoor temperature is in the range of 10 degree to negative 40 degree or lower , the control system can apply the second defrosting method , which is also called as the high speed cross - defrosting process ; the threshold at which the control system switches between the cross - air defrosting process and the high speed cross - defrosting process can be adjust at any point between 10 degree celsius to 0 degree celsius . the second embodiment as shown in fig2 a , the cross - defrosting humidity control system comprising the following basic components : main compressor 201 , main condenser 202 , first evaporator 221 , second evaporator 222 , main expansion valve 203 , first upper - flow valve 231 , second upper - flow valve 232 , first defrost - flow valve 251 , second defrost - flow valve 252 , first expansion valve 241 , second expansion valve 242 , first defrost - condenser 223 , second defrost - condenser 224 , first venting fan 291 , second venting fan 292 , separate heat insulation for each evaporator , first indoor - air - intake fan 283 , second indoor - air - intake fan 284 , first outdoor - air - intake valve 295 , second outdoor - air - intake valve 296 , first indoor - air - intake valve 281 , second indoor - air - intake valve 282 , first temperature sensor 293 , second temperature sensor 294 , outdoor temperature sensor ( not shown ). the first evaporator 221 and the first defrost - condenser 223 are constructed together to maximize the heat transfer rate between each other , therefore , the heat energy will be transfer from the first defrost - condenser 223 to the first evaporator 221 through the radiator fins they shared during the high speed cross defrosting process of the first evaporator 221 . the second evaporator 222 and the second defrost - condenser 224 are also constructed together in the same manner for maximizing the heat transfer rate between each other . now referring to fig2 a for the full capacity heating operation when both the first evaporator 221 and second evaporator 222 are operating with the evaporation process ; the refrigerant - flow of the first evaporator 221 and the refrigerant - flow of the second evaporator 222 are enabled by opening the first upper - flow valve 231 and second upper - flow valve 232 ; the refrigerant circuits for the high speed cross - defrosting process are disabled by shutting the first defrost - flow valve 251 and the second defrost - flow valve 252 ; the heat insulated space of the first evaporator 221 and the second evaporator 222 will block the indoor - air - flow and admit the outdoor - air - flow for absorbing heat , the first indoor - air - intake fan 283 and the second indoor - air - intake fan 284 will be disabled to block the indoor - air - flow into the first evaporator 221 and the second evaporator 222 , the first outdoor - air - intake valve 295 and the second outdoor - air - intake valve 296 will be open , the first venting fan 291 and the second venting fan 292 will be operating to draw the outdoor - air - flow into the heat insulated space of the first evaporator 221 and the heat insulated space of the second evaporator 222 ; the main compressor 201 and the main condenser 202 will be operating with the pressurization process and the condensation process respectively to provide the heat energy for the air - conditioning . now referring to fig2 b and fig2 c for the cross - air defrosting process of the second embodiment ; the control system can employ said cross - air defrosting process when the outdoor temperature is between 20 degree celsius and 0 degree celsius ; during the defrost - cycle of the cross - air defrosting process , the control system will defrost each evaporator with a defrost - cycle as follows ; the first evaporator 221 defrosts with the cross - air defrosting process for 5 minute as shown in fig2 b , and next the second evaporator 222 defrosts with the cross - air defrosting process for 5 minute as shown in fig2 c , and next the first evaporator 221 and the second evaporator 222 will resume the evaporation process as shown in fig2 a or repeat the defrost - cycle if the condition required . as shown in fig2 b , the first evaporator 221 is defrosting with the cross - air defrosting process ; the refrigerant - flow of the first evaporator is disabled by shutting the first upper - flow valve 231 , the outdoor - air - flow will be drawn into the heat insulated space of the first evaporator 221 , and the frost on the first evaporator 221 will melt by the absorbing the heat energy of the outdoor - air - flow ; the second evaporator 222 will operate with the evaporation process to provide the evaporated refrigerant to the main compressor 201 ; the main compressor 201 and the main condenser 202 will continue the pressurization process and the condensation process respectively for the air - conditioning ; the refrigerant circuits for the high speed cross - defrosting process are disabled by shutting the first defrost - flow valve 251 and the second defrost - flow valve 252 . as shown in fig2 c , the second evaporator 222 is defrosting with the cross - air defrosting process ; the refrigerant flow of the second evaporator 222 is disabled by shutting the second upper - flow valve 232 , the outdoor - air - flow will be drawn into the heat insulated space of the second evaporator 222 , and the frost on the second evaporator 222 will melt by the absorbing the heat energy of the outdoor - air - flow ; the first evaporator 221 will operate with the evaporation process to provide the evaporated refrigerant to the main compressor 201 ; the main compressor 201 and the main condenser 202 will continue the pressurization process and the condensation process respectively for the air - conditioning ; the refrigerant circuits for the high speed cross - defrosting process are disabled by shutting the first defrost - flow valve 251 and the second defrost - flow valve 252 . now referring to fig2 d and fig2 e . when the outdoor temperature reaches the threshold for initiating the high speed cross defrosting process , the control system will operate with a defrost - cycle of the high speed cross defrosting process , a defrost - cycle is provided as follows ; the first evaporator 221 and the second evaporator 222 operate with the evaporation process to absorb the heat energy from the outdoor - air - flow as shown in fig2 a for 10 minute , and next the first evaporator 221 defrosts with the high speed cross defrosting process as shown in fig2 d for 2 minute , and next the second evaporator 222 defrosts with the high speed cross defrosting process as shown in fig2 e for 2 minute , and next the system repeats the defrost - cycle until further change in the outdoor environment is detected . the basic concept of the high speed cross defrosting process is to transfer a controlled amount of the indoor air into the heat insulated space of the evaporator that is defrosting , and at the same time a controlled amount of the pressurized refrigerant will be distributed into the defrost - condenser associated with the evaporator that is defrosting , the accumulated frost on said evaporator will melt by the heat current transferred from its associated defrost - condenser and the heat energy of the indoor air , therefore , the required time for the defrosting process will be greatly shortened , and the indoor air will be ventilated during this process ; the other evaporator of the system will continue the evaporation process with the outdoor - air - flow , the main compressor and the main condenser will also continue their operation to generate the heat energy for the air - conditioning . the defrost - cycle of the high speed cross defrosting process requires each evaporator to alternate its operation at a time interval , and the detailed control scheme is provide in fig2 d and fig2 e . as shown in fig2 d , the first evaporator 221 is defrosting with the high speed cross defrosting process ; the first evaporator 221 will stop the evaporation process and disable the refrigerant passage from the main expansion valve 203 by shutting the first upper - flow valve 231 ; the first defrost - condenser 223 will be enabled by opening the first defrost - flow valve 251 , providing a refrigerant passage from the main compressor 201 to the first defrost - condenser 223 , so the pressurized refrigerant from the main compressor 201 will now be distributed to the main condenser 202 and the first defrost - condenser 223 ; said pressurized refrigerant will condense in the first defrost - condenser 223 to heat up and melt the accumulated frost on the first evaporator 221 , and said refrigerant - flow of the first defrost - condenser 223 will exit through the first expansion valve 241 into the second evaporator 222 ; the first outdoor - air - intake valve 295 will be shut to stop the outdoor - air - flow of the first evaporator 221 , the first venting fan 291 will stop or spin slowly to conserve the heat inside the heat insulated space of the first evaporator 221 , thus creating a hot environment inside the heat insulated space of the first evaporator 221 ; the first evaporator 221 will now be defrosting with the heat energy of the condensation process of the first defrost - condenser 223 and the indoor - air - flow ; the second evaporator 222 will receive the refrigerant - flow from the main expansion valve 103 and the refrigerant - flow from the first expansion valve 241 ; in other words , the main condenser 202 and the first defrost - condenser 223 will be condensing refrigerant to generate heat energy for the air - conditioning and the high speed cross defrosting process respectively , while the second evaporator 222 will be operating with the evaporation process by absorbing the heat from the outdoor - air - flow ; the second venting fan 292 will be operating at full speed to provide a sufficient flow of the outdoor air for the evaporating process of the second evaporator 222 ; the second defrost - condenser 224 is disabled by shutting the second defrost - flow valve 252 . as shown in fig2 e , the second evaporator 222 is defrosting with the high speed cross defrosting process ; the second evaporator 222 will stop the evaporation process and disable the refrigerant passage from the main expansion valve 203 by shutting the second upper - flow valve 232 ; the second defrost - condenser 224 will be enabled by opening the second defrost - flow valve 252 , providing a refrigerant passage from the main compressor 201 to the second defrost - condenser 224 , so the pressurized refrigerant from the main compressor 201 will now be distributed to the main condenser 202 and the second defrost - condenser 224 ; said pressurized refrigerant will condense in the second defrost - condenser 224 to heat up and melt the accumulated frost on the second evaporator 222 , and said refrigerant - flow of the second defrost - condenser 224 will exit through the second expansion valve 242 into the first evaporator 221 ; the second outdoor - air - intake valve 296 will be shut to stop the outdoor - air - flow of the second evaporator 222 , the second venting fan 292 will stop or spin slowly to conserve the heat inside the heat insulated space of the second evaporator 222 , thus creating a hot environment inside the heat insulated space of the second evaporator 222 ; the second evaporator 222 will now be defrosting with the heat energy of the condensation process of the second defrost - condenser 224 and the indoor - air - flow ; the first evaporator 221 will receive the refrigerant - flow from the main expansion valve 203 and the refrigerant - flow from the second expansion valve 242 ; in other words , the main condenser 202 and the second defrost - condenser 224 will be condensing refrigerant to generate heat energy for the air - conditioning and the high speed cross defrosting process respectively , while the first evaporator 221 will be operating with the evaporation process by absorbing the heat from the outdoor - air - flow ; the first venting fan 291 will be operating at full speed to provide a sufficient flow of the outdoor air for the evaporating process of the first evaporator 221 ; the first defrost - condenser 223 is disabled by shutting the first defrost - flow valve 251 . the second embodiment of the present invention can be further extended with additional evaporators and additional defrost - condensers , and the control system can adjust accordingly to the basic concept of the present invention ; when one of the evaporators is frosted and requires to defrost with the high speed cross defrosting process , said frosted evaporator will block the refrigerant passage from the main expansion valve with its associated control valves , and the defrost - condenser associated with said frosted evaporator will initiate the refrigerant - flow from the main compressor with its associated control valves , said defrost condenser will initiate the condensation process with the pressurized refrigerant from the main compressor , and the heat insulated space of said frosted evaporator will block the flow of the outdoor air and admit a controlled amount of indoor air with its associated air - intake means , at the same time all other evaporators can continue the evaporation process to absorb heat energy from the outdoor - air - flow , the main compressor and the main condenser will continue their operation for the air - conditioning ; the control system will also operate in a defrost - cycle , wherein each evaporator will take turns to operate with the high speed cross defrosting process , a defrost cycle is as follows , all evaporators operate with the evaporation process for 10 minute , and next the first evaporator defrosts for 2 minute , next the second evaporator defrosts for 2 minute , and next the third evaporator defrosts for 2 minute , and next the fourth evaporator defrosts for 2 minute , and next the control system repeats the defrost - cycle or adjust its operation if further change in the outdoor temperature is detected . the control system can further employ the sensor means for the progress of the defrosting process to detect if the evaporator has melted all the frost thereon , if all the frost has melted , the control system can be reset to the next step of the defrost - cycle ; said sensor means can be a pressure or temperature sensor in the evaporator . a special ventilation operation mode can also be implanted in the control system as an additional function , said operation mode is called as the forced - ventilation mode , wherein a controlled amount of the outdoor - air - flow and a controlled amount of the indoor - air - flow are admitted into the evaporators that are operating with the evaporation process , therefore the indoor air will be drawn out of the indoor space for the ventilation purpose , while the heat insulated space of each evaporator will have an air flow of higher temperature , thus ventilating the indoor air with a high energy recovery rate . it should be understood that the threshold temperatures for initiating each stage of defrosting are different for each regions in the world , wherein the humidity and frosting condition are the main factor for selecting the appropriate threshold for each defrosting method and operation mode .	5
reference will now be made in detail to the present preferred embodiments of the invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . referring now to fig1 it can be seen that the process of the present invention may be subdivided into various treatment steps or regions , namely , a mixing region a , a mixing and melting region b , a flashing zone c , an expansion and creaming zone d , and a filling region e . foodstuff such as raw cheese , generally in large hunks or pieces , is minced in special cheese mincers to an average particle size of between 1 and 4 mm and then charged using known feeding means into a mixer 1 , which is diagrammatically represented in fig1 in the mixing region a . this mincing operation is performed discontinuously or continuously as required , depending on the amount of foodstuff to be processed . while various different types of mixers having different load capacities may be used , a preferred mixer may be an open , double - screw mixer which is capable of processing up to 5000 kg . of foodstuff , such as cheese , per batch mixing session . in the mixer 1 , the minced raw cheese is intimately and homogeneously mixed with any additional ingredients at a mixing temperature of approximately between 15 ° and 30 ° c . the cheese mixture is thereafter analyzed , and the fat and water content as well as , perhaps , ph are measured and adjusted as necessary according to set standards and requirements . the treated , standardized cheese mass is pumped out of the mixer 1 by a dairy pump 2 into the intake 3 of a continuously operating mixing and melting apparatus 4 . it is possible to use a frequency - controlled motor in place of the dairy pump drive 2 for automatic control of the feed flow . fig2 and 3 show the construction of the mixing and melting apparatus 4 . the drive of the mixing and melting apparatus can be performed by means of any suitable , commercially available drive unit or motor ( not shown in detail ). the drive unit is operatively connected to a drive shaft 5 which , in turn , is operatively associated with a mixing and feeding shaft 6 . the mixing and feeding shaft 6 is fitted with radially directed mixing tools 7 which , by virtue of an appropriate angle of pitch , impart to the material to be mixed an axial feeding action in the direction of the drive unit . the mixing and feeding shaft 6 rotates within a mixing chamber 8 , and as seen in a direction against the product feeding direction , the mixing chamber is adjacent a steam blowing - in zone or steam injection chamber 9 which , in turn , is adjacent an intake chamber 3 . the steam may be introduced through steam injectors located on the circumference of the wall of the steam injection chamber 9 . the steam injectors may be in the form of nozzles , a steam ring , steam non - return valves 10 or the like . the motor or drive shaft 5 is generally rotated at speeds between 1000 and 4000 rpm . as seen in fig3 and in the product feeding direction , a rotor 11 is integrally mounted on the motor shaft 5 downstream of the mixing and feeding shaft 6 and rotates within a stationary stator 12 . an emulsifying unit , comprising the rotor 11 and the stator 12 , is arranged and housed in an emulsifying chamber 13 . the housing of the emulsifying chamber 13 is flange - mounted directly on the drive unit . a processed cheese outlet tube 14 leads out of the housing of the emulsifying chamber 13 and guides or leads the emulsifying unit 11 , 12 downstream in the radial direction . referring to fig4 to 6 , the stator 12 has axially directed teeth 16 , forming axial slits 15 between them . cutting profiles 17 designed as tips are fastened on the teeth 16 . two axial edges are provided on each cutting profile 17 . one axial edge of the cutting profile 17 is designed and adapted as a cutting edge 18 , whereas the other axial edge , together with the cutting edge of the following , adjacent cutting profile 17 forms a cutting gap 19 . the emulsifying unit may , alternatively be designed according to the form and configuration represented in ep - b1 0 005 726 , as incorporated herein by reference . steam is introduced and injected into the steam blow - in zone ( or steam injection chamber ) 9 via steam non - return valves 10 . the quality of the steam is of drinking water quality , i . e ., potable , and is preferably at a temperature of approximately 140 ° c . in principle , however , the temperature of the injected steam could also be about 170 ° c ., which higher temperature steam would require a correspondingly greater outlay and investment on apparatus and equipment . the steam injection is preferably performed immediately before the pumped - in raw cheese mass is taken up by the mixing tools 7 , rotating at high speed , and subjected to high turbulences in order that the water vapor can give off its energy through condensation to the cheese mass . the result is that the cheese mass is heated in a matter of seconds to a desired temperature of approximately 95 ° c . in accordance with the invention , the high turbulent conditions are necessary in order to quickly effect transfer of heat energy in the steam to the cheese mass . the steam pressure may in this case be up to 8 . 0 bar . the rate of steam injection into the steam blowing - in zone or chamber is regulated such that , according to the cheese mass flowing through , the condensate preferably gives off approximately 100 % of its energy , so that no free steam is available to escape from the system . in the case of a continuously operating installation , mixing and feeding shaft 6 and rotor - stator system 11 , 12 can be varied according to hourly output , recipe and expected quality as well as speed , in order to accomplish different intensities of turbulences and homogenizing effects . for example , the rotor - stator system can , depending on the desired homogenizing intensity , have homogenizing gaps of between approximately 0 . 05 to 10 mm , preferably between approximately 0 . 1 and 3 mm . by adjusting the distance of the homogenizing gaps , just as by changing the speed , the shearing forces can be varied . all these factors and possibilities for making changes have a significant influence on the emulsion , the dispersion effect , and , consequently , also directly on the appearance , the gloss , the spreadability and the texture of the cheese mass . with the technology according to the present invention , all physical , thermal and chemical factors acting in the melting process can be matched optimally with one another so that optimal end product results as desired product characteristics can be obtained . continuously operated heating and emulsifying processes can be controlled by automatic control units or devices in such a way that the quality of the end product is consistently uniform . according to fig1 the treatment of the cheese mass is followed downstream by a temperature - maintaining and reaction section 20 , which is downstream of the processed cheese outlet tube 14 and , depending on the product and the product temperature , permits the choice of a temperature - maintaining time of between about 4 to 180 seconds , for example , not only for spreadable processed cheese products but also for block and sliced cheese . according to fig1 this temperature - maintaining and reaction section 20 is adjoined by a flashing unit 21 , where the processed cheese mass is heated , for example , from about 95 ° c . to about 140 ° c ., in order to significantly prolong the shelf life of the cheese . the process is performed in the superpressure range by injection of steam via a steam line 22 similar to the steam line 23 connected to the steam non - return valves 10 of the mixing and melting apparatus 4 . referring to fig1 the flashing unit or zone c is adjoined by the expansion and creaming unit or zone d . after running through a further heat - retaining unit or section 24 , the cheese mass , now already referred to as processed cheese , passes into a vacuum - tight expansion and creaming tank 25 . a vacuum system 26 as well as a condenser 27 is attached to the expansion and creaming tank 25 for the precipitation of water vapor vacuumed out of the tank 25 . combined , the vacuum system 26 and the condenser 27 form a vacuum condenser system . in the expansion and creaming tank 25 , the temperature of the processed cheese , which may be between about 95 ° and about 140 ° c ., is lowered by a defined vacuum level within a matter of seconds to a desired product or creaming temperature of about 80 ° c . vacuum level and product temperature are kept constant by automatic control . rotatable mixing and creaming tools 28 , which can be driven at speeds of between about 5 and about 50 rpm , are provided in the tank 25 . the creaming of the processed cheese is improved by the use of these tools . moreover , additional ingredients can be added in this way so as to be mixed into the processed cheese mass . for this purpose , an ingredients tank 29 as well as a supply line 30 , which is fitted with a pump and shut - off valve and which opens out into a suction intake opening of the tank 25 , are indicated in fig1 . the expansion and creaming tank 25 is mounted on weighing cells , by means of which the amounts of precooked cheese and the filling level of the tanks can be constantly monitored and exactly determined during production . for example , the filling level which corresponds to a certain weight can be visually indicated on a display on the switch cabinet . in order to be able to carry out a cleaning of the expansion and creaming tank 25 as well as of the vacuum tank of the vacuum system 26 continuously during the process , three cleaning lines 31 , 32 and 33 , each fitted with shut - off valves , are connected to the tank 25 . the expansion and creaming tank 25 is consequently able to meet stringent hygienic and aseptic requirements with regard to its housing and its internal fittings . this means , inter alia , that dead spaces , in which residues can be deposited , are avoided . no slotted screws which could come into contact with the product may be used . the gaps of all shaft glands are cleaned directly . according to fig1 water lines 34 , 35 and a steam line 36 are also connected to the expansion and creaming tank 25 . moreover , the tank 25 has a bottom seat valve 37 for continuously pumping off the ready , produced and subsequently creamed processed cheese . the feeding of the ready , produced and subsequently creamed processed cheese is performed continuously , for example , by means of a gear pump 38 , into a buffer tank 39 and from there into a filling machine 40 . it will be apparent to those skilled in the art that various modifications and variations can be made in the process of the present invention and in the construction of this apparatus without departing from the scope or spirit of the invention . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with true scope and spirit of the invention being indicated by the following claims .	1
a synthetic substrate amide compound [ 19 or [ 4 ] for lap or γ - gtp assay of the present invention can be produced by conventional methods of peptide synthesis , for example , by reacting the carboxyl group of l - leucine or γ - carboxyl group of l - glutamic acid with amine [ 2 ] or aniline derivative [ 5 ]. in the above condensation reaction , a reactive group for not taking part in the reaction , such as amino group of l - leucine or amino group and α - carboxyl group of l - glutamic acid , should be protected . example of protected group for amino group is conventional protective group for α - amino group , such as t - butoxycarbonyl , t - amyloxycarbonyl , benzyloxycarbonyl , p - nitrobenzyloxycarbonyl or o - nitrophenylthio group . α - carboxyl group of l - glutamic acid is preferably protected by methyl ester , ethyl ester , t - butyl ester , benzyl ester , p - nitrobenzyl ester or p - methoxybenzyl ester , and the said protective group can preferably be removed together with protective group for amino group in one step removal procedure . for example , amino group is protected by benzyloxycarbonyl , and α - carboxyl group is protected by benzyl ester . examples of amine [ 2 ] used in the condensation reaction are lower alkyl , lower alkoxy , amino , substituted amino , hydroxy , carbonyl or sulfo group , for example o -( m - or p -) toluidine , o -( m - or p -) ethylaniline , 2 , 3 -( 2 , 4 -, 2 , 5 -, 2 , 6 -, 3 , 4 - or 3 , 5 -) xylidine , o -( m - or p -) anisidine , 2 , 5 - dimethoxyanilien , 2 , 5 - diethoxyaniline , o -( m - or p -) chloroaniline , o -( m - or p -) bromoaniline , o -( m - or p -) phenylenediamine , n , n - dimethyl - m - phenylenediamine , n , n - dimethyl - p - phenylenediamine , n , n - diethyl - p - phenylenediamine , n , n - dipropyl - p - phenylenediamine , o -( m - or p -) aminophenol , o -( m - or p -) aminobenzoic acid , p - aminobenzene sulfonic acid , 4 - hydroxy - 3 , 5 - dichloroaniline , 4 - hydroxy - 3 , 5 - dibromoaniline , 2 -( or 4 -) methyl - o - phenylenediamine , 2 - hydroxy - 5 - toluidine , 3 -( or 4 -) chloro - o - toluidine , 2 -( or 4 -) methyl - m - phenylenediamine , 2 -( or 4 -) chloro - m - phenylenediamine , 4 - methyl - m - aminobenzoic acid , 2 -( or 3 -) hydroxy - o - aminobenzoic acid , 4 - hydroxy - m - aminobenzoic acid , 4 - chloro - 2 - aminophenol , n - ethyl , n - hydroxyehtyl - p - phenylenediamine , 4 - methyl - 2 - aminophenol , 2 - methoxy - 5 - chloroaniline , 3 - chloro - o - toluidine or 4 - chloro - o - toluidine . further example of amine [ 2 ] is naphthylamine compound , such as α - napthylamine or 1 - amino - 6 - naphtholsufonic acid . the condensation reaction is performed by that α - carboxyl group of l - leucine in which α - amino group is protected or γ - carboxyl group of l - glutamic acid in which α - amino and α - carboxyl group are protected , is activated by an acid halide , acid anhydride , acid azide , acid imidazolide or activated ester such as cyanomethyl ester , p - nitrophenyl ester , 2 , 4 - dinitrophenyl ester , n - hydroxysuccineimide ester or n - hydroxyphthalimide ester and is reacted with amine [ 2 ] or aniline derivative [ 5 ]. or the above protected l - leucine or l - glutamic acid is reacted with amine [ 2 ] or aniline [ 5 ] in the presence of condensing agent , for example carbodiimide such as n , n &# 39 ;- dicyclohexylcarbodiimide or n , n &# 39 ;- carbonylimidazole and isoxazolium salt such as woodward reagent . the above condensation reaction is carried out in an inert organic solvent such as dimethylformamide , dimethylacetamide , dimethylsulfoxide , tetrahydrofuran , dioxane , benzene , chloroform , dichloromethane or dichloroethane , with equal amount of protected amino acid and amine [ 2 ] or aniline derivative [ 5 ] at room temperature or below . the reaction process can be traced by silica gel thin layer chromatography ( tlc ) or high performance liquid chromatography ( hplc ) and can be stopped upon checking the disappearance of starting material . the thus obtained reaction product is dissolved , with or without distilling off the reaction solvent , in water immiscible organic solvent such as chloroform , dichloromethane , ethyl acetate , butyl acetate , methylisobutyl ketone , benzene or diethyl ether , washing with acidic water and alkaline water , and removing the sovent to isolate the product . if further purification is required , recrystallization is performed from suitable recrystallizing solvent or purification is made by silica gel , active alumina or adsorption resin column chromatography . removal of protective group can be made by conventional method of peptide chemistry . for example , t - butyloxycarbonyl group of α - amino group is removed by 2n - hcl in acetic acid , trifluoroacetic acid or formic acid , and benzyloxycarbonyl is removed by catalytic reduction using palladium carbon or hbr in acetic acid . benzyl ester of α - carboxyl group of l - glutamic acid is removed by catalytic reduction using palladium - carbon . the thus obtained amide compound [ 1 ] or amide compound [ 4 ] can be isolated by neutralizing the reaction mixture in case of acid decomposition removal of protective group or removing the catalyst in case of catalytic reduction , adding water immiscible organic solvent such as chloroform , dichloromethane , dichloroethane , ehtyl acetate , butyl acetate , methylisobutyl ketone , benzene or diethyl ether , washing with acidic water and alkaline water , and removing the solvent . further purification is made by recrystallization by suitable solvent or column chromatography using silica - gel , active alumina or adsorption resin . amide compound [ 1 ] or amide compound [ 4 ] can optionally be prepared as salt thereof , for example , inorganic salt such as hydrochloride , sulfate , nitrate or phosphate , or organic salt such as formate , acetate , propionate , malate , citrate , tartrate or oxalate . in the present invention , an amide compound [ 1 ] is hydrolysed by lap or γ - gtp in sample to liberate amine [ 2 ] which is oxidatively condensed with coupler [ 3 ] by the action of oxidase to form chromogenic compound ( hereinafter designates as chromogen ) examples of coupler [ 3 ] can be an aromatic compound which forms chromogen having absorption maxima at 550 - 750 nm and oxidatively condensed with amine [ 2 ] by the action of oxidase . preferable examples are phenols , aminophenols , anilines and naphthols . examples of phenols are phenol , salicylic acid , m - hydroxybenzoic acid , p - hydroxybenzoic acid , 2 , 6 - dihydroxybenzoic acid , methyl salicylate , o -( m - or p -) cresol , o -( or m -) ethylphenol , 2 , 3 -( 2 , 4 -, 2 , 5 -, 3 , 5 - or 2 , 6 -) xylenol , o -( m - or p -) methoxyphenol , 2 , 6 - dimethoxyphenol , o -( m - or p -) chlorophenol , 2 , 4 -( or 2 , 6 -) dichlorophenol , o -( m - or p -) bromophenol , 2 , 4 -( or 2 , 6 -) dibromophenol , 2 - methyl - 6 - chlorophenol , 2 - chloro - 5 - methylphenol , o - carboxymethylphenol or 2 - hydroxy - 4 - aminoethylphenol . examples of aminophenols are 4 - chloro - 2 - aminophenol , n , n - diethyl - m - aminophenol , 4 - methyl - 2 - aminophenol , 5 - amino - 2 - hydroxybenzoic acid , 2 - amino - 3 - hydroxybenzoic acid , o -( m - or p -) aminophenol , 2 , 6 - dichloro - 4 - aminophenol or 2 , 6 - dibromo - 4 - aminophenol . examples of anilines are aniline , o -( m - or p -) toluidine , n - methylaniline , n - ethylaniline , n , n - dimethylaniline , n , n - diethylaniline , n , n - dimethyl - o - toluidine , n , n - dimethyl - p - toluidine , n , n - diethyl - o - toluidine , n , n - diethyl - p - toluidine , o -( or m -) chloroaniline , m - bromoaniline , anthranilic acid , 3 - aminobenzoic acid , p - dimethylaminobenzoic acid , 4 - chloro - o - toluidine , 3 - aminoe - 4 - methylbenzoic acid , m - phenylenediamine , n , n - dimethyl - m - phenylenediamine , 4 - methyl - o - phenylenediamine , 4 - methyl - m - phenylenediamine , 2 - chloro - m - phenylenediamine , 4 - chloro - m - phenylenediamine , 3 - chloro - o - toluidine , 2 - methoxy - 5 - chloroaniline , o - ethylaniline , 2 , 5 - diethoxyaniline , n - ethyl - n - hydroxyethylaniline or n - ethyl - n - hydroxyethyl - m - toluidine . examples of naphthols are α - naphthol , β - naphthol , 1 - naphthol - 2 - carboxylic acid , 4 - chloro - 1 - naphthol , 1 - hydroxy - 2 - naphthoic acid , 1 - naphthol - 2 - sulfonic acid , 1 - naphthol - 4 - sulfonic acid , 1 - naphthol - 8 - sulfonic acid , 2 - naphthol - 6 - sulfonic acid , 2 - naphthol - 7 - sulfonic acid , 2 - naphthol - 8 - sulfonic acid , 2 - naphthol - 3 , 6 - disulfonic acid or 2 - naphthol - 6 , 8 - disulfonic acid . examples of oxidase are oxidase which consumes oxygen and which can form chromogen by oxidizing the liberated amine [ 2 ] alone or by oxidatively coupling the liberated amine [ 2 ] with coupler [ 3 ]. for example , ascorbate oxidase , laccase , tyrosinase , aminophenol oxidase , phenol oxidase or polyphenol oxidase can be mentioned . preferable examples are ascorbate oxidase obtained from pumpkin , cucumber or chayote ( sachium edule ) [ japan . unexam . pat . publ . no . 56 - 88793 ] or laccase obtained from japan ( urushi , japanese lacquer ) or bacidiomycetes ( coriolus versicolor , rhizopus or polyporus versicolor ) [ j . biochem . 50 , 264 ( 1961 ), biochim . biophys , acta , 73 , 204 ( 1963 ), acta chem . scand ., 21 , 2367 1967 )]. embodiment of lap or γ - gtp assay using amide compound [ 1 ] is as follows . in the lap assay , amide compound [ 1 ] of synthetic substrate for lap , in which r 1 is l - leucyl group , or salt thereof is treated with lap in sample ( specimen ) to liberate amine [ 2 ]. sample is a specimen serum 0 . 01 - 5 ml . enzyme reaction is carried out at 37 ° c . for 5 minutes or more . optimum ph of the enzyme is ph 6 . 5 - 8 . 0 . example of buffer solution is phosphate , borate , barbital , carbonate or tris hydroxymethylamino ethane buffer . in the γ - gtp assay , amide compound [ 1 ] of synthetic substrate for γ - gtp , in which r 1 is γ - l - glutamyl group , or salt thereof is treated with γ - gtp in sample to liberate amine [ 2 ]. amount of sample specimen is serum 0 . 01 - 5 ml . enzyme reaction proceeds at 37 ° c . for 5 minutes or more . optimum ph of the enzyme is ph 7 . 5 - 9 . 0 . the enzymatic reaction is carried out in the buffer of ph 7 . 5 - 9 . 0 containing amino acid or peptide as an acceptor such as glycylglycine to determine amine [ 2 ] which forms relative to γ - gtp activity . examples of buffer are phosphate , borate , barbital , carbonate , triethanolamine , glycine or trishydroxymethylamino methane . quantitative determination of amine [ 2 ] can be made by teating with oxidase in the presence of coupler [ 3 ]. coloring reaction is completed at optimum ph of oxidase , generally ph 6 - 7 , to form chromogen by oxidative condensation . examples of buffer used are phosphate , borate , carbonate , acetate or trishydroxymethylamino methane buffer . enzymatic reaction proceeds at approximately 37 ° c . chromogen formed by oxidative condensation of amine [ 2 ] and coupler [ 3 ] has absorption maxima at 550 - 750 nm depending upon the kind of coupler [ 3 ]. in general , the chromogen shows blue color having absorption maxima at 570 - 700 nm , with high sensitivity and stability without deviation by temperature , and is not afforded by contaminant such as birilubin , and is preferable for lap or γ - gtp assay . in the present invention , an enzymatic reaction on amide compound [ 1 ] by lap or γ - gtp and enzymatic oxidative condensation reaction by amine [ 2 ] and coupler [ 3 ] can be proceeded simultaneously . in that case , optimum ph should be a common ph for lap or γ - gtp and oxidase such as ph 7 . 0 . buffer solution can be selected by the same as hereinbefore . quantitative determination of the thus formed chromogen can preferably be made colorimetrically at specific absorption wave length of the chromogen . determination of the specific absorption wave length can be made by conventionally measuring an absorption spectrum of the chromogen , and is performed generally at 550 - 770 nm . lap or γ - gtp activity in a sample can be measured by determining an amount of consumed oxygen and is preferably made by oxygen electrode . further , the oxidase hereinabove is immobilized by known immobilizing technique and the said immobilized enzyme is combined with electrode to set up enzyme electrode . quick , simple and repeated assay can be performed by the said enzyme electrode , and the said electrode can be assembled in automatic assay system . also , the measurement by electrochemical changes on oxygen electrode can save an amount of expensive enzyme . lap or γ - gtp activity can be determined by converting from the recorded or indicated amount of an electrochemical change measured by electrode . as hereinabove explained , the present invention is simple assay method in each reaction step and is an exact and quick lap or γ - gtp assay method . moreover the chromogen formed has absorption maxima at 550 - 750 nm which cannot be affected by the contaminant in specimens . embodiment of peptidase assay using amide compound [ 4 ] is as follows . amide compound [ 4 ] or salt thereof is treated by peptidase in sample , especially lap or γ - gtp , to liberate aniline derivative [ 5 ]. the said aniline derivative is converted to chromogen by the action of oxidizing agent or oxidase , and the coloring compound is colorimetrically measured , or amount of consumed oxygen is measured by oxidase . an oxidative coloration is preferably a colorimetric assay of chromogen which is generated by oxidative condensation of coupler [ 3 ] and aniline derivative [ 5 ]. examples of coupler are aromatic compound which forms chromogen which is oxidatively condensed with aniline derivative [ 5 ], and are preferably phenol , aminophenol , aniline or naphthol series compound of the coupler [ 3 ] hereinbefore . the oxidative condensation is carried out at ph 4 - 12 to complete coloring reaction . buffers or aqueous alkaline solution for controling the ph are carbonate , phosphate , borate buffer or alkaline hydroxide solution . the condensation proceeds in the presence of oxidizing agent or oxidase which can oxidatively condense the aniline derivative [ 5 ] with coupler [ 3 ]. examples of oxidizing agent are preferably halogen series oxidizing agent such as periodate , chloramine t or hypochlorous acid , peroxide series oxidizing agent such as persulfate or hydrogen peroxide , or cyanoferric complex , and preferable example is sodium metaperiodate . preferable examples of oxidase are laccase , ascorbate oxidase or tyrosinase . oxidation by oxidase can be carried out as the same way as that of amide compound [ 1 ]. chromogen thus formed by the oxidative condensation of aniline derivative [ 5 ] and coupler [ 3 ] has maximum absorption wave length approximately at 550 - 770 nm depending on the kind of coupler , and is generally colored pigment , having 570 - 680 nm . the said pigmentation is high sensitive and stable without affecting by temperature and contaminant in specimen such as bilirubin . therefore it does no cause positive error , and so preferable for peptidase assay such as lap or γ - gtp . another colorimetric assay method of aniline derivative [ 5 ] is colorimetry of the color which is produced by treating pentacyanoferric complex with peroxide . examples of peroxide are sodium periodate , potassium periodate , potassium permanganate or hydrogen peroxide . hydrogen peroxide is preferable . stable ferric complex reagent can be obtained by mixing the above cyanoferric complex with bicarbonate such as sodium bicarbonate , lithium bicarbonate or potassium bicarbonate and low molecular dextran . the said complex mixture is stable in freeze dried powder and is preferable for a reagent of kit for colorimetric assay . colorimetric assay using cyanoferric complex is carried out at an acidic ph , preferably at ph 3 - 7 , and most preferably ph 4 - 5 . 5 . for maintaining ph conventional buffer is used . example of buffer is 0 . 01 - 1m , preferably 0 . 05 - 0 . 4m lactate , citrate or oxalate buffer . chromogen , which is formed by the reaction of cyanoferric complex and aniline derivative [ 5 ], has maximum absorption approximately at 700 nm with stable tone , and is suitable for assaying peptidase such as lap or γ - gtp . further , assay of peptidase such as lap or γ - gtp by colorimetry of chromogen , which is formed by the reaction of sodium pentacyanoacoferriate na 2 [ fe ( cn ) 5 . h 2 o ] and liberated aniline derivative [ 5 ], can be made . furthermore , the peptidase assay can be colorimetrically made by conventional chemical colorimetric assay method , for example colorimetry of aromatic amine , such as diazocoupling method , or colorimetry of schiff base which is formed by reacting with aldehyde series compound . lap assay using amide compound [ 4 ] is illustrated in details as follows . synthetic substrate for lap , l - leucyl - 3 , 5 - dihalogeno - 4 - hydroxyanilide is enzymatically reacted with lap in sample to liberate aniline derivative [ 5 ], i . e . 3 , 5 - dihalogeno - 4 - hydroxyaniline . serum 0 . 01 - 5 ml as specimen is used , and the enzymatic reaction is carried out at 37 ° c . for over 5 minutes . optimum ph of the reaction is ph 6 . 5 - 8 . 0 , and is maintained with a buffer solution such as phosphate , barbital , borate or trishydroxyaminomethane . the thus formed aniline derivative [ 5 ] can be colorimetrically determined , in the presence of coupler such as p - xylenol and alkaline condition , the formed chromogen by oxidative condensation with oxidating reagent such as sodium metaperiodate , or alternatively , colorimetrically determined by using coloration reagent obtained by oxidation of pentacyanoaminoferroate with oxidating reagent such as hydrogen peroxide . further , colorimetric assay can be made by treating with oxidase to consume oxygen and liberate chromogen , and measuring the consumed oxygen or formed chromogen . embodiment of γ - gtp assay using amide compound [ 4 ] is illustrated in details as follows . synthetic substrate for γ - gtp , γ - l - glutamyl - 3 , 5 - dihalogeno - 4 - hydroxyanilide is enzymatically reacted with γ - gtp in sample to liberate aniline derivative [ 5 ] of 5 - dihalogeno - 4 - hyroxyaniline . amount of sample specimen is serum 0 . 01 - 5 ml . enzymatic reaction of γ - gtp is carried out at 37 ° c . for over 5 minutes at optimum ph of ph 7 . 5 - 9 . 0 . reaction can be carried out in a buffer of ph 7 . 5 - 9 . 0 containing amino acid or peptide , as an acceptor , such as glycylglycine , and aniline derivative [ 5 ], which is formed in proportion to γ - gtp activity , is determined . examples of buffer solution are phosphate , barbital , borate , carbonate , triethanolamine , glycine or tris ( hydroxymethyl ) aminomethane . determination of aniline derivative [ 5 ] can be made by the same way as of in an assay of lap . as explained hereinabove , an assay method of the present invention using synthetic substrate amide compound [ 4 ] is simple in each reaction step and so peptidase such as lap or γ - gtp can be assayed rapidly and accurately . furthermore , since the formed chromogen has maximum absorption at 550 - 750 nm , an affect of contaminant in specimen can be avoided , and hence the accurate assay of peptidase can be provide . further , an assay method of the present invention is carried out with mild enzymatic reaction step , moreover lap or γ - gtp can be enzymzatically assayed with simple single step reaction . the method can easily be set up for automatic system , and so rate assay , which has been impossible by conventional prior chemical assay method , can be possible . following examples illustrate the present invention but are not construed as limiting . a solution ( 25 ml ) of boc - leu - osu ( 3 . 28 g , 10 mm ) in dioxane was added dropwise with stirring at 0 °- 5 ° c . in 2 , 6 - dichloro - 4 - aminophenol ( 1 . 78 g , 10 mm ) and sodium bicarbonate ( 0 . 92 g , 15 mm ) dissolved in water ( 25 ml ). mixture was stirred for overnight at room temperature and dioxane was distilled off in vacuo at below 30 ° c . residue dissolved in ethyl acetate ( 200 ml ) was washed three times with saturated sodium bicarbonate , water , 1n - hcl and saturated nacl solution ( each 50 ml ). ethyl acetate layer was dried with anhydrous magnesium sulfate and concentrated in vacuo to obtain boc - l - leucyl - 3 , 5 - dichloro - 4 - hydroxyanilide ( 2 . 96 g ). the product dissolved in 2n - hcl / acoh ( 15 ml ) was stirred at room temperature and crystallized by adding dry diethyl ether ( 100 ml ) which was subjected to twice decantation with dry ether . crystals were dried in vacuo to obtain l - leucyl - 3 , 5 - dichloro - 4 - hydroxyanilide . hcl . mol . formula : c 12 h 16 n 2 o 2 cl 2 . hcl a solution ( 70 ml ) of boc - leu - osu ( 6 . 01 g , 18 . 3 mm ) in dioxane was added dropwise at 0 °- 5 ° c . in 2 , 6 - dibromo - 4 - aminophenol ( 4 . 90 g , 18 . 8 mm ) and sodium bicarbonate ( 1 . 68 g , 20 mm ) dissolved in water ( 20 ml ). mixture was stirred at room temperature for over - night and dioxane was distilled off at below 30 ° c . residue dissolved in ethyl acetate ( 400 ml ) and washed three times with saturated aqueous sodium bicarbonate , water , 1n - hcl and saturated nacl solution ( each 100 ml ). ethyl acetate layer was dried with anhydrous magnesium sulfate and concentrated in vacuo to obtain boc - l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 5 . 8 g ). the product dissolved in 2n - hcl / acoh ( 3 . 0 ml ) was stirred at room temperature for 2 hours , then dry ether was added therein to crystallize the product l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl . mol . formula : c 12 h 16 n 2 o 2 br 2 ( 416 . 54 ) n . n - phthaloyl - l - glutamic acid anhydride ( 5 . 16 g , 20 mm ) and 4 - amino - 2 , 6 - dichlorophenol ( 3 . 56 g , 20 mm ) dissolved in dioxane ( 50 ml ) was stirred at 60 ° c . for 2 hours . dioxane was distilled off in vacuo and hydrazine hydrate ( 1 . 5 ml ) in methanol ( 50 ml ) was added therein , then allow to stand at room temperature for 2 days . methanol was distilled off in vacuo , added water to the residue and adjusted to ph 3 by adding 0 . 5n - hcl to obtaine precipitated γ - l - glutamyl - 3 . 5 - dichloro - 4 - hydroxyanilide ( 3 . 96 g ). mol . formula : c 11 h 12 n 2 o 4 cl n , n - phthaloyl - l - glutamic acid anhydride ( 2 . 18 g , 8 . 4 mm ) and 4 - amino - 2 , 6 - dichlorophenol ( 2 . 26 g , 8 . 4 mm ) dissolved in dioxane ( 20 ml ) was stirred at 60 ° c . for 1 . 5 hour . dioxane was distilled off in vacuo , and hydroazine hydrate ( 0 . 7 ml ) in methanol ( 20 ml ) was added to the residue , then allowed to stand at room temp . for 2 days . methanol was distilled off in vacuo , added water to the residue and adjusted to ph 3 by adding 0 . 5n - hcl to obtain precipitated γ - l - glutamyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 2 . 13 g ). mol . formula : c 11 h 12 n 2 o 4 br 2 substrate solution containing 0 . 1m phosphate buffer solution ( ph 7 . 0 ) of l - leucyl - 4 - n , n - diethylaminoanilide . 2hcl ( 2 mm ) and coupler potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) was prepared . laccase solution ( 100 μl , 330 u ) obtained from poryporus versicolor and serum ( lap : 879 g - r units / ml , 50 μl ) were added to the substrate solution ( 2 . 0 ml ) and incubated at 37 ° c . to form pigment . ( the absorption spectrum of pigment is shown in fig5 absorption maximum at 655 nm ). in the reaction , absorption at 655 nm of the formed pigment was continuously measured at each time . result is shown in fig6 . fig7 is shown the result obtained by using serum of 414 g - r units / ml . as shown in fig6 and 7 , serum lap activity can be exactly measured by an assay method of the present invention , and contrary to the prior known chemical colorimetry , reaction mixture is colored simultaneously with starting lap action , hence rate assay can be possible . substrate containing l - leucyl - 4 - n , n - diethylanilide . 2hcl ( 2 mm ) and coupler phenol ( 1 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . laccase solution ( 100 μl , 330 u ) and serum ( 50 μl , lap : 879 g - r units / ml ) were added to the substrate solution ( 2 ml ) and incubated at 37 ° c . to form pigment . in the reaction , color ( maximum absorption at 670 nm ) formed each reaction time was continuously measured at 670 nm . result is shown in fig8 . as shown in fig8 an assay method of the present invention is simple and exact assay method for lap , meoreover reaction mixture became colored simultaneously with starting lap action , in which rate assay can be possible . absorption curve of the pigment formed by the above process at each wave length is shown in fig9 wherein the maximum absorption is at 670 nm . lap assay using l - leucyl - 4 - n , n - diethylaminoanilide , coupler ( 2 , 3 - dimethylphenol , 2 , 4 - dimethylphenol , 2 , 5 - dimethylphenol and 2m6 - dimethylphenol ) and laccase in example 5 , 1 - naphthol - 2 - sulfonate was replaced by 2 , 3 - dimethylphenol , 2 , 4 - dimethylphenol , 2 , 5 - dimethylphenol or 2 , 6 - dimethylphenol to prepare substrate solution containing l - leucyl - 4 - n , n - diethylaminoanilide . 2hcl ( 2 mm ) and coupler ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ). laccase solution ( 100 μl , 330 u ) and serum ( 50 μl , lap : 879 g - r units / ml ) were added to the substrate solution ( 2 ml ) and incubated at 37 ° c . after 10 minutes , absorption of pigment formed was measured at maximum absorption wave length thereof . result is shown in table 1 . table 1______________________________________ maximumcoupler absorption optical density______________________________________2 , 3 - dimethylphenol 630 nm 0 . 1682 , 4 - dimethylphenol 630 nm 0 . 1872 , 5 - dimethylphenol 650 nm 0 . 2312 , 6 - dimethylphenol 630 nm 0 . 193______________________________________ lap assay using l - leucyl - 4 - n , n - diethylaminoaniline , coupler ( 1 - naphthol - 2 - sulfonate , phenol , 2 , 3 - dimethylphenol , 2 , 4 - dimethylphenol , 2 , 5 - dimethylphenol or 2 , 6 - dimethylphenol ) and ascorbate oxidase substrate solution containing l - leucyl - 4 - n , n - diethylaminoaniline . 2hcl ( 2 mm ) and coupler ( potassium 1 - naphthol - 2 - sulfonate , phenol , 2 , 3 - dimethylphenol , 2 , 4 - dimethylphenol , 2 , 5 - dimethylphenol or 2 , 6 - dimethylphenol ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . ascorbate oxidase obtained from chayote ( sechium edule ) solution ( 100 μl , 130 u ) and serum ( 50 μl , lap : 879 g - r units / ml ) were added and incubated at 37 ° c . after 10 minutes , absorption of pigment formed was measured at maximum absorption wave length thereof . result is shown in table 2 . table 2______________________________________ maximum optical densitycoupler absorption ( od ) ______________________________________1 - naphtol - 2 - sulfonate 655 nm 0 . 411phenol 670 nm 0 . 3472 , 3 - dimethylphenol 630 nm 0 . 3562 , 4 - dimethylphenol 630 nm 0 . 2672 , 5 - dimethylphenol 650 nm 0 . 2222 , 6 - dimethylphenol 630 nm 0 . 427______________________________________ in example 5 , l - leucyl - 4 - n , n - diethylaminoanilide . 2hcl was replaced by l - leucyl - 4 - n , n - dimethylaminoanilide . 2hcl and serum ( lap : 879 g - r units / ml ) was added , and the remaining procedure was carried out as same as in example 5 . maximum absorption of the pigment bormed was 650 nm , and absorption ratio of each reaction time was measured at 650 nm . result is shown in fig1 . as shown in fig1 , lap activity can be assayed by the method of the present invention . in example 6 , l - leucyl - 4 - n , n - diethylaminoanilide . 2hcl was replaced by l - leucyl - 4 - n , n - dimethylaminoanilide . 2hcl and operation was performed as same as in example 6 . maximu absorption wave length of the pigment formed was at 655 nm . absorption ratio at each reaction time is shown in fig1 . as shown in fig1 , lap assay of the present invention is excellent . substrate solution containing l - leucyl - 3 . 5 - dibromo - 4 - hydroxyanilide . hcl ( 2 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . a solution ( 20 μl ) containing ascorbate oxidase ( 130 u ) and arylamidase ( boehringer , 1000 g - r units / ml ) was added to the substrate solution ( 2 ml ) and incubated at 37 ° c . at each reaction time , absorption of the formed pigment was measured at 630 nm . result is shown in fig1 . as shown in fig1 , the assay method of the present invention provides excellent lap assay , and rate assay can be possible because of simultaneous coloring with starting the lap reaction . absorption curve of the pigment is shown in fig1 . substrate solution ( 1 . 0 ml ) prepared by the same as in example 11 was added in the reaction cell ( inner volume : 1 ml ) assembled with oxygen electrode and pre - heated to 37 ° c . a solution ( 100 μl ) containing ascorbate oxidase ( 350 u ) and arylamidase ( 1000 g - r units / ml ) was added thereto and incubated at 37 ° c . amount of consumed oxygen at each time was measured by oxygen electrode . result is shown in fig1 , in which assay can advantageously be made by oxygen electrode . in the same experiment , ascorbate oxidase was replaced by laccase ( 250 u ), in which excellent result was obtained as shown in fig1 . in example 11 , 1 - naphthol - 2 - sulfonate was replaced by phenol or 2 . 5 - dimethylphenol ( 0 . 5 mm ) to prepare substrate solution . a solution ( 20 μl ) containing laccase ( 330 u ) and arylamidase ( 1000 g - r units / ml ) was added to the substrate solution ( 2 ml ), and incubated at 37 ° c . for 10 minutes . absorption ratio of teh formed pigment was measured by maximum absorption wave length . result is shown in table 3 . table 3______________________________________ maximum optical absorption densitycoupler wave length ( od ) ______________________________________phenol 610 nm 0 . 1602 , 5 - dimethylphenol 585 nm 0 . 452______________________________________ substrate solution containing l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl ( 2 . 5 mm ) and phenol ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . tyrosinase solution ( 100 μl , 300 u ) and arylamidase ( 1000 g - r units / ml , 20 μl ) were added in substrate solution ( 2 ml ) and incubated at 37 ° c . for 10 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length at 610 nm . ( od 610 = 0 . 158 ). lap can be assayed with good result . substrate solution containing l - leucyl - 2 - methyl - 4 - aminoanilide . 2hcl ( 2 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in phosphate buffer ( ph 7 . 0 ) was prepared . laccase solution ( 100 μl , 330 u ) and arylamidase solution ( 50 μl , 1000 g - r units / ml ) were added to substrate solution ( 2 ml ) and incubated at 37 ° c . for 30 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length at 565 nm ( od 565 = 0 . 143 ). substrate solution containing l - leucyl - 4 - aminoanilide . 2hcl ( 2 . 5 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . laccase solution ( 100 μl , 330 u ) and arylamidase solution ( 50 μl , 1000 g - r units / ml ) were added to substrate solution ( 2 ml ) and incubated at 37 ° c . for 30 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length at 565 nm ( od 565 = 0 . 143 ). substrate solution containing l - leucyl - 4 - n , n - dipropylaminoanilide . 2hcl ( 2 mm ) and potassium p - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . laccase solution ( 100 μl , 330 u ) and arylamidase solution ( 50 μl , 1000 g - r units / ml ) were added to the substrate solution ( 2 ml ), and incubated at 37 ° c . for 10 minutes . absorption ration of the formed pigment was measured at maximum absorption wave length at 650 nm ( od 650 = 0 . 430 ). substrate solution containing l - leucyl - 3 , 5 - dichloro - 4 - hydroxyanilide . hcl ( 2 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ). laccase solution ( 100 μl , 330 u ) and arylamidase solution ( 20 μl , 1000 g - r units / ml ) were added to the substrate solution ( 2 ml ) and incubated at 37 ° c . for 10 minutes . absorption ratio of the formed pigment was measured at 630 nm . ( od 630 = 0 . 535 ). the above 1 - naphthol - 2 - sulfonate was replaced by 0 . 5 mm phenol and measured the formed pigment at 610 nm . ( od 610 = 0 . 111 ). laccase ( 100 μl , 330 u ) and arylamidase solution ( 20 μl , 1000 g - r units / ml ) were added to the substrate solution ( 2 ml ) containing l - leucyl - 4 - n - ethyl - n - hydroxyethylaminoanilide . 2hcl ( 2 mm ) and 2 , 6 - dibromophenol ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ), and incubated at 37 ° c . for 5 minutes . absorption ratio of the formed pigment was measured at 705 nm . ( od 705 = 1 . 47 ). in example 19 , l - leucyl - 4 - n - ethyl - n - hydroxyethylaminoanilide . 2hcl was replaced by l - leucyl - anilide . hcl ( 2 mm ). absorption ratio of the formed pigment was measured at its maximum absorption wave length at 655 nm . ( od 655 = 0 . 178 ). in example 19 , l - leucyl - 4 - n - ethyl - n - hydroxyethylaminoanilide . 2hcl was replaced by l - leucyl - 2 - ethylanilide . hcl ( 2 mm ). absorption ratio of the formed pigment was measured at its maximum absorption wave length at 675 nm . ( od 675 = 0 . 428 ). laccase solution ( 100 μl , 330 u ) and arylamidase solution ( 50 μl , 1000 g - r units / ml ) were added to the substrate solution containing l - leucyl - 2 - carboxyanilide . hcl ( 2 mm ) and 3 , 5 - dibromo - 4 - hydroxyaniline ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ), and incubated at 37 ° c . for 10 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length at 645 nm . ( od 645 = 0 . 397 ). in the above , 3 , 5 - dibromo - 4 - hydroxyaniline was replaced by 4 - n , n - diethylaminoaniline . 2hcl ( 0 . 5 mm ). absorption ratio of the formed pigment was measured by its maximum absorption wave length at 690 nm . ( od 690 = 0 . 613 ). substrate solution containing synthetic substrate ( 2 mm ) and coupler ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) were prepared . laccase solution ( 100 μl , 330 u ) arylamidase ( 50 μl , 1000 g - r units / ml ) were added to the substrate solution ( 2 ml ), and incubated at 37 ° c . for 10 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length . result is shown in table 4 . table 4______________________________________synthetic substrate for lapcoupler ( a ) ( b ) ( c ) ______________________________________ ( 1 ) od . sub . 705 = 3 . 712 od . sub . 730 = 1 . 849 ( 2 ) od . sub . 670 = 1 . 031 od . sub . 705 = 0 . 187 od . sub . 700 = 0 . 168 ( 3 ) od . sub . 660 = 0 . 508 od . sub . 695 = 0 . 259 ( 4 ) od . sub . 580 = 0 . 567 od . sub . 635 = 0 . 157 ( 5 ) od . sub . 655 = 0 . 45 od . sub . 690 = 0 . 301 od . sub . 690 = 0 . 271 ( 6 ) od . sub . 675 = 0 . 396 od . sub . 710 = 0 . 260 od . sub . 700 = 0 . 234 ( 7 ) od . sub . 645 = 0 . 401 od . sub . 690 = 0 . 244 od . sub . 690 = 0 . 219 ( 8 ) od . sub . 600 = 0 . 495 od . sub . 665 = 0 . 201 ( 9 ) od . sub . 590 = 0 . 693 od . sub . 650 = 0 . 329 ( 10 ) od . sub . 715 = 0 . 421 od . sub . 745 = 3 . 79 ( 11 ) od . sub . 740 = 3 . 54 ( 12 ) od . sub . 675 = 1 . 08 od . sub . 700 = 2 . 05 ( 13 ) od . sub . 575 = 0 . 338 od . sub . 640 = 0 . 157 ( 14 ) od . sub . 700 = 0 . 261 od . sub . 730 = 1 . 01 od . sub . 725 = 0 . 907 ( 15 ) od . sub . 705 = 0 . 536 od . sub . 730 = 1 . 22 ( 16 ) od . sub . 650 = 0 . 698 od . sub . 690 = 0 . 449 od . sub . 680 = 0 . 404 ( 17 ) od . sub . 650 = 0 . 495 od . sub . 685 = 0 . 203 ( 18 ) od . sub . 605 = 0 . 338 ( 19 ) od . sub . 590 = 0 . 468 ( 20 ) od . sub . 630 = 0 . 842 ( 21 ) od . sub . 610 = 0 . 63 ( 22 ) od . sub . 635 = 0 . 567 ( 23 ) od . sub . 580 = 0 . 356 od . sub . 640 = 0 . 05 ( 24 ) od . sub . 590 = 0 . 419______________________________________ substrate solution containing γ - l - glutamyl - 4 - n , n - diehtylaminonilide ( 5 mm ), glycylglycine ( 100 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 50 mm phosphate buffer ( ph 8 . 0 ) was prepared . laccase ( 100 μl , 1000 u / ml ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) were added to the substrate solution ( 2 ml ), and incubated at 37 ° c . absorption ratio of the formed pigment was measured at each reaction time at 655 nm . result is shown in fig1 . serum ( γ - gtp : 105 mu / ml ) was measured and the result is shown in fig1 . as shown in fig1 and 17 , γ - gtp activity can be excellently assayed by the method of the present invention , and reaction mixture is colored simultaneously with starting γ - gtp action and so rate assay can be possible . absorption curve of the formed pigment is shown in fig1 . substrate solution ( 1 ml ) in example 24 was added in reaction cell ( inner volume 1 ml ) set with oxygen electrode and pre - heated at 37 ° c . a solution ( 100 μl ) containing laccase ( 200 u ) and serum ( γ - gtp : 416 mu / ml ) was added thereto , then incubated at 37 ° c . amount of consumed oxygen was measured by oxygen electrode . oxygen consumed rate is shown in fig1 , in which showing γ - gtp activity can advantageously be measured . substrate solution ( 2 ml ) was prepared by the same way as in example 24 . ascorbate oxidase solution ( 100 μl , 100 u ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) were added thereto and incubated at 37 ° c . for 5 minutes and 10 minutes , respectively . absorption ratio of the formed pigment was measured in each time at 655 nm ( maximum absorption wave length ). optical density at 655 nm at 5 minutes reaction is od 655 = 0 . 949 , and at 10 minutes if od 655 = 1 . 895 . substrate solution containing γ - l - glutamyl - 3 , 5 - dichloro - 4 - hydroxyanilide ( 5 mm ), glycylglycine ( 100 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 50 mm borate buffer ( ph 7 . 1 ) was prepared . laccase solution ( 100 μl , 100 u ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) were added to the substrate solution ( 2 ml ), and incubated at 37 ° c . for 10 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length at 630 nm . ( od 630 = 1 . 044 ). laccase was replaced by tyrosinase solution ( 100 μl , 100 u ) in the above experiment , and conducted the same way as above . result was od 630 = 1 . 042 . γ - gtp assay using various synthetic substrate for γ - gtp and coupler and ascorbate oxidase substrate solution containing substrate ( 5 mm ), glycylglycine ( 100 mm ) and coupler ( 0 . 5 mm ) in 50 mm borate buffer ( ph 8 . 0 ) was prepared . ascorbate oxidase solution ( 100 μl , 100 u ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) were added to the substrate solution ( 2 ml ), and incubated at 37 ° c . for 5 minutes . absorption ratio of the formed pigment was measured at maximum absorption wave length thereof . result is shown in table 5 . table 5______________________________________cou - synthetic substratepler ( a ) ( b ) ( c ) ( d ) ______________________________________ ( 1 ) od . sub . 650 = 0 . 978 od . sub . 650 = 0 . 902 od . sub . 630 = 0 . 803 ( 2 ) od . sub . 585 = 0 . 645 ( 3 ) od . sub . 705 = 0 . 368 od . sub . 700 = 0 . 379 od . sub . 670 = 1 . 120 ( 4 ) od . sub . 635 = 0 . 313 od . sub . 595 = 0 . 322 od . sub . 580 = 0 . 511 ( 5 ) od . sub . 730 = 1 . 362 od . sub . 725 = 1 . 404 ( 6 ) od . sub . 730 = 1 . 627 od . sub . 705 = 1 . 907 ( 7 ) od . sub . 740 = 2 . 426 ( 8 ) od . sub . 700 = 1 . 871 od . sub . 675 = 0 . 826 ( 9 ) od . sub . 695 = 0 . 453 od . sub . 655 = 0 . 495 ( 10 ) od . sub . 650 = 0 . 331 od . sub . 590 = 0 . 622 ( 11 ) od . sub . 590 = 0 . 605 ( 12 ) od . sub . 640 = 0 . 297 ( 13 ) od . sub . 655 = 0 . 562 od . sub . 610 = 0 . 717______________________________________ substrate solution containing l - leucyl - 3 , 5 - dichloro - 4 - hydroxynilide . hcl ( 5 mm ) dissolved in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . serium specimen obtained from patient ( 20 μl , lap : 236 g - r units ) was added to the substrate solution ( 1 ml ), mixed well and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution ( 3 ml ) containing sodium metaperiodate ( 2 mm ) and p - xylenol ( 10 mm ) in 0 . 2n - koh was added to develop color . adsorption ratio of the formed color was measured at 585 nm to obtain od 585 = 0 . 18 . substrate solution containing l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanolide . hcl ( 5 mm ) dissolved in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . serum specimen obtained from patient ( 20 μl , lap : 250 g - r units ) was added to the substrate solution ( 1 ml ), mixed well and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution ( 3 ml ) containing sodium metaperiodate ( 2 mm ) and p - xylenol ( 10 mm ) in 0 . 2n - koh was added to develop color . absorption ratio of the color was measured at 585 nm . ( od 585 = 0 . 18 ). substrate solution containing γ - l - glutamyl - 3 , 5 - dichloro - 4 - hydroxyanilide ( 5 mm ) and glycyclglycine ( 5 mm ) in 5 mm tris - hcl buffer ( ph 8 . 0 ) was prepared . serum specimen ( 10 μl , γ - gtp : 130 mu / ml ) was added to the substrate solution ( 0 . 5 ml ), mixed well and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution ( 2 ml ) containing sodium metaperiodate ( 2 mm ) and p - xylenol ( 10 mm ) in 0 . 2n - koh was added to develop color . absorption ratio was measured at 585 nm . ( od 585 = 0 . 112 ). substrate solution containing γ - l - glutamyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 5 mm ) and glycylglycine ( 100 mm dissolved in 50 mm tris - hcl buffer ( ph 8 . 0 ). patients &# 39 ; s serum specimen ( 10 μl , γ - gtp : 130 mu / ml ) was added to the substrate solution ( 0 . 5 ml ) and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution ( 2 ml ) containing sodium metaperiodate ( 2 mm ) and p - xylenol ( 10 mm ) in 0 . 2n - koh was added to develop color . absorption ratio was measured at 585 nm ( od 585 = 0 . 140 ). substrate solution ( 5 mm ) containing l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl dissolved in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . patient &# 39 ; s serum specimen ( 20 μl , lap : 250 g - r units ) was added to the substrate solution ( 1 ml ) and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution ( 3 ml ) containing sodium metaperiodate ( 2 mm ) and 2 - chloro - 5 - methylphenol ( 5 mm ) in 0 . 2n - koh was added to develop color . absorption ratio of the color at 635 nm was measured . ( od 635 = 0 . 33 ). substrate solution containing γ - l - glutamyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 5 mm ) and glycylglycine ( 100 mm ) dissolved in 50 mm tris - hcl buffer ( ph 8 . 0 ) was prepared . patient &# 39 ; s serum specimen ( 10 μl , γ - gtp : 130 mu / ml ) was added to the substrate solution ( 0 . 5 ml ) and incubated at 37 ° c . for 20 minutes . oxidizing reagent ( 2 ml ) containing sodium metaperiodate ( 2 mm ) and 2 - chloro - 5 - methylphenol ( 5 mm ) in 0 . 2n - koh was added to develop color . absorption ratio at 635 nm was measured to obtain od 635 = 0 . 214 . 0 . 3 % hydrogen peroxide ( 60 ml ) was added to sodium pentacyanoaminoferroate ( 2 g ) dissolved in water ( 20 ml ), and further 10 % sodium bicarbonate solution ( 20 ml ) was added . dextran t - 10 ( pharmacia , 4 g ) was added therein to prepare color developer undiluted solution . reaction stopper - color developer undiluted solution was prepared by adding 0 . 2m citrate buffer ( 50 ml , ph 4 . 5 ) containing 1 % nacl and 0 . 5 % tween 80 to the color developer undiluted solution ( 1 ml ). serum specimen obtained from patient ( 20 μl , lap : 250 g - r units ) was added to l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl ( 5 mm ) dissolved in 0 . 1m phosphate buffer ( ph 7 . 0 ) ( 1ml ), mixed well and incubated at 37 ° c . for 20 minutes . reaction stopper - color developer solution ( 5 ml ) was added and allowed to stand at room temperature for 20 minutes to develop color . absorption ratio for 700 nm was measured to obtain od 700 = 0 . 21 . patient &# 39 ; s serum specimen ( 20 μl , γ - gtp : 130 mu / ml ) was added to a solution ( 1 ml ) dissolved γ - l - glutamyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 5 mm ) and glycylglycine ( 100 mm ) in 50 mm tris - hcl buffer ( ph 8 . 0 ), mixed well and incubated at 37 ° c . for 20 minutes . reaction was stopped and developed as same as in example 35 to obtain the absorption ratio of od 700 = 0 . 132 . substrate solution ( 5 mm ) containing l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl dissolved in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . patient &# 39 ; s serum specimen ( 20 μl , lap : 250 g - r units ) was added to the substrate solution ( 1 ml ), mixed well and incubated at 37 ° c . for 15 minutes . a solution ( 4 ml ), prepared by adding 0 . 2m edta . 2na solution ( ph 11 , 90 ml ) in 1 % sodium pentacaynoacoferriate ( 30 ml ), was added thereto and incubated at 37 ° c . for 15 minutes . absorption ratio was measured at 730 nm to obtain od 730 = 0 . 232 . 1 % sodium pentacyanoacoferriate was prepared by uv - irradiation for 15 minutes to a solution of 1 % sodium nitroprussid na [ fe ( cn ) 5 no ]- 1 % sodium carbonate . substrate solution containing hydroxynilide ( 5 mm ) and glycylglycine ( 100 mm ) in 50 mm tris - hcl buffer ( ph 8 . 0 ) was prepared . serum γ - gtp ( 74 - 370 mu / ml , 10 μl ) was added to the substrate solution ( 0 . 5 ml ), mixed well and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution containing sodium metaperiodate ( 2 mm ) and p - xylenol ( 10 mm ) in 0 . 2n - koh was added to develop color . absorption ratio of the formed color was measured at 585 nm . result is shown in fig2 in which serium γ - gtp can be measured advantageously . substrate solution containing l - leucyl - 3 . 5 - dichloro - 4 - hydroxyanilide . hcl ( 2 mm ) or l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl ( 2 mm ) and 2 , 5 - dimethylphenol ( 2 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . ascorbate oxidase ( 130 u ) and patient &# 39 ; s serum psecimen ( 20 μl , lap : 1113 g - r units / ml ) were added to the substrate solution ( 2 ml ) and incubated at 37 ° c . for 10 minutes . absorption ration was measured at its maximum absorption wave length . results are : substrate solution containing l - leucyl - 3 . 5 - dichloro - 4 - hydroxyanilide . hcl ( 2 mm ) and 2 , 5 - dimethylphenol ( 2 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . a solution ( 20 μl ) containing laccase ( 330 u ) and arylamidase ( 1000 g - r units / ml ) was added to the substrate solution ( 2 ml ) and incubated at 37 ° c . for 10 minutes . absorption ratio at 585 nm was od 585 = 0 . 386 . substrate solution containing γ - l - glutamyl - 3 , 5 - dichloro - 4 - hydroxyanilide ( 5 mm ), glycylglycine ( 100 mm ) and 2 , 5 - dimethylphenol ( 0 . 5 mm ) in 50 mm borate buffer ( ph 8 . 0 ) was prepared . ascorbate oxidase ( 100 μl , 100 u ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) was added to the substrate solution ( 2 ml ) and incubated at 37 ° c . for 5 minutes . absorption ratio at 585 nm was od 585 = 0 . 547 . substrate solution containing γ - l - glutamyl - 3 , 5 - dichloro - 4 - hydroxyanilide ( 5 mm ) or γ - l - glutamyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 5 mm ), glycylglycine ( 100 mm ) and 2 , 5 - dimethylphenol ( 0 . 5 mm ) in 50 mm borate buffer ( ph 8 . 0 ) was prepared . laccase solution ( 100 μl , 100 u ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) were added to each substrate solution ( 2 ml ), and incubated at 37 ° c . for 5 minutes . absorption ratio of the formed color was measured . results are :	8
