text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the present invention is directed to methods for preventing and treating the inhibition of gastrointestinal motility , particularly constipation , that arises in the group of patients taking chronic or maintenance doses of opioids . these patients include late stage cancer patients , elderly patients with osteoarthritic changes , methadone maintenance patients , neuropathic pain and chronic back pain patients . it has been discovered that the group of patients chronically taking opioids is surprisingly responsive to doses of quaternary derivatives of noroxymorphone that were previously considered too low to be clinically efficacious . treatment of these patients is important from a quality of life standpoint , as well as to reduce complications arising from chronic constipation , such as hemorrhoids , appetite suppression , mucosal breakdown , sepsis , colon cancer risk , and myocardial infarction . in the invention , a preferred quaternary derivative of noroxymorphone is methylnaltrexone . preferred side effects to be treated include constipation and gastrointestinal motility inhibition , dysphoria , pruritus , and urinary retention . when used as a treatment for these opioid - induced side effects , methylnaltrexone ( mntx ) or other quaternary derivatives of noroxymorphone ( qdmn ) provide prolonged relief of the side effects . idiopathic constipation , i . e ., that due to causes other than exogenous administration of opioids , may be mediated by opioid sensitive mechanisms . endogenous opioid receptors have been identified in the gut and these receptors may modulate gut motility . thus , administration of an opioid antagonist with peripheral action , such methylnaltrexone or other quaternary derivatives of noroxymorphone , would block the effects of endogenous opioids . quaternary derivatives of noroxymorphone are described in full in goldberg et al ., u . s . pat . no . 4 , 176 , 186 ( herein incorporated by reference ), and in general are represented by the formula : wherein r is allyl or a related radical such as chlorallyl , cyclopropyl - methyl or propargyl , and x is the anion of an acid , especially a chloride , bromide , iodide or methylsulfate anion . the presently preferred quaternary derivative of noroxymorphone is methylnaltrexone . methylnaltrexone is a quaternary amine derivative of naltrexone . methylnaltrexone has been found to have only 2 to 4 % of the opiate antagonistic activity of naltrexone in vivo due to its inability to pass the blood - brain - barrier and bind to the opiate receptors in the central nervous system . opioids are typically administered at a morphine equivalent dosage of . 0 . 005 to 0 . 15 mg / kg body weight for intrathecal administration ; 0 . 05 to 1 . 0 mg / kg body weight for intravenous administration ; 0 . 05 to 1 . 0 mg / kg body weight for intramuscular administration ; 0 . 05 to 1 . 0 mg / kg body weight / hour for transmucosal or transdermal administration . by “ morphine equivalent dosage ” is meant representative doses of other opioids which equal one milligram of morphine , for example 10 mg meperidine , 1 mg methadone , and 80 μg fentanyl . in accordance with the present invention , methylnaltrexone is administered at a dosage of : 0 . 001 to 1 . 0 mg / kg body weight for intravenous administration ; 0 . 001 to 1 . 0 mg / kg body weight for intramuscular administration ; 0 . 001 to 1 . 0 mg / kg body weight for transmucosal administration and 0 . 1 to 40 . 0 mg / kg body weight for oral administration . the administration of the methylnaltrexone is preferably commenced prior to administration of the opioid to prevent opioid - induced side effects , including constipation . it is desirable to commence administration of methylnaltrexone about 5 minutes for parenteral mntx administration and 20 minutes for enteral mntx administration prior to administration of opioids in order to prevent these opioid - induced side effects , while the prevention of symptoms is preferred , in some patients , such as those chronically on opioids , prevention is not possible . however , methylnaltrexone administration may also be commenced after the administration of the opioid or after the onset of opioid induced symptoms as a treatment for those symptoms . methylnaltrexone is rapidly absorbed after oral administration from the stomach and bowel . initial plasma levels of the drug are seen within 5 - 10 minutes of the administration of non - enteric coated compound . addition of an enteric coating which prevents gastric absorption is associated with lower plasma levels of the methylnaltrexone . for intravenous or intramuscular administration , methylnaltrexone ( from , e . g ., mallinckrodt pharmaceuticals , st . louis , mo .) is formulated with saline or other physiologically acceptable carriers ; for transmucosal administration the methylnaltrexone is formulated with a sugar and cellulose mix or other pharmacologically acceptable carriers known in the art ; and for oral administration , the methylnaltrexone is provided in granules which can be coated or left uncoated , and can be put in gelatin capsules . an enteric coating manufactured by coating place , inc ., verona , wis . can be made as follows . the drug was prepared by encapsulating mntx powder with a eudragit l100 and myvacet 9 - 45 mixture . the final substance used in the study was the 45 - 80 mesh fraction which was 50 % mntx by weight . this was demonstrated to decrease release of the drug at gastric ph by 77 % based on the methods of the usp / nf . these microencapsulated granules were then put into gelatin capsules for administration . alternatively , methylnaltrexone is formulated with pharmacologically acceptable binders to make a tablet or capsule with or without an enteric coating . methods for such formulations are well known to those skilled in the art ( see e . g ., remington : the science and practice of pharmacy , 19 th ed . ( 1995 ) mack publishing company , easton , pa . ; herein incorporated by reference ). any art - known transdermal application may be used , but transdermal administration is preferably via a patch applied to the skin with a membrane of sufficient permeability to allow diffusion of mntx at a fixed rate in the range of 1 . 0 to 10 . 0 mg / hr . the rate of administration may be varied by varying the size of the membrane contact area and / or applying an electrical wiring potential to a drug reservoir . the patch preferably holds 25 mg to 1 gram of available drug in the reservoir plus additional drug as needed for the mechanics of the system . in the description above and below , methylnaltrexone is used as an example of a particularly effective qdnm . it is apparent that other qdnms may be used as desired , and appropriate dosage can readily be determined empirically by those of skill in the art to account for e . g ., variable affinity of the qdnm for opiate receptors , different formulations , etc . the following examples are intended to illustrate aspects of the invention and are not to be construed as limitations upon it . with approval from the institutional review board at the university of chicago , two male and two non - pregnant female adults participating in a methadone maintenance program were enrolled in this study . all four subjects were african americans . their mean age ± sd ( range ) was 45 . 3 ± 8 . 6 ( 35 - 56 ) years . subjects in this study met the following inclusion criteria : ( 1 ) they were currently enrolled in a methadone maintenance program for at least 1 month ; ( 2 ) they experienced methadone - induced constipation , i . e . less than one bowel movement in the previous 3 days or less than three bowel movements in the previous week ( o &# 39 ; keefe et al ., j . gerontol ., 50 : 184 - 189 ( 1995 ); parup et al ., scand . j gastroenterol , 33 : 28 - 31 ( 1998 )). exclusion criteria were as follows : ( 1 ) history or current evidence of significant cardiovascular , respiratory , endocrine , renal , hepatic , hematological or psychiatric disease ; ( 2 ) any laboratory findings indicating hepatic or renal impairment , or abnormal physical examination findings ; ( 3 ) current use of other medications , or evidence of illicit drug use ; ( 4 ) known hypersensitivity to lactose or lactulose ; ( 5 ) participation in any investigational new drug study in the previous 30 days ; ( 6 ) subject is breastfeeding . subjects also agreed not to take any laxatives for 2 days before the beginning of the study and during the study . after obtaining written , informed consent , subjects were admitted to the clinical research center at the university of chicago medical center for up to 8 days . methylnaltrexone dose of 0 . 45 mg / kg was chosen to start this trial because this dose was previously given in normal volunteers and prevented opioid - induced delay of the oral - cecal transit time without any side effects ( yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 )). drug administration was performed single blind to the subjects in this pilot study . thus , methylnaltrexone dose could be adjusted based on subjects &# 39 ; clinical response during the study . all four subjects received test drug ( normal saline or methylnaltrexone ( n - methylnaltrexone bromide , prepared by mallinckrodt specialty chemicals , st . louis , mo .)) twice daily at 09 : 00 h and 21 : 00 h , except on the last day of the study in which they received test drug only at 09 : 00 h . all four subjects received placebo ( normal saline ) on day 1 . thereafter , subjects received intravenous methylnaltrexone until the end of the study . on day 2 at 09 : 00 hours ( h ), subjects 1 and 2 were given 0 . 45 mg / kg intravenous methylnaltrexone over 1 min . subject 2 experienced severe abdominal cramps after receiving the compound and was withdrawn from the study . subject 1 did not experience abdominal cramps after the first dose of methyl naltrexone , but was given placebo in place of the compound at the regularly scheduled dosing times for day 2 and day 3 to maintain the single blind study while the reaction of subject 2 was investigated . beginning on day 4 , the study was resumed for subject 1 using 0 . 45 mg / kg of methylnaltrexone , diluted with 50 ml normal saline and administered over 30 min . infusion could be stopped at any time for complaints of abdominal pain . for subjects 3 and 4 , the study was shortened from 8 to 5 days , methylnaltrexone dosage was decreased , and a new , three - step dosing procedure was established . methylnaltrexone 0 . 05 mg / kg , mixed in 30 ml normal saline ( first syringe ), was infused intravenously over 10 min . the subject was then observed 10 min for drug response . if there was no response , then methylnaltrexone 0 . 1 mg / kg ( second syringe ), mixed in 30 ml normal saline , was infused over 15 min . subject was observed 15 min for drug response . if there was no response , then methylnaltrexone 0 . 3 mg / kg ( third syringe ), mixed in 30 ml normal saline , was infused over 15 min . vital signs were obtained at 0 , 5 , 10 , 30 , 60 , 90 and 120 min after each test drug administration . for oral - cecal transit time measurement , 10 g lactulose ( solvay pharmaceuticals , marietta , ga .) was administered orally at 09 : 00 h of day 1 , day 5 and day 8 for subject 1 ; of day 1 for subject 2 and of day 1 , day 3 and day 5 for subjects 3 and 4 . illicit drug use was monitored by random urine drug screens . after each test drug administration , seven blood samples ( 5 ml each ) were obtained at time 0 , 5 , 30 min , and 1 , 2 , 4 , 8 h , and three urine samples were collected at time 0 , 2 , and 4 h . plasma and urine methylnaltrexone levels were determined by an hplc technique with a detection limit of 2 ng / ml ( kim et al ., 1989 ; yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 ); both herein incorporated by reference ). subjects were asked to record frequency and consistency of stools during the study period . subjects &# 39 ; bowel movements were witnessed and recorded by a research nurse . the oral - cecal transit time was assessed by the pulmonary hydrogen ( h 2 ) measurement technique , which measures pulmonary h 2 that is produced when unabsorbed lactulose is fermented by colonic bacteria and excreted in the breath . this h 2 production is reflected by a concomitant increase in breath h 2 excretion . the time between ingestion and the earliest detectable and sustained rise in pulmonary hydrogen excretion , i . e ., a sudden rise to peak (& gt ; 25 ppm ), or an increase of at least 2 ppm above the baseline , maintained and increased in three consecutive samples , indicates that lactulose has reached the cecum and represents the oral - cecal transit time ( see e . g ., yuan , et al ., clin . pharmacol ther ., 59 : 469 - 475 ) ( 1996 ); bond and levitt , j . lab clin . med , 85 : 546 - 555 ( 1975 ); read , et al ., gut ., 26 : 834 - 842 ( 1985 ) bailisco , et al , dig . dis . sci ., 32 : 829 - 832 ( 1987 )). hydrogen breath tests were conducted every 15 min until oral - cecal transit time was determined . to evaluate possible opioid withdrawal with methylnaltrexone , subjects were asked to rate on a 5 - point scale from 0 ( not at all ) to 4 ( extremely ) an objective checklist withdrawal scale ( fraser et al ., j . pharmacol exp . ther , 133 : 371 - 387 ( 1961 ); jasinski , drug addiction j ., 197 - 258 ( 1977 ); both herein incorporated by reference ). items to be rated were : muscle cramps , flushing , painful joints , yawning , restless , watery eyes , runny nose , chills or gooseflesh , sick to stomach , sneezing , abdominal cramps , irritable , backache , tense and jittery , sweating , depressed / sad , sleepy , shaky ( hands ), hot or cold flashes , and bothered by noises . the ratings for individual items were summed for a total score for each scale . the total scores were compared before and after methylnaltrexone administration to see if there was a significant difference . all four subjects showed no response to placebo injection . subjects 1 and 2 , who received a methyl naltrexone dose of 0 . 45 mg / kg , showed immediate positive laxation during or immediately after intravenous drug infusion . during 7 days of methylnaltrexone administration , subject 1 did not experience any significant side effects , and reported mild abdominal cramping after each injection . subject 2 , however , had severe abdominal cramping after a single dose of methylnaltrexone , but showed no signs of systemic withdrawal such as lacrimation , diaphoresis , mydriasis , or hallucinations . subject 2 was released without receiving additional methylnaltrexone . subjects 3 and 4 received intravenous methylnaltrexone ( 0 . 05 - 0 . 15 mg / kg ) twice daily for 4 consecutive days . this 0 . 05 - 0 . 15 mg / kg dose range induced immediate laxation response in these two subjects , therefore , the third syringe injection ( methylnaltrexone dose 0 . 3 mg / kg dose ) was not administered during the study . no significant side effects were observed . like subject 1 , both subjects described mild abdominal cramping , similar to a defecation sensation , without discomfort involved . the stool frequency of these subjects increased from 1 - 2 times per week before the study to approximately 1 . 5 stool per day during the treatment period ( table 1 ). for subjects 1 , 3 , and 4 , oral - cecal transit times were reduced from 150 , 150 and 150 min ( after placebo ) to 90 , 60 and 60 min ( after methylnaltrexone , at the end of the study ), respectively . the baseline transit time for subject 2 was 180 min . due to the discontinuation . of this subject , no other transit time was recorded after day 1 . peak plasma methylnaltrexone levels for subjects 1 , 2 , 3 and 4 were 1 . 65 , 1 . 10 , 0 . 25 and 0 . 53 μg / ml , respectively . in previous healthy volunteer studies , intravenous 0 . 45 mg / kg methylnaltrexone effectively prevented opioid - induced delay in oral — cecal transit time without affecting analgesia ( yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 )). however , that study was performed in normal volunteers after acute single administration doses of opioid and methylnaltrexone . thus , the dose relationship of agonist to antagonist remained unknown in opioid - tolerant individuals , such as subjects in methadone maintenance programs as well as advanced cancer patients with chronic opioid pain medications . when this study was designed , 0 . 45 mg / kg intravenous methylnaltrexone was chosen , the dose previously administered in normal volunteers that did not cause gastrointestinal symptoms ( e . g . abdominal cramping ) or laxation response . to achieve positive laxation while limiting the possibility of adverse effects , bid dosing was planned for 7 days . due to the fact that the elimination half - life of intravenous methylnaltrexone is approximately 2 h ( yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 ); foss et al ., j . clin . pharmacol , 37 : 25 - 30 ( 1997 )), no drug accumulation was expected in this study . after intravenous injection , immediate bowel movements were observed in the first two subjects . while methylnaltrexone has been demonstrated to not reverse the analgesic effects of opioids ( yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 )), the potential effects of the compound in a population of chronic opioid users was unknown . gastrointestinal symptoms are one of the hallmarks of gut withdrawal , and the persistent severe cramping in subject 2 , which required treatment , prompted a modification of the protocol . it is important to note , however , that none of the other primary indicators of opioid withdrawal were noted in this or any of the other subjects . for the next two subjects , the drug dose was reduced and the study duration shortened . while no effects were observed after placebo , positive laxation and significant reduction of the gut transit time were observed after a lower intravenous dose of methylnaltrexone in these two chronic methadone subjects . peak plasma levels of methylnaltrexone in all subjects were determined and were comparable to those seen in volunteers given similar doses ( yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 ); foss et al ., j . clin . pharmacol , 37 : 25 - 30 ( 1997 )). subject 1 , who had laxation but no other symptoms actually had higher peak plasma levels than subject 2 ( with the severe abdominal cramping ), suggesting a difference in subject 2 &# 39 ; s pharmacological response rather than a difference in pharmacokinetics . the three subjects who completed the study reported mild abdominal cramping during intravenous methylnaltrexone infusion . the mild cramping appears to be a physiological desire to move the bowels , because the cramping disappeared after their bowel movement . since the half - life of methylnaltrexone is approximately 2 h , one would expect that cramping caused by hyperactivity of the gut to be more prolonged . this indicates that methylnaltrexone and similar qdnms are safe and ideal candidates to resolve opioid induced constipation without stimulant / laxative type side effects . this example was a double - blind , randomized , placebo - controlled trial , evaluating the effects of methylnaltrexone in treating chronic opioid - induced constipation . we conducted this trial using subjects in a methadone maintenance program , in which approximately 60 % of the chronic methadone users have constipation . these subjects served as a proxy group for advanced cancer patients to evaluate the efficacy of methyl naltrexone on chronic opioid - induced constipation . with approval from the institutional review board , 9 male and 13 non - pregnant , non - breastfeeding female adults were enrolled ( fig1 ). their mean age ± s . d . ( range ) was 43 . 2 ± 5 . 5 ( 25 - 52 ) years . subjects met the following inclusion criteria : ( 1 ) enrollment in a methadone maintenance program for & gt ; 1 month ; ( 2 ) methadone - induced constipation , i . e ., 0 - 1 bowel movement in the previous three days , or 0 - 2 bowel movements in the previous week ; ( 3 ) no laxative use two days before the study nor during the study . exclusion criteria were as in the previous example . an investigator explained the study procedures and obtained written , informed consent from 22 paid subjects . these subjects , who continued to receive their usual dose of methadone during the study , were admitted to the clinical research ( center at the university of chicago medical center for two days . an intravenous catheter was placed in each arm , one for test drug administration ( placebo or methylnaltrexone [ n - methylnaltrexone bromide ], prepared by mallinckrodt specialty chemicals , st . louis , mo . ), and the other for blood drawing . on day 1 , at 9 am , after a restricted supper of no fiber the night before ( required for the oral - cecal transit time measurement , see below ) and overnight fasting , subjects were instructed to ingest 10 g lactulose ( solvay pharmaceuticals , marietta , ga .) in 1 . 00 ml tap water . subjects were also given placebo ( normal saline ) in four syringes ( 35 ml each ) for intravenous injection ( single - blinded to the subject ). on day 1 , at 5 pm , subjects were given placebo or methylnaltrexone up to 0 . 365 mg / kg over four syringes . each syringe contained placebo or methyl naltrexone in 35 ml of normal saline , and was administered intravenously over nine minutes . for the methylnaltrexone group , syringes 1 , 2 , 3 and 4 contained 0 . 015 , 0 . 05 , 0 . 1 and 0 . 2 mg / kg study drug , respectively . the interval between administration of each syringe in both groups was one minute . the continued administration of each syringe depended on the absence of a clinical laxation response ( i . e ., elimination of any stool ) and / or potential side effects . immediate laxation was defined as defecation either during or within one minute after cessation of the infusion . the injection was discontinued if the subject had a bowel movement . after a non - fiber supper the night before and overnight fasting , subjects on day 2 at 9 am , were again given test drug intravenously . subjects were also given 10 g lactulose at this time . day 2 studies were done to test the constancy of effect and to measure the oral - cecal transit time ; this study did not have a crossover design . injection assignment was prepared using a table of random numbers from which sealed envelopes were prepared and opened sequentially as subjects were enrolled in the study . no stratification or blocking factors were used , except to insure that equal numbers of subjects were assigned to each treatment group after enrollment of the last ( 22 nd ) subject . randomization and test drug preparation were done by a biostatistician and a physician , respectively , who did not participate in data acquisition and evaluation . vital signs were obtained at 0 , 5 , 10 , 30 , 60 , 90 and 120 min after each test drug administration . illicit drug use was monitored by random urine drug screens . blood and urine sampling and analysis were performed as in example 1 . subjects were asked to record frequency and consistency of stools during the study period . subjects &# 39 ; bowel movements were confirmed and recorded by a research nurse blinded to the group assignment . at the end of the study , the subjective opinion of each participant was gathered in order to rate subjects &# 39 ; satisfaction in respect to bowel movement . to evaluate possible opioid withdrawal with methylnaltrexone , before and 10 min after the completion of test drug administration , subjects were asked to complete an objective checklist of withdrawal symptoms modified from fraser et al . ( j . pharmacol exp . ther ., 133 : 371 - 387 ( 1961 )) and jasinski ( drug addiction j ., 197 - 258 ( 1977 )). items rated ( none , mild , moderate , severe ) were yawning , lacrimation ( excessive tearing ) rhinorrhea ( nasal discharge ), perspiration , tremor , piloerection ( goosebumps ), and restlessness . the ratings for individual items were translated to a 0 - 3 scale and summed to give a total symptom score . the total scores before and after test drug administrations were compared between the groups . potential opioid withdrawal symptoms were also monitored by an investigator throughout the study . laxation responses were compared between groups using fisher &# 39 ; s exact test . the mann - whitney u test was used to compare the change from baseline in oral - cecal transit time between the two groups and to evaluate statistical differences between genders in oral - cecal transit times with p & lt ; 0 . 05 considered statistically significant . changes in opioid withdrawal symptoms were analyzed similarly . the mean stool frequency per week of the 22 subjects before the study was 1 . 5 ± 0 . 7 . all 22 subjects showed no response to placebo in the morning of day 1 . eleven subjects were randomized to each treatment group . those randomized to placebo received all four syringes in day 1 afternoon and day 2 morning sessions . as shown in table 2 , none of them showed any laxation response after placebo , and no abdominal cramping was reported . at the end of the trial , seven of them were disappointed in respect to bowel movement satisfaction . there were no significant bowel movement frequency changes before and during the study . there were no opioid withdrawal and no significant side effects in these subjects . ten subjects in the methylnaltrexone group had immediate laxation response in the day 1 afternoon session , and all 11 subjects had immediate laxation in the day 2 morning session ( fisher &# 39 ; s exact p value & lt ; 0 . 0001 when compared with placebo group response for both days 1 and 2 ). the stool of most subjects ( over 90 %) was soft to loose and in large quantity . the methylnaltrexone dose received was 0 . 09 ± 0 . 10 ( 0 . 01 - 0 . 37 ) mg / kg and 0 . 10 ± 0 . 10 ( 0 . 01 - 0 . 37 ) mg / kg for day 1 and day 2 , respectively . fig2 shows the relationship between effective methyl naltrexone dose and peak plasma concentration . during and immediately after each study drug injection , all subjects reported mild to moderate abdominal cramping , which they described as being similar to a defecation sensation , without discomfort involved . there was no opioid withdrawal symptoms observed in any of these subjects during the study . no significant side effects were reported by the subjects . subject 13 reported mild light - headedness which resolved spontaneously . no subject demonstrated any clinically significant change in blood pressure or heart rate from baseline with either the placebo or study drug infusions . subjects did not have additional bowel movements after drug - induced - immediate laxation , except subject 15 who reported mild diarrhea . at the end of the study , all 11 subjects were satisfied with their bowel movement activity ( table 2 ). oral - cecal transit time data are presented in fig3 . the transit times for subjects in the placebo group ( n = 11 ) at baseline and after placebo injection were 126 . 8 ± 48 . 3 ( 60 - 195 ) min and 125 . 3 ± 45 . 0 ( 60 - 180 ) min , respectively . the transit times for subjects in the methylnaltrexone group ( n = 11 ) showed that the study drug reduced the transit time from the baseline level of 132 . 3 ± 36 . 0 ( 60 - 180 ) min to 54 . 5 ± 19 . 3 ( 30 - 105 ) min . the average change in the methylnaltrexone group (− 77 . 7 ± 37 . 2 min ) was significantly greater than the average change in the placebo group ( 1 . 4 ± 12 . 0 min ) ( p & lt ; 0 . 001 ). there were no statistical differences in oral - cecal transit times between genders . peak plasma levels of 11 subjects in methylnaltrexone group for day 1 and day 2 were 162 ± 237 ( 30 - 774 ) ng / ml and 166 ± 177 ( 33 - 658 ) ng / ml , respectively . the percentage of the intravenous dose excreted , unchanged in urine from 0 to 4 hr for day 1 and day 2 was 23 . 7 ± 10 . 5 ( 9 . 6 - 39 . 9 ) % and 37 . 6 ± 17 . 8 ( 13 . 2 - 73 . 6 ) %, respectively . the effect of opioids on gastrointestinal motility and transit is well appreciated as a clinical phenomenon . opioids inhibit gastric emptying and propulsive motor activity of the intestine , thereby decreasing the rate of intestinal transit and producing constipation . it has been shown that opioid receptors and endorphins are widely distributed in the central nervous system and throughout the gastrointestinal tract . based on data obtained from previous animal experiments , the site of opioid action ( central vs . peripheral ) of exogenous opioid - induced gut motility change or constipation is still controversial ( daniel , et al ., gastroenterology , 36 : 510 - 523 ( 1959 ); stewart , et al ., j . pharmacol exp . ther ., 205 : 547 - 555 ( 1978 ); tavani , et al ., life sci ., 27 : 2211 - 2217 ( 1980 ); galligan and burks , j pharmacol exp . ther ., 226 : 356 - 361 ( 1983 ); manara , et al ., j . pharmacol exp . ther ., 237 : 945 - 949 ( 1986 )). since the translation of animal experiment data in the literature to humans is problematic due to differences in the physiology of the opioid systems , the action site for opioid - induced constipation in humans remains a matter of investigation . methylnaltrexone , a peripheral opioid receptor antagonist , very effectively reversed chronic opioid constipation in this clinical trial . the data in these examples provide the first strong evidence that the methadone constipating effect in humans is predominantly mediated by receptors located in the peripheral gastrointestinal tract . all 11 subjects who received intravenous methylnaltrexone had an immediate laxation response , and all reported some degree ( mild to moderate ) of abdominal cramping prior to their bowel movement . we interpret their abdominal cramping as a physiological desire to defecate , because the cramping disappeared after their bowel movement . because the half - life of methylnaltrexone is approximately two hours , one would expect that cramping caused by hyperactivity of the gut to be much more prolonged . the lactulose hydrogen breath test was used , and subjects always received placebo the morning of day 1 to establish an oral - cecal transit time baseline . compared to baseline levels , we observed a significant reduction in gut transit time in all subjects after methylnaltrexone treatment . this result is consistent with the methylnaltrexone - induced clinical laxation response in these individuals . lactulose , a non - absorbable osmotic agent that acts in the colon by increasing water content of the stool without directly stimulating gut peristaltic activity , may have laxative effects itself and could affect interpretation of our results . however , the dose used in this study ( 10 g ) is ½ to ⅓ of a single dose and ⅙ th 1 / 12 th the daily dose recommended to produce soft stools . this small dose of lactulose had no effect in our study , as indicated by the absence of a laxation response as well as no change in oral - cecal transit time in the placebo group . a relatively wide dose range of intravenous methy 1 naltrexone was used to achieve clinical laxation . in terms of individual subjects , however , the laxation doses for day 1 and day 2 were very similar , and no tachyphylaxis was noticed . in this study , no opioid withdrawal symptoms were observed in our chronic methadone subjects , which further indicates that methylnaltrexone does not penetrate into the brain in humans . none of the 11 subjects in the methyl naltrexone group experienced significant side effects . since oral medication is a safer and more convenient way to deliver drugs than is intravenous administration , the efficacy of oral mntx in relieving constipation in methadone maintained patients was evaluated . twelve constipated adults (≦ 2 stool / week ) were enrolled . their daily methadone dose was 73 . 3 ± 16 . 2 mg ( 41 - 100 mg ), mean ± sd ( range ). on day 1 at 9 am , subjects ingested 10 g lactulose ( solvay pharmaceuticals ) to assess oral - cecal transit time as described above , and a placebo capsule . on day 2 at 9 am , subjects again received lactulose , and a capsule containing methylnaltrexone ( mallinckrodt ). ascending oral methylnaltrexone doses ( 0 . 3 , 1 . 0 , and 3 . 0 mg / kg ) were given to 3 groups of 4 subjects per group . drug administrations were single - blinded to the subject . laxation response and potential opioid withdrawal were recorded and blood samples were collected . none of the 12 subjects showed laxation response to placebo on day 1 . on day 2 , 3 out of 4 subjects had a bowel movement 18 . 0 ± 8 . 7 hr ( 8 - 24 hr ) after receiving 0 . 3 mg / kg mntx . all subjects in the 1 . 0 mg / kg group and 3 . 0 mg / kg group had bowel movements at 12 . 3 ± 8 . 7 hr ( 3 - 24 hr ) and 5 . 2 ± 4 . 5 hr ( 1 . 2 - 10 hr ) after receiving oral compound , respectively . most subjects reported very mild abdominal cramping after oral mntx . bowel movements , in most cases , were loose and in large quantity . there was no opioid withdrawal in any subjects , and no adverse effects were reported . dose - related reduction of oral - cecal transit times is shown in fig4 . oral mntx has a significant dose - response effect ( p & lt ; 0 . 05 ) using the spearman rank correlation coefficient test and linear regression model . eight subjects had undetectable methylnaltrexone in their plasma . peak plasma level for another 4 subjects ( one from 1 . 0 mg / kg group and three from 3 . 0 mg / kg group ) was 17 . 8 ± 6 . 6 ng / ml ( 10 - 26 ng / ml ). with approval from the institutional review board at the university of chicago , seven men and seven nonpregnant women were enrolled in this double - blind , randomized placebo - controlled study . mean age ± sd was 25 . 8 ± 8 . 4 years : age range was 18 to 43 years . subjects were screened for drug abuse disorders or medical contraindications that would keep them from participating in the study . subjects fasted from midnight the night before the study day and were admitted for each experimental day ( or session ) in the morning to the clinical research center at the university of chicago medical center . sessions were separated by at least 1 week . each session lasted approximately 7 hours , and the subjects received one of three injections : ( 1 ) placebo plus placebo , ( 2 ) placebo plus 0 . 05 mg / kg morphine , or ( 3 ) 0 . 45 mg / kg methylnaltrexone plus 0 . 05 mg / kg morphine . injection 1 was given at the first session , and the subjects were blinded to the medication . injections 2 and 3 were given in a random order , and the subjects and observers were blinded to the medication . injection assignments were prepared by random selection on a computer and were sealed in envelopes . drug preparation and administration was done by a physician who did not participate in subject observation and data acquisition . after completion of the above three injections , we asked six of the subjects , beginning with those who had completed the study last , to return for a fourth injection ( 0 . 45 mg / kg methylnaltrexone plus 0 . 1 mg / kg morphine ). this was done to evaluate the effects of methylnaltrexone with a higher does of morphine . the following drugs were used : morphine sulfate ( elkins - sinn , cherry hill , n . j . ), n - methylnaltrexone bromide ( mallinckrodt specialty chemicals , st . louis , mo . ), and lactulose ( duphalac , solvay pharmaceuticals , marietta , ga .). results of the hydrogen breath test after different injections were analyzed with the use of the wilcoxon matched - pairs signed - rank test , with p & lt ; 0 . 05 considered to be statistically significant . the mann - whitney u test was used to evaluate statistical differences between genders in oral - cecal transit times and in cold - indicted paid scores . two female subjects were excluded from the study after the first ( placebo plus placebo ) session . one of them showed a relatively high and unstable baseline h 2 peak value ( 12 ppm ) 2 hours after drinking lactulose . h 2 production requires a colonic bacterial flora capable of fermenting carbohydrate and yielding h 2 . in in vivo studies of humans who had ingested lactulose and in vitro studies of fecal incubates with varying carbohydrates , h 2 was not produced in 2 % to 27 % of individuals tested . oral - cecal transit times are reported in fig5 . transit time increased after morphine administration in all 12 subjects and methyl naltrexone prevented the morphine - induced delay in every subject . morphine significantly increased oral - cecal transit time from a baseline level of 104 . 6 ± 31 . 1 minutes ( mean ± sd ) to 163 . 3 ± 39 . 8 minutes p & lt ; 0 . 01 ). methylnaltrexone plus morphine did not increase transit time ( 106 . 3 ± 39 . 8 minutes , not significant compared with baseline ; p = 0 . 56 ). methylnaltrexone prevented 97 % of morphine - induced changes in oral - cecal transit time ( p & lt ; 0 . 01 compared with morphine alone ). there were not statistical differences in oral - cecal transit times between genders . table 3 summarizes the results . humans do not appreciably de - methylate methylnaltrexone . results from a phase i trial with eight normal volunteers showed that doses of methylnaltrexone up to 0 . 32 mg / kg did not cause side effects ; doses of 0 . 64 to 1 . 25 mg / kg were associated with transient orthostatic hypotension ( foss et al ., unpublished data , 1993 ). the effect of opioids on gastrointestinal motility and transit is appreciated as a clinical phenomenon . however , the mechanism of the opioid constipating action is not fully understood . the major factors responsible include the delay of gastric emptying and changes in the motility and transit in the small intestine and the colon . increased intestinal absorption may also contribute to morphine - induced constipation because of the change in the consistency of the stools . in this study , we observed a significant delay in oral - cecal transit time after intravenous morphine injection in human subjects and the delay was effectively antagonized by concomitant administration of methylnaltrexone . this result suggests that methylnaltrexone can reverse morphine - induced peripherally mediated effects on the gastrointestinal tract . in the united states , approximately 500 , 000 patients die of cancer annually . opioid pain medication is used in the terminal phase of care for over 50 % of these patients , and constipation , a significant clinical problem , affects 40 - 50 % ( approximately 125 , 000 ) of patients with metastatic malignancy who receive opioid pain medications ( schug , et al ., j . pain & amp ; symptom management , 7 : 259 - 266 ( 1992 ); wingo , et al ., ca : a cancer j . for clin ., 45 : 8 - 30 ( 1995 )). a significant number of hospice patients receiving chronic opioids for pain would rather endure their pain than face the severe incapacitating constipation that opioids cause . results described herein demonstrate that chronic methadone subjects are very sensitive to intravenous methylnaltrexone compared to normal opioid naive subjects in a previous trial , who received 0 . 45 mg / kg methylnaltrexone without any laxation response ( yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 )). comparison of the results of example 4 with examples 1 - 3 demonstrates the increased responsiveness of chronic opioid patients to the effects of methylnaltrexone . lower doses of methylnaltrexone provide constipation relief to these patients comparable to that observed in normal patients administered higher doses of methyl naltrexone . thus , patients having increased sensitivity to methylnaltrexone , such as chronic methadone users or cancer patients receiving chronic opioids , can benefit from very low doses of methylnaltrexone to manage their opioid induced constipation . this invention can substantially improve the quality of life for terminally ill patients and others chronically using opioids . the preceding description and examples are intended to be illustrative . those skilled in the art to which the invention pertains will appreciate that alterations and changes in the described protocols may be practiced without departing from the meaning , spirit , and scope of this invention . therefore , the foregoing description should be read consistent with and as support to the following claims , which are to have their fullest and fair scope . | 0 |
regulation of hif - 1 alpha protein stability by the vhl tumor suppressor protein hif - 1 alpha is normally not detectable by immunoblot analysis of cellular extracts under normoxic conditions due to the pronounced lability of the hif - 1 alpha protein under normoxic conditions . thus , it is not currently possible to investigate the effect of expression of vhl on endogenous hif - 1 alpha protein levels . a . to establish experimental conditions to examine the effect of vhl on hif - 1 alpha protein stability under normoxic conditions , cos7 cells were transiently transfected with 0 . 2 , 0 . 5 or 1 . 0μ grams of flag epitope - tagged hif - 1 alpha expression plasmids in 6 cm diameter plastic dishes . a pflag - cmv2 / hif - 1 alpha ( 1 - 826 ) expression plasmid was constructed as described in kallio , p . j . et al ., proc . natl . acad . sci ., 94 : 5667 - 5672 , 1997 . cos7 cells ( obtained from atcc ) were routinely maintained in dulbecco &# 39 ; s minimal essential medium supplemented with 10 % fetal calf serum plus penicillin ( 50 iu / ml ) and streptomycin ( 50 μg / ml ). the plasmids were mixed with two volumes of fugene6 ( boehringer mannhein ) and added to the culture medium . after 12 hours of incubation , cells were treated for 12 hours under normoxic ( 21 % o 2 ) or hypoxic ( 1 . 0 % o 2 ) conditions . for the detection of hif - 1 alpha fusion protein expression , whole cell extracts were prepared essentially as described in kallio , p . j . et al ., proc . natl . acad . sci ., 94 : 5667 - 5672 , 1997 . briefly , cells were harvested in ten buffer ( 40 mm tris - hcl ph 7 . 9 , 10 mm edta , 150 mm nacl ), and the cell pellet was resuspended in 20 microliters of lysis buffer ( 150 mm nacl , 1 % np40 , 0 . 5 % deoxycholate , 0 . 1 % sds , 0 . 05 m tris - hcl ph 8 . 0 ), followed by centrifugation for 30 minutes at 14 , 000 rpm . protein concentrations of the extracts were measured using the bio - rad protein assay reagent . fifty micrograms of total cell proteins were blotted onto nitrocellulose filters following sds - polyacrylamide gel electrophoresis and blocked overnight with 5 % non - fat milk in tris - buffered saline ( tbs ). anti - flag m2 ( kodak ) antibodies , used as a primary antibody , were diluted 1 : 500 in tbs containing 0 . 1 % tween - 20 ( tbs - t ) and 1 % non - fat milk and incubated with the sample for 1 hour . after several washes , anti - mouse ig - horseradish peroxidase conjugate ( amersham life science ), used as a secondary antibody , was diluted 1 : 1000 in tbs - t buffer containing 1 % non - fat milk and incubated with the sample for 1 hour at room temperature . after extensive washing with tbs - t buffer , immunocomplexes were visualized using enhanced chemiluminescence ( amersham pharmacia biotech ) according to the manufacturer &# 39 ; s instructions . [ 0087 ] fig1 shows the results using increasing amounts of hif - 1 alpha protein ( 0 . 2 μg ( lanes 1 and 2 ), 0 . 5 μg ( lanes 3 and 4 ), 1 . 0 μg ( lanes 5 and 6 )) at normoxia ( 21 % o 2 , lanes 1 , 3 and 5 ) or hypoxia ( 1 . 0 % o 2 , lanes 2 , 4 and 6 ). the mobility of molecular weight markers are shown on the right hand side of the blot . at the lowest concentration of expression vector , hif - 1 alpha was not detected at normoxic conditions but was detected under hypoxic conditions ( fig1 lanes 1 and 2 ). however , at higher concentrations of expression vector , hif - 1 alpha protein expression could be detected under normoxic conditions ( fig1 lane 3 ). at the highest concentrations of expression vector tested , significant hif - 1 alpha expression levels were observed both under normoxic and hypoxic conditions ( fig1 lanes 5 and 6 ). thus , these experiments indicate that the mechanism of degradation of hif - 1 alpha at normoxia had become saturated under these conditions and that one or several components of the degradation machinery were limiting . b . to determine the effect of degradation of the hif - 1 alpha protein in the presence of the vhl tumor suppressor protein , 1 . 0 μg of pflag cmv2 / hif - 1 alpha was co - transfected with either 2 . 0 μg of empty vector or wild - type vhl expression vector ( pcmx / vhl ) into cos7 cells . the pcmx / vhl plasmid was constructed by inserting an nhei - ecori ( following blunting of both sites with klenow polymerase ) fragment of pci / vhl wild - type ( generously provided by dr . joan w . conaway , howard hughes medical institute , usa ) into an ecorv - digested pcmx vector . the plasmid mixtures were mixed with two volumes of fugene6 ( boehringer mannhein ) and added to the culture medium in a 6 - cm dish . after 12 hours of incubation , cells were treated for 12 hours under hypoxic ( 1 % o 2 ) or normoxic ( 21 % o 2 ) conditions . whole cell extracts were prepared as above and analyzed by immunoblotting as carried out above using anti - flag m2 ( kodak ) or anti - vhl ( pharmingen ) antibodies as the primary antibody . as seen in fig2 co - transfection of the cells with flag / hif - 1 alpha and vhl expression plasmids resulted in significant reduction of the hif - 1 alpha protein signal under normoxic conditions ( upper panel , compare lanes 1 and 3 ), indicating that vhl may have been limiting under the conditions of overexpression of hif - 1 alpha alone . interestingly , transiently expressed vhl failed to induce reduction of the hif - 1 alpha protein levels under hypoxic conditions ( compare lanes 2 and 4 ). in control experiments similar levels of vhl expression were detected in extracts from either normoxic or hypoxic cells ( lower panel , compare lanes 3 and 4 ). the mobility of molecular weight markers are shown on the right hand side of the blot . c . to determine if vhl mediates proteasomal degradation of hif - 1 , the above experiment was repeated except the co - transfected cells were incubated in the absence or presence of 5 μm of the proteasome inhibitor mg - 132 for 6 hours before harvesting . cellular extracts were prepared and analyzed as in example 1b . as shown in fig3 vhl - induced reduction of hif - 1 alpha protein levels under normoxic conditions was inhibited by treatment of the cells with the proteasome inhibitor mg - 132 ( compare lanes 1 - 3 ). taken together with the above experiments , these results indicate that vhl mediates proteasomal degradation of hif - 1 alpha . d . to determine if vhl is specific for hif - 1 alpha , an experiment was conducted to see if overexpression of vhl affects dioxin receptor ( dr ) protein levels . the dioxin receptor is a basic helix - loop - helix / pas ( per / arnt / sim ) protein belonging to the same class of transcriptional regulators as hif - 1 . one ( 1 ) μg of a flag - tagged dioxin receptor expression vector ( pcmv / dr / flag ) was co - transfected with 2 . 0 μg of either empty vector or wild - type vhl expression vector ( pcmx / vhl ) into cos7 cells . the flag - tagged dioxin receptor expression plasmid , pcmv / dr / flag , was provided by dr . j . mcguire ( karolinska institutet , sweden ). cotransection , incubation and analysis was carried out as in example 1b . as seen in fig4 transiently expressed vhl did not affect the protein levels of the flag - tagged dioxin receptor . this indicates the effect of vhl was specific for hif - 1 alpha . two domains of vhl are required for inducing protein degradation of hif - 1 to determine if vhl physically interacts with hif - 1 alpha , 35 s - labeled , in vitro translated hif - 1 alpha was incubated with wild - type or mutant gal4 - vhl fusion proteins or the minimal gal4 dna binding domain ( dbd ) alone prior to immunoprecipitation assays . fig5 provides a schematic representation of the gal4 fused wild - type ( 1 - 213 ) and deletion or single amino acid point mutant ( pmt ) forms of vhl . the wild - type or mutant forms of vhl and gal4 dbd fusion vhls were assembled by inserting an nhei - ecori ( following blunting of both sites with klenow polymerase ) fragment of pci / vhl wild - type or mutant / flag ( generously provided by dr . joan w . conaway , howard hughes medical institute , usa ) into an ecorv - digested pcmx - gal4 . in in vitro immunoprecipitation assays , gal4 fusion proteins containing full length hif - 1 were translated in the presence of [ 35 s ] methionine in rabbit reticulocyte lysate ( promega ). [ 35 s ] methionine - labeled translation products were separated by sds - page and analyzed by phosphorimager ( fuji ) for calculation of the protein concentration on the basis of incorporated [ 35 s ] methionine . immunoprecipitation experiments were performed as described in gradin , k . et al ., mol . cell . biol ., 16 : 5221 - 5231 , 1996 ). briefly , radio - labeled hif - 1 alpha was incubated with equal concentrations of unlabeled gal4 - vhl or vhl mutants at room temperature for 1 hour . cells were treated with 5 μm mg - 132 for 6 h and then harvested in ten buffer . protein concentrations of the extracts were measured using the bio - rad protein assay reagent . five ( 5 ) microliters of anti - gal4 ( upstate biotech ) or pre - immune rabbit serum was added to the protein mixtures and incubated for another 1 hour at room temperature . thirty ( 30 ) microliters of a 50 % slurry of protein g - sepharose in teg buffer ( 20 mm tris - hcl ( ph7 . 4 ), 1 mm edta , 10 % glycerol , 1 mm dtt ) containing 150 mm nacl and 0 . 1 % triton x - 100 , was then added to the reaction mixtures and incubated for 12 hours at 4 ° c . under rotation . after rapid centrifugation , the resulting sepharose pellets were washed three times with supplemented teg buffer , and coimmunoprecipitated proteins were analyzed by sds - page and subsequent autoradiography . equal concentrations of in vitro translated 35 s - labeled full length hif - 1 alpha was incubated with in vitro translated wild - type gal4 / vhl ( fig6 lane 2 ) or vhl deletion mutants ( fig6 lane 3 - 5 ) or gal4 - dbd spanning the gal4 dna binding domain alone ( fig6 lane 6 ). for loading controls , 10 % of input 35 s - labeled labeled hif - 1 alpha was added ( fig6 , lane 1 ). coimmunoprecipitation with anti - gal4 antibody is shown in the upper panel of fig6 while the control preimmune serum is found in the lower panel . as seen in fig6 s - labeled hif - 1 alpha was coimmunoprecipitated in the presence of gal4 / vhl by gal4 - specific antibodies , whereas no interaction was observed between hif - 1 alpha and the minimal gal4 dna binding domain ( upper panel , compare lanes 2 and 6 ). non - specific pre - immune rabbit antiserum did not precipitate hif - 1 alpha protein in the presence of either vhl or gal4 alone ( fig6 lower panel ), indicating that wild - type vhl specifically interacted with hif - 1 alpha in vitro . with respect to the deletion mutants , the vhl δ114 - 154 deletion mutant showed interaction with hif - 1 alpha , whereas the vhl 114 - 154 fragment failed to do so ( fig6 compare lanes 3 and 4 ). however the vhl 91 - 154 deletion mutant was able to interact with hif - 1 alpha ( fig6 compare lanes 4 and 5 ). thus , a structure located between residues 91 and 113 of vhl appeared to be critical for interaction with hif - 1 alpha . interestingly , this region of vhl is contained not only within the putative macromolecular binding observed in the crystal structure of the vhl - bc complex ( stebbins , c . e . et al ., science , 284 : 455 - 461 , 1999 ), but also represents one of the mutational hot spots in tumors ( gnarra , j . r . et al ., biochim . biophys . acta ., 1242 : 201 - 210 , 1996 ). to determine whether tumor derived mutations of vhl would affect its ability to interact with hif - 1 alpha and / or to induce hif - 1 alpha degradation , experiments were performed using gal4 - vhl fusion proteins containing either a y98n ( the most frequent tumor mutation in this region ) or a c162f single amino acid mutation ( see fig5 for schematic representation of the single amino acid point mutant ( pmt ) forms of vhl ). the c162f mutation has been demonstrated to render vhl unable to bind the elongin b - c complex ( lonergan , k . m . et al ., mol . cell . biol ., 18 : 732 - 741 , 1998 ; lisztwan , j . et al ., genes & amp ; dev ., 13 : 1822 - 1833 , 1999 ), and inhibit ubiquitin ligase activity in vitro ( lisztwan , j . et al ., genes & amp ; dev ., 13 : 1822 - 1833 , 1999 ). in these coimmunoprecipitation experiments , equal concentrations of in vitro - translated 35 s - labeled full - length hif - 1 alpha were incubated with in vitro - translated gal4 fused wild - type vhl ( fig7 lane 3 ) or mutant vhl y98n ( fig7 lane 4 ), c162f ( fig7 lane 5 ) or gal4 - dbd alone ( fig7 lane 2 ). the results of the coimmunoprecipitation are shown in the upper panel of fig7 while the control preimmune serum is found in the lower panel . these coimmunoprecipitation experiments were carried out and analyzed as in fig6 . as seen in fig7 upper panel , vhl y98n was unable to interact with hif - 1 , whereas vhl c162f showed wild - type levels of interaction with hif - 1 alpha ( compare lanes 3 - 5 ). these results indicate that a tumor - derived point mutation in the beta domain impairs the interaction between hif - 1 alpha and vhl . next a cellular degradation assay was carried out . pflag cmv2 / hif - 1 alpha was transiently coexpressed in cos7 cells in the absence or presence of gal4 fused wild - type or mutant forms of vhl as indicated in fig8 . the cells were incubated at normoxia for 24 h . whole cell extracts were prepared and analyzed by immunoblotting . the blots were developed with anti - flag ( upper panel ) or anti - vhl ( lower panel ) antibodies . as seen in fig8 immunoblot analysis demonstrated that , in contrast to wild - type vhl , both the vhl y98n and vhl c162f mutants failed to induce degradation of hif - 1 alpha at normoxia ( fig8 compare lanes 2 - 4 ). accordingly , these results demonstrate that both the hif - 1 alpha interaction domain and the elongin c binding domain of vhl are necessary to mediate degradation of hif - 1 , and that regulation of hif - 1 alpha may be involved in the tumor suppressor function of vhl . the oxygen - dependent degradation domain of hif - 1 alpha is targeted for regulation by vhl to identify the domain of hif - 1 alpha which is targeted by vhl to mediate proteasomal degradation at normoxia , either wild - type flag / hif - 1 alpha or a series of flag - tagged hif - 1 alpha deletion mutants were transiently expressed in cos7 cells under normoxic conditions in the presence or absence of vhl . fig9 a provides a schematic representation of the series of flag - tagged hif - 1 alpha deletion mutants . in fig9 a , bhlh is an acronym for basic helix - loop - helix domain ; pas is an acronym for per / arnt / sim domain ; odd is an acronym for oxygen - dependent degradation domain ; n - tad is an acronym for n - terminal transactivation domain ; and c - tad is an acronym for c - terminal transactivation domain . the n - terminal transactivation domain has been mapped to reside between amino acids 531 - 575 ( jiang , b . h . et al ., j . biol . chem ., 272 : 19253 - 19260 , 1997 ), or 549 - 582 ( pugh , c . w . et al ., j . biol . chem ., 272 : 11205 - 11214 , 1997 ), respectively . the flag epitope - tagged deletion mutant hif - 1 alpha ( 1 - 652 ) was made by inserting a bamhi - spei fragment ( the spei site was filled - in with klenow polymerase ) of pgfp / hif - 1 ( 1 - 652 ) into a bamhi - smai - digested pflag - cmv2 ( kodak ). pflag - cmv2 / hif - 1 ( 1 - 330 ) was constructed by inserting an ecori fragment of pflag - cmv2 / hif - 1 ( 1 - 826 ) into a ecori - digested pflag - cmv2 . pflag - cmv2 / hif - 1 ( 526 - 826 ) was assembled by inserting a sali - hind iii ( the hindiii site was filled - in with klenow polymerase ) fragment of pcmx - gal4 / hif - 1 ( 526 - 826 ) into a sali - bamh i ( bamh i was site was filled - in with klenow polymerase ) digested pflag - cmv2 . whole cell extracts were prepared and used for immunoblot analysis as described in example 1b . as seen in fig9 b , the gal4 / hif - 1 alpha 1 - 652 and hif - 1 alpha 526 - 826 fragments show vhl - mediated degradation in normoxic cells . however , deletion mutant hif - 1 alpha 1 - 330 was not degraded upon overexpression of vhl in cos7 cells under normoxic conditions . to map the domain of hif - 1 alpha required to interact with vhl , full length hif - 1 alpha or a set of hif - 1 alpha deletion mutants fused to the gal4 dna binding domain were expressed and coimmunoprecipitation assays were performed following incubation with 35 s - labeled vhl . 