for a general understanding of the present invention , reference is made to the drawings . in the drawings , like reference numerals have been used throughout to designate identical elements . the low impedance radiofrequency ( rf ) shielded window is depicted as being installed in an enclosure , however , the radiofrequency shielded window of the present invention may be installed in a variety of enclosures , containers , shelters , buildings , walls , ceilings , cabinets , and the like . while the use of a screen material for radiofrequency shielding in combination with a clear material such as a glass or plastic is known , the specific arrangement of shielded window layers as disclosed herein to achieve low impedance shielding effectiveness has heretofore been unknown . specifically , each layer of screen in a typical radiofrequency shielded window only provides 20 - 40 db of rf shielding , and thus to achieve greater shielding effectiveness these layers are commonly stacked . with each layer isolated from the other , the current from the upper layer passes through the lower layer &# 39 ; s path to ground , thus effectively “ lifting ” the ground of the upper layer from true ground , making the upper layer less effective than it would be without this ground shift effect . essentially , this problem of decreased shielding effectiveness is akin to resistors in series , where each shielding layer is equivalent to a resistor in series . at higher frequencies , inductance of this ground path can be , for example , 5 - 10 nanohenries and at 2 gigahertz this is equivalent to 10 - 20 ohms ; thus the ground of the window shielding layer is diminished by this resistance . series stacking of shielded windows has diminishing returns as related to shielding effectiveness . the present invention , however , overcomes the problem of ground lifting of series stacked radiofrequency shielded windows by essentially placing the ground paths of each radiofrequency shielded window in parallel such that each layer goes to ground independently of the other . fig7 depicts a typical equivalent circuit of a two layer rf shielded window of the present invention . the physical structure and implementation of such a novel arrangement will be described in further detail below . turning now to fig1 , an exploded perspective view of a low impedance radiofrequency shielded window used with a shielded enclosure is depicted . while two window layers are depicted , in some embodiments of the present invention there may be three or more window layers interconnected in a similar manner to that which will be further described . each window layer has a conductive mesh surface and an insulating surface . the conductive mesh surface may have a conductive mesh such as copper mesh or screening attached to , bonded or printed to it . in some embodiments of the present invention , the conductive mesh may comprise more of a coating or a film than a true mesh , in such a way that radiofrequency shielding is accomplished . thus , mesh refers to any radiofrequency shielded coating that maintains optical transparency or visibility regardless of the size of the mesh openings , or lack thereof . on the opposing surface of each window layer , there is no conductive mesh and therefore it is considered an insulating surface . the conductive mesh surface and the insulating surface make up opposing sides to each window layer . in fig1 , the first window layer 109 comprises a perimeter , a conductive mesh surface and an insulating surface . a first conductive perimeter layer 115 makes ohmic contact with the conductive mesh surface of the first window layer and extends past the insulating surface of the first window layer 109 to allow contact to ground . the window layers may be made from glass , a plastic such as polycarbonate , or the like . a second window layer 111 also comprises a perimeter , a conductive mesh surface and an insulating surface . a second conductive perimeter layer 119 makes ohmic contact with the conductive mesh of the second window layer 111 and extends past the insulating surface of the first window layer , where it makes contact to ground independently of the first window layer . the first conductive perimeter layer 115 and the second conductive perimeter layer 119 make mechanical and ohmic contact along the insulating surface of the first window layer 109 , thus creating a separate path to ground for each window layer . in some embodiments of the present invention , the second conductive perimeter layer 119 makes ohmic contact with the conductive mesh of the second window layer ill and extends to the first conductive perimeter layer 115 . the first conductive perimeter layer 115 and the second conductive perimeter layer 119 make mechanical and ohmic contact along the perimeter of the first window layer 109 . the conductive mesh of each layer therefore goes independently to ground . each conductive perimeter layer folds over such that each layer contacts the grounding wall of the enclosure at the same or a similar point . while the conductive mesh may simply be a fine mesh screen attached to or otherwise connected with a glass or plastic pane , in some embodiments of the present invention , the conductive mesh may be screen printed on a polycarbonate film or similar substrate to make up the conductive mesh surface of each window layer . there are disadvantages to the use of wire mesh in radiofrequency shielding including the degradation over time of many of the wire junctions in the wire mesh , creating a high impedance junction and associated shielding degradation . the use of screen printed wire mesh on each window layer solves the problem of ground path and associated shielding degradation . in addition , thin film coatings that may be optically transparent or provide good visual clarity may also be used . an example of such a coating is indium - tin - oxide ( ito ). other conductive shielding materials may also be used . the opposing side of each window layer that does not contain conductive mesh is in turn referred to as the insulating surface . the conductive mesh surface and the insulating surface of each window layer are each a planar surface of their respective window layer . in some embodiments of the present invention , the conductive mesh is embedded or otherwise molded , sandwiched or contained within a window layer , and the terms conductive mesh surface and insulating surface may in fact be somewhat arbitrary , but still serve a useful purpose in defining the fact that each window layer has two opposing surfaces and a conductive layer integrated therein . in some embodiments of the present invention , more than two window layers may be employed . for example , three or four window layers may provide additional signal attenuation that is necessary for some applications . to further improve on shielding effectiveness , the conductive mesh of each window layer may be overlaid at an angle with the orientation of the conductive mesh of the previous layer . an overlay angle of between 30 and 60 degrees , for example , may be suitable . a protective layer 113 may also optionally be employed to protect the radiofrequency shielded window layers . the protective layer 113 may be a clear polycarbonate , acrylic , or the like . the conductive perimeter layers are , in some embodiments of the present invention , a conductive tape such as , for example , a fabric conductive tape such as a silver fabric conductive tape . to make the described window layer assembly using such a conductive tape , the tape is applied half way on to the edge of each window layer with the remaining half left free while other assembly steps are completed . the other window layers are constructed the same way . to complete the assembly , the free edges of the conductive tape are folded over so that each layer &# 39 ; s conductive tape connects at the same point , typically where the overall window assembly is fastened to an enclosure wall . using this novel arrangement , each layer has its own path to ground and one layer does not have to go through another layer to get to ground . when attaching one window layer to another window layer , the first conductive perimeter layer 115 and the second conductive perimeter layer 119 ( or additional conductive perimeter layers ) are aligned where there are no seams between the conductive perimeter layers ( for example , conductive tape ). an example of such an arrangement can be seen in fig1 as well as fig4 and 6 . the conductive tape or other conductive perimeter layer are arranged such that the seams of one layer overlap the seams of another layer , ensuring that seams of different layers are not superimposed on each other where they would permit radiofrequency signal leakage . various techniques to ensure proper mechanical and electrical connection of each layer may be used . for example , rivets , bolts , screws , clips , adhesives , wire , clamps , or the like , may be used as fasteners . in the example provided herein , fasteners 107 such as bolts may be used . to receive the fasteners 107 , mounting holes may be placed around the periphery of each window layer or at other suitable locations . for example , first window layer mounting holes 117 can be seen in fig1 along with second window layer mounting holes 121 . additional window layers would also have similar mounting holes , as well as optional protective layer mounting holes 123 . a radiofrequency shielded enclosure 101 can be seen in fig1 . the radiofrequency shielded enclosure depicted is merely an example , and should not be considered a limitation . for example , while conductive sleeves are depicted as part of the radiofrequency shielded enclosure , they may be omitted entirely , modified , or replaced with conductive gloves , mittens , probes , or the like . in the example depicted in fig1 , a radiofrequency shielded cover 103 can be seen . the radiofrequency shielded enclosure is made from a conductive material such as a metal , for example , steel or copper . the radiofrequency shielded cover 103 is also made from a conductive material 105 such as a metal , for example , steel or copper . fasteners 107 can be seen that have been attached to the radiofrequency shielded cover 103 where the opening for the low impedance radiofrequency shielded window can be seen . the radiofrequency shielded enclosure comprises a volume defined by conductive surfaces enclosing said volume to create a faraday cage enclosure . the low impedance radiofrequency shielded window is placed in the opening , and the fasteners 107 pass through the mounting holes in each window layer , and are tightened securely in place , creating a radiofrequency tight seal . of course the low impedance radiofrequency shielded window can be placed in another location on the enclosure where a sufficient opening has been fabricated . fig2 is a plan view of the low impedance radiofrequency shielded window installed in a cover for a shielded enclosure . the angled overlay of conductive mesh patterns in the window layers can be seen . also the second conductive perimeter layer 119 can be seen as well as fasteners around the perimeter of the window assembly . taking a cross section along line a - a of fig2 , fig3 depicts the resulting cross sectional view of the low impedance radiofrequency shielded window . the conductive material 105 from a cover , panel or wall of a radiofrequency shielded enclosure can be seen along with the first window layer 109 and the second window layer 111 , covered by a protective layer 113 . fig4 depicts an exploded view of the low impedance radiofrequency shielded window installed in a cover for a shielded enclosure . the skewed or staggered seams of the conductive perimeter layers can be seen along with the overlay of the conductive mesh of the window layers . it should be noted that there may be more than two window layers in some embodiments of the present invention that are interconnected with parallel ground paths as described herein . it should be noted that each layer terminates independently to ground . for example , the conductive perimeter layers are wrapped in such a way that they each have an independent path to ground ( in this case the shielded enclosure ) as seen in fig5 . the layers are not merely stacked , as this would result in each previous layer being in the path to ground for the subsequent layers . fig5 is a close up diagrammatic view of the layers of the low impedance radiofrequency shielded window . the way in which the first conductive perimeter layer 115 and the second conductive perimeter layer 119 make contact with the window layers and each layer then contacts ground independently can be clearly seen . additional window layers may be interconnected in the same manner as depicted in fig5 . a typical fastener 107 is also shown that pulls the layers together and holds them in place against conductive material 105 of a radiofrequency enclosure . fig6 depicts two exemplary layers of the low impedance radiofrequency shielded window showing the angled orientation of the conductive mesh between layers as well as the staggered seams of the conductive perimeter layers . lastly , to further depict schematically the independent path to ground for each window layer of the low impedance radiofrequency shielded window of the present invention , fig7 is an equivalent circuit of the low impedance radiofrequency shielded window having two window layers . rl 1 and rl 2 represent a first radiofrequency shielded window layer and a second radiofrequency shielded window layer respectively . merely stacking each window layer would result in a series equivalent circuit that would not have the independent ground path and improved shielding of the present invention . the low impedance radiofrequency shielded window can be installed in a radiofrequency shielded enclosure to provide visibility while still affording radiofrequency shielding . radiofrequency shielded enclosures have many uses , from testing to secure communications and military and police work . it is , therefore , apparent that there has been provided , in accordance with the various objects of the present invention , an low impedance radiofrequency shielded window . while the various objects of this invention have been described in conjunction with preferred embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art . accordingly , it is intended to embrace all such alternatives , modifications and variations that fall within the spirit and broad scope of this specification , drawings and claims herein .	7
wireless devices use antennas to transmit and receive radio signals . noise sources , such as other wireless devices including wireless devices that transmit on the same channel , may interfere with wireless communication . conventional wireless devices use a variety of techniques to reduce the detrimental effect of noise on communication for example , dividing the area of coverage into sectors , using directional antenna , and using multiple antennas to provide redundancy and spatial diversity . an improved wireless device , according to the various aspects of the present invention includes directional antennas positioned in such a way that the physical sectors of the antennas of the wireless device overlap and the antennas selected for communication are the antennas whose physical sectors overlap in an area in a manner that permits the antennas to operate as a multiple input multiple output (“ mimo ”) antenna . the wireless device , according to the various aspects of the present invention may select for communication any suitable combination of directional antennas that operate as a mimo antenna and are oriented in a desired direction of communication . furthermore , the wireless device may assign any available channel to the antennas to improve performance . a wireless device , according to the various aspects of the present invention includes , for example , wireless cells , access points , wireless clients , mobile computers , and handheld devices . the term “ physical sector ” is understood to mean the area of coverage in which an antenna transmits and receives signals . the size and shape of a physical sector depends on a variety of factors for example , the type of antenna , atmospheric conditions , presence of noise sources , and physical surroundings . physical sectors 58 , 60 and 62 represent the two - dimensional shape of idealized physical sectors of directional antennas . physical sectors 58 , 60 and 62 do not overlap in fig2 . physical sectors 58 , 60 and 62 substantially overlap in fig3 . physical sectors 58 , 60 and 62 partially overlap in fig4 and 5 . the term “ mimo antenna ” is understood to mean at least two antennas that each transmits and / or receives signals on the same channel in the area where the physical sectors of the antennas overlap . antennas may be positioned in such a way that their physical sectors overlap . antennas whose physical sectors overlap in the same area may be configured to operate as a mimo antenna in that area . each individual antenna of a mimo antenna operates on the same channel ( e . g ., frequency , encoding , or other method of dividing the radio spectrum for communication ). a mimo antenna provides , inter alia , spatial diversity between the antennas , redundancy , and temporal diversity to reduce the effects of noise on transmission and reception . reducing the effects of noise permits a wireless device to communicate more reliability . antennas that form a mimo antenna may be oriented to use different signal polarization for example , horizontal , vertical , and circular . antennas that form a mimo antenna may be physically separated to provide spatial diversity . mimo physical sectors are formed to provide communication with increased immunity to noise within the area of the mimo physical sector . the term “ mimo physical sector ” means the area where the physical sectors of the antennas that operate as a mimo antenna overlap . in an exemplary embodiment , referring to fig3 , physical sectors 58 , 60 , and 62 substantially overlap to form mimo physical sector 82 . physical sectors 66 , 68 , and 70 substantially overlap to form a mimo physical sector 84 . in this embodiment , each mimo physical sector has an angle of coverage of about 90 degrees . in another embodiment , referring to fig6 , each one physical sector 58 , 60 , and 62 and each one physical sector 66 , 68 , and 70 has an angle of coverage of about 180 degrees , thus the resulting mimo physical sectors 82 and 84 have an angle of coverage of about 180 degrees . fig7 represents an alternate method for diagrammatically representing physical sectors and mimo physical sectors . physical sectors 58 - 62 respectively have about a 180 degree angle of coverage and the center of each physical sector is oriented at approximately 90 degrees ( straight up on the page ). each physical sector 58 - 62 extends from wireless device 10 to the furthest extent reached by the respective antennas even though fig7 shows gaps between the physical sectors for clarity . the mimo physical sectors 82 and 84 of fig6 and 7 are equivalent ; however , the diagrammatical representation of fig7 provides greater clarity . thus , mimo physical sectors 82 and 84 respectively include three substantially overlapping physical sectors 58 - 62 and 66 - 70 . the physical sectors of the antennas that form a mimo antenna are not limited to being substantially overlapping . when physical sectors only partially overlap , the mimo physical sector is the area where the physical sectors of the antennas that form the mimo antenna overlap . referring to fig4 and 5 , the antennas associated with physical sectors 58 - 62 transmit and receive using the same channel . area 94 is the area where physical sectors 58 , 60 , and 62 overlap , thus area 94 is a mimo physical sector . the antennas associated with physical sectors 58 - 62 operate as a mimo antenna in area 94 . the mimo physical sector formed by physical sectors 66 - 70 is also shown in fig4 as mimo physical sector 82 . mimo physical sectors may be formed in a variety of ways . in one exemplary method for forming a mimo physical sector , referring to fig1 , antennas are selected to operate as a mimo antenna then the antennas are positioned in such a way that the physical sectors of the antennas overlap . in another exemplary method for forming a mimo physical sector , referring to fig2 , a plurality of antennas are positioned in such a way that the physical sectors of at least some of the antennas at least partially overlap then at least two antennas are selected to operate as a mimo antenna in the area where their physical sectors overlap to form a mimo physical sector . the plurality of antennas may be positioned in such a way that the various mimo physical sectors that are formed are oriented in different directions . at least two antennas may be selected to operate as a mimo antenna in accordance with the orientation of the mimo physical sector formed by the physical sectors of the selected antennas . the orientation of some mimo physical sectors may provide increased performance over the orientation of other mimo physical sectors . furthermore , the antennas that form the mimo antenna may be assigned any available channel . accordingly , the selected antennas , thus the mimo physical sector , may be assigned to a channel that provides improved performance . the term “ mimo virtual sector ” means the area where the physical sectors of antennas that may operate as a mimo antenna overlap . referring to fig1 , physical sectors 58 - 62 and 66 - 70 each have an angle of coverage of about 180 degrees respectively . the antennas associated with physical sectors 58 - 62 and 66 - 70 are positioned in such a way that in area 150 , physical sectors 58 , 68 , and 70 overlap . in area 152 , physical sectors 58 , 60 , and 70 overlap and so forth for areas 154 - 160 . each one area 150 - 160 comprises a mimo virtual sector because the antennas whose physical sectors overlap in the area may operate as a mimo antenna . if the antennas associated with physical sectors 58 , 68 , and 70 are selected to form a mimo antenna , then area 150 operates as a mimo physical sector . if the antennas associated with physical sectors 58 , 60 , and 70 are selected to form a mimo antenna , then area 152 operates as a mimo physical sector and so forth for the other areas . before antennas are selected to form a mimo physical sector , areas 150 - 160 are mimo virtual sectors . when antennas are selected to form a mimo antenna , the area where the physical sectors of the selected antennas overlap become a mimo physical sector while the other areas remain mimo virtual sectors . a mimo physical sector may also be referred to as a selected mimo virtual sector or an active mimo virtual sector . any criteria may be used to select a mimo virtual sector for communication . the method of positioning antennas to form mimo virtual sectors then selecting antennas to operate as a mimo antenna permits the wireless device to respond to changes in , inter alia , performance , noise sources , and the environment by communicating through the mimo physical sector that provides increased performance . positioning antennas to form mimo virtual sectors permits a wireless device with fixed antenna positions to select from a variety of mimo virtual sectors to communicate using the mimo physical sector that provides a desired level of performance . when the performance of the selected mimo physical sector deteriorates due to , inter alia , noise sources or environmental conditions , the wireless device can select different antennas to operate as a mimo antenna , thereby selecting a different mimo virtual sector to operate as a mimo physical sector where the different mimo physical sector provides increased performance . mimo physical sectors permits a wireless device to communicate with increased performance . mimo virtual sectors permits a wireless device to select an area to transmit and receive in accordance with the mimo virtual sector that provides a desired level of performance . a wireless device having multiple mimo virtual sectors may select between the various mimo virtual sectors . a wireless device may select the mimo virtual sector that provides an increased level of performance . positioning the antennas of a wireless device to form mimo virtual sectors that are oriented in different directions permits the wireless device to select a mimo physical sector based on the orientation of the virtual sector with relation to the position of noise sources . performance may be measure by , inter alia , throughput , data throughput , signal - to - noise ratio , reduced signal error , reduced data errors , reduced retransmission requests , reduced interference , rejection of multipath signals , higher transmission rates , and signal strength . a mimo system includes radios and antennas that may be configured to form mimo antennas , mimo physical sectors , and mimo virtual sectors . a mimo system may form a mimo antenna using any suitable combination of radios and antennas . a mimo system may select any suitable mimo physical sector for communication . a mimo system may have any suitable number of mimo virtual sectors and / or selected mimo virtual sectors . the mimo system may position its mimo physical sectors at any orientation . the mimo physical sectors of a mimo system may overlap other mimo physical sectors of the same mimo system . overlapping mimo physical sectors of the same mimo system may be assigned different channels . a mimo system has at least two radios and at least two antennas where at least two radios and two antennas form a mimo antenna . in another exemplary embodiment , referring to fig1 , a mimo system has three radios with two antennas interfacing with each one radio . three antennas , one antenna from each radio , may operate as a mimo antenna , thereby resulting in a mimo system having two mimo antennas . the present invention may employ various types of radios using any type of communication protocol and operating at any frequency and / or with any number of channels suitable for the application . the present invention may use any variety of antennas or groups of antennas for any purpose for example , transmission , reception , noise reduction , and multipath detection . antennas may be positioned in any manner for example , their physical sectors may be overlapping and non - overlapping . radios and antennas may operate as a mimo system , mimo antennas , mimo physical sectors , and mimo virtual sectors . any type of algorithm and / or processor may be used to enable radios and / or antennas to form and operate as mimo antennas . antennas may be selected for communication according to any criteria such as for example , data throughput , signal strength , signal quality , and signal - to - noise ratio . in one embodiment , the antennas of the wireless device are positioned to form non - overlapping mimo physical sectors and one of the non - overlapping mimo physical sectors is selected for communication with other wireless devices . in another embodiment , the antennas of the wireless device are positioned to form overlapping mimo virtual sectors and some of the mimo virtual sectors are selected for communication with other wireless devices . the antennas that form a mimo antenna may be used in any manner to transmit and / or receive signals for example , any number of antennas that operate as the mimo antenna may transmit only , receive only , and transmit and receive signals . in an exemplary embodiment , referring to fig1 , antennas 34 , 36 , and 38 , with their associated radios , form a mimo antenna in which each antenna 34 , 36 , and 38 transmits and receives the same signals . in another embodiment , antennas 34 - 38 form a mimo antenna in which antenna 34 transmits , antenna 36 receives only , and antenna 38 transmits and receives . different mimo antenna configurations may provide different communication characteristics . for example , a configuration where all antennas of the mimo antenna transmit and receive the same information may provide increased error correction . a configuration where antennas transmit and / or receive different information may provide increased data throughput . in an configuration where each antenna of the mimo antenna receives some version of the same signal , the information content of the various signal versions received by the antennas of the mimo antenna may be highly similar and / or less similar depending on environmental conditions for example , the presence of noise sources , multipath reflections , and spatial diversity of the antennas . advanced algorithms may be used to process the signal received by each antenna that form the mimo antenna to construct a resultant receive signal that contains as much of the receive signal information as can be extracted . the antennas of a mimo antenna may be configured to receive signals from a common source by positioning the antennas such that their physical sectors overlap . the number of antennas used to form a mimo physical sector and the overlap of the physical sectors of the antennas may affect performance . for example , referring to fig1 and 5 , area 90 receives coverage from only physical sector 62 , thus communications within area 90 are transmitted and received by only antenna 38 . likewise , area 98 receives coverage only from physical sector 60 and antenna 36 . even when antennas 36 and 38 are selected to operate as a mimo antennas , areas 90 and 98 are not mimo physical sectors because only one antenna operates in the area . when only one antenna of the antennas selected to operate as a mimo antenna transmits and receives in an area , the performance may not be as high as in the areas where the physical sectors of the antennas overlap to form a mimo physical sector . areas 92 and 96 receive coverage from physical sectors 58 , 62 and 58 , 60 respectively . areas 92 and 96 are mimo physical sectors because at least two antennas operate as a mimo antenna in the areas . communication using at least two antennas of the antennas selected to operate as a mimo antenna may improve performance . area 94 , a mimo physical sector formed by the overlap of the physical sectors of three antennas , receives coverage from physical sectors 58 , 60 and 62 and their related antennas 34 - 38 . antennas 34 - 38 operate as a mimo antenna , thus reception and / or transmission through all three antennas in area 94 may provide higher performance than reception and / or transmission through areas 90 - 92 and 96 - 98 . the mimo physical sector in area 94 is most likely to provide improved performance because all antennas of the mimo antenna communicate in area 94 . mimo physical sectors formed using directional antennas may use conventional antenna select methods to reduce interference from noise sources . for example , referring to fig1 and 8 , wireless device 10 comprises processor 12 , radios 18 - 22 , rf switches 26 - 30 , and antennas 34 - 38 and 42 - 46 where two antennas interfacing with each one rf switch respectively . antennas 34 - 38 and 42 - 46 operate as a first mimo antenna and a second mimo antenna respectively . radios 18 - 22 use the 802 . 11a / b / g / n communication protocols . antenna physical sectors 58 - 62 , associated with antennas 34 - 38 respectively , substantially overlap to form mimo physical sector 82 . antenna physical sectors 66 - 70 , associated with antennas 42 - 46 respectively , substantially overlap to form mimo physical sector 84 . in this embodiment , each radio is set to the same channel . the physical sectors and the mimo physical sectors 82 - 84 extend farther than shown in fig8 to enable wireless device 10 to communicate with wireless device 102 and receive interference from noise sources 106 and 108 . wireless device 10 uses rf switches 26 - 30 to select between antennas 34 - 38 and 42 - 46 . in this embodiment , the rf switches select between one of two groups of antennas ; either antennas 34 - 38 or antennas 42 - 46 are selected , thus only one mimo physical sector , either 82 or 84 , is active at any given time . in the embodiment and the scenario described in fig8 , wireless device 10 selects mimo antennas physical sector 84 to reduce interference from noise sources 106 and 108 while communicating with wireless device 102 . wireless device 104 of fig8 may also be implemented using mimo physical sectors similar to those of wireless device 10 . wireless device 104 may select the mimo physical sector that provides the best performance while communicating with wireless device 102 and reduces interference from noise source 110 . in another embodiment of a mimo system , referring to fig9 , wireless device 10 comprises a processor 12 , three radios 18 - 22 , three rf switches 26 - 30 , and three antennas interfacing with each rf switch . antennas 34 - 38 , 42 - 46 , and 50 - 54 may have any angle of coverage , be oriented in any direction , form mimo antennas , and form mimo virtual sectors in any manner . in an exemplary embodiment , referring to fig1 , each antenna 34 - 38 , 42 - 46 , and 50 - 54 has an angle of coverage of about 120 degrees . antennas 34 - 38 are oriented so that their associated physical sectors , 58 - 62 respectively , substantially overlap to form mimo physical sector 82 . antennas 42 - 46 are oriented so that their associated physical sectors , 66 - 70 respectively , substantially overlap to form mimo physical sector 84 . antennas 50 - 54 are oriented so that their associated physical sectors , 74 - 78 respectively , substantially overlap to form mimo physical sector 86 . physical sectors 58 - 62 , 66 - 70 , and 74 - 78 are oriented such that the center of mimo physical sectors 82 , 84 , and 86 are respectively oriented at about 60 , 180 , and 300 degrees respectively . in this embodiment , the mimo physical sectors do not substantial overlap . each radio is set to the same channel , thus the mimo physical sectors 82 - 86 each use the same channel . the wireless device embodiment of fig9 and 10 may also be used to reduce interference with noise sources by selected one of the three mimo physical sectors for communication . in another embodiment , not shown , wireless device 10 comprises a processor , four radios , an rf switch interfacing with each one radio , and four directional antennas interfacing with each one rf switch . each antenna has an angle of coverage of about 90 degrees . the physical sectors of one antenna from each rf switch substantially overlap to form a mimo physical sector resulting in a mimo system having four mimo virtual sectors . each mimo physical sector receives coverage from each one of the four radios . the physical sectors of the antennas are oriented in such a way that the mimo physical sectors do not overlap and the mimo physical sectors provide a combined angle of coverage of about 360 degrees . all radios are set to the same channel . in another embodiment , not shown , wireless device 10 comprises a processor , two radios interfacing with the processor , an rf switch interfacing with each one of the radios , and three directional antennas interfacing with each one rf switch . each antenna has an angle of coverage of about 120 degrees . the physical sectors of one antenna from each one rf switch substantially overlap to form a mimo physical sector resulting in a mimo system having three mimo virtual sectors . each mimo physical sector receives coverage from each one of the two radios . the physical sectors of the antenna are oriented in such a way that the mimo physical sectors do not overlap and the mimo physical sectors provide a combined angle of coverage of about 360 degrees . all radios are set to the same channel . in another embodiment , not shown , wireless device 10 comprises a processor , two radios interfacing with the processor , an rf switch interfacing with each one of the radios , and “ n ” directional antennas interfacing with each one rf switch . each antenna has an angle of coverage of about 360 degrees divided by n . two antennas , one from each rf switch , form a mimo antenna , thereby forming n mimo antennas . the physical sectors of the antennas that form each mimo antenna substantially overlap to form n mimo physical sectors . the mimo physical sectors are oriented in such a way that the mimo physical sectors do not substantially overlap , thereby providing a combined angle of coverage of about 360 degrees . all radios are set to the same channel . radios , antennas , and mimo physical sectors are not limited to using a single channel for communication or to forming mimo physical sectors that are substantially non - overlapping . radios may be grouped to provide mimo physical sectors that use different channels . mimo physical sectors that communicate on different channels may be positioned to overlap . overlapping mimo physical sectors that use different channels may simultaneously communicate less mutual interference . in one embodiment , referring to fig1 , wireless device 10 comprises a process 12 , controllers 14 , 16 interfaces with processor 10 , two radios 18 , 20 interface with controller 14 thereby forming a first radio group , two radios 22 , 24 interface with controller 16 thereby forming a second radio group , an rf switch 26 , 28 , 30 , 32 interfaces with radio 18 , 20 , 22 , 24 respectively , antennas 34 - 48 interface with the rf switches in such a manner that two antennas interface with each one rf switch . the antennas may form mimo antennas any manner ; however , forming mimo antennas using antennas from the same group enables mimo physical sectors from different groups to operate on different channels . in one embodiment , antennas 34 and 36 form a first mimo antenna . antennas 42 and 44 form a second mimo antenna . the first and second mimo antennas belong to the first radio group . antennas 38 and 40 form a third mimo antenna . antennas 46 and 48 form a fourth mimo antenna . the third and fourth mimo antennas belong to the second radio group . in another embodiment , antennas 34 - 40 form a first mimo antenna and antennas 42 - 48 form a second mimo antenna . the antennas and their respective physical sectors may have any angle of coverage and be oriented in any direction . the antennas of the various groups may form mimo antennas in any manner . the resulting mimo physical sectors may be overlapping or non - overlapping . in an exemplary embodiment , antennas 34 , 36 , 38 , 40 , 42 , 44 , 46 , and 48 and their respective physical sectors 58 , 60 , 62 , 64 , 66 , 68 , 70 , and 72 each have an angle of coverage of about 180 degrees . referring to fig1 and 12 , physical sector 58 substantially overlaps physical sector 60 to form mimo physical sector 82 . physical sectors 62 and 64 substantially overlap , 66 and 68 substantially overlap , and 70 and 72 substantially overlap to form mimo physical sectors 84 , 86 , and 88 respectively . the center of the angles of coverage of antennas 34 , 36 and 38 , 40 are oriented at about 90 degrees ( e . g ., up the page ), thus mimo physical sectors 82 and 84 overlap . the center of the angles of coverage of antennas 42 , 44 and 46 , 48 are oriented at about 270 degrees ( e . g ., down the page ), thus mimo physical sectors 86 and 88 substantially overlap . radios 18 and 20 belong to the first radio group and radios 22 and 24 belong to the second radio group . assigning channel c 1 to the first radio group and channel c 2 to the second radio group results in mimo physical sectors 82 and 86 using channel c 1 and mimo physical sectors 84 and 88 using channel c 2 . thus , the channel assignment , the antenna orientation , and the mimo antenna configurations provide overlapping mimo physical sectors that use different channels . referring to fig1 , mimo physical sector 82 is assigned to c 1 , mimo physical sector 84 is assigned to c 2 , and mimo physical sector 82 substantially overlaps mimo physical sector 84 . because mimo physical sectors 82 and 84 are assigned different channels , they may communicate with different wireless devices simultaneously with less mutual interference . mimo physical sectors formed using antennas from different radio groups enables the mimo physical sectors to overlap , be assigned different channels , and communicate simultaneously . mimo antennas of the same radio group use the same channel . interference between mimo physical sectors formed using antennas from the same group may be reduced by , for example , positioning the mimo physical sectors in such a way that they do not overlap and communicating using only one mimo physical sector from the same group at any one time . in another embodiment , referring to fig1 , each one antenna 34 - 48 has a physical sector with an angle of coverage of about 90 degrees . antennas are organized , as described above , to form four mimo antennas . antenna physical sectors are positioned such that the center of the angle of coverage for antennas pairs 34 and 36 , 38 and 40 , 42 and 44 , and 46 and 48 and their respective physical sectors are oriented at 45 , 135 , 225 , and 315 degrees respectively . channel c 1 is assigned to the first group radios and channel c 2 is assigned to the second group radios . the resulting four mimo physical sectors are positioned to not substantially overlap and adjacent mimo physical sectors are assigned a different channel . one mimo physical sector from the first radio group and one mimo physical sector from the second radio group may operate simultaneously . the antennas of wireless device 10 may be oriented to form mimo virtual sectors . mimo virtual sectors may have any angle of coverage and be oriented in any manner . a mimo virtual sector may be selected for communication to decrease interference . in one embodiment , referring to fig1 and 13 , antennas 34 - 38 and 42 - 46 have an angle of coverage of about 180 degrees . antennas 34 , 36 , 38 , 42 , 44 , 46 and the center of the angle of coverage of their respective physical sectors 58 , 60 , 62 , 66 , 68 , 70 are oriented at 90 , 150 , 210 , 270 , 300 , and 30 degrees respectively . the area between 0 and 60 degrees , marked as area 150 in fig1 , is covered by physical sectors 58 , 68 , and 70 . antennas 34 , 44 , and 46 may function together as a mimo antenna to transmit signals to and receive signals from any wireless device within area 150 . areas 152 , 154 , 156 , 158 , and 160 are respectively positioned between about 60 - 120 degrees , about 120 - 180 degrees , about 180 - 240 degrees , about 240 - 300 degrees , and about 300 - 0 degrees and are serviced respectively by antennas 34 , 36 , and 46 ; 34 , 36 and 38 ; 42 , 36 and 38 ; 42 , 44 and 38 ; and 42 , 44 and 46 . each one area 150 - 160 comprises a mimo virtual sector . in an exemplary embodiment , referring to fig1 and 13 , area 150 operates as a mimo physical sector by forming a mimo antenna using antennas 34 , 44 , and 46 . area 152 operates as a mimo physical sector by forming a mimo antenna using antennas 34 , 36 , and 46 , and so forth for areas 154 - 160 . in this embodiment , areas 158 and 160 may not be combined to operate as a mimo physical sector because area 158 requires antennas 42 , 44 , and 38 to form a mimo antenna while area 160 requires antennas 42 , 44 , and 46 to form a mimo antenna . because rf switch 30 selects only one antenna at a time , mimo physical sectors , for this embodiment , are limited to any combination of any one antenna associated with each rf switch . in this embodiment , wireless device 10 may select and communicate through any one mimo virtual sector at any given time . the method of selecting the mimo virtual sector consists of setting the rf switches to select the antennas that service the desired mimo virtual sector . in another embodiment , an rf switch with its associated antennas may be replaced by a phased array . antenna elements of each phased array may form mimo antennas . antennas may be oriented in any manner to form mimo virtual sectors of any size . in an exemplary embodiment , referring to fig1 , each mimo virtual sector 150 - 160 has an angle of coverage of about 60 degrees . in another embodiment , referring to fig1 , mimo virtual sectors 150 , 152 , 154 , 156 , 158 , and 160 lie between 0 - 30 degrees , 30 - 60 degrees , 60 - 180 degrees , 180 - 210 degrees , 210 - 240 degrees , and 240 - 0 degrees respectively . in another embodiment , referring to fig1 , each mimo virtual sector has an angle of coverage of about 40 degrees . mimo virtual sectors 150 - 166 lie between 0 - 40 degrees , 40 - 80 degrees , 80 - 120 degrees , 120 - 160 degrees , 160 - 200 degrees , 200 - 240 degrees , 240 - 280 degrees , 280 - 320 degrees , and 320 - 0 degrees respectively . in another embodiment , referring to fig1 and 18 , each mimo virtual sector has an angle of coverage of about 90 degrees . channel c 1 is assigned to the first group radios and channel c 2 is assigned to the second group radios . antenna pairs 34 and 36 , 38 and 40 , 42 and 44 , and 46 and 48 respectively form mimo antennas . mimo virtual sectors formed by antennas 34 , 36 and 42 , 44 extend from 0 - 180 and 180 - 0 degrees respectively and are assigned channel c 1 . mimo virtual sectors formed by antennas 38 , 40 and 46 , 48 extend from 90 - 270 and 270 - 90 degrees respectively and are assigned channel c 2 . the mimo virtual sectors are positioned to form areas 150 - 156 which each receive coverage from two mimo virtual sectors that operate on different channels . a wireless device may select and communicate through a mimo virtual sector to improve performance . a wireless device may use any criteria for selecting a mimo virtual sector for communication such as , for example , the presence of noise sources , noise source channels used , signal - to - strength ratio , direction of primary data flow , signal quality , signal strength , and data throughput . in one embodiment , referring to fig9 and 17 , wireless device 10 desires to communicate with wireless device 102 . wireless device 10 successively enables each antenna combination that forms each mimo virtual sector 150 - 160 . through each mimo virtual sector , wireless device 10 measures its ability to communicate with wireless device 102 . through at least mimo virtual sector 150 , wireless device 10 detects the presence of noise source 110 . through at least mimo virtual sectors 154 and 156 , wireless device 10 detects the presence of noise sources 106 and 108 respectively . while communicating with wireless device 102 , wireless device 10 may reduce interference from noise sources 106 and 108 by selecting and communicating through mimo virtual sector 150 . in the embodiment of wireless device 10 shown in fig1 and 17 , areas adjacent to the selected mimo virtual sector have at least one antenna in common , thus selecting a mimo virtual sector does not disable all communication in other sectors , but communication within the selected mimo virtual sector may provide increased performance than adjacent areas because it transmits and / or receives using all the antennas that form the mimo antenna . referring still to fig1 and 17 , wireless device 10 may reduce interference from noise source 110 by selecting a channel that is different from the channel used by noise source 110 . in the event that wireless device 102 cannot switch to a channel that is not used by noise source 110 , communication with wireless device 102 may proceed using mimo virtual sector 150 if it provides a desired level of performance . a wireless device may select any mimo virtual sector that provides a desired level of performance . in this embodiment , wireless device 10 may select mimo virtual sector 152 to communicate with wireless device 102 . wireless device 10 may detect less interference from noise source 110 through mimo virtual sector 152 than it detects through mimo virtual sector 150 , but wireless device 10 may also receive a less desirable signal from wireless cell 102 . in the event that wireless device 10 desires to communicate with wireless device 104 and noise sources 106 , 108 , and 110 all operate on the same channel as wireless device 104 , wireless cell 10 may reduce interference from the noise sources by selecting mimo virtual sector 160 for communicating with wireless device 104 . a wireless device may select and use any mimo virtual sector for any duration of time . a wireless device may switch from using one mimo virtual sector to using any other mimo virtual sector at any time and for any purpose . in an exemplary embodiment , referring to fig1 , wireless device 10 switches between mimo virtual sectors 150 and 160 to communicate with wireless devices 102 and 104 respectively . additionally , a wireless device may transmit through one mimo virtual sector and receive through a different mimo virtual sector . in another embodiment , referring to fig1 and 18 , wireless device 10 may select the mimo virtual sector that provides a desired level of communication for each area . additionally , wireless device 10 may communicate with two wireless devices 104 and 120 , both in area 156 , simultaneously on different channels ; for example , wireless device 104 communicates using channel c 1 while wireless device 120 communicates using channel c 2 . unless contrary to physical possibility , the inventor envisions the methods and systems described herein : ( i ) may be performed in any sequence and / or combination ; and ( ii ) the components of respective embodiments combined in any manner . this application incorporates by reference u . s . provisional application ser . no . 60 / 484 , 800 filed on jul . 3 , 2003 ; u . s . provisional application ser . no . 60 / 493 , 663 filed on aug . 8 , 2003 ; u . s . provisional application ser . no . 60 / 692 , 490 filed on jun . 21 , 2005 ; u . s . utility application ser . no . 10 / 869 , 201 filed on jun . 15 , 2004 and issued under u . s . pat . no . 7 , 302 , 278 ; and u . s . utility application ser . no . 10 / 880 , 387 filed on jun . 29 , 2004 and issued under u . s . pat . no . 7 , 359 , 675 , in their entirety for the teachings taught therein . the wireless cell can ask the advanced client to measure and report communication statistics such as , but not limited to , bit error rate , signal - to - noise ratio , dropped bits , signal strength , number of retransmission requests or any other environmental or communication parameter . each antenna and antenna controller functions independently of the other antennas and controllers . the antenna controller sets the beam width , beam azimuth , beam steering , gain of the antenna and any other parameter available on adjustable antennas . the antennas are also capable of high - speed switching . the controllable characteristics of the antenna are dynamically modifiable . the antenna beam can steer directly at one receiving client during transmission then pointed at a second client when transmission to the second client begins . the beam width of the antenna can be increased or decreased as necessary ; however , it is preferable to not increase the beam width to provide antenna coverage beyond the width of a sector . if the beam width is adjusted to provide coverage wider than a sector , the radio signal may interfere with adjacent or opposing sectors or wireless cells or detect clients not associated with the sector or wireless cell . the processor is responsible for tracking the antenna characteristics best suited to service each client in the sector covered by the antenna and to set the antenna controller to the parameters best suite for the particular client when communicating with the client . the use of an adjustable antenna , an antenna controller and a processor capable of controlling the antenna controller is not limited to the six - sector embodiment of a wireless network , but can also be used in a four - sector wireless cell or other wireless cell types . preferably , the beam width would not exceed the width of the sector of the wireless cell in which it is used . mimo antennas may use any combination of spatial , polarization , or angle antenna diversity . the mimo antenna array may be fixed or adaptive for either transmit , receive , or both . when receiving , the mimo antenna may use , for example , a maximum ratio combiner , an optimal linear combiner , selection diversity , or any combination of these methods or other methods for combining the signals from multiple antennas into a single signal . when transmitting , the mimo antenna may use any type of encoding including , for example , ofdm , space - time - codes , or weighting of the antenna signals in the array to accomplish beam steering . during transmission or reception , all or any subset of antennas in the mimo array may be used or selection diversity may be used to limit the number of antennas used . antenna diversity may be used in the transmit path , in the receive path , or in both transmit and receive paths . the signal from each antenna , transmitted or received , may or may not be weighted . servicing a physical sector with a mimo antenna means that all antennas in the mimo array use the channel assigned to the physical sector . signal attenuation may be added after each antenna , after the signal combiner , or in the signal processor that manipulates the incoming signals . although mimo antennas are arrays of antennas , any antenna array may be used as a single antenna or a mimo antenna may be used . for example , a directional antenna with about 120 - degree angle of coverage may be replaced by an antenna array that provides similar coverage . the array may be fixed or adaptive . adaptive arrays may use adaptive array weights to transmit directional beams within the angle and area of coverage to send a stronger signal to a desired client . during reception , an adaptive array may use array weights to direct a beam substantially towards the transmitting client and substantially null out any sources of interference . the processor , in exemplary embodiments , in addition to getting receive data from and sending transmit data to the radios , may also send instructions to control the radios such as , for example , instructing a radio to change channels or getting control information from the radios . in exemplary embodiments , the processor may also be capable of , for example , varying attenuation , controlling any or all rf switches , maintaining route tables , maintaining client specific information , and handing off mobile clients . in an exemplary embodiment , the processor may also control , for example , the attenuation or rf switches on a transmit or receive basis , a per client basis , a fixed period basis , and on a per demand basis . some embodiments may have a network connection that may enable the wireless cell to communicate with a wired network . some embodiments may have local storage to store , for example , transmit and receive date , relay data , video or audio data , environmental conditions data , and any other type of data required to service clients , function as a network , handoff or receive mobile clients , and forward information . when receiving , the mimo antenna may use , for example , a maximum ratio combiner , an optimal linear combiner , selection diversity , or any combination of these methods or other methods for combining the signals from multiple antennas into a single signal . assume for this example that the communication protocol uses packetized data and that the clients must transmit rts and await a cts before transmitting a single packet . it is possible to switch a client , or multiple clients , from a packet based communication protocol to a data stream protocol to increase the efficiency of long data transfers between clients . another aspect of the invention is the use of multiple directional antennas , at least one radio , at least one attenuator and other electronic devices such as rf switches , packet switches , antenna sharing devices and other electronic and electrical components to generate various embodiments of wireless cells and wireless networks with differing characteristics and capabilities . although there have been described preferred embodiments of this novel invention , many variations and modifications are possible and the embodiments described herein are not limited by the specific disclosure above , but rather should be limited only by the scope of the appended claims .	7
reference throughout this specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention . thus , the appearances of the phrases “ in one embodiment ” or “ in an embodiment ” in various places throughout this specification are not necessarily all referring to the same embodiment . furthermore , the particular features , structures , or characteristics may be combined in any suitable manner in one or more embodiments . same elements have been designated with same references in the different drawings . for clarity , only those elements and those method operations which are necessary to the understanding of the present invention have been shown in the drawings and will be described hereafter . in particular , the different calculations and processings upstream and downstream of the storages and of the reading of the range blocks have not been detailed and are no object of the present invention . further , the sequencing of the processings of loading and unloading of the range blocks depends on the application and is no object of the present invention either . fig3 very schematically shows the seven possible isometries in a fractal image coding for a range block 1 of four by four pixels . the choice of the number of 16 pixels for the range block is arbitrary . the present invention applies whatever the number of pixels of the range blocks , provided that the blocks are square . in particular , most often , these blocks are blocks of eight by eight pixels , their size depending on the size of the obtained sub - sampled blocks ( dbi , fig2 ). reference block 1 is taken arbitrarily as the identity block , that is , in the case where pixels p 1 to p 16 of range block 1 correspond in values and arrangements to the pixels of the domain block being compared . in fig3 , the pixels of the range block have been numbered as p 1 to p 16 and arranged line by line from left to right from the bottom of the block in the position of the drawing . a first isometry 2 corresponds to a symmetry with respect to vertical axis y centered in the middle of the range block . if a domain block corresponds to the arrangement shown in isometry 2 of fig3 , it will be considered that it is possible to transmit it in the form of the number of range block 1 , associated with the parameter defining the isometry of vertical axis . a second isometry 3 corresponds to a symmetry with respect to horizontal axis x centered in the middle of the reference image . a third isometry 4 corresponds to a symmetry of axis y = x . this amounts to a symmetry with respect to diagonal d xy . a fourth isometry 5 corresponds to a 180 ° rotation of the range block . a seventh isometry 8 corresponds to a symmetry of axis y =− x , that is , a reflection with respect to diagonal d − xy . a feature of an embodiment of the present invention is to only use four memory areas having a size corresponding to the size of the range block to store all the isometries necessary to the comparison . another feature of an embodiment of the present invention is to provide a reading of the isometries in reverse directions so that each memory area actually contains two isometries of the range block . fig4 illustrates , in a simplified view to be compared to that of fig3 , four memory areas m 1 , m 2 , m 3 , and m 4 storing range block 1 shown in fig3 and its isometries . according to an embodiment of the present invention , a first memory area m 1 contains arrangements 1 and 3 , that is , the identity and the symmetry with respect to the horizontal axis . a second memory area m 2 contains isometries 2 and 4 , that is , the symmetry with respect to the vertical axis and the 180 ° rotation . a third memory area m 3 contains isometries 5 and 6 , that is , the symmetry of axis y = x and the 270 ° rotation . a fourth memory area m 4 contains isometries 7 and 8 , that is , the 90 ° rotation and the symmetry of axis y =− x . as appears from fig4 , to obtain the different isometries , it is enough to organize the reading from the corresponding memory area , once from top to bottom , then , from bottom to top . such a reading is easily implementable by means of a memory addressing circuit 10 , parameterized according to the type of isometry with which the current domain block is desired to be compared . an advantage of the present invention is that it divides by two the memory space necessary for the storage of the range blocks and of their respective isometries . another advantage of the present invention is that it results in no complexity of the memory selectors . the only counterpart is a read - adapted programming of memory areas m 1 to m 4 containing the range block isometries . of course , the present invention is likely to have various alterations , modifications , and improvements which will readily occur to those skilled in the art . in particular , although an embodiment of the present invention has been described in reference to isometries of range blocks of 4 × 4 pixels , it applies to any square range block and its isometries . further , the present invention more generally applies to any image processing method requiring storage of image block isometries , similar to those used in a fractal compression . moreover , the practical implementation of the circuits necessary to the implementation of the present invention and the control signals of addressing of the different memory areas are within the abilities of those skilled in the art based on the function indications given hereabove . such alterations , modifications , and improvements are intended to be part of this disclosure , and are intended to be within the spirit and the scope of the present invention . accordingly , the foregoing description is by way of example only and is not intended to be limiting . the present invention is limited only as defined in the following claims and the equivalents thereto . all of the above u . s . patents , u . s . patent application publications , u . s . patent applications , foreign patents , foreign patent applications and non - patent publications referred to in this specification and / or listed in the application data sheet , are incorporated herein by reference , in their entirety .	6