3 5s - labeled vhl was translated in the presence of 35 s - methionine in rabbit reticulocyte lysate ( promega ). the 35 s - methionine - labeled translation products were separated by sds - page and analyzed by phosphorimager ( fuji ) for calculation of the protein concentration on the basis of incorporated 35 s - methionine . equal concentrations of in vitro translated 35 s - labeled full - length vhl was incubated with in vitro - translated gal4 - fusion proteins spanning the indicated hif - 1 alpha deletion mutants ( fig1 , lanes 2 - 7 ) or gal4 - dbd alone ( fig1 , lane 8 ). for loading controls , 10 % of input 35 s - labeled vhl is shown ( fig1 , lane 1 ). the precipitated material was analyzed by sds - page and autoradiography . the results of the coimmunoprecipitation assays performed with anti - gal4 antibodies are shown in the upper panel of fig1 . the assays performed with the control non - specific rabbit antiserum are shown in the lower panel of fig1 . as seen in fig1 , gal4 / hif - 1 alpha 1 - 330 failed to physically interact in vitro with 35 s - labeled vhl ( upper panel , lane 2 ). moreover , gal4 / hif - 1 alpha 778 - 826 spanning the c - terminal transactivation domain of hif - 1 alpha did not show any interaction with vhl ( upper panel , lane 7 ). in contrast , the gal4 / hif - 1 alpha 1 - 652 , gal4 / hif - 1 alpha 331 - 641 , gal4 / hif - 1 alpha 526 - 641 and hif - 1 alpha 526 - 826 fragments clearly interacted with vhl ( upper panel , lanes 3 - 6 ). in fact , when compared to full length hif - 1 , all these latter fragments of hif - 1 alpha interacted with vhl with very similar efficacies . in control precipitation reactions , non - specific pre - immune rabbit antiserum did not precipitate vhl protein in the presence of any of the used gal4 / hif - 1 alpha fragments or gal4 alone ( lower panel ). taken together , these results indicate that a region of hif - 1 alpha spanning residues 526 - 641 was essential for physical interaction with vhl . interestingly , this region contains the oxygen / redox - dependent degradation domain of hif - 1 alpha which has previously been demonstrated to mediate proteasomal degradation of hif - 1 alpha in normoxic cells and which has broadly been defined to be located between amino acid residues 401 and 603 of hhif - 1 alpha ( huang , l . e . et al ., proc . natl . acad . sci ., 95 : 7987 - 7992 , 1998 ; kallio , p . j . et al ., j . biol . chem ., 274 : 6519 - 6525 , 1999 ). the minimal n - terminal transactivation domain of hif - 1 alpha is a target for ubiquitination and proteasomal degradation by vhl the vhl - interacting fragment , gal4 / hif - 1 alpha 526 - 641 , contains not only the core of the oxygen - dependent degradation domain of hif - 1 alpha but also the n - terminal transactivation domain , n - tad ( see fig9 a ). within the n - tad of hif - 1 alpha , a sequence motif of about 19 amino acid residues ( located between amino acids 556 - 574 of human hif - 1 alpha ) shows the strongest conservation between species and is also conserved in the related hypoxia - inducible factor epas - 1 / hlf . the related hypoxia - inducible factor epas - 1 / hlf is expressed in a more tissue - restricted fashion ( ema , m . et al ., proc . natl . acad . sci ., 94 : 4273 - 4278 , 1997 ; tian , h . et al ., genes & amp ; dev ., 11 : 72 - 82 , 1997 ). this motif is also highly conserved in the hypoxia - responsive drosophila similar protein ( taylor , b . l . et al ., microbiol . mol . biol . rev ., 63 : 479 - 506 , 1999 ). this sequence motif has recently been reported to be important for the function of the oxygen - dependent degradation domain of hif - 1 alpha since alanine substitutions within this domain impair hypoxia - dependent protein stabilization and stabilize the protein in normoxic conditions ( srinivas , v . et al ., biochem . biophys . res . commun ., 260 : 557 - 561 , 1999 ). fig1 shows an alignment of the conserved core motif of n - tad sequences of human ( h ) and mouse ( m ) hif - 1 alpha and epas - 1 . to determine if vhl could directly interact with the conserved core motif of n - tad of hif - 1 alpha , coimmunoprecipitation assays were conducted using in vitro translated 35 s - labeled vhl proteins and flag - tagged wild - type or mutant n - tad fragments . pflag / hif - 1 / ntad ( amino acids 532 - 585 of hif - 1 alpha ) was constructed by inserting an ecori - bamhi fragment made by pcr into ecori - bamhi digested pflag - cmv2 . next a mutant n - tad was made where the central pyi triplet with the n - tad domain was substituted with three aspartic acid residues . amino acid substitutions within flag / hif - 1 / ntad were generated using a quikchange site - directed mutagenesis kit ( stratagene ). the positions of the amino acid substitutions are shown in fig1 . the in vitro translated 35 s - labeled vhl protein was incubated with equal concentrations of in vitro translated flag - tagged wild - type ( fig1 , lane 3 ) or mutant ( fig1 , lanes 4 ) n - tad or flag epitope alone ( fig1 , lane 2 ). coimmunoprecipitation assays were carried out using anti - flag antibodies , and the resulting precipitates were analyzed by sds - page and autoradiography . for loading controls , 10 % of input 35 s - labeled vhl was used ( fig1 , lane 1 ). as shown in fig1 , flag antibodies could precipitate 35 s - labeled vhl in the presence of the flag epitope - tagged minimal wild - type n - tad of hif - 1 alpha ( lane 3 ). this demonstrates that this region of hif - 1 alpha is sufficient to mediate interaction with vhl . substitution of the central pyi triplet with aspartic acid totally abolished interaction between vhl and the n - tad ( compare lanes 3 and 4 ). these experiments indicate that the highly conserved core motif of the n - tad is critical for interaction with vhl . because of the central role of this portion of the sequence , any amino acid substitution that changes positions 564 - 566 will effectively abrogate interaction with the vhl protein . it will create stabilization against vhl mediated degradation and renders transactivation function of the protein hypoxia - independent . a more detailed mutation analysis of residues within the pyi triplet or in its vicinity demonstrated that mutation of residues yi564 - 565 to gg , and ddd569 - 571 to aaa also totally abolished interaction between vhl and the n tad , whereas mutation of residues pm567 - 568 resulted in partial inhibition of interaction between vhl and the n - tad ( fig2 ). amino acid substitutions at y565 can abrogate interaction with vhl . y565 was replaced with g resulting in stabilization against vhl - mediated degradation . y565 replaced with f , however , does not give the same effect . f565 does not alter the properties of the degradation box , instead , it maintains vhl interaction , mediates degradation at normoxia , and allows for hypoxia - dependent transactivation . therefore , substitutions at y565 should alter the hydrophobic mature of the residue , so substitutions with hydrophilic or neutral amino acids will result in a disruption of vhl binding , but a substitution at y565 with a hydrophobic amino acid may not . amino acid substitutions at i566 can also abrogate interaction with vhl . for example , replacing i566 with g stabilizes the protein against vhl - mediated degradation . yi565 - 566 can be replaced with substitute amino acids . for example , yi565 - 566 can be replaced with gg to abrogate interaction with vhl , to stabilize the protein against vhl - mediated degradation , and to remove the hypoxic dependency of transactivation . because neutral or hydrophilic amino acid substitutions at y565 appear to produce this effect , similarly a neutral or hydrophilic substitution at yi565 - 566 should also produce this effect . the replacement of amino acids ddd569 - 57l to aaa abrogated interaction with vhl . it is expected that all amino acid substitutions at ddd569 - 571 should have this effect . a replacement at fql572 - 574 to aqa also abrogated the interaction with vhl protein . this substitution stabilized the protein against vhl - mediated degradation and rendered the transactivation function of the protein constitutive , or no longer hypoxia - dependent . other substitutions to fql572 - 574 should have this effect . next immunoblot assays were conducted to determine the affect on wild - type or mutant n - tad in the absence or presence of increasing concentrations of vhl . 1 μg per 6 - cm dish of flag ( fig1 , lane 1 ) or flag - tagged wild - type ( fig1 , lanes 2 - 4 ) or mutant ( fig1 , lanes 5 - 7 ) n - tad was transiently coexpressed in cos7 cells in the absence (−) or presence (+, 1 . 0 μg ; ++, 2 . 0 μg / 6 - cm dish ) of vhl as indicated . the cells were incubated at normoxia for 24 hours . whole cell extracts were prepared as in example 1a and analyzed by immunoblotting . the blots were developed with anti - flag ( fig1 , upper panel ) or anti - vhl ( fig1 , lower panel ) antibodies . as seen in fig1 , wild - type n - tad protein was degraded in a dose - dependent manner by vhl ( compare lanes 2 - 4 ). in contrast , the stability of the mutant n - tad was not affected by identical concentrations of vhl ( compare lanes 5 - 7 ). to investigate the mechanism of vhl - mediated degradation of hif - 1 alpha , in vivo ubiquitination experiments were conducted using flag - tagged wild - type or mutant n - tad . the flag epitope alone ( fig1 , lane 1 ), flag - tagged wild - type n - tad ( fig1 , lanes 2 and 3 ) or mutant n - tad ( fig1 , lanes 4 and 5 ) and ha - tagged ubiquitin were transiently coexpressed in cos7 cells in the presence ( fig1 , lanes 1 , 3 , 5 ) or absence ( fig1 , lanes 2 , 4 , 6 ) of vhl under normoxic conditions in combination with incubation with the proteasome inhibitor mg132 for 6 hours . after anti - flag immunoprecipitation of whole cell extracts , ubiquitinated - tad forms were detected by anti - ha immunoblotting analysis . as fig1 shows , ubiquitination of wild - type n - tad was strongly enhanced by coexpression of vhl ( upper panel , compare lanes 2 and 3 ). on the other hand , the mutant n - tad showed very low levels of ubiquitination even in the presence of vhl ( upper panel , lanes 5 - 7 ). 10 % of input whole cell extracts are shown in the lower panels . importantly , these results clearly demonstrate that vhl mediates ubiquitination of hif - 1 alpha via physical interaction with the minimal n - tad motif . given the ubiquitination of the minimal n - tad motif , it was determined which of the three lysines of n - tad were targeted for regulation by vhl . flag - tagged wild - type or single lysine mutants ( k532r , k538r , and k547r , respectively ) of n - tad were transiently expressed in 293 cells . the cells were incubated at normoxia or hypoxia for 12 hours , and whole cell extracts were prepared as in example 1a and analyzed by immunoblotting . in analogy to full length hif - 1 alpha , the minimal wild - type gal4 / n - tad fusion protein showed significant degradation under normoxic conditions , and was stabilized by hypoxia . interestingly , mutation of k547 stabilized the protein at normoxia , whereas expression of the two other lysine mutants was hardly detectable at normoxia ( fig1 ). these results indicate that lysine 547 is significant for degradation of hif - 1 alpha . previously it was demonstrated that hypoxia induces nuclear translocation of hif - 1 alpha ( kallio , p . j . et al ., embo j ., 17 : 6573 - 6586 , 1998 ). in the case of vhl , nuclear - cytoplasmic trafficking has been suggested to be required for vhl function ( lee , et al ., 1999 ). to study the intracellular localization of vhl in relation to its function in normoxic versus hypoxic cells , vhl was transiently expressed in cos7 cells . cos7 cells grown on cover slips were transiently transfected with flag - vhl expression plasmid ( pcmx / vhl ) and incubated for 24 hours . after incubation for 6 hours under hypoxic ( 1 % o 2 ) or normoxic ( 21 % o 2 ) conditions , the cells were fixed with 4 % ( w / v ) paraformaldehyde in pbs at room temperature for 30 minutes , followed by incubation with anti - vhl monoclonal antibody in pbs containing 0 . 1 % triton x - 100 at 4 ° c . for 9 hours . indirect immunofluorescence was obtained by using biotinylated anti - mouse igg antibodies and fitc - conjugated streptavidin ( amersham ) in pbs and 0 . 1 % triton x - 100 . for quantitative purposes , 150 - 200 fluorescent cells were analyzed for compartmentalization and subdivided into four categories as described in kallio , p . j . et al ., embo j ., 17 : 6573 - 6586 , 1998 . as seen in fig1 , at normoxia , immunofluorescence by an anti - vhl antibody was detected throughout the cells with some preference toward localization in the cytoplasmic compartment of the cells . a very similar distribution of vhl immunoreactivity was observed under hypoxic conditions . semiquantitive analysis of the subcellular localization of vhl - immunoreactivity following the method disclosed in kallio , p . j . et al ., embo j ., 17 : 6573 - 6586 , 1998 , under normoxic conditions , reveals that 47 % of the transfected cells had equal distribution of fluorescence in the cytoplasm and the nucleus ( category n − c ), whereas in 45 % of the transfected cells cytoplasmic fluorescence predominated over that detected in the nucleus ( category n & lt ; c ). only 3 % of the transfected cells showed nuclear fluorescence dominating over the cytoplasmic signal ( category n & gt ; c ), and no transfected cell showed exclusive nuclear staining ( category n ). hypoxic treatment of the cells had no effect on the intracellular distribution of vhl since under these conditions 47 %, 51 % and 6 % of the transfected cells fell into categories n = c , n & lt ; c , and n & gt ; c , respectively . consistent with the results obtained at normoxia exclusive nuclear fluorescence was also not observed under hypoxic conditions . thus , in contrast to hif - 1 alpha which shows hypoxia - inducible nuclear import ( kallio , p . j . et al ., embo j ., 17 : 6573 - 6586 , 1998 ), the subcellular localization of vhl was not altered upon exposure to hypoxia . protection of hif - 1 alpha from vhl - dependent proteasomal degradation is a multi - step pathway requiring hypoxia - induced nuclear translocation of hif - 1 alpha and a hypoxia - induced activation signal next the subcellular localization of wild - type hif - 1 alpha was compared to that of a hif - 1 alpha mutants , hif - 1 alpha k719t and hif - 1 alpha δ178 - 390 mutant . the hif - 1 alpha k719t mutant fails to enter the nucleus at hypoxia and is thus is constitutively localized in the cytoplasm ( kallio , p . j . et al ., embo j ., 17 : 6573 - 6586 , 1998 ). the hif - 1 alpha δ178 - 390 mutant lacks a portion of the pas domain and shows constitutive nuclear localization ( kallio , p . j . et al ., embo j ., 17 : 6573 - 6586 , 1998 ). expression plasmid for the green fluorescent protein ( gfp ) fused to the wild - type full - length hif - 1 alpha was generated by cutting the hif - 1 alpha coding region from pgex - 4t3 - hif - 1 alpha as a bamhi - noti fragment ( the noti site filled - in with klenow polymerase ) and ligating this in - frame into a bamhi - nhei digested pcmx - sah - y145f ( kallio , p . j . et al ., embo j ., 17 : 6573 - 6586 , 1998 ). the pcmx - sah - y145f expression vector encodes a modified and highly chromophoric form of gfp under the control of cmv immediate early promoter which contains an s65a mutation that confers a wavelength shift and temperature resistance to the protein as well as a y145f substitution increasing the intracellular stability of gfp . the gfp - hif - 1 alpha ( k719t ) was constructed by site - directed mutagenesis of the c - terminal nuclear localization signal by overlap pcr as described in ausubel , f . m . et al ., current protocols in molecular biology , j . wiley and sons , ny , 1994 . the desired mutation ( codon 719 aag to aca ) was introduced into a pcr product and then inserted as an ecori - psti subfragment into pgfp - hif - 1 alpha ( 526 - 826 ). a gfp fusion of full - length hif - 1 alpha carrying the k719t mutation was thereafter assembled by inserting the n - terminal bamhi - spei fragment of hif - 1 alpha into pgfp - hif - 1 alpha ( 526 - 826 k719t ) ( kallio , p . j . et al ., embo j ., 17 : 6573 - 6586 , 1998 ). the plasmids were transiently expressed in cos7 cells . cos7 cells grown on cover slips were transiently transfected with the respective gfp - fusion expression plasmids and incubated for 24 hours . following 24 hours of expression , the transfected cells were further incubated under either normoxic ( 21 % o 2 ) or hypoxia ( 1 % o 2 ) conditions for 6 hours before observation . subcellular distribution of fluorescence activity was examined and photographs taken using a zeiss axiovert 135 microscope with an fitc - filter set , and epifluorescence with illumination from a gixenon burner ( carl zeiss jena gmbh , jena , germany ). as expected , hif - 1 alpha δ178 - 390 shows constitutive nuclear localization under both normoxic and hypoxic conditions ; whereas , hif - 1 alpha k719t , which fails to enter the nucleus at hypoxia and is thus constitutively localized in the cytoplasm ( fig1 ). in fig1 , the effect of vhl on the stability of the wild - type hif - 1 alpha full - length protein was compared to the stability of the hif - 1 alpha k719t mutant . pflag - cmv2 / hif - 1 alphak719t was made by inserting a bamhi - nhei ( the nhei site was filled - in with klenow polymerase ) fragment of pgfp / hif - 1 alphak719t into a bamhi - smai digested pflag - cmv2 . following 24 hours of expression , the transfected cells were further incubated under either normoxic ( 21 % o 2 , fig1 , lanes 1 , 2 ) or hypoxia ( 1 % o 2 , fig1 , lanes 3 , 4 ) conditions for 12 hours before observation . whole cell extracts were prepared as in example 1a and assayed by immunoblot analysis as in example 1b . under normoxic conditions , both wild - type hif - 1 alpha and hif - 1 alpha k719t were degraded in the presence of overexpressed vhl ( fig1 , lane 2 ). interestingly , the wild - type hif - 1 alpha showed significant ( albeit not total ) resistance to vhl under hypoxic conditions ( fig2 ; fig1 , lane 4 ), whereas the hif - 1 alpha k719t mutant was potently degraded upon exposure to vhl in hypoxic cells ( fig1 , lane 4 ). these results indicate that hypoxia - induced nuclear translocation of hif - 1 alpha protects hif - 1 alpha from vhl - mediated proteasomal degradation . to test if nuclear localization is sufficient to protect hif - 1 alpha from vhl - mediated proteasomal degradation , the effect of vhl on the stability of the hif - 1 alpha δ178 - 390 mutant was examined . pflag - cmv2 / hif - 1 alpha ( δ178 - 390 ) was constructed by inserting a sali fragment of pcmx - gal4 / hif - 1 alpha ( δ178 - 390 ) into a sali - digested pflag - cmv2 . following 24 hours of expression , the transfected cells were further incubated under either normoxic ( 1 % o 2 , fig1 , lanes 1 , 2 ) or hypoxic ( 1 % o 2 , fig1 , lanes 3 , 4 ) conditions for 12 hours before observation . whole cell extracts were prepared as in example 1a and assayed by immunoblot analysis as in example 1b . as seen in fig1 , the hif - 1 alpha δ178 - 390 mutant was degraded at normoxia upon exposure to vhl ( compare lanes 1 and 2 ). thus , nuclear localization per se cannot explain the protection of hif - 1 alpha against degradation by vhl . however , this mutant showed significant resistance against vhl - mediated degradation in hypoxic cells ( compare lanes 2 and 4 ). these results indicate that , in addition to nuclear translocation , a distinct intranuclear event or signal is required for protection of hif - 1 alpha against vhl - induced proteolysis . given the striking overlap within the n - tad of hif - 1 alpha between the structures that mediate oxygen - dependent degradation , physical interaction with vhl , and hypoxia - inducible transactivation , it is possible that this putative intranuclear stabilizing signal may be linked to the transactivation function of the protein . in view that both nuclear translocation of hif - 1 alpha and an hypoxia - induced activation signal were necessary to protect hif - 1 alpha from vhl - mediated degradation , the mechanistically important question of whether vhl was released from hif - 1 alpha under hypoxic conditions was next examined . to test whether vhl was released from hif - 1 alpha under hypoxic conditions , gal4 dbd ( 4 μg ) ( fig1 , lane 1 ) or gal4 / hif - 1 alpha ( 4 μg ) ( fig1 , lanes 2 - 6 ) were transiently expressed in cos7 cells in the absence ( fig1 , lane 2 ) or presence ( fig1 , lanes 1 , 3 - 6 ) of vhl in 10 cm diameter plastic dishes . after 12 hours of incubation , cells were treated for 1 , 3 or 6 hours under normoxic ( fig1 , lanes 1 - 3 , respectively ) or hypoxic conditions ( fig1 , lanes 4 - 6 , respectively ). cells were incubated with 5 μm mg - 132 proteasome inhibitor ( calbiochem ) for 6 hours before harvesting the cells in ten buffer . the cell pellet was resuspended in 200 liters of whole cell extract buffer ( 25 mm hepes , 100 mm nacl , 5 mm edta , 20 mm beta - glycerophosphate , 20 mm para - nitrophenyl - phosphate , 0 . 5 % triton x - 100 , 100 m sodium orthovanadate ) supplemented with 20 μm n - ethylmaleimide , followed by centrifugation for 30 minutes at 14 , 000 rpm . protein concentrations of the extracts were measured using the bio - rad protein assay reagent . coimmunoprecipitated proteins were analyzed by sds - page followed by immunoblotting . following anti - gal4 antibody —( fig1 , upper panel ) or control anti serum —( fig1 , middle panel ) mediated immunoprecipitation of whole cell extracts , vhl was detected by immunoblotting using vhl antibodies . as a control , 10 % of input whole cell extracts were used ( fig1 , lower panel ). as expected , vhl was specifically coimmunoprecipitated together with gal4 / hif - 1 alpha under normoxic conditions ( fig1 , lanes 1 - 3 ). however , vhl was also coimmunoprecipitated under hypoxic conditions at levels similar to those observed at normoxia ( fig1 , lanes 4 - 6 ). these results indicate that dissociation of the hif - 1 alpha - vhl complex is not necessary for protection of hif - 1 alpha from vhl - mediated degradation and that there exists a mechanism for hypoxia - dependent inactivation of vhl function when remaining associated with hif - 1 . next it was determined whether arnt was associated with the hif - 1 alpha - vhl complex . gal4 / hif - 1 alpha or the minimal gal4 dna binding domain transiently expressed in cos7 cells in the absence or presence of vhl and / or arnt at normoxia or hypoxia . as expected , arnt was specifically coimmunoprecipitated together with gal4 / hif - 1 alpha under hypoxic conditions in the absence of vhl ( fig2 ). moreover , in the presence of vhl , arnt and gal4 / hif - 1 alpha were also coimmunoprecipitated in a hypoxia - dependent fashion ( fig2 ), demonstrating that these proteins formed a ternary complex in hypoxic cells . role of protein stabilization in regulation of the hypoxia - dependent transactivation function of the hif - 1 alpha n - tad domain transcriptional activation by hif - 1 alpha in hypoxic cells is mediated by two distinct transactivation domains , n - tad and c - tad ( arany , z . et al ., proc . natl . acad . sci ., 93 : 12969 - 12973 , 1996 ; kallio , p . j . et al ., embo j ., 17 : 6573 - 6586 , 1998 ; ema , m . et al ., embo j ., 18 : 1905 - 1914 , 1999 ; carrero , p . et al ., mol . cell . biol ., 20 : 402 - 415 , 2000 ). given the fact that vhl interacted with the minimal n - tad structure , a comparison of both the stability and transactivation functions of gal4 fusion proteins harboring either the wild - type or the pyi mutant n - tad motifs ( fig1 ) was made under normoxic and hypoxic conditions . four ( 4 ) micrograms of flag - tagged wild - type or pyi mutant n - tad were transiently expressed in cos7 cells in 10 cm diameter plastic dishes under normoxic ( fig2 , lanes 1 , 3 ) or hypoxic ( fig2 , lanes 2 , 4 ) conditions for 12 hours . whole cell extracts were prepared as in example 1a and assayed by immunoblot analysis as in example 1b . in analogy to full length hif - 1 , the minimal wild - type gal4 / n - tad fusion protein showed significant degradation under normoxic conditions , and was stabilized by hypoxia ( fig2 , lanes 1 - 2 ). pyi mutant gal4 / n - tad protein levels were readily detectable by immunoblot analysis of extracts from normoxic cells , and were not significantly increased following exposure of the cells to hypoxia ( fig2 , lanes 3 - 4 ). a minimal n - tad fragment comprising residues 547 - 575 behaved similar to the n - tad domain : it showed significant degradation under normoxic conditions , and was stabilized by hypoxia ( fig3 ). in contrast , mutation of the single p564 resulted in striking protection against normoxia - dependent degradation of the protein fragment , and was not further stabilized by hypoxia treatment of the cells ( fig3 ). thus , the failure of these mutants to interact with vhl , as assessed by coimmunoprecipitation experiments ( fig1 ; fig2 ), correlated with constitutively stable protein expression levels which were similar to those generated by wild - type gal4 / n - tad under hypoxic conditions . the transcriptional activity of wild - type or pyi mutant gal4 / n - tad ( 0 . 2 μg / 30 - mm dish ) was analyzed in cos7 cells in a cotransfection assay with a luciferase reporter gene under the control of thymidine kinase minimal promoter and five tandem copies of gal4 - responsive elements ( gal4 - luc ) ( 0 . 5 μg / 30 - mm dish ) and a beta - galactosidase expression plasmid ( 0 . 05 μg / 30 - mm dish ) as an internal control . after 6 hours of transfection , cells were incubated for 36 hours under hypoxic ( 1 % o 2 ) or normoxic ( 21 % o 2 ) conditions prior to analysis of reporter gene activity . reporter gene activities are expressed relative to the activity in the presence of the gal4 - dna binding domain alone at normoxia . values represent the mean ± sd of three independent experiments . as observed in fig2 and fig3 , in reporter gene transactivation assays using a gal4 - driven luciferase reporter gene , a rather modest ( about 3 - fold ) activation of the function of the minimal wild - type gal4 / n - tad by hypoxia . this result was expected in view of results disclosed in carrero , p . et al ., mol . cell . biol ., 20 : 402 - 415 , 2000 . in the context of full length hif - 1 alpha , mutation of the pyi motif rendered the protein stable under normoxic conditions and resistant to vhl - mediated degradation ( fig2 ), demonstrating that this motif is the critical determinant for vhl - dependent degradation of hif - 1 alpha . although the mutant protein showed an increased constitutive transcriptional activity in comparison to wild - type hif - 1 alpha , it was still hypoxia - inducible ( fig2 ). within the minimal n - tad domain , mutation of the pyi motif reduced the transactivation function with regard to both the activity observed at normoxia and hypoxia ( fig2 ). these results indicate that the mutation may generally have altered the structure important for transactivation , possibly impairing some of the protein contacts that may be required for the full activation response . nevertheless , this mutated construct was inducible by hypoxia , yielding an about two - fold increase in transcriptional activity ( fig2 ). these data indicate that the stabilized protein resistant to degradation by vhl is still capable of mediating a hypoxia - dependent activation response , and that protein stabilization per se does not bypass the need of the hypoxic signal for transactivation . in contrast to the broad pyi - aaa mutation described above the transactivation function of a gal4 - n - tad fusion protein containing a single p564a mutation resulted in a dramatic increase in transactivation function by the protein . in fact , it was comparable to the activity of the maximally hypoxia - induced function of the wild - type construct ( fig3 ). importantly , the activity of the p564a mutant construct was not further enhanced by hypoxia treatment , demonstrating that it was rendered constitutively active at high levels by this single point mutation ( fig3 ). in a similar fashion the mutations yi565 - 566 , and ddd - aaa not only abolished vhl - n - tad interaction ( fig2 ) but also rendered constitutively active mutants of gal4 - n - tad fusion protein constructs , as assessed in reporter gene assays performed as described above in 293 cells ( fig2 ). in addition to the activity of the p564a mutant construct , additional substitutions of any amino acid at p564 will yield similarly active mutant constructs . for example , p564h also abrogates interaction with vhl , stabilizes the protein against vhl - mediated degradation , and renders the transactivation function of the protein constitutive . that is , the protein is no longer hypoxia dependent . specific mutations destroying the function of the degradation box are useful applications of the present invention . further , directing protein degradation through fusion of a normal degradation box to proteins other than hif - 1 alpha has utility with regard to all cellular proteins . model of conditional regulation of hif - 1 alpha function under normoxia and hypoxia the data presented here indicate that under normoxic conditions vhl functions by targeting hif - 1 alpha for ubiquitin - proteasomal degradation by recruiting hif - 1 alpha to the vhl - bc - cul - 2 complex . the interaction between the two proteins occurs via the beta - domain of vhl and the minimal n - tad of hif - 1 . hypoxic conditions lead to inhibition of degradation of hif - 1 alpha by induction of nuclear translocation and a regulatory signal that may be linked to recruitment of a partner dna binding factor , arnt , transcriptional coactivators and / or the redox regulator ref - 1 . the shaded areas in vhl in fig2 indicate mutational hot spots in tumors that coincide with the beta - domain or the elongin c binding domain ( cbd ) of vhl , respectively . mutations in either of these two domains stabilize the hif - 1 alpha protein . the point mutagenesis experiments indicated that the highly conserved central pyi motif of the n - tad of hif - 1 alpha , and , in particular , the p564 and y565 residues were critical for interaction with vhl and for vhl - induced proteasomal degradation . in fact , it was demonstrated that the minimal hif - 1 alpha n - tad structure was specifically ubiquitinated by vhl , and that this process required the conserved central pyi motif . given the conservation of this core motif between hif - 1 alpha and the related , tissue - restricted hypoxia - inducible factor epas - 1 / hlf ( ema , m . et al ., proc . natl . acad . sci ., 94 : 4273 - 4278 , 1997 ; tian , h . et al ., genes & amp ; dev ., 11 : 72 - 82 , 1997 ), it is likely that both factors are regulated by vhl - mediated ubiquitination in a similar fashion . in support of this epas - 1 / hlf has recently been reported to also contain an oxygen - dependent degradation domain overlapping with the n - tad ( ema , m . et al ., embo j ., 18 : 1905 - 1914 , 1999 ), and to interact with vhl in vitro ( maxwell , p . h . et al ., nature , 399 : 271 - 275 , 1999 ). a second point mutation has also been demonstrated to play a critical role , that being lysine residue k547 . this lysine residue was shown to be critical for hif - 1 alpha protein stabilization . as schematically outlined in fig2 , hypoxia - induced protection of hif - 1 alpha against regulation by vhl involves two distinct and successive steps : nuclear translocation of hif - 1 alpha and an intranuclear event or signal required for protecting hif - 1 alpha against vhl - induced proteolysis . this model is based on the observation that a mutant of hif - 1 alpha which fails to enter the nucleus showed vhl - induced degradation even in hypoxic cells . on the other hand , a mutant form of hif - 1 alpha which shows constitutive nuclear localization was degraded in normoxic cells but showed hypoxia - inducible stabilization in the presence of vhl . these data indicate that nuclear compartmentalization does not suffice to protect hif - 1 alpha against vhl function but that hif - 1 alpha requires the hypoxic signal for resistance against degradation . given the striking overlap within the n - tad of hif - 1 alpha between the structures that mediate oxygen - dependent degradation , physical interaction with vhl , and hypoxia - inducible transactivation , it is possible that the putative intranuclear stabilizing signal may be linked to the transactivation function of the protein . it was previously observed that hypoxia - inducible function of both the n - tad and c - tad is critically dependent on the recruitment of the transcriptional coactivator cbp / p300 and src - 1 / pl60 ( arany , z . et al ., proc . natl . acad . sci ., 93 : 12969 - 12973 , 1996 ; kallio , p . j . et al ., embo j ., 17 : 6573 - 6586 , 1998 ; ema , m . et al ., embo j ., 18 : 1905 - 1914 , 1999 ; carrero , p . et al ., mol . cell . biol ., 20 : 402 - 415 , 2000 ). this recruitment appears to be facilitated by the redox regulator ref - 1 ( ema , m . et al ., embo j ., 18 : 1905 - 1914 , 1999 ; carrero , p . et al ., mol . cell . biol ., 20 : 402 - 415 , 2000 ). thus , the functional architecture of the n - tad encompasses overlapping structures which have two different functions . in fact the functions are opposing , i . e . protein degradation versus activation of gene transcription . this creates an important “ switch ” in regulation of hif - 1 alpha protein function . as outlined in the model in fig2 , the hypoxia - dependent intranuclear mechanism of protection may involve dimerization with arnt , recruitment of coactivators , and / or recruitment of ref - 1 . importantly , the present data indicate that protein stabilization per se does not provide the sole basis for rendering hif - 1 alpha transcriptionally active . even if the n - tad protein was made constitutively stable and resistant to vhl by point mutagenesis , it still required hypoxic inducibility with regard to its transactivation function . it is possible that covalent modification of the c - terminus of hif - 1 alpha may play a role in determining this regulatory effect . in analogy to the steroid receptor system ( xu , l . et al ., curr . opin . genet . dev ., 9 : 140 - 147 , 1999 ), it is also an attractive scenario that the hypoxic signal may determine a conformational change in hif - 1 alpha which facilitates recruitment of the coactivators and inactivates vhl function . the foregoing description and examples have been set forth merely to illustrate the invention and are not intended to be limiting . since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed broadly to include all variations falling within the scope of the appended claims and equivalents thereof . atg ccc cgg agg gcg gag aac tgg gac gag gcc gag gta ggc gcg gag 48 gag gca ggc gtc gaa gag tac ggc cct gaa gaa gac ggc ggg gag gag 96 ggc gcc gag gag gag atg gag gcc ggg cgg ccg cgg ccc gtg ctg cgc 192 tcg gtg aac tcg cgc gag ccc tcc cag gtc atc ttc tgc aat cgc agt 240 ccg cgc gtc gtg ctg ccc gta tgg ctc aac ttc gac ggc gag ccg cag 288 pro arg val val leu pro val trp leu asn phe asp gly glu pro gln ccc tac cca acg ctg ccg cct ggc acg ggc cgc cgc atc cac agc tac 336 cga ggt cac ctt tgg ctc ttc aga gat gca ggg aca cac gat ggg ctt 384 ctg gtt aac caa act gaa tta ttt gtg cca tct ctc aat gtt gac gga 432 leu val asn gln thr glu leu phe val pro ser leu asn val asp gly cag cct att ttt gcc aat atc aca ctg cca gtg tat act ctg aaa gag 480 gln pro ile phe ala asn ile thr leu pro val tyr thr leu lys glu cga tgc ctc cag gtt gtc cgg agc cta gtc aag cct gag aat tac agg 528 arg cys leu gln val val arg ser leu val lys pro glu asn tyr arg aga ctg gac atc gtc agg tcg ctc tac gaa gat ctg gaa gac cac cca 576 aat gtg cag aaa gac ctg gag cgg ctg aca cag gag cgc att gca cat 624 asn val gln lys asp leu glu arg leu thr gln glu arg ile ala his pro arg val val leu pro val trp leu asn phe asp gly glu pro gln leu val asn gln thr glu leu phe val pro ser leu asn val asp gly gln pro ile phe ala asn ile thr leu pro val tyr thr leu lys glu arg cys leu gln val val arg ser leu val lys pro glu asn tyr arg asn val gln lys asp leu glu arg leu thr gln glu arg ile ala his atg gag ggc gcc ggc ggc gcg aac gac aag aaa aag ata agt tct gaa 48 cgt cga aaa gaa aag tct cga gat gca gcc aga tct cgg cga agt aaa 96 gaa tct gaa gtt ttt tat gag ctt gct cat cag ttg cca ctt cca cat 144 aat gtg agt tcg cat ctt gat aag gcc tct gtg atg agg ctt acc atc 192 asn val ser ser his leu asp lys ala ser val met arg leu thr ile agc tat ttg cgt gtg agg aaa ctt ctg gat gct ggt gat ttg gat att 240 gaa gat gac atg aaa gca cag atg aat tgc ttt tat ttg aaa gcc ttg 288 glu asp asp met lys ala gln met asn cys phe tyr leu lys ala leu gat ggt ttt gtt atg gtt ctc aca gat gat ggt gac atg att tac att 336 tct gat aat gtg aac aaa tac atg gga tta act cag ttt gaa cta act 384 ser asp asn val asn lys tyr met gly leu thr gln phe glu leu thr gga cac agt gtg ttt gat ttt act cat cca tgt gac cat gag gaa atg 432 gly his ser val phe asp phe thr his pro cys asp his glu glu met aga gaa atg ctt aca cac aga aat ggc ctt gtg aaa aag ggt aaa gaa 480 caa aac aca cag cga agc ttt ttt ctc aga atg aag tgt acc cta act 528 agc cga gga aga act atg aac ata aag tct gca aca tgg aag gta ttg 576 ser arg gly arg thr met asn ile lys ser ala thr trp lys val leu cac tgc aca ggc cac att cac gta tat gat acc aac agt aac caa cct 624 his cys thr gly his ile his val tyr asp thr asn ser asn gln pro cag tgt ggg tat aag aaa cca cct atg acc tgc ttg gtg ctg att tgt 672 gln cys gly tyr lys lys pro pro met thr cys leu val leu ile cys gaa ccc att cct cac cca tca aat att gaa att cct tta gat agc aag 720 act ttc ctc agt cga cac agc ctg gat atg aaa ttt tct tat tgt gat 768 thr phe leu ser arg his ser leu asp met lys phe ser tyr cys asp gaa aga att acc gaa ttg atg gga tat gag cca gaa gaa ctt tta ggc 816 cgc tca att tat gaa tat tat cat gct ttg gac tct gat cat ctg acc 864 aaa act cat cat gat atg ttt act aaa gga caa gtc acc aca gga cag 912 tac agg atg ctt gcc aaa aga ggt gga tat gtc tgg gtt gaa act caa 960 tyr arg met leu ala lys arg gly gly tyr val trp val glu thr gln gca act gtc ata tat aac acc aag aat tct caa cca cag tgc att gta 1008 ala thr val ile tyr asn thr lys asn ser gln pro gln cys ile val tgt gtg aat tac gtt gtg agt ggt att att cag cac gac ttg att ttc 1056 cys val asn tyr val val ser gly ile ile gln his asp leu ile phe tcc ctt caa caa aca gaa tgt gtc ctt aaa ccg gtt gaa tct tca gat 1104 atg aaa atg act cag cta ttc acc aaa gtt gaa tca gaa gat aca agt 1152 agc ctc ttt gac aaa ctt aag aag gaa cct gat gct tta act ttg ctg 1200 gcc cca gcc gct gga gac aca atc ata tct tta gat ttt ggc agc aac 1248 gac aca gaa act gat gac cag caa ctt gag gaa gta cca tta tat aat 1296 gat gta atg ctc ccc tca ccc aac gaa aaa tta cag aat ata aat ttg 1344 asp val met leu pro ser pro asn glu lys leu gln asn ile asn leu gca atg tct cca tta ccc acc gct gaa acg cca aag cca ctt cga agt 1392 agt gct gac cct gca ctc aat caa gaa gtt gca tta aaa tta gaa cca 1440 aat cca gag tca ctg gaa ctt tct ttt acc atg ccc cag att cag gat 1488 asn pro glu ser leu glu leu ser phe thr met pro gln ile gln asp cag aca cct agt cct tcc gat gga agc act aga caa agt tca cct gag 1536 cct aat agt ccc agt gaa tat tgt ttt tat gtg gat agt gat atg gtc 1584 aat gaa ttc aag ttg gaa ttg gta gaa aaa ctt ttt gct gaa gac aca 1632 gaa gca aag aac cca ttt tct act cag gac aca gat tta gac ttg gag 1680 glu ala lys asn pro phe ser thr gln asp thr asp leu asp leu glu atg tta gct ccc tat atc cca atg gat gat gac ttc cag tta cgt tcc 1728 met leu ala pro tyr ile pro met asp asp asp phe gln leu arg ser ttc gat cag ttg tca cca tta gaa agc agt tcc gca agc cct gaa agc 1776 gca agt cct caa agc aca gtt aca gta ttc cag cag act caa ata caa 1824 gaa cct act gct aat gcc acc act acc act gcc acc act gat gaa tta 1872 aaa aca gtg aca aaa gac cgt atg gaa gac att aaa ata ttg att gca 1920 tct cca tct cct acc cac ata cat aaa gaa act act agt gcc aca tca 1968 tca cca tat aga gat act caa agt cgg aca gcc tca cca aac aga gca 2016 gga aaa gga gtc ata gaa cag aca gaa aaa tct cat cca aga agc cct 2064 gly lys gly val ile glu gln thr glu lys ser his pro arg ser pro aac gtg tta tct gtc gct ttg agt caa aga act aca gtt cct gag gaa 2112 gaa cta aat cca aag ata cta gct ttg cag aat gct cag aga aag cga 2160 aaa atg gaa cat gat ggt tca ctt ttt caa gca gta gga att gga aca 2208 lys met glu his asp gly ser leu phe gln ala val gly ile gly thr tta tta cag cag cca gac gat cat gca gct act aca tca ctt tct tgg 2256 aaa cgt gta aaa gga tgc aaa tct agt gaa cag aat gga atg gag caa 2304 aag aca att att tta ata ccc tct gat tta gca tgt aga ctg ctg ggg 2352 lys thr ile ile leu ile pro ser asp leu ala cys arg leu leu gly caa tca atg gat gaa agt gga tta cca cag ctg acc agt tat gat tgt 2400 gln ser met asp glu ser gly leu pro gln leu thr ser tyr asp cys gaa gtt aat gct cct ata caa ggc agc aga aac cta ctg cag ggt gaa 2448 glu val asn ala pro ile gln gly ser arg asn leu leu gln gly glu gaa tta ctc aga gct ttg gat caa gtt aac tga 2481 asn val ser ser his leu asp lys ala ser val met arg leu thr ile glu asp asp met lys ala gln met asn cys phe tyr leu lys ala leu ser asp asn val asn lys tyr met gly leu thr gln phe glu leu thr gly his ser val phe asp phe thr his pro cys asp his glu glu met ser arg gly arg thr met asn ile lys ser ala thr trp lys val leu his cys thr gly his ile his val tyr asp thr asn ser asn gln pro gln cys gly tyr lys lys pro pro met thr cys leu val leu ile cys thr phe leu ser arg his ser leu asp met lys phe ser tyr cys asp tyr arg met leu ala lys arg gly gly tyr val trp val glu thr gln ala thr val ile tyr asn thr lys asn ser gln pro gln cys ile val cys val asn tyr val val ser gly ile ile gln his asp leu ile phe asp val met leu pro ser pro asn glu lys leu gln asn ile asn leu asn pro glu ser leu glu leu ser phe thr met pro gln ile gln asp glu ala lys asn pro phe ser thr gln asp thr asp leu asp leu glu met leu ala pro tyr ile pro met asp asp asp phe gln leu arg ser gly lys gly val ile glu gln thr glu lys ser his pro arg ser pro lys met glu his asp gly ser leu phe gln ala val gly ile gly thr lys thr ile ile leu ile pro ser asp leu ala cys arg leu leu gly gln ser met asp glu ser gly leu pro gln leu thr ser tyr asp cys glu val asn ala pro ile gln gly ser arg asn leu leu gln gly glu asn pro phe ser thr gln asp thr asp leu asp leu glu met leu ala | 2 |
fig1 shows , diagrammatically , a device according to the invention . the device comprises a vertical low - pass filter 11 and a vertical high - pass filter 12 . an interlaced frame signal , in the form of digital frame samples x i ( u , v ), is applied to the device . the low pass filter 11 supplies a spatial signal x s ( u , v ). the high - pass filter 12 supplies a motion auxiliary signal x m ( u , v ). the motion auxiliary signal x m ( u , v ) is applied to a selector switch 25 , either directly or via an inverter 24 . dependent on the position of the selector switch 25 , the direct motion auxiliary signal x m ( u , v ) or the inverted motion auxiliary signal - x m ( u , v ) is added to the spatial signal x s ( u , v ) in an adder circuit 26 . the adder circuit 26 supplies an interlaced output signal y i ( u , v ). the selector switch 25 is controlled by a forward / reverse operating signal f / r . for normal forward play , the selector switch is in the position shown . the motion auxiliary signal x m ( u , v ) and the spatial signal x s ( u , v ) are then added together . in the reverse play mode , the selector switch is in the other position . in this mode the motion auxiliary signal x m ( u , v ) is subtracted from the spatial signal x s ( u , v ). the device shown in fig1 will be described with reference to an input signal having the shape of a rectangular frame area of 2 pixels wide and 4 tv lines high . the rectangle moves to the right at a rate of one pixel period per field . in fig3 a this interlaced frame is shown graphically . due to the motion , the pixels in the second , odd field are moved to the right over one sample period . fig3 b shows the pixel values x i ( u , v ) corresponding to the frame . the pixels constituting the frame area have the value of 1 and the pixels constituting the background have the value of 0 ( not shown ). as described in patent application ep 0 520 546 ( u . s . pat . no . 5 , 239 , 377 ), the interlaced input signal can be considered as the sum of a baseband component , having a spectrum around the vertical frequency ω y = 0 , and an alias component around the vertical frequency ω y = π . here , ω y = π is the highest vertical frequency , or half the sample frequency . the low - pass filter 11 ( see fig1 ) filters the baseband component from the input signal and supplies the spatial frame signal x s ( u , v ) which represents the spatial contents of the frame . the high - pass filter 12 ( see fig1 ) filters the alias component from the input signal and supplies the motion auxiliary signal or &# 34 ; motion helper &# 34 ; x m ( u , v ) which is representative of the motion in the frame signal . if desired , the motion auxiliary signal may have a narrow band . it will hereinafter be further assumed that the filters shown in fig2 a and 2b are used in the device shown in fig1 . the vertical low - pass filter 11 ( see fig2 a ) with filter coefficients 1 / 4 , 1 / 2 and 1 / 4 has a cut - off frequency ω y = 1 / 2π . the vertical high - pass filter 12 ( see fig2 b ) has filter coefficients - 1 / 4 , 1 / 2 and - 1 / 4 and also has a limit frequency ω y = 1 / 2π . for these filters , fig3 c shows the pixel values of the spatial signal x s ( u , v ) and fig3 d shows the pixel values of the motion auxiliary signal x m ( u , v ). in the case of forward play , the motion auxiliary signal x m ( u , v ) is added to the spatial signal x s ( u , v ). the pixel values of the output signal y i ( u , v ) are shown in fig3 e . they have been obtained by adding the pixel values in fig3 c and fig3 d together . in fig3 f , the obtained interlaced frame is shown graphically . as is apparent therefrom , the rectangle is displayed correctly . due to the delay in the filters the rectangle is shifted only slightly downwards . assuming that first the even field and subsequently the odd field of each frame is displayed , it appears from fig3 f that the frame area moves to the fight . this is in full conformity with the original video scene . in the case of reverse play , the motion auxiliary signal x m ( u , v ) is subtracted from the spatial signal x s ( u , v ). the pixel values of the output signal y i ( u , v ) are shown in fig3 g . now they have been obtained by subtracting the pixel values in fig3 d from the corresponding pixel values in fig3 c . fig3 h shows the interlaced frame graphically . with an unchanged sequence of displaying the fields ( first the even field , then the odd field ), it appears from fig3 h that the odd field has shifted to the left over one sample period . consequently , the frame area now moves in the opposite direction . as is further apparent from fig3 h , the resolution of the frame upon reverse play is slightly reduced in the example considered . this is caused by the following fact . for the sake of simplicity of the example , a frame area having extremely steep vertical transitions has been chosen as an input signal . consequently the spectra of the baseband component and the alias component overlap each other for the greater part and an unambiguous split - up of the components is not possible . moreover , also for the sake of simplicity , two non - optimal filters are used . in practical situations the reverse frame signal is not subject to degradation of the frame quality . fig4 shows diagrammatically a video recorder including a device according to the invention . in this figure , elements having the same reference numerals denote the same components as in fig1 . the video recorder comprises a recording section and a playback section 2 . both sections are coupled to a storage medium 3 , for example a magnetic tape . the tape 3 is transported by means of a transport device 4 . the interlaced frame signal x i ( u , v ) is applied to an input 10 of the recording section . the interlaced frame signal is applied to the vertical low - pass filter 11 and the vertical high - pass filter 12 . the spatial signal x s ( u , v ) and the motion auxiliary signal x m ( u , v ) are subjected in respective coding circuits 13 and 14 to some coding operation and converted into digital bit streams z s ( n ) and z m ( n ), respectively . the bit streams are applied to a multiplexer 15 which applies a resultant channel bit stream z ( n ) to a recording head 16 . a reproducing head 20 reads the recorded signal . the channel bit stream z &# 39 ;( n ) which has been read is split into digital bit streams z &# 39 ; s ( n ) and z &# 39 ; m ( n ) in a demultiplexer 21 . decoding circuits 22 and 23 perform decoding operations which are inverse to the coding operations performed by the coding circuits 13 and 14 . thus , upon play - back , the spatial signal x &# 39 ; s ( u , v ) and the motion auxiliary signal x &# 39 ; m ( u , v ) are regained . they are applied in a manner already described to the inverter 24 , the selector switch 25 and the adder circuit 26 . the adder circuit 26 applies the interlaced output signal y i ( u , v ) to an output 27 of the video recorder . the selector switch 25 is controlled by a forward / reverse operating signal f / r which also controls the transport device 4 . in the normal forward direction of the tape the selector switch 25 is in the position shown . in the reverse play mode of the video recorder the tape direction is reversed and the selector switch 25 is in the other position . | 7 |