referring to fig1 to 3 , one embodiment of a battery latching device 60 ( fig3 ) used in a portable electronic device 100 such as a mobile phone , includes a first housing 10 , a second housing 20 mounted to the first housing 10 , a battery 30 receivable in the first housing 10 , a stopping member 40 secured to the first housing 10 , and a sealing member 50 rotationally latched to the first housing 10 . the stopping member 40 is substantially a sheet member , and includes a body section 42 , two hook - shaped retaining sections 44 extending from opposite ends of the body section 42 , and a guiding section 46 perpendicularly extending from the middle of the body section 42 . the body section 42 is elastic and substantially arched . the retaining sections 44 are elastic and located on one side of the body section 42 . the guiding section 46 is substantially arched and bent toward the body section 42 . the sealing member 50 includes a rectangular base 52 , a mating portion 54 extending from one side of the base 52 , a pivot portion 56 located at the side of the base 52 with the mating portion 54 . the mating portion 54 is a hollow frame and has a plurality of resisting members 542 protruding from an outer side . the resisting members 542 are located away from the base 52 and configured for latching the sealing member 50 to the first housing 10 . the pivot portion 56 is a column protruding from the base 52 and adjacent to the mating portion 54 . the pivot portion 56 has a circular flange 562 around a peripheral wall thereof . the circular flange 562 is located apart from the base 52 and used for latching the pivot portion 56 to the first housing 10 . the first housing 10 includes a bottom wall 12 and sidewalls connecting with the bottom wall 12 . the sidewalls include a first sidewall 14 , a second sidewall 16 located opposite to the first sidewall 14 , and a third sidewall 18 perpendicularly connects the first sidewall 14 with the second sidewall 16 . the bottom wall 12 has two latching portions 122 protruding outwards and parallel to the first sidewall 14 . one of the latching portions 122 is adjacent to the first sidewall 14 , and another latching portion 122 is adjacent to the second sidewall 16 . each latching portion 122 is l - shaped and includes a rectangular first sheet 1222 and a rectangular second sheet 1224 . the first sheet 1222 extends perpendicularly from the bottom wall 12 . the second sheet 1224 extends perpendicularly from a distal end of the first sheet 1222 towards the center of the first housing 10 , thus , a receiving space 124 is enclosed by the first sheet 1222 , the second sheet 1224 , and the bottom wall 12 of the housing 10 . the receiving space 124 is configured for receiving the battery 30 . the bottom wall 12 has a plurality of projection sliders 126 formed between the latching portions 122 . the projection sliders 126 are parallel with the latching portions 122 . the function of the projection sliders 126 is as follows : when the battery 30 is received in the receiving space 124 , the bottom wall of the battery 30 can contact with the projection sliders 126 to prevent bottom wall of the battery 30 from directly contacting the bottom wall 12 of the first housing 10 , so as to decrease frictional area of the battery 30 thus , decreasing friction force acted on the battery 30 , and further facilitate detaching the battery 30 from the receiving space 124 . the bottom wall 12 has a resisting portion 128 protruding parallel to the third sidewall 18 . the resisting portion 128 is opposite to the third sidewall 18 , i . e ., the third sidewall 18 is located adjacent to one end of latching portion 122 , and the resisting portion 128 is positioned adjacent to another end of the latching portion 122 . the resisting portion 128 has an electric connector 1282 mounted for electrically connecting to the battery 30 when the battery 30 is resisting the resisting portion 128 . the bottom wall 12 has two brackets 129 protruding therefrom and positioned between the third sidewall 18 and the latching portions 122 . each block 129 has a retaining groove 1292 defined in one side of the block facing another block 129 . the retaining sections 44 of the stopping member 40 are fixed in the retaining grooves 1292 to assemble the stopping member 40 to the first housing 10 . the bottom wall 12 defines a slot 130 between the two brackets 129 . the slot 130 corresponds to and configured for receiving the guiding section 46 . the third sidewall 18 defines an opening 182 and a hole 184 , and the opening 182 is adjacent to the hole 184 . the opening 182 corresponds to the mating portion 54 of the sealing member 50 , and has the same size and shape as the mating portion 54 . the opening 182 is configured for accommodating the mating portion 54 . the hole 184 corresponds to the pivot portion 56 of the sealing member 50 , and has the same size and shape as the pivot portion 56 . referring to fig1 to 3 , to assemble the portable electronic device 100 , firstly , the stopping member 40 is bent to shortened its length , and thereby , accumulating an elastic force . then , the stopping member 40 is inserted between the two brackets 129 of the first housing 10 , and the retaining sections 44 of the stopping member 40 are aligned with the retaining grooves 1292 of the brackets 129 . after that , the bending of the stopping member 40 is released / stopped such that the stopping member 40 stretches outwardly under the accumulated elastic force until the retaining sections 44 are fully accommodated into the retaining grooves 1292 correspondingly . at this time , the guiding section 46 is located over and bent toward the slot 130 of the first housing 10 , the retaining sections 44 are compressed in the retaining grooves 1292 , i . e ., the retaining sections 44 tend to straighten and tightly secure the stopping member 40 to the first housing 10 . then , the mating portion 54 of the sealing member 50 is aligned with the opening 182 of the first housing 10 with the pivot portion 56 of the sealing member 50 is aligned with the hole 184 of the first housing 10 . the sealing member 50 is pressed into the first housing 10 to snap the mating portion 54 in the opening 182 and latch the pivot portion 56 in the hole 184 . at this stage , as the mating portion 54 gradually enter into the opening 182 , the side wall of the opening 182 pushes the resisting members 542 so that the mating portion 54 is bent toward the center until the resisting members 542 pass through the opening 182 . once the resisting members 542 passes through the opening 182 , the mating portion 54 restores to a normal state , as a result , the securing portion 542 restricts against the inner wall of the third sidewall 18 to prevent the mating portion 54 from disengaging from the first housing 10 . because the pivot portion 56 has the same size and shape as the hole 184 , and the pivot portion 56 has the circular flange 562 surrounding the peripheral wall thereof , the circular flange 562 has the same shape as the hole 184 with a larger size than the hole 184 . thus , the sealing member 50 becomes slidably restricted between the circular flange 562 and the base 52 of the sealing member 50 once the circular flange 562 is squeezed through the hole 184 , as a result that the pivot portion 56 is stably latched in the hole 184 . then , the second housing 20 is mounted on the first housing 10 to form the portable electronic device 100 . referring to fig4 and 6 , to insert the battery 30 into the first housing 10 , firstly , the mating portion 54 is pulled away from the opening 182 until the securing portion 542 is freed from the first housing 10 . then , the sealing member 50 is rotated about the pivot portion 56 until the opening 182 is fully exposed . after that , the battery 30 is aligned with the opening 182 . then , the battery 30 is pushed into the opening 182 . at this time , the battery 30 moves along the guiding section 46 and pushes the guiding section 46 into the slot 130 , as a result , the body section 42 of the stopping member 40 is bent towards the bottom wall 12 of the first housing 10 , and the battery 30 can slide through the opening 182 into the receiving space 124 of the latching portion 122 . once the battery 30 is slid pass the stopping member 40 , the stopping member 40 restores to an original state , and the battery 30 is fully received in the receiving space 124 . at this time , the opposite ends of the battery 30 is limited between the resisting portion 128 and the stopping member 40 , and the opposite sides of the battery 30 is limited between the latching portions 122 . thus the battery 30 is stably secured in the first housing 10 by the battery latching device 60 composed of the first housing 10 , the resisting portion 128 , the stopping member 40 and the latching portions 122 . finally , the sealing member 50 is reversely rotated about the pivot portion 56 until the mating portion 54 is aligned with the opening 182 again , then push the sealing member 50 to make the mating portion 54 accommodated in the opening 182 , at this time , the resisting members 542 resist against the first housing 10 again . when detaching the battery 30 from the first housing 10 , firstly , the mating portion 54 is pulled away from the opening 182 until the resisting engagement between the securing portion 542 and the first housing 10 is released . then , the sealing member 50 is rotated about the pivot portion 56 until the opening 182 is exposed . the stopping member 40 is pressed toward the bottom wall 12 of the first housing 10 , e . g ., the stopping member 40 is leveled with the projection sliders 126 . at this time , the battery 30 is freed to slide out of the opening 182 . it is to be understood , however , that even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and function of the invention , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .	7
the milkweed oil starting material for use herein may be any milkweed seedmeal pressing or refined fraction thereof . though the current primary source of milkweed oil is seed from the common milkweed ( asclepias syriaca l . ), oil from other species of milkweed having a similar fatty acid profile ( high in linoleic acid ) could also be used . the sunscreen compounds of the invention are produced by derivatizing the milkweed oil with a cinnamic acid selected from the group of ferulic , coumaric , sinapic , and o - methylsinapic acids to form esters at or near the sites of unsaturation . these acids are illustrated by formula i , below . esterification is conducted through an epoxy intermediate formed by epoxidizing one or more of the olefinic groups ( sites of unsaturation ) present in the acyl substituents ( fatty acid side chains ) of the milkweed triglyceride . the milkweed oil fatty acid profile as reported by natural fibers corporation ( www . buymilkweed . com / oil profile . htm ) is reproduced in table i , below . a total of 42 % of the fatty acids are monounsaturated , 47 % are diunsaturated ( predominantly linoleic acid ), and the level of triunsaturated fatty acids ( linolenic ) is minimal . this fatty acid profile offers a platform for unique distribution of the cinnamic acid functionality . in a preferred embodiment of the invention , all , or nearly all , the available sites of unsaturation are derivatized with two cinnamate moieties per original site of unsaturation . however , if desired , the stoichiometry of the reactants or conditions of reaction ( as described below ), may be selected for achieving only partial derivatization . epoxidation may be carried out as described by qureshi et al . [ polymer science and technology , vol . 17 , plenum press , p . 250 ] or by any other method as known in the art . for example , the epoxidation may be carried out by reaction of the milkweed oil with formic acid and hydrogen peroxide at an elevated temperature on the order of 75 ° c . the degree of epoxidation should be such that there is at least 2 , and preferably at 3 , or even 4 , oxirane rings per triglyceride molecule . typically , the epoxidation is carried to completion . conversion of the oxirane rings of the epoxidized oil to hydroxy substituents is readily conducted in the presence of a strong acid , such as hcl , hno 3 , h 2 so 4 , etc . at a temperature ranging from about 50 ° c . to about 200 ° c . esterification of hydroxy or epoxy fatty acid moieties with the cinnamic acid is optimally conducted in the absence of oxygen at a temperature ranging from about 150 ° c . to about 250 ° c . for a period of time ranging from about 12 to 72 hours . alternatively , esterification of hydroxy or epoxy fatty acid moieties may be carried out with the use of acid catalyst such as zncl 2 , p - toluenesulfonic acid , tin ( ii ) 2 - ethylhexanoate , tin octanoate , tin chloride and bf 3 in toluene , tetrahydroxyfuran , dimethylformamide or another suitable solvent for the reactants at a temperature in the range of about 80 ° c . to about 150 ° c . for a period of time ranging from about 1 to 3 hours . scheme 1 , illustrated below , shows the esterification of milkweed oil with ferulic acid via the epoxide and hydroxyl derivatives to produce the ferulyl - milkweed oil ester . formic acid in the presence of peroxide is reacted with the unsaturated triglyceride at a temperature on the order of 75 ° c . the epoxide may then be directly esterified with ferulic acid in the presence of zncl 2 at 110 ° c . alternatively , each oxirane ring is opened by means of a strong acid catalyst to yield a dihydroxy intermediate , and then reacted with ferulic acid using zncl 2 or other acid catalyst ( as described above ) to yield the ferulated milkweed ester . the milkweed oil cinnamate esters of this invention , having at least 4 , preferably at least 6 , and more preferably at least 8 cinnamate moieties per triglyceride molecule , are characterized by the water - insoluble properties of a lipid that resists being washed off in water . the uv absorbance of these products extends from about 280 nm to about 350 nm , and they are particularly effective in absorbing uv in the range of about 310 to about 350 nm . this is predominantly in the uva range , but also covers part of the uvb range . for additional uvb protection , the subject compounds may be formulated with other sunscreen agents as discussed , below . the sunscreen agents of the invention may be formulated into any cosmetic preparations that are especially designed to be water - resistant . the total level of sunscreen agent in these preparations will typically be on the order of about 0 . 1 to 20 %, by weight , and preferably within the range of about 1 to about 15 %, by weight . the amount of sunscreen agent currently approved in the united states for inclusion in a topical skin treatment formulation is 15 % by weight . it is contemplated that the agents of this invention will be incorporated into formulations that are both effective and safe . an effective amount ( or photoprotective amount ) is that amount which is sufficient to significantly induce a positive effect of protection against uv sunlight as compared to a control . one measure of the effectiveness of the sunscreen agent is the sun protection factor ( spf ) of the composition . spf is a commonly - used measure of photoprotection of a sunscreen against sunburn . the spf is defined as the ratio of the uv energy required to produce minimal erythema on protected skin to that required to produce the same minimal erythema on unprotected skin in the same individual ( see federal register , 43 , no . 166 , pp . 38206 - 38269 , aug . 25 , 1978 ). a safe amount is that which does not produce serious side effects . the cosmetic preparations according to the invention can be formulated as a lotion , cream , gel , stick or aerosol . the base of the formulation may be a water - in - oil emulsion , an oil - in - water emulsion , an oil - in - oil alcohol lotion , a vesicular dispersion , or as an emulsifier - free starch / lipid dispersions as described in u . s . pat . nos . 5 , 676 , 994 and 5 , 882 , 713 , both herein incorporated by reference . the term “ oil ” is used herein to be inclusive of all lipids . the term “ lipid ” ( or fat ) is a comprehensive term referring to substances which are found in living cells and which are comprised of only a non polar hydrocarbon moiety or a hydrocarbon moiety with polar functional groups ( see the encyclopedia of chemistry , 3rd edition , c . a . hampel and g . g . hawley , eds ., 1973 , p . 632 , herein incorporated by reference ). most lipids are insoluble in water and are soluble in fat solvents such as ether and chloroform . commonly used oils for cosmetic formulations include coconut oil , silicone oil and jojoba oil . other components that may be included in the sunscreen formulations of the invention include : other uva and uvb sunscreen agents , such as 2 - phenyl - benzimidazole - 5 - sulfonic acid , tea salicylate , octyl dimethyl paba , padimate - o ( 2 - ethylhexyl 4 -( dimethylamino ) benzoate ) and octyl methyl cinnamate ; inorganic physical sunblocks , such as zinc oxide and tio 2 ; artificial tanning agents ; abrasives ; absorbents ; fragrances ; pigments ; colorings / colorants ; essential oils ; skin sensates ; astringents carriers and vehicles ; thickening / structuring agents ; emollients ; emulsion stabilizers ; excipients and auxiliaries commonly incorporated into cosmetic formulations ; humectants ; moisturizers ; skin conditioners ; anti - caking agents ; antifoaming agents ; antimicrobial agents ; antioxidants ; binders ; buffering agents ; bulking agents ; chelating agents ; chemical additives ; film formers ; humectants ; opacifying agents ; skin - conditioning agents ; vitamins ; and the like . suitable emulsifiers include any of those conventionally used for cosmetic formulations , including for example , ethoxylated esters of natural derivatives , such as polyethoxylated esters of hydrogenated castor oil , a silicone oil emulsifier such as silicone polyol , free or ethoxylated fatty acid soap , an ethoxylated fatty alcohol , a free or ethoxylated sorbitan ester , an ethoxylated fatty acid or an ethoxylated glyceride . exemplary agents and additives that could be included in formulations comprising the sunscreen agents of the invention , as well as suggested levels of addition , are given in u . s . pat . no . 5 , 989 , 528 ( tanner et al . ), which is herein incorporated by reference . as previously indicated , the compositions of the invention are useful as sunscreen agents to provide protection from adverse effects of uv radiation . the principal application is as a topical sunburn protectant for human skin . however , it is envisioned that the compositions and formulations of the invention would also have veterinary applications as a skin protectant . the sunscreen formulations contemplated herein may be applied to the skin by spreading or spraying a thin layer thereof over the skin surface intended to be protected . it is envisioned that the compounds of this invention may also have certain industrial applications , such as a uv protectant for epoxies , paints , and other consumer products . for these applications , the compounds could either be formulated into the material to be protected , such as by blending into a paint , or they could be applied as a separate coating . the following example is intended to further illustrate the invention , without any intent for the invention to be limited to the specific embodiments described therein . in a typical process , refined milkweed oil 582 . 0 g ( 673 . 76 mmol , iodine value , iv = 111 . 4 ) was placed in a 1 l 3 - necked jacketed flask equipped with a mechanical stirrer and heated to 45 . 5 ° c . formic acid ( 96 %, 39 . 7 g , 0 . 3 equiv ./ mol of c ═ c ) was added and the mixture stirred to homogeneity . hydrogen peroxide ( 50 %, 320 ml , 6 . 74 mol ) was added slowly ( i . e . drop wise ). at the end of hydrogen peroxide addition , the temperature was raised to 70 ° c . and vigorous stirring was continued for 7 hours . the heat source was then removed , the reaction mixture allowed to cool and transferred to a separatory funnel with ethyl acetate as diluent . the material was washed with saturated nacl ( 300 ml × 4 ) followed by saturated na 2 co 3 ( 35 ml ) in more nacl solution . when ph 7 . 5 was reached , the organic phase was then washed with deionized water . the wet organic layer was separated from a turbid aqueous phase and was concentrated at 60 ° c . in vacuo to remove the solvent and water . yield of epoxy triglyceride was 558 . 4 g ; the kinematic viscosities , measured were : η 40 ° c . = 1208 . 95 cs and η 100 ° c . = 81 . 3 cs , that is , a viscosity index of 18 . 79 cs /° c . pv = 9 . 4 , iv = 1 . 79 . specific rotation [ α ] d 20 =+ 0 . 17 ° ( 0 . 065 , ch 2 cl 2 ). an aqueous fraction ( 42 . 0 g ) was reclaimed from the final water - wash following concentration at 70 ° c ., thus giving a total yield of 600 . 6 g ( 97 %). in a 1 l jacketed flask as described above , reprocessed milkweed oil ( 648 . 0 g , 759 . 9 mmol ) was introduced . the oil was stirred vigorously at 40 ° c . and formic acid ( 90 . 4 %, 62 . 2 g , 1 . 22 mol ) was added in one portion followed with a slow ( drop wise ) addition of h 2 o 2 ( 50 %, 203 . 0 g , 2 . 98 mol ). at the end of peroxide addition , the temperature was increased to 70 ° c . after 15 h , the heat source was removed but stirring was continued , allowing the reaction mixture to cool to room temperature and the aqueous phase removed . deionized water ( 300 ml ) was added followed by 6 m hcl ( 100 ml ). the nearly colorless sludge was stirred at 70 ° c . overnight . the cream colored product was transferred into a separatory funnel using ethyl acetate as diluent . the aqueous layer was discarded and the organic phase washed sequentially with brine , saturated nahco 3 to ph 7 . 5 , and deionized water . ethanol was added to facilitate separation of the phases . after removal of the aqueous layer , the product was concentrated in vacuo at 70 ° c . to yield 711 . 6 g ( 94 . 7 %) of the polyhydroxyl triglyceride with an oxirane value = 1 . 35 ; iodine value = 14 compared to an iodine value of 114 in the starting milkweed oil . the measured kinematic viscosities were : η 40 ° c . = 2332 . 5 centistokes and η 100 ° c . = 75 . 53 centistokes , that is , a viscosity index of 37 . 62 centistokes /° c . specific rotation [ α ] d 20 =+ 0 . 37 °. milkweed polyhydroxytriglyceride 34 . 40 g ( 38 . 5 mmol ), glacial acetic acid ( 150 ml ), 4 - hydroxy - 3 - methoxycinnamic acid ( ferulic acid , 45 . 0 g , 231 . 7 mmol ), hcl ( 12 . 1 m , 4 . 5 ml ), ethyl acetate ( 250 ml ) were placed in a 1 l three - necked round bottomed flask equipped with a mechanical stirrer . the contents of the reaction flask were stirred and heated to gentle reflux . progress of the reaction was monitored by tlc ( hexanes / ethyl acetate : 1 : 1 v / v ) on precoated silica gel . after 36 h , the reaction mixture was allowed to cool to room temperature , diluted with more ethyl acetate and transferred into a separatory funnel . the solution was washed with deionized water ( 300 ml × 4 ) to remove most of the acetic acid . the organic phase was then washed with saturated disodium monohydrogen phosphate solution and deionized water until the washings were about ph 7 . the reddish tinged organic solution was dried ( na 2 so 4 ) and concentrated in vacuo to give a crude product , 64 . 0 g ( 81 %). the crude product was purified by volume liquid chromatographic ( vlc ) technique on silica gel with hexanes / ethyl acetate ( 1 : 1 ) as the eluting solvent . the desired fraction yield was 44 . 50 g ( 56 . 5 %) based on the hexaferuloyl ester . all references disclosed herein or relied upon in whole or in part in the description of the invention are incorporated by reference .	0
hereinafter , exemplary embodiments of the present invention will be described in detail with reference to the accompanying drawings . it is to be noted that in giving reference numerals to components of each of the accompanying drawing , like reference numerals refer to like elements even though the like components are shown in different drawings . further , in describing exemplary embodiments of the present invention , well - known functions or constructions will not be described in detail since they may unnecessarily obscure the understanding of the present invention . further , exemplary embodiments of the present invention are described below , but may be variously modified and practiced by those skilled in the art without departing from the technical spirit of the present invention . according to an exemplary embodiment of the present invention , in order for a user to login in a web service , the user stores all the used ids and passwords in a device ( for example , mobile phone ) which is always carried by him / her and the corresponding device performs an authentication process , such that the user does not require to memorize his / her id and password . conditions required by the device storing the id and password are as follows . { circle around ( 2 )} the device should have computing capability . ( the device should be able to perform an encoding operation ). { circle around ( 3 )} the device should be able to be accessed through the internet . { circle around ( 4 )} the device should be always carried by a user . a representative device satisfying all the conditions described above is a smart phone . a level of the camera is enough to analyze a two - dimensional barcode ( or , two - dimensional code ) such as qr code . in the computing capability , an encoding and decoding operation should be able to be performed . an encoding technology used herein needs to use a public key scheme , and therefore the computing capability enough to perform rsa or dsa within a short period of time is required and the internet access should be able to be made . according to the scheme proposed by the present invention , since an authentication device may directly access an authentication server of a web site , when the authentication device may not be connected to the internet , user authentication may not be made . for the user authentication of a web service , a user needs to create his / her own account in a service and after the account is created , the user authentication is made through a login procedure and the user may receive a personalized service . an account creation method and a login method will be sequentially described below . fig1 is a diagram sequentially illustrating a procedure of creating an account when a user wants to join a web site and fig2 is a diagram illustrating a message exchange procedure between a user and a web service at the time of creating an account . the account creation method will be described in detail below with reference to fig1 and 2 . first , when a user wants to join any web service , a web service provides a joining form to a user ( s 101 ). next , when the user prepares all forms in addition to his / her own id , the web service needs to confirm an authentication device carried by the user so that the user may perform a login through the authentication device later . that is , an operation to bind the user with the authentication device is required . therefore , the web service transmits a bit string to the user to confirm the authentication device . a method for transmitting a bit string may be diverse , but in the case of a smart phone , it is most convenient to use sms . when the sms may not be used ( for example , in the case of using a device such ipod touch ), any bit string is transmitted to a user through e - mail , and the like . in describing below the exemplary embodiment of the present invention , the bit string is marked by nonce1 ( s 102 ). next , the web service creates the two - dimensional barcode and shows the created barcode through a web browser . any two - dimensional barcode may be used , but the qr code is most generally used . the tow - dimensional barcode includes a url of the web service , a public key of the web service , and any new bit string different from the nonce1 . in describing below the exemplary embodiment of the present invention , the bit string is marked by nonce2 . as the public key of the web service , any public key algorithm within a range included in a gist of the present invention may be used . in describing below the present invention , the public key of the web service is marked by wpub ( s 103 ). next , the user uses information received from the two - dimensional barcode to confirm whether he / she joins the corresponding web site in advance ( that is , whether an account is created ). one user may be permitted to have a plurality of accounts depending on characteristics of the web service . in this case , it is preferable to go through a process of confirming whether a new account is additionally opened ( s 104 ). next , if it is confirmed that the user joins the corresponding web site in advance or wants to additionally open a new account , a warning message is shown to the user and an account creation process stops . on the other hand , if it is confirmed that the user does not previously hold an account or wants to additionally open a new account , the account creation process continuously proceeds . new confidential is configured of an id and a public key of a newly created key pair ( a public key and a secret key ). hereinafter , in describing the present invention , the public key and the secret key are marked by dpub and dpriv . of the created key pair , the public key may be reckoned to replace a password . a user id may be transmitted to the authentication device while being included in the qr code or the user may directly input the user id to the authentication device . a scheme for transmitting a user id to an authentication device while being included in the qr code may be convenient but may expose the user id and a scheme for directly inputting a user id may lower the exposure possibility of the user id but may make the user inconvenient . when the key pair creation is completed , the authentication device encodes the user id , the newly created public keys dpub , nonce1 , and nonce2 , and a signature for the nonce1 and nonce2 based on the public key wpub of the web service which is received beforehand . at the time of performing the signature , the newly created secret key dpriv is utilized . the encoded message is transmitted to the web service . at the time of transmitting the encoded message , url received through the qr code is utilized ( s 105 ). next , the web service resolves the message received from the authentication device of the user using his / her own secret key wpriv and confirms whether the signature is right . the user has two accesses to the web service , in which one is an access using a computer at an early stage and the other is an access transmitting the encoded confidential using the authentication device . the web service should be able to find out whether the two accesses come from the same user . for this purpose , the nonce2 is used . since the authentication device copies and takes the nonce2 using a camera , the computer and the authentication device share the same nonce2 value ( s 106 ). next , the web service stores contents input by the user and the user public key dpub obtained by decoding in its own database to complete the account creation operation ( s 107 ). fig3 and 4 illustrate procedures of performing a login using the previously held account . a login method will be described in detail below with reference to fig3 and 4 . first , when the user accesses the web service through the web browser to request a login , the web service shows the qr code through the web browser . the qr code includes the url of the authentication server of the web service , the public key wpub of the web service , and any bit string . the nonce is newly created whenever the user requests a login and a timer is operated as soon as the login request of the user is received . a web server of the web site previously sets time as a time limit showing the qr code in the timer . for example , when the user sets the timer to perform the authentication within 60 seconds , the qr code is shown only for 60 seconds and is automatically hidden after the elapse of 60 seconds . the reason for setting the timer is to prevent the nonce value from being reused . after the qr code is hidden , when the user wants the authentication , he / she needs to again request the authentication . in this case , the nonce value is renewed . the web server of the web site knows what user wants a login , and therefore is subscribed in an authentication server to let the authentication server inform when the authentication is completed ( s 201 ). next , the user photographs the qr code on a web browser screen using the authentication device . when the authentication device is a smart phone , the authentication device drives a separate application ( hereinafter , app ) for authentication and photographs the qr code . the authentication device confirms the url included in the qr code to check whether the confidential is already present in the authentication device ( s 102 , s 103 ). next , if it is confirmed that the confidential is not stored , an error message is output ( that is , authentication failure ) ( s 214 ). on the other hand , if it is confirmed that the confidential is stored , an authentication token is created and then transmitted to the url included in the qr code . the authentication token includes the confidential ( that is , the user id and the public key dpub of the key pair created by the user ) and the nonce obtained from the qr code . further , the authentication token includes the signature for the nonce and the signature uses the secret key dpriv . when all the contents are encoded by using the public key wpub of the web server , the encoded contents become the authentication token ( s 204 ). next , when receiving the authentication token , the authentication server of the web service decodes the received authentication token and then confirms the signature to check whether a message is normal and if it is confirmed that the message is normal , the authentication server sees the confidential to determine whether the normal user attempts a login and if it is confirmed that the user is the normal user , informs the web server of the web service that the normal authentication is made . as described above , the web server of the web service is subscribed in the authentication server to receive the message for a set time and the authentication server responds thereto and thus the web server may perform the login processing on the corresponding user ( s 205 ). as described above , according to the exemplary embodiment of the present invention , the communication between the web server of the web service and the authentication server may use a message queue , but the present invention is not limited thereto and the communication between the web server of the web service and the authentication server may use any method within a range included in the gist of the present invention . when the authentication server of the web service confirms the confidential , the size of the public key is much larger than that of the password at the time of confirming whether the public key agrees and therefore a cost increase is expected , but the authentication server calculates and stores hash values ( digests ) for the public key at the time of the account creation , and then uses the hash values at the time of confirming whether the public key agree to minimize the costs , such that it may be appreciated that the problem of cost increase may not occur . as described above , according to the exemplary embodiments of the present invention , it is possible to perform the user authentication only by holding the camera on the web browser screen when the dedicated device is present and improve the user convenience by driving applications which may be authenticated and then performing only the photographing even in the case of using a smart phone . in the case of a handicapped person who is difficult to perform the input through the keyboard , convenience may be more increased . according to the exemplary embodiments of the present invention , it is possible to effectively cope with the brute force attack or the premeditated attack by using an encryption key instead of using the password . the existing 8 to 12 digit password which is combined only by alphabet and figures requires the attack attempts a maximum of 62 8 (≈ 2 47 ) to 62 12 (≠ 2 71 ) times , but according to the exemplary embodiment of the present invention , the encryption key usually uses 512 bits , 1024 bits , and 2048 bits , and therefore at the time of the brute force attack search , the attack attempts are required a maximum of 2 512 , 2 1024 , and 2 2048 times , such that the present invention may provide the high security strength . according to the exemplary embodiments of the present invention , the secret key essential for authentication is not stored in the authentication server , and therefore even though the specific web service is hacked to expose all the contents of database included in the authentication server , it is possible to prevent the login from being made in the user name . according to the exemplary embodiments of the present invention , different confidential for each web service is used , and therefore even though the specific web service is exposed to hacking , no account of other services is damaged , each web service uses different keys at all times and thus security may be secured , and the user does not require to memorize even his / her own id and thus the user id may be differently set for each web service , such that even though several web services maliciously gain agreement , it is difficult to find out a correlation between users . according to the exemplary embodiments of the present invention , the user never directly inputs contents at the time of a login , and therefore the contents are safe from a keylogger ( keyboard hacking ). according to the exemplary embodiments of the present invention , since all the security related information is stored in the smart phone of the user and the smart phone directly communicates with the web server , even when the stability of the used pc is not secured ( for example , shared computer of a pc room , and the like ), security may be secured . meanwhile , the embodiments according to the present invention may be implemented in the form of program instructions that can be executed by computers , and may be recorded in computer readable media . the computer readable media may include program instructions , a data file , a data structure , or a combination thereof . by way of example , and not limitation , computer readable media may comprise computer storage media and communication media . computer storage media includes both volatile and nonvolatile , removable and non - removable media implemented in any method or technology for storage of information such as computer readable instructions , data structures , program modules or other data . computer storage media includes , but is not limited to , ram , rom , eeprom , flash memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical disk storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium which can be used to store the desired information and which can accessed by computer . communication media typically embodies computer readable instructions , data structures , program modules or other data in a modulated data signal such as a carrier wave or other transport mechanism and includes any information delivery media . the term “ modulated data signal ” means a signal that has one or more of its characteristics set or changed in such a manner as to encode information in the signal . by way of example , and not limitation , communication media includes wired media such as a wired network or direct - wired connection , and wireless media such as acoustic , rf , infrared and other wireless media . combinations of any of the above should also be included within the scope of computer readable media . as described above , the exemplary embodiments have been described and illustrated in the drawings and the specification . the exemplary embodiments were chosen and described in order to explain certain principles of the invention and their practical application , to thereby enable others skilled in the art to make and utilize various exemplary embodiments of the present invention , as well as various alternatives and modifications thereof . as is evident from the foregoing description , certain aspects of the present invention are not limited by the particular details of the examples illustrated herein , and it is therefore contemplated that other modifications and applications , or equivalents thereof , will occur to those skilled in the art . many changes , modifications , variations and other uses and applications of the present construction will , however , become apparent to those skilled in the art after considering the specification and the accompanying drawings . all such changes , modifications , variations and other uses and applications which do not depart from the spirit and scope of the invention are deemed to be covered by the invention which is limited only by the claims which follow .	7
the aim the invention is to connect the exchange 1 to another exchange 6 of the same type when the link 7 for connecting the two exchanges is of a different type and operates in accordance with a protocol other than that of the isdn standard . in the example shown in fig1 , the link 7 uses an internet protocol conforming to the udp - ip standard . more generally , the link includes channels ( not shown ) for transmitting the message content parts 5 and a channel to the udp - ip standard for transmitting the signaling parts 4 relating to the message content parts 5 . the invention converts the signaling information 4 , which consists of data in the format of the isdn standard , into a signaling message 8 in a format accepted by the channel 7 to the other standard . for example , signaling messages 4 , 41 , 42 and 43 can be encapsulated in udp - ip packets 9 to 12 . the packets 9 to 12 are encapsulated by control bits conforming to the udp - ip standard . under the udp - ip standard , one message is inserted into each udp - ip packet . there cannot be more than one signaling message in a udp - ip packet . moreover , a signaling message is not divided into several parts . according to the invention , the messages 8 encapsulated in this way are sent on the channel 7 and received in the exchange 6 . in the exchange 6 the received messages 8 are converted into information of the signaling part 4 type conforming to the isdn standard which can then be processed in the exchange 6 to enable the units 2 and 3 to be connected to other units 13 and 14 ( possibly on another channel ). because the udp - ip protocol involves the risk of loss of packets , and most importantly the risk of the order of the packets 9 to 12 being reversed , an improvement to the invention modifies the message 8 formatted to the udp - ip standard by adding packet order information to it . in the structure of the message 8 , the construction of the successive data blocks ( blocks 9 to 12 ) is modified . packet order information is added to each block . the packet order information occupies one byte , for example , covering packet numbers from 0 to 255 . the packet number is then incorporated into the message 8 in a respective area 15 to 18 placed before or after each block 9 to 12 . the packet number forms an integral part of each send block ( i . e . each block to be sent ). in this case , in accordance with the invention , it is the send block consisting of a block 9 and its number 15 that must conform to the udp - ip standard . the successive send blocks are then sent to the other exchange 6 . the latter receives them and sends back to the exchange 1 an acknowledgment essentially representing the number of the last send block that has been received and corresponding to a continuous stream of send packets that have been received . in one example , this sending is affected by means of a circular memory 19 which has four locations for loading four send blocks , for example . thus send blocks 1 , 2 , 3 and 4 are loaded . the four send blocks are then sent in turn to the exchange 6 via the channel 7 . the memory 19 can be loaded as and when the blocks are sent . the exchange 6 may then , for example , depending on transmission conditions that apply , determine that it has received blocks 1 and 2 , that it has not received block 3 and that it has received block 4 . in this case , the exchange 6 sends an acknowledgment to the exchange 1 indicating the block number 2 ( n = 2 ). this means that the blocks have been received continuously up to block 2 . in this case the exchange 1 can load the circular memory 19 with subsequent blocks 5 and 6 instead of the blocks 1 and 2 already received . the content of the memory 19 will then consist of the blocks 3 , 4 , 5 and 6 . accordingly , when the exchange 1 loads the circular memory 19 with the blocks 5 and 6 , only these two blocks are sent . after block 6 is sent , it is necessary to send block 3 again if no acknowledgment citing a block number greater than or equal to 3 has been received after a time - out . a block is sent when it is present in the circular memory and the block already sent has not been acknowledged after a time - out . in this way the block 3 is sent , and possibly the block 4 . note that the block 4 can be sent a second time , even though it has already been received ( after it was sent the first time ), because the time - out can end before the acknowledgment for block 3 is received ( or even for block 6 , as both these blocks have been sent ). thus the circular memory 19 is loaded and blocks are sent as and when acknowledgments are received . if no acknowledgment is received after a given time - out all of the content of the circular memory is sent again . thus , if no other acknowledgment has been received since the acknowledgment citing block number 2 , blocks 3 , 4 , 5 and 6 can be sent a second time . it is also possible for block 3 , which has not previously been received in time , to reach the exchange 6 late , although by then the exchange has already received block 3 ( after it was sent the second time ). in this case , the block that was sent is merely received twice over . it is set aside and is not processed a second time . according to another improvement to the invention , the functionality of the channel 7 is tested continuously by sending surveillance messages 20 which simply take the form of a signaling block 1 that is sent at a period adopted for testing the functionality of the channel 7 . for example , it can be sent approximately every 15 seconds . if the acknowledgment 1 which concerns it is received , the channel is deemed to be functional . if not , after a particular number of attempts , the channel 7 is declared deficient and an alert procedure is undertaken . the same applies if an expected block n is never received . given that only one byte is used to convey the block order information , the number of a send block cannot be greater than 255 . this is not a problem because if the number of blocks is greater than 255 it is sufficient to start counting again from 0 when 255 is reached . in this case , the circular memory need only include a number of blocks significantly less than 256 . fig2 shows similar elements to fig1 , but for the qsig - gf protocol , which does not conform to the isdn standard either . the figure also shows the exchange 1 in a little more detail . the exchange includes a microprocessor 21 connected by a bus 22 to the units 2 – 3 , a qsig - gf format interface 23 and a program memory 24 containing in particular a program for formatting messages to the format conforming to the qsig - gf standard . the same applies to fig1 with regard to the udp - ip standard . the program 24 provides a particular mode of use including a call request procedure , a connection procedure , a procedure for sending free messages ( facility messages ) and a disconnection procedure . in accordance with the invention , the microprocessor 21 launches a working session of the interface 23 so that it calls the exchange 6 by setting up a call with no b channel , connects to it and remains connected to it . automatic disconnection time - outs are eliminated if necessary . the call set up with no b channel is set up via the d channel of the qsig - gf bundle . it is referred to as a support call . in accordance with the invention , facility messages are sent on the d channel by encapsulating the isdn signaling ( sapi s and sapi p messages ) in facility messages carried by the support call . facility messages are exchanged between the exchange 1 and the exchange 6 transparently . the transfer can continue for as long as the support call is active . in this mode , messages to be sent on the qsig - gf format channel must essentially include a header 25 . in practice , the header 25 occupies one byte . this first byte is a facility information element ( ei facility ). it contains four types of information . a first type of information advises the length of the facility message . the header also contains a protocol discriminator , references of the support call request and the message type . in fact , in this instance , the message type is always the facility type . an area 26 of the facility message following on from the header area 25 contains a header specific to the message . in a subsequent area 27 , the nature of the message ( sapi s or sapi p ) is indicated by a code corresponding to s or p . signaling messages 4 are sent in a subsequent free area 28 , and consist of the information previously referred to . if the resulting message conforming to the qsig - gf protocol is longer than the 128 bytes available in a normal facility message frame ( from which the headers and areas 26 and 27 must be deducted , incidentally ), the length indicated in the part 25 must include an indication that the facility message continues beyond the 128 bytes . in this case , the message includes a part 29 and a part 30 . the part 29 is identical to the part 26 . the part 30 is substituted for the indication relating to the nature of the message ( sapi s or sapi p ). however , it includes in practice an indicator of the order of the length extension ( the additional length over and above the normal length ). in this example , the part 30 could contain information a , then information b , and so on ; depending on the length of the signaling message to be transmitted , length information 25 is provided and markers a , b are inserted into the message . the signaling data to be transmitted in accordance with the invention comprises flow control data , security data and , essentially , message scheduling data . according to the invention , the information part 5 can be sent between the exchanges 1 and 6 via other channels , in a manner that is known or unknown . the units 2 and 3 can also be connected to the units 13 and 14 by udp - ip or qsig - gf channels . the channels , although of the same type as the channels used to transmit signaling , are nevertheless different . thus signaling and messages are not sent at the same time on the same channel .	7
for the purposes of promoting an understanding of the principles in accordance with the embodiments of the present invention , reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended . any alterations and further modifications of the inventive features illustrated herein , and any additional applications of the principles of the invention as illustrated herein , which would occur to one skilled in the relevant art and having possession of this disclosure , are to be considered within the scope of the invention claimed . initial reference is made to fig1 - 8 illustrating a clubhead and hosel arrangement generally referred to by reference numeral 100 . the clubhead 110 and hosel 120 are normally cast , but in limited circumstances may also be forged , from a suitable alloy such as any combination of aluminum , steel , beryllium , nickel , copper , titanium , or other metals in varying combinations . the clubhead 110 comprises a clubface 111 , club back 112 , toe 113 and heel 114 . while not shown , a first end 125 of the hosel 120 includes an opening for receipt of a golf club shaft 130 ( shown in dotted lines ). the shaft 130 is typically held in place with an adhesive like epoxy or similar substance . to accommodate the shaft 130 , the first end 125 and upper segment 135 of the hosel 120 have a circular cross - section and the upper segment 135 of the hosel 120 is in alignment with the corresponding received shaft 125 . the hosel 120 is termed a dog - leg hosel based on its configuration . the hosel 120 begins to diverge near a lower segment 140 thereof . the divergence extends the hosel 120 in a rearward direction or in a direction of a golfer &# 39 ; s backswing . along with the divergence , the cross - section of the hosel 120 transforms from circular to elliptical . the elliptical cross - section of the hosel 120 near the clubface 111 is flattened such that a lower hosel surface 145 is elevated out of the way of the clubface 111 . fig9 shows a cross - sectional view along a in fig1 of the lower segment 140 of the hosel 120 showing flattened surface 145 on a clubface 111 side of the club . now referring to fig5 , each club in a set ( e . g ., 1 - iron , 2 - iron , 3 - iron , 4 - iron , 5 - iron , 6 - iron , 7 - iron , 8 - iron , 9 - iron , wedge and pitching wedge ) has a cavity 115 with a different such that each club &# 39 ; s weight distribution is different . the cavity 115 of each club is designed according to the hosel 120 position and orientation for the subject club . in so doing , a club &# 39 ; s center of gravity is positioned optimally for player performance . the hosel 120 becomes integral with the clubhead 110 at an elevated point near the golf club heel 114 . the divergence of the hosel 120 provides for an unobstructed clubhead face 111 to prevent shanks . that is , more surface area of the clubface 111 is available to hit the golf ball and the hosel 120 is out of the way of the striking surface of the clubface 111 . in addition , by integrating the hosel 120 at an elevated point on the clubhead 110 , swing energy is transferred to a position at the rear of the clubhead 110 . with conventional clubs , swing energy is transferred to the leading edge where the hosel joins the clubhead . consequently , the swing energy transferred with the present clubs provides a player with additional golf ball travel distance in response to the same swing magnitude . accordingly , a player does not feel the desire to over swing . now referring to fig1 b , a chart 200 details two measurements ( a ) 210 and ( b ) 220 in millimeters and an angle ( c ) 230 in degrees ( as identified in fig1 a ) for an exemplary set of irons ( i . e ., 4 iron through pitching wedge ) 240 in accordance with the embodiments of the present invention . the chart 200 shows that ( a ) 210 and ( b ) 220 have an inverse relationship . that is , as ( a ) 210 increases from the 4 iron to the pitching wedge , ( b ) 220 decreases . angle ( c ) 230 decreases from the 4 iron to the pitching wedge . consequently , a width of the sole of the club increases from 4 iron to pw . fig1 a shows a chart 300 detailing iron dimensions , including an offset 310 , for an exemplary set of irons ( i . e ., 4 iron through pitching wedge ). the offset 310 , as shown in fig1 b , is measured from a leading edge 320 of the hosel 120 and a leading edge 330 of the clubface 111 . a positive offset 310 signifies that the leading edge 320 of the hosel 120 is ahead of the leading edge 330 of the clubface 111 while a negative offset signifies that the leading edge 320 of the hosel 120 is behind the leading edge 330 of the clubface 111 . the offset hosel 120 of the present clubs helps players maintain their hands in the proper position through the hitting zone , including at time of impact . hand position is a significant problem faced by all golfers . the offset hosel 120 of the embodiments of the present invention keeps a player &# 39 ; s hands in a forward position thus causing the player to release and square up their hand position as their swing progresses through the hitting zone . the additional useful surface area of the clubface 111 and the proper hand position not only reduces shanks , it also , through repetition , teaches a player a more consistent and proper swing . also , the hosel 120 orientation further brings the energy of the clubhead 110 to a center - point on the clubface 111 rather than conventional clubs which , based on their hosel orientation , direct energy closer to a toe than the heel . as disclosed above , the back side of the clubs of the embodiments of the present invention include cavities 115 for distributing weight differently to fully utilize the benefits of the hosel 120 . although the invention has been described in detail with reference to several embodiments , additional variations and modifications exist within the scope and spirit of the invention as described and defined in the following claims .	0
fig1 is an elevational view of an electrosurgical apparatus 10 comprising an electronic control power source typically a radio frequency generator 12 connected by an electrical connector 14 to an electrode holder 16 . in this embodiment , the electronic control power source 12 is a monopolar device with one polarity of electrical voltage being furnished through electrical connector 14 and with a second electrical connector ( not shown ) normally connected through a dispersive electrode to the patient . although a specific example has been shown for the electronic control power source , the power source , per se , does not form a part of the invention as will be apparent hereinafter . the electrode holder 16 is electrically connected to an electrode 20 through activating switches shown as push button switches 22 and 24 . first switch 24 provides sufficient power to electrode 20 for cutting tissue whereas second switch 22 provides limited power to electrode 20 for coagulation . multiple switches 22 and 24 on the electrode holder 16 enable cutting or coagulating by the surgeon with the electrosurgical electrode 20 . fig2 is an enlarged exploded sectional view generally along the line 2 -- 2 of fig1 illustrating the electrode holder 16 having an external taper 26 and an axial aperture 28 . the electrode holder 16 is preferably made of an insulating plastic material with a resilient metallic electrical connector 30 connected to switches 22 and 24 ( not shown ) and disposed within the electrode holder 16 . shaft connecting means comprising a rounded first end 31 of a solid electrode shaft 34 is received within an aperture 36 of an insulating hub 38 preferably made of an insulating plastic material . the insulating hub 38 includes an internal taper 40 which cooperates in a sealing relationship with the external taper 26 of the electrode holder 16 when the first end 31 of solid electrode shaft 34 is inserted within axial aperture 28 of the electrode holder 16 to electrically contact electrical connector 30 . a substantially waterproof seal is established between the internal taper 40 and external taper 26 . the insulating hub 38 includes an undercut portion 42 comprising a surface 44 extending generally axially along solid shaft 34 and defined by a shoulder 46 . the undercut portion 42 is established to receive shaft insulation means 50 shown as a first shaft tubing 51 in direct engagement with the solid electrode shaft 34 and a second shaft tubing 52 which overlays the first shaft tubing 51 . the shaft insulation means 50 extends upon surface 44 and engages shoulder 46 to provide a watertight seal between the shaft tubing insulation means 50 and insulating hub 38 . preferably , the shaft tubing insulation is a heat shrinkable tubing as will be described in greater detail hereinafter . furthermore , although the shaft tubing insulation has been disclosed as a first and second shaft tubing insulation , it should be appreciated that a single tubing insulation may be incorporated within the present invention . irrespective of whether a single or multiple shaft tubing insulation is utilized , it is important that the outer surface of the shaft tubing insulation be resistant to abrasion normally encountered in the surgical procedure . this abrasion resistance will maintain the electrical insulation characteristic of the shaft tubing insulation and reduce the possibility of undesired electrical leakage through the insulation due to abrasion occuring during the operating procedure . fig3 is an enlarged elevational view of a first embodiment of an improved electrosurgical electrode 20a . the insulating hub portion 38 is identical to the embodiment shown in fig2 . the solid electrode shaft 34 within the shaft tubing insulation means 50 includes a second end 32 receiving an electrode tip 60 which will be described in greater detail in reference to fig4 - 6 . fig4 is an enlarged sectional view of a portion of the electrode shown in fig3 with fig5 being an elevational view along line 5 -- 5 in fig4 . the solid electrode shaft 34 is tapered by a taper 62 at the second end 32 . the second end 32 includes an axial bore 64 for receiving an electrode tip base ( proximal end ) 66 . the electrode tip base ( proximal end ) 66 is secured from axial movement from the axial bore 64 by a deformation 68 in the outer surface of the second end 32 . the deformation 68 may be obtained by a swaging operation , the use of a center punch or the like . the electrode tip base ( proximal end ) 66 may be optionally deformed or crimped at 69 to receive the deformation 68 . the electrode tip 60 is tapered along the length thereof as shown in fig4 - 5 and includes a bend at 70 forming and angle of approximately 10 ° from an axis 72 extending through the solid electrode shaft 34 . the electrode tip 60 also includes a bend at 74 of approximately 100 ° establishing the distal end 76 of the electrode tip 60 to have an axis thereof 78 established approximately 90 ° relative to the axis 72 extending through the solid electrode shaft 34 . a tip insulator 82 insulates the tapered electrode tip 60 from an area approximate the base 66 to expose only a portion of electrode tip 60 adjacent the distal end 76 as shown in fig4 . the tip insulator 82 is overlayed by the shaft insulation means 50a and specifically first shaft tubing 51a and second shaft tubing 52a to provide a watertight electrical seal of the electrode tip 60 and electrode shaft 34 with only the distal end 76 of the electrode tip 60 being exposed . in a specific example of the electrode 20 shown in fig3 - 5 , the solid shaft 34 is preferably made of type 300 series stainless steel with the electrode tip 60 fashioned from a conical blank of a cobalt chromium alloy material . the distal end 76 preferably has a spherical radius of 0 . 007 inches with a teflon tip insulator 82 exposing from approximately 0 . 040 inches to 0 . 050 inches . this exposure has been found to be optimal since a much greater exposure will cause the electrical energy to dissipate whereas a much lesser exposure will concentrate the electrical energy in a confined area . the embodiment shown in fig4 utilizes a soft polyolefin shrink tubing for the first shaft tubing 51a and a polyvinylidene fluoride sold under the trademark kynar by raychem corporation for the second shaft tubing 52a . the first shaft tubing prevents leakage of electrical energy especially radio frequency power along the solid shaft 34 . additionally , the first shaft tubing seals the first and second ends 31 and 32 of solid shaft 34 to provide a water tight seal . the second shaft tubing 52a overlays the first shaft tubing 51a to provide additional resistance to abrasion . fig6 is an enlarged sectional view similar to fig4 illustrating a variation of the electrode of fig3 . in this embodiment , a single shaft tubing 50b is utilized for effecting the insulation of solid shaft 34 . the single shaft tubing 50b may be a semi - rigid polyolefin tubing as described in raychem specification rt - 1190 / 3 . the thickness of the shaft tubing 50 should be sufficient to prevent electrical leakage of the radio frequency signal generated by the power source 12 . preferably this thickness may be in the range of 0 . 013 inch to 0 . 017 inch . the distal end 76 as illustrated by phantom line 84 extends beyond the surface of the electrode 20 as illustrated by the phantom line 86 a distance less than the radius of the electrode 20 as represented by the distance between axis 72 and phantom line 86 . this diameter of the configuration enables the electrode tip 60 to have a low axial profile to provide strength and rigidity while permitting passage through an introducer cannula . fig7 is an enlarged elevational view of a second embodiment of an improved electrosurgical electrode 20c . the insulating hub portion 38 is identical to the embodiment shown in fig2 . the solid electrode shaft 34 within the shaft tubing insulation means 50c includes a second end 32 receiving an electrode tip 60c which will be described in greater detail in reference to fig8 - 14 . fig8 is an enlarged sectional view of a portion of the electrode shown in fig7 with fig9 being an elevational view along the line 9 -- 9 in fig8 . the solid electrode shaft 34 is tapered by a taper 62 at the second end 32 . the second end 32 includes an axial bore 64 for receiving an electrode tip base ( proximal end ) 66c . the electrode tip base ( proximal end ) 66c is secured in the axial bore 64 by suitable means as set forth in reference to fig4 . the electrode tip 60c is tapered along the length thereof as shown in fig8 and includes a bend at 71 of approximately 90 ° establishing the distal end 76c of the electrode tip 60c to have an axis thereof 79 established approximately 90 ° relative to the axis 72 extending through the electrode shaft 34 . the electrode tip 60c is formed in a hooked configuration having a blade 81 . in a specific embodiment of the electrode 20c shown in fig7 - 9 , the solid shaft 34 and conical shaped blade blank are made of series 300 stainless steel . the distal end 76c has a spherical radius approximately of 0 . 007 inches . the embodiment of fig7 - 9 utilizes a soft polyolefin shrink tubing for the first shaft tubing 51c and a polyvinylidene fluoride tubing for the second shaft tubing 52c in a manner similar to fig4 . fig1 is essentially identical to fig8 but utilizes a single shaft tubing of semi - rigid polyolefin tubing in a manner similar to fig6 . the distal end 76c as illustrated by the phantom line 84c extends beyond the surface of electrode 20c as illustrated by the phantom line 86c a distance generally equal to the radius of the electrode 20c as represented by the distance between axis 72 and phanton line 86 . this diameter of the configuration enables the electrode tip 60c to be passed through an introducer catheter . fig1 - 14 illustrate the steps of making the electrode tip 60c shown in fig7 - 10 . although the process is shown with the electrode tip 60c attached to the electrode shaft 34 , it should be understood that the process may be performed prior to securing the electrode tip 60c to the solid shaft 34 . fig1 shows the bending of the conical blank electrode 60c at 71 to provide a substantially 90 ° bend with the axis 79 of the distal end 76 being perpendicular to the axis 72 of solid shaft 34 as shown in fig8 . fig1 illustrates dies 91 and 92 comprising the bent conical blank to provide the blade 81 having a substantially uniform thickness as shown in fig1 . fig1 shows the complete electrode tip 60c awaiting the application of the shaft tubing 50c or 50d . although the two embodiments of the improved electrodes shown in fig3 - 6 and fig7 - 10 may find a wide variety of applications , the electrode shown in fig3 - 6 finds particular value in meniscectomy procedures whereas the electrode shown in fig7 - 10 finds particular value in a subcutaneous lateral release . fig1 illustrates the interior knee joint 100 of a patient undergoing examination by an arthroscope 102 revealing a meniscal defect 104 . fig1 shows the entry of the electrode 20a of fig3 - 6 with the electrode tip 60 excising the defect through electrosurgery to enable the subsequent removal of excised tissue from the joint . the specific configuration of the electrode tip 60 facilitates an easy excision of the tough cartilaginous tissue . fig1 illustrates the interior knee joint and muscle tissue 110 with a landmark needle 112 marking the proximal limit of lateral release at the margin of the vastus lateralis . fig1 shows the electrode shown in fig7 - 10 effecting release distally to the level of the tibial tubercle with the line of incision disposed approximately one centimeter to the border of the patella . the improved hemostasis as a result of the electrode accelerates rapid recovery of the patient and lowers patient morbidity . the present disclosure includes that contained in the appended claims as well as that of the foregoing description . although this invention has been described in its preferred form with a certain degree of particularity , it is understood that the present disclosure of the preferred form has been made only by way of example and that numerous changes in the details of construction and the combination and arrangement of parts may be resorted to without departing from the spirit and scope of the invention .	0