the aforementioned illustrations and following detailed descriptions are exemplary for the purpose of further explaining the scope of the instant disclosure . other objectives and advantages related to the instant disclosure will be illustrated in the subsequent descriptions and appended drawings . in the drawings , the size and relative sizes of layers and regions may be exaggerated for clarity . it will be understood that , although the terms first , second , third , and the like , may be used herein to describe various elements , components , regions , layers and / or sections , these elements , components , regions , layers and / or sections should not be limited by these terms . these terms are only to distinguish one element , component , region , layer or section from another region , layer or section discussed below could be termed a second element , component , region , layer or section without departing from the teachings of the instant disclosure . as used herein , the term “ and / or ” includes any and all combinations of one or more of the associated listed items . please refer to fig1 , fig1 shows a schematic diagram of a bidirectional wireless charging system of one embodiment of the instant disclosure . the bidirectional wireless charging system comprises at least two bidirectional wireless charging devices . in this embodiment , the bidirectional wireless charging system comprises a first bidirectional wireless charging device 1 a , a second bidirectional wireless charging device 1 b and a third bidirectional wireless charging device 1 c . it is to be noted that fig1 is merely used to describe the bidirectional wireless charging system of one embodiment of the instant disclosure but does not limit the instant disclosure . in other embodiments , the bidirectional wireless charging system can merely comprise two bidirectional wireless charging devices or comprise more than two bidirectional wireless charging devices . the first bidirectional wireless charging device 1 a , the second bidirectional wireless charging device 1 b and the third bidirectional wireless charging device 1 c can be a mobile phone , a tablet computer , a laptop , a wireless charger , a smart watch , a set - top box or other electric products having a wireless charging function . for an easy instruction and understanding of the instant disclosure , in the following description , the first bidirectional wireless charging device 1 a may be a mobile phone , the second bidirectional wireless charging device 1 b may be a wireless charger and the third bidirectional wireless charging device 1 c may be a smart watch . in addition , the first bidirectional wireless charging device 1 a , the second bidirectional wireless charging device 1 b and the third bidirectional wireless charging device 1 c are operated according to the electromagnetic induction technology . however , it is not limited herein . the first bidirectional wireless charging device 1 a , the second bidirectional wireless charging device 1 b and the third bidirectional wireless charging device 1 c can also be operated according to the electromagnetic resonance technology . the second bidirectional wireless charging device 1 b may often be provided with commercial power and thus maintain sufficient power . when the first bidirectional wireless charging device 1 a has insufficient power , the user can operate the first bidirectional wireless charging device 1 a to send a switch signal to the second bidirectional wireless charging device 1 b . for example , the switch signal is an analogue signal indicating that the bidirectional wireless charging device turns into a power mode or a charging mode . for instance , the bidirectional wireless charging device receiving a high - level switch signal would turn into the power mode , and he bidirectional wireless charging device receiving a low - level switch signal would turn into the charging mode . after receiving the high - level switch signal , the second bidirectional wireless charging device 1 b turns into the power mode and starts to charge the first bidirectional wireless charging device 1 a . in another case , when the stored power of the first bidirectional wireless charging device 1 a is insufficient to drive the first bidirectional wireless charging device 1 a , the user can also operate the second bidirectional wireless charging device 1 b to send a low - level switch signal to the first bidirectional wireless charging device 1 a . the switch signal has energy , so the first bidirectional wireless charging device 1 a can be turned on by the energy of the switch signal . after that , the first bidirectional wireless charging device 1 a would reply the second bidirectional wireless charging device 1 b with a high - level switch signal . after receiving the high - level switch signal , the second bidirectional wireless charging device 1 b starts to charge the first bidirectional wireless charging device 1 a . when the stored power of the first bidirectional wireless charging device 1 a reaches a predetermined value ( such as 90 % of the maximum stored power of the first bidirectional wireless charging device 1 a ), the first bidirectional wireless charging device 1 a sends a status signal to the second bidirectional wireless charging device 1 b , so that the second bidirectional wireless charging device 1 b ends the power mode and thus stops charging the first bidirectional wireless charging device 1 a . sometimes the user may bring the first bidirectional wireless charging device 1 a , the second bidirectional wireless charging device 1 b and the third bidirectional wireless charging device 1 c outside , and in this case the second bidirectional wireless charging device 1 b can &# 39 ; t be provided with commercial power and can &# 39 ; t maintain sufficient power . when the second bidirectional wireless charging device 1 b has insufficient power , the second bidirectional wireless charging device 1 b can &# 39 ; t charge the third bidirectional wireless charging device 1 c . there may be a more urgent demand for using the third bidirectional wireless charging device 1 c , so the user would try not to run out the power of the third bidirectional wireless charging device 1 c . at this moment , the user can operate the third bidirectional wireless charging device 1 c to send a switch signal to the first bidirectional wireless charging device 1 a , so that the first bidirectional wireless charging device 1 a would turn into the power mode and start to charge the third bidirectional wireless charging device 1 c . in other words , the first bidirectional wireless charging device 1 a , the second bidirectional wireless charging device 1 b and the third bidirectional wireless charging device 1 c provided in this embodiment can be used as a charging end or a powering end , so as to increase the convenience of the bidirectional wireless charging system . in addition , the switch signal can be a pulse width modulation signal ( pwm signal ) sent by a coil ; however , it is not limited herein . for example , in other embodiments , the bidirectional wireless charging device 1 can send a switch signal wirelessly via a wireless transmission unit ( not shown in fig1 ). there is further instruction for a structure of the bidirectional wireless charging device in the following description . please refer to fig2 , fig2 shows a block diagram of a bidirectional wireless charging device of one embodiment of the instant disclosure . the bidirectional wireless charging device 1 can be one of the above mentioned first bidirectional wireless charging device , second bidirectional wireless charging device 1 b and third bidirectional wireless charging device 1 c . for a need to instruct easily , they are described as the bidirectional wireless charging device 1 in the following description . the bidirectional wireless charging device 1 comprises a transceiver chip 10 , a coil 11 , a power processing unit 12 and a power storage unit 13 . the coil 11 is electrically connected to the transceiver chip 10 . the transceiver chip is electrically connected to the power processing unit 12 and the power storage unit 13 . the power processing unit 12 is electrically connected to the power storage unit 13 . the coil 11 can be a cable coil or other inductor that can generate an induced voltage corresponding to a variable electromagnetic field . when the bidirectional wireless charging device 1 is used as a powering end , the coil 11 can convert the voltage into a pwm signal and send the pwm signal out . the pwm signal includes an electromagnetic energy , so a charging end can charge with the received electromagnetic energy . when the bidirectional wireless charging device is used as a charging end , the coil 11 can sense the pwm signal and convert the electromagnetic energy of the pwm signal into an induced voltage . the transceiver chip 10 receives the switch signal and correspondingly controls and makes the bidirectional wireless charging device 1 turn into the power mode or the charging mode . moreover , when the bidirectional wireless charging device 1 is used as a powering end , the transceiver chip 10 receives the voltage from the power processing unit 12 and the power storage unit 13 , and provides the voltage to the coil 11 so that the coil 11 generates a pwm signal . when the bidirectional wireless charging device 1 is used as a charging end , the transceiver chip 10 receives an induced voltage generated by the coil 11 , and rectifies and regulates the induced voltage to generate a regulated voltage . the power processing unit 12 manages the stored power of the bidirectional wireless charging device 1 . for example , the power processing unit 12 determines when to transmit the regulated voltage outputted by the transceiver chip 10 to the power storage unit 13 , or makes the power storage unit 13 provide power to the transceiver chip 11 . the power storage unit 13 is used to store power , for example , the battery of the bidirectional wireless charging device 1 or other power storage devices , such as a capacitor . for further instruction , please refer to fig3 a . fig3 a is a schematic diagram of a bidirectional wireless charging device of one embodiment of the instant disclosure . as described in the above embodiment , the bidirectional wireless charging device 1 comprises a transceiver chip 10 , a coil 11 , a power processing unit 12 and a power storage unit 13 . the relationship of connection between the transceiver chip 10 , the coil 11 , the power processing unit 12 and the power storage unit 13 for this embodiment can be referred to the description in the previous embodiment , and thus the redundant information is not repeated . the following description is merely for the difference between this embodiment and the previous embodiment . the transceiver chip 10 further comprises a control module 101 , a power stage circuit 102 , a charging mode operation module 104 and a power mode operation module 103 . the control module 101 is electrically connected to the power stage circuit 102 . the power stage circuit 102 is electrically connected to the coil 11 . the charging mode operation module 104 is electrically connected to the control module 101 and the coil 11 . the power mode operation module 103 is electrically connected to the control module 101 and the coil 11 . in conjunction with fig3 a and fig3 b , fig3 b is a schematic diagram of a bidirectional wireless charging device of another embodiment of the instant disclosure . the transceiver chip 10 of the bidirectional wireless charging device 1 also comprises a control module 101 , a power stage circuit 102 , a charging mode operation module 104 and a power mode operation module 103 . the following is further instruction about the structure and function of the transceiver chip 10 . the control module 101 comprises a control unit 1010 . the control unit 1010 is electrically connected to the power stage circuit 102 . the control unit 1010 controls and adjusts the voltage output by the power stage circuit 102 . the power stage circuit 102 comprises a power switch , a pulse width modulation circuit , an isolated high - frequency transformer , a rectifying circuit and an output filter ( not shown in fig3 b ). the rectifying circuit can be , for example , a half - bridge rectifying circuit or a full - bridge rectifying circuit , to generate a rectified voltage . when the bidirectional wireless charging device 1 is used as a power end , the power stage circuit 102 drives the power switch and provides a voltage to the coil 11 , so that the coil 11 is driven to have a resonance and output a pwm signal . when the bidirectional wireless charging device 1 is used as a charging end , the power stage circuit 102 receives an induced voltage from the coil 11 and generates a rectified voltage . the detailed structure and the working mechanism of the power stage circuit 102 would be able to be comprehended by one skilled in the art and further descriptions are therefore omitted . the power mode operation module 103 comprises a demodulation unit 1030 electrically connected to the control unit 1010 and the coil 11 . the demodulation unit 1030 receives a pwm signal pwm ′ output by another bidirectional wireless charging device which is used as a charging end via the coil 11 , and demodulates the received pwm signal pwm ′. the pwm signal pwm ′ includes a status message sent from the charging end . in detail , the status message comprises a quantity of the charging end ( for example , the currently stored electric quantity of the charging end ), an energy adjusting request , an energy maintaining request , a cut - off supply request or the like . the demodulation unit 1030 filters the high - frequency band out from pwm signal pwm ′, maintains the amplitude , and uses the amplitude size as a status message sent by the charging end . after that , the demodulation unit 1030 outputs the demodulated status message to the control unit 1010 , so that the control unit 1010 correspondingly controls the voltage output by the power stage circuit 102 according to the demodulated status message . for example , when the status message includes an energy adjusting request , the control unit 1010 would correspondingly adjust the voltage output by the power stage circuit 102 according to the currently stored power of the charging end . when the status message includes an energy maintaining request , the control unit 1010 would make the power stage circuit 102 maintain the provided voltage . the charging mode operation module 104 comprises a voltage regulating unit 1040 and a modulation unit 1041 . the voltage regulating unit 1040 is electrically connected to the control unit 1010 , the power stage circuit 102 and the power processing unit 12 . the modulation unit 1041 is electrically connected to the control unit 1010 and the coil 11 . the voltage regulating unit 1040 receives the rectified voltage output by the power stage circuit 102 , regulates the rectified voltage and outputs the regulated voltage to charge the power storage unit 13 of the bidirectional wireless charging device 1 . the modulation unit 1041 is controlled by the control unit 1010 . the control unit 1010 controls and makes the modulation unit 1041 generate a pwm signal including a status message according to the regulated voltage value and the power currently stored in the bidirectional wireless charging device . please refer to fig4 . fig4 shows a schematic diagram of a bidirectional wireless charging device of one embodiment of the instant disclosure in the power mode . when another bidirectional wireless charging device 1 ′ ( not shown in fig4 , such as the wireless charging device 1 ′ in fig5 ) has insufficient power ( for example , the left power of the bidirectional wireless charging device 1 ′ is less than 20 % of the maximum stored power but more than the minimum stored power ), the user can operate the bidirectional wireless charging device 1 ′ to send a switch signal , such as a high - level switch signal . after receiving the switch signal , the bidirectional wireless charging device 1 turns into the power mode and becomes a powering end to start to provide power to the bidirectional wireless charging device v . in addition , in this embodiment , the high - level switch signal corresponds to the power mode but it is not limited herein . that is , in other embodiments , the low - level switch signal can also be set to correspond to the power mode . further , when the switching unit ( not shown in fig4 ) of the control module 101 receives the high - level switch signal , the switching unit makes the circuit path corresponding to the power mode operation module 103 turn on ( shown as the circuit path connected by the real line in fig4 ), and makes the circuit path corresponding to the charging mode operation module 103 turn off ( shown as the circuit path connected by the dash line in fig4 .). the switching unit may be , for example , a multiplexer or a metal - oxide - semiconductor field - effect transistor ( mosfet ) switch , so as to switch the corresponding circuit path according to the switch signal . after the bidirectional wireless charging device 1 turns into the power mode , the power processing unit 12 controls the power storage unit 13 to provide power to the power stage circuit 102 . after that , the control unit 1010 of the control module 101 controls the power stage circuit 102 to output a voltage to the coil 11 so as to drive the coil to have the resonance and to output a pwm signal having the electromagnetic energy . as the charging end , the coil 11 of the bidirectional wireless charging device 1 ′ generates an induced voltage via the electromagnetic induction and start to charge . when the stored power of the bidirectional wireless charging device 1 ′ reaches a predetermined value , the bidirectional wireless charging device 1 ′ would output a pwm signal including a cut - off supply request . after the demodulation unit 1030 of the power mode operation module 103 of the bidirectional wireless charging device 1 receives a pwm signal pwm ′ via the coil 11 , it would demodulate the pwm signal pwm ′ and output a demodulated status message . the control unit 1010 receives the status message and correspondingly controls the output power of the power stage circuit 102 according to the status message . for example , when the bidirectional wireless charging device 1 receives the status message indicating that the stored power of the bidirectional wireless charging device 1 ′ reaches a predetermined value ( such as 90 % of the maximum stored power of the bidirectional wireless charging device 1 ′, but it is not limited herein ), the control unit 1010 of the bidirectional wireless charging device 1 makes the power stage circuit 102 stop charging the bidirectional wireless charging device 1 ′. please refer to fig5 . fig5 shows a schematic diagram of a bidirectional wireless charging device of one embodiment of the instant disclosure in the charging mode . different from the embodiment shown in fig4 , the bidirectional wireless charging device 1 ′ shown in fig5 is used as the charging end . in addition , the bidirectional wireless charging device 1 shown in fig4 and the bidirectional wireless charging device 1 ′ shown in fig5 have the same structure but different operation modes . further , when the user tends to charge the bidirectional wireless charging device 1 ′, the user can make the bidirectional wireless charging device 1 ′ turn into the charging mode . at this moment , the switching signal generating unit ( not shown in fig5 ) of the bidirectional wireless charging device 1 ′ would generate a high - level switch signal and a low - level switch signal . the high - level switch signal is sent to the bidirectional wireless charging device 1 ( not shown in fig5 , such as the wireless charging device 1 ), so that the bidirectional wireless charging device 1 turns into the power mode . the low - level switch signal is sent to the control module 101 ′ of the bidirectional wireless charging device 1 ′, so that the bidirectional wireless charging device 1 ′ turns into the power mode . after the switching unit ( not shown in fig5 ) of the control module 101 ′ receives the switch signal , the switching unit makes the circuit corresponding to the charging mode operation module 104 ′ turn on ( shown as the circuit path connected by the real line in fig5 ), but makes the circuit corresponding to the powering mode operation module 103 ′ turn off ( shown as the circuit path connected by the dotted line in fig5 ). as mentioned above , the switching unit , such as a multiplexer or a mosfet switch , is configured to correspondingly switch the circuit paths according to the switch signal . the coil 11 ′ receives the pwm signal from the bidirectional wireless charging device 1 , and converts the electromagnetic energy of the pwm signal into an induced voltage . the power stage circuit receives and rectifies the induced voltage , and outputs a rectified voltage . the voltage regulating unit 1040 ′ of the charging mode operation module 104 ′ receives and regulates the rectified voltage , and generates a regulated voltage . after that , the voltage regulating unit 1040 ′ outputs the regulated voltage to the control unit 1010 ′, so as to provide power for the operation of the bidirectional wireless charging device v . moreover , the voltage regulating unit 1040 ′ outputs the regulated voltage to the power processing unit 12 ′, and the power processing unit 12 ′ uses the regulated voltage to charge the power storage unit 13 ′. after receiving the regulated voltage , the control unit 1010 ′ makes the modulation unit 1041 ′ change the voltage amplitude of the coil 11 according to the regulated voltage value and the currently stored power of the bidirectional wireless charging device 1 ′, so that the coil 11 ′ generates a pwm signal pwm ′ including a status message for informing the powering end about the current electric quantity of the bidirectional wireless charging device 1 ′, an energy adjusting request , an energy maintaining request or a cut - off supply request . the steps for the bidirectional wireless charging device 1 ′ to generate a pwm signal pwm ′ are as follows . after receiving the regulated voltage , the control unit 1010 ′ determines whether the power provided from the power storage unit 13 ′ to the bidirectional wireless charging device 1 ′ is within a normal range . if the power provided by the power storage unit 13 ′ is not within the normal range , it means that the power currently stored in the power storage unit is insufficient to support and maintain the operation of the bidirectional wireless charging device v . at this moment , the control unit 1010 ′ makes the modulation unit 1041 ′ change the voltage amplitude of the coil 11 ′, so as to generate a pwm signal pwm ′ including an energy adjusting request or an energy maintaining request . if the power provided by the power storage unit 13 ′ is within the normal range , the control unit 1010 ′ further detects whether the power stored in the power storage unit 13 ′ reaches a predetermined value . when the control unit 1010 ′ determines that the power stored in the power storage unit 13 ′ reaches the predetermined value , the control unit 1010 ′ makes the modulation unit 1041 ′ generate a pwm signal pwm ′ including a cut - off supply signal . for example , when the power provided by the power storage unit 13 ′ is not within the normal range , the control unit 1010 ′ makes the modulation unit 1041 ′ generate a pwm signal pwm ′ including an energy adjusting request , so as to request the powering end to provide a pwm signal pwm having more energy . when the power provided by the power storage unit 13 ′ is within the normal range and the power stored in the power storage unit 13 ′ has not reached the predetermined value ( such as 90 % of the maximum stored power of the bidirectional wireless charging device 1 ′), the control unit 1010 ′ makes the modulation unit 1041 ′ generate a pwm signal pwm ′ including an energy adjusting request , so as to request the powering end to output a pwm signal pwm having more energy . in another case , the control unit 1010 ′ can also makes the modulation unit 1041 ′ generate a pwm signal pwm ′ including an energy maintaining request , so as to make the powering end keep outputting the current pwm signal pwm . when the power provided by the power storage unit 13 ′ is within the normal range and the control unit 1010 ′ determines that the power stored in the power storage unit 13 ′ reaches the predetermined value , the control unit 1010 ′ makes the modulation unit 1041 ′ generate a pwm signal pwm ′ including a cut - off supply signal , so as to make the powering end stop charging the bidirectional wireless charging device 1 ′. in addition , the above embodiment is an example for describing the application of the instant disclosure , but it is not limited herein . the user can set the normal range of power provided by the power storage unit 13 ′ and set the predetermined value of power stored in the power storage unit 13 ′ based on need . in other embodiments , the control unit 1010 ′ is also configured to make the modulation unit 1041 ′ generate a pwm signal pwm including a status message once every time interval , so as to inform the powering end of the current electric quantity of the bidirectional wireless charging device 1 ′, an energy adjusting request , or an energy maintaining request . thereby , the powering end can dynamically adjust the electromagnetic energy provided to the bidirectional wireless charging device 1 ′. for instance , when the status message output by the bidirectional wireless charging device 1 ′ indicates that the currently stored power of the bidirectional wireless charging device 1 ′ is less than 70 % of the maximum stored power , the powering end would output a pwm signal pwm with more energy . when the status message output by the bidirectional wireless charging device 1 ′ indicates that the currently stored power of the bidirectional wireless charging device 1 ′ is about 70 %- 90 % of the maximum stored power , the powering end would output a pwm signal pwm with less energy . when the status message output by the bidirectional wireless charging device 1 ′ indicates that the currently stored power of the bidirectional wireless charging device 1 ′ is more than 90 % of the maximum stored power , the powering end would stop charging the bidirectional wireless charging device 1 ′. in addition , the above embodiment is an example for describing the application of the instant disclosure , but it is not limited herein . the user can set how the bidirectional wireless charging device 1 and bidirectional wireless charging device 1 ′ dynamically adjust the electromagnetic energy based on needs . in this embodiment , the transceiver chip 10 of the bidirectional wireless charging device 1 merely comprises one power mode operation module 103 and one charging mode operation module 104 . in other embodiments , the transceiver chip 10 can also comprise a plurality of coils 11 , a plurality of power mode operation modules 103 and a plurality of charging mode operation modules 104 . the power mode operation modules 103 are electrically connected to the control module 101 and the corresponding coil 11 respectively , and the charging mode operation modules 104 are electrically connected to the control module 101 , the corresponding coils and the power stage circuit 102 respectively . thereby , the bidirectional wireless charging device 1 can receive the electromagnetic energy from many powering ends at the same time or can provide the electromagnetic energy to many charging ends at the same time , which makes the bidirectional wireless charging device 1 have multiple bidirectional wireless charging functions . it is worth mentioning that , in the above embodiment , the user needs to manually operate the bidirectional wireless charging device 1 to generate a switch signal and start the charging process . however , in other embodiments , the two bidirectional wireless charging devices 1 and 1 ′ in the bidirectional wireless charging system can automatically start the charging process . in detail , in other embodiments , the user can set the bidirectional wireless charging devices 1 and 1 ′ to turn on the automatic charging function . when the distance between the bidirectional wireless charging devices 1 and 1 ′ is less than a preset distance , the bidirectional wireless charging devices 1 and 1 ′ would exchange their status messages to inform each other of the current electric quantity . when the current electric quantity of the bidirectional wireless charging device 1 is more than a first threshold value and the current electric quantity of the bidirectional wireless charging device 1 ′ is less than a second threshold value , the bidirectional wireless charging device 1 would start to charge the bidirectional wireless charging device 1 ′. for example , when the current electric quantity of the bidirectional wireless charging device 1 ′ is less than 20 % of the maximum stored power and the current electric quantity of the bidirectional wireless charging device 1 is more than 80 % of the maximum stored power , the bidirectional wireless charging device 1 would automatically charge the bidirectional wireless charging device v . in addition , the above embodiment is merely an example for describing the application of the instant disclosure , but it is not limited herein . the skilled in the art can set the predetermined distance , a first threshold value and second threshold value based on the actual