referring to the drawings , a preferred form of the present invention comprises a source of dc analog voltage 4 which may be a potentiometer 6 that is connected between a source of voltage 10 and a current sink 5 at ground potential . source 10 produces a reference voltage which is the difference in potential between the voltage produced by source 10 and the voltage established by current sink 5 . any desired dc analog voltage between the value of the reference voltage and ground potential may be selected by moving a slider 8 along potentiometer 6 . according to this arrangement , the reference voltage and analog voltage have the same polarity , and current sink 5 has a neutral polarity and voltage . an integrating circuit 12 comprises a conventional operational amplifier 14 having an inverting input 15 , a non - inverting input 16 , and an output terminal 17 which produces an output signal vo . the integrating circuit also comprises a feedback capacitor 18 and input resistors 19 and 20 . a conventional comparator 22 compares output signal vo with a signal transmitted over a conductor 23 . when the voltage of the signals becomes identical , the comparator produces an indicating pulse which stops the operation of a digital counter 24 . counter 24 produces a digital output signal on an output cable 25 comprising a plurality of conductors in which each conductor represents one bit of a digital number . the counter sums clock pulses generated by a clock 26 in a well known manner . the output of counter 24 is transmitted to a latch circuit 28 which is loaded in response to the indicating pulse produced by comparator 22 . the latch is capable of storing a digital number which is available on digital output terminals 29 . the connection of the reference voltage , analog voltage and current sink to integrating circuit 12 is controlled by a switch circuit 30 . the switch circuit comprises mos field effect transistors 32 - 35 having gates 38 - 41 , drains 44 - 47 and sources 50 - 53 , respectively . referring to fig3 a , source 10 more specifically comprises an operational amplifier 70 , a zener diode 72 and resistors 74 , 75 and 77 connected as shown . conductor 79 is connected to a source of positive voltage . referring to fig3 b , counter 24 more specifically comprises identical counter modules 81 and 82 , such as type sn74193 manufactured by texas instruments , inc ., and identical counter modules 84 and 85 , such as type sn7493 manufactured by texas instruments , inc . counter 24 also comprises a nand gate 86 , an inverter 88 , and conductors 90 - 93 connected as shown . and gate 62 ( fig1 ) is fabricated within counter module 81 . still referring to fig3 b , latch 28 more specifically comprises d - type flipflops 96 - 103 , diodes 106 - 113 and resistors 116 - 123 , respectively . the latch also includes a conductor 125 connector to a source of positive 5 volts potential and a conductor 126 connected to the clock ( clk ) inputs of flipflops 96 - 103 . referring to fig3 a , control logic circuit 60 more specifically comprises d - type flipflops 130 - 135 having clear inputs ( clr ), clock inputs ( clk ), d inputs ( d ), a preset input ( pre ), q outputs ( q ) and q outputs ( q ). the logic circuit also comprises and gates 138 - 141 used for signal level shifting , nand gates 142 - 144 , inverters 146 - 148 , 150 - 151 , and a resistor 153 . flipflops 132 , 133 , 134 and 135 have their d inputs connected to a logical 1 voltage level . a bipolar transistor 155 is used as a zener diode to provide a nonprecision negative voltage to comparator 22 . operational amplifier 14 and comparator 22 are each supplied with nonprecision sources of positive and negative voltage as shown in fig3 a . a resistor 157 is used to protect comparator 22 from start - up transients . the voltage drop across resistor 157 is negligible during normal operation . the circuitry operates in the following manner . referring to fig2 at the beginning of a cycle of operation , such as time t o , capacitor 18 has no charge stored on it , and the gates of transistors 32 - 35 are biased in the manner shown by the waveforms a - d in fig2 . when the gate of a transistor is biased on , the transistor is switched into its saturated condition so that current is readily conducted from the drain to the source . when the transistor is biased in its off condition , the drain - to - source junction presents a relatively high resistance to the flow of electrical current . as a result , at time t o transistor 32 is switched on or acts as a switch which connects the analog voltage to inverting input 15 and transistor 34 is switched on or acts as a switch which connects ground potential to non - inverting input 16 . ( the small voltage drop across resistors 19 and 20 will be ignored for purposes of the present explanation .) at time t o , counter 24 is reset and gate 62 is enabled so that clock pulses are transmitted from clock 26 to counter 24 . as the counter advances , capacitor 18 charges in the manner shown by waveform v c until the counter overflows at time t 1 . the output of counter 24 is transmitted to control logic circuit 60 over cable 63 . at time t 1 , the overflow condition of the counter is detected by control logic circuit 60 and the operation of switch circuit 30 is altered . transistor 32 is switched off and transistor 35 is switched on so that non - inverting input 16 is connected to the reference potential . this mode of operation causes the output signal v o of the integrating circuit to shift positively or slew by the magnitude of the reference voltage vref . the change in voltage and polarity of the output signal is illustrated by waveform v o , fig2 in which the difference in voltages v1 and v2 equals vref . once integrating circuit 12 has slewed to its new output level by time t2 , as determined by counter 24 , transistor 33 is switched on so that inverting input 15 is connected to ground potential . since integrating circuit 12 responds to differences in input signals , this condition causes the voltage v c across capacitor 18 to decrease in a linear manner and the output signal v o to increase in linear manner . at time t2 , clock pulses are again allowed to flow into counter 24 which had previously overflowed so that pulses are again counted . alternatively , the counter may be reset at time t2 so that it is in the same condition as time t o . the output signal voltage continues to increase until the reference voltage vref is reached . at this point in time ( i . e ., time t3 ), comparator 22 produces a change in output state which loads the number in counter 24 into latch circuit 28 , resets counter 24 , and causes control logic circuit 60 to switch the transistors in switching circuit 30 in the manner shown by waveforms a - d in fig2 . more specifically , transistors 33 and 35 are switched off and transistor 34 is switched on so that inverting input 15 floats and non - inverting input 16 is connected to ground potential . output signal v o then slews back to ground potential at time t4 so that the circuit is ready for another cycle of operation . this slewing of output signal v o also causes the output of comparator 22 to revert to its original state . since capacitor 18 is allowed to float while the integrating circuit is slewing , the charge stored on the capacitor changes by only a negligible amount during the slew period . this mode of operation is shown by waveform v c in fig2 between time periods t1 and t2 . as a result of this operation , the reference voltage and dc analog voltage may have the same polarity , thereby drastically simplifying the design and complexity of the power supply which furnishes the voltage needed to operate the circuitry . voltage waveforms v c and v o are somewhat idealized in fig2 in order to clarify the explanation of operation . the actual voltages may be offset slightly from the values shown due to the internal biasing voltages of operational amplifier 14 . those skilled in the art will recognize that only a preferred embodiment of the invention is shown herein and that the embodiment may be altered and modified without departing from the spirit and scope of the invention as defined in the appended claims .	7
referring now to fig1 there is illustrated a conventional autopilot control surface servomotor apparatus employing pulse width modulation ( pwm ) control and incorporating the base current compensation circuit of the present invention . the basic pwm servomotor control apparatus is generally the same as that disclosed in the above - referenced u . s . pat . no . 3 , 848 , 833 . since its structure and operation are described fully therein , only its general characteristics need be repeated herein . an electric motor 10 is mechanically coupled to drive the aircraft control surface through coupling 11 which may include a convention engage / disengage clutch , reduction gearing and control cable capstan ( none shown ). control surface position and velocity are conventionally provided by position sensor 12 , such as a potentiometer or synchro and tachometer 13 . the autopilot control surface command is provided at the input terminal 14 where it is compared with existing control surface position from position sensor 12 to generate a position error signal at the input of first stage or error amplifier 15 . the output of error amplifier 15 is combined with the servomotor velocity damping signal from tachometer 13 and supplied to a second stage amplifier 16 , the output of which constitutes the servomotor input command signal on lead 17 . in accordance with conventional pwm control techniques , the motor command signal on lead 17 is supplied to positive and negative pwm comparators 18 and 19 supplied by a triangular reference waveform , the normal zero references of which are raised and lowered by the positive and negative - going output of amplifier 16 to generate positive pulses on leads 20 or 21 having a pulse width proportional magnitude of the control signal on lead 17 . these pulses are supplied to a conventional transistor switched bridge power amplifier 22 , 23 to drive motor 10 in one direction or the other . for the purpose of disclosing the present invention as briefly and succinctly as possible , only the positive half of bridge amplifier 22 for positive direction of motor drive need be described , it being understood by those skilled in this art that motor drive by the other half of the bridge amplifier is essentially identical . in accordance with the teachings of the reference &# 39 ; 833 patent , torque limiting is achieved by monitoring the current drawn by the servomotor , the voltage produced by this current being compared with a reference voltage corresponding to a predetermined not - to - exceed motor current . if motor current exceeds the limiting current , the input to the bridge amplifier is disabled or alternatively reduced to reduce motor current until it is within limits . however , in this prior art current limiting technique included an error produced by the base drive current of the bridge transistor supplying drive current to the motor . since motor drive current is dependent upon pulse width and since it is not possible to calculate the current pulse width due to its dependence upon motor loading , its effect on current or torque limiting had to be compromised by lowering the torque limit reference . the uncompensated base drive current can produce an error of as much as about 7 % of the total motor current measurement . the present invention provides circuitry for compensating for the power bridge base drive current so as to provide an accurate measure of total motor current . the foregoing is illustrated in fig2 which illustrates graphically the contribution of the base drive current to total motor current under various pulse width duty cycles . it will be noted that the ratio of bridge drive current i d to actual motor current i m is significant at lower duty cycles and decreases only slightly for higher duty cycles . the present invention can be demonstrated mathematically as follows . the current i t is the sum of the bridge drive current i d , the actual motor current i m and the power transistor base drive current i b : let the current i s be the sum of the motor winding inductive current i i and the base drive compensating current i c : the voltages produced by the currents of equations ( 1 ) and ( 2 ) flowing through equal value resistances r s may be amplified in a differential amplifier having a gain letting v i = i t r s and v 2 = i s r s , the output of the differential amplifier is which is the true motor current and is used to more precisely control current or torque limiting for the servosystem . this is graphically illustrated in fig3 wherein the compensation or cancellation of the base current of the transistor bridge results in a true measure of motor current only . the circuit for accomplishing this base drive compensation of the present invention is illustrated in fig1 wherein the pulse output of pwm amplifier 18 turns on transistor 25 which results in current flow from power supply v cc through transistor 26 , motor 10 , transistor 27 and resistor r s . sbsb . 1 to ground . in addition , the base current bridge transistor 25 also flows through resistor 28 , transistors 25 and 27 together with the drive current from pwm amplifier through resistor 29 . thus , as illustrated in fig1 the current i t flowing through resistor r s . sbsb . 1 to ground is the sum of the motor current i m , the bridge drive current i d and the power amplifier base drive current i b of the bridge transistor 27 as set forth in equation ( 1 ) above . in accordance with the present invention , the output of pwm amplifier 18 is also supplied via lead 30 to a base drive compensation circuit 31 comprising transistor switch 32 , its base resistor 33 , blocking diode 34 , and scaling resistor 35 connected between transistor 32 and power supply v cc . it should be noted that the base drive conpensation circuit is supplied from the same power supply as the power bridge so that any fluctations in power supply voltage do not effect the compensation . when the power bridge is turned on , the compensation circuit is also turned on resulting in compensation current flow i c from supply v cc through resistor r s . sbsb . 2 to ground . the compensation circuit component values are selected such that i c = i b + i d in accordance with equation ( 3 ) above . also , motor winding inductive current i i also flows through resistor r s . sbsb . 2 . thus , the current flow i s through resistor r s . sbsb . 2 is the sum of compensation current i c and motor inductive current i i in accordance with equation ( 2 ) above . the voltage v 1 resulting from the current flow i t is applied via lead 40 to the other input of differential amplifier 41 while the voltage v 2 resulting from current flow i s is applied via lead 43 to the other input thereof ; the value of resistors r s . sbsb . 1 and r s . sbsb . 2 is the same . the gain k of differential amplifier 41 is such that its output v i on lead 44 is equal to v i = kr s ( i m + i i ) as derived above , this voltage representing only the actual motor current which , of course , represents motor torque . now the motor torque can be precisely limited , uncontaminated by other currents in the bridge drive amplifier , particularly the base current required to drive the bridge . therefore , the voltage on lead 44 representing motor current is supplied to a voltage comparator 45 where it is compared with a predetermined reference voltage from power supply 46 . the reference voltage is selected to be proportional to the torque limit imposed on the motor 10 . thus , if the voltage v i exceeds the reference voltage , and output will appear on comparator output lead 47 and 48 which is used to disable both pwm amplifiers 18 and 19 . while the invention has been described in its preferred embodiment , it is to be understood that the words which have been used are words of description rather than limitation and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the invention in its broader aspects .	6
described herein is a method and apparatus for maintaining a file system is described . in one embodiment , a method to reduce duplication of data blocks is described . an allocation module receives a request from a kernel module to allocate a block of the file system to a file . the allocation module examines another block of the file system to determine whether the other block contains a same data as the first block . the allocation module also determines an external reference count of the other block containing the same data . the other block is then allocated to the file and the external reference count is updated accordingly . in another embodiment , to avoid duplication of file systems , an allocation module manages the allocation of blocks to a file so that if the block contains the same data as an already allocated block , the file gets allocated the already allocated and written block . the present application is applicable to deduplicating blocks . in a first application , blocks that are duplicates take up extra storage space . in this instance , the present application provides for a technique to reduce such block duplication . in a second application , creating or editing a file may be performed in such a way as to reduce or minimize the number of blocks used to store data . if data from the file is already stored in a pre - existing block , there would be no need to create another block for that file . those of ordinary skills in the art will recognize that the concept presented in this application is not solely limited to unix - based operating system but may also be applicable to other operating file systems . fig1 is a block diagram illustrating a block 102 of a file system of a unix based operating system . block 102 includes an inode 104 and a data block 106 . inodes 104 and data block 106 are logically and physically separate entities . a disk ( or disk partition ) is formatted to contain a set of block groups ( i . e . groups of sector clusters called blocks , each group can be n blocks in length , each block can be up to 4 kb ), each of which contains a superblock ( 1 block ), group descriptor information ( n blocks ), a data block bitmap 106 ( 1 block ), inode bitmap 104 ( 1 block ), a table of inodes ( information nodes , each of which is a data record of 128 bytes in length ) for the files in the block group ( n blocks ), and the data blocks ( n blocks or clusters of sectors ). block groups are like logical sub - partitions that are used to reduce file fragmentation as linux stores individual files within a block group . a block descriptor holds descriptions of blocks within a block group . block sizes may be 512 - 4096 bytes . a single block may contain descriptions for up to 8 , 192 blocks . each file in the system is described with an inode data structure . an inode is a data record in the inode table that describes which blocks on the device are occupied by a particular file , as well as the access rights , modification times , and type of the file . every file in the file system is represented by a single inode ( an entry in the block group &# 39 ; s inode table ). each inode is referenced by a single unique identifying number , called the inode number , which is used to link the file &# 39 ; s name / entry in a directory file , to the inode structure in the inode table in the group block . each inode is 128 bytes in length and contains information such as file mode ( a 16 bit entry that indicates the file type ( regular , directory , character , et .) owner / group / other read / write / execute permissions ) owner id , group id , file size , time / date last modified , time / date last accessed , and the file ( block ) addresses , which consist of pointers to the data blocks . file data blocks are referenced directly by the inode , and the remainder ( up to 1074791424 ) indirectly by data blocks acting as index pointers . in one embodiment , allocated blocks are changed according to the following process : for example , if file a has data blocks 1 , 2 , and 3 , and file b has data blocks 2 and 3 , when something writes to data block 2 from the context of file a ( say , a text editor program , which is being used to edit file a ), the system needs to allocate a new block matching the content to be written , decrement the reference count on block 2 , and update a &# 39 ; s mode to point to the new block ( call it block # 4 ), making a &# 39 ; s data blocks 1 , 4 , and 3 . fig2 is a block diagram illustrating one embodiment of allocating blocks to a file 202 of a file system . to begin with , since a block may be allocated to more than one file , an external reference count 208 for the block would be needed . also , to speed up searching for a block to allocate , hash values for allocated blocks should be maintained . the reference count could replace the current allocation bitmap used in the ext2 file system , or it could be stored separately . on a 32 bit system using 4 k blocks , it would take 256 blocks ( 1 mb ) of reference counts to track a gigabyte of allocatable blocks . the hash values would be a more complicated matter — for efficient searching , they would need to be stored in a more complicated structure than an unsorted list . also , to be effective , the hashes would need to take significantly more room than a simple pointer , so an unsorted list would be prohibitively large in any case . in one embodiment , a two - level hashing process is used where each allocated block 206 is hashed using a fast algorithm with a small result ( e . g . a crc - 16 variant ), as well as a longer , more industrial - strength hashing algorithm ( e . g . sha1 , or sha256 or 512 ). the first hash 210 would be used as an index into a list of b - tree structures , where the b - tree structures are each ordered by the second hash 212 , with values being the block numbers . with a 16 - bit first level hash , this would require a minimum of 65 , 536 blocks for second level b - trees ( 256 mb , on a system that uses 4 k blocks ). however , on a large disk , the overhead would be small in relative terms . fig3 is a flow diagram illustrating one embodiment of a method for allocating blocks to a file of a file system . at 302 , a request to allocate a block to a file is received . at 304 , a search for a block to allocate is performed by computing the two hashes of the block at 306 to see if there &# 39 ; s a match already allocated by using the first hash to find the appropriate b - tree at 308 , and then using the second hash to look up any matching blocks at 310 . if matching blocks are found at 312 , a byte - by - byte comparison of the matches is performed against the block to be allocated at 314 . and if it matches one of the found blocks at 316 , that block is allocated at 318 , and its reference count is incremented at 320 . if there are no matching blocks at 312 and 316 , a new previously unallocated block is allocated . fig4 is a flow diagram illustrating one embodiment of a method for de - allocating blocks to a file of a file system . a request to de - allocate a block to a file is received at 402 . deallocating a block would require decrementing the reference count in the reference count map at 404 . if the reference count goes to zero at 406 , the deallocator computes the two block hashes at 408 to delete it from the appropriate b - tree at 410 . fig5 is a block diagram illustrating one embodiment of logical components of a computer system . a unix based operating system 502 includes a file system having software for controlling the transfer of data . a kernel module 504 communicates with the os 502 to maintain various system services such as memory management , timer , synchronization , and task creation . an allocation module 506 and a processing module 508 interact with the kernel module 504 to carry out block allocation and processing operations . allocation modules 506 and processing modules 508 may either be integral to os 502 or operate as independent modules and may be implemented in hardware and / or software . fig6 illustrates a diagrammatic representation of a machine in the exemplary form of a computer system 600 within which a set of instructions , for causing the machine to perform any one or more of the methodologies discussed herein , may be executed . in alternative embodiments , the machine may be connected ( e . g ., networked ) to other machines in a lan , an intranet , an extranet , or the internet . the machine may operate in the capacity of a server or a client machine in client - server network environment , or as a peer machine in a peer - to - peer ( or distributed ) network environment . the machine may be a personal computer ( pc ), a tablet pc , a set - top box ( stb ), a personal digital assistant ( pda ), a cellular telephone , a web appliance , a server , a network router , switch or bridge , or any machine capable of executing a set of instructions ( sequential or otherwise ) that specify actions to be taken by that machine . further , while only a single machine is illustrated , the term “ machine ” shall also be taken to include any collection of machines that individually or jointly execute a set ( or multiple sets ) of instructions to perform any one or more of the methodologies discussed herein . the exemplary computer system 600 includes a processing device 602 , a main memory 604 ( e . g ., read - only memory ( rom ), flash memory , dynamic random access memory ( dram ) such as synchronous dram ( sdram ), a static memory 606 ( e . g ., flash memory , static random access memory ( sram ), etc . ), and a data storage device 618 , which communicate with each other via a bus 630 . processing device 602 represents one or more general - purpose processing devices such as a microprocessor , central processing unit , or the like . more particularly , the processing device may be complex instruction set computing ( cisc ) microprocessor , reduced instruction set computing ( risc ) microprocessor , very long instruction word ( vliw ) microprocessor , or processor implementing other instruction sets , or processors implementing a combination of instruction sets . processing device 602 may also be one or more special - purpose processing devices such as an application specific integrated circuit ( asic ), a field programmable gate array ( fpga ), a digital signal processor ( dsp ), network processor , or the like . the processing device 602 is configured to execute modules 626 ( previously described with respect to fig1 ) for performing the operations and steps discussed herein with . in one embodiment , the modules may include hardware or software or a combination of both . the computer system 600 may further include a network interface device 608 . the computer system 600 also may include a video display unit 610 ( e . g ., a liquid crystal display ( lcd ) or a cathode ray tube ( crt )), an alphanumeric input device 612 ( e . g ., a keyboard ), a cursor control device 614 ( e . g ., a mouse ), and a signal generation device 616 ( e . g ., a speaker ). the data storage device 618 may include a computer - accessible storage medium 630 on which is stored one or more sets of instructions ( e . g ., software 622 ) embodying any one or more of the methodologies or functions described herein . the software 622 may also reside , completely or at least partially , within the main memory 604 and / or within the processing device 602 during execution thereof by the computer system 600 , the main memory 604 and the processing device 602 also constituting computer - accessible storage media . the software 622 may further be transmitted or received over a network 620 via the network interface device 608 . the computer - accessible storage medium 630 may also be used to store the allocation module 624 as presently described . the allocation module 624 may also be stored in other sections of computer system 600 , such as static memory 606 . while the computer - accessible storage medium 630 is shown in an exemplary embodiment to be a single medium , the term “ computer - accessible storage medium ” should be taken to include a single medium or multiple media ( e . g ., a centralized or distributed database , and / or associated caches and servers ) that store the one or more sets of instructions . the term “ computer - accessible storage medium ” shall also be taken to include any medium that is capable of storing , encoding or carrying a set of instructions for execution by the machine and that cause the machine to perform any one or more of the methodologies of the present invention . the term “ computer - accessible storage medium ” shall accordingly be taken to include , but not be limited to , solid - state memories , optical and magnetic media . in the above description , numerous details are set forth . it will be apparent , however , to one skilled in the art , that the present invention may be practiced without these specific details . in some instances , well - known structures and devices are shown in block diagram form , rather than in detail , in order to avoid obscuring the present invention . some portions of the detailed descriptions above are presented in terms of algorithms and symbolic representations of operations on data bits within a computer memory . these algorithmic descriptions and representations are the means used by those skilled in the data processing arts to most effectively convey the substance of their work to others skilled in the art . an algorithm is here , and generally , conceived to be a self - consistent sequence of steps leading to a desired result . the steps are those requiring physical manipulations of physical quantities . usually , though not necessarily , these quantities take the form of electrical or magnetic signals capable of being stored , transferred , combined , compared , and otherwise manipulated . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , characters , terms , numbers , or the like . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise as apparent from the following discussion , it is appreciated that throughout the description , discussions utilizing terms such as “ processing ” or “ computing ” or “ calculating ” or “ determining ” or “ displaying ” or the like , refer to the action and processes of a computer system , or similar electronic computing device , that manipulates and transforms data represented as physical ( electronic ) quantities within the computer system &# 39 ; s registers and memories into other data similarly represented as physical quantities within the computer system memories or registers or other such information storage , transmission or display devices . the present invention also relates to apparatus for performing the operations herein . this apparatus may be specially constructed for the required purposes , or it may comprise a general purpose computer selectively activated or reconfigured by a computer program stored in the computer . such a computer program may be stored in a computer readable storage medium , such as , but is not limited to , any type of disk including floppy disks , optical disks , cd - roms , and magnetic - optical disks , read - only memories ( roms ), random access memories ( rams ), eproms , eeproms , magnetic or optical cards , or any type of media suitable for storing electronic instructions , and each coupled to a computer system bus . the algorithms and displays presented herein are not inherently related to any particular computer or other apparatus . various general purpose systems may be used with programs in accordance with the teachings herein , or it may prove convenient to construct more specialized apparatus to perform the required method steps . the required structure for a variety of these systems will appear from the description below . in addition , the present invention is not described with reference to any particular programming language . it will be appreciated that a variety of programming languages may be used to implement the teachings of the invention as described herein . the present method for deduplicated file system may be particularly useful for a system that is used to mirror several software repositories , particularly one that is used to mirror several versions of several software repositories . a great deal of space could be saved as a result of implementing the deduplicated file system . it is to be understood that the above description is intended to be illustrative , and not restrictive . many other embodiments will be apparent to those of skill in the art upon reading and understanding the above description . the scope of the invention should , therefore , be determined with reference to the appended claims , along with the full scope of equivalents to which such claims are entitled .	6
referring to the drawings , fig1 shows an air turbine starter 10 embodying the present invention to selectively engage with an engine 11 . the air turbine starter 10 is comprised of a first housing assembly 12 and a second housing assembly 13 . the housing assembly 12 defines a flow path 14 extending from an inlet 16 to an outlet 18 . the housing assembly 13 includes a mounting flange 19 for mounting the air turbine starter to the engine 11 . within the starter 10 , the housing assemblies 12 and 13 support a turbine section 20 , a compound planetary gear train 40 and an overrunning first clutch 60 described in greater detail below . the turbine section 20 is comprised of a turbine wheel 22 having rotatable shaft 24 extending in an axial direction 23 and journaled in bearings 26 . a gear 25 is secured to the shaft 24 for transferring torque . a plurality of turbine blades 28 radially extend from the turbine wheel 22 into the flow path 14 . upstream of the blades 28 are a plurality of nozzles 29 mounted to the housing assembly 12 for veering the air flow before it traverses the turbine blades 28 . in operation , pressurized air enters through the inlet 16 , is angled by the nozzles 29 , is expanded across the blades 28 , and exits through the outlet 18 . the blades 28 convert the pressure energy of the air into rotary motion causing the turbine wheel 22 , the shaft 24 , and the gear 25 to rotate at the same speed as the blades 28 . the compound planetary gear train 40 is comprised of a plurality of circumferentially - spaced shafts 42 each having a gear 44 that meshes with the gear 25 . a gear 45 integral with the shaft 42 engages a ring gear 48 which in turn engages a hub gear 62 . the hub gear 62 is supported by bearings 64 and has a hollow cylindrical hub portion 63 encircling the overrunning first clutch 60 . in operation , the gear train 40 converts the high speed , low torque output of the turbine section 20 into low speed , high torque input for the first clutch 60 . the first clutch 60 is preferably a sprag type clutch , but any overrunning type clutch would accomplish the objectives of the invention . a pawl and ratchet clutch with the pawls attached to an inner diameter driving member and the ratchets attached to an outer diameter driven member would be an alternative . the hub gear 62 operates as an output member to transfer torque to the input side of clutch 60 through the hub portion 63 . as shown in the drawings , a clutch drive shaft 70 is operative as a power transfer member and receives the torque from the output side of clutch 60 . in the preferred embodiment , the clutch drive shaft 70 is supported by bearings 66 and extends outside of the housing 13 . the first clutch 60 is positively engaged and transfers torque when the hub portion 63 rotates at the same speed or begins to exceed the speed of the clutch drive shaft 70 . engine start up begins with the flow of pressurized air rotating the turbine wheel 22 which transfers torque through the planetary geartrain 40 to the hub gear 62 . at this point , the hub portion 63 begins to rotate faster than the stationary clutch drive shaft 70 so the first clutch 60 engages and transfers torque therebetween . the clutch drive shaft 70 is connected to the input side of a second clutch 68 . connected to the output side of the second clutch 68 is a driven assembly 71 which is coupled to the engine 11 . in the preferred embodiment , the second clutch 68 and the driven assembly 71 are located outside of housing 13 such that when the second clutch 68 disengages , all components within the starter 10 can come to a complete rest . the second clutch 68 is a jaw clutch which is comprised of two clutch jaws , in this case jaws 72 and 74 . clutch jaw 72 is connected to the clutch drive shaft 70 and clutch jaw 74 is connected to a slidable disk 76 which is part of the driven assembly 71 . the slidable disk 76 is connected to rotate with the output shaft 78 , which is also part of the driven assembly 71 , through three equiangularly - spaced torque teeth 84 . equiangularly - spaced between the torque teeth are three flyweights 80 ( only one shown ) connected to the output shaft 78 by three pins 86 ( only one shown ) and have essentially radially inward extending portions 90 that abut the slidable disk 76 . to urge clutch jaw 74 axially into clutch jaw 72 , a spring 82 is interposed between the output shaft 78 and the slidable disk 76 by abutting a retaining ring 88 as shown . at initial start up , the second clutch 68 , urged into engagement by the spring 82 , transfers torque from the clutch drive shaft 70 to the slidable disk 76 . the torque teeth 84 transfer the torque between the slidable disk 76 and the output shaft 78 . the driven assembly 71 is connected to rotate with the engine 11 through a tie bolt 91 and transfers the torque to the engine 11 through engaging means ( not shown ). torque is transferred to the engine 11 until engine starter assist speed when the engine 11 begins to accelerate on its own power . at this time , gas flow to the starter is shut off and the engine 11 rotates the driven assembly 71 . at this point disengagement of the second clutch 68 will allow all components within the starter 10 to come to rest . thus , an operating range of the second clutch 68 is defined from initial start up ( zero rpm ) to a speed greater than engine starter assist speed at which disengagement is desired . fig2 depicts the second clutch 68 when the driven assembly 71 is being rotated by the engine 11 beyond its operating range . as the driven assembly 71 accelerates with engine 11 from starter assist speed , the flyweights 80 pivot about the pins 86 due to centrifugal forces . once the driven assembly 71 is rotating beyond the operating range , the centrifugal force exerted on the flyweights 80 overcomes the biasing force exerted by the spring 82 . the radially inward extending portions 90 of the flyweights 80 abut the slidable disk 76 and slide it in the axial direction 23 such that the second clutch 68 is disengaged . during engine rolldown , the engine 11 speed is decreased until the centrifugal force on the flyweights 80 is overcome by the biasing force of spring 82 and the slidable disk 76 is urged to engage the second clutch 68 . the clutch drive shaft 70 begins to rotate with the driven assembly 71 . if the starter 10 is not operating , the hub gear 62 is not rotating . thus , the clutch drive shaft 70 will be rotating faster than the hub gear 62 and the first clutch 60 will overrun and prevent the torque transfer to the hub gear 62 . to perfect an engine restart , the starter 10 begins acceleration until the hub gear 62 rotates at the same speed as the clutch drive shaft 70 . then the first clutch 60 switches from overrunning mode to positive engagement and begins transferring torque . the engine 11 reaches starter assist speed again and accelerates the driven assembly 71 beyond the second clutch 68 operating range . the second clutch 68 disengages and the starter 10 is shut off and coasts to rest . the foregoing description of the preferred embodiment is intended as illustrative rather than restrictive . the full scope of the invention should be construed by reference to the following claims , as reasonably interpreted in view of the teaching herein .	5
with reference to such figures an automatic device made according to an embodiment of the present invention for the ignition and control of a gas apparatus 1 is globally and schematically indicated with 10 . the gas apparatus 1 is in particular a gas fireplace , schematically represented in fig1 , but the automatic device 10 can be used in other apparatuses like for example gas stoves and gas braziers and similar . the gas apparatus 1 is equipped with a pilot burner 11 and with a main burner 12 and suitable electrically controlled valve means 7 , for regulating the flow of gas from a main pipe 28 for the gas towards a first nozzle 8 , coupled with the pilot burner 11 and to a second nozzle 13 , coupled with the main burner 12 , respectively . the pilot burner 11 and the main burner 12 are coupled in the usual way , so that the flame at the pilot burner 11 can act as ignition source for the gas released by the nozzle 13 to the main burner 12 . a supply voltage provided by electricity main 2 , through a transformer 3 , and by battery pack 4 supplies the automatic device 10 ; the automatic device 10 is coupled through a ground terminal 59 to a constant reference voltage gnd that in the present embodiment is a ground voltage . moreover , the valve means 7 are supplied by a supply voltage and are of the type with the valve normally closed . in particular , the valve means 7 comprise a first solenoid 17 , which actuates a first shutter associated with the first nozzle 8 so that when the solenoid is crossed by an electric current the first shutter opens allowing the gas to flow , whereas , when the solenoid is not crossed by an electric current the shutter closes blocking the flow of gas . similarly , a second solenoid 18 actuates a second shutter associated with the second nozzle 13 . the automatic device 10 comprises a spark circuit 80 suitable for generating a flame on the pilot burner 11 , close to the first nozzle 8 , upon receipt of a start signal start . according to an embodiment of the present invention , the automatic device 10 comprises an electrical microprocessor unit 5 that actuates and electrically controls both the spark circuit 80 and such valve means 7 , so as to uniformly and totally burn all of the gas put out exploiting to the highest degree the thermal value as well as in complete safety . advantageously , according to an embodiment of the present invention the valve means 7 are activated by the electrical unit 5 and are coupled to the ground terminal 59 . the automatic device 10 , as illustrated in fig4 , comprises a first actuator circuit 40 and a second actuator circuit 45 , structurally similar , dynamically activated by the electrical unit 5 , through a first activation signal 21 and a second activation signal 22 , respectively . the first activation signal 21 and the second activation signal 22 are signals having a pulse train with a predetermined charge factor or duty cycle . such actuator circuits 40 , 45 are suitable for dynamically polarizing the valve means 7 to regulate its charge state according to the duty cycle of the pulse train . in particular , according to an embodiment of the present invention , the automatic device 10 and in particular the electrical unit 5 is substantially a circuit operating at low voltage that dynamically drives such valve means 7 , with a low power consumption and a substantial saving of energy . the electricity main 2 that supplies a voltage vac to the transformer rectifier 3 , which through a first terminal 16 provides a first supply voltage vdc ; and battery pack 4 that supply a second supply voltage vbb through a second terminal 20 . according to an embodiment , the transformer rectifier 3 comprises a graetz bridge rectifier or else a modern switching voltage regulator , for example of the step - down or buck type . a remote control panel 6 allows the electrical unit 5 to be activated upon receipt of the start signal start . the start signal start is transmitted through a set of terminals 27 and can consist of a protocol , in the form of an encoded signal , or else the reading of a switch or contact open and closed state . according to an embodiment , the remote control panel 6 comprises a pair of switches coupled to the array of terminals 27 . a diagnostic circuit 14 interacts with the electrical unit 5 through suitable connection terminals 15 and allows the user to keep the automatic device 10 constantly under remote observation , allowing possible anomalies to be diagnosed . according to an embodiment of the present invention , in the case of anomalies the automatic device 10 acts autonomously intervening to restore its functionality or to place it under safe conditions . the control panel 6 and the diagnostic circuit 14 could in some cases be incorporated directly in the electrical unit 5 . in particular , the electrical unit 5 comprises a programmable microcontroller 30 capable of storing a management program that analyzes the received signals , generating suitable signals for the operation and for the safety of the automatic device 10 itself . the automatic device 10 also comprises a selector 50 that is supplied in input by the first supply voltage vdc and by the second supply voltage vbb to supply in output a third constant voltage vcc_pos , which is substantially the greater of the input supply voltages . as shall be specified hereafter , the selector 50 uses the battery pack 4 as a buffer battery both in the case of a total lack of the first supply voltage vdc , and in the case in which the electricity main 2 supplies sporadic low voltages compared to a nominal voltage . in particular , the selector 50 feeds an enable circuit 46 , a regulator circuit 60 and a high voltage generator circuit 85 . the enable circuit 46 provides in output a fourth voltage vcc which is a voltage substantially translated in level compared to the third voltage vcc_pos and suitable for feeding the first 40 and the second actuator circuit 45 and defined arranged control peripherals . the regulation circuit 60 carries out a first filtering for possible over voltages in the third supply voltage vcc_pos supplying in output a substantially stabilised fifth supply voltage vdd suitable for feeding the electrical unit 5 . according to an embodiment of the present invention , as highlighted in fig4 , the first actuator circuit 40 and the second actuator circuit 45 are supplied by the fourth supply voltage vcc respectively through a first supply terminal 47 and a second supply terminal 48 and they are also coupled to the ground terminal 59 . moreover , they are activated by the first activation signal 21 and by the second activation signal 22 received , respectively , at a first input terminal 23 and at a second input terminal 24 . the first activation signal 21 and the second activation signal 22 having a pulse train have regular pulses of rectangular wave shape with a particular and predetermined charge factor or duty cycle , so as to dynamically activate the valve means 7 coupled to a respective output terminal 34 , 35 . in particular , according to an embodiment , the first actuator circuit 40 comprises a first inductance l 1 , arranged between the first supply terminal 47 and an inner node a , a first capacitance c 1 , arranged between the inner node a and an output node e , which is coupled with the ground terminal 59 through a first diode d 1 that , for greater efficiency , is of the schottky type . a first resistance r 33 is also arranged between the output node e and the first output terminal 34 . a first switch q 1 is arranged between the inner node a and the ground terminal 59 and is suitably activated at a command terminal g by the first activation signal 21 . the first switch q 1 can be a fet or mosfet transistor or else a bjt transistor . a first resistive divider r 7 - r 8 is coupled with the first input terminal 23 and is coupled to the ground terminal 59 and allows the voltage of the first activation signal 21 to be adjusted in a predetermined way . furthermore , the first actuator circuit 40 comprises a first filtering element f 1 arranged between the inner node a and the ground terminal 59 capable of filtering the signal present at the inner node a . in particular , the first filtering element f 1 comprises , coupled in series , a resistance r 4 coupled to the inner node a and to a capacitance c 9 . in an embodiment , at the first actuator circuit 40 a zener diode dz 3 is arranged between the inner node b and the command terminal g of the first switch q 1 , to make a further protection of the first actuator circuit 40 against over voltages that could reach the fourth supply voltage vcc through the first supply terminal 47 . the first impulsive activation signal 21 , based upon the provided duty cycle , has an activation time period t on and a deactivation time period t off and dynamically biases the first inductance l 1 and the first capacitance c 1 . in particular , the first actuator circuit 40 absorbs electrical energy discontinuously from the fourth supply voltage vcc only during the activation time period t on and returns it by taking a substantially continuous current from such valve means 7 . the first activation signal 21 generates a potential at the output node e that is kept below the potentials of the other nodes of the first actuator circuit 40 . in particular , the potential of the output node e is less than the ground voltage gnd of the ground terminal 59 . the activation time period t on of the first activation signal 21 is substantially less than the deactivation time period t off . in other words , unlike the prior art , the first actuator circuit 40 : during the activation time period t on , receives a charge current , i . e . from the first solenoid 17 , keeping the flow of gas to the first burner 11 open ; during the deactivation time period t off , the output node e is coupled to the ground terminal 59 through the first diode d 1 and thus also the first solenoid 17 and the first solenoid 17 as a effect of its own inductance is crossed by a current still coming out towards the output terminal e , keeping the flow of gas to the first burner 11 open . this allows , in particular , the energy required by the first actuator circuit 40 during its operation to been substantially reduced with a substantial reduction of the power absorbed . with reference to fig1 , the duty cycle of the first activation signal 21 is defined by the formula : where t on is the activation time period and t off is the deactivation time period . with reference to fig1 - 18 , the operation of the first actuator circuit 40 is analyzed in particular . fig1 shows the first actuator circuit 40 in a rest state , in which the fourth supply voltage vcc is present whereas the first activation signal 21 is absent , i . e . the electrical unit 5 enables the enable circuit 46 but still does not command the first actuator circuit 40 . in this case , the first switch q 1 is in open state and the first capacitance c 1 is charged at the fourth supply voltage vcc through a current that , from the first supply terminal 47 slips through the first inductance l 1 , the first capacitance c 1 and the first diode d 1 towards the ground terminal 59 . fig1 and 18 illustrate the first actuator circuit 40 activated by the first activation signal 21 , in a first and a second operative condition , respectively . in particular , in the first operative condition , the first activation signal 21 is active for the activation time period t on and the first switch q 1 closes connecting the inner node a to the ground terminal 59 . the first inductance l 1 accumulates inductive energy , whereas the first capacitance c 1 discharges absorbing current from the first solenoid 17 whilst the first diode d 1 is electrically blocked . in such a first operative condition , for the brief activation time period t on , the first actuator circuit 40 absorbs a current from the first solenoid 17 and in particular a current slips from the charge towards the inner node a making the voltage at the output node e negative with respect to the reference voltage gnd present at the ground terminal 59 . in such a first operative condition , the first solenoid 17 , crossed by the electric current , allows the first shutter to open allowing the gas to flow to the pilot burner 11 , whereas the power required by the first actuator circuit 40 is given by the energy accumulated by the first inductance l 1 during the brief activation time period t on . in the second operative condition , the first switch q 1 is kept open for the passive time period t off . the first inductance l 1 discharges the inductive energy accumulated during the activation time period t on , recharging the first capacitance c 1 through the first diode d 1 which is also brought into conduction and a current continues to flow from the first solenoid 17 to the first diode d 1 . therefore , also during the deactivation time period t off , the output node e is kept at a negative voltage with respect to the reference voltage gnd of the ground terminal 59 . the first solenoid 17 , crossed by substantially continuous current , allows the first shutter to be kept open allowing the gas to flow to the pilot burner 11 without any power requirement from the supply and therefore with a substantial saving of energy . substantially , therefore , the first actuator circuit 40 activated by the first activation signal 21 keeps the transfer of energy from the to the charge operative with a transfer factor that depends upon the duty cycle of the first activation signal 21 . furthermore , when the first activation signal 21 is deactivated the first switch q 1 is kept open and the first actuator circuit 40 is taken back into rest state . moreover , according to an embodiment of the present invention , the first activation signal 21 has the duty cycle regulated so that the current that crosses the first solenoid 17 for each activation time period t on and for each deactivation time period t off , is greater than a minimum opening current suitable for keeping the first shutter open making the gas flow to the pilot burner 11 . according to an embodiment of the present invention , the electrical unit 5 modulates the duty cycle of the first activation signal 21 according to some parameters , like for example : value of the fifth supply voltage vcc ; value of the minimum opening current of the first solenoid 17 ; value of a temperature of the first solenoid 17 , as shall become clearer hereafter . in particular , there is substantially a retroaction between the first actuator circuit 40 and the electrical unit 5 . a value of the measured current i_measure , proportional to the current present at the first output terminal 34 , is detected through a detection terminal 31 coupled to the first output node e . such a value is suitably processed by the electrical unit 5 based upon suitable reference values stored and possible corrective compensations of the duty cycle of the first activation signal 21 can be foreseen , in relation to the specific parameters of the first solenoid 17 , indicated above . this allows a substantial saving of energy at the automatic circuit 10 . moreover , in the case in which the first solenoid 17 undergoes variations due to the environment temperature that can change the electrical characteristics , for example such as to generate undesired deactivation thereof , the value of the measured current i_measure undergoes variations which are intercepted by the electrical unit 5 and are compensated correctively by varying the duty cycle of the first activation signal 21 . similarly , as highlighted in fig4 , the second actuator circuit 45 comprises a second inductance l 2 arranged between the second supply terminal 48 and an inner node a ′, a second capacitance c 2 arranged between the inner node a ′ and an output node e ′ which is coupled with the ground terminal 59 through a second schottky diode d 2 . a second resistance r 72 is coupled in series between the output node e ′ and through a second output terminal 35 to the charge or else to the second solenoid 18 . a second switch q 3 , arranged between the inner node a ′ and the ground terminal 59 , is driven dynamically by the second activation signal 22 which is suitably regulated in voltage by a second divider r 12 - r 14 . in an embodiment , the second actuator circuit 45 has a zener diode dz 6 that is arranged between the inner node b ′ and the command terminal g ′ of the second switch q 3 , to make a further protection against excessive voltages that could reach the fourth supply voltage vcc through the terminal 48 . the second impulsive activation signal 22 , based upon the provided duty cycle , regulates a charge time t on ′ and a discharging time t off ′ of the second capacitance c 2 keeping the second output node e ′ at a potential that is less than any potential present at the other nodes of the second actuator circuit 45 and in particular of the voltage at the ground terminal 59 . a second filtering element f 2 is arranged between the inner node a ′ and the ground terminal 59 allowing the signal to be filtered at the inner node a ′ and has , coupled in series , a resistance r 12 and a capacitance c 19 . similarly to the first actuator circuit 40 , the second actuator circuit 45 biases the second solenoid 18 in relation to the duty signal of the second activation signal 22 , providing , in particular , a current to the actuator circuit 40 during the charge time period t on ′ . this allows a low energy consumption improving the performance of the automatic device 10 itself . furthermore , the first actuator circuit 40 and the second actuator circuit 45 to satisfy defined control and safety regulations can , instead of a first capacitance c 1 and a second capacitance c 2 , have many capacitances c 1 ′, c 2 ′, c 3 ′ and c 10 , c 11 and c 12 , respectively , arranged in series and placed between the respective inner node a and a ′ and the output node e and e ′ as highlighted in fig4 . similarly , the first actuator circuit 40 and the second actuator circuit 45 to increase efficiency of energy conversion can , as an alternative to the first diode d 1 and the second diode d 2 , have two or more diodes , d 3 and d 4 , as well as d 5 and d 6 , respectively , arranged in parallel and coupled between the output node e , e ′ and the ground terminal 59 . such diodes can , in some cases , be schottky diodes . it is worth noting that the first resistance r 33 and the second resistance r 72 , in series respectively with the output nodes e , e ′, could be replaced by a pair of inductances of a value similar to the first and second inductance l 1 and l 2 , without for this reason jeopardizing the operation of the actuator circuits 40 and 45 , as well as of the automatic device 10 . therefore , it is possible to improve the attenuation of possible interferences conducted from and towards the nodes e , e ′ at the first drive signal 41 and at the second drive signal 42 , also allowing current specific regulations to be respected , like for example the regulations known by the acronym emc ( electro - magnetic compatibility ). furthermore , the diode dz 3 and the diode dz 6 may not be present without for this reason jeopardizing the operation of the actuator circuits 40 and 45 , as well as of the automatic device 10 . moreover , according an embodiment there is retroaction between the first actuator circuit 40 and the electrical unit 5 . according to this embodiment , the automatic device 10 comprises an unique connector cn 1 , shown repeatedly in fig4 , 6 and 13 , which represents a unitary and main connection interface between the electrical unit 5 and the peripherals of the automatic device 10 , allowing quick and easy connection . in particular , the connector cn 1 receives the first supply voltage vdc through the first terminal 16 and the second supply voltage vbb through the second terminal 20 , and it is suitably coupled to the ground terminal 59 . in particular , the connector cn 1 has three successive terminals that contact a command reading circuit 100 , shown in fig1 , which receives respective signals 101 , 103 coming through the set of terminals 27 from the command panel 6 . such signals 101 , 103 are interpreted by the microcontroller 30 so as to generate the activation signal for the enable circuit 46 for driving the first actuator circuit 40 and the second actuator circuit 45 . finally , the connector cn 1 has three further terminals that contact the valve means 7 respectively coupling the output terminals 34 , 35 and the ground reference terminal 59 of the first 40 and of the second actuator circuit 45 , to respective terminals 41 and 42 of the first solenoid 17 and of the second solenoid 18 . even more specifically , a fourth input terminal of the connector cn 1 is arranged to receive a switching signal command_switch , a fifth input terminal of the connector cn 1 is arranged to receive a selection signal mode_switch and a sixth terminal of the connector cn 1 is arranged to receive the return signal switch_gnd provided by the connection with the set of terminals 27 towards a command panel 6 . the selector 50 , illustrated in fig6 , receives , in particular through the connector cn 1 , the first supply voltage vdc and the second supply voltage vbb respectively at a second input terminal 51 and at a first input terminal 52 , and it is coupled to the ground terminal 59 to supply , to an output terminal , the third supply voltage vcc_pos . in particular , the third supply voltage vcc_pos is the maximum voltage between the input supply voltages . according to an embodiment , the selector 50 comprises a first diode d 12 , in series with the first input terminal 51 , and a second diode d 13 , in series with the second input terminal 52 , as well as a filter f 3 suitably coupled in series with the first diode d 12 and with the second diode d 13 and coupled to the output terminal 56 . advantageously , the first diode d 12 and the second diode d 13 are of the schottky type and in particular go into blocking mode in the presence of possible inverse voltages at the respective input terminals , blocking the passage of current . the first filter f 3 comprises a first capacitance c 8 , a first inductance l 6 and a second inductance l 7 and attenuates possible interferences conducted , from and towards the first input terminal 51 and the second input terminal 52 , in particular respecting current specific regulations , like for example the regulations known by the acronym emc ( electro - magnetic compatibility ). a fuse rt 1 and a third diode dz 2 , zener type , are coupled to the output terminal 56 and make a protection from possible over voltages and over currents . indeed , when there are over voltages the third diode dz 2 goes into inverse conduction , whereas the fuse rt 1 is activated once a so - called marker current has been exceeded . it is worth noting that the first inductance l 6 and the second inductance l 7 of the filter f 3 could be replaced by a pair of short - circuits , without for this reason jeopardising the operation of the selector 50 , as well as of the automatic device 10 . in the most general form , the selector 50 operates in the presence of the first supply voltage vdc and the second supply voltage vbb and the battery pack 4 take care of possible supply voltage drops of the electricity main 2 , as a buffer battery . in particular , during operation , the first diode d 12 and the second diode d 13 automatically impose upon an inner node x of the selector 50 a voltage that in value is the greater from the first supply voltage vdc and the second supply voltage vbb . a possible temporary or extended drop in the first supply voltage vdc makes just the first diode d 12 conduct automatically connecting the battery pack 4 and offering a low direct voltage drop at the output terminal 56 . therefore , the first diode d 12 and the second diode d 13 allow a non - conflicting connection between the first supply voltage vdc and the second supply voltage vbb avoiding the first supply voltage vdc from overloading the battery pack 4 damaging them and at the same time avoiding the battery pack 4 being needlessly consumed . according to a possible embodiment , such battery pack 4 provide a voltage of 6v , with four 1 . 