operation and needs . moreover , the user can also choose to turn off the automatic charging function of the bidirectional wireless charging devices 1 and 1 ′, and thus in the instant disclosure the bidirectional wireless charging devices 1 and 1 ′ can optionally turn on their automatic charging function . on the other hand , in other embodiments , the bidirectional wireless charging system can be set such that the bidirectional wireless charging device 1 periodically sends a switch signal to another bidirectional wireless charging device . when the bidirectional wireless charging device 1 ′ receives the switch signal and the bidirectional wireless charging device 1 ′ has insufficient power , the bidirectional wireless charging device 1 ′ would reply to this switch signal . after receiving the reply of the bidirectional wireless charging device 1 ′, the bidirectional wireless charging device 1 would turn into the power mode and start to charge the bidirectional wireless charging device 1 ′. in short , the bidirectional wireless charging device provided in the embodiment of the instant disclosure can be used as a powering end or a charging end , so as to increase the convenience of the bidirectional wireless charging system . moreover , the transceiver chip 10 of the bidirectional wireless charging device provided in the embodiment of the instant disclosure integrates the power mode operation module 103 and the charging mode operation module 104 into a single chip . thereby , the bidirectional wireless charging device 1 merely needs one control module 101 and one power stage circuit 102 to realize the bidirectional wireless charging function . please refer to fig6 , fig6 shows a flow chart of a bidirectional wireless charging device of one embodiment of the instant disclosure in the power mode . the steps of process shown in fig6 are applied to the above bidirectional wireless charging devices 1 and 1 ′. the step s 601 is starting the powering process . the step s 602 is making the bidirectional wireless charging device 1 turn into the power mode . the switch signal can be sent from the switch signal generating unit of the bidirectional wireless charging device 1 or from the switch signal generating unit of another bidirectional wireless charging device ( such as the bidirectional wireless charging device 1 ′). the step s 603 is that the bidirectional wireless charging device 1 starts to output the electromagnetic energy to the bidirectional wireless charging device 1 ′. the step s 604 is that the bidirectional wireless charging device 1 receives and demodulates a pwm signal pwm ′ sent by the bidirectional wireless charging device 1 ′, so as to obtain a status message of the bidirectional wireless charging device 1 ′, which includes an electric quantity in formation of the charging end , an energy adjusting request , an energy maintaining request or a cut - off supply request . the step s 605 is that the bidirectional wireless charging device 1 determines whether the status message includes a cut - off supply message . if the status message includes a cut - off supply message , it goes to the step s 606 , and if the status message does not include a cut - off supply message , it goes to the step s 607 . the step s 606 is that the bidirectional wireless charging device 1 adjusts the power output by the power stage circuit according to the status message and that it returns to the step s 603 so as to continue to charge the bidirectional wireless charging device v . the steps for the bidirectional wireless charging device 1 adjusting the power output by the power stage circuit are the same as the above embodiment , and thus the redundant information is not repeated . the step s 606 is that the bidirectional wireless charging device 1 stops outputting the electromagnetic energy , and the step s 607 is ending the powering process . please refer to fig7 , fig7 shows a flow chart of a bidirectional wireless charging device of one embodiment of the instant disclosure in the charging mode . the steps of the process shown in fig7 are also applied to the above bidirectional wireless charging devices 1 and v . the step s 701 is starting the charging process . the step s 702 is that the bidirectional wireless charging device 1 ′ receives a switch signal and turns into the charging mode . the step s 703 is that the bidirectional wireless charging device 1 ′ receives a pwm signal pwm from another bidirectional wireless charging device ( such as the bidirectional wireless charging device 1 ), so as to charge based on the electromagnetic energy of the pwm signal pwm . the step s 704 is that the bidirectional wireless charging device 1 ′ converts the electromagnetic energy into a regulated voltage and provides the regulated voltage to the power storage unit 13 ′ for charging . the step s 705 is that control unit 1010 ′ of the bidirectional wireless charging device 1 ′ determines whether the power provided from the power storage unit 13 ′ to the bidirectional wireless charging device 1 ′ is within a normal range . as described above , those skilled in the art can set this normal range of power provided by the power storage unit 13 ′ based on need . if the power provided by the power storage unit 13 ′ is within the normal range , it goes to the step s 706 . if the power provided by the power storage unit 13 ′ is not within the normal range , it goes to the step s 707 . the step s 706 is that the control unit 1010 ′ determines whether the power stored in the power storage unit 13 ′ reaches a predetermined value . if the control unit 1010 ′ determines that the power stored in the power storage unit 13 ′ reaches the predetermined value , it goes to the step s 708 , otherwise it goes to the step s 707 . as described above , those skilled in the art can set a predetermined value of power stored in the power storage unit 13 ′ based on need . the step s 707 is that the control unit 1010 ′ makes the modulation unit 1041 ′ drive the coil 11 ′ to generate a pwm signal pwm ′ including an energy adjusting request or an energy maintaining request , so as to inform the bidirectional wireless charging device 1 of its electric quantity information . after the bidirectional wireless charging device 1 receives the pwm signal pwm ′, it adjusts the output power according to the status message of the pwm signal pwm ′ and continues to provide the electromagnetic energy to the bidirectional wireless charging device 1 ′. the step s 708 is that the power stored in the power storage unit 13 ′ reaches the predetermined value , so the control unit 1010 ′ makes the modulation unit 1041 ′ drive the coil 11 ′ to generate a pwm signal pwm ′ including a cut - off supply request . after that , the bidirectional wireless charging device 1 ′ outputs the pwm signal pwm ′ to the bidirectional wireless charging device 1 , so that that bidirectional wireless charging device 1 stops charging the bidirectional wireless charging device v . the step s 709 is ending the charging process . to sum up , the bidirectional wireless charging device provided by the instant disclosure can be used as a powering end or a charging end to improve the convenience of the bidirectional wireless charging device . moreover , compared with the traditional bidirectional wireless charging device , the transceiver chip of the bidirectional wireless charging device provided by the instant disclosure integrates the power mode operation module and the charging mode operation module into a single chip . thereby , merely one control module and one power stage circuit are needed for the instant disclosure to provide the bidirectional wireless charging function , which effectively shrinks the circuit area , decreases the cost and also reduces the system complexity . in addition , in the transceiver chip provided by the embodiment of the instant disclosure , the power mode operation module and the charging mode operation module are set to use one control module and one power stage circuit together , and the number of pins of the transceiver chip also decreases . in detail , in the power mode , part of the pins of the transceiver chip can be necessarily used for powering . when switching to the charging mode , the above part of the pins would be necessarily used with the change of the transceiver chip &# 39 ; s mode . in other words , part of the pins of the transceiver chip is used both in the power mode and the charging mode . thereby , the number of pins of the transceiver chip can be decreased , which effectively reduces the cost of the transceiver chip . moreover , the traditional bidirectional wireless charging device using the electromagnetic induction technology would lose some power after electromagnetic transduction because of the external circuit , which decreases the power obtained by the bidirectional wireless charging device . the bidirectional wireless charging device provided by the embodiment of the instant disclosure integrates the switching circuit , the rectifying circuit and the demodulation circuit into a single transceiver chip , which reduces the power loss and thus increases the efficiency of the bidirectional wireless charging device . the bidirectional wireless charging device provided by the embodiment of the instant disclosure also provides an automatic charging function . when there is not sufficient power , the bidirectional wireless charging device would automatically search for a nearby bidirectional wireless charging device for charging , so that the user need not manually operate the bidirectional wireless charging device for charging . the descriptions illustrated supra set forth simply the preferred embodiments of the instant disclosure ; however , the characteristics of the instant disclosure are by no means restricted thereto . all changes , alterations , or modifications conveniently considered by those skilled in the art are deemed to be encompassed within the scope of the instant disclosure delineated by the following claims . | 7 |
for purposes of the description hereinafter , the terms “ upper ”, “ lower ”, “ vertical ”, “ horizontal ”, “ top ”, “ bottom ”, “ aft ”, “ behind ”, “ forward ”, “ rear ”, “ beneath ”, “ below ” and derivatives thereof shall relate to the invention , as it is oriented in the drawing figs . however , it is to be understood that the invention may assume various alternative configurations except where expressly specified to the contrary . it is also to be understood that the specific elements illustrated in the drawings and described in the following specification are simply exemplary embodiments of the invention . therefore , specific dimensions , orientations and other physical characteristics related to the embodiments disclosed herein are not to be considered limiting . as employed herein , the term “ number ” refers to one or more than one ( i . e ., a plurality ). as employed herein , the term “ fastener ” refers to any suitable fastening , connecting or tightening mechanism expressly including , but not limited to , integral rivets . as employed herein , the statement that two or more parts are “ coupled ”, “ attached ” or “ connected ” together shall mean that the parts are joined together either directly or joined through one ore more intermediate parts . turning to fig1 , a full open easy open can end 10 is displayed . the can end 10 has a score line 12 which defines an opening panel 14 . a pull tab 15 may be lifted to fracture the score line 12 . after the score line 12 is fractured , the pull tab 15 may be pulled upward from the container which severs the remainder of the score line 12 in order to remove the entire opening panel 14 for dispensing the contents of the container . turning to fig2 , fan patterns emitted from a low pressure solid stream or non - atomization spray head 16 and a high pressure droplet or atomization spray head 18 are displayed . as can be seen , the fan pattern 20 of the spray head 16 is circular and concentrated whereas the fan pattern 22 of the spray head 18 is elliptical and disperse . the spray head 16 uses a solid stream nozzle 24 at a relatively low pressure of less than 100 psi ( 0 . 690 mpa ) from a compressed gas source or the like . the length that the fluid leaves the nozzle 24 allows for a continuous circular vector of fluid without turbulence or fluid breakup as it leaves the nozzle 24 . conversely , spray head 18 disperses an elliptical pattern of fluid in droplet form as it leaves nozzle 26 . the emission of the fluid from spray head 16 in a solid stream and in a circular pattern allows the fluid to be sprayed on the score line 12 of the can end 10 in higher volumes and minimizes overspray onto a transfer mechanism or belt that negatively effects the machine efficiency equipped with spray head 18 due to the elliptical fan pattern 22 . the spraying method of spray head 16 is performed with low pressure on a translating or rotating spray head assembly 28 shown in fig3 . the spray path of the spray head assembly 28 is in a controlled manner if a solid stream spraying technique is employed . the spray head assembly 28 is dynamically balanced with a rigid bearing support mechanism 30 shown in fig4 - 5 . the rigid bearing support mechanism 30 allows for accurate dispensing of the fluid to the can end 10 located in the transfer mechanism or belt located below the spray head assembly 28 , a spray gun 82 and the nozzle 24 . the solid stream method requires an accurate rotating assembly to control the spray location of the fluid . the bearing support mechanism 30 assists in controlling the rotating path of the spray head assembly 28 . as can be seen in fig4 - 5 , the bearing support mechanism 30 is rotatably coupled to a motor 32 by an elongated first shaft 34 coupled to a coupling member 36 and a frame 40 . with reference to fig4 , an elongated second shaft 38 is rotatably coupled to the frame 40 . each of the shafts 34 , 38 are rotatably coupled to the frame 40 with one of a plurality of connectors 42 . each of the shafts 34 , 38 passes through either a first or a second tubular spacer 44 , a portion of a plurality of bearing members 46 coupled to the frame 40 and an aperture of either a first or a second sprocket 48 . bearing members 46 could be ball bearings , ball thrust bearings , flange bearings , needle bearings , preloaded bearings , roller bearings , roller thrust bearings , split sleeves , tapered roller bearings and other types of bearing members that are known in the art . the connectors 42 assist in keeping the upper bearing members 46 in place . connectors 49 assist in keeping the lower bearing members 46 in place . rotary motion applied by the motor 32 to shaft 34 is translated to shaft 38 by a belt 50 rotatably coupled to the sprockets 48 . sprockets 48 are spaced from shafts 34 , 38 by spacing members 52 which have apertures through which one of the shafts 34 , 38 pass . mounting plates 54 are coupled to one or the other of the shafts 34 , 38 . one end of each eccentric third and fourth shafts 56 are coupled to one or the other of mounting plates 54 and one or the other of the shafts 34 , 38 . each of shafts 56 passes through an aperture of either a first or a second bearing member 58 . bearing members 58 could be ball bearings , ball thrust bearings , flange bearings , needle bearings , preloaded bearings , roller bearings , roller thrust bearings , split sleeves , tapered roller bearings and other types of bearing members that are known in the art . bearing members 58 pass through apertures of first plate 60 and are encased within rings 62 which may be , by way of example and not limitation , sealing rings . plate 60 is rotatably coupled to bearing members 58 . the other end of each eccentric third and fourth shafts 56 are coupled to one or the other plate 64 . each of the bearing members 58 are spaced apart from the plates 54 , 64 by a certain number of spacing members 66 . each plate 64 is also coupled to one or the other of fifth and sixth eccentric shafts 68 which are coupled to one or the other of third and fourth shafts 56 . each of shafts 68 pass through an aperture of either a third or a fourth bearing member 70 . bearing members 70 could be ball bearings , ball thrust bearings , flange bearings , needle bearings , preloaded bearings , roller bearings , roller thrust bearings , split sleeves , tapered roller bearings and other types of bearing members that are known in the art . bearing members 70 pass through apertures of second plate 72 and are encased within rings 74 which may be , by way of example and not limitation , sealing rings . plate 72 is rotatably coupled to bearing members 70 . each of the bearing members 70 are spaced apart from the plate 72 by a certain number of spacing members 76 . a cap 78 is coupled to each of the shafts 68 to assist in keeping the bearing members 70 in place . with reference to fig3 , plate 60 has a mounting bracket 80 for securing a spray gun 82 of the type shown in fig7 . spray gun 82 has a low pressure solid stream or non - atomization spray head 16 and nozzle 24 . of course , one could attach a high pressure droplet or atomization spray head 18 to the mounting bracket 80 as well . the spray gun 82 has a plurality of apertures 84 for coupling the spray gun 82 to the mounting bracket 80 . fig8 shows the spray gun 82 coupled to bracket 80 . various hoses that supply fluid to the spray gun 82 have been omitted from fig8 for the purpose of simplifying fig8 . likewise , plate 72 has a mounting bracket 86 for securing a spray gun 82 of the type shown in fig7 . of course , one could attach a high pressure droplet or atomization spray head 18 to the mounting bracket 86 as well . fig8 shows the spray gun 82 coupled to bracket 86 . fig9 shows the spray guns 82 connected to a spray machine 88 . as in fig8 , various hoses that supply fluid to the spray gun 82 have been omitted from fig9 for the purpose of simplifying fig9 . a transfer mechanism or belt 90 is shown in fig9 below the spray guns 82 and nozzle 24 which conveys can ends 10 below the spray guns 82 for application of fluid , repair fluid , lacquer or paint to the can ends 10 . the can ends 10 are typically transferred to the transfer mechanism 90 by a downstacker or the like . with reference to fig7 , apertures 84 are located on mounting brackets 92 . the spray gun 82 is equipped with a manifold 94 for delivery of the fluid to spray head 16 . hoses ( not shown ) are coupled to connectors 96 for delivery of the fluid to the manifold 94 . the hoses ( not shown ) are additionally secured to the spray gun 82 by connector assembly 98 . as an example , connector assembly 98 is shown as a plurality of brackets coupled together . with reference to fig1 , the fluid delivery system of the present invention is a low pressure tank system . fluid is supplied to a low pressure tank 100 . next , the tank 100 is pressurized using conventional compressed gas sources or the like which are typically less than 100 psi ( 0 . 690 mpa ). the tank 100 does not require additional complicated amplification systems and equipment for flowing the fluid through the fluid delivery system . the fluid is then filtered through a fluid filter 102 . the fluid then flows through a fluid flow sensor 104 which monitors and / or controls the flow rate of the fluid . the fluid flow sensor 104 allows the end - user to selectively control the flow rate of the fluid from the spray gun 82 . by controlling the flow rate of the fluid from the spray gun 82 , the end - user can control the amount or weight of fluid that is dispensed onto each can end 10 . the fluid then flows to the rotating spray gun 82 attached to the spray machine 88 which is rotating in a circular pattern . the tank 100 , the fluid filter 102 , the fluid flow sensor 104 and the spray gun 82 are in fluid communication with one another and define a fluid delivery system . the fluid is dispensed from the nozzle 24 in a circular pattern in a solid stream from the nozzle 24 toward the can end 10 . the circular pattern is concentrated and emitted with low pressure using conventional compressed gas sources which are typically less than 100 psi ( 0 . 690 mpa ) without further amplification whereas the prior art spray head 18 emits the fluid in an elliptical and disperse pattern at a higher pressure which is typically greater than 100 psi ( 0 . 690 mpa ). the circular and concentrated pattern of the present invention significantly reduces the problem associated with the overspray produced by spray head 18 . the fluid is dispensed from the spray head 16 in a controlled manner due to the rigid bearing support system 30 of the present invention . the length that the fluid leaves nozzle 24 allows for a continuous circular vector of fluid without turbulence or fluid breakup as it leaves the nozzle 24 . dispensing the fluid from spray head 16 allows the fluid to be sprayed on the score line 12 of the can end 10 in low and high volumes and minimizes overspray that negatively effects the machine efficiency equipped with spray head 18 . the spray machine 88 has been omitted from fig1 for the purpose of simplifying the fig . the low pressure of this system minimizes the number of components that are wetted by the fluid which oftentimes consists of mixed epoxy coatings . avoiding overspray is important to machine efficiency because it reduces the downtime of cleaning and maintaining the transfer mechanism , belts or other components of the machine . the industry has not utilized this type of spraying method because it has not been provided as an option by the can machinery original equipment manufacturers (“ oems ”) since the oems did not have appropriate spray head control technology of the rigid bearing support system 30 used in the present invention that implements the low pressure solid stream or non - atomization spray method . the apparatus and method of the present invention allows for the spray head to translate or rotate in a precise circular motion that places the spray pattern within approximately a ± 0 . 050 inch ( 1 . 27 mm ) radial band around the centerline of the score line 12 . this precise motion allows the circular band to fully cover the score line 12 even though the band width is substantially smaller than the commonly used atomized fan pattern as is shown in fig2 . solid stream or non - atomization spraying is typically applied by dispensing the fluid through a nozzle 24 at a low pressure using conventional compressed gas sources which are typically less than 100 psi ( 0 . 690 mpa ) whereas high pressure methods used in the droplet or atomization process generally use high pressure circulating fluid circuits at a pressure of between 100 psi ( 0 . 690 mpa ) to 600 psi ( 4 . 137 mpa ) or using a secondary low pressure air source of around 100 psi ( 0 . 690 mpa ) with specialized pumps for the two part epoxy mixtures predominantly used as fluid in score repair . the low pressure solid stream spraying method uses less complicated fluid delivery systems . for example , the present invention uses the pressure pot system of fig1 that minimizes the number of components wetted by the two part epoxy coatings . the low pressure requirement for the solid stream spray head 16 greatly simplifies the fluid delivery method of the present invention . this is particularly important to machine efficiency because the two part epoxy coating mixtures used are difficult to manage because they usually have a finite pot life and the apparatus requires routine maintenance . the low pressure method of the present invention limits the number of wetted components in the apparatus . see fig1 . while specific embodiments of the invention have been described in detail , it will be appreciated by those skilled in the art that various modifications and alternatives to those details could be developed in light of the overall teachings of the disclosure . accordingly , the particular arrangements disclosed are meant to be illustrative only and not limiting as to the scope of the invention which is to be given the full breadth of the claims appended hereto and any and all equivalents thereto . | 1 |
fig1 shows a model rocket 10 supported in a fin assembly system 12 constructed according to this invention . the assembly system includes a base member 14 with a central aperture 16 , a set of fin guide plates 18 mounted on the base 14 , and a set of assembly clips 20 . the model rocket 10 , which is of typical well known construction , has a tubular , generally cylindrical , thin - walled body 22 , a set of fins 24 , a nose cone 26 , and an engine mount tube 28 secured in the lower end of the rocket opposite the nose cone 26 . casings 30 and 32 for a rocket engine are slidably engaged in the mount tube 28 . the inner casing 30 is preferably a standard &# 34 ; mini &# 34 ; engine casing with an outside diameter of 0 . 500 inch . the outer casing 32 , as shown , is the next larger standard engine casing having an outside diameter of 0 . 690 inch . the mini engine casing 30 telescopically nests within the casing 32 . the relationship between the casings , the rocket body and the base 14 are more clearly shown in fig3 . with reference to fig1 - 4 , the base 14 has a substantially flat , horizontally extending upper surface 14a interrupted by the central aperture 16 and sets of opposed pairs of open brackets 34 , 34 with the brackets in each set aligned to define path or guideway 36 that has a generally radial orientation with respect to the aperture 16 . as shown , there are six guideways 36 , each defined by three radially spaced pairs of brackets 34 , 34 . four of the guideways are angularly spaced from one another by ninety degrees to accommodate the assembly of four fins 24 and three of the guideways 36 are angularly spaced by one hundred twenty degrees to accommodate the assembly of three fins . it is economical to form the base 14 and the brackets 34 , 34 integrally from a molded plastic such as a fifty percent glass filled medium impact styrene . the guide plates 18 and the clips 20 can also be formed of the same material . the base 14 also has a generally shell - like construction to minimize material costs and weight while allowing the aperture 16 to have cylindrical walls that extend vertically for a sufficient distance to support the rocket reliably . a skirt 14b and radially extending webs 14c strengthen and stabilize the base . screw mounting bosses 14d located in the webs 14c near the skirt 14b allow the base 14 to be attached conveniently to a workbench . with particular reference to fig1 and 4 - 8 , each guide plate 18 is generally a sheet - like member with a generally square configuration and with substantially parallel side faces designated in the drawings as &# 34 ; 1 / 8 &# 34 ; and &# 34 ; 3 / 32 &# 34 ;. each plate 18 has a t - shaped flange 38 that extends along its lower edge and structured to engage the brackets 34 , 34 ( fig4 ) when the plate is slid into and along a guideway 36 . the flange 38 and the brackets 34 , 34 thus provide a mechanical connection for replaceably securing the plates 18 on the base 14 in a selected guideway . this mounting arrangement holds the plates substantially perpendicular to the upper surface 14a and aligned with respect to the aperture 16 is a generally radial array . in operation , the casing 30 is seated in the aperture 16 . one or more &# 34 ; outer &# 34 ; engine casings such as the casing 32 may then be inserted over the casing 30 , depending on the size of the engine mount tube and / or the rocket body itself . for &# 34 ; mini - size &# 34 ; rockets , the rocket body 22 is inserted directly over the standard &# 34 ; mini &# 34 ; engine casing 30 . for intermediate size rockets , the engine casing 30 is fitted over the mini engine casing , usually in telescoping fashion as shown . the rocket body 22 with its engine mount tube is then fitted over the casing 32 . for standard &# 34 ; d &# 34 ; size engines with an outside diameter of 0 . 945 inch , a further engine casing surrounds the casing 30 and 32 . rocket bodies with very large outside diameters , e . g . in excess of three inches , are mounted to the engine casings in a well known manner using spacers that span the annular space between the rocket body and the engine mount tube . it should be noted that the rocket body 22 is shown in fig1 and 3 as spaced from the upper surface 14a . this allows the fins to extend below the body as shown . however , for other common rocket configurations the rocket body can also rest directly on the surface 14a . a significant advantage of this invention is that the aperture 16 , sized to receive a standard engine casing , ( 1 ) automatically aligns the verical centerline of the rocket with the center of the fin assembly system , ( 2 ) supports the rocket body , and ( 3 ) maintains the correct orientation and alignment of the rocket body without the application of forces to the body which might cause it to deform . another significant advantage of this mounting and alignment system is that it readily accommodates all common sizes of rocket engines and rocket bodies , including bodies having outside diameters ranging from 0 . 541 inch to 3 . 938 inches . the guide plates 18 are mounted by inserting the flanges 38 in the guideways 36 with a radial sliding movement . another significant feature of this invention is that the plates 18 are spaced from the rocket body . this feature avoids deformation of the body , provides a clear view of , and access to , the fin - to - body joint , and accommodates differing body sizes . also , a person using this assembly system can adjust the radial position of the plates 18 with respect to an associated fin 24 to provide the optimal level of support ( usually at a point near the center of the face of the fin ). the fins are assembled by placing each fin against one guide plate with their edge adjacent the rocket body , which typically carries a bead of an adhesive , in contact with the rocket body . the adhesive bead spreads to form , when it sets , a seal 40 that secures the fin to the body . while the adhesive sets , one of the clips 20 ( fig1 and 9 ) is applied over each plate and the associated fin to secure the fin in the proper alignment established by the guide plate . as is best seen in fig2 the guide plate is laterally offset from a radial plane passing through the centerline of the rocket and the aperture 16 . the amount of this offset allows the fin 26 itself to be aligned accurately with the centerline of the rocket . to assure that the fin is placed against the correct face of the plate 18 , the base preferably includes indicia 42 shown in fig2 . another significant feature of this invention is that the offset of the flange 38 with respect to the plate 18 changes the lateral offset of the face of the plate that abuts the fin . more specifically , as is best seen in fig4 if the plate 18 is inserted with the &# 34 ; 3 / 32 &# 34 ; face adjacent the fin 24 , a fin having a thickness of 3 / 32 inch is automatically aligned with the rocket body . on the other hand , if the plate is reversed and the &# 34 ; 1 / 8 &# 34 ; face is adjacent the fin 24 , a fin having a thickness of 1 / 8 inch is radially aligned with the rocket body ( phantom position in fig4 ). because the guide plates 18 are spaced from the rocket body 22 , the adhesive seal 40 is readily inspected for gaps or an excess of adhesive . if there is an excess , the assembly system 12 does not interfere with removal of the excess . when the adhesive has set , the clips 20 , guide plates 18 and the rocket , with the fins secured in proper alignment to the rocket body , are readily removed from the base 14 . while the invention has been described in its preferred form , it will be understood that modifications and variations will occur to those skilled in the art from the foregoing detailed description of the accompanying drawings . one variation is in the system for aligning and supporting the rocket body on the base . rather than the aperture 16 , it is possible to utilize a projection that is centered on the base and extends upwardly into the engine casing . the projection would typically be cylindrical and firmly engage the casing . this system is not useful where the engine , including a propellant and nozzle , is mounted in the rocket body rather than simply the engine casing . another variation is that while the engine casing 30 has been described as lodged in the aperture 16 , it is possible to insert a rocket body directly in to an aperture . this arrangement , however , is impractical for most purposes since the assembly system can then be used for only one size of rocket body . other arrangement for replaceably securing the guide plates on the base will also occur to those skilled in the art . for example , a rail - like structure can be formed on the base to define the guideways 36 and a mating , open bottomed passage analogous to the brackets 34 , 34 can be formed on the lower edge of each guide plate 18 . still other variations can include guide plates with varying geometries ( besides generally square ), arrangements other than the clips 20 to secure the fins in position against the guide plates , and materials for forming all of these component parts besides plastic . these and other modifications and variations that will readily occur to those skilled in the art are intended to fall within the scope of the appended claims . | 1 |
in the following description , numerous details are set forth to provide an understanding of the present disclosure . however , it may be understood by those skilled in the art that the methods of the present disclosure may be practiced without these details and that numerous variations or modifications from the described embodiments may be possible . at the outset , it should be noted that in the development of any such actual embodiment , numerous implementation - specific decisions must be made to achieve the developer &# 39 ; s specific goals , such as compliance with system related and business related constraints , which will vary from one implementation to another . moreover , it will be appreciated that such a development effort might be complex and time consuming but would nevertheless be a routine undertaking for those of ordinary skill in the art having the benefit of this disclosure . the description and examples are presented solely for the purpose of illustrating the preferred embodiments should not be construed as a limitation to the scope and applicability of the disclosed embodiments . while the compositions of the present disclosure are described herein as comprising certain materials , it should be understood that the composition could optionally comprise two or more chemically different materials . in addition , the composition can also comprise some components other than the ones already cited . embodiments relate to compositions and methods for cleaning surfaces coated with a naf . such surfaces include a borehole in a subterranean well whose surfaces are coated with a naf . in an aspect , embodiments relate to compositions . the compositions comprise water , an inorganic cement , one or more surfactants and hydrophobic solids . the water may be fresh water , produced water , connate water , sea water or brines . the inorganic cement may comprise portland cement , calcium aluminate cement , lime / silica blends , fly ash , blast furnace slag , zeolites , cement kiln dust , geopolymers or chemically bonded phosphate ceramics or combinations thereof . the cement slurry may further comprise additives comprising accelerators , retarders , extenders , weighting agents , fluid - loss additives , dispersants , nitrogen , air , gas generating agents , antifoam agents or lost circulation agents or combinations thereof . in a further aspect , embodiments relate to methods for cleaning a wellbore in a subterranean well whose surfaces are coated with a naf . in this application , the surfaces in the wellbore include both the casing surfaces and the formation rock surfaces . an aqueous treatment fluid is provided that comprises water , one or more surfactants and hydrophobic solids . the treatment fluid is circulated in the wellbore , then removed from the wellbore . the surfaces may comprise the borehole wall , tubular body surfaces or both . the circulation of the treatment fluid may remove the naf , filter cake or both from the tubular body and borehole - wall surfaces , and could also leave them water wet . the tubular body may be drill pipe , casing or tubing or combinations thereof . a naf has been employed as a drilling fluid . in yet a further aspect , embodiments relate to methods for cementing a subterreanean well having a wellbore that has been drilled with a naf . a casing string is placed inside the wellbore , thereby forming an annulus between an outer surface of the casing string and a wellbore wall . an aqueous treatment fluid is provided that comprises water , one or more surfactants and hydrophobic solids . the treatment fluid is pumped into and through an interior of the casing string , wherein the treatment fluid is not preceded by a bottom plug . the treatment fluid is then removed from the interior of the casing string . a cement slurry is then provided and placed in the annulus between the outer surface of the casing string and the wellbore wall . the aqueous treatment fluid volume may be at least one casing volume . or , the volume may also be adjusted such that the contact time ( i . e ., the period of time that a point in the casing or wellbore is exposed to the treatment fluid ) is at least 15 minutes . the surfaces may comprise the borehole wall , tubular body surfaces or both . the circulation of the treatment fluid may remove the naf , filter cake or both from the tubular body and borehole - wall surfaces , and may render leaving them water wet . the tubular body may be drill pipe , casing or tubing or combinations thereof . the cement slurry may comprise portland cement , calcium aluminate cement , lime / silica mixtures , fly ash , blast furnace slag , zeolites , geopolymers or chemically bonded phosphate ceramics or combinations thereof . the cement slurry may further comprise additives comprising accelerators , retarders , extenders , weighting agents , fluid - loss additives , dispersants , nitrogen , air , gas generating agents , antifoam agents or lost circulation agents or combinations thereof . the hydrophobic solids may comprise polyester fibers , polyalkene fibers , acrylic fibers , amide fibers , imide fibers , carbonate fibers , diene fibers , ester fibers , ether fibers , fluorocarbon fibers , olefin fibers , styrene fibers , vinyl acetal fibers , vinyl chloride fibers , vinylidene chloride fibers , vinyl ester fibers , vinyl ether fibers , vinyl ketone fibers , vinylpyridine fibers , vinylpyrrolidone fibers or polyamide fibers or combinations thereof . the polyester fibers may be derived from polylactic acid . the polyester fibers may comprise polyglycolide or polyglycolic acid ( pga ), polylactic acid ( pla ), polycaprolactone ( pcl ), polyhydroxyalkanoate ( pha ), polyhydroxybutyrate ( phb ), polyethylene adipate ( pea ), polybutylene succinate ( pbs ), poly ( 3 - hydroxybutyrate - co - 3 - hydroxyvalerate ) ( phbv ), polyethylene terephthalate ( pet ), polybutylene terephthalate ( pbt ), polytrimethylene terephthalate ( ptt ) or polyethylene naphthalate ( pen ) or combinations thereof . the polyester fibers may comprise short cut pla staple , available from fiber innovation technology , johnson city , tenn ., usa . the polyamide fibers may comprise nylon - 6 , nylon - 11 , nylon - 12 , nylon - 6 , 6 , nylon - 4 , 10 , nylon - 5 , 10 , pa6 / 66 dupont zytel [ 21 ]), pa6 / 6t basf ultramid t [ 22 ]), pa6i / 6t dupont selar pa [ 23 ], pa66 / 6t dupont zytel htn or pa4t dsm four tii or combinations thereof . the fibers may have a diameter larger than 1 micron but smaller than 50 microns , or smaller than 40 microns , or smaller than 30 microns . specifically , the fibers may have a diameter between 1 micron and 50 microns , or 5 microns and 30 microns or 10 microns and 15 microns . the fibers may have a length longer than 1 mm but shorter than 30 mm , or 20 mm , or 10 mm . specifically , the fibers may have a length between 2 mm and 20 mm , or 4 mm and 12 mm or 6 mm and 8 mm . the fibers may be present at a concentration between 0 . 6 kg / m 3 and 14 kg / m 3 , or 1 . 2 kg / m 3 and 10 kg / m 3 or 2 kg / m 3 and 8 kg / m 3 . for some aspects , the fibers may be crimped . for this disclosure , crimps are defined as undulations , waves or a succession of bends , curls and waves in a fiber strand . the crimps may occur naturally , mechanically or chemically . crimp has many characteristics , among which are its amplitude , frequency , index and type . for this disclosure , crimp is characterized by a change in the directional rotation of a line tangent to the fiber as the point of tangent progresses along the fiber . two changes in rotation constitute one unit of crimp . crimp frequency is the number of crimps or waves per unit length of extended or straightened fiber . another parameter is the crimping ratio , k1 ( eq . 1 ). where lk is the length of the crimped fiber in the relaxed , released state ; and lv is the length of the same fiber in the stretched state ( i . e ., the fiber is practically rectilinear without any bends ). for this disclosure , the fibers may have a crimp frequency between 1 / cm and 6 / cm , or 1 / cm and 5 / cm or 1 / cm and 4 / cm . the k1 value may be between 2 and 15 , or between 2 and 10 or between 2 and 6 . the surfactants may comprise anionic surfactants , cationic surfactants , nonionic surfactants or zwitterionic surfactants or combinations thereof . the anionic surfactants may comprise sulfates , sulfonates , phosphates or carboxylates or combinations thereof . the anionic surfactants may comprise ammonium lauryl sulfate , sodium lauryl sulfate , sodium laureth sulfate , sodium myreth sulfate , dioctyl sodium sulfosuccinate , perfluorooctane sulfoantes , perfluorobutanesulfonates , alkylbenzene sulfonates , alkyl - aryl ether phosphates , alkyl ether phosphates , alkyl carboxylates , sarcosinates , perfluorononanoates , or perfluorooctanoates or combinations thereof . the cationic surfactants may comprise primary , secondary or tertiary amines , or quaternary ammonium salts or combinations thereof . the nonionic surfactants may comprise long chain alcohols , ethoxylated alcohols , polyoxyethylene glycol alkyl ethers , polyoxypropylene glycol alkyl ethers , glucoside alkyl ethers , polyoxyethylene glycol octylphenol ethers , polyoxyethylene glycol alklyphenol ethers , glycerol alkyl esters , polyoxyethylene glycol sorbitan alkyl esters , sorbitan alkyl esters , cocamide dea , cocamide mea , dodecyldimethylamine oxide , block copolymers of polyethylene glycol or polypropylene glycol , or polyethoxylated tallow amine or combinations thereof . the zwitterionic surfactants may comprise sultaines or betaines or combinations thereof . the surfactants may be present at a concentration between about 0 . 1 vol % and 50 vol %, or between 0 . 5 vol % and 30 vol %, or between 1 vol % and 10 vol %. the aqueous fluid may comprise a drilling fluid , a spacer fluid , a sacrificial spacer fluid , a chemical wash or a cement slurry or a combination thereof . if the aqueous treatment fluid is a drilling fluid , it may be the drilling fluid that was used to drill the wellbore , or a second drilling fluid with different chemical or physical properties . one non - limiting example of the method is illustrated in fig2 . casing 101 is present in the wellbore , and a non - aqueous coating 104 is deposited on its surface . on the other side of the annular space , a non - aqueous coating 104 also is attached to the formation wall 102 . the treatment fluid comprising surfactants and hydrophobic fibers 105 is flowing upward 103 in the annular space . the hydrophobic nature of the fibers and the presence of the surfactants cause the non - aqueous coating to be removed from the casing and formation surfaces as the treatment fluid travels up the annulus . the following examples serve to further illustrate the subject matter of the present application . the following test method was employed in each of the following examples . a rotor test was conducted to evaluate the ability of treatment - fluid compositions to remove naf from casing surfaces . the test equipment was a chan 35 ™ rotational rheometer , available from chandler engineering , tulsa , okla ., usa . the rheometer was equipped with two cups — one with an 85 - mm diameter for tests conducted at 25 ° c . and 55 ° c ., and one with a 50 - mm diameter for tests conducted at 85 ° c . a closed rotor , 73 . 30 mm long and 40 . 70 mm in diameter , was employed to simulate the casing surface and provide an evaluation of test repeatability . both rotors had a sand blasted stainless - steel surfaces with an average roughness of 1 . 4 μm . the naf was an 80 / 20 oil / water emulsion obtained from a field location . the naf density was 1420 kg / m 3 ( 11 . 8 lbm / gal ). the surfactant was ezeflo ™ surfactant , a blend of ethoxylated alcohols available from schlumberger , houston , tex ., usa . the fiber was short cut pla staple , available from fiber innovation technology , johnson city , tenn ., usa . the naf was sheared at 6000 rpm in a silverson mixer for 30 minutes . the naf was then transferred to one of the chan 35 ™ rheometer cups . a test rotor was weighted ( w 0 ) and then lowered into the naf to a depth of 50 mm . the rotor was then rotated within the naf for one minute at 100 rpm and then left to soak in the naf for 10 minutes . next , the rotor was removed from the naf and left to drain for two minutes . the bottom of the rotor was wiped clean and then weighed ( w 1 ). the rotor was then remounted on the rheometer and immersed in a cup containing the treatment fluid such that the naf layer was just covered by the treatment fluid . the rotor was rotated for 10 minutes at 60 rpm . the rotor was then removed from the treatment fluid and left to drain for two minutes . the bottom of the rotor was wiped clean and weighed ( w 2 ). the naf removal efficiency r was then determined by eq . 2 . the tests were repeated at least twice , and the results were averaged to obtain a final result . it is desirable to achieve an r value higher than 75 %. experiments were performed to evaluate the effect of fiber diameter on cleaning efficiency . the ezeflo ™ surfactant was present at a concentration of 23 . 8 vol % ( 1 gal / bbl ). the fiber length was 6 mm , and the fiber concentration in the treatment fluid was 3 . 6 kg / m 3 ( 1 . 25 lbm / bbl ). the results are presented in table 1 . fibers with diameters between 5 microns and 30 microns showed better cleaning efficiencies . experiments were performed to evaluate the fiber geometry ( i . e ., straight or crimped ) on cleaning efficiency . the ezeflo ™ surfactant was present at a concentration of 23 . 8 vol % ( 1 gal / bbl ). the fiber length was 6 mm , and the fiber concentration in the treatment fluid was 3 . 6 kg / m 3 ( 1 . 25 lbm / bbl ). the results are presented in table 2 . experiments were performed to determine the effect of fiber concentration on cleaning efficiency . the ezeflo ™ surfactant was present at a concentration of 23 . 8 vol % ( 1 gal / bbl ). the results are presented in table 3 . fibers at concentrations above 3 kg / m 3 showed better cleaning efficiencies . the upper limit of the fiber concentration can be adjusted according to the fluid design , but in general less than 10 kg / m 3 . although only a few example embodiments have been described in detail above , those skilled in the art will readily appreciate that many modifications are possible in the example embodiments without materially departing from this invention . accordingly , all such modifications are intended to be included within the scope of this disclosure as defined in the following claims . | 2 |
when mounting a probe card onto an ate system , electrical contact must be made between the probe card and the electronics of the tester . if the dut interface of the ate system uses zif connectors , an appropriate mating surface must be created on the probe card . fig2 illustrates a probe card 180 with printed circuit boards 130 mounted with a right angle connector 120 to attach a paddle board 130 to the probe card 180 . the paddle board 130 may be mated with zif connectors 140 through interposer electrical contacts 150 . the zif connectors may be electrically connected to the ate system ( not shown ) at 160 . probe tip needles 110 may contact the device under test on the probe card 180 . the right angle connectors 120 may be any industry standard right angle connector , such as teredyne &# 39 ; s vhdm daughter board connector system or 3m &# 39 ; s standard 2 mm hard metric right angle connector system . many types of dielectric materials may be used to fabricate the printed circuit board of paddle board 130 , including nelco 4000 - 13 si , rogers 4000 series and other high speed materials . the length and width of the paddle board 130 may be chosen by the designer to optimize mechanical dimensional space constraints and pin count requirements . currently , printed circuit boards may be routed with line widths up to 20 mils . this minimizes the high frequency series resistance of the transmission line . this is an improvement over flex circuits , where the maximum trace width with a 50 ohm characteristic impedance is 10 mils . however , many fabrication houses can only process 5 mil wide lines on flex circuits . the paddle board will have enough rows of contacts to support very high pin count applications . the layer count limitation of a common printed circuit board today is 60 layers , which is a 10 × improvement in the number of layers to route signals over flex circuits , which are currently limited to 6 layers . the paddle board may have active or passive circuitry contained thereon . for example , the paddle board may have circuitry that enables fanout of the address lines of memory devices , such as mcp , nand , nor or dram . further , the paddle board may include circuitry for fanout of power supply and sense lines . alternatively , the paddle board may include circuitry for fanout of i / o lines of memory devices , such as mcp , nand , nor or dram . fig3 shows a flow chart for a method of testing a device using a paddle board probe card mated with an ate tester with a zif connector 300 . as shown in fig3 , a paddle board probe card 190 is provided 310 . a device under test may be mounted 320 onto the paddle board probe card 190 . the paddle board probe card 190 is mated 330 to zif connectors 140 on an ate testhead ( not shown ). the device under test is then tested 340 . fig4 illustrates a flow chart for a method of fabricating a paddle board probe card 400 , in which a probe card is provided 410 and at least one printed circuit board 130 is mounted 420 at right angles with the probe card 180 to form a paddle board probe card 190 for mating with zif connectors 140 on an ate testhead ( not shown ). while the invention has been particularly shown and described with reference to specific embodiments thereof , it will be understood by those skilled in the art that changes in the form and details of the disclosed embodiments may be made without departing from the spirit or scope of the invention . for example , some of the descriptions of embodiments herein imply a certain orientation of various assemblies of which the system is constructed or a certain order of fabricating or mounting the assemblies . it will be understood , however , that the principles of the present invention may be employed in systems having a variety of spatial orientations or orders of fabrication or mounting and that therefore the invention should not be limited to the specific orientations or orders of fabrication or mounting shown . | 6 |
the invention , in its simplest form , is illustrated in fig1 for use in mapping the pressure in a plane behind an airplane a in a wind tunnel w . the wind tunnel w is basically a tubular conduit having a stream of air flowing therethrough . the object under test , such as the airplane a , is placed in a wind stream from the tunnel w to similate actual flight of the airplane a . the mapping system includes a conventional pressure sensor 12 mounted at the end of an elongated probe 14 . a conventional light 16 is also mounted at the end of the probe 14 . the lamp 16 faces away from the airplane a so that it is clearly visible behind the airplane a . a power supply 18 supplies electrical power of appropriate voltage to the light 16 and sensor 12 . a variety of signal - processing circuits may receive the output of the sensor 12 in order to drive the light 16 . in its simplest form , however , the pressure sensor 12 has a resistance which varies in proportion to the measured pressure . the sensor 12 and light 16 may then be positioned in series with the power supply 18 so that the intensity of the illumination from the lamp 16 is directly proportional to the pressure at the sensor 12 . a map of the pressure in a plane perpendicular to the wind axis is made in accordance with fig1 by systematically scanning the sensor 12 behind the airplane a . a conventional camera 20 , having a shutter open during the entire scanning process , records the illumination from the lamp 16 during the scanning process . the intensity of the image on the film in the camera 20 at each point in the image is thus proportional to the pressure at that point . this , of course , assumes that the sensor 12 has been scanning at a constant velocity since the intensity of the image on the film is also proportional to the duration of the exposure at each point on the film . scanning at a constant velocity is not often easy so that characteristics of the illumination from the lamp 16 other than illumination intensity are more advantageously used . one illumination chracteristic of a lamp 16 which does not vary with the scanning speed is color . as illustrated in fig2 the output of the sensor 12 is applied to a conventional amplifier 22 which increases the voltage of the signal from the sensor 12 and provides a low - impedance output which is applied to a conventional voltage - level detector 24 . the voltage - level detector 24 has four outputs to which a signal is sequentially applied as the amplitude of the input to the detector 24 increases . the four outputs are applied to respective conventional light - driver circuits 26 , each of which supplies power to respective lamps 16a , b , c , d of differing color . thus , relatively low pressures may illuminate one lamp of a first color ( blue , for example ). as the pressure measured by the sensor 12 continues to increase , the lamps 16b , c , d having other colors ( green , yellow , red , respectively ) are then sequentially illuminated . this system thus causes the color indicative of the physical variable to vary in discrete stages , each corresponding to a discrete range of pressure measured by the sensor 12 . the system could , of course , be operated in a more linear manner by gradually shifting from one voltage - level detector output 24 to the next so that more than one lamp is illuminated as the pressure changes from one pressure range to another . although the embodiment of fig1 utilizes a lamp 16 which is mounted with the sensor 12 at the end of the probe 14 , it will be understood that the light 16 may be mounted anywhere , as long as it moves in synchronism with the movement of the sensor 12 . in the embodiment of fig2 the lamps 16a - d are mounted on a support 30 which is connected to the probe 14 by a mechanical linkage . the linkage , in its simplest form ( illustrated in fig2 a ), is merely an extension 30 of the probe 14 which has an elongated slot 32 formed therein . a stationary pin 34 projects through the slot . consequently , upward movement of the senaor 12 produces a corresponding downward movement of the lamps 16a - d . movement of the sensor 12 to the right causes a corresponding movement of the lamps 16a - d to the right . it will now be apparent that the movement of the lamps 16a - d need not be equal to or even a linear function of the movement of the sensor 12 . instead , the movements may be the inverse of each other , as illustrated in fig2 ( upward movement of the sensor 12 producing downward movement of the lamps 16a - d ), or a transposition may occur in which , for example , movement of the sensor 12 along components of a circular coordinate system produces movement of the lamps 16a , b along respective components of a cartesian coordinate system . the embodiment illustrated in fig2 is used in the same manner as the embodiment of fig1 . the probe 14 and probe extension 30 systematically cause the sensor 12 to scan in a plane behind the object under test . it will be understood , however , that it is unnecessary to precisely control the scanning pattern since the accuracy of the resulting map is not affected by the scanning pattern . however , the scanning pattern does affect the resolution of the resulting map , and the scanning pattern can be adjusted to vary the resolution from area to area of the map . areas of the measurement plane in which greater variations of the physical variable are occurring can be scanned with a finer pattern . the system &# 39 ; s ability to generate the map in real time thus allows real time adjustments of the scanning pattern to minimize the measurement time without sacrificing resolution where fine resolution is needed . although the inventive mapping system is illustrated in fig1 and 2 for use in mapping the pressure behind an airplane a in a wind tunnel w , it will be understood that the technique is equally applicable to mapping any physical variable . for example , as illustrated in fig3 the system may be used to map the temperature of a fluid f in a tank t in a transverse vertical plane . the system includes a conventional temperature sensor 40 mounted on the bottom end of an elongated vertical probe 42 extending downwardly from a conventional traversing mechanism 44 . as is well known in the art , the traversing mechanism 44 produces vertical and horizontal position signals on lines 46 , 48 , respectively , which are proportional to the vertical and horizontal position of the sensor 40 . the vertical and horizontal position signals on lines 46 , 48 are applied to the respective x and y terminals of a conventional x - y plotter 50 . signal lamps 16a , b , c , d are mounted on a movable pen support 52 which , as well known in the art , moves in x and y directions in proportion to the amplitude of the signals applied to its x and y inputs . the lamps 16a - d are driven by the same amplifier 22 , voltage - level detector 24 , and light drivers 26 of fig2 so that the color of the illumination from the lamps 16a - d is indicative of the range of temperature measured by the sensor 40 . the camera 20 thus produces images on film which have a color at each location on the film corresponding to the temperature of the fluid f at a corresponding position in the transverse , vertical measurement plane . although a conventional camera 20 operating in a time - exposure mode is illustrated herein as being the illumination recording device , it will be understood that other conventional devices may also be used for making a record of a characteristic of the illumination from the lamp 16 as a function of the position of the lamp . in fact , the recording device may be a conventional stereographic camera for recording a map of the physical variable in three dimensions , although only two - dimensional maps are illustrated herein . similarly , although only three devices are shown for moving the lamp 16 in accordance with the movement of the sensor 12 , it will be understood that any system for synchronizing the movement of the lamp 16 to the movement of the sensor 12 may be used . | 1 |
the present invention is directed to a web - based system and method for facilitating off - loading of design requirements to a supplier . the specific construction of the web - based system and the industry in which the system is implemented may vary . it is to be understood that the disclosure below provides a number of embodiments or examples for implementing different features of various embodiments . specific examples of components and arrangements are described to simplify the present disclosure . these are merely examples and are not intended to be limiting . by way of example , the disclosure below describes a web - based system and method implemented by the boeing corporation for off - loading of design requirements for airplane parts in compliance with faa regulations . the following is a list of acronyms used in the detailed description below : referring to fig1 , a block diagram of a web - based enterprise software system 100 is shown . the web - based system 100 is suitable for implementing design requirements off - loading processes in accordance with disclosed embodiments . the web - based system 100 communicates via a corporate intranet 102 with engineering designers 104 , procurement agents 106 , and other employees 108 of the enterprise . the corporate intranet 102 communicates through a firewall 110 with access security to the internet 112 . the corporate intranet 102 may comprise a web - based protocol , such as soap , to support exchange of structured information on the corporate intranet 102 . soap may use xml for its message format . specifications for soap architecture and specifications for xml are known and , therefore , will not be described . the corporate intranet 102 and the internet 112 supports communication between internal resources ( i . e ., the web - based system 100 , the engineering designers 104 , the procurement agents 106 , and the other employees 108 of the enterprise , for examples ) and external resources including top - tier suppliers 114 , sub - tier suppliers 116 , and others 118 . the top - tier suppliers 114 and the sub - tier suppliers 116 may comprise contracted suppliers , and the others 118 may comprise third - party partners , internal partners , or mobile employees of the enterprise , for examples . in accordance with an embodiment , the web - based system 100 comprises a host server 130 which communicates via the corporate intranet 102 with the engineering designers 104 , the procurement agents 106 , and the other employees 108 , and via the corporate intranet 102 and the internet 112 with the top - tier suppliers 114 , the sub - tier suppliers 116 , and the others 118 external to the enterprise . the host server 130 is a web - based server which communicates with a database 200 which may comprise an xml database . the host server 130 accesses and stores srx data in the database 200 . the srx database 200 and the srx data stored therein will be described in detail later . the host server 130 includes an electronic processor which is configured to execute a srx application 150 to facilitate a design requirements off - loading process in accordance with an embodiment as will be described below . more specifically , the electronic processor of the host processor 130 executes the srx application 150 to access and store srx data in the srx database 200 as needed to support web operation and user interfaces ( e . g ., the web - based user interfaces of the engineering designers 104 , the procurement agents 106 , and the suppliers 114 , 116 ) used in the design requirements off - loading process . the electronic processor of the host server 130 may also execute the srx application 150 to support interfaces to other data systems which are connected to the corporate intranet 102 . for examples , as shown in fig1 , the srx application 150 may support any combination of interfaces to a csdt data system , a redars data system , a pdm data system , an enovia data system , a slate data system , and a doors data system . it is conceivable that the srx application may support any combination of other interfaces to other data systems . the srx application 150 supports interfaces to other data systems to enable the srx application 150 to natively use the data from these other data systems . referring to fig2 , the srx database 200 comprises a web - enabled relational database which supports gated workflow technology . as shown in the example embodiment of fig2 , there are eight ( 8 ) gated workflow processes designated as gate 1 ( g 1 ), gate 2 ( g 2 ), gate 3 ( g 3 ), gate 4 ( g 4 ), gate 5 ( g 5 ), gate 6 ( g 6 ), gate 7 ( g 7 ), and gate 8 ( g 8 ). each gate may have input data from or output data to other data systems . any input data or output data which may be associated with a gate is shown above that particular gate in fig2 . each gate also has a number of schedule items of the design requirements off - loading process associated with that particular gate . the schedule items of the design requirements off - loading process associated with a gate is shown below that particular gate in fig2 . moreover , each gate has a number of reports ( i . e ., design requirements metrics and measures ) associated with that particular gate . the reports associated with a gate are shown below the schedule items associated with that particular gate . workflow process steps contained in each of gates g 1 , g 2 , g 3 , g 4 , g 5 , g 6 , g 7 , and g 8 are shown in fig3 - 10 , respectively . in fig3 for gate g 1 , a vertical array of rectangular blocks is shown along the left side of fig1 . the vertical array of rectangular blocks shown in fig1 indicates the initiators of the srx process . these initiators are from outside of the srx system 100 . in each of fig4 - 10 for gates g 2 , g 3 , g 4 , g 5 , g 6 , g 7 , and g 8 , respectively , a vertical array of trapezoidal blocks is shown along the left side of the corresponding figure . the vertical array of trapezoidal blocks shown in each of fig4 - 10 indicates data entities which have been created in workflow processes of a previous gate and are available for processing in the workflow processes of the current gate . referring to gated workflow process 300 shown in fig3 , gate g 1 is directed to package startup , create , configure and load package requirements . initial srx activities accomplished by gate g 1 allow use of the tool to manage package startup , create , configure and load package requirements . this step is the foundation of the requirements packaging which feeds all of the supporting steps in srx . referring to gated workflow process 400 shown in fig4 , gate g 2 is directed to package integration , validation and qualification planning . this activity sets the bar for industry standards for requirements package integration , validation and qualification planning . these elements of the package create a traceable set of qualitative data for the package requirements which enable the users and tool to elevate the requirements maturity . referring to gated workflow process 500 shown in fig5 , gate g 3 is directed to package administration , sdrl and external data release authority . the elements in gate g 3 support verification of the requirements package which leads to supplier submittal of contract data deliverables . these deliverables are the key to product design compliance to the package requirements . referring to gated workflow process 600 shown in fig6 , gate g 4 is directed to stakeholder and approver package review . gate g 4 takes advantage of the relational aspects of the stakeholders to the package requirements . the package owner gets a significant advantage in the auto load of the stakeholders for review and approval , eliminating gaps in requirement and product quality . referring to gated workflow process 700 shown in fig7 , gate g 5 is directed to package release . advantages excel over typical software behaviors by integrating advanced metrics and performance visibility during release promotion of the package . these qualitative measures target business risk mitigation and control advancement of the package through risk controls . referring to gated workflow process 800 shown in fig8 , gate g 6 is directed to supplier management package review and supplier distribution . industry shows gaps here where the absence of an integrated process and tool for supplier interaction with the source requirements leads to product deficiencies . the workflow process steps in gate g 6 tie the creators directly to the supplier designers consuming the requirements without loss of quality of the computer sensible native requirements objects . referring to gated workflow process 900 shown in fig9 , gate g 7 is directed to supplier review , comment and acceptance . gate g 7 is focused on supplier review , comment and acceptance of the requirements contract package . direct access to the source data is unprecedented considering an all in method avoiding any degradation through transfer or conversion of the data to human readable data requiring re - compilation effort and exposing data errors . referring to gated workflow process 1000 shown in fig1 , gate g 8 is directed to incorporate supplier feedback , engineering acceptance of final package , and supplier package deviations . direct access to the source data is unprecedented using an all in method for the receiving party avoiding any degradation through transfer or conversion of the data to human readable data requiring re - compilation effort and exposing data errors . requirement package deviations are a required record of exception for the defined requirements . these deviations are submitted by the supplier and reviewed by the package author for acceptance . deviations are critical to the contract and require visibility accordance with regulatory mandate . the historical hazard by industry method kept the deviations disconnected from the source requirements . srx overcomes the basic instinct for configuration control by carrying the requirements integration for deviations throughout the gated work flow . the workflow processes 300 , 400 , 500 , 600 , 700 , 800 , 900 , and 1000 contained in the eight gates g 1 , g 2 , g 3 , g 4 , g 5 , g 6 , g 7 , and g 8 , respectively , described hereinabove provide an srx tool which includes a number of features described hereinbelow . a first feature is that the srx tool comprises an integrated computer sensible single source process and tool which supports electronic design requirements information management utilizing object oriented technology . the implementation of this feature is provided by workflow process steps contained predominately within gate g 1 . a second feature is that the srx tool enables engineering designers to interactively exchange design requirements information with suppliers using a web exchange environment directly from the requirements source . the implementation of this feature is provided by workflow process steps contained predominately within gates g 6 and g 7 . a third feature is that the srx tool enables three - way partner business integration , including access permissions , communication , and data distribution . the implementation of this feature is provided by workflow process steps contained predominately within gate g 1 . a fourth feature is that the srx tool provides a method to utilize a gated process workflow for necessary design requirements integration . the implementation of this feature is provided by workflow process steps contained predominately within gate g 2 . a fifth feature is that the srx tool provides an electronic method for supplier input and integration during the gated workflow process supporting requirements development . the implementation of this feature is provided by workflow process steps contained predominately within gate g 8 . a sixth feature is that the srx tool provides an electronic qualitative method for ensuring development assurance regulatory compliance . the implementation of this feature is provided by workflow process steps contained predominately within gates g 2 , g 3 , and g 8 . a seventh feature is that the srx tool provides a method to electronically collect , organize , monitor , and manage metrics for the requirements package gated workflow and content . the implementation of this feature is provided by workflow process steps contained predominately within gate g 5 . an eighth feature is that the srx tool provides performance metrics within the context of the object oriented data base for specified levels of granularity . the implementation of this feature is provided by workflow process steps contained predominately within gates g 4 and g 5 . while the workflow process steps contained in each of gates g 1 - g 8 can be understood with reference to fig3 - 10 , an appreciation of advantages resulting therefrom can be gained by first describing a prior art design requirements off - loading process such as shown in fig1 , and designated with reference numeral “ 1100 ”. the known design requirements off - loading process 1100 includes workflow process step 1110 in which scd requirements are gathered , and workflow process step 1120 in which the scd is developed . the known process 1100 also includes workflow process step 1130 in which an external information release authorization is completed , workflow process step 1140 in which the engineering aa is developed , and workflow process step 1150 in which the sdrl is prepared and updated . the known process 1100 further includes workflow process step 1160 in which the supplier change notification agreement is documented , workflow process step 1170 in which scd package review and approval is completed , and workflow process step 1180 in which the scd package is validated and approved by the cma . as shown in diagram 1200 of fig1 , if the known design requirements off - loading process 1100 of fig1 were to be implemented using the gated workflow processes of g 1 - g 8 , then only gates g 1 , g 3 , g 4 , and g 5 would be needed . gates g 2 , g 6 , g 7 , and g 8 would not be needed to implement the known design requirements off - loading process 1100 of fig1 . accordingly , the use of gates g 2 , g 6 , g 7 , and g 8 fills process gaps in the known process 1100 . thus , the use of gates g 2 , g 6 , g 7 , and g 8 provides advantages of package integration ( g 2 ), package distribution ( g 6 ), supplier acceptance ( g 7 ), supplier feedback ( g 8 ), and supplier deviations ( g 8 ), all of which are absent in the known workflow process 1100 . also , while the workflow process steps contained in each of the individual gates g 1 - g 8 can be understood with reference to the respective figure of fig3 - 10 , an appreciation of advantages resulting therefrom can be gained by understanding an end - to - end workflow process which transcends gates g 1 - g 8 such as shown in fig1 and designated with reference numeral “ 1300 ”. the end - to - end workflow process 1300 shown in fig1 is divided into six functional portions labeled “ configure package ”, “ integrate package ”, “ review package ”, “ approve and distribute package ”, “ supplier package management and deviation records ”, and “ srx package completion ”. as shown in fig1 , ten highlighted functionalities of the end - to - end workflow process 1300 are indicated by encircled areas . three of the ten highlighted functionalities are designated by areas 1400 , 1420 , and 1440 in fig1 , and are shown in more detail in fig1 . the remaining seven of the ten highlighted functionalities are designated by areas 1500 , 1600 , 1700 , 1800 , 1900 , 2000 , and 2100 in fig1 , and are shown in more detail in fig1 , 16 , 17 , 18 , 19 , 20 , and 21 , respectively . referring to fig1 and 14 , the functionalities in areas 1400 , 1420 , and 1440 relate to requirement entities and relationships . more specifically , as shown in area 1400 of fig1 , requirements will be managed entities with associations to the supporting elements that make a complete requirement . also , as shown in area 1420 of fig1 , requirements will be associated to qualification method , requirement validation , and supplier requirement verification entities . further , as shown in area 1440 of fig1 , requirements that are created by tailoring an existing requirement will have an association to the original requirement and will maintain associations to supporting elements and qualification method , requirement validation , and supplier requirement verification entities . referring to fig1 and 15 , the functionalities in area 1500 relate to system control of required process steps . more specifically , as shown in area 1500 of fig1 , system controls recognize when required entities ( or elements ) are missing or incomplete and directs the user to the required process step to create / complete the required entity . referring to fig1 and 16 , the functionalities in area 1600 relate to supplier decomposition of requirements . more specifically , as shown in area 1600 of fig1 , supplier decomposed requirements are managed maintaining relationships to parent requirements and creating a path for development assurance through traceability of requirements validations , qualification methods , and verifications . referring to fig1 and 17 , the functionalities in area 1700 relate to package risk assessment . more specifically , as shown in area 1700 of fig1 , the system enables the tracking of relationship and entity completeness and status to create package risk entities identifying specific risks and mitigation plans . referring to fig1 and 18 , the functionalities in area 1800 relate to package review with stakeholders . more specifically , as shown in area 1800 of fig1 , the system will use relationships between requirements and stakeholders to identify the requirements each stakeholder will review and accept . referring to fig1 and 19 , the functionalities in area 1900 relate to package review with procurement agent . more specifically , as shown in area 1900 of fig1 , the system will generate and display metrics based on defined criteria to enable informed decisions about status and schedule . referring to fig1 and 20 , the functionalities in area 2000 relate to supplier entry into srx . more specifically , as shown in area 2000 of fig2 , srx will enable supplier entry into the system to operate directly on the package . referring to fig1 and 21 , the functionalities in area 2100 relate to supplier entry into srx . more specifically , as shown in area 2100 of fig2 , the system will enable the supplier to directly link verification items , supplier data requirements list items , deviation requests , change requests , and comments to the specific package elements needing attention . the system will also enable the package author to review and accept the specific items . the end - to - end workflow process 1300 shown in fig1 and the more detailed workflow process steps shown in fig1 - 21 support a number of features including the following : allows for collection and storage of requirements data in any electronic format . allows all supporting graphic files to remain in original file format . provides support for regulatory requirements compliance in the gated process flow . controls storage of requirements validation and verification data , along with completion metrics . includes the data necessary to monitor and measure performance during requirements packaging . eliminates data duplication and redundancy ( as a result of the single source technology ). allows for design requirements package comparisons and reuse . it should be apparent that the above - described web - based enterprise software system 100 enables the interactive exchange , management , checking , and distribution , of design requirements with suppliers . the web - based system 100 provides a new tool and methods to manage design requirements in an integrated environment while maintaining computer sensibility of design requirements . in particular , the tool and methods enable engineering designers , procurement agents , and suppliers to interactively exchange design requirements during the design requirements off - loading process . the tool and methods implement an improved standard workflow for design requirements authoring , packaging , distribution and feedback , including metrics and measures which allow performance measurements and reporting during the design requirements development cycle . the improved workflow enables development assurance including requirements validation and verification to be accomplished in accordance with applicable industry regulation , such as federal aviation administration ( faa ) regulations for example . the improved workflow also provides an electronic platform for decomposing design requirements and the ability to complete and manage analysis of decomposed design requirements . the improved workflow further enables suppliers to review and comment on design requirements that is integral to the tool and methods . the improved workflow addresses and resolves a number of problems in known workflows . in particular , the improved workflow addresses known workflow problems of how to package , schedule , communicate , control distribution , monitor performance , and maintain configuration control of the off - load of an engineering part design to a supplier . the improved workflow addresses known lack of compliance controls for industry - required development assurance validation and verification of the design requirements flow down . the improved workflow also resolves the known workflow problems of having multiple data sources by establishing a single source collaborative environment that ensures the integrity of the design requirements and data elements . the improved workflow further addresses the known open loop problem for supplier feedback by providing the capability for suppliers to