5v batteries arranged in series , whereas the voltage in output from the transformer provides a nominal voltage equal to 7v . in further embodiments , the second supply voltage vbb has a field of variation of between 4v and 6 . 4 v according to the level of charge of the battery pack , whereas the first supply voltage vdc has a field of variation of between 4v and 8 . 5 v . the enable circuit 46 , illustrated in fig5 , is supplied at a supply terminal 43 by the third supply voltage vcc_pos and is enabled at an input terminal 44 by an enabling signal 49 , provided by the microcontroller 30 , to generate the fourth supply voltage vcc at an output terminal 147 . in particular , the enable circuit 46 comprises a first transistor q 2 coupled between the supply terminal 43 and the output terminal 147 with a command terminal coupled to the input terminal 44 through the interposition of a second transistor q 4 , which is suitably coupled to the ground terminal 59 and has a command terminal coupled to the input terminal 44 . preferably , the first transistor q 2 is of the bipolar pnp type and is coupled to a common emitter through the interposition of a first resistance r 11 . moreover , a first resistive divider r 15 - r 16 allows the voltage of the enabling signal to be regulated at the command terminal of the second transistor q 4 , whereas a second resistance r 13 arranged between the second transistor q 4 and the first transistor q 2 allows the bias voltage at the latter to be regulated . a buffer capacitance c 14 is coupled in parallel between the output terminal 147 and the ground terminal 59 , allowing the voltage at the output terminal 147 to be stabilized . it is worth noting that the enabling circuit 46 is substantially a safety circuit made to satisfy defined current regulations . alternatively , a replacement resistance r 9 could be arranged between the input terminal 43 and the output terminal 147 of the enable circuit 46 , supplying the fourth supply voltage vcc directly and permanently to the first actuator circuit 40 and to the second actuator circuit 45 . according to the present embodiment , the regulation circuit 60 , shown in fig7 , at an input terminal 61 receives the third supply voltage vcc_pos and supplies the fifth supply voltage vdd , which is substantially a stabilised voltage suitable for feeding the electrical unit 5 , to an output terminal 65 . the regulation circuit 60 is also coupled to the ground terminal 59 . an integrated linear regulator u 2 is arranged between the input terminal 61 and the output terminal 65 , a first capacitance c 15 and a second capacitance c 17 are coupled in parallel arranged between the input terminal 61 and the ground terminal 59 , whereas a third capacitance c 18 , a fourth capacitance c 16 and a pair of zener diodes dz 4 and dz 5 are coupled in parallel between the output terminal 65 and the ground terminal 59 . in the present embodiment , the electrical unit 5 comprises , as shown in fig8 , a stabilization network 37 associated with the microcontroller 30 , which comprises passive components able to stabilise the operation . in particular , the stabilisation network 37 , supplied at a first node 65 by the fifth supply voltage vdd , has a second node 66 coupled to the ground terminal 59 , a first capacitance c 4 and a second capacitance c 5 coupled in parallel with each other between the first node 65 and the second node 66 , with the ends coupled to respective supply pins vdd and vss , vdd ′ and vss ′ of the microcontroller 30 . in particular , the first capacitance c 4 and the second capacitance c 5 absorb possible variations in current that can be generated by sources either inside or outside the electrical unit 5 due to quick switching of electrical currents and voltages . moreover , a delayed circuit comprising a first resistance r 1 and a third capacitance c 7 arranged in series between the first node 65 and the second node 66 , as well as a second resistance r 5 coupled between a third node 64 and a pin mclr_icd of the microcontroller 30 , allows the fifth supply voltage vdd to be stabilized ensuring that the microcontroller 30 starts up with a voltage that is as stable as possible . a first clock reference circuit 38 coupled with two terminals i and l , to two different pins osc 1 and osc 2 of the microcontroller 30 and coupled to the ground terminal 59 that comprises a ceramic resonator y 1 . the ceramic resonator y 1 , in particular , allows an onboard timer installed in the microcontroller 30 to be oscillated at an appropriate frequency allowing a correct operation of a logic part installed in the microcontroller 30 and allowing the microcontroller 30 to carry out timed functions . according to the present embodiment , a second reference circuit 39 is present in the electrical unit 5 and comprises a timer used as independent source for checking the operation of the first clock reference circuit 38 and vice - versa . in particular , the second reference circuit 39 , as illustrated in fig2 and 21 , comprises a switch s arranged between the fifth supply voltage vdd and the ground terminal 59 activated by a command signal 62 coming from the microcontroller 30 . the switch s suitably drives an schmitt trigger inverter tr , coupled in cascade , which has a lower threshold voltage v ml and an upper threshold voltage v mh . a suitable resistance r 76 is arranged between an output terminal rc 0 of the switch s and an input terminal rc 1 of the inverter tr whereas a capacitance c 44 is coupled between the input terminal rc 1 and the ground terminal 59 . in particular , when the command signal 62 of the switch s switches in relation to a third signal v p present at the output terminal p of the inverter tr , a first signal v n at the output terminal rc 0 switches . based upon the value of the resistance r 76 and of the capacitance c 44 , a second signal v m with exponential ramp is generated at the input terminal rc 1 . the second signal v m drives the inverter tr and the third signal v p has a waveform substantially analogous to that of the first signal v n but suitably shifted in time . the time sequences of the first signal v n , of the second signal v m and of the third signal v p are shown in fig2 . the first signal v n has a duty cycle substantially independent from the inner peripherals of the microcontroller 30 , in particular it has a period t ref equal to : where t h is the time with presence of high logic level signal the period t ref is compared by the microcontroller 30 with a period of the clock generated by the ceramic resonator y 1 to satisfy defined control and safety regulations . a comparison between the magnitudes provided by the first ceramic resonator y 1 and by the first reference circuit 38 as well as a suitable management of the signals of the second reference circuit 39 allows the microcontroller 30 to recognize possible deviations between the magnitudes provided , placing if necessary the electrical unit 5 in a stop state and the electronic device 10 in a safety state . the switch s and the inverter tr can be integrated directly into the microcontroller 30 and , in this case , the output terminal rc 0 and the input terminal rc 1 are pins of the microcontroller 30 . the microcontroller 30 , as shown in fig8 , has a plurality of further input pins ra 0 , ra 1 , ra 2 , ra 3 , ra 5 , re 0 coupled to a plurality of control peripherals suitable for providing analogue signals , as well as further pins provided to receive digital signals or rather signals with a significant interpretation only based upon two levels of discrete voltages , of the “ high ” or “ low ” or “ 0 ” or “ 1 ” type and that shall be described hereafter . according to the present embodiment , the voltage generator 85 , shown in fig9 , is supplied at a supply terminal 32 by the third supply voltage vcc_pos and is activated by a first command signal 86 received at an enabling terminal 33 to supply a high voltage impulsive bias signal 83 to an output terminal 89 . the first command signal 86 is generated by the microcontroller 30 and is of the impulsive type regulated according to the fourth supply voltage vcc , suitably measured by said microcontroller 30 through a fifth voltage measurer 160 , which is described hereafter . in particular , the voltage generator 85 comprises a first transformer t 1 with a primary winding the terminals i 1 - i 2 of which are respectively coupled to the supply terminal 32 and to a switch q 6 which is suitably coupled to the ground terminal 59 and is activated by the first command signal 86 . the first transformer t 1 has a secondary winding the terminals o 1 - o 2 of which are respectively coupled with the output terminal 89 and with the ground terminal 59 . according to an embodiment , the first transformer t 1 has a transformation ratio equal to 10 . a filtered divider element 88 is arranged between the first enabling terminal 33 and the switch q 6 to process the first command signal 86 and dynamically actuate the switch q 6 . the filtered divider element 88 is an r - c network and has a first resistance r 29 as well as a second resistance r 31 and a first capacitance c 29 , coupled in parallel with each other , arranged between the enabling circuit 33 and the ground terminal 59 . moreover , a second capacitance c 24 and a third capacitance c 25 , for filtering , coupled in parallel to each other , and arranged between the input terminal 32 and the ground terminal 59 allow possible interferences present in the third supply voltage vcc_pos to be filtered . furthermore , a first diode dz 1 , zener type , and a second diode d 8 are coupled in parallel to the primary winding i 1 - i 2 of the first transformer t 1 . finally , a resistance r 73 is arranged between the ground terminal 59 and a conducting terminal of the switch q 6 to limit the maximum reachable value by the conducting current of the switch q 6 . the bias signal 83 generated at the output terminal 89 is a high voltage alternating pulse train signal suitable for actuating the flame detector 90 as well as for feeding the spark circuit 80 . the spark circuit 80 receives the bias signal 83 at an input terminal 79 coupled to the output terminal 89 of the voltage generator 85 , and is activated by the microcontroller 30 through a second command signal 57 , suitably having a pulse train , received at a second enabling terminal 78 . the spark circuit 80 , between a first output terminal 25 and a second output terminal 26 provides a suitable discharge signal 84 with a high voltage difference , that is sufficient to generate sparks or electrical discharges , to generate the pilot flame , in a suitable first electrode 29 at the first nozzle 8 of the pilot burner 11 . according to the present embodiment , the second output terminal 26 is coupled to a further ground terminal 36 . in particular , the spark circuit 80 comprises a second transformer t 2 with a primary winding the terminals i 3 - i 4 of which are coupled between the input terminal 79 and the ground terminal 59 and a secondary winding with the terminals o 3 - o 4 coupled to the first output terminal 25 and to the second output terminal 26 . according to an embodiment , the first output terminal 25 is coupled to a third connector cn 3 and the second output terminal 26 is coupled to a second connector cn 2 . moreover , the spark circuit 80 comprises a third diode d 7 a first resistance r 21 and a second resistance r 22 , in series , coupled between the input terminal 79 and the primary winding i 3 - i 4 of the second transformer t 2 , whereas a first capacitance c 26 is coupled between the second transformer t 2 and the ground terminal 59 . a triggering element 82 is arranged between the second transformer t 2 and the ground terminal 59 and comprises a thyristor q 7 of the scr triggering type and a fourth diode d 9 , arranged in antiparallel with each other . the thyristor q 7 is activated by the second command signal 57 suitably regulated in voltage by a filtered divider r 30 - r 32 - c 43 coupled between the enabling terminal 78 and the ground terminal 59 . as regards the operation of the voltage generator 85 as well as of the spark circuit 80 , the first impulsive command signal 86 with a predetermined duty cycle , dynamically activates the switch q 6 between a closed operative condition , i . e . coupled to the reference voltage gnd , and an open operative condition for a predetermined number of switches per second . when the switch q 6 is in the closed operative condition an electric current crosses the primary winding i 1 - i 2 of the first transformer t 1 and a suitable energy is accumulated , a portion of such energy transfers to the secondary winding o 1 - o 2 , generating a negative semi - wave of the bias signal 83 . when the switch q 6 is in the open operative condition , a mesh is suitably formed between the primary winding i 1 - i 2 of the first transformer t 1 , the first diode dz 1 and the second diode d 8 . in particular , a current crosses the first diode dz 1 , which is taken into inverse conduction , and the second diode d 8 , which is taken into direct conduction . in such an open operative condition , the remaining portion of the energy accumulated by the first transformer t 1 transferred to the secondary winding o 1 - o 2 generates the remaining positive semi - wave of the bias signal 83 . this semi - wave charges the fourth capacitance c 26 of the spark circuit 80 through the third diode d 7 , the resistance r 21 and the resistance r 22 . after the defined number of switches of the first command signal 86 , the fourth capacitance c 26 of the spark circuit 80 suitably charges to a predetermined high voltage value . when the thyristor q 7 goes into conduction , activated by the second command signal 57 , a mesh is formed between the primary winding i 3 - i 4 of the second transformer t 2 and the fourth capacitance c 26 . at the same time , the second transformer t 2 , with a high transformation ratio , generates the discharge signal 84 at the secondary winding o 3 - o 4 with a high voltage and in particular able to overcome the dielectric rigidity of air , producing sparks , at the first electrode 29 arranged near to the first nozzle 8 of the pilot burner 11 , of sufficient energy to ignite the gas and generate the pilot flame . the output terminal 25 is advantageously connected to a discharge terminal associated with the first electrode 29 through the second connector cn 2 and the third connector cn 3 , both of the type suitable for high voltages . a suitable conductive return mesh of the discharge current is formed through the pilot burner 11 , the first nozzle 8 and the discharge terminal connected to the second connector cn 2 , as well as through the further ground terminal 36 and the output terminal o 3 of the secondary of the second transformer t 2 . according to an embodiment , the fourth capacitance c 26 is charged to a voltage of about 120 - 140v and through the second transformer t 2 causes a spark having a voltage of about 15 - 30 kv near the first electrode 29 . the spark circuit 80 , in some embodiments , could be integrated in the electrical unit 5 . a connection block 190 , represented in fig9 , is arranged between the ground terminal 59 and the further ground terminal 36 to make a star network and thus ensure the electrical continuity in the automatic device 10 minimising the propagation of the interferences generated by the discharge signal 84 , respecting defined current regulations , in particular emc ( electro - magnetic compatibility ). for functional purposes , the connection block 190 can be replaced by a resistance of sufficiently high value respecting current regulations . the detector 90 , illustrated in fig1 , is supplied by the bias signal 83 received at an input terminal 93 and allows it to be checked whether there is a pilot flame in the pilot burner 11 , exploiting an ionization detection principle . in particular , through such an ionization detection principle , the detector 90 detects the presence of a flame by analyzinq a current received at a control terminal 91 which is coupled to a second ionization electrode 19 introduced in the pilot flame and suitable biased through the bias signal 83 . the detector 90 , suitably sized , has sensitivity and a rate of response that satisfy the current regulations . the detector 90 , connected to the ground terminal 59 , receives the flame detection signal 94 at the control terminal 91 . moreover , the detector 90 comprises an activation terminal 95 that receives an activation signal 96 , generated by the microcontroller 30 , and an output terminal 92 that provides a verification signal 99 having a pulse train . the verification signal 99 is suitably analyzed by the microcontroller 30 within a predetermined time period . as known to the skilled in the art , the ionization detection principle makes it possible to check for the presence of a flame surrounding two electrodes subject to a potential difference . in such a condition , the two electrodes are , indeed , crossed by a weak electric current whereas , by inverting the polarity of the voltage in the presence of a flame between the two electrodes , the current becomes substantially zero . the behaviour of two electrodes introduced in the flame can be simulated with a circuit comprising a rectifying diode with high direct resistance . in particular , in the present embodiment , the first nozzle 8 being metallic and being coupled to the further ground terminal 36 defines the second electrode . therefore , in the presence of a flame , when the ionization electrode 19 has a positive voltage with respect to the first nozzle 8 there is a passage of current and the flame is recognized as lit . on the other hand , when by inverting the polarity of the voltage , the voltage difference between the ionization electrode 19 and the first nozzle 8 is negative there is no passage of current even if the flame is lit . furthermore , in the absence of a flame , when the electrode 19 has a positive or negative voltage with respect to the first nozzle 8 , there is no passage of current since the mixture of air and fire - proof gas is an electrical insulator at the voltage values used . the detector 90 comprises a first capacitance c 35 arranged between the input terminal 93 and a first inner node w , a first resistance r 41 and a second resistance r 42 , in series , coupled between the first inner node w and the control terminal 91 . moreover , the detector 90 comprises a first filtering element 97 and a second filtering element 98 , consisting of r - c circuits , coupled together in series and arranged between the first inner node w and a second inner node y . the first filtering element 97 comprises a third resistance r 46 coupled to the first inner node w and coupled to a second capacitance c 34 in turn connected to the ground terminal 59 . similarly , the second filtering element 98 comprises a fourth resistance r 45 coupled to a third capacitance c 33 in turn connected to the ground terminal 59 . a divider comprising a fifth resistance r 39 and a sixth resistance r 48 , arranged between the activation terminal 95 and the ground terminal 59 , allows the rest voltage of the inner node y to be suitably regulated from the level of the activation signal 96 . furthermore , a first bipolar transistor q 9 arranged between the output terminal 92 and the ground terminal 59 is commanded by a signal coming from the second inner node y . finally , a seventh resistance r 38 is arranged between the activation terminal 95 and the output terminal 92 . the detector 90 can have a protection and compensation network for the temperature variation that comprises a second transistor q 10 , suitably diode - connected , arranged between the second inner node y and the ground terminal 59 through an eighth resistance r 47 of high resistive value . as regards the operation of the detector 90 , a current that averages out at zero detected by the detection signal 94 keeps the average value of the alternating voltage present at the first inner node w practically unchanged , also keeping the second inner node y at a continuous voltage level upper than a conduction voltage of the first transistor q 9 . therefore , the first transistor q 9 is kept in a conduction area and provides the output terminal 92 with a voltage that the microcontroller 30 interprets as low logic level , i . e . “ 0 ” or absence of flame . on the other hand , a current of positive average value detected by the detection signal 94 lowers the average value of the alternating voltage present at the first inner node w , also lowering the continuous voltage present at the second inner node y . in this way , the first transistor q 9 comes out from the conduction area zeroing the current through the seventh resistance r 38 that is no longer crossed by current and the voltage at the output terminal 92 increases . the microcontroller 30 interprets such a voltage as high logic level , i . e . “ 1 ” detecting a presence of flame . advantageously , the verification signal 99 is of the type with rectangular wave and is generated by the detection signal 94 which is suitably alternated and generated by the bias signal 83 having a pulse train . moreover , thanks to the fact that the verification signal 99 is analyzed through the microcontroller 30 in a predetermined time period , it is possible to distinguish a real presence of a flame from an anomalous or parasite conductive pathway that could give false flame detection . indeed , possible conductive pathways created in the presence of carbon residues deposited due to poor combustion or else in the presence of foreign bodies in the pilot burner 11 , or even in the presence of aesthetic embers of mineral substance that are often scattered in the combustion chamber , can easily be detected by the microcontroller 30 . moreover , it is worth noting that since the bias signal 83 alternates with a succession of pulse trains , equipped with a suitably defined duration and frequency , as well as a peak voltage of around one hundred volts , it allows the voltage generator circuit 85 to ensure a transfer to the detector 90 of a peak current of the detection signal 94 with a value around the unit of microamperes , adequate for normal requirements . the time sequences of the bias signal 83 , of the detection signal 94 and of the verification signal 99 are schematically shown in fig2 . in particular , the detection signal 94 has a first active time period t s and a second passive time period t o that are defined by the bias signal 83 . even more particular , the electrical unit 5 through the first command signal 86 activates in pulses the voltage generator 85 , which generates the high voltage alternating bias signal 83 at the output terminal 89 for the first time period t s that is transferred as detection signal 94 and biases the second ionization electrode 19 . at the same time , the microcontroller 30 , through the activation signal 96 , activates the detector 90 and measures the verification signal 99 for the same first time period t s . after such a predetermined time window t s , the electrical unit 5 deactivates the first command signal 86 and the voltage generator 85 stops providing the bias signal 83 that cancels out like the detection signal 94 and stops biasing the second ionization electrode 19 . simultaneously , even if the detector 90 shows for the second time period t o the ( desired ) loss of detection signal 94 , the microcontroller 30 suspends the acquisition of the verification signal 99 . advantageously , the second time period t o is greater than the first time period t s . the measurement of the presence of flame is detected through the electrical unit 5 only during the first active time period t s . advantageously such a time period t s is reduced to fractions of the order of a tenth of a second that substantially is the period in which the pulse train of the bias signal 83 is kept active at the voltage generator 85 . a substantial saving in energy is thus obtained . indeed , during the second time period t o , the bias signal 83 is deactivated with a substantial saving of energy especially in the case in which the electronic device 10 is supplied exclusively by the battery pack 4 . the bias signal 83 has a time sequence of alternating voltage pulse trains that has frequency and duty cycle equal to : frequency detection f r = 1 / t r = 1 /( t s + t o ) duty cycle detection d r = t s /( t s + t o ) which advantageously allows the consumption to be kept low whilst still ensuring a real and immediate recognition following the real loss of flame with a maximum reaction time of less than the one second that fully satisfies the regulations of the regulations . a control peripheral of the automatic device 10 is a current measurer 110 , illustrated in fig1 , which when activated by the microcontroller 30 , through an enabling signal 115 , at a first input terminal 112 , coupled to the detection terminal 31 of the first actuator circuit 40 , detects a signal proportional to the current present at the first output terminal 34 . the current measurer 110 provides such a measured current value i_measure to an output terminal re 0 coupled to the microcontroller 30 to carry out some checks . in particular , the current measurer 110 comprises an amplifier with common collector , coupled to suitable resistive and capacitive elements , which is enabled by the enabling signal 115 . the automatic device 10 comprises further voltage measurers , illustrated in fig1 , activated by a single enabling signal 122 , generated by the same microcontroller 30 , and suitable for providing the microcontroller 30 with a measurement of the voltages present in the automatic device 10 for specific checks and necessary comparisons and regulation . in particular , a first voltage measurer 120 measures the fifth supply voltage vdd present at the output terminal 65 of the detection circuit 60 , using a resistance r 71 and providing such a measurement to a first analogue input ra 2 of the microcontroller 30 . a second voltage measurer 130 implicitly measures the reference voltage gnd of the ground terminal 59 and provides it to a second analogue input ra 5 of the microcontroller 30 . a third voltage measurer 140 measures the supply voltage vbb supplied by the battery pack 4 and through a network of substantially r - c passive elements generates a measured supply voltage vbb_measure that is supplied to a third analogue input ra 0 of the microcontroller 30 . a fourth voltage measurer 150 takes the fifth supply voltage vdd and , through a network of substantially r - c passive elements and a bipolar transistor coupled with diode , generates a reference voltage vref_measure that is supplied to a fourth analogue input ra 1 of the microcontroller 30 . in particular , the measured reference voltage vref_measure is acquired at an input independent both from the fifth supply voltage vdd measured through the first voltage measurer 120 , and from the reference voltage gnd detected through the second voltage measurer 130 . therefore , the microcontroller 30 uses the three distinct magnitudes that are compared with each other in the safety checks for self - diagnosis and in the satisfaction of the regulations of the regulations . finally , a fifth voltage measurer 160 detects the fourth supply voltage vcc and through a network of substantially r - c passive elements generates a voltage vcc_measure that is supplied to a fifth analogue input ra 3 of the microcontroller 30 . in particular , it is worth highlighting that through a suitable activation of the transistor q 16 by the microcontroller 30 all of the measuring blocks 140 , 150 and 160 , shown in fig1 , are able to be deactivated / activated simultaneously . more in particular , the deactivation of such measuring blocks saves a few hundred microamperes of supply current . further suitable blocks and peripherals can be coupled or present in the automatic device 10 to satisfy specific requirements . a suitable interface block 180 , shown in fig1 , comprises a fifth connector j o , connected to the fifth supply voltage vdd and to the ground terminal 59 as well as to the microcontroller 30 through three command terminals 181 , 182 , 183 and allows rapid connection to the microcontroller 30 for rapid programming . finally , the automatic device 10 comprises a diagnostic block 170 , shown in fig1 , which is supplied by the fifth supply voltage vdd and is coupled to the ground terminal 59 as well as receives a first diagnostic signal 172 and a second diagnostic signal 171 from the microcontroller 30 suitable for providing the diagnostic circuit 14 with four interface signals + vdd , txd , − gnd , rxd , through a sixth connector cn 6 . the diagnostic circuit 14 can comprise an acoustic element for emitting encoded sounds , or else it can consist of a luminous device for emitting encoded flashes or it can be a serial communication interface for exchanging data through a suitable protocol . as regards the operation of the automatic device 10 , according to the present embodiment , for ignition of the automatic device 10 the electrical unit 5 from the command circuit 6 receives the start signal start , which can be generated by an external command signal , or received from a user , or from means for detecting the room temperature . in the ignition step , the electrical unit 5 commands the voltage generator 85 in pulses through the first command signal 86 , which , at the output terminal 89 , generates the high voltage alternating bias signal 83 suitable for commanding the spark circuit 80 and for driving the detector 90 both enabled by the microcontroller 30 . the detector 90 detects the detection signal 94 from the second ionization electrode 19 close to the pilot burner 11 and through the flame detection principle provides the microcontroller 30 with the verification signal 99 , detecting an initial absence of flame . once it has been verified that there is no flame , otherwise a breakdown symptom , since the commands to open the gas are still inactive , the electrical unit 5 enables the enable circuit 46 with activation of the enabling signal 49 and the actuator circuit 40 with the activation of the first activation signal 21 . simultaneously , the electrical unit 5 with the second command signal 57 activates the spark circuit 80 , which generates the discharge signal 84 through the formation of an electrical discharge repeated over time at the corresponding output terminals 25 and 26 to make a series of sparks in a suitable first electrode 29 at the first nozzle 8 to generate the pilot flame in the pilot burner 11 . simultaneously , the first actuator circuit 40 suitably biases the first solenoid 17 in relation to the duty cycle of the first activation signal 21 , regulating the passage of the gas through the pilot burner 11 . the ignition sequence of the pilot flame is completed when the verification signal 99 generated by the detector 90 and analyzed by the microcontroller 30 in the predetermined time window detects a continuous flame that hits the second ionization electrode . in this case , it is deactivated the second command signal 57 at the spark circuit 80 and the discharges at the first electrode 29 are stopped . the detector 90 continues to check the pilot flame in the pilot burner 11 thanks to the second ionization electrode 19 and the electrical unit 5 is ready for the ignition of a flame in the main burner 12 , if required , with the activation of the second activation signal 22 and the corresponding bias of the second solenoid 18 . simultaneously , the microcontroller 30 through the peripherals checks the correct operation of the automatic device 10 . in the case of anomalies , the microcontroller 30 activates the diagnostic interface block 170 that provides respective signals that can be processed by the diagnostic circuit 14 , coupled to the electrical unit 5 , which according to the requirements and the design specifications , allows suitable and specific alarm signals to in turn be generated . an embodiment of the present invention also refers to a method for driving an automatic device for the ignition and control of a gas apparatus , of the type described previously for which details and cooperating parts having the same structure and function shall be indicated with the same reference numbers and symbols . a method according to an embodiment of the present invention refers to an automatic device 10 of a gas apparatus 1 which is equipped with a pilot burner 11 and a main burner 12 , coupled in the usual way . moreover , suitable electrically controlled valve means 7 allow the flow of gas to be regulated from a main pipe 28 towards a first nozzle 8 , associated with the pilot burner 11 , and to a second nozzle 13 , associated with the main burner 12 . such a driving method is basically based upon the dynamic actuator of a first actuator circuit 40 and of a second actuator circuit 45 through , respectively , a first activation signal 21 and a second activation signal 22 having a pulse train , generated by an electrical unit 5 with a microcontroller . the pulses of such activation signals 21 , 22 have a predetermined duty cycle the valve means 7 are dynamically polarized by such actuator circuits 40 , 45 regulating the charge state according to the duty cycle of the pulse train of such activation signals 21 , 22 , allowing a substantial saving of energy . the actuator circuits 40 , 45 are made so that , during the actuator of the respective activation signal 21 , 22 , the voltage at a respective output node e , e ′ is less than the voltages of any inner node , and in particular less than the voltage of the ground terminal 59 . substantially , according to an embodiment of the present method the actuator circuits 40 , 45 are structurally and functionally similar . preferably , a first inductance l 1 and a first capacitance c 1 , arranged in series between a first supply terminal 47 , which receives a fourth supply voltage vcc , and the output node e associated with a first output terminal 34 , as well as a first diode d 1 arranged between the output node e and an ground terminal 59 , are used to make the first actuator circuit 40 . a first switch q 1 , coupled between an intermediate inner node a and the ground terminal 59 , is suitably dynamically commanded by the electrical unit 5 through the first activation signal 21 having a pulse train . the intermediate node a is arranged between the first inductance l 1 and the first capacitance c 1 . the valve means 7 and in particular a first solenoid 17 is connected to the first output terminal 34 , the first solenoid 17 also being connected to the ground terminal 59 . in particular , in order to suitably actuate the first actuator circuit 40 , the method provides a preliminary step supplying the fourth supply voltage vcc and keeping the first switch q 1 open . thereafter , the method provides actuating the first actuator circuit 40 through the first activation signal 21 having a pulse train , to dynamically polarize the valve means 7 and in particular the first solenoid 17 . for the dynamic bias of the first solenoid 17 , during the activation time period t on the first capacitance c 1 is advantageously connected to the ground terminal 59 through the first switch q 1 . therefore , the first actuator circuit 40 absorbs current from the first solenoid 17 making the voltage at the output node e negative . consequently , during the deactivation time period t off , the output node e is connected to the ground terminal 59 through the first diode d 1 which is taken into conduction and also absorbs a recirculation current coming from the first solenoid 17 . the activation time period t on is foreseen to be substantially shorter than the deactivation time period t off . therefore , the first actuator circuit 40 provides a power transfer from the power supply , fourth supply voltage vcc , to the valve means 7 that is defined based upon the value of the duty cycle of the pulse train . in particular , there is an absorption of energy just during the activation time period t on of the first activation signal 21 . the method provides modulating the duty cycle of the first activation signal 21 according to some parameters , like for example : value of the fourth supply voltage vcc ; value of the minimum current relative to an active condition of the first solenoid 17 to open the corresponding shutter ; temperature value of the first solenoid 17 . preferably , according to an embodiment of the present invention , a method provides at least one feedback measuring step which provides taking a measured current value i_measure , proportional to the current value present at the first output terminal 34 , through a detection terminal 31 . the detection terminal 31 is connected near to the first output node e and suitably connected to the electrical unit 5 . the method thus provides analyzing the measured current value i_measure through the electrical unit 5 , comparing it with suitable reference values stored in the microcontroller and modulating the duty cycle of the first activation signal 21 , providing possible corrective compensations . similarly , to suitably actuate the second actuator circuit 45 , the method provides a preliminary step supplying the fourth supply voltage vcc and keeping a second switch q 2 open . thereafter , the method provides actuating the second actuator circuit 45 providing the activation signal 22 having a pulse train to dynamically polarize the valve means 7 and in particular a second solenoid 18 . the fourth supply voltage vcc is generated by an enable circuit 46 arranged in series with a selector 50 which is supplied by a first supply voltage vdc , supplied by a rectifying transformer 3 coupled in series and supplied by the network voltage vac of the electricity main 2 , as well as by a second supply voltage vbb supplied by battery pack 4 . a method provides equipping the selector 50 with a first diode 12 and with a second diode 13 , suitably arranged in series with the input terminals to supply an inner node x with the third continuous supply voltage vcc_pos allowing a non - conflicting connection between the first supply voltage vdc and the second supply voltage vbb to avoid the first supply voltage vdc from overloading the battery pack 4 damaging them and consequently preventing the battery pack 4 from being needlessly consumed . in particular , a method according to an embodiment of the present invention provides the steps of : initial automatic ignition , activating an spark circuit 80 suitable for generating a pilot flame at the first nozzle 8 of the pilot burner 11 when a start signal start is received , through the electrical unit 5 . more in particular , according to an embodiment of the present invention , the initial automatic ignition step provides the following preliminary steps : receiving and interpreting the start signal start by the electrical unit 5 according to a specific and provided protocol , the start signal start being emitted by a remote control panel 6 ; activating a voltage generator 85 and activating a flame detector 90 and verifying an initial condition of pilot flame not present ; activating the voltage generator 85 to generate a spark through a discharge signal 84 near to the first nozzle 8 . activating the voltage generator 85 through a first command signal 86 with pulse train and with a predetermined duty cycle , generated by the electrical unit 5 , to generate the bias signal 83 , advantageously with alternating pulse train and having a high voltage , at the output terminal ; activating the spark circuit 80 through a second command signal 57 , also with pulse train with a predetermined duty cycle , generated by the electrical unit 5 , to generate the high voltage discharge signal 84 at the output terminal . the discharge signal 84 , compared to the voltage present at the ground terminal 59 , has a voltage difference suitable for generating suitable sparks at the first nozzle 8 . according to an embodiment of the present invention , the electrical unit 5 according to a measured supply voltage vcc_measure through a fifth voltage measurer 160 regulates the first command signal 86 . moreover , a method provides : activating the detector 90 with a suitably timed activation signal 95 generated by the electrical unit 5 to control the pilot flame in the pilot burner 11 . the method provides detecting the flame at the first burner 11 , through the ionization principle , receiving a detection signal 94 of a flame coming from a second ionization electrode 19 at a control terminal 91 and then providing a verification signal 99 to the electrical unit 5 . the method then provides the step of analyzing the verification signal 99 in a predetermined time period through the electrical unit 5 . according to an embodiment of the present invention , the flame detection signal 94 is an alternating signal with a negative voltage part and a positive voltage part to allow a real presence of flame to be distinguished from a parasite conductive pathway . once the pilot flame at the first nozzle 8 of the burner 11 has been generated and controlled , the method provides using the pilot flame as ignition source for a main flame near to the second nozzle 13 of the main burner 12 . a method according to an embodiment of the present invention provides suitably actuating the second actuator circuit 45 , through the activation by the electrical unit 5 of the second activation signal 22 with pulse train to dynamically bias the valve means and in particular the second solenoid 18 and regulate the gas flow from the main pipe 28 to the main burner 12 . a second inductance l 2 and a second capacitance c 2 , in series between a second supply terminal 48 and a second output terminal 35 , as well as a second diode d 2 , arranged between the output terminal 35 and the ground terminal 59 , and a second switch q 2 suitably dynamically commanded by the electrical unit 5 through the second activation signal 22 having a pulse train , are used to make the second actuator circuit 45 . in an analogous way to what generally occurs , the method then provides the steps of : constantly checking the pilot flame in the pilot burner 11 through the detector 90 and the electrical unit 5 . the method provides further steps of detection of the voltages and of the currents present in the automatic device 10 , through special blocks ; such steps are suitably timed by the electrical unit 5 with a microcontroller in a logic suitable for instantaneously detecting possible anomalies of the automatic device 10 as well as for minimising the energy consumption of the automatic device 10 . such steps , for example , provide the use of a first current measurer 110 , as well as of a first 120 , a second 130 , a third 140 , a fourth 150 and a fifth 160 voltage measurer , these being enabled simultaneously by the same enabling signal 122 provided by the electrical unit 5 . further detection blocks can be present to satisfy specific regulatory or requirements or specific and detailed needs . an advantage of an automatic device according to an embodiment of the invention is its low energy consumption as well as its automatic management in terms of the flame ignition command , in terms of the flame control , and in terms of the safe restoring of the device in the presence of anomalies . indeed , the actuator circuits , dynamically activated through the pulse train by the electrical unit with a microprocessor , bias the valve means with an energy transfer from the power supply just in the activation time period defined by the duty cycle of the pulse train of the respective activation signals . a further advantage is given by the fact that thanks to the feedback between the first actuator circuit and the electrical unit it is possible to regulate the duty cycle of the pulse train of the activation signals activating the first actuator circuit and biasing the valve means with less use of energy . another advantage is given by the energy saving due to the timed actuation between the voltage generator , the spark circuit and the detector and by the fact that the detection of a flame through the verification signal is timed . such advantages , in particular , allow extremely low energy consumption with a substantial and unusual saving of energy , in this way allowing the automatic device to be suitably supplied with just the battery means for a significant period of time . a further advantage of an automatic device according to an embodiment of the present invention is the versatility of use ; indeed , the spark circuit can be commanded remotely for flame ignition and completely automatic control of the entire device . another advantage of the automatic device is given by the safety provided ; indeed , the detector allows automatic quick checking of the flame leaving the electrical unit to safely manage the entire automatic device and in particular the valve means . a further advantage of the automatic device is given by the speed of response to possible anomalies of the pilot flame and to the capability to distinguish a real flame from another conductive pathway . in particular , the possible loss of the pilot flame is detected by the electrical unit 5 allowing resetting for safe management of the automatic device . indeed , the detector uses the ionization flame detection principle and uses the alternating voltage pulse train detection signal . another advantage of the automatic device is given by the opportunity to activate the gas apparatus in complete safety through remote command , with a remote control or with a radio control . another advantage is the versatility of the present electronic device . thanks to the fact that the valve means are biased through the actuator circuit activated by the activation signal with pulse train with duty cycle that can be regulated by the electrical unit , the automatic device can be adapted to a wider range of valve means equipped with substantially inductive solenoids with low supply voltage . in particular , the automatic device can replace other devices in existing apparatuses . another advantage of a pilot method according to an embodiment of the present invention is its efficiency linked to the low energy consumption required and to the completely electronic management in terms of the command to the spark circuit , in terms of the flame control and in terms of the control of the operation of the automatic device . moreover , such a method allows the device to be completely automatical and to be quickly restored or made safe . from the foregoing it will be appreciated that , although specific embodiments of the invention have been described herein for purposes of illustration , various modifications may be made without deviating from the spirit and scope of the invention .	5
fig1 shows a bleacher or stadium seat 12 attachable cup holding device 10 which can be constructed or molded in separate connectable pieces of a resilient plastic or other suitable structural material . a first piece is a bracket clip / shaft 3 which includes lip clip 5 . the bottom leg of clip 5 extends horizontally away from clip 5 and far enough out to contain a small angled flange 11 . flange 11 is emanating from this bottom leg and raises up . its open end extends back towards clip 5 . clip / shaft bracket 3 then extends downwardly ( from slightly beyond emanation point of angled flange 11 ) as a vertical flat shaft before transition or morphing into cylindrical shaft 16 . shaft or post 16 allows connection to a second piece , a cup / bottle holding support 1 . the clip / shaft bracket 3 also has an upward curved flange 4 protruding out of the vertical flat shaft for holding shakers . the second piece , cup / bottle holding support 1 comprises a cup holding ring 13 housing a hole 6 at its connecting ( to cylindrical shaft 16 ) end through which passes the slightly smaller diametrically cylindrical shaft 16 . shaft 16 can be secured after passage through hole 6 by a connectable ( e . g . adhesive , glued on ) ring cap 2 . the hole 6 can be larger slightly than the cylindrical shaft 16 to allow ring 13 to rotate about 180 degrees from a position in front of bleacher to a position under a bleacher 12 , as illustrated by arrows 36 in fig2 , 6 , and 7 . support 1 can optionally contain two pair ( one on left side of ring and one on right side of ring ) of curved flanges 8 , 9 extending off of the ring 13 horizontally . these flanges 8 , 9 are set apart far enough and are curved enough to allow a narrowed portion of a bottleneck 14 of bottle 27 to securely rest in them ( see fig3 and 9 ). another part of apparatus 10 can be a short , but wide trash bag mount or hanger 7 extending horizontally off of the ring 13 and directly between the two pair of bottle holding curved flanges 8 , 9 and directly opposite the hole 6 at apex of ring 13 ( see fig1 ). fig2 shows bleacher attachable cupholding device 10 assembled and ready for attachment to bleacher or stadium seat 12 . assembly is simply passing the cylindrical shaft 16 through the hole 6 of the support apparatus 1 and connecting ( e . g . adhesive , gluing ) the ring cap 2 in place at the tip of the shaft 16 . in fig7 , bleacher or stadium seat 12 has an upper panel 38 having grooves 39 , front and rear flanges or panels 40 , 41 and bottom flanges or panels 42 , 43 . panel 42 is a front bottom panel . panel 43 is a rear bottom panel . in order to attach the clip / shaft bracket 3 to seat or bleacher 12 , recess 44 in between clip 5 and flange 11 is receptive of front bottom panel 42 of bleacher seat 12 ( see fig7 ). in this position , flange 11 engages front panel 40 . fig6 shows device 30 assembled with shaft 35 connected through hole 32 to cap 33 . fig7 shows device 30 attached to inner lip 17 of bleacher 12 via clip 31 which has been secured to front bottom flange 42 . fig8 shows cup 15 being supported by device 30 which is attached to a bleacher 12 . fig9 shows bottle 27 supported by device 30 which is attached to a bleacher 12 . in fig5 , ring 13 is attached to vertical flat shaft 35 which is attached to cylindrical shaft 34 . the parts 13 , 34 , 35 can be single piece , for example injection molded plastic . shaft 34 extends through hole or opening 32 and is rotatably mounted in hole or opening 32 , secured with cap 33 ( using a fastener , bolt , screw , adhesive , etc .). fig1 shows another embodiment of bleacher attachable cupholding device 20 in an exploded view . device 20 comprising a clip 23 attached at the bottom in the center of clip 23 to a thin vertical shaft which attaches to the top middle section of a rail 21 which extends a few inches backward . on the rail 21 rides a snugly fitting car 25 attached to a ring 13 , the rail 21 held on by a stop cap 26 . fig1 shows device 20 assembled with the car 25 attached to ring 13 riding on a rail 21 which is affixed to a clip 23 and held on by a stop cap 26 . fig1 shows device 20 attached to a bleacher 12 via the bleacher 12 front panel 40 and front bottom panels 42 with the car 25 and ring 13 combination able to move from a position in front of bleacher 12 ( fig1 ) to a position directly under bleacher 12 . in fig1 , device 20 is attached to bleacher 12 and supporting cup 15 in its ring 13 in an extended position . fig1 shows device 20 comprising a clip 23 attached at middle of bottom to a rail 21 supporting a sliding car 25 which is affixed to a ring 13 holding a bottle 27 held by extending flanges 9 encircling its neck 14 . the device 20 is secured to a bleacher 12 via front panel 40 and front bottom panel 42 of bleacher 12 . the car 25 slides between an extended position of fig1 and a retracted or storage position wherein the car engages stop 22 . thus car 25 travels between stop 22 and stop cap 26 as illustrated by arrows 37 in fig1 . thus any of the embodiments of the apparatus of the present invention provides a holder that enables a cup , bottle , and or bag to be moved between an extended position and a stored position . in the extended position , the cup , bottle and or bag is placed toward the front of the stadium seat or bleacher 12 as shown in fig3 , 4 , 7 , 8 , 9 , 11 , 12 , 13 , 14 . in the retracted position , the cup , bottle , bar or other similar object is moved to a storage position under the stadium seat 12 . in one embodiment , a pivotal connection is formed between a bracket or clip that is attached to a seat and the holder which supports the cup , bottle , or bag . in another embodiment , the cup , bottle or bag is mounted to a support which includes a car that can slide between an extended and a retracted or storage position . the present invention thus provides an improvement over prior art systems in that a user can access a cup , bottle or bag when desired . that same user can store the cup , bottle and or bag under his or her position in a stadium seat when the user does not wish to use the cup , bottle or bag . when supporting a cup , the cup would desirably have a larger diameter upper end 46 which is larger than the diameter or opening 45 of ring 13 , thus a portion of the cup 15 extends through the opening 45 while the upper end portion which is of a larger diameter 46 than the opening 45 extends above ring 13 ( see fig4 ). it should be understood that the rail 21 and car 25 could have many different configurations . for example , the rail 21 could be cylindrically shaped with the car 25 having a circular opening that fits the cylindrical rail . it should also be understood that other linkages could be used in addition to the pivotal linkage of fig1 - 9 or the sliding linkages of 10 - 14 . for example , the linkages could employ multiple arms or multiple segments or joints which might pivot one upon another . a fourth embodiment of the present invention , cup holder 110 ( fig1 - 22 ) is similar to cup holder 10 , and varies in just a few details . it includes a perimeter support rib 150 . rib 150 starts at the midpoint of the top of clip / shaft combination / bracket 103 and goes to back of clip 103 , proceeds down back of clip 103 and all the way on underside of clip 103 to the flat part of the vertical component 170 . the purpose of rib 150 is to strengthen the clip 103 . there is a downward projection 155 on the underside of top leg 160 of clip 103 . the purpose of downward projection 155 is to hug the top part 117 of the bleacher lip on bleachers 112 that have a little nub 117 on the end of the lip , as shown in fig1 . there is a metal spring 165 received in clip 103 . this spring 165 serves the same purpose as the plastic stop 11 in fig1 and is a movable projection . however , spring 165 rises from the side instead of in front and going back toward clip . the spring 165 can also be made as part of the mold ( in which case it would be the same plastic ) instead of being a separate metal piece inserted into slit 166 as shown in fig1 - 20 . though not shown in fig2 - 26 , clip 203 preferably has such a molded spring in roughly the same position as metal spring 165 on clip 103 . instead of gluing ring 2 to shaft 16 , one could instead for example : ( 1 ) provide a form fitting cap which could be sonically welded to end of cylindrical shaft 16 ; ( 2 ) provide a retaining ring ( made of metal , for example ) with three prongs which are inserted into three holes made toward the end of cylindrical shaft 16 and are at evenly spaced intervals circumnavigating shaft 16 . ( 3 ) provide a modified end of shaft 16 in the form of a barbed lock which is inserted through the sleeve ( hole ) 6 in the apex of the cupholding ring using a mechanical press . it pops out of the bottom of the sleeve and can not go back thus securing the cupholding ring to the shaft . ( 4 ) provide a four - pronged cored out barbed lock which operates similarly but does not have to be mechanically pressed . ( 5 ) provide a two - pronged split tail barbed lock which serves the same purpose only using two prongs instead of four . tab 171 is connected to the top of shaft 16 and contacts ring 113 when shaft 16 is inserted through the sleeve ( hole ) 6 ( see fig1 - 22 ). clip 203 shown in fig2 - 26 is similar to clip 103 . it differs primarily in that vertical component 170 is shorter and rib 250 is wider than rib 150 and does not extend as far . also , a molded plastic spring ( not shown ) is preferably used . curved flange / hangers 108 , 109 shown in fig1 - 22 are similar to flanges 8 , 9 . they differ primarily in that flanges 108 , 109 have flange ears 111 located at the end of each flange . flange ears 111 can be used to assist the narrowed portion of a bottleneck 14 of bottle 27 to enter into and securely rest in flanges 108 , 109 . to attached cup holder 110 to bleacher 112 , clip 103 is moved forward and around bleacher 112 so that downward projection 155 hugs the top part 117 of the bleacher lip . to detach cup holder 110 , clip 103 is moved away from the bleacher forward panel 40 . spring 165 engages front panel 40 . the following is a list of parts and materials suitable for use in the present invention : 1 cup / bottle support 2 retainer / ring cap 3 clip / shaft combination / bracket 4 upwardly curved shaker holding flange 5 lip clip 6 opening / hole 7 trash bag mount / hanger 8 curved flange / hanger 9 curved flange / hanger 10 bleacher attachable cup holding device 11 angled flange 12 bleacher rail / stadium seat 13 ring 14 bottle neck 15 cup 16 cylindrical shaft / post 17 inner lip 19 cup / bottle holding apparatus 20 bleacher attachable cup holding device 21 rail 22 stop 23 clip 25 car 26 stop cap 27 bottle 30 bleacher attachable cup holding device 31 clip 32 hole / opening 33 cap 34 cylindrical shaft 35 vertical flat shaft 36 arrow indicating rotation of ring 13 37 arrow indicating sliding movement of car 25 38 upper panel 39 groove 40 forward flange or panel 41 rear flange or panel 42 front bottom panel 43 rear bottom panel 44 recess 45 opening 46 larger diameter upper end 103 clip / shaft combination / bracket 108 curved flange / hanger 109 curved flange / hanger 110 bleacher attachable cup holding device 111 flange ears 112 bleacher 113 ring 117 inner lip of bleacher 112 142 front bottom panel 143 rear bottom panel 150 perimeter support rib 155 downward projection 160 top leg 165 spring 166 slit 170 vertical component 171 tab 203 clip 250 perimeter support rib all measurements disclosed herein are at standard temperature and pressure , at sea level on earth , unless indicated otherwise . the foregoing embodiments are presented by way of example only ; the scope of the present invention is to be limited only by the following claims .	0
referring to fig1 there is shown a typical walk - behind rotary lawn mower designated 10 . lawn mower 10 includes an engine 12 mounted on a base 14 that is supported by two pairs of opposed wheels , of which only two wheels 16 and 18 are shown . a handle 22 is attached to the base 14 for manually guiding and / or pushing the lawn mower . base 14 includes a housing , shroud , or cowling 20 that extends around the wheels and a rotatable blade 23 . an interior surface 25 of housing 20 encloses the blade 23 and defines a blade chamber 21 within which the blade 23 rotates and the lawn clippings whirl . it should be understood that any type of lawn mower may utilize the present invention , thus , although a rotary , walk - behind mower is depicted in fig1 the present invention is not limited to such use , and therefore may be used with riding lawn mowers , garden tractors , and other propelled or self - propelled lawn mowers . in accordance with the present invention , a washer ring 24 is positioned on the surface of the ground and is coupled to a garden hose 26 . the garden hose 26 is shown coupled to a water faucet , however , it should be understood that any water source of adequate pressure may suffice . placement of the water ring 24 is preferably directly underneath or below the blade 23 , but can be placed anywhere underneath the housing 20 where the water will be directed into the blade chamber 21 . positioning the water ring 24 directly below the blade 23 allows full utilization of the rotating blade during the cleansing process . although the washer ring 24 is oriented in fig1 such that the water hose 26 connects with washer ring 24 from the rear of the mower 10 , it should be understood that washer ring 24 may be oriented in any direction relative to the mower 10 and not degrade the performance of the washer ring 24 . referring now to fig2 and 3 there is depicted an enlarged view of the present washer ring 24 . washer ring 24 includes an annular conduit 30 , preferably fabricated from a metal , typical of current lawn sprinklers and the like , such as stainless steel , aluminum , etc , but which can be a pvc or other material suitable as a water conduit for pressurized water . it has been found that the diameter of annular conduit 30 should , preferably , not exceed eight inches ( 8 &# 34 ;), and can be less . a support or brace 31 is disposed radially inwardly of annular conduit 30 . support 31 includes four arms 32 , 33 , 34 , 35 , each of which extend radially inwardly from a respective point on the inner periphery of annular conduit 30 , the respective points being equidistant along the annular periphery or 90 ° from each other . it should here be appreciated that support 31 may include more arms or less arms than shown , or may constitute a plate or plate - like structure . each arm 32 , 33 , 34 , 35 , terminates at a ring 49 that forms a part of spike or stake 46 . since annular conduit 30 is rigid , support 31 essentially provides a central position for stake 46 and retains the same . attached to a periphery of annular conduit 30 is a conduit extension 38 that is preferably fashioned from like materials as annular conduit 30 . conduit extension 38 is approximately twelve inches ( 12 &# 34 ;) in length , and terminates in a hose coupler 40 or like connector adapted to releasably attach to a typical garden hose or other water supply conduit . since annular conduit 30 is preferably eight or less inches in diameter , conduit extension 38 allows an operator to connect and disconnect the water supply hose 26 and operate the valve 42 while the mower 10 is positioned over the washer ring 24 . disposed within conduit extension 38 and proximate hose coupler 40 is a conventional type ball valve 42 or the like , with an actuating handle or lever 43 positioned on the surface of extension conduit 38 . the ball valve 42 permits a range of water flow rates into annular conduit 30 from a maximum flow rate determined by the water supply to zero flow , such that the operator may turn on the flow of water from the faucet 28 and completely control the water from washer ring 24 . it should be appreciated that valve 43 may be any type of suitable fluid valve that includes the ability to provide a range of flows varying from no flow to a maximum flow . specifically referring now to fig3 annular conduit 30 is shown in cross - section . annular conduit 30 defines an annular d - shaped interior chamber 50 that is in communication with passageway 44 defined by extension conduit 38 . as can be appreciated from fig3 annular conduit 30 includes an annular flat surface or portion 52 on one axial end , that essentially defines a cross - section of annular conduit 30 as a d - shaped toroid . annular flat surface 52 is adapted to abut the surface of the ground when washer ring 24 is in operation , and provides stability thereto . annular flat 52 also creates a low profile in order to allow the mower 10 to be placed thereover . a stake 46 is centrally located relative to annular conduit 30 and as indicated above , is retained by support 31 through ring 49 . stake 46 includes a knob 48 that enables an operator to grasp and insert stake 46 into the ground in order to releasably retain or immobilize washer ring 24 onto the ground . knob 48 also assists in the removal of stake 46 and thus washer ring 24 . stake 46 is oriented such that annular flat 52 abuts or is disposed adjacent the ground in order to achieve a low overall profile when inserted into the ground . annular conduit 30 includes a semicircular wall 54 in which there are disposed a plurality of orifices or apertures collectively designated 56 and 58 . apertures 56 form a first annular pattern or formation about annular conduit 30 , while apertures 58 form a second annular pattern or formation about annular conduit 30 . each annular pattern 56 , 58 includes a select number of apertures , preferably twelve , equally annularly spaced about annular conduit 30 . each annular pattern 56 , 58 thus forms or defines an annular spray pattern or formation . with particular reference to fig6 each of the apertures collectively designated 56 and 58 includes respective spray nozzles collectively designated 60 and 62 that includes respective nozzle bores 64 and 66 , collectively . the nozzles may be standard brass spray nozzles as is well known in the sprinkler or fluid spraying arts , or similar structures that allow for a controlled spray . apertures 58 that define the second annular spray pattern are preferably disposed in wall 54 perpendicular to the ground or parallel to a vertical axis of washer ring 24 , such that the spray emanating from each nozzle 62 is essentially directed upwardly . apertures 56 that define the first annular pattern are situated at an angle φ ( φ °) from the perpendicular to the ground or parallel to the vertical axis of between 0 ° to 46 °, and preferably , as depicted , at a φ ° of 45 °. the perpendicular annular spray pattern defined by collective apertures 58 directs the cleansing water spray essentially vertically upwards into the blade chamber 21 and blade 23 , while the angled annular spray pattern defined by collective apertures 56 directs the cleansing water spray essentially outwardly towards the corners of the interior surface 25 of housing 20 . the angled annular spray pattern thus directs the cleansing water towards the area within the blade chamber 21 that generally clogs and compacts with clippings the most . it should also here be noted that the present washer ring is designed to operate with the mower running and the blade rotating in order to most effectively distribute the water and swirl it at sufficient velocity to dislodge the compacted clippings and thoroughly cleanse the blade chamber 21 . referring to fig4 and 5 there is shown an alternative embodiment of the washer ring depicted in fig2 and 3 , and described hereinabove . washer ring 70 of fig4 includes an annular conduit 72 with a support structure or brace 73 having four arms 74 , 75 , 76 , 77 that each radially inwardly extend from an inner periphery of the annular conduit 72 in like manner to the washer ring 24 of fig2 and 3 . the arms 74 , 75 , 76 , 77 terminate at ring 78 of a spike or stake 80 . a knob 82 is disposed on the upper part of ring 78 for grasping the spike 80 for inserting and removing the spike 80 as described hereinabove with reference to washer ring 24 . annular conduit 72 is likewise connected to an extension conduit 84 so as to be in fluid communication therewith . extension conduit 84 terminates in a hose coupler 86 that is adapted to couple to a hose or other water supply conduit . a valve ( not shown ) is disposed in extension conduit 84 proximate hose coupler 86 , in like manner to washer ring 24 , and includes a valve actuator handle or lever 88 for permitting the operator the control the flow of water from a no flow to a full flow at the washer ring 72 itself rather than at the water source or faucet . annular conduit 72 further includes a plurality of apertures collectively designated 94 and 96 . in like manner , function , and form to collective apertures 56 and 58 of washer ring 24 , collective apertures 94 forms or defines a first annular spray pattern or formation that directs water upwardly perpendicular to the ground or parallel to a vertical axis of the washer ring , while collective apertures 96 forms or defines a second annular spray pattern or formation that directs water upwardly and radially outwardly at an angle defined from the perpendicular ( see fig6 ). this angle is defined by and follows the same criteria as that for washer ring 24 , above . washer ring 72 includes a stand or guard 92 that essentially encompasses and conforms to the outer surface of annular conduit 72 , and may be fabricated from a plastic such as is common to current sprinklers and known in the art . in this manner an annular flat portion 92 of stand 92 is disposed adjacent annular flat portion 89 of annular conduit 72 . stand or guard 72 thus protects annular conduit 72 from puncture or otherwise . it should be appreciated that in both embodiments , only one annular spray pattern or formation is necessary for the efficient functioning of the present invention . it is preferred that the single pattern be the angled annular spray pattern defined by the radially outwardly disposed apertures ( 56 of fig2 and 3 ; 96 of fig4 and 5 ). in operation , when the operator decides to cleanse the mower , preferably a short time after finishing the mowing , the washer ring is placed onto the ground . this may be accomplished virtually anywhere , but preferably where the ground is flat and a hose or other water supply conduit is available . referring to the embodiment depicted in fig2 and 3 , the operator grasps knob 48 and pushes or drives stake 46 fully into the ground until the annular flat portion 52 abuts the surface of the ground . at this point valve 42 should be closed . a hose is connected to hose coupler 40 and the water supply is commenced to flow . the operator may then either actuate lever 43 to open the valve 42 to the desired flow and position the running mower over washer ring 24 , or actuate the valve 42 after positioning the mower thereover . although the present washer ring 24 can operate without the mower running , it is more effective if the blade is rotating to help circulate and throw the water or cleansing fluid into the blade chamber . the procedure is reversed in order to cease cleansing the mower . while the foregoing is directed towards the preferred embodiment of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims which follow .	8
suitable bioactive materials include triclosan , chlorhexidine , iodopropargyl butyl carbamate ( ipbc ), orthophenyl phenol , parachlorometaxylenol ( pcmx ), parachloro ortho benzyl phenol , tertiary amyl phenol , pine oil , mixed phenol disinfectants , mixed phenol and quats . suitable water soluble polymers for forming the polymer - surfactant complex in the matrix of the invention includes pvp , alkylated pvp copolymers , pva - vinyl acetate copolymers , and the like . suitable anionic sulfactants include sulfonic acid derivatives , such as sodium dodecyl sulfate , laureth sulfate , alkyl sulfonate , sarcosinate , alkyl phosphate ester , and the like . the presence of the water soluble pvp polymer in the matrix is essential for forming a polymer - surfactant complex which can dissolve the bioactive material even with low amounts of surfactant present in the composition . both the use of a low level of anionic surfactant and the complexing polymer like pvp provides a substantially irritant - free composition . the amount of sds to solubilize the active in water depends on the active to be solubilized and concentration of the active ingredient . the higher the active ingredient concentration , the higher the amount of sds to be added . for compositions of the polymer - surfactant - complex and hydrophobic bioactive materials the weight ratio of bioactive material to polymer suitably is 1 : 5 to 5 : 0 . 5 , preferably 1 : 0 . 2 to 1 : 2 . the weight ratio of bioactive material to surfactant suitably is 1 : 10 to 2 : 1 , preferably 1 : 3 to 1 : 5 . the use level of bioactive suitably is 10 ppm to 10 %, preferably 100 ppm to 5 %, and most preferably 0 . 05 % to 0 . 2 %. the rest is water . 3 % triclosan was dissolved in water containing , by weight , 3 % polyvinylpyrrolidone ( pvp k - 30 ) and 10 % sodium dodecyl sulfate ( sds ). the aqueous concentrate was diluted at 1 / 10 , 1 / 30 , 1 / 60 , and 1 / 120 to produce optically clear , ready - to - use disinfectant compositions . triclosan in these compositions were in the nano - particle range . compositions with lower than 10 % sds or with 10 % sds in the absence of pvp did not dissolve the triclosan . a use formulation containing , by weight , 3 % triclosan , 3 % pvp k - 30 and 10 . 5 % sds was diluted with water at a weight ratio of 1 / 450 to a final concentration of 66 ppm triclosan , 66 ppm pvp k - 30 and 230 ppm sds . the diluted sample remained clear without any precipitate . while the amount of sds at this dilution is below the cmc of sds itself , it was above the critical aggregation concentration of an insitu formed pvp - sds complex . thus , the disinfectant active triclosan ingredients were maintained soluble in water at this low surfactant content because it was present in the polymer - surfactant complex . 5 . 4 % 2 - phenylphenol was dissolved in water containing , by weight , 2 . 3 % pvp k - 30 and 16 . 6 % sds . the aqueous concentrate was diluted at 3 . 6 / 100 and 1 . 9 / 100 to produce optically clear , ready - to - use disinfectant compositions . 2 - phenylphenol in these compositions was in the nanoparticle range . 4 . 2 % triclosan was dissolved in water containing , by weight , 3 . 2 % pvp k - 30 and 17 % sds . the aqueous concentrate was diluted at 4 . 6 / 100 and 2 . 3 / 100 to produce optically clear , ready - to - use disinfectant compositions . triclosan in these compositions was in the nanoparticle range . 2 % triclosan was dissolved in water containing , by weight , 2 % pvp k - 30 and 7 % sds . the optically clear aqueous concentrate was diluted at 1 / 10 and 1 / 20 to produce optically clear , ready - to - use disinfectant compositions . triclosan in these compositions was in the nanoparticle range . 2 % triclosan was added to water containing , by weight , 2 % pvp k - 30 . triclosan remained undissolved in the aqueous concentrate . 2 % triclosan was added to water containing , by weight , 7 % sds . the sample was heated to 60 ° c . for 3 days . triclosan remained undissolved in the aqueous concentrate . 1 % ferulic acid was dissolved in water containing , by weight , 2 . 8 % pvp k - 30 and 6 . 3 % sds . the aqueous solution was optically clear and in the nanoparticle range . 5 . 4 % pcmx was dissolved in water containing , by weight , 16 . 5 % sds and 2 . 3 % pvp k - 30 . the aqueous concentrate was diluted at 1 / 10 , 1 / 20 , 1 / 40 , 1 / 100 , and 1 / 450 to produce optically clear , ready - to - use disinfectant compositions . pcmx in these compositions was found to be in nanoparticle range . 2 % pcmx was dissolved in water containing , by weight , 6 % sds and 1 % pvp k - 30 . the aqueous concentrate was diluted at 1 / 10 , 1 / 20 to produce optically clear , ready - to - use disinfectant compositions . pcmx in these compositions was found to be in nanoparticle range . the formulation described in example 10 was diluted in di water to contain 1000 ppm of pcmx . antimicrobial activity was demonostrated against pseudomonas aeruginosa ( atcc 10145 ) and bacillus subtilis ( atcc 27328 ). one hundred microliters of an overnight culture of each bacterial cell suspension were inoculated into the diluted sample to a final concentration of about 10 7 cfu / ml . the same bacterial suspension was also added to di water to serve as a control . after 5 minutes incubation time at room temperature , the samples were serially diluted in modified letheen broth and plated onto modified letheen agar . plates were incubated at 32 ° c . for 24 hours and bacterial growth enumerated . log reduction was calculated based on the log difference in bacterial counts between the control sample ( no pcmx ) and pcmx containing sample . the results are presented in the following table . 2 % pcmx was added to water containing , by weight , 2 % pvp k - 30 . pcmx remained undissolved in the aqueous concentrate . 4 . 9 % pcmx was dissolved in water containing , by weight , 13 . 8 % sds and 4 % pvp k - 30 . this clear aqueous concentrate was diluted at 1 / 10 , 1 / 20 to produce optically clear , ready - to - use disinfectant compositions at rt ( 18 ° c .). pcmx in these compositions was found to be in nanoparticle range . 4 . 9 % pcmx was added to water containing , by weight , 14 . 4 % sds . the sample was heated and cooled to rt ( 18 ° c .). pcmx remained undissolved in the aqueous concentrate . while the invention has been described with particular reference to certain embodiments thereof , it will be understood that changes and modifications may be made which are within the skill of the art .	0
the base plate 4 is disposed in a retained or latched condition between two abutments 5 , 6 , referring to the latching region 10 . when the travelling pad 3 with the base plate 4 is pushed into the guide grooves 1 the base plate 4 slides over the abutment 6 . upon that occurrence , the base plate 4 is elastically deformed . when the travelling pad 3 is worn the base plate 4 is adapted to be lifted over the abutment 6 through an opening indicated by a phantom line at 7 , by means of a tool represented by line 11 ( not shown ), and is to be levered out by way of a further tool ( also not shown ) which is to be inserted as indicated by the arrow 8 . the base plate 4 is disposed in a main plane 9 , and is free of any incisions , in essence it is in the form of a tongueless base plate 4 . referring to fig2 in a departure from fig1 a base plate 14 is provided with a deformation or shaping 15 formed by non - cutting shaping . the main plane 9 and the tongue plane 16 form an angle 17 . that results in frictional contact when the travelling pad 13 is pushed in or out of the tubular body 2 , only between the deformation 15 and the abutment 6 . the shaping zones in the latching region 10 which result in the formation of the tongue 15 are described with reference to fig7 . referring to fig3 and 4 , in the case of a travelling pad 23 — similarly to fig2 and 7 — a base plate 24 with a tongue 25 which is formed therefrom by non - cutting shaping or deformation is provided in the latching region 10 . the base plate 24 extends in terms of surface area with the major part thereof over the travelling pad 23 . an elastomer layer 26 is disposed between a wearable steel body 27 which engages into the guide grooves 1 in a tubular body 22 , which is shown in dash - dotted line . similarly to the abutments 5 , 6 shown in fig1 and 2 , the base plate 24 is also disposed between abutments 28 and 29 . an opening for lifting the tongue 25 out of the tubular body 22 is identified by reference numeral 30 . as shown in fig5 to 7 , a travelling pad 33 which is fixed in a tubular body 32 has a base plate 34 corresponding to that of fig2 and 4 . the base plate 34 has two shaped or deformation zones 36 in the retaining region 10 . those shaped zones 36 provide for the formation of a deformation 35 corresponding to the angle 17 with respect to the main plane 9 , as shown in fig2 . the base plate 34 , which extends between abutments 38 and 39 , is the carrier of the travelling pad 33 and at the same time it serves to form a positively locking connection with the tubular body 32 by engagement into the guide grooves 31 of the tubular body 32 . an opening 40 serves for disengagement of the deformation 35 at the abutment 39 . in the case of a crawler track 50 as shown in fig8 tubular bodies 51 with guide teeth 52 are hingedly connected together by means of rubber - mounted pins 53 which are arranged in the tubular bodies 51 , and connectors 54 which are fixed on the pins 53 . each tubular body 51 has guide grooves 55 and abutments 56 , 57 for fixing a travelling pad 63 . the abutment at the insertion side is denoted by reference numeral 56 and the abutment at the rear side is denoted by reference numeral 57 . as shown in fig9 an intermediate plate 64 with guide bars 65 for the guide grooves 55 and a base plate 74 with a deformations or shaped portion 75 are joined to the travelling pad 63 through vulcanizing . the deformation or shaped portion 75 has rubber disposed therebeneath in the latching region 10 . as shown in fig8 the tongue 75 of the base plate 74 has a double corrugated shape . that is afforded by the three shaped zones 76 and 77 as shown in fig1 . in addition the base plate 74 has an end abutment 78 which corresponds with a rear wall 79 with the abutment 57 of the tubular body 51 . the abutment 56 of the tubular body 51 is provided with a central recess 80 which corresponds to an oppositely disposed recess 81 in of the travelling pad 63 . finally , the base plate 74 has stiffening beads or corrugations 81 which are disposed in the direction of travel 80 of the crawler track 50 , as shown in fig1 .	1
preferred embodiments of the present invention will be described hereinafter in detail with reference to the accompanying drawings . a communication system according to a first embodiment of the present invention starts a communication by causing a switchboard to transmit information on addresses of switchboard terminals other than a switchboard terminal of the switchboard , and the switchboard terminal that has received the addresses to select a communication partner from among the switchboard terminals at the received addresses , and to pass the address of the selected switchboard terminal to independent general - purpose p2p communication software incorporated in the switchboard terminal . furthermore , while the switchboard terminal is holding a voice communication , a communication starts by passing address information on a voice output destination to the general - purpose communication software . if the switchboard terminal separates from the p2p general - purpose communication software and differs in address , a communication starts by registering information for coupling them with each other in the switchboard and passing the information to the switchboard terminal in response to a request from the switchboard terminal . moreover , if the switchboard terminal is holding a voice conference , a communication starts by passing address information on a voice conference partner to the switchboard terminal . a configuration of the communication system using voice lines ( i . e ., an internal voice line and an external voice line ) and a lan line in an office as shown in fig1 will be described . it is assumed that a communication method realized by the p2p communication software is a video communication . in the office , a voice switchboard 101 ( hereinafter , simply “ switchboard ”) switching voice communication , a voice and video terminal 102 used by a user a and connected to a lan line , a voice and video terminal 103 used by a user b and connected to the lan line , a video terminal 104 used by a user c and connected to the lan line , a voice terminal 107 connected to a voice internal line , a voice terminal 105 used by a user d and connected to the lan line , a video terminal 106 connected to the lan line , a cti ( computer telephony integration ) server 109 connected to the switchboard 101 and realizing cti , and a presence server 110 managing and notifying status information ( presence ) of the terminals 102 to 107 are present . further , the switchboard 101 is connected to a voice communication network 108 via a voice external line . in this way , the switchboard 101 is connected to the voice communication network 108 and the terminals 102 to 107 , and controls connection of voice communications held by the terminals 102 to 107 . the cti server 109 mediates a communication between cti client software mounted in each of the terminals 102 to 106 connected to the lan line and the switchboard 101 . the presence server 110 communicates with the switchboard 101 and the terminals 102 to 106 connected to the lan line , constantly updates and holds the status information ( presences ) of the terminals 102 to 107 , and transmits a notification to each of the terminals 102 to 106 and the switchboard 101 in response to a request . referring now to fig2 , operations performed by respective constituent elements of each of the terminals 102 to 107 will be outlined . a user interface (“ i / f ”) 201 receives input signals from a keyboard , a mouse or the like and outputs video signals to a display . a voice source i / f 202 transmits and receives voice data to and from a voice source 208 connected to the voice source i / f 202 . a voice internal line i / f 203 transmits and receives signals to and from the voice communication line . a lan line i / f 204 transmits and receives signals to and from the lan line . a cpu 205 controls entirety of the terminal . a memory 206 is used as a work area when software or data necessary to control the terminal is used . a terminal software 211 is software stored in the memory 206 and executed by the cpu 205 . a video i / f 209 receives signals input from a video camera 210 connected to the video i / f 209 . referring to fig3 , operations performed by respective constituent elements of the switchboard 101 will be outlined . a voice internal line i / f 301 transmits and receives signals to and from the voice communication line . a lan line i / f 302 transmits and receives signals to and from the lan line . a voice external line i / f 303 transmits and receives signals to and from the voice external line . a cpu 304 controls entirety of the switchboard 101 . a memory 305 is used as a work area when software or data necessary to control the switchboard 101 is used . a database 306 is an area for holding various setting data stored in the memory 305 . fig4 is a schematic diagram showing a module configuration of software 211 stored in the memory 206 in each of the voice and video terminals 102 and 103 . switchboard terminal software 402 and video communication software 408 are application software operating on an os ( operating system ) 401 . the switchboard terminal software 402 is constituted by various software modules . a switchboard i / f 403 controls communication with the switchboard 101 . a voice communication control unit 404 controls voice signal communication by communicating with the voice source i / f 202 , the voice internal line i / f 203 , and the lan line i / f 204 . a cti server i / f 405 controls communication with the cti server 109 by communicating with the lan line i / f 204 . a presence server i / f 406 controls communication with the presence server 110 by communicating with the lan line i / f 204 . user setting data 407 stores therein a user id and a password of the user of the terminal , information on a current communication partner and the like . the video communication software 408 is a general - purpose p2p communication software and has a video communication capability to start communication between the terminals in which the video communication software is mounted , to transmit and receive video data , and to perform a communication end processing in the first embodiment . the video communication software 408 includes a function of receiving address information on a communication partner , i . e ., the other software mounted in the same terminal , and starting a communication with the partner according to the address information . fig5 shows an example of contents of the database 306 stored in the memory 305 of the switchboard 101 . in a “ switchboard user id ” area 501 , id information on each of the users using the switchboard 101 is stored . in a “ switchboard user password ” area 502 , a password corresponding to the user id is stored . in a “ possible communication method : address : port ” area 503 , a possible communication method of the terminal used by each user , an address of the terminal , and a port number used by the communication method in the terminal are stored . if the terminal supports a plurality of communication methods , a plurality of information is stored in the “ possible communication method : address : port ” area 503 . in a “ communication partner user id ” area 504 , a user id or an external line number of a communication partner is stored if the user is holding a communication . in an “ external line ” area 505 , the number of each voice external line connected to the switchboard 101 is stored . in a “ communication partner number ” area 506 , a telephone number of the communication partner on a voice external line having the external line number is stored . fig6 shows an example of contents of the terminal software 211 stored in the memory 206 of each of the voice and video terminals 102 and 103 . in a “ switchboard user id ” area 601 , a switchboard user id of a user using the terminal 102 or 103 is stored . in a “ switchboard user password ” area 602 , a password corresponding to the user id is stored . in a “ possible communication method : address : port ” area 603 , a possible communicate method of the terminal , the address of the terminal , and the port number used by the communication method in the terminal are stored . if the terminal supports a plurality of communication methods , a plurality of information is stored per user id . if the terminal is connected to the voice line , an internal line number is stored in place of the address and the port number . a “ communication partner ” area 604 is an area in which information on the communication partner is stored during a voice or video communication of the terminal . namely , in the “ communication partner ” area 604 , a user id , an address , and a port number of the communication partner are stored . if the communication partner is a terminal that does not include a lan line i / f and that is connected to the voice line or a terminal that is connected to the voice external line , an internal line number or an external line number is stored in the “ communication partner ” area 604 in place of the address , and the port number of the communication partner . in a “ communication destination port initial value ” area 605 , a default destination port used if the communication port of the communication partner is unknown for every communication method is stored . first , an instance in which the user a starts a video communication with the user b while the user a is not on the phone will be described with reference to the flowchart of fig7 . it is assumed herein that only the address and the port for the voice communication are stored in the “ possible communication method : address : port ” area 603 in the terminal software 211 stored in the memory 206 of each of the voice and video terminals 102 and 103 . it is also assumed that the terminal configuration of each of the voice and video terminals 102 and 103 is such that the voice internal line i / f 203 is not present in the configuration of the voice and video terminal shown in fig2 . first , the user a input a user id and a password using the keyboard and display 207 of the voice and video terminal 102 . in response to the input , the cpu 205 and the switchboard terminal software 402 operating in the memory 206 receive information on the user id and the password of the user a via the user i / f 201 and the os 401 , respectively . further , the input user id is stored in the “ switchboard user id ” area 601 and the password is stored in the “ switchboard user password ” area 602 . the user id and the password as well as the information stored in the “ possible communication method : address : port ” area 603 of the voice and video terminal 102 are passed to the os 401 via the switchboard i / f 403 , and transmitted to the switchboard 101 via the lan i / f 204 . when receiving the information via the lan line i / f 302 , the switchboard 101 searches the received user id from the areas 501 in the database 306 , and checks whether the password stored in the area 502 corresponding to the hit area 501 is identical with the received password . if the switchboard 101 confirms that the both passwords are identical , the switchboard 101 stores the received information of “ possible communication method : address : port ” in the corresponding area 503 . likewise , the user b registers the voice and video terminal 103 in the switchboard 101 ( step 701 ). the user a performs an operation for calling a video communication partner list using the keyboard and display 207 of the voice and video terminal 102 . in response to the operation , a user list disclosure request is passed from the switchboard terminal software 402 to the os 401 via the switchboard i / f 403 , and transmitted to the switchboard 101 via the lan i / f 204 . when receiving the information via the lan line i / f 302 , the switchboard 101 extracts all the information stored in “ switchboard user id ” areas 501 and “ possible communication method : address : port ” areas 503 corresponding to all the users in the database 306 included in the switchboard 101 , and transmits the information to the voice and video terminal 102 . the switchboard i / f 403 of the switchboard terminal software 402 in the voice and video terminal 102 receives the information via the lan line i / f 204 and the os 401 , and the voice and video terminal 102 displays the information on the display 207 via the user i / f 201 ( step 702 ). the user a performs an operation for selecting the video communication partner using the keyboard and display 207 of the voice and video terminal 102 . in response to the operation , the user id of the selected video communication partner is passed from the switchboard terminal software 402 to the os 401 via the switchboard i / f 403 , and transmitted to the switchboard 101 via the lan line i / f 204 . when receiving the information via the lan line i / f 302 , the switchboard 101 searches the received user id from the “ switchboard user id ” areas 501 in the database 306 of the switchboard 101 , extracts information described in the “ possible communication method : address : port ” area 503 corresponding to the hit record ( area 501 ), and transmits the extracted information to the voice and video terminal 102 . the switchboard i / f 403 of the switchboard terminal software 402 in the voice and video terminal 102 receives the information via the lan line i / f 204 and the os 401 ( step 703 ). the switchboard terminal software 402 checks the received possible communication method , address , and port to confirm whether video communication is present in the area 603 . in the first embodiment , since the address and the port for the video communication are not described in the area 603 , the switchboard terminal software 402 extracts only the address for the voice communication , extracts a video communication port ( port 101 ) described in the “ communication destination port initial value ” area 605 as the port , and passes the address and the port to the video communication software 408 . at the same time , the switchboard terminal software 402 writes contents of the information in the “ communication partner ” area 604 in the user setting data 211 as video communication partner information ( step 704 ). the video communication software 408 starts a video communication by setting the received address and port as the communication destination ( step 705 ). in the first embodiment , it is assumed that only the address and the port for the voice communication are stored in the “ possible communication method : address : port ” area 603 in the terminal software 211 stored in the memory 206 of each of the voice and video terminals 102 and 103 . alternatively , not only the address and the port for the voice communication but also the address and the port for the video communication may be stored in the “ possible communication method : address : port ” area 603 . in this alternative , the user a can confirm whether the communication partner is a video - communicable terminal in advance at the step 703 . moreover , at the step 704 , the switchboard terminal software 402 passes the address and the port for the video communication among the information of the possible communication method , address , and port received from the switchboard 101 to the video communication software 408 . it is thereby possible for the terminal 102 to flexibly set the video communication port . furthermore , in the first embodiment , the p2p communication software has been described while taking that for the video communication as an example . however , as long as the software enables communication only by receiving the address and the port , the software is not limited to the video communication software . by changing the video communication software 408 to arbitrary p2p communication software , the present invention is applicable to various communication methods such as mail communication , instant message communication , file sharing communication , whiteboard sharing communication , and application sharing communication . in the first embodiment , it is necessary for each user to manually select the video communication partner by operating the terminal of the user . however , during a conversation , the communication partner may be automatically selected so as to be able to start a video communication . an instance of automatically selecting the communication partner will be described with reference to the flowchart of fig8 . it is assumed herein that the address and the port for the voice communication and those for the video communication are stored in the “ possible communication method : address : port ” area 603 of each of the voice and video terminals 102 and 103 . a step 801 is the same as the step 701 according to the first embodiment . the voice and video terminal 102 transmits signals to the voice and video terminal 103 using the voice internal line , thereby establishing a voice communication . at this time , the address and the communication method ( voice communication ) of the voice signal destination ( i . e ., the terminal of the voice communication partner ) are stored in the “ communication partner ” area 604 in the user setting data 211 . further , the switchboard software 402 writes the user id of the communication partner in the “ communication partner user id ” area 504 corresponding to each user in the database 306 of the switchboard 101 ( step 802 ). the user a performs an operation for staring a video communication with the current voice communication partner using the keyboard and display 207 of the voice and video terminal 102 . in response to the operation , a current communication partner information request is passed from the switchboard terminal software 402 to the os 401 via the switchboard i / f 403 , and transmitted to the switchboard 101 via the lan line i / f 204 . when receiving the current communication partner information request via the lan line i / f 302 , the switchboard 101 reads information described in the “ communication partner user id ” area 504 corresponding to the user a in the database 306 , and searches the “ switchboard user id ” area 501 corresponding to the user id described in the area 504 . further , the switchboard 101 extracts the possible communication method , address , and port from the “ possible communication method : address : port ” area 503 corresponding to the hit area 501 , and transmits the extracted information to the voice and video terminal 102 . the switchboard i / f 403 of the switchboard terminal software 402 of the voice and video terminal 102 receives the information via the lan line i / f 204 and the os 401 ( step 803 ). the switchboard terminal software 402 checks the received possible communication method , address , and port , and confirms whether the video communication is present in the “ possible communication method : address : port ” area 503 . if the video communication is present , the switchboard terminal software 402 passes the address and the port for the video communication to the video communication software 408 , and at the same time , writes contents of the address and the port for the video communication in the “ communication partner ” area 604 in the user setting data 211 stored in the voice and video terminal 102 as the video communication partner information ( step 804 ). the video communication software 408 starts a video communication while setting the received address and port as the communication destination ( step 805 ). in the second embodiment , the switchboard 101 is inquired about the communication partner information at the step 803 . alternatively , if the communication partner information stored in the terminal 102 is used , there is no need to inquire the switchboard 101 about the communication partner information . in this alternative , the switchboard terminal software 402 reads the information described in the “ communication partner ” area 604 in the user setting data 211 at the step 803 . the switchboard terminal software 402 passes the address and the port described in the area 604 to the video communication software 408 at the step 804 . it is thereby possible to control the video communication without using the switchboard 101 at all . in the preceding first and second embodiments , the voice terminal is identical with the video terminal and the voice and video terminals have the same address . however , the video terminal and the voice and video terminals may be different terminals . an instance in which the video terminal and the voice and video terminals are different will be described with reference to the flowchart of fig9 . it is assumed herein that the address and the port for the video communication are stored in the “ possible communication method : address : port ” area 603 of each of the video terminals 104 and 106 , that the address and the port for the voice communication are stored in the “ possible communication method : address : port ” area 603 of the video terminal 105 , and that the “ possible communication method : address : port ” area 603 of the voice terminal 107 is blank . it is also assumed that the internal line number of the voice terminal 107 is set in the “ possible communication method : address : port ” area 503 corresponding to the user c described in the “ user id area ” 501 of the database 306 of the switchboard 101 , as the address for the voice communication in advance , and that no port is described in the same “ possible communication method : address : port ” area 503 . it is further assumed that the voice terminal 107 is already activated and on standby . moreover , it is assumed that the terminal configuration of each of the video terminals 104 and 106 is such that the voice internal line i / f 203 and the voice source i / f 202 are not present in the configuration of the voice and video terminal shown in fig2 , the terminal configuration of the voice terminal 105 is such that the voice internal line i / f 203 and the video i / f 209 are not present in the configuration of the voice and video terminal shown in fig2 , and that the terminal configuration of the voice terminal 107 is such that the video i / f 209 and the lan line i / f 204 are not present in the configuration of the voice and video terminal shown in fig2 . first , the user c registers the video terminal 104 and the voice terminal 107 in the switchboard 101 , and the user d registers the voice terminal 105 and the video terminal 106 in the switchboard 101 using their respective user ids and passwords , respectively through procedures similar to that of the step 701 in the first embodiment ( step 901 ). the voice terminal 107 transmits signals to the voice terminal 105 using the voice internal line , thereby establishing a voice communication . at this time , the address and the communication method ( voice communication ) of the voice signal destination ( i . e ., the terminal of the voice communication partner ) are stored in the “ communication partner ” area 604 in the user setting data 211 stored in the terminal 107 . further , the switchboard software 402 writes the user id of the communication partner in the “ communication partner user id ” area 504 corresponding to each of the users c and d in the database 306 of the switchboard 101 when establishing the voice communication between them ( step 902 ). the user c performs an operation for staring a video communication with the current voice communication partner using the keyboard and display 207 of the voice and video terminal 104 ( step 903 ). in response to the operation , the switchboard terminal software 402 passes a current communication partner information request to the os 401 via the switchboard i / f 403 , and the current communication partner information request is transmitted to the switchboard 101 via the lan line i / f 204 . when receiving the current communication partner information request via the lan line i / f 302 , the switchboard 101 reads information described in the “ communication partner user id ” area 504 corresponding to the user c in the database 306 , and searches the “ switchboard user id ” area 501 corresponding to the user id described in the area 504 . further , the switchboard 101 extracts the possible communication method , address , and port from the “ possible communication method : address : port ” area 503 corresponding to the hit area 501 , and transmits the extracted information to the video terminal 104 . the switchboard i / f 403 of the switchboard terminal software 402 of the video terminal 104 receives the information via the lan line i / f 204 and the os 401 ( step 904 ). the switchboard terminal software 402 checks the received possible communication method , address , and port , and confirms whether the video communication is present in the “ possible communication method : address : port ” area 503 . if the video communication is present , the switchboard terminal software 402 passes the address and the port for the video communication to the video communication software 408 , and at the same time , writes contents of the address and the port for the video communication in the “ communication partner ” area 604 in the user setting data 211 stored in the video terminal 104 as the video communication partner information ( step 905 ). the video communication software 408 starts a video communication while setting the received address and port as the communication destination ( step 906 ). in the preceding first to third embodiments , the address and the port of the communication partner are passed to the video communication software 408 at the start of the video communication , and the video communication software 408 is entrusted with the subsequent video communication control . due to this , even if the voice communication is finished , the user is forced to manually instruct the video communication software 408 for the video communication . alternatively , the switchboard terminal software 402 may detect end of the voice communication using the cti server i / f 405 , and instruct the video communication software 408 to finish a video communication , thereby automatically finishing the video communication simultaneously with the end of the voice communication . an instance of automatically finishing the video communication simultaneously with the end of the voice communication using the cti server i / f 405 will be described with reference to the flowchart of fig1 . it is assumed herein that the switchboard terminal software 402 of the video terminal 104 is connected to the cti server 109 via the cti server i / f 405 and that the voice terminal 107 is registered as a cti control target . it is also assumed that the cti server 109 acquires a status ( presence ) of the voice terminal 107 by communicating with the voice switchboard 101 and transmits the status information to the cti server i / f 405 of the video terminal 104 . further , it is assumed that all the procedures at the steps 901 to 906 are already carried out . first , a voice communication between the voice terminal 107 of the user c and the voice terminal 105 of the user d is finished ( step 1001 ). the switchboard 101 notifies the cti server 109 of the end of the voice communication between the voice terminals 105 and 107 via the ian line i / f 302 simultaneously with the end of the voice communication . the cti server 109 notifies the cti server i / f 405 of the video terminal 104 that the voice terminal 107 finishes the voice communication ( step 1002 ). the switchboard terminal software 402 of the video terminal 104 reads video communication partner information from the “ communication partner ” area 604 corresponding to the user c in the user setting data 211 , deletes the information from the area 604 , and then passes a video communication end instruction as well as the information to the video communication software 408 ( step 1003 ). the video communication software 408 finishes the video communication for which the received address and port are set as the communication destination ( step 1004 ). in the fourth embodiment , the switchboard terminal software 402 detects the end of the voice communication by using the cti server i / f 405 . alternatively , the switchboard terminal software 402 may detect the end of the voice communication using the presence server i / f 406 , and instruct the video communication software 408 to finish a video communication , thereby automatically finishing the video communication simultaneously with the end of the voice communication . an instance of automatically finishing the video communication simultaneously with the end of the voice communication using the presence server i / f 406 will be described with reference to the flowchart of fig1 . it is assumed herein that the switchboard terminal software 402 of the video terminal 104 is connected to the presence server 110 via the presence server i / f 406 and that the voice terminal 107 is registered as a presence watching target . it is also assumed that the presence server 110 acquires a status ( presence ) of the voice terminal 107 by communicating with the switchboard 101 and transmits the status information to the presence server i / f 406 of the video terminal 104 . further , it is assumed that all the procedures at the steps 901 to 906 are already carried out . first , a voice communication between the voice terminal 107 of the user c and the voice terminal 105 of the user d is finished ( step 1101 ). the switchboard 101 notifies the presence server 110 that the presence of the voice terminal 107 changes from a state of holding a voice communication to a standby state , via the lan line i / f 302 simultaneously with the end of the voice communication . the presence server 110 notifies the presence server i / f 406 of the video terminal 104 that the voice terminal 107 finishes the voice communication ( step 1102 ). the switchboard terminal software 402 of the video terminal 104 regards the information as the end of the voice communication , reads video communication partner information from the “ communication partner ” area 604 corresponding to the user c in the user setting data 211 , deletes the information from the area 604 , and then passes a video communication end instruction as well as the information to the video communication software 408 ( step 1103 ). the video communication software 408 finishes the video communication for which the received address and port are set as the communication destination ( step 1104 ). in the preceding first to fifth embodiments , one - to - one voice or video communication is held . alternatively , a video conference communication may be held by interlocking the voice or video communication with a voice conference by a plurality of terminals . an instance of holding a video conference communication will be described with reference to the flowchart of fig1 . it is assumed herein that the address and the port for the voice communication and the address and the port for the video communication are stored in the “ possible communication method : address : port ” area 603 of the voice and video terminal 102 , that the address and the port for the video communication are stored in the “ possible communication method : address : port ” area 603 of each of the video terminals 104 and 106 , that the address and the port for the voice communication are stored in the “ possible communication method : address : port ” area 603 of the voice terminal 105 , and that the “ possible communication method : address : port ” area 603 of the voice terminal 107 is blank . it is also assumed that the internal line number of the voice terminal 107 is set in the “ possible communication method : address : port ” area 503 corresponding to the user c described in the “ user id area ” 501 of the database 306 of the switchboard 101 , as the address for the voice communication in advance , and that no port is described in the same “ possible communication method : address : port ” area 503 . it is further assumed that the voice terminal 107 is already activated and on standby . further , it is assumed that the video communication software 408 can simultaneously hold video communications with a plurality of communication partners . moreover , it is assumed that the terminal configuration of each of the video terminals 104 and 106 is such that the voice internal line i / f 203 and the voice source i / f 202 are not present in the configuration of the voice and video terminal shown in fig2 , the terminal configuration of the voice terminal 105 is such that the voice internal line i / f 203 and the video i / f 209 are not present in the configuration of the voice and video terminal shown in fig2 , and that the terminal configuration of the voice terminal 107 is such that the video i / f 209 and the lan line i / f 204 are not present in the configuration of the voice and video terminal shown in fig2 . first , the user a registers the voice and video terminal 102 , the user c registers the video terminal 104 and the voice terminal 107 , and the user d registers the voice terminal 105 and the video terminal 106 in the switchboard 101 using their respective user ids and passwords , respectively through procedures similar to that of the step 701 in the first embodiment ( step 1201 ). a conference communication is established among the voice and video terminal 102 , the voice terminal 107 , and the voice terminal 105 . at this time , the addresses and the communication methods ( voice communication ) of the voice signal destinations ( i . e ., the terminals of the voice communication partners ) are stored in the “ communication partner ” area 604 in the user setting data 211 in each of the terminals 102 , 105 , and 107 . further , the switchboard software 402 of each of the terminals 102 , 105 , and 107 writes the user ids of the communication partners in the “ communication partner user id ” area 504 corresponding to each of the users a , c , and d in the database 306 of the switchboard 101 when the conference communication is held among them ( step 1202 ). the user c performs an operation for staring a video communication with the current voice communication partners using the keyboard and display 207 of the voice and video terminal 104 ( step 1203 ). in response to the operation , the switchboard terminal software 402 of the voice and video terminal 104 passes a current communication partner information request to the os 401 via the switchboard i / f 403 , and the current communication partner information request is transmitted to the switchboard 101 via the lan line i / f 204 . when receiving the current communication partner information request via the lan line i / f 302 , the switchboard 101 reads information described in the “ communication partner user id ” area 504 corresponding to the user c in the database 306 , and searches a plurality of “ switchboard user id ” areas 501 corresponding to the user ids described in the areas 504 , respectively . further , the switchboard 101 extracts the possible communication methods , addresses , and ports from the “ possible communication method : address : port ” areas 503 corresponding to the hit plural areas 501 , and transmits all the extracted information as well as the user ids to the video terminal 104 . the switchboard i / f 403 of the switchboard terminal software 402 of the video terminal 104 receives the information via the lan line i / f 204 and the os 401 ( step 1204 ). the switchboard terminal software 402 checks all the received possible communication methods , addresses , and ports , and confirms whether the video communication is present in each of the “ possible communication method : address : port ” areas 503 . if the video communication is present in each of the “ possible communication method : address : port ” areas 503 , the switchboard terminal software 402 displays the user ids of a plurality of video - communicable video communication partner candidates on the display 207 via the user i / f 201 . thereafter , the user c performs an operation for selecting an arbitrary video communication partner from among the displayed user ids using the keyboard and display 207 of the video terminal 104 ( step 1205 ). in response to the selection operation , the switchboard terminal software 402 passes the address and the port of the selected user id for the video communication to the video communication software 408 , and at the same time , writes contents of the address and the port for the video communication in the “ communication partner ” area 604 in the user setting data 604 stored in the video terminal 104 as the video communication partner information ( step 1206 ). the video communication software 408 starts a video communication while setting the received address and port as the communication destination ( step 1207 ). the user c can additionally perform the operation for selecting a video communication partner from among the displayed user ids using the keyboard and display 207 of the video terminal 104 if the user wants to hold a video communication with another user . in this case , the procedures at the steps 1206 to 1208 are repeatedly carried out whenever the selection operation is performed ( step 1208 ). although the exemplary embodiments of the present invention have been described in detail , it should be understood that various changes , substitutions and alternatives can be made therein without departing from the sprit and scope of the invention as defined by the appended claims . further , it is the inventor &# 39 ; s intent to retain all equivalents of the claimed invention even if the claims are amended during prosecution .	7
in general , the following transformer fault symptoms can be attributed to the failure modes listed thereafter : the three dominant types of winding faults are an open winding , a turn or layer bypass and a winding short circuit . any of these faults can occur in either the primary or secondary windings , but the majority will occur in the primary winding . most such faults are due to corruption of the winding insulation , involving a flashover or dielectric puncture of the insulation , which establishes a fault path through an electric arc . this will generally cause melting of the conductors with resulting displacement of conductor material through globulation and vaporization , interrupting the continuity of the winding and causing an open winding condition which can be readily detected by resistance measurement . occasionally the gap will be bridged by carbon and metallic particles , noticeably increasing the resistance of the winding . detectability will then depend upon the resistance of the bridged path . moreover , in most cases the fault punctures the insulation between winding layers and welds together conductors in the adjacent layers , creating a short circuited winding or , if turns of the shorted layer burn open , a layer bypass . these conditions cannot be reliably detected by resistance measurements alone , since the resulting resistance differs by only a few percent from the nominal value , which has a substantial tolerance . the present invention provides a method and apparatus for analyzing a faulty distribution transformer and ascertaining which failure mode is responsible for the fault . in a preferred embodiment , the analysis covers three parameters : 1 . winding resistance : every transformer winding consists of a finite length of metal conductor which therefore has a measurable dc resistance . measurement is accomplished using a portable multimeter capable of measuring resistances of less than 1 kω . 2 . magnetizing impedance : this consists of two components , the magnetizing reactance and the core losses . magnetizing reactance represents the energy that is periodically stored and recovered with each half cycle of the applied 60 hz voltage in orienting the magnetic domains of the transformer core . the core losses are represented by equivalent resistance model of the power losses due to the rotation of the magnetic domains and eddy current losses in the core . magnetizing impedance is measured by energizing the transformer from one of the windings while the other is disconnected from all load . the impedance is the ratio of the voltage and the current into the energized winding . the reactance and resistance values can be determined by measuring the angular displacement between the current and voltage traces . because it is normally very high , magnetizing impedance is quite sensitive to even relatively minor defects in the transformer such as shorted turns . this measurement is taken from both windings , each while the other is disconnected from all load , to obtain a measure of the impedance balance . 3 . winding ratio : this is the ratio of turns on the primary and secondary windings . the effective ratio will be affected by the loading of the transformer and the presence of shorted turns . thus , a transformer in good condition with no load connected to its secondary terminals should provide an effective winding ratio value which is very close to the nominal design value given by the turns ratio . this ratio is also measured from both windings , to obtain a measure of the winding ratio balance . fig1 illustrates a distribution transformer analyzer embodying the subject invention , connected to a dual - secondary transformer . a test power supply supplies a low voltage signal through current shunts and shunt switches to a supply switch selector , which selects between a dc test voltage ( preferably 6 v ) and one of two ac test voltages ( preferably 2 v for testing the low voltage winding and 80 v for testing the high voltage winding ) produced by an ac converter . the analyzer thus selectively energizes combinations of the primary and secondary windings through the four test leads using the supply select switches , with minimal battery drain because the duration of each test can be less than one second . the test leads for connection to the low voltage bushings are each provided with separate power and measuring wires , to eliminate the effects of conductor resistance , and all leads are appropriately fused . the transformer analyzer in a preferred embodiment incorporates the functions of an ohmmeter , ratiometer and impedance meter , controlled by a microprocessor . the measuring circuitry , illustrated in fig2 includes an analog - to - digital ( a - d ) converter , a scaling circuit , an ac - dc converter , shunts for measuring currents and a switching network . the microprocessor conventionally sets all switches and iteratively adjusts scales to obtain the most accurate reading for any selected test , and the a - d converter output is passed directly to the microprocessor for processing . fig3 schematically illustrates the digital components of the transformer analyzer circuitry . the microprocessor is connected to the output and input multiplexers that allow for data entry and control of the analogue functional blocks . the switch configurations are determined by registers loaded from the output bus . data from the a - d converter is routed through the input bus . the several operator interface input / output devices include a small keypad for scan - list type data entry , requiring no more than 5 keys . for example , the operator could scan through a list of transformer kva sizes using &# 34 ; up &# 34 ; and &# 34 ; down &# 34 ; scan keys , and select the appropriate size using an &# 34 ; enter &# 34 ; key . the preferred data scan - list is as follows : primary voltages : 19 . 92 , 16 , 14 . 4 , 13 . 86 , 12 . 42 , 8 . 32 , 8 , 7 . 2 , 4 . 8 , 2 . 4 kv kva ratings : 167 , 100 , 75 , 50 , 37 . 5 , 25 , 15 , 10 , 5 , 3 kva all programming , scan - lists and pass fail criteria are contained in a single rom chip , which can be easily replaced to upgrade , expand or modify the device . the analyzer may optionally include a non - volatile ram to retain records of tests and test results which , used in conjunction with means for entering transformer system location data and downloading to a larger computer system , could also produce a useful transformer / fuse failure survey instrument . in use , the operator scans through the scan - lists and enters required data from the transformer nameplate . this can be done on the ground or in the service vehicle . the analyzer is then carried up to the transformer and the test leads are clamped to the designated transformer bushings . the operator then simply depresses the &# 34 ; test &# 34 ; button to initiate a test sequence that will acquire and evaluate all test data , over a period of about 20 seconds . the analyzer output will then indicate a fault / no fault condition through a pass / fail light system , with an optional audible alarm in the case of a fault condition , and may identify the type of fault on a small alpha - numeric display such as a 40 character lcd window . initially , the transformer is tested with the secondary load still connected . therefore the analyzer &# 34 ; load &# 34 ; selector is initially set at &# 34 ; connected &# 34 ;. if the analysis indicates no fault , the transformer is simply re - energized . if the analysis indicates a fault , the secondary load is disconnected for replacement of the transformer . at this point a second analysis may be conducted , with the &# 34 ; load &# 34 ; selector set to &# 34 ; not connected &# 34 ;. in this configuration the analyzer can use more refined pass / fail criteria to positively confirm the existence of a fault and identify its type . if this second analysis indicates a no fault condition , contrary to the initial analysis , then service personnel must inspect the secondary conductors or service equipment to detect a fault that may have escaped an initial visual inspection . the method of the present invention will now be described with reference to a transformer having two secondary ( low voltage ) windings , which is typical of distribution transformers currently in use in north america . for the small minority of transformers having only a single secondary winding , only parameters or data preceded by an asterisk () are required to perform the analysis . the method of the present invention , in a preferred embodiment , involves calculation of the following transformer parameters : r sw1 = secondary winding resistance between terminals x 1 and x 2 [ ω ] r sw2 = secondary winding resistance between terminals x 3 and x 2 [ ω ] r sw3 = secondary winding resistance between terminals x 1 and x 3 [ ω ] * n p1 = primary to secondary ( x 1 - x 2 ) ratio [ per unit of nominal ratio ] n p2 = primary to secondary ( x 2 - x 3 ) ratio [ per unit of nominal ratio ] * n ps1 = secondary ( x 1 - x 2 ) to primary ratio [ per unit of nominal ratio ] n ps2 = secondary ( x 2 - x 3 ) to primary ratio [ per unit of nominal ratio ] n s12 = secondary ( x 1 - x 2 ) to secondary ( x 2 - x 3 ) ratio [ per unit ] n s21 = secondary ( x 3 - x 2 ) to secondary ( x 1 - x 2 ) ratio [ per unit ] n s23 = secondary ( x 3 - x 2 ) to secondary ( x 1 - x 3 ) ratio [ per unit ] * k n1 = primary to secondary ( x 1 - x 2 ) ratio balance k n2 = primary to secondary ( x 3 - x 2 ) ratio balance k ns =( x 1 - x 2 ) to ( x 2 - x 3 ) ratio balance * z mp = shunt impedance measured from the primary [ p . u . of base impedance ] * z ms1 = shunt impedance from the ( x 1 - x 2 ) secondary [ p . u . of base impedance ] z ms2 = shunt impedance from the ( x 3 - x 2 ) secondary [ p . u . of base impedance ] * k z1 = impedance balance between the primary and the ( x 1 - x 2 ) secondary k z2 = impedance balance between the primary and the ( x 3 - x 2 ) secondary k zs = impedance balance between the ( x 1 - x 2 ) and the ( x 3 - x 2 ) secondaries the raw data required to be measured in order to calculate these transformer parameters is as follows : v pdc = dc voltage applied to the high voltage winding [ v ] i pdc = dc current flowing as a result of voltage application v pdc [ a ] v 1dc = dc voltage applied to the x 1 - x 2 secondary winding [ v ] v 2dc = dc voltage applied to the x 3 - x 2 secondary winding [ v ] i 1dc = dc current flowing as a result of voltage application v 1dc [ a ] i 2dc = dc current flowing as a result of voltage application v 2dc [ a ] v p = test voltage applied to the high voltage winding [ v ] i p = current flowing into the winding as a result of v p [ a ] v sp1 = voltage between secondary terminals x 1 and x 2 due to v p [ v ] v sp2 = voltage between secondary terminals x 3 and x 2 due to v p [ v ] v s1 = test voltage applied between secondary terminals x 1 and x 2 [ v ] i s1 = current flowing into the winding as a result of v s1 [ a ] v ps1 = voltage across the high voltage winding due to v s1 [ v ] v s2 = test voltage applied between secondary terminals x 3 and x 2 [ v ] i s2 = current flowing into the winding as a result of v s2 [ a ] v ps2 = voltage across the high voltage winding due to v s2 [ v ] fig8 and 9 illustrate relay contact positions for measuring each of these values . v hr = voltage rating of the high voltage winding [ kv ] ( in case of transformers with multiple taps , this is the currently selected tap ) v sr = principal voltage rating of the secondary winding [ v ] ( 120 v for 240 / 120 v secondaries ) v sv = combined voltage rating of all secondary windings [ v ] ( 240 v for 240 / 120 v secondaries , for all other cases v sv = v sr ) based on the input of transformer nameplate data prior to testing , the analyzer calculates the following data : ## equ1 ## resistances are calculated from the raw data using ohm &# 39 ; s law . since resistance varies substantially as between transformers of different manufacturers , and is not provided on the transformer nameplate , a comparison can be made to upper and lower limits as provided in the table of fig6 . determining secondary winding resistance is somewhat more complicated , because resistance must be determined from each leg of the secondary , but the same general approach of determining resistance limits from the specified transformer impedance is followed . the presence of a load on the secondary has no effect on the dc resistance measurements in the primary , but the load resistance will appear in parallel with the secondary winding resistance . however , even in the most extreme cases the load resistance is unlikely to be less than four times the maximum resistance of the secondary winding , which is typically in the range of a fraction of an ohm . since the test instrument might only be capable of measuring resistances above 50 mω , the utility of this measurement is limited to detecting open winding conditions by ascertaining that the total resistance is less than , for example , 25 % of the minimum load resistance . thus , a faulty transformer is identified by the following criterion : if r . sub . sl & lt ; 50 mω then r . sub . sw1 & gt ; 0 . 5z . sub . b / n . sub . 12 or r . sub . sw2 & gt ; 0 . 5 z . sub . b / n . sub . 12 the transformer ratio is defined as the ratio of high voltage winding turns to low voltage winding turns . it is measured with no load on the transformer , by exciting one winding to its rated voltage and measuring the output voltage on the others . in a fault - free transformer , this measurement should be within ± 0 . 5 % of the nameplate data . this requires a voltage measurement accuracy greater than ± 0 . 1 %, which may be difficult to attain in a field instrument . the transformer ratio parameters are determined from the raw data using the following equations : ## equ2 ## based on an assumed instrument accuracy of ± 0 . 25 %, the total transformer ratio error is the allowable ratio error ( 0 . 5 %) plus the instrument error for each voltage measurement ( 2 × 0 . 25 %), or ± 1 %. the maximum allowable ratio balance error is four times the instrument error , or ± 1 %. ( i ) the criterion to detect a faulty transformer by individual secondary winding ratios is : ( ii ) the criterion to detect a faulty transformer by the ratio balances is : the presence of a load on the secondary produces a voltage drop on the transformer leakage impedance , which affects the apparent ratio . for a transformer connected to its secondary load : ( i ) the criterion to detect a faulty transformer by individual secondary winding ratios is : ( ii ) the criterion to detect a faulty transformer by the ratio balance is : these broad criteria are unlikely to detect many small layer - to - layer faults , and can be narrowed by compensating for transformer and load impedances . to compensate for the effects of transformer and load impedances , the total impedance reflected into the primary terminals of the transformer is computed as follows : ## equ3 ## where : z t = total impedance [%] changes in apparent winding ratio and magnetizing impedance are related , because of the equivalent circuit of a faulty transformer , which is illustrated in fig5 x p = leakage reactance portion assigned to the primary winding [ ω ] x s = leakage reactance portion assigned to the secondary winding [ ω ] x f = leakage reactance portion assigned to the faulted winding section [ ω ] r m = resistance representing excitation losses of the transformer [ ω ] from fig6 it will be evident that the faulted winding will appear as a low impedance branch in parallel with the actual magnetizing impedance of the transformer . thus , the effective magnetizing impedance of the transformer , as measured at the winding terminals , will be lower than for an unfaulted transformer . the effective magnetizing impedance of a faulted transformer is the apparent ratio measured under these conditions is higher than the actual ratio , because of the voltage drop in the transformer leakage impedance caused by the load current . since there is no way of determining from the measured data the extent to which the load is balanced , it is necessary to assume the worst case condition for any given parameter . this compensation can only be applied to ratios measured from the primary . for secondary measurements the following compensating equation is used : ## equ6 ## where : n px = corrected transformer ratio of subscript &# 34 ; x &# 34 ; θ t = measured or assumed angular displacement of i p [ degrees ] this gives rise to the practical problem of determining the values of z l % and k xr , because problems of providing a low impedance shorting connection across the secondary terminals cannot be readily solved in a portable instrument . three options for deriving these parameters are as follows : ( i ) the criterion to detect a faulty transformer by individual secondary winding ratios is : ( ii ) the criterion to detect a faulty transformer by the ratio balances is : a ) calculation based on assumed z l % , k xr , and measured θ t the angular displacement of the current into the load through the transformer can be measured directly , but the arrangement will increase significantly the complexity of the measuring system . however , the benefit will be an increased accuracy of the corrected value of the ratio . the errors of this approach have been evaluated for the extremes of all the parameters using correction factors based on the maximum k xr and z l % = 1 . 7 %. the following test criteria have been derived . ( i ) the criterion to detect a faulty transformer by individual secondary winding ratios is : ( ii ) the criterion to detect a faulty transformer by the ratio balances is : b ) calculations based on assumed k r , θ t and on nameplate specified z l % most transformers in service today include the leakage impedance in the nameplate data . based on the transformer failure study , the nameplate can be missing or it is illegible in some 20 % of all cases . in the remaining 80 % of transformers , the value could be determined and input to the tester , increasing somewhat the complexity of the test . c ) calculation based on assumed k xr , measured θ t and on nameplate specified z l % this is the most complex and also the most accurate method of determining the ratio of a loaded transformer . the test criteria are as follows . ( i ) the criterion to detect a faulty transformer by individual secondary winding ratio is : ( ii ) the criterion to detect a faulty transformer by the ratio balances is : a particularly useful criterion for ascertaining certain types of faults , such as layer and turn faults when the secondary load is connected to transformer terminals , is the ratio balance . the winding ratios as determined in the primary and secondary windings should balance , i . e . be substantially equal . the ratio balance is essentially the ratio of the winding ratio measured from the primary ( forward ) to the winding ratio measured from the secondary ( reverse ). the ratio balance can be tested under load , and is accordingly quite a useful criterion for transformer analysis . ( i ) the criterion to detect a faulty transformer by the magnetizing impedance is : ( ii ) the criterion to detect a faulty transformer by the impedance balance is : an impedance test on an unloaded transformer will detect all fault conditions except layer bypass or special open winding conditions . as established through failure survey measurements , in a properly working transformer the minimum impedance limit is 25 p . u . of z b ( 4 % magnetizing current ) and the maximum is 200 p . u . of z b ( 0 . 5 % magnetizing current ). ( i ) the criterion to detect a faulty transformer by the magnetizing impedance is : ( ii ) the criterion to detect a faulty transformer by the impedance balance is : when the secondary load is still connected , the measured impedances include the load impedance . thus , impedance values can be as low as 0 . 25 p . u . of z b ( base impedance of the transformer ) even in a good transformer , due to cold load pickup . the test is still useful since many faulty transformers exhibit impedance values well below this level . however , because of the uncertain disposition of the load , the impedance balances are unlikely to provide a useful indication of the transformers condition . ( i ) the criterion to detect a faulty transformer by impedance measurement in the presence of a load is : as in the case of the ratio balance , the impedance balance can be a very useful criterion for determining certain types of fault conditions such as layer and turn faults , with no load connected to the transformer . the impedance balance is calculated in both the forward and reverse directions , i . e . from the perspective of the primary winding and then the secondary winding , and the ratio of these two calculations , the impedance balance , should be approximately one . a different result indicates a fault condition . determination of the above criteria and comparison with known values for a fault - free transformer , examples of which are given in fig6 and 7 , will provide a transformer profile which will indicate the fault conditions listed above in most cases of faulty transformers . combining the comparisons in the three parameters winding resistance , magnetizing impedance and winding ratio increases the accuracy of the analysis to the extent that results will often be corroborative . the winding ratio balance and the impedance balance each provide a high degree of accuracy in fault analysis , and are useful even apart from other results in determining the presence of a fault ; it is nevertheless expected that in most cases a comparative study of all parameters will help to determine the specific fault in any given case . the invention having thus been described by way of a preferred embodiment , it will be obvious to those skilled in the art that certain modifications and adaptations may be made without departing from the scope of the invention as set out in the appended claims .	6
reference is now had to fig2 through 5 illustrating a preferred embodiment of the present invention . the fluid jet loom embodying the present invention is different from the conventional device as to the structure of the weft yarn cutter 10 which is substituted for the cutter 5 , but is otherwise the same as the aforementioned conventional device . therefore , the same parts or components are designated by the same reference numerals . a fixed blade 11 placed towards the selvedge is fitted to a fixed support shaft 12 on a machine frame , not shown , and is secured at the rear end to a fixed shaft 11a projecting away from the selvedge so as to be unrotatable relative to the machine frame . a movable blade 13 is carried for free rotation by said support shaft 12 and has an arm 13a extending obliquely down in the opposite direction to the cutting edge and carrying a drive pin 14 . an l - shaped lever 16 is mounted by a shaft 15 for rotation relative to the loom frame and has one end connected through said drive pin 14 to said movable blade 13 . the lever 16 is biased by a tension spring 17 for rotation counterclockwise in fig2 . a cam follower 20 is mounted for rotation about its own axis towards the distal end of the lever 16 and contacts by a rolling motion with a cam 19 secured to a rotary shaft 18 . a weft yarn guide 23 formed by a cylindrical boss 21 and a triangular guide plate 22 is fitted on the support shaft 12 externally of the rotary blade 13 . a guide groove 22a is formed on the upper edge of the guide plate 22 while a tapped hole 21a is formed in the boss 21 . the weft yarn guide 23 is secured to the support shaft 12 by a presser screw 24 threaded to said tapped hole so that the guide groove 22a is positioned slightly above the edge end of the fixed blade 11 , as seen in fig2 . a weft yarn deflector 25 is mounted to the support shaft 12 externally of the weft yarn guide 23 and for rotation about said support shaft . a weft yarn deflecting portion 25a is provided to the foremost part of the weft yarn deflector 25 for extending forwardly of the guide groove 22a of the guide plate 22 . the weft yarn deflector 25 has its upper end formed with an engaging hole 25b for engagement by a boss 27a at the foremost part of a movable iron core 27 of a solenoid 26 mounted for rotation relative to the loom frame . this solenoid 26 comes into operation when a trouble caused in inserting the weft yarn has been detected by the weft yarn sensor 8 ( fig1 ). the weft yarn cutter 10 thus far described operates as follows . in the weft yarn cutter 10 , the solenoid 26 is normally inoperative and the weft yarn deflector 25 is positioned so that the upper edge of the weft yarn deflective portion 25a is at a lower level than the guide groove 22a of the guide plate 22 of the weft yarn guide 23 . when the loom is driven into operation in this state and the weft yarn is laid down in the open warp shed , the weft yarn end towards the weft yarn inserting nozzle 3 ( fig1 ) is introduced into the guide groove 22a of the weft yarn guide 23 . as the cam 19 is rotated clockwise in fig2 along with the rotary shaft 18 with progress in the loom operation , the lever 16 is kept in the fixed position as long as the lesser diameter portion of the cam 19 contacts the cam follower 29 . when the contact portion has passed the lesser diameter portion , the lever 16 is turned clockwise against the force of the tensile spring 17 . when the lever 16 has turned from the solid - line position to the double - dotted chain line position in fig2 the rotary blade 13 is also rotated counterclockwise from the solid - line position to the double - dotted chain line position in fig2 for cutting the weft yarn disposed in the guide groove 22a . with continued rotation of the cam 19 , the lever 16 is turned counterclockwise under the force of the tensile spring 17 and returned to the starting position , the rotary blade 13 being similarly returned to the starting position . rotation of the cam 19 is synchronized to the swinging movement of the sley 1 so that the rotary blade 13 is rotated in the weft yarn cutting direction as soon as the reed beats up the preceding weft yarn . thus , in normal loom operation , the weft yarn is cut for each weft inserting operation as soon as the reed beats up the preceding weft yarn . when a trouble in the weft inserting operation is sensed by the sensor 8 during loom operation , the solenoid 26 is energized via the control circuit 41 and the movable iron core 27 is retracted into the solenoid 26 against the force of a spring ( not shown ) enclosed in the solenoid 26 . the weft yarn deflector 25 is rotated to a position shown in fig4 wherein the upper edge of the deflective portion 25a is at the same level as the upper edge of the guide plate 22 . in this state , the end of the weft yarn being inserted is not introduced into the guide groove 22a of the weft yarn guide 23 when the sley 1 is swung towards the cloth fell , but rides on the upper edge of the deflective portion 25a . thus , when the sley 1 is turned in a direction away from the cloth fell after beating , the weft yarn end slides on the upper edge of the weft yarn deflective portion 25a and is not engaged at the cutting point , that is , the guide groove 22a , so that the weft yarn is not cut in spite of rotation of the rotary blade 13 . in this manner , in the fluid jet loom provided with the weft yarn cutter 10 , the weft yarn deflector 25 is energized through solenoid 26 via a control circuit 41 immediately after the weft yarn sensor 8 has sensed the trouble in weft yarn insertion during loop operation for disabling the weft yarn cutting function of the weft yarn cutter 10 . the weft yarn inserted after beating the defective weft yarn length y 1 and until the loom is halted by operation of the loom stop mechanism 42 takes the form of a letter u with one end y 2 contiguous to the defective weft yarn y 1 , as shown in fig5 . hence the defective weft yarn y 1 may be extracted by pulling the weft yarn y 2 layed down in the form of the letter u , while the loom is operated slowly in reverse by manual operation or by actuation of a push button associated with inching . in this manner , the complicated operation of removing the defective weft yarn as required in the conventional practice may be dispensed with . extraction of the weft yarn may also be effected through suction by using an air suction gun or the conventional vacuum sucker 40 . for disabling the weft yarn cutting function of the weft yarn cutter 10 , the weft yarn may be deflected away from the weft yarn guide 23 by direct operation from the solenoid and hence the yarn deflector 25 may be dispensed with . alternatively , the rotary blade 13 may be designed to rotate in the direction of the support shaft 12 or the rotation of the rotary blade 13 may be disabled when the defect has been sensed in the insertion of the weft yarn . in the above preferred embodiment , the succeeding uncut weft yarn portion y 2 which is inserted into the shed contiguous to the sensed defective weft yarn y 1 is not gripped , so that the loom operation is stopped , via the loom stop mechanism 42 which is also actuated by the control circuit 41 , with the uncut weft yarn y 2 inserted in the shed in the u shape by the weft insertion nozzle , as illustrated in fig5 . however , the loom operation may be stopped while inhibiting the insertion of the uncut weft yarn contiguous to the defective weft yarn . in this case , there is no weft yarn supplied in the u - shape from the weft insertion nozzle , so that the amount of the weft yarn to be extracted with the defective weft yarn may be reduced and the operation of extracting the defective weft yarn may be facilitated . insertion of the uncut weft yarn may be inhibited by providing a conventional vacuum sucker 40 between the weft insertion nozzle 3 and the shed so that the sucker 40 is energized , via the control circuit 41 as illustrated in fig5 upon detection of trouble in the weft insertion for sucking the weft yarn . vacuum sucker 40 may also be used to remove the defective yarn length y 1 , by drawing in the yarn length y 2 to which the length y 1 is attached . alternatively , the weft yarn may be gripped by a gripper 37 ( fig1 ) between a length measuring device 33 and the nozzle 3 or the operation of the device 33 may be stopped for inhibiting the operation of weft yarn insertion . it is seen from the foregoing description of the preferred embodiment that the weft yarn cutting function of the weft yarn cutter adjacent to the weft insertion nozzle may be disabled temporarily upon trouble detection in the weft yarn insertion and subsequently the loom operation may be stopped while the weft yarn portion to be inserted next time is still uncut and contiguous to the defective yarn for promoting convenience in extracting the defective weft yarn , preferably by using the vacuum sucker 40 . thus the complicated manual operation of pulling out several points of the defective weft yarn into the warp shed by using a tapered needle as required in the conventional device may be dispensed with and the defective yarn may be removed by simply pulling the readily accessible uncut weft yarn portion contiguous to the defective yarn .	3
there are several ways of improving alignment between a fiber optic bundle and an awg . in some cases , quick coarse alignment is followed up with finely aligning the fiber optic bundle and awg afterwards . fig4 shows a first embodiment for aligning a fiber optic bundle to an awg . in this embodiment , the awg 142 is mounted to a base 110 . the fiber optic bundle &# 39 ; s termination head 140 is also mounted to the base 110 via a high viscosity epoxy 120 . in one embodiment , a spacer 122 attached to the base 110 may be used to reduce the thickness of epoxy 120 employed . typical epoxies such as that used in prior art fig3 shrink when cured . this post - bond shrinkage is not a problem in the prior art fig3 since it pulls the termination head 40 closer to the awg 42 . however , if the epoxy of fig4 shrinks , alignment of the fiber optic bundle with the awg will suffer , as the termination block 140 is pulled toward the base 110 . an epoxy having a silicate content of over 70 % by volume has been found to reduce shrinkage . additionally , the high silicate content makes the epoxy very viscous allowing for manual alignment being maintained after being achieved . thus , alignment of the termination head 140 and the awg 142 can be achieved without significant post - bond shrinkage as the epoxy is cured by heat or other methods . raising the silicate content of the epoxy to up to 90 % by volume reduces the post - bond shrinkage even more . however , as the silicate content is increased , the shear strength of the bond is reduced , so a balancing between post - bond shrinkage and shear strength should be performed . the alignment method using the high viscosity epoxy described provides a robust bond area for achieving and maintaining alignment between the fiber optic bundle and the awg . additionally , a gel having a refractive index matching the optical fibers and the awg channels may be dispensed between the fiber optic bundle and the awg . this helps to prevent light from scattering at an air gap between the fiber optic bundle and the awg . fig5 a shows a second embodiment for aligning a fiber optic bundle with an awg using pins ( or dowels / rods ). in one embodiment , the termination head is made with optical fibers filling all of the grooves except for a groove at each end . the ends of the optical fibers are then polished , as usual . pins 200 can then be inserted into the open grooves in the termination block of the fiber optic bundle . fig5 b shows an awg corresponding to the fiber optic bundle of fig5 a . the awg has recesses 202 . in one embodiment , the awg recesses are initially filled with materials different from the rest of the awg . this allows selective etching to form the recesses 202 . however , other methods of making the recesses are possible . the pins 200 of the fiber optic bundle fit snugly into the recesses 202 of the awg to provide coarse alignment . additional manual adjustment to more finely align the fiber optic bundle to the awg may be performed . fig6 shows a cross section of a fiber optic block and an awg joined with pins 200 to perform a coarse alignment . a gel can be dispensed between the fiber optic bundle and the awg to provide better photonic coupling , and an epoxy is used to permanently fix the alignment . fig7 shows a third embodiment for aligning optical fibers to an awg . in this embodiment only one retainer 300 is used in the termination block of the fiber optic bundle , and the optical fibers are attached into the one retainer 300 . v - grooves are etched into the awg &# 39 ; s substrate in the same way that the retainer was etched , however the v - grooves on the awg extend only a predetermined distance across the awg from an edge of the awg . the one retainer 300 is placed over the v - grooves on the awg 320 to sandwich the optical fibers between the retainer 300 and the awg 320 . the optical fibers come to rest within the v - grooves of the awg 320 . the ends of the optical fibers 322 are butted up against the ends of the awg &# 39 ; s v - grooves 324 . the interlocking compatibility between the retainer 300 and the v - grooves of the awg 320 provide for quick coarse alignment of the optical fibers with the channels 350 of the awg . manual adjustment may then be performed to more finely align the optical fibers with the awg . fig8 shows a side view of the retainer 300 placed over the etched awg 320 having channels 350 within . fig9 shows another embodiment in which the awg 325 is etched a predetermined depth below the awg surface before etching the v - grooves . this allows a better coupling to channels 355 that are deeper below the awg surface . in one embodiment , over - etching the awg provides for a better ability to manually align the optical fibers and the awg afterwards . as previously described , gel or epoxy having a refractive index matching the optical fibers and the channels of the awg can be dispensed between the retainer and awg . thus , a device and method of aligning optical fibers in a fiber optic bundle to a waveguide is disclosed . however , the specific embodiments and methods described herein are merely illustrative . numerous modifications in form and detail may be made without departing from the scope of the invention as claimed below . rather , the invention is limited only by the scope of the appended claims .	6
preferred embodiments of the invention will now be described . in drawings referred to below , like reference numerals used in the conventional technique ( shown in fig9 through 13 ) are used to refer to elements having like functions so as to omit the description . a contactless ic card according to embodiment 1 of the invention will now be described with reference to fig1 . the contactless ic card of this embodiment is different from the conventional ic card ( shown in fig9 ) in including a shunt regulator 10 having a frequency characteristic against the power vdd . the shunt regulator 10 includes , as shown in fig2 a low - pass filter ( lpf ) 11 and an nmos transistor m 1 . the lpf 11 allows merely a low frequency component of the power vdd to pass therethrough . a signal having passed through the lpf 11 is supplied to the gate of the transistor m 1 . the drain and the source of the transistor m 1 are respectively connected to the power vdd and the ground vss . as shown in fig2 the lpf 11 is herein composed of resistors r 1 and r 2 and a capacitor c 1 . when it is assumed , for example , that the resistors r 1 and r 2 respectively have resistance of 100 kω and 400 kω and the capacitor c 1 has capacitance of 50 pf , the cutoff frequency of the lpf 11 is approximately 30 khz . at this point , the power consumption of the shunt regulator 10 is , as shown in fig3 large in a low frequency region ( of 30 khz or less ) of the power vdd and is small in a high frequency region including a signal band of an rx signal ( of 100 khz through several mhz ). this means that even when the power consumption of the shunt regulator 10 is increased to suppress the increase of the power vdd , the rx signal is not affected . therefore , degradation of communication quality derived from device variation and temperature change can be suppressed , so as to realize a high performance contactless ic card . it is noted that the modulator circuit 8 , the rectifier 3 , the shunt regulator 10 , the rx signal frequency , the transfer rate , the carrier frequency and the modulation method employed in this embodiment are described merely as specific examples , which do not limit the invention . for example , although a full - wave rectifying circuit is used as the rectifier 3 , any circuit capable of rectifying an ac signal may be used instead . furthermore , although the modulator 8 is connected in parallel to the antenna coil , it may be connected between the power vdd and the ground vss . also , any modulator capable of modulating impedance between the ends of the antenna coil may be used . in a system where there is no need to send a signal , the modulator 8 is not necessary . moreover , although the shunt regulator 10 includes the mos transistor m 1 , a bipolar transistor may be included instead . also , the modulation method may be any of the ask modulation , psk modulation and fsk modulation . in short , the present invention covers all contactless ic cards each including a shunt regulator whose power consumption is large in a low frequency region of the power vdd and is small in a signal band of an rx signal . a contactless ic card according to embodiment 2 of the invention will now be described with reference to fig4 . the contactless ic card of fig4 includes a shunt regulator 40 instead of the shunt regulator 10 of fig1 . the structure apart from the shunt regulator 40 is the same as that of the contactless ic card of fig1 . the contactless ic card of this embodiment is different from that of embodiment 1 in the shunt regulator 40 further consuming power in a high frequency region of the power vdd . the shunt regulator 40 includes , in addition to the elements of the shunt regulator 10 of fig1 ( namely , the lpf 11 and the nmos transistor m 1 ), a lpf 41 and a pmos transistor m 2 . the lpf 41 allows merely a low frequency component of the power vdd to pass therethrough . a signal having passed through the lpf 41 is supplied to the gate of the transistor m 2 . the source and the drain of the transistor m 2 are respectively connected to the power vdd and the ground vss . as shown in fig5 the lpf 41 is herein composed of resistors r 3 and r 4 and a capacitor c 2 . when it is assumed , for example , that the resistors r 3 and r 4 respectively have resistance of 10 kω and 40 kω and the capacitor c 2 has capacitance of 5 pf , the cutoff frequency of the lpf 41 is approximately 3 mz . therefore , the power consumption of the shunt regulator 40 is , as shown in fig6 large in a low frequency region ( of 30 khz or less ) and a high frequency region ( of 3 mhz or more ) of the power vdd and is small in a signal band of an rx signal ( of 100 khz through 3 mhz ). thus , the power vdd can be prevented from increasing and noise caused in a carrier signal and another frequency can be reduced . herein , the noise caused in another frequency means noise generated in the memory , the cpu or the like of the digital signal processor 7 . in this manner , the degradation of the communication quality derived from process variation and temperature change can be reduced , so as to realize a high performance contactless ic card . the shunt regulator 40 used in this embodiment is described merely as a specific example , which does not limit the invention . for example , the shunt regulator 40 may be replaced with a shunt regulator 70 shown in fig7 . the shunt regulator 70 of fig7 uses a band rejection filter ( brf ) 71 instead of the lpf 11 of the shunt regulator 10 of fig1 and 2 . also in such a case , the shunt regulator has a frequency characteristic as shown in fig6 so that a signal component in a carrier wave band can be filtered off . in short , the present invention covers all contactless ic cards each including a shunt regulator whose power consumption is large in low and high frequency regions of the power vdd . furthermore , the power consumption in the rx signal band and that in the high frequency region may be at the same level . in this case , the power consumption in the high frequency region is lowered , so as to reduce the degradation of the signal quality in the rx signal band . thus , the present invention is very useful for realizing a high performance contactless ic card . a contactless ic card according to embodiment 3 of the invention will now be described with reference to fig8 . the contactless ic card of this embodiment is different from those of embodiments 1 and 2 in including an rx demodulator 80 and a signal processor 90 in the semiconductor integrated circuit 2 . the rx demodulator 80 includes a rectifier 3 , a shunt regulator 81 , a charging capacitor ca and a demodulator 6 . the signal processor 90 includes a rectifier 30 , a charging capacitor cb , a shunt regulator 91 and a digital signal processor 7 . the inputs of the rectifier 3 and the rectifier 30 are connected to an antenna coil l 1 . a signal having been rectified by the rectifier 3 is supplied to the charging capacitor ca and the shunt regulator 81 , so as to generate power vdd 1 . the demodulator 6 extracts an rx signal from the power vdd 1 . a signal having been rectified by the rectifier 30 is supplied to the charging capacitor cb and the shunt regulator 91 , so as to generate power vdd 2 for the digital signal processor 7 . the digital signal processor 7 processes the rx signal extracted by the demodulator 6 . as the shunt regulator 81 of this embodiment , the shunt regulator used in any of embodiments 1 and 2 is used . as a result , a contactless ic card free from the degradation of the communication quality can be realized in the same manner as in embodiments 1 and 2 . furthermore , since the signal processor 90 and the rx demodulator 80 are separated from each other , the influence of digital noise generated in the digital signal processor 7 on the demodulator 6 can be further reduced . in this manner , the present invention is very useful for realizing a high performance contactless ic card .	6
the present invention is related to processes for preparing imatinib , intermediates thereof , and pharmaceutical acceptable salts thereof . these processes of the present invention provide imatinib in high yields and purity . also , these processes can be adapted easily to industrial scale because , when using pyridine as a solvent , it is present in small amounts , and the recovery of a substantially pure product is simple and not time consuming . wherein x is cl , br , i , mesyloxy or tosyloxy , preferably x is cl ; n is 0 , 1 or 2 , preferably n = 0 ; hx is an acid selected form the group consisting of : hcl , hbr , hi , methanesulfonic acid , and para - toluenesulofinic acid , preferably hx is hcl ; r 1 is a leaving group selected from the group consisting of : h , cl , and br ; and r is either h or a hydrocarbon group , preferably , h . preferably , the hydrocarbon group is an alkyl or aryl group . preferably , the alkyl group is optionally , substituted by a hetero atom . more preferably , the alkyl group is a c 3 - 8 cyclo - alkyl , a c 4 - 8 cyclo alkenyl , or a c 3 - 8 alkoxy . preferably , the aryl group is phenyl . the first step in these processes comprises preparing a 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid of formula ii . b ) optionally recovering 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid of formula ii ; wherein x is a leaving group selected from the group consisting of cl , br , i , mesyl or tosyl , preferably x is cl , n is 0 , and hx is an acid selected form the group consisting of : hcl , hbr , hi , methanesulfonic acid , and para - toluenesulofinic acid , preferably hx is hcl . the amount of n - methylpiperazine in the reaction of step a ) is about 3 to about 6 , preferably about 4 to about 5 equivalents of the amount of the benzoic acid derivative with which it is reacted . in the above process of the present invention , the reaction is done in the presence of an organic solvent . preferably , the organic solvent is a protic organic solvent , more preferably , an alcohol , even more preferably , a c 1 - 6 alcohol , more preferably , methanol , ethanol , n - propanol , iso - propanol , n - butanol , iso - butanol , sec - butanol , n - pentanol , iso - pentanol , sec - pentanol , n - hexanol , and mixtures thereof , most preferably , n - butanol . combining the two reactants and the solvent provides a solution . the solution is maintained at a temperature of about 15 ° c . to about 30 ° c ., preferably of about 20 ° c . to about 25 ° c . preferably , the solution is maintained for about 2 to about 10 hours , more preferably for about 3 to about 6 hours ; during this time 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid of formula ii is expected to be formed . the compound of formula ii may be recovered by any known process , preferably by evaporating the solvent from the above mixture ; adding a protic organic solvent to obtain a second mixture ; heating the second mixture at a temperature of about 70 ° c . to about 90 ° c ., preferably of about 70 ° c . to about 82 ° c ., more preferably , to a temperature of about 80 ° c . to about 82 ° c . ; cooling the heated second mixture to obtain a precipitate , and filtering the precipitate . preferably , the organic solvent is a protic organic solvent , more preferably , an alcohol , even more preferably , a c 1 - 6 alcohol , most preferably , methanol , ethanol , n - propanol , iso - propanol , n - butanol , iso - butanol , sec - butanol , n - pentanol , iso - pentanol , sec - pentanol , n - hexanol , and mixtures thereof , and even most preferably , iso - propanol . preferably , the heated second mixture is cooled to a temperature of about 15 ° c . to about 30 ° c ., more preferably of about 20 ° c . to about 25 ° c ., to obtain a precipitate . the recovery may further comprise washing the filtered precipitate , and drying . the process for preparing 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid of formula ii may further comprise the conversion of 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid of formula ii to an imatinib salt of the following formula ; wherein hb is an acid , preferably , methanesulfonic acid . the use of the compound of formula ii instead of its acid salt form improves the performance of the process for preparing imatinib or salt thereof due to its solubility in the reaction medium . the conversion of the compound of formula ii to imatinib salt can be carried out for example , by the process disclosed in european patent 208404 , preparation p . this process includes a step where a hydrochloride salt of the acid of formula ii is converted to the activated acid derivative 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl derivative of formula iv or salt thereof of the following formula , where x and r 1 are described before and the compound of formula is isolated . in a preferred embodiment , the reaction for preparing imatinib from the 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl derivative of formula iv or salt thereof comprises and about 2 to about 10 volumes ( 7 to 35 equivalents ) preferably about 4 to about 7 volumes , more preferably about 5 to about 6 volumes per gram of pyridine per gram of the compound of formula iii ; and wherein n is 0 , 1 , or 2 ; r 1 is a leaving group selected from the group consisting of : h , cl , br , mesyl and tosyl , preferably , r 1 is cl ; r is either h or a hydrocarbon group , preferably , h , and ha is an acid selected form the group consisting of : hcl , hbr , hi , methanesulfonic acid , para - toluenesulofinic acid , preferably , the acid is hcl . the reaction is done in the presence of a minimum amount of pyridine , which is about 2 to about 10 volumes ( 7 to 35 equivalents ) preferably about 4 to about 7 volumes , more preferably about 5 to about 6 volumes per gram , which may serve as a solvent and as a base . the amine of formula iii is combined with pyridine to obtain a solution . to this solution a 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl derivative of formula iv is then added . this addition may be done at low temperatures to avoid the formation of impurities . preferably , the addition is done at a temperature of about 0 ° c . to about 25 ° c ., more preferably of about 15 ° c . to about 25 ° c . the addition provides a reaction mixture . preferably , the reaction mixture is maintained at a temperature of about 10 ° c . to about 30 ° c ., more preferably of about 15 ° c . to about 25 ° c . preferably , the reaction mixture is maintained for about 30 minutes to about 4 hours , more preferably for about 1 hour ; during this time the formation of imatinib salt of having the following formula , occurs ; wherein r 1 is derived from the compound of formula iv , preferably , cl . imatinib is recovered from the said mixture by a process comprising : admixing water with the reaction mixture comprising the imatinib salt , and reacting with a base . preferably , an aqueous solution of the base is used . preferably , the base is selected from the group consisting of ammonium hydroxide , sodium hydroxide , and potassium hydroxide , preferably ammonium . preferably , before the addition of the base heating to a temperature of about 30 ° c . to about 50 ° c ., more preferably of about 40 ° c ., is conducted . heating may be carried out to obtain a solution . the addition of the base provides imatinib , which precipitates by the addition of an additional amount of water . preferably , after adding the second amount of water , the mixture is maintained at 15 ° c . to about 25 ° c ., to increase the yield of the precipitated imatinib . in addition , to increase the yield even more , the mixture is maintained for an overnight period , preferably the overnight period is about 12 hours to about 16 hours the recovery process of imatinib may further comprise filtering off the precipitated imatinib , washing and drying . the starting material , 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl derivative , can be the free base when n is 0 , or the corresponding salt derivative when n is either 1 or 2 . accordingly , when n when n is 2 , and x is cl , the compound of formula iv corresponds 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl dihydrochloride of the following formula . r 1 in the compound of formula iv is a leaving group as defined above , preferably r 1 is cl . accordingly , when n is 0 and r 1 is cl , the compound of formula iv corresponds to 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl chloride of the following formula . when n is 2 , and r 1 is cl , the compound of formula iv corresponds to 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl chloride dihydrochloride of the following formula . the free base , 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl derivative of formula iv , may be obtained according to the process described before in the present application or by any process known to one skilled in the art . the salt is , usually , a hydrochloride salt , preferably , dihydrochloride . the dihydrochloride salt can be obtained from a commercial source . the process for preparing imatinib can further comprise the conversion of imatinib to imatinib salt . preferably , the salt is a mesylate salt . the conversion of imatinib to imatinib salt can be done by reacting imatinib with an acid , as exemplified in u . s . application ser . no . 11 / 796 , 573 , filed apr . 27 , 2007 . the conversion can be carried out for example by combining imatinib base with a mixture of a c 1 - c 4 alcohol , preferably ethanol , and water . the temperature can be lowered to below room temperature , such as about − 10 ° c .- 0 ° c . a source of meso 3 h , such as a solution of meso 3 h in a c 1 - c 4 alcohol is then added . the reaction mixture can be seeded . the reaction mixture can then be maintained to increase the yield of the mesylate . the mesylate can be recovered by evaporating solvents from the reaction mixture to obtain a residue . having described the invention with reference to certain preferred embodiments , other embodiments will become apparent to one skilled in the art from consideration of the specification . the disclosures of the references referred to in this patent application are incorporated herein by reference . the invention is further defined by reference to the following examples describing in detail the process and compositions of the invention . it will be apparent to those skilled in the art that many modifications , both to materials and methods , may be practiced without departing from the scope of the invention . to a solution of n -( 5 - amino - 2 - methylphenyl )- 4 -( 3 - pyridyl )- 2 - pyridineamine ( 80 g ) in pyridine ( 400 g ) at 0 ° c ., 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl chloride dihydrochloride ( 1 . 1 eq ) is added . the reaction is kept under stirring at 15 - 20 ° c . for 1 h , then water ( 400 ml ) is added . the mixture is heated up to 40 ° c ., then 26 % nh 4 oh ( 200 g ) and water ( 900 g ) are added . the reaction mixture is kept under stirring at room temperature overnight . the solid is filtered off , washed with water and dried at 75 ° c . under vacuum for 3 - 4 h . imatinib is obtained as a yellowish powder ( 135 g , 95 % yield , & gt ; 98 % purity ). to a suspension of 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid ( 84 g ) in pyridine ( 400 g ) at 0 ° c ., socl 2 ( 44 . 8 g , 1 . 05 eq ) is added and the mixture is kept under stirring at 30 - 50 ° c . for 1 - 2 h . after cooling at 0 ° c ., n -( 5 - amino - 2 - methylphenyl )- 4 -( 3 - pyridyl )- 2 - pyridineamine ( 80 g ) is added . the reaction is kept under stirring at 15 - 20 ° c . for 1 h , then water ( 400 ml ) is added . the mixture is heated up to 40 ° c ., then 26 % nh 4 oh ( 200 g ) and water ( 900 ml ) are added . the reaction mixture is kept under stirring at room temperature overnight . the solid is filtered off , washed with water and dried at 75 ° c . under vacuum overnight . imatinib is obtained as a yellowish powder ( 125 g , 88 % yield , & gt ; 98 % purity ). to a suspension of 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid dihydrochloride ( 30 g ) in pyridine ( 100 g ) at 20 ° c ., socl 2 ( 11 . 5 g , 1 . 05 eq ) is added and the mixture is kept under stirring at 45 - 50 ° c . for 1 - 2 h . after cooling at 0 ° c ., n -( 5 - amino - 2 - methylphenyl )- 4 -( 3 - pyridyl )- 2 - pyridineamine ( 20 g ) is added . the reaction is kept under stirring at 15 - 25 ° c . for 1 h , then water ( 100 ml ) is added . the mixture is heated up to 40 ° c ., then 26 % nh 4 oh ( 50 g ) and water ( 225 ml ) are added . the reaction mixture is kept under stirring at room temperature overnight . the solid is filtered off , washed with water and dried at 75 ° c . under vacuum overnight . imatinib is obtained as a yellowish powder ( 32 g , 90 % yield , & lt ; 98 % purity ). to a suspension of 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid ( 10 g ) in ch 2 cl 2 ( 400 g ) at room temperature , dcc ( 9 . 6 g ) and hobt ( 9 g ) are added . after 18 h stirring , the solid is filtered off and washed with ch 2 cl 2 ( 100 g ). n -( 5 - amino - 2 - methylphenyl )- 4 -( 3 - pyridyl )- 2 - pyridineamine ( 9 . 5 g ) is added to the combined filtrates , the solution is stirred at 15 - 25 ° c . for 1 h , then dmap ( 1 g ) is added and stirring is continued for 2 days . after addition of water ( 200 g ) and 26 % nh 4 oh ( 20 g ), the organic phase is separated and evaporated . the residue is taken up with ipa ( 100 g ). the product is filtered , washed with epa and dried ( 13 . 5 g , 77 % yield , 96 . 3 % purity ). 4 -( chloromethyl ) benzoic acid ( 58 g ) is added to a solution of n - methylpiperazine ( 150 g ) in n - buoh ( 580 g ) at room temperature . after stirring for 3 - 6 h , the solvent is evaporated under reduced pressure and the residue is taken up with ipa ( 440 g ). the mixture is refluxed for 15 min under stirring , then stirred for 24 h at room temperature . the solid is filtered off , washed with ipa ( 2 × 58 g ) and dried under vacuum at 70 ° c . overnight . the desired product is obtained as a white solid ( 59 . 5 g , 75 % yield ). 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ]- n -[ 4 - methyl - 3 -[[ 4 -( 3 - pyridinyl )- 2 - pyrimidinyl ] aminophenyl ] benzamide ( 98 . 2 g ) is added to etoh ( 1 . 4 l ). to the suspension methanesulfonic acid ( 19 . 2 g ) is added dropwise . the solution is filtered clear at 65 ° c . the solvent is evaporated and the residue is taken up with etoh ( 2 . 2 l ) and dissolved under reflux with addition of water ( 30 ml ). the solution is cooled down and kept overnight at 25 ° c . the solid is filtered off and dried at 65 ° c . the title product is obtained as light beige crystals . to a suspension of compound ii ( n = 2 , a = cl ) ( 20 g ) in toluene ( 35 ml ) and dmf ( 1 ml ) under n2 at 60 ° c ., ( 20 g ) was added over a period of 1 h socl2 . the mixture was kept under stirring at 62 ° c . for 20 h . after cooling at 20 ° c ., toluene ( 20 ml ) was added and the mixture was stirred for 0 . 5 h . the solid was filtered off , washed with toluene ( 50 ml ) and dried at 65 ° c . under vacuum for 15 h . the product was obtained as a white powder ( 21 g ). imatinib base ( 60 g , 0 . 1216 mol ) was suspended in etoh ( 900 - 1200 ml ) and water ( 2 - 5 % v / v vs etoh ) was added under stirring . the temperature was adjusted to − 10 /− 5 ° c . and a solution of meso 3 h in etoh ( 79 . 8 ml 10 % v / v ; 0 . 1213 mol ) was added in 2 min , keeping the temperature at − 10 /− 5 ° c . the reaction mixture was seeded with imatinib mesylate form x ( 300 - 500 mg ) and kept under stirring at − 5 ° c . for 3 h . the suspension was diluted with mtbe ( 750 - 1000 ml ) keeping the temperature below 0 ° c . the solid was filtered off , washed with mtbe and dried under vacuum onto the filter in a nitrogen atmosphere to remove free etoh . crystalline imatinib mesylate containing about 7 % etoh was obtained in 92 - 95 % yield . imatinib base ( 60 g ; 0 . 1216 mole ) was suspended in 1200 ml of ethanol and stirred . reactor was kept under flow of nitrogen during all of the experiment ( 6 litres per hour ). then , 24 ml of water was added to the suspension and the temperature was adjusted at − 15 ° c . an ethanolic solution of methanesulfonic acid ( 79 . 8 ml 10 % v / v ; 0 . 1213 mole ) was added during 2 minutes to the reaction mixture . temperature of the solution was set at − 10 ° c . during 10 minutes , imatinib base was dissolved and seeding material of form x ( 2 g ) was added . the crystallization process was continued under stirring for 190 minutes and temperature was continuously increased to − 5 ° c . the suspension was stored overnight in a freezer at approx . − 27 ° c . than , suspension was diluted by 1000 ml tbme , filtered by nitrogen pressure and obtained crystalline portion was washed with 400 ml tbme . the resulted crystalline form was dried by flow of nitrogen through the filter to remove free ethanol . ethanol content was about 7 . 5 %. ( yield was 67 . 95 g ; 85 %)	2
an electrochromic device ( fig1 ), e . g . a window , comprises a first electrode 3 and a second electrode 5 , out of which at least one becomes colored under reducing or oxidizing conditions . the electrodes 3 , 5 are separated by an electrolyte 4 . each of the two electrodes is typically supported by a conducting transparent plate 1 , 7 or the like , e . g . a glass plate covered with a transparent conductive coating 2 , 6 , such as doped tin oxide . furthermore , the conductive coatings 2 , 6 are connected to an external electric circuit by means of contacts 8 . the electrochemical capacitance of a conducting ( or semiconducting ) surface in contact with an electrolyte is typically about 10 μfcm − 2 to 40 μfcm − 2 ( the electrical double layer or helmholtz capacitance ). by using a nanostructured conducting film with a roughness factor of about 1000 ( described more in detail below ), it has been found that the total capacitance is raised to about 10 mfcm − 2 to 40 mfcm − 2 ( the relationship between the roughness factor and the capacitance is proportional ). this raise in capacitance makes it possible to use such a nanostructured film as an electrode in an electrochromic device , as it has the ability to provide the charge needed to color a coloring electrode in an electrochromic device , ( which is in the range of 5 mccm − 2 to 20 mccm − 2 ). furthermore , since no intercalation is involved , such an electrode is “ fast ” enough to be used in any fast color switching electrochromic device in a nanostructured electrode it is essential that the particles are electrically connected with each other and the conducting substrate . they can be sintered together ( heated ), pressed together , chemically connected , connected with some kind of inorganic or organic binder particles in the film , etc . the porosity in the film must be high . essential is that the pores in the film also form a 3 - d network with nano - dimensions ( 1 - 100 nm pore size ). this open porous structure makes the ion transport rapid when immersed in an electrolyte . to improve the conductivity of electrons and ions in the film , the film may contain particles of larger size than nanoparticles . for example , micrometer - size zno rods that are grown from the substrate , as disclosed in wo 9800035 - 9 or graphite . in the same way the porous network may contain micron - size “ pore channels ” to speed up the ion transport . one could also imagine other additives , like light - scattering particles and the “ binder particles ” discussed above . essential is that the main contact between the electrode and the electrolyte is located at the surface of the nanoparticles , and that this interface is easily accessible ( e . g . not via long narrow pores within a particle ) from the 3d - networks of both the particles and the pores . examples of suitable materials for such nanostructured conducting films are semiconducting metal oxides , carbon , metals and other semiconducting materials . a suitable semiconducting metal oxide may be an oxide of any suitable metal , such as , titanium , zirconium , hafnium , chromium , molybdenum , tungsten , vanadium , niobium , tantalum , silver , zinc , tin , strontium , iron , cobalt or nickel or a perovskite thereof . the present inventors have discovered that certain semiconducting metal oxides ( specified below ), when prepared as nanostructured films with a roughness factor of at least 20 , exhibit color - change characteristics that are not dependent upon intercalation of ions into the material . the main mechanism in these cases is instead capacitive charging ( or double layer charging ) at the surface of the nanostructured material . this capacitive behavior leads to much faster color switching , as there is essentially no intercalation involved . for a nanostructured coloring electrode nio ( in the crystalline form bunsenite ), coo , wo 3 and moo 3 are particularly preferred . out of these , nio and coo become colored under oxidizing conditions and the others under reducing conditions . for a nanostructured non coloring electrode tio 2 , in 2 o 3 , sno 2 , ruo 2 and carbon are particularly preferred . the electrolyte is preferably in liquid form and preferably comprises at least one electrochemically inert salt , either as a molten salt or dissolved in a solvent . suitable salts are composed of cations such as lithium , sodium , potassium , magnesium , tetraalkylammonium and dialkylimidazolium ions , and anions such as chloride , perchlorate , trifluoromethanesulfonate , bis ( trifluoromethysulfonyl ) amide , tetrafluoroborate and hexafluorophosphate ions . suitable solvents are electrochemically inert such as water , acetonitrile , methoxyacetonitrile , butyronitrile , propionitrile , 3 - methoxypropionitrile , glutaronitrile , - butyrolactone , propylenecarbonate , ethylenecarbonate , dimethylsulfoxide , dimethylformamide , dimethylacetamide , and n - methyloxazolidinone , or mixtures thereof . in one preferred embodiment , the first electrode 3 is a nanostructured electrode with a type n electrochromophore added to the surface . the second electrode 5 is a non - coloring electrode , comprising a nanostructured film of a conducting or semiconducting material as defined above . it should be noted that this second electrode 5 in this device does not have an adsorbed monolayer of electrochromophore or the like on the surface , whereby the production step of adding an electrochromophore to this electrode is omitted . systems of this type utilize the fast color switching characteristics of the electrochromophore and the capacitive behavior of the nanostructured electrode . such a system exhibits as fast color switching as the prior art systems based on electrochromophores , but has substantially better long - term stability ( and cyclability ). these improvements are due to the fact that no electrochemical reactions , other than ( pseudo -) capacitive charging , are taking place at the counter electrode . in another embodiment both the first electrode 3 and the second electrode 5 lack adsorbed monolayers of electrochromophores or the like on the surface . in this embodiment the second electrode 5 is a nanostructured coloring electrode of the type described above , i . e . a nanostructured nio electrode or the like . in a third embodiment both the first electrode 3 and the second electrode 5 are nanostructured coloring electrodes , i . e . one of the electrodes becomes colored under reducing conditions , and the other electrode becomes colored under oxidizing conditions . as both electrodes in the last two embodiments lack adsorbed monolayers of electrochromophores or the like on the surface , production of such systems will be faster and less complicated . the adsorption of electrochromophores at the nanostructured electrode is a time consuming step in the fabrication of nanostructured electrochromic devices . the adsorption process may also negatively affect the properties of the electrode material . such systems will further exhibit enhanced long - term stability since there are no intercalation or electrodepostion reactions at the electrodes and problems associated with desorption of electrochromophores are avoided . by avoiding intercalation or electrodepostion reactions and adsorbed electrochromophores , one reduces the risk for competing destructive reactions ( electrochemically and photo - induced ). supercapacitors with pure double - layer capacity are generally believed to have the highest electrochemical stability , in fact , electrochromic devices with two nanostructurednanoporous electrodes are “ colouring supercapacitors ”. even though the color switch in the two last embodiments is not dependent upon intercalation , there will still exist intercalation to , some degree if small ions such as lithium ions are present in the electrolyte . one way to minimize the intercalation , which may slow down the color switch process , is to use an electrolyte that does not comprise such ions . therefore , it is preferred to use an electrolyte that only comprises larger ions such as for example tetraalkylammonium ions . the electrolyte thus supports capacitive charge compensation when capacitive charge compensation processes are dominant in relation to existing intercalation processes , in particular under change of colour of the electrode . an electrochromic display according to the invention may be provided as described in detail below . bis -( 2 - phosphonoethyl )- 4 , 4 ′- bipyridinium dichloride is adsorbed to the surface of a 4 m thick nanostructured film of tio2 on a conducting glass plate ( 0 . 5 μm fluorine - doped sno2 on 2 mm glass ). this electrode is transparent , but colours blue upon reduction . a nanostructured carbon film ( 10 - 50 μm thick ), comprising carbon black and graphite particles , is deposited on a second conducting plate . on top of this film a porous white light - scattering film is deposited as a reflector . the two plates are assembled face - to - face using a hot - melting plastic at the uncovered edges of the two plates . electrolyte ( 0 . 2 m tetrabutylammonium trifluoromethanesulfonate in 3 - methoxypropionitrile ) is introduced in the space between the two electrodes . the resulting electrochromic display has a good memory effect and stability (& gt ; 100 , 000 cycles without severe degradation ). above a number of embodiments have been described . however , it is obvious that the design could be varied without deviating from the inventive idea , of providing an improved electrochromic device . therefore the present invention should not be regarded as restricted to the above disclosed embodiments , but can be varied within the scope of the appended claims .	6
the present invention relates to methods for treating or preventing pain in a human or non - human animal patient in need thereof , which the method comprises administering to said patient a therapeutically effective amount of at least one compound represented by formula i : r 5 and r 5 ′ are independently — h , — oh or — or 6 , wherein r 6 is a linear or branched c 1 - c 4 alkyl ; z is — ch 2 ch 2 o —, — ch ( ch 3 ) ch 2 o — or — ch 2 ch ( ch 3 ) o —; n is an integer of 1 , 2 , 3 , 4 , or 5 ; the present invention relates to a method for the treatment of acute or chronic pain . the present invention relates to a method for the treatment of nociceptive pain or neuropathic pain . the present invention relates to a method for the treatment or prevention of pain , wherein the compound administered is represented by formula ii : or a pharmaceutically acceptable salt prodrug , metabolite , or hydrate thereof . the present invention relates to a method , wherein z is — ch 2 ch ( ch 3 ) o —. the present invention relates to a method , wherein the compound administered is represented by formula iii : the present invention relates to a method , wherein r 5 is h or oh . the present invention relates to a method , wherein r 5 ′ is h or oh . the present invention relates to a method , wherein n is 1 or 2 . the present invention relates to a method , wherein the compound is represented by formula iv , v , vi or vii : wherein r is a polyalkylene glycol polymer having n units , wherein n is an integer of 1 , 2 , 3 , 4 , or 5 . the present invention relates to a method , wherein the compound is administered as a pharmaceutical composition comprising a therapeutically effective amount of one or more of the compounds represented by formulae i , ii , iii , iv , v , vi , or vii together with one or more pharmaceutically acceptable excipients . the present invention relates to a method , wherein the composition administered comprises said one or more compounds in substantially pure form , said substantially pure form consisting of at least 95 % wt of said one or more compounds and up to 5 % wt . of free polyalkylene glycol , with the total amount in said form of said one or more compounds and said free polyalkylene glycol being 100 % wt . the present invention relates to a method , wherein the composition administered comprises said one or more compounds in partially pure form , said partially pure form consisting of about 5 - 60 % wt . of the one or more compounds and about 95 - 40 % wt . of free polyalkylene glycol , the total amount being 100 % wt . the present invention relates to a method , wherein the composition is formulated as a unit dosage form . the present invention relates to a method , wherein the composition is formulated for oral administration . the present invention relates to a method , wherein the composition is formulated as a unit dosage form comprising from 0 . 1 to about 500 mg of the one or more compounds . the present invention relates to a method , wherein a daily dose of 1 . 0 mg to 15 g of said one or more compounds is administered . the present invention relates to a method , wherein the one or more compounds are administered orally . polyalkylene glycol compounds were generally synthesised by preparation of the appropriate alcohol compound followed by conjugation of the alcohol with a polyalkylene glycol ( pag ) polymer ( e . g ., polyethylene glycol ( peg ) or polypropylene glycol ( ppg )) of the desired length . 1 . 2 g , 32 mm , of lialh 4 were added to 2 . 3 g , 10 mm , phenyl alanine ethyl ester hcl in 50 ml dry ether . after stirring for 2 hours at room temperature , water and koh were added and the reaction product was extracted with ethyl acetate . after evaporation , 0 . 8 g of compound a , a light yellow oil , was obtained . nmr cdcl 3 7 . 30 ( 5h , m ), 3 . 64 ( 1h , dd , j = 10 . 5 , 3 . 8 hz ) 3 . 40 ( 1h , dd , j = 10 . 5 , 7 . 2 hz ) 3 . 12 ( 1h , m ), 2 . 81 ( 1h , dd , j = 13 . 2 , 5 . 2 hz ), 2 . 52 ( 1h , dd , j = 13 . 2 , 8 . 6 hz ) nmr acetone d 6 7 . 30 ( 5h , m ), 3 . 76 ( 1h , dt ) 3 . 60 ( 1h , m ) 3 . 30 ( 1h , t ), 2 . 85 ( 2h , m ). helv . chim . acta , 31 , 1617 ( 1948 ). biels . - e3 , vol . 13 , p 1757 . to 3 g , 12 mm , l - tyrosine ethyl ester hcl in 50 ml dry ether was added 1 . 2 g 32 mm lialh 4 . after stirring 3 hours at room temperature , water and koh were added and the reaction was extracted with ethyl acetate . evaporation gave 1 . 1 g of a light yellow oil , 54 % yield , which on standing crystallized . mp - 85 . nmr cdcl 3 7 . 20 ( 4h , ab q , j = 8 . 6 hz ), 3 . 50 ( 2h , m ) 3 . 20 ( 1h , m ), 2 . 81 ( 2h , m ). nmr tyrosine ethyl ester free base cdcl 3 7 . 0 , 6 . 56 ( 4h , ab q , j = 8 . 8 hz ), 4 . 20 ( 2h , q , j = 7 , 0 hz ), 3 . 70 , 10 , 2 . 80 ( 3h , 12 line abxm ), 1 . 28 ( 3h , t , j = 7 . 0 hz ). jacs 71 , 305 ( 1949 ). biels . - e3 , vol . 13 , p 2263 , compound 2 ( nrd135 ) has the structure of general formula iv , with r ═ ppg and n = 1 . mw = 354 l - tyrosinol ( 24 . 4 g ) was reacted with hydrocinnamic acid ( hca , 1 . 02 eq ), dcc ( 1 . 1 eq ), hobt ( 1 . 1 eq ) and nahco 3 ( 4 . 0 eq ) at room temperature overnight . reaction was completed overnight at rt . the reaction was filtered and a solvent swap from thf to ea was performed . the ea layer was washed with 1n hcl , sat nahco 3 , brine , and organic layer dried over na 2 so 4 . removal of a portion of ea was conducted via distillation , then slow addition of heptane afforded 33 . 82 g ( 94 . 1 % yield ) of desired product . hplc : purity =≧ 92 %. the benzyl ether of av74s was prepared . 1 . 33 eq benzyl chloride was charged to av74s ( 50 . 90 g ), 1 . 33 eq potassium carbonate , 0 . 1 eq potassium iodide in acetone at 50 ° c . after 20 hours at 50 ° c ., the reaction was heated to reflux for an additional 7 hours to consume all the starting material . the reaction was cooled to room temperature and quenched with water . the slurry was cooled to & lt ; 5 ° c . and stirred for 1 . 5 hours , then filtered . the solids were dried in vacuo ( 70 ° c .) over the weekend to afford 62 . 98 g of crude solids . the auc purity was 94 . 4 %. 1 h nmr analysis supports the assigned structure . a 5 - fold excess of propylene glycol was treated with trityl - cl ( 246 . 7 g , 885 mmol ) in the presence of pyridine and dmap in dmf at rt . the reaction was allowed to stir over the weekend at rt . the mixture was diluted with 3 vol of water and extracted with ea . the recrystallization from acetonitrile / water afforded 235 . 04 g ( 83 . 4 % yield , purity = 98 . 7 %) of desired product . the trityl ether ( 99 . 82 g , 313 . 5 mmol ) was converted into the orthogonally protected bis ether . to a & lt ; 10 ° c . slurry of 2 equiv of nah in dmf was added dropwise trityl ether at a rate to control gas evolution . after stirring for 15 minutes at & lt ; 10 ° c ., p - methoxybenzyl chloride was added via syringe . the mixture was warmed to rt ( mildly exothermic ) and allowed to stir at rt for 1 . 5 hours . hplc analysis indicated complete consumption of starting material . workup consisted of careful quenching of the mixture with 3 volumes of water and ea extraction . the ea layers were washed with water to remove dmf and dried over na 2 so 4 to give a hazy oil ( 150 . 95 g .). the protected bis ether was exposed to a catalytic amount of para - toluenesulfonic acid to detritylate the trityl group . to the protected bis ether ( 150 . 95 g , pr030 - 084 - 2 ) in methanol and thf was added a catalytic amount ( 0 . 1 eq ) of para - toluenesulfonic acid . after 60 minutes at room temperature , thin layer chromatography and hplc analysis indicated that the reaction was complete . triethylamine was added to quench the reaction and the solvent was removed via durp . the desired product was isolated from a silica gel plug to afford 51 . 74 g ( 84 % yield , purity = 98 . 4 %). 1 h nmr analysis supported the assigned structure . the mesylation of ppg - 1 - hydroxy - 2 - opmb ( 20 . 1 g ) was conducted using 2 . 0 eq of methanesulfonyl chloride and 2 . 25 eq of triethylamine at & lt ; 5 ° c . to give a clean conversion to desired product in 108 % crude yield as an oil . this material was sufficiently pure to use for next steps . 20 . 13 g obn - tyrosinol core ( from step a ) and 2 . 25 eq ppg - 1 - omesyl - 2 - opmb ( from step b ) in dmso was added 2 . 0 eq of 1m potassium tert - butoxide ( in thf ) over 1 . 6 hours at room temperature . after 15 . 5 hours at room temperature , 91 . 9 % of desired product had formed and 8 . 1 % of obn - tyrosinol core was not fully consumed . an additional 0 . 3 eq of 1m potassium tert - butoxide was added and the reaction was allowed to stir at 45 ° c . after an additional 18 hours at 45 ° c ., 98 . 3 % of desired product had formed and 1 . 7 % of obn - tyrosinol core was not fully consumed . the reaction mixture was quenched with usp water at room temperature and extracted with ethyl acetate . the combined organic layers were successively washed with usp water , saturated aqueous nahco3 solution , brine , and dried over sodium sulfate to afford 39 . 00 g of an oil . an attempt to recrystallize from toluene / heptane proved to be unsuccessful and provided 25 . 8 g of solids that were 77 . 4 % pure of desired product . celite was added to 25 . 3 grams of pr030 - 114 - 12 dissolved in hot mtbe / heptane ( 1 : 1 ). this mixture was filtered hot over a bed of celite . the filtrate was cooled to room temperature and the solids were collected via vacuum filtration to provide 13 . 1 g of white solids ( 52 . 4 % yield ). a second crop was obtained giving an additional 2 . 75 g of white solids ( an additional 11 % yield ). the purity of these two crops was 98 . 8 % and 98 . 1 %, respectively . 1h nmr and mass spec analysis supported the assigned structure for desired product . the combined yield was 63 . 5 %. the bis - protected ether ( 15 . 7 g ) was exposed to one - pot hydrogenation - debenzylation conditions ( 10 % loading of 10 % pd / c and 0 . 25 eq of p - toluenesulfonic acid ) in methanol . after 2 hours at 60 ° c . under a hydrogen atmosphere , hplc analysis indicated that the hydrogenation of the benzyl and the debenzylation of pmb ring was complete . the reaction mixture was filtered over celite and concentrated under reduced pressure . the residue was dissolve in ethyl acetate and a saturated aqueous sodium bicarbonate treatment was conducted to effectively remove p - toluenesulfonic acid , then durp to provide 12 . 13 g of an oil ( pr030 - 120 - 4 ). desired product was isolated from an ea / heptane recrystallization to provide 8 . 83 g of a white solid ( pr030 - 120 - 6 , 89 . 4 % yield ). the purity of pr030 - 120 - 6 was 99 . 3 % via hplc analysis . 1 h nmr and mass spec analysis supported the assigned structure for desired pro duct . compound 1 has the structure of general formula iv , with r ═ ppg and n = 2 . mw = 413 compound 1 was prepared using the same procedure as described above in synthesis 1 , with the substitution of the ppg , n = 1 for ppg , n = 2 . it will be understood that the procedures of synthesis 1 can therefore be applied to produce compounds of formula vii in which z is ppg . alternative compounds falling within formula i can be produced by substitution of l - tyrosinol in step ( a ) with the appropriate amino alcohol ( e . g . phenyl alaninol as produced in synthesis a )). the procedures of synthesis 1 can also be adapted as described below in synthesis 3 so that they result in the production of a compound of formula 1 in which z is peg . compound 3 has the structure of general formula iv , with r = peg and mw = 413 a 5 - fold excess of ethylene glycol was treated with trityl - cl ( 22 . 9 g , 82 . 13 mmol ) in the presence of pyridine and dmap in dmf at rt . the reaction was allowed to stir overnight at room temperature . the mixture was diluted with 3 vol of water and extracted with ea . isolation of desired product via recrystallization from acetonitrile / water gave 22 . 87 g of solids ( 91 . 5 % yield ). the purity determined by hplc was 97 . 8 %. 1 h nmr and mass spec analysis supported the assigned structure for desired product . the mesylation of compound a - 1 ( 11 . 00 g ) was conducted using 2 . 0 eq of methanesulfonyl chloride and 2 . 25 eq of triethylamine at & lt ; 5 ° c . to give a clean conversion to desired product in quantitative yield as a solid ( 13 . 85 g ). auc purity = 97 . 5 %. mass spec and 1 h nmr analysis supported the assigned structure . c ) i ) 2 . 29 g of obn - tyrosinol core ( from step a ) and 2 . 25 eq of compound b - 1 ( from step b ) in dmso was added 2 . 0 eq of 1m potassium tert - butoxide ( in thf ) over 45 mins at room temperature . after 12 . 25 hours at 35 ° c ., the reaction mixture was quenched with usp water at room temperature and extracted with ethyl acetate . the combined organic layers were successively washed with usp water , saturated aqueous nahco 3 solution , brine , and dried over sodium sulfate to afford 5 . 05 g as an oil . this product was purified via column chromatography to isolate the desired product as a solid ( 2 . 07 g ). auc purity = 97 . 5 %. 1 h nmr analysis supported the assigned structure for desired product . 2 . 07 g c - 1 , c - 1 was dissolved in 30 vol methanol at 60 c . 10 wt % pd / c then 0 . 25 eq ptsa was added while at 60 c . hydrogen atmosphere was maintained for 3 hours . the catalyst was removed by hot filtration . the filtrate was durp to obtain a solid . the solids were dissolved in ethyl acetate and washed with sodium bicarbonate . the organic was dried over sodium sulfate and durp to give gooey solids . the experiments described below were conducted to demonstrate the utility of compounds of the invention in the treatment of pain . the objective of the study was to assess antinociceptive activity of tested items in the hot plate tests in mice , when administered sub - chronically . measuring paw licking or jumping response time elapses following placement on heated surface ( hot plate ) was used to determine potential antinociceptive effect in mice . a total of 42 balb / c mice ( 12 weeks old ) were utilized . the mice were approximately 25 g males at study initiation . the minimum and maximum weights of the group were within a range of ± 10 % of group mean weight . compounds 2 and 3 were tested and compared with diclofenac ® ( perigo ). dmso solutions were used . six groups of mice ( each having n = 7 or n = 8 mice ) were tested , the last group receiving diclofenac ®. formulations according to the following table were prepared for administration to the groups of mice . control - 0 . 02 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 0 . 6 μl dmso + 2999 . 4 μl compound 2 , 0 . 1 mg / kg = 0 . 003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 , 0 . 03 mg ( stock 50 mg / 1 ml dmso ) 0 . 6 μl + 2999 . 4 μl ddw ), n = 8 compound 2 , 5 mg / kg = 0 . 15 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 1 . 5 mg ( stock 50 mg / 1 ml dmso ) 30 μl + 2970 μl ddw ), n = 8 compound 3 , 0 . 1 mg / kg = 0 . 003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 , 0 . 03 mg ( stock 50 mg / 1 ml dmso ) 0 . 6 μl + 2999 . 4 μl ddw ), n = 8 compound 3 , 5 mg / kg = 0 . 15 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 1 . 5 mg ( stock 50 mg / 1 ml dmso 30 μl + 2970 μl ddw ), n = 8 diclofenac ® 10 mg / kg = 0 . 3 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) from stock all groups received the drugs daily po for 16 days . hot plate experiments were performed on days ; 1 , 8 and 15 . the following parameters were examined : body weight ( days 1 , 8 15 ); open field on day 16 including distance moved , velocity , immobility , rearings , time in center and other parameters . after the last experiment ( i . e ., open field day 16 ), animals were sacrificed by decapitation and blood was collected 24 hr after last drug administration . the following organs were dissected : liver ( gall bladder ), spleen , lungs , brain , heart and kidney for toxicity examination ( formaldehyde 4 %). the hot plate is maintained thermostatically at a temperature of 52 ° c . one hour before the administration of the drugs , mice are tested in the hot plate . at time 0 the mice are administered with the test compound and the response to the hot plate is measured again at different times : 60 , 120 , 180 , 240 , 300 and 360 min . results are expressed as : delta from maximum response [ baseline vs . maximum response ]; absolute measures over time ; and accumulated time . fig1 a and 1 b provide graphical results showing a comparison of compounds 2 and 3 with diclofenac ® at days 1 , 8 , and 15 . fig1 c shows internal organ weight data after administration of the tests . additional data showed that compositions 2 - 5 significantly increased the time to reaction as compared with the control . a sample of such data is provided in fig1 d . these data show that compounds 2 and 3 are effective as pain relievers . using the procedure outlined in example 1 , 40 male mice ( balb / c , 9 weeks old , naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - 0 . 2 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 6 μl dmso + 2994 μl compound 2 , 0 . 01 mg / kg = 0 . 0003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 , 0 . 003 mg ( stock 50 mg / 1 ml dmso ) 0 . 06 μl + 2999 . 94 μl compound 2 , 0 . 1 mg / kg = 0 . 003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 , 0 . 03 mg ( stock 50 mg / 1 ml dmso ) 0 . 6 μl + 2999 . 4 μl compound 2 , 1 mg / kg = 0 . 03 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 , 0 . 3 mg ( stock 50 mg / 1 ml dmso ) 6 μl + 2994 μl ddw ), n = 8 compound 2 , 0 . 1 mg / kg = 0 . 003 mg / 0 . 3 ml / mouse , i . p . ( 3 ml / 10 mice ) ( compound 2 , 0 . 03 mg ( stock 50 mg / 1 ml dmso ) 0 . 6 μl + 2999 . 4 μl ddw ), the animals were determined on the hotplate at : − 60 , 0 , 120 , 240 , 360 , 420 and 480 min . the hotplate mean temperature was 52 degrees ± 1 . fig2 a and 2 b provide data for these tests . using the procedure outlined in example 1 , 40 male mice ( balb / c , 9 weeks old , naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 2 . 5 % dmso 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) ( 63 μl dmso + compound 2 , eqm 25 ( 12 . 5 ) mg / kg = 0 . 3125 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 3 . 125 mg ( stock 50 mg / 1 ml dmso ) 63 μl + 2437 μl ddw ) compound 2 eqm 12 . 5 ( 6 . 25 ) mg / kg = 0 . 15625 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 1 . 5625 mg ( stock50 mg / 1 ml dmso ) 32 μl + 2468 μl ddw ) compound 2 eqm 6 . 25 ( 3 . 125 ) mg / kg = 0 . 078 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 0 . 78 mg ( stock50 mg / 1 ml dmso ) 16 μl + 2484 μl ddw ) the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min . the hot - plate means the temperature of 52 degrees ± 1 . fig3 a , 3 b , and 3 c provide data for this test . using the procedure outlined in example 1 , 40 male mice ( balb / c , 13 weeks old , not naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , p . o .) with the formulations shown in the following table , control - ddw + 0 . 2 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 6 μl dmso + compound 2 ( mw 357 ) 1 mg / kg = 0 . 03 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 0 . 3 mg ( stock50 mg / 1 ml dmso ) 6 μl + 2994 μl ddw ) compound 2 ( mw 357 ) 0 . 2 mg / kg = 0 . 006 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 0 . 06 mg ( stock50 ml / 1 ml dmso ) 1 . 2 μl + 2998 . 8 μl ddw ) compound 2 ( mw 357 ) 0 . 04 mg / kg = 0 . 0012 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 0 . 012 mg ( stock 50 mg / 1 ml dmso ) 0 . 24 μl + 2999 . 76 μl ddw ) compound 2 ( mw 357 ) 0 . 008 mg / kg = 0 . 00024 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 0 . 0024 mg ( stock 50 mg / 1 ml dmso ) 0 . 048 ( 0 . 05 ) μl + the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min after treatment . the hot - plate means the temperature of 52 degrees ± 1 . fig4 a and 4 b provide data for this test . using the procedure outlined in example 1 , 40 male mice ( balb / c , 15 weeks old , not naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 0 . 02 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 0 . 06 μl compound 2 ( mw = 357 ) 0 . 01 mg / kg = 0 . 0003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 0 . 003 mg ( stock 50 mg / 1000 μl dmso ) 0 . 06 μl + 2999 . 94 μl compound 2 0 . 001 mg / kg = 0 . 00003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 0 . 0003 mg ( stock 50 mg / 1000 μl dmso ) 0 . 006 μl + 2999 . 994 μl compound 3 ( mw = 343 ) 0 . 01 mg / kg = 0 . 0003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice )( compound 3 0 . 003 mg ( stock 50 mg / 1000 μl dmso ) 0 . 06 μl + 2999 . 94 compound 3 0 . 001 mg / kg = 0 . 00003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 0 . 0003 mg ( stock 50 mg / 1000 μl dmso ) 0 . 006 μl + 2999 . 994 the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min after treatment . the hot - plate means the temperature of 52 degrees ± 1 . fig5 a and 5 b provide data for this experiment . using the procedure outlined in example 1 , 40 male mice ( balb / c , 9 weeks old , not naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , po .) with the formulations shown in the following table . control - ddw + 1 . 24 % dmso 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) ( 31 μl compound 2 ( mw 357 ) 6 . 25 mg / kg = 0 . 15625 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 1 . 5625 mg ( stock50 mg / 1 ml dmso ) 31 . 25 ( 31 ) μl + 2469 μl compound 2 ( mw 357 ) 2 . 083 ( 2 . 1 ) mg / kg = 0 . 052 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 0 . 52 mg ( stock50 mg / 1 ml dmso ) 10 . 415 ( 10 ) μl + compound 2 ( mw 357 ) 0 . 694 ( 0 . 7 ) mg / kg = 0 . 01735 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 0 . 1735 mg ( stock 50 mg / 1 ml dmso ) 3 . 47 ( 3 ) μl + gabapentine ( gbp ) 30 mg / kg = 7 . 5 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) ( gbp the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min , and 24 h after treatment . the hot - plate means the temperature of 52 degrees ± 1 fig6 a - e provide the data from this test . using the procedure outlined in example 1 , 40 male mice ( balb / c , 12 weeks old , naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 5 % dmso 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) ( 125 μl dmso + compound 1 25 mg / kg = 0 . 625 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) ( compound 1 1 . 5625 mg ( stock 30 mg / 0 . 6 ml dmso ) 32 μl + 2468 μl ddw ) compound 1 ( mw 415 ) eqm 25 mg / kg ( 15 mg / kg ) = 3 . 75 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice )( compound 1 3 . 75 mg ( stock 30 mg / 0 . 6 ml dmso ) 75 μl + compound 1 ( mw 415 ) eqm 12 . 5 mg / kg ( 7 . 5 mg / kg ) = 1 . 875 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice )( compound 1 1 . 875 mg ( stock 30 mg / 0 . 6 ml dmso ) 37 . 5 ( 38 ) the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min , and 24 h . fig7 a - d provide data for this experiment . using the procedure outlined in example 1 , 37 male mice ( balb / c , 16 weeks old , not naïve ), were divided in 5 groups and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 1 . 2 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 36 μl dmso + compound 3 ( mw = 343 ) 0 . 06 mg / kg = 0 . 0018 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 0 . 018 mg ( stock 4 . 6 mg / 92 μl dmso ) 0 . 36 μl + 2999 . 64 μl compound 3 0 . 6 mg / kg = 0 . 018 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 0 . 18 mg ( stock 4 . 6 mg / 92 μl dmso ) 3 . 6 μl + 2996 . 4 μl ddw ), n = 7 compound 3 6 mg / kg = 0 . 18 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 1 . 8 mg ( stock 4 . 6 mg / 92 μl dmso ) 36 μl + 2964 μl ddw ), n = 8 diclofenac 50 mg / kg = 1 . 25 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) diclofenac 14 . 4 the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min after treatment . the hot - plate means the temperature of 52 degrees ± 1 . fig8 a and 8 b provide data for this experiment . using the procedure outlined in example 1 , 40 male mice ( balb / c , 13 weeks old , not naïve ), were divided in 5 groups and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 0 . 8 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 24 μl dmso + compound 2 ( mw 357 ) 4 mg / kg = 0 . 12 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 1 . 2 mg ( stock50 mg / 1 ml dmso ) 24 μl + 2976 μl ddw ) compound 2 ( mw 357 ) 0 . 04 mg / kg = 0 . 0012 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 0 . 012 mg ( stock50 mg / 1 ml dmso ) 0 . 24 μl + 2999 . 76 μl ddw ) compound 1 ( mw 415 ) eq . 4 ( 4 . 65 ) mg / kg = 0 . 14 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 1 1 . 395 mg ( stock 30 mg / 0 . 6 ml dmso ) 27 . 9 ( 28 ) μl + 2972 compound 1 ( mw 415 ) eq . 0 . 04 ( 0 . 05 ) mg / kg = 0 . 0014 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 1 0 . 014 mg ( stock 60 mg / 0 . 6 ml dmso ) 0 . 279 ( 0 . 28 ) μl + the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min after treatment . the hot - plate means the temperature of 52 degrees ± 1 . fig9 a - e provide data for this experiment . using the procedure outlined in example 1 , 40 male mice ( balb / c , 13 weeks old , not naïve ), were divided in 5 groups and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 0 . 04 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 1 . 2 μl dmso + compound 1 0 . 125 mg / kg = 0 . 00375 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 1 0 . 0375 mg ( stock 60 mg / 1 . 2 ml dmso ) 0 . 75 μl + 2999 . 25 μl ddw ), compound 2 0 . 1 mg / kg = 0 . 003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 0 . 03 mg ( stock 60 mg / 1 . 2 ml dmso ) 0 . 6 μl + 2999 . 4 μl ddw ), n = 8 diclofenac 50 mg / kg = 1 . 25 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) diclofenac 12 . 5 mg + 0 . 25 μl dmso + 2999 . 75 μl ddw ), n = 8 the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min after treatment . the hot - plate means the temperature of 52 degrees ± 1 . fig1 a , 10 b , and 10 c provide data for this experiment . male sd rats ( 9 weeks old , naïve ), were divided into 5 groups ( 6 mice in each group ) and treated (− 120 min , p . o .) with the formulations shown in the following table . control - ddw + 10 % dmso 0 . 3 ml / rat , po ( 2 . 4 ml / 8 rats ) ( 241 μl dmso + compound 2 , 1 mg / kg = 0 . 3 mg / 0 . 3 ml / rat , po ( 2 . 4 ml / 8 rats ) ( compound 2 , 2 . 4 ( stock 21 . 5 mg / 0 . 43 ml dmso ) 32 μl + 2352 μl ddw ) compound 2 , 5 mg / kg = 1 . 5 mg / 0 . 3 ml / rat , po ( 2 . 4 ml / 8 rats ) ( compound 2 , 12 mg ( stock 21 . 5 mg / 0 . 43 ml dmso ) 241 μl + 2159 μl ddw ) compound 3 1 mg / kg = 0 . 3 mg / 0 . 3 ml / rat , po ( 2 . 4 ml / 8 rats ) ( compound 3 2 . 4 mg ( stock 19 . 1 mg / 0 . 382 ml dmso ) 32 μl + 2352 μl ddw ) compound 3 5 mg / kg = 1 . 5 mg / 0 . 3 ml / rat , po ( 2 . 4 ml / 8 rats ) ( compound 3 , 12 mg ( stock 19 . 1 mg / 0 . 382 ml dmso ) 241 μl + 2159 μl ddw ) formalin test . the method used was similar to that described by hunscaar and hole ( 1987 ) “ the formalin test in mice : dissociation between inflammatory and non - inflammatory pain ,” pain 30 , pp . 103 - 104 . five animals are used in each group and two to three hours after oral administration of the conjugates , 40 μl or 20 μl ( rats or mice , respectively ) of a 1 % formalin ( in 0 . 9 % saline ) solution is injected subcutaneously into the dorsal surface hind paw . the formalin induced typical flinching behaviour of the injected paw which was counted . the animals were returned to a glass chamber and the total time spent by the animal licking or biting the injected paw was measured . formalin induced pain behaviour is biphasic . the duration of paw licking was determined during the following two time periods : 0 - 5 min ( first - neurogenic phase ) and 20 - 30 min ( second - inflammatory phase ) after formalin injection . part a . male mice ( balb / c mice , 27 weeks old , not naïve ), were divided in 4 groups ( 5 mice per group ) and treated ( 0 min , i . p .) with the following formulations , respectively : control - ( 0 . 2 ml dmso + 3 . 52 saline ) i . p . 0 . 3 ml / mouse . n = 5 . compound 2 , 0 . 2 mg / kg = 0 . 006 mg / 0 . 3 ml / mouse , 6 mice / 0 . 036 mg / 1 . 8 ml = ( 0 . 72 μl ( 2 mg compound 2 + 40 μl dmso ) + 1799 . 28 μl ddw ) n = 5 . compound 2 , 1 mg / kg = 0 . 03 mg / 0 . 3 ml / mouse , 6 mice / 0 . 18 mg / 1 . 8 ml = ( 3 . 6 μl ( 2 mg compound 2 + 40 μl dmso ) + 1796 . 4 μl ddw ) n = 5 . compound 2 , 2 . 5 mg / kg = 0 . 15 mg / 0 . 3 ml / mouse , 6 mice / 0 . 9 mg / 1 . 8 ml = ( 9 μl ( 2 mg stock compound 2 + 40 μl dmso ) + 1782 μl ddw ) n = 5 . part b . male mice ( balb / c mice , 27 weeks old , not naïve ), were divided in 4 groups ( 5 mice in groups ) and treated ( 0 min , i . p .) with the following formulations , respectively : control - ( 0 . 2 ml dmso + 3 . 52 saline ) i . p . 0 . 3 ml / mouse . n = 5 . compound 2 0 . 2 mg / kg = 0 . 006 mg / 0 . 3 ml / mouse , 6 mice / 0 . 036 mg / 1 . 8 ml = ( 0 . 72 μl ( 1 . 3 mg compound 2 + 26 μl dmso ) + 1799 . 28 μl ddw ) n = 5 . compound 2 1 mg / kg = 0 . 03 mg / 0 . 3 ml / mouse , 6 mice / 0 . 18 mg / 1 . 8 ml = ( 3 . 6 μl ( 1 . 3 mg compound 2 + 26 μl dmso ) + 1796 . 4 μl ddw ) n = 5 . compound 2 2 . 5 mg / kg = 0 . 15 mg / 0 . 3 ml / mouse , 6 mice / 0 . 9 mg / 1 . 8 ml = ( 9 μl ( 1 . 3 mg compound 2 + 26 μl dmso ) + 1782 μl ddw ) n = 5 . results from these tests are plotted in fig1 a and 12 b respectively . fig1 c , 12 d , and 12 e provide further data based on measurement time . these data further confirm the anti - inflammatory properties of compound 2 .	0
the present invention relates to a combination of n - methyl - 2 - pyrrolidone ( nmp ) and resorbable polymers or copolymers . the invention is based on the unexpected realization that by combining a resorbable matrix material and nmp in a certain ratio , an implant having osteogenic properties is achieved . the implant thus induces bone growth due to the osteogenic properties of the polymer composition and enhances bone healing after osteotomies and bone fractures . the implant forms include , but are not limited to , membranes , films , plates , mesh plates , screws , taps or other formed pieces . the implant can be prepared for example of polyglycolide , polylactides , polycaprolactones , polytrimethylenecarbonates , polyhydroxybutyrates , polyhydroxyvalerates , polydioxanones , polyorthoesters , polycarbonates , polytyrosinecarbonates , polyorthocarbonates , polyalkylene oxalates , polyalkylene succinates , poly ( malic acid ), poly ( maleic anhydride ), polypeptides , polydepsipeptides , polyvinylalcohol , polyesteramides , polyamides , polyanhydrides , polyurethanes , polyphosphazenes , polycyanoacrylates , polyfumarates , poly ( amino acids ), modified polysaccharides ( like cellulose , starch , dextran , chitin , chitosan , etc . ), modified proteins ( like collagen , casein , fibrin , etc .) and their copolymers , terpolymers or combinations or mixtures or polymer blends thereof . polyglycolide , poly ( l - lactide - co - glycolide ), poly ( d , l - lactide - co - glycolide ), poly ( l - lactide ), poly ( d , l - lactide ), poly ( l - lactide - co - d , l - lactide ), polycaprolactone , poly ( l - lactide - co - caprolactone ), poly ( d , l - lactide - co - caprolactone ) polytrimethylenecarbonate , poly ( l - lactide - co - trimethylenecarbonate ), poly ( d , l - lactide - co - trimethylenecarbonate ), polydioxanone and copolymers , terpolymers and polymer blends thereof are highly preferred polymers . polylactide / polyglycolide / trimethylene carbonate copolymer ( pla / pga / tmc ), with a composition of 80 / 10 / 10 , granulates were compression moulded to form a film with a thickness of 0 . 2 mm . used compression temperature was 180 ° c . and pressure 130 bar . from the film 10 rectangular pieces were cut , each with a width of 20 mm . the weight of the individual film pieces were measured with balance with an accuracy of 1 mg . the film pieces were then immersed individually into nmp for 30 seconds . after immersion the film pieces were air dried for 20 minutes and the weight of the pieces was measured again . the weight of the film pieces before and after immersion into nmp are shown in table 1 . the average amount of nmp diffused into polymeric film was 44 . 19 %. this rabbit study shows the osteogenetic effect of pla / pga / tmc and pldla / pla / tmc membranes when treated with nmp . the details of the tested membranes can be found in the following table 2 . the study design included eight rabbits with four 6 - mm artificial craniotomy defects each . the defects were treated with biodegradable membranes and a commercial biodegradable osseoquest membrane as shown in table 2 . controls treated without any membranes were included , too . the matrixes of the resorbable membranes are also presented in table 2 . the rabbits were sacrificed 4 weeks after the operation and the calvarial bone excised . thorough histological analysis was performed in order to assess the degree and type of bone regeneration . fig1 a to 1 c illustrate examples of some histological sections from the middle of the defect . it is clearly evident that the bone formed during the 4 - week repair phase is more a cancellous bone than a cortical bone . a cellular interaction with the membrane was not observed . fig2 shows the percentage of a full - thickness repair of rabbit calvarial bone defects . the middle sections of the defects , 6 mm in diameter in the calvarial bone were evaluated . the percentage of repair was determined by pixel number of the defect filled with bone × 100 / pixel number of the defect area . the different membranes are specified by name . ‘ control ’ means the defect without the application of a membrane . evaluation of the level of a full - thickness repair of the bone defect revealed that the use of membranes improved bone healing . the percentage of repair without a membrane , i . e . ‘ control ’, was 31 . 3 ± 4 . 1 % of the defect area of the middle section . essential improvement of bone healing as compared with the control was achieved with osseoquest ( 55 . 78 ± 9 . 9 %), and e1m - 11 nmp ( 77 . 6 ± 8 . 8 %). a direct comparison of bone healing enhanced by osseoquest and e1m - 11 nmp shows a clearly better healing with e1m - 11 nmp . furthermore , e1m - 3nmp shows a healing effect essentially similar to osseoquest . as shown in fig2 the membranes of the present invention , i . e . e1m - 3 nmp and e1m - 11 nmp , increase markedly the healing response in the defect as compared with the membranes with an identical polymeric composition , i . e . e1m - 3 , e1m - 11 , that do not comprise nmp . according to one embodiment of the method of the present invention , nmp is added to the polymer matrix that has been already fashioned into the form of a medical implant . polymer compositions were prepared by dry - mixing commercially available granular - form base materials with commercially available copolymer additives . the material composition was 80 wt -% p ( l / dl ) la ( 70 / 30 ) and 20 wt -% plla / tmc ( 70 / 30 ). the components were weighed according to a desired weight ratio into a container which was then rotated in a turbula t2f shaker mixer for 30 minutes until a homogenous dry mixture was obtained . the resulting mixture was then dried in vacuum at 60 ° c . for 8 to 12 hours and thereafter melt - blended and injection - moulded in to plate - shaped test pieces . the injection - moulding machine used was a fully electric fanuc roboshot alpha i30a injection - moulding machine with a mould clamping force of 300 kn . the injection unit was equipped with high speed ( max . 66 cm 3 / s to 330 mm / s ), high pressure ( max . 2500 bar ) injection options . the barrel diameter was 16 mm and it was equipped with three - band heater zones , a standard profile anticorrosion screw and a standard open nozzle with a 2 . 5 mm hole . the extruder melt - blending and homogenization conditions of the material during the metering phase of the process included a back pressure of 40 to 60 bar , a screw speed of 60 to 100 rpm and barrel temperatures of 160 to 230 ° c . injection moulding conditions included a nozzle temperature of 180 to 230 ° c ., an injection speed of 80 to 300 mm / s , a maximum injection pressure of 2500 bar , a pack pressure of 1000 to 2300 bar for 3 to 8 s , a cooling time of 10 to 22 s and a mould temperature of 20 to 30 ° c . the total cycle time was 20 to 40 s consisting of the following phases during one injection - moulding process cycle : closing of the mould , injection of the molten polymer into the mould , pack pressure , cooling while extruder was metering for the next cycle during cooling phase , opening the mould and ejection of article from the mould . the plates were sterilized by gamma irradiation with a nominal dose of 25 kgy . after sterilisation , the plates were submerged in nmp ( 1 - methyl - 2 - pyrrolidinone , 99 %, acros organics , inc ., usa ) for 30 seconds . after submerging the plates were set for 30 minutes on a plastic holder at room conditions at 20 ° c . thickness , length and mass of the plates were measured before submerging and 30 minutes thereafter . dimensions were measured with a slide gauge and mass with an analysis balance . additionally , 30 , 60 and 120 minutes after the submerging of the plate , it was bent to 45 ° angle to find out softening and bending characteristics of the plate . the diffusion depth of the nmp was analysed with smartscope flash optical 3d - measuring device . approximately 1 mm of the material was cut off from the edge of the plate . the depth of the diffusion was measured from the cut cross - section of the plate 120 minutes after submerging . the results of the nmp diffusion after 30 min of submerging are shown in table 3 . the thickness of the plate was increased 13 % and its mass was increased 22 % due to the submerging of the plate in nmp . the increase of the mass can be seen as the diffusion of nmp into the plate . the increase of the thickness is due to the swelling of the outer layer of the plate . the thickness of the swollen outer layer of the plate was ca . 0 . 15 mm . the length was not changed due to the submerging . moreover , 30 minutes after submerging the plate was softened and bendable by hand . resorbable polymer matrix absorbs nmp when immersed into it . thereafter , an implant loaded with nmp is implanted into the body , and nmp is released gradually during a certain period of time . if the rate of releasing is appropriate , nmp owns osteogenic properties . as with almost any pharmaceuticals , the concentration of nmp must be within certain limits , called a therapeutic window . below the window , nmp is inefficacious . correspondingly , above the window , nmp presents an adverse event by inhibiting certain proteins , other molecules or cell lines . the nmp content is preferably between 0 . 05 and 50 weight - %, more preferably between 0 . 1 and 10 weight -%. according to one preferred embodiment of the method of the present invention , nmp is mixed with a polymer matrix or one of its components before the polymer matrix is fashioned into the form of a medical implant . the mixing can take place in an extruder , in a mixer or similar equipment known per se . nmp may be applied to the implant as well by packing said implant into a container with nmp already in the production process . nmp will be absorbed to the polymer matrix of the implant during storage in said container . the polymer composition of the present invention can be fashioned into implants by injection moulding , compression moulding , extrusion or with another melt - moulding process known by persons skilled in the art . example 4 presents one preferred embodiment of the present invention , where the implant is a barrier membrane in guided tissue regeneration ( gtr ) to treat a periodontal defect . the membrane comprises pla / pga - matrix polymers . the membrane is packaged in a slot of a package , such as a plastic blister . the preparation of the membrane is conducted as one stage of surgical operation as follows : 1 . after opening the package , a proper amount of nmp is poured into the membrane slot . the membrane is fully immersed in nmp for an adequate period , for example 30 seconds to 3 minutes , preferably for 30 seconds . 3 . nmp is allowed to diffuse into the polymer matrix of the membrane for 15 to 20 minutes . 4 . the membrane is ready for use as a barrier between the gingival soft tissue and the healing bone tissue and / or periodontal tissues in order to prevent the gingival soft tissue filling the defect side . in the conditions of a normal operating theater temperature and humidity , the membrane stays malleable for several hours . implants of the invention can be used for example in guided bone regeneration applications , where the effect of a nmp loaded barrier membrane is required to avoid soft tissue ingrowth in the area where new bone formation is required , and to enhance bone regeneration . it will be obvious to a person skilled in the art that , as the technology advances , the inventive concept can be implemented in various ways . the invention and its embodiments are not limited to the examples described above but may vary within the scope of the claims .	0
solids loaded , extrudable , solventless , double - base propellants , also known as composite - modified double - base propellants are formulated by combining liquid plasticizers , solid binders , a high percentage of solid oxidizers , and fillers . initially , an equilibrium saturation solution of a liquid aliphatic hydrocarbon solvent and solutes of soluble and partially soluble liquid plasticizers and fillers is prepared . it is important to recognize that some of the solutes are completely soluble in the liquid aliphatic hydrocarbon solvent while other solutes are only partially soluble . additionally , it must be recognized that during the processing of this propellant some of the solutes will be partially extracted from the solution while other solutes will be extracted from the propellant mix and go into solution . thus , the final solution decanted from the undried and uncured propellant composition will have either the desired equilibrium saturation or it will be close to the desired solution depending on the condition of the initial solvent . there are basically three ways to prepare the equilibrium solution . in the first method , a virgin liquid aliphatic hydrocarbon is used and it is run through the entire process . at the completion of the first run the intermediate solution is decanted from the propellant , the propellant is discarded , and the intermediate solution is saved . this intermediate solution is then run through the entire process a second time . as before , the propellant is discarded but this time the solution decanted at the end of the process contains the proper equilibrium concentrations and it is saved for future use . the second method which can be used in the preparation of the first equilibrium solution is merely estimating the precentages of the various solutes which will utimately be found in the final liquid aliphatic hydrocarbon solution , adding those amounts of liquid plasticizers and fillers to the solvent and mixing these ingredients with the solvent until they are all fully dissolved . the third method , and that which is generally preferred , starts by using the estimation method , described above , and then uses that solution in place of the intermediate solution of method one . although most any liquid aliphatic hydrocarbon will work well in this process , those of heptane , hexane , and octane are preferred , and heptane is most preferred . the soluble and partially soluble liquid plasticizers and fillers which will ultimately be found in the equilibrium solution are only limited by those used in preparing the desired solids loaded propellant . therefore , if a propellant having metriol trinitrate , thiethylene glycol dinitrate , dinormal propyl adipate and ethyl centralite is desired , they should be first dissolved in the liquid aliphatic hydrocarbon . the percentage of each ingredient to be dissolved in the solvent will vary depending on the desired propellant and thus the only way to determine the amount to be initially dissolved will be through experience . once the equilibrium solution has been readied , the solid binder ingredient is mixed into the solution so as to form a first slurry and deagglomerate and bruise the surface of the solid binder ingredient . proper mixing breaks large clumps of binder so as to subsequently allow the plasticizer to evenly coat and penetrate the binder . mixing times and rates vary broadly and depend in many cases on the type of mixing system used . however , it has been found that a good slurry will be formed if the ingredients are mixed for between about 30 and about 60 minutes at between about 3500 and 5000 revolutions per minute . the preferred mixing conditions for preparing this first slurry are about a 30 minute mixing time at about 4000 revolutions per minute . solids binders may range from about 10 to about 40 total weight percent of the propellant although a range from about 15 to about 30 total weight perecent is preferred . appropriate solids binders may be , from 12 - 14 . 14 percent nitrogen nitrocellulose ,. mixed into this first slurry is a first portion of a plasticizer . depending on the desired propellant composition various plasticizers such as metriol trinitrate , triethylene glycol dinitrate , nitroglycerin , and pentaerythritol trinitrate may be used . however , a relatively non - active plasticizer such as metriol trinitrate is preferred . the object of this is to evenly coat the slurried solid binder ingredient with the plasticizer , and thereby prepare it for drying . a ratio which ranges from about one part plasticizer to about five parts binder to about a ratio of about one part plasticizer to about three parts binder is considered functional , however , a ratio of about one part plasticizer to about 4 parts binder is preferred . mixing should take between about 15 and 30 minutes at between about 1000 and about 3000 revolutions per minute . the preferred mixing conditions are about 15 minutes at a rate of about 2000 revolutions per minute . after obtaining the evenly coated slurried solid binder , the excess liquid aliphatic hydrocarbon solution is then separated from the solid binder and saved for future use . the plasticizer coated solid binder is then thoroughly dried to remove all traces of water and make it relatively non - sensative to static electric charges . although the preferred drying conditions are about 24 hours at about 140 ° f ., actual times and temperature may vary from about 24 to about 72 hours and from about 120 to about 140 ° f . the dry coated solid binder is now ready for re - slurrying in a mixture of the previously saved liquid aliphatic hydrocarbon solution and enough liquid aliphatic hydrocarbon to replace that lost during decanting and drying . to properly re - slurry , mixing will range from about 10 to about 30 minutes at about 2000 to about 4000 revolutions per minute . preferred mixing conditions for this step are 10 minutes at 2000 revolutions per minute . after formation of the second slurry , a solid oxidizer is added to the slurry while mixing at about 2000 revolutions per minute . mixing is then continued until a good dispersion is obtained . this should take about 30 minutes at about 4000 revolutions per minute . actual mixing times and rates may however range from about 20 to about 60 minutes at about 3500 to about 5000 revolutions per minute . it is important to carefully mix the oxidizer into the slurry to insure that a good dispersion is obtained . solid oxidizers can vary from about 10 to about 75 total weight percent , however a range from about 40 to about 60 total weight percent is preferred . these oxidizers include nitroguanidine , ammonium perchlorate , ammonium nitrate , hydroxylammonium nitrate , hydroxylammonium perchlorate , cyclotetramethylenetetranitramine and cyclotrimethylenetrinitramine . a preferred group of solid oxidizers includes ammonium perchlorate and ammonium nitrate . after achieving a complete dispersion of solid oxidizers in the slurry , the remaining plasticizer and fillers are mixed into the propellant system . the specific mixing conditions will vary according to the desired propellant , but a mixing time ranging from about 40 to about 100 minutes at about 3500 to about 5000 revolutions per minute will satisfy most requirements . the preferred conditions are about 40 minutes at about 4000 revolutions per minute . depending upon the specific ballistic and tensile requirements , almost any common liquid plasticizers and fillers in almost any combination may be added . the plasticizers may be metriol trinitrate , triethylene glycol dinitrate , nitroglycerin , pentaerythritol trinitrate , dinormal propyl adipate , dibutyl phthalate , dimethyl phthalate , diethyl phthalate , dioctyl phthalate , diisobutyl azelate , dimethyl sebacate , dibutyl sebacate and mixtures thereof . the fillers may be any one or any combination of ballistic additives used in the art , however those of candelilla wax , ethyl centralite , resorcinol , 2 - nitro diphenyl amine , aluminum , lead oxide , lead stamate , lead salicylate , lead β resorcylate , copper salicylate , copper β resorcylate and mixtures thereof are preferred . fillers can vary from greater than 0 to about 15 total weight percent although a range of about 0 . 1 to about 5 total weight percent is preferred . as these plasticizers and fillers are mixed into the propellant system they coat the solid oxidizer and begin to penetrate the coated binder . if insufficiently mixed , the coated solid binder and solid oxidizer will not receive an even coating of plasticizer and fillers , and undesirable ballistic and physical properties may result . after throughly mixing all propellant ingredients the excess liquid aliphatic hydrocarbon solution is decanted from the wet propellant and saved for future use . the propellant is then dried and cured until the binder is fully plasticized and the mix is extruded into strands . by way of example not by limitation the following process and formulations are given . in a cowles 5vtv dissolver , 1 . 54 pounds of dibutyl phthalate , 0 . 94 pounds of metriol trinitrate ( mtn ), 0 . 20 pound of ethyl centralite ( ec ), 0 . 10 pound of triethylene glycol dinitrate ( tegdn ), and 48 . 0 pounds of pure heptane are mixed for 5 minutes at 2000 rpm . to this is added 3 . 83 pounds of water - wet , 12 . 0 % n nitrocellulose and this combination is mixed for 30 minutes at 4000 rpm ; then 0 . 83 pound of mtn is added and mixing is continued for 15 minutes at 2000 rpm . the heptane is decanted and saved . the plasticizer coated nc is dried one day at 140 ° f . the dried coated nc , used heptane and 7 . 6 pounds of new heptane is mixed for ten minutes at 2000 rpm in the cowles 5vtv mixer . while the mixer is still operating , 4 . 8 pounds of ammonium perchlorate ( ap ) is added and mixed for 10 minutes at 2000 rpm and 30 minutes at 4000 rpm . still while the mixer is in operation , a mixture of 2 . 53 pounds of mtn , 0 . 228 pound of tegdn , 0 . 18 pound of ec , 0 . 26 pound of resorcinol , 20 grams of candelilla wax and 0 . 60 pound of dibutyl phthalate are added slowly . the mix is continued for 40 minutes at 4000 rpm . the heptane is then decanted for use in another mix and the mix is dried for 4 days at ambient temperature , 1 day at 120 ° f ., 3 days at 140 ° f . and 1 day at 170 ° f . the mix is then extruded into 1 / 4 inch strands . ______________________________________other formulations include : i ii iii______________________________________ ( 12 . 0 % n ) nc 16 . 2 % 21 . 3 % 26 . 4 % mtn 18 . 5 % 22 . 3 % 26 . 0 % tegdn 1 . 7 % 3 . 1 % 4 . 5 % dinormal propyl adipate 1 . 0 % 1 . 0 % 1 . 0 % ec 2 . 0 % 1 . 7 % 1 . 5 % resorcinol 0 . 5 % 0 . 5 % 0 . 5 % candelilla wax 0 . 1 % 0 . 1 % 0 . 1 % ap 60 . 0 % 50 . 0 % 40 . 0 % ______________________________________ thus it is apparent that there is provided by this invention a solid loaded , extrudable , solventless , double - base propellant having a high percentage of solids and the method of making this propellant . it is to be understood that what has been described is merely illustrative of the principles of the invention and that numerous arrangements in accordance with this invention may be devised by one skilled in the art without departing from the spirit and scope thereof .	2
the invention shall be described in detail below , but it is not to be construed as being limited thereto . proof in mouse and human showing that the gene responsible for systemic carnitine deficiency ( scd ) is octn2 the inventors have previously isolated human cdna encoding a protein having an activity to transport carnitine in a sodium - ion dependent manner , and also the corresponding mouse cdna ( japanese patent application no . hei 9 - 260972 , japanese patent application no . hei 10 - 156660 ). the nucleotide sequences of the human and mouse octn2 cdna isolated by the inventors are shown in seq id no : 2 and 4 , respectively , and the amino acid sequences of the proteins encoded by these cdnas are shown in seq id no : 1 and 3 , respectively . the inventors drew up a working hypothesis that octn2 might be the gene responsible for systemic carnitine deficiency , and conducted experiments to prove this . the juvenile visceral steatosis ( jvs ) mouse was generated due to a mutation in the c3h . oh mouse . this jvs mouse shows symptoms similar to systemic carnitine deficiency patients , and shows an extremely low carnitine concentration within its blood and tissues . this phenotype is inherited by autosomal inheritance . from the above facts , the jvs mouse is considered to be a mouse model for systemic carnitine deficiency ( hashimoto , n . et al ., gene - dose effect on carnitine transport activity in embryonic fibroblasts of jvs mice as a model of human carnitine transporter deficiency , biochem pharmacol , 1998 , 55 : 1729 - 1732 ). the inventors examined the octn2 gene arrangement of the jvs mouse . specifically , whole rna was extracted from the kidney of a jvs homologous mouse , cdna was synthesized , jvs mouse octn2 cdna was amplified using this synthesized cdna as the template by rt - pcr , and the sequence was examined by direct sequencing . the amplification reaction by pcr was conducted as follows . for the 5 ′ side fragment , the primers monb 31 ( 5 ′- gataagcttacggtgtccccttattcccatacg - 3 ′/ seq id no : 22 ) and monb 20 ( 5 ′- cccatgccaacaaggacaaaaagc - 3 ′/ seq id no : 23 ) were prepared . then , amplification was done within a reaction solution ( 50 μl ) containing , cdna , 5 μl of 10 × kod buffer ( toyobo ), 5 μl of 2 mm dntps , 2 μl of 25 mm mgcl 2 , 0 . 5 μl of kod dna polymerase ( toyobo ), 1 μl of 20 μm monb 31 primer , and 1 μl of 20 μm monb 20 primer at 94 ° c . for 3 min , 30 cycles of “ 94 ° c . for 30 sec , 50 ° c . for 30 sec , and 74 ° c . for 1 min ”, and 72 ° c . for 10 min . as for the 3 ′ side fragment , the primers monb 6 ( 5 ′- tgtttttcgtgggtgtgctgatgg - 3 ′/ seq id no : 24 ) and monb 26 ( 5 ′- acagaacagaaaagccctcagtca - 3 ′/ seq id no : 25 ) were prepared , and amplification was done within a reaction solution ( 50 μl ) containing cdna , 5 μl of 10 × extaq buffer ( takara ), 4 μl of 2 . 5 mm dntps , 1 μl of a mixture of extaq dna polymerase ( takara ) and anti taq antibody ( taqstart antibody ™, clontech ), 1 μl of 20 μm monb 6 primer , and 1 μl of 20 μm monb 26 primer , at 94 ° c . for 2 min , 30 cycles of “ 94 ° c . for 30 sec , 60 ° c . for 30 sec , and 74 ° c . for 2 min ”, and 72 ° c . for 10 min . sequencing revealed that the codon encoding the 352 nd leucine ( ctg ) was mutated to a codon encoding arginine ( cgg ) ( fig1 ). this mutation can be detected by restriction fragment length polymorphism ( pcr - rflp ) due to the presence of the cfr13i restriction enzyme site . this method revealed that the jvs homologous mouse ( jvs / jvs ) had this mutation in both alleles , and that the heterologous mouse ( wt / jvs ) has both the mutated and wild type alleles ( fig2 left ). this mutation was also found in the c57bl jvs mouse in which the genetic background has been replaced with that of the c57bl / 6 mouse by backcrossing 12 times or more ( fig2 right ). since the c57bl jvs mouse was constructed after a series of selections using the jvs phenotype as an index , the jvs phenotype and octn2 mutations are considered to be very closely associated . next , the effect this mutation has on the carnitine transporting activity was examined . plasmid dna expressing wild - type mouse octn2 , and those expressing mutated octn2 were separately introduced into bek293 cells , and then , carnitine transporting ability was measured similar to the assay of human octn2 described in japanese patent application hei 10 - 156660 ( fig3 ). this revealed that although wild - type mouse octn2 shows a carnitine transporting activity similar to human octn2 , the mutated octn2 has absolutely no activity . however , both proteins were confirmed to be expressed at a similar amount by a western blotting using an antibody against the c - myc epitope sequence ( nh2 - eqkliseedl - cooh ; seq id no : 26 ) added to the c terminus ( fig4 ). thus , the jvs mouse is thought to have developed the disease due to a functional deletion mutation of the octn2 gene . a database search using human octn2 cdna sequence revealed that the human octn2 genomic dna sequence has been decoded by lawrence berkeley national laboratory ( lbnl ) of the united states as a part of the human genome project . however , it was only recorded as several cosmid clone sequences , therefore , the inventors determined a complete human octn2 genomic dna sequence ( seq id no : 5 ) by comparing with human octn2 cdna sequence and suitably combining the clone sequences . the human octn2 gene is an about 26 kb gene comprising ten exons and nine introns . the eight pairs of primers shown below , which can amplify all the exons as eight fragments , were prepared from this gene arrangement . specifically , ocn2 43 ( 5 ′- gcaggaccaaggcggcggtgtcag - 3 ′, seq id no : 6 ) and ocn2 44 ( 5 ′- agactagaggaaaaacgggatagc - 3 ′, seq id no : 7 ) for exon one ; ocn2 25 ( 5 ′- agatttttaggagcaagcgttaga - 3 ′ seq id no : 8 ) and ocn2 26 ( 5 ′- gaggcagacaccgtggcactacta - 3 ′, seq id no : 9 ) for exon two ; ocn2 27 ( 5 ′- ttcacacccacttactggatggat - 3 ′ seq id no : 10 ) and ocn2 50 ( 5 ′- attctgttttgttttggctctttt - 3 ′, seq id no : 11 ) for exons three and four ; ocn2 31 ( 5 ′- agcagggcctgggctgacatagac - 3 ′, seq id no : 12 ) and ocn2 32 ( 5 ′- aaaggacctgactccaagatgata - 3 ′, seq id no : 13 ) for exon five ; ocn2 33 ( 5 ′- tctgaccacctcttcttcccatac - 3 ′, seq id no : 14 ) and ocn2 34 ( 5 ′- gcctcctcagccactgtcggtaac - 3 ′, seq id no : 15 ) for exon six ; ocn2 35 ( 5 ′- atgttgttccttttgttatcttat - 3 ′, seq id no : 16 ) and ocn2 36 ( 5 ′- cttgttttcttgtgtatcgttatc - 3 ′, seq id no : 17 ) for exon seven ; ocn2 37 ( 5 ′- tatgtttgttttgctctcaatagc - 3 ′, seq id no : 18 ) and ocn2 40 ( 5 ′- tctgtgagagggagtttgcgagta - 3 ′, seq id no : 19 ) for exon eight and nine ; and , ocn2 41 ( 5 ′- tacgaccgcttcctgccctacatt - 3 ′, seq id no : 20 ) and ocn2 42 ( 5 ′- tcattctgctccatcttcattacc - 3 ′, seq id no : 21 ) for exon 10 . next , human octn2 gene mutations in three families that have systemic carnitine deficiency patients , but no blood relationships were examined . the analysis is done by amplifying all the exons using the above primers and genomic dna prepared from blood cells as the template , and subjecting the amplified products into direct sequencing . the amplification reaction by pcr was done within a reaction solution ( 50 μl ) containing 100 ng of genomic dna , 5 μl of 10 × extaq buffer ( takara ), 4 μl of 2 . 5 mm dntps , 1 μl of a mixture of extaq dna polymerase ( takara ) and anti taq antibody ( taqstart antibody ™, clontech ), and 1 μl of each of the 20 μm primers . the reaction conditions were , 94 ° c . for 2 min , 36 cycles of “ 94 ° c . for 30 sec , 60 ° c . for 30 sec , and 74 ° c . for 2 min ”, and 72 ° c . for 10 min . however , in the case of exon one and exon five amplification , a reaction solution ( 50 μl ) containing 100 ng genomic dna , 25 μl of 2 × gc buffer 1 ( takara ), 8 μl of 2 . 5 mm dntps , 0 . 5 μl of la taq dna polymerase ( takara ), and 1 μl of each of the 20 μm primers , was used . in the first family ( kr family ), a 113 bp deletion was found in first exon of the octn2 gene of a systemic carnitine deficiency patient ( fig5 ). this deletion affects the initiation codon and thus , a complete protein will not be produced . the next usable atg codon present in the correct frame is at nucleotide no . 177 , and in this case , it is thought that at least two transmembrane regions will be deleted . the two systemic carnitine deficiency patients in this family were found to contain this mutated octn2 gene in both alleles . on the other hand , the parents and the two brothers of the patient , who have not developed the disease , carry the mutation on just one allele . in the second family ( ak family ), the systemic carnitine patients were found to contain two types of mutated octn2 genes . one mutation was a cytosine insertion just after the initiation codon , which is thought to cause a frame shift and prevent the proper protein from being produced ( fig6 ). the other mutation is a single base substitution ( g to a ) in the codon encoding the 132 nd tryptophan ( tgg ). this mutation had altered the codon into a stop codon ( tga ) ( fig7 ). these mutations are thought to prevent the production of active octn2 proteins in patients . these mutations can be detected by pcr - rflp analysis using bcni , nlaiv restriction enzymes , respectively , which revealed that the patient &# 39 ; s parents who have not developed the disease , had one of each of the mutations , and the patient &# 39 ; s sisters who have not developed the disease , do not have any mutated genes ( fig8 ). in the third family ( th family ), a mutation ( ag to aa ) was found in the splicing site in the 3 ′ end of the intron eight of the octn2 gene ( fig9 ). this mutation prevents the gene from undergoing normal splicing , and thus , it is expected that the normal protein would not be produced . sequencing analysis showed that the systemic carnitine deficiency patient belonging to this family had this mutation in both alleles . on the other hand , the patient &# 39 ; s parents and one of the brothers who have not developed the disease had one mutated allele . the above results revealed that systemic carnitine deficiency is a genetic disease caused by mutations in the octn2 gene . thus , the present invention enables definitive diagnosis , prenatal diagnosis and such , of systemic carnitine deficiency by examining mutations in the octn2 gene using analyses described herein , as well as other methods . the present invention also enables treatment of systemic carnitine deficiency by treatments such as gene therapy using the octn2 gene . the present invention revealed that the octn2 gene is the gene responsible for systemic carnitine deficiency , thus enabling tests for the disease by detecting mutations in the octn2 gene and its protein . moreover , the present invention facilitates treatment of systemic carnitine deficiency by utilizing the octn2 gene and its protein .	2
with reference to fig1 , a schematic of the present invention shows a 180 degree lengthwise cross - section of the packer . a mandrel 1 has a running thread 16 with a tension or shear parting point , or connection , 17 located below the running thread . the mandrel 1 may be shortened by more than one means at point 17 , i . e ., any type of shear , tension , or locking device that can be separated in a fashion to shorten the mandrel . a setting tool ( not shown ) is made up to running thread 16 in order to convey the packer into the well . a millable , frangible or disintegrable disc 14 is a fluid barrier and is part of mandrel 1 or can be attached and sealed to mandrel 1 in some fashion . cone surface 3 is shown of the o . d . of mandrel 1 . slip segments 4 are expandable by sliding up coned surfaces at 2 and 3 . seal 5 , commonly known as a packing element , is located between slip segments 4 and extrusion barriers 6 . seal 5 is compressed and expanded between slip segments 4 . the slip segments 4 have gaps between them that increase in size as the slip segments travel up the cones 2 and 3 . the extrusion barriers 6 are segmented and attached to the slip segments 4 so that the gaps between the slip segments 4 are always bridged to prevent extrusion of seal 5 as the slip segments 4 travel outward to meet the i . d . of the casing . as an alternative , the extrusion barriers 6 may be manufactured as part of the slip segments 4 so that the slip segments 4 themselves bridge the gaps between the slip segments as the slip segments expand outward . shear pins 7 secure the slip segments 4 in the retracted position while the packer is run into the well . the slip segments 4 have dovetail shaped runners 12 that slide in dovetail grooves 11 at cone surfaces 3 and 2 . the runners 12 and grooves 11 may be of any profile and serve to retain the slip segments to both mandrel 1 and cone 8 . furthermore , the runners and grooves provide a means to equally space the slip segments 4 around the perimeter of the plug . additionally , the runners and grooves provide a means to rotationally lock the slip segments 4 , the mandrel 1 , the cone 8 , and the lock ring 9 together during milling operations . when the slip segments engage the inner casing wall , all components become rotationally locked together to help prevent spinning of the packer parts . the lock ring 9 threads are arranged in a manner so if right - hand rotation during milling rotates lock ring 9 to the right , the lock ring 9 rotates down thread 10 , until it bottoms out at the end of thread 10 . once bottomed out , it 9 becomes rotationally locked to the mandrel 1 , rotationally locked to the cone 8 , which is rotationally locked to slip segment 4 , while the teeth 19 of slip segment 4 are penetrated into the inner casing wall . the slip segments 4 are positioned almost 360 degrees around the o . d . of the mandrel 1 . each slip segment has a series of teeth 19 , or some other casing penetrating profiles such as hard inserts positioned on the o . d . of the slip segments as shown in fig4 . in fig4 the slip segment 4 is shown without teeth 19 , but instead inserts or coating 25 . inserts or coating 25 may be ceramic balls , carbide balls , other geometries made of carbide or ceramic , proppant or sand , or other materials . inserts or coatings 25 may be of any pattern on the o . d . of slip segment 4 and can be either a structured or random pattern . sand or proppant , for example 20 - 40 or larger sizes , gravel pack sand or fracturing proppant made by santrol or hexion , or carboceramics , can be used in or on the surface of slip segment 4 and can be attached to the surface with bonding materials or imbedded into the base material . those in the gravel pack or frac pack business know that sand or proppant can stick downhole tools in the well , so it would be obvious that sand or proppant can be used on packer slips to hold tools in place relative to pipe or casing . the objective of using inserts or coatings 25 is to improve millability of the slip segments whereby the base material of the slip segments are easily machined and the inserts or coating 25 are hard enough to penetrate the casing i . d . another objective to inserts or coating 25 is to minimize casing damage on the i . d . of the casing . teeth marks from slips can increase susceptibility of the casing to corrosion and other failure mechanisms , especially in chrome based materials . the teeth , inserts , or coatings are sufficiently hard to penetrate the inside of the casing wall in order to grip the wall and prevent the packer from moving relative to the casing . the slip segments have an o . d . that is machined to be almost equal to the i . d . of the casing . the slip segments are machined to minimize any gaps between the o . d . of the slip segments and the i . d . of the casing . similarly , the angles on the i . d . of the slip segments are machined to almost match the o . d . of the cone surfaces 2 and 3 when the slip is fully expanded , in order to minimize gaps between the parts . the cone 8 has a surface 2 . the setting tool ( not shown ) pushes against surface 18 while pulling on threads 16 during the setting operation . the cone 8 has an internal thread that engages body lock ring 9 . body lock ring 9 can ratchet freely toward the slip segments 4 but engages and prevents movement away from the slip segments 4 by engaging the threads 10 on the top o . d . of the mandrel 1 . lugs 13 engage slots 15 if plugs stack during milling so the relative plugs don &# 39 ; t spin during milling . fig2 shows the packer in the “ set position ”. in operation , also see fig1 , the setting tool ( not shown ) pushes on cone 8 , at or near surface 18 , and simultaneously pulls on thread 16 of mandrel 1 . cone 8 moves toward the slip segments 4 and seal 5 and in the process expands the slip segments 4 up cones 2 and 3 and compresses seal 5 between slip segments 4 and extrusion barriers 6 . expansion of slip segments 4 and seal 5 continues until sufficient contact is made with the i . d . of the casing to achieve slip tooth 19 penetration in the inner wall of the casing . at this point the teeth of the slip segments have nearly closed any seal 5 extrusion gaps between the o . d . of the slip segments 4 and the i . d . of the casing . extrusion gaps have been minimized nearly 360 degrees around the packer . additionally , slip load has been nearly evenly distributed around the i . d . of the casing to minimize distortion of the casing . slip segment 4 distribution around the o . d . of the mandrel 1 is more uniform due to the rails 12 and grooves 11 keeping the slip segments equally spaced around the packer . also , extrusion gaps have been closed where the i . d . of the slip segments contact the surfaces of the cones at 20 and 21 . at this point , the extrusion gaps between the slip segments 4 are bridged with the extrusion barriers 6 . in the set position , fig2 , the lock ring 9 has traveled over thread 10 . thread 10 is designed to prevent reverse movement of lock ring 9 , so that lock ring 9 holds cone 8 in a firm position under slip segment 4 while maintaining compression on seal 5 and keeping the slip segments 4 expanded into the i . d . of the casing . once sufficient load is applied to cone 8 and thread 16 of mandrel 1 , in order the drive teeth 19 into the i . d . of the casing and create an adequate seal with seal 5 , the upper portion of mandrel 1 with thread 16 , disconnects at point 17 . the upper portion 22 of mandrel 1 comes out of the hole with the setting tool ( not shown ) and leaves a short section of mandrel 1 in the well . obviously , with the outer packer components 4 , 5 , and 8 compressed closely together in combination with the short section of mandrel 1 , the remaining portion of the plug is not only very short , but requires less material and length to mill out . the amount of material to mill out is minimized by taking as much material out of the packer components as possible , while still maintaining enough strength to hold well pressure differentials . for example , notice on mandrel 1 that the i . d . is bored out and at the lower end of mandrel 1 below the angled surface 3 , material has been removed at location 23 . as a result , the packer becomes a minimum material packer by removing material that is not needed to structurally maintain a pressure differential in the well bore . also , to enhance millability of the packer , highly millable materials may be used , such as cast iron , or some other easily machinable material . fig3 shows a cross - sectional end view of the slip segments 4 in the expanded position . in the expanded and set position , gaps exist between each slip segment 4 . an extrusion barrier 6 is attached to the slip segment 4 by an attachment means , such as drive - loc pins 24 . the extrusion barriers 6 cover the gaps between each slip segment 4 to form a seal 5 backup surface to prevent seal 5 extrusion past the slip segments 4 . since the teeth 19 of the slip segments penetrate the inside of the casing wall , any extrusion gaps are closed off on the outside of the slip segments 4 . since the i . d . of the slip segments 4 closely matched the o . d . of the tapered surfaces 2 and 3 , the extrusion gaps on the inside of the slip segments 4 are reduced to a minimum . this described geometry forms a near metal - to - metal seal backup system in the packer which is very desirable for high pressure and temperature well conditions . fig5 shows a similar packer , or frac disc , to fig1 . the fig5 packer has the same features mentioned above except it does not have an upper set of slip segments 4 , therefore , it would normally be used in situations where the packer is only required to hold pressure from above . this version would be a lower cost version than the one shown in fig1 and cone 8 could be replaced with lock ring housing 26 . in order to further simplify the packer design , the extrusion rings 6 could be eliminated and the packing element , or seal 5 , could have a backup built into the seal system 5 . in low pressure applications , or in cases where a positive seal with the i . d . of the casing is not needed , extrusion backup 6 and other backups in the packing element could be eliminated . fig6 shows a similar packer , or frac disc , to fig1 . the fig6 packer has many of the same features mentioned above except it does not have the upper set of slip segments 4 , or the packing element 5 , or the anti - extrusion devices 6 . the cone 8 is replaced with cup retainer 27 and the packing element 5 is replaced with the packing cup 28 . obviously the packing cup 28 only holds pressure from above generated from pressure operations occurring above the cup . this design allows opportunities to further minimize the material left in the well for milling out , for example , by eliminating the upper slip segments 4 and leaving a shorter mandrel 1 by moving separation point 17 downward .	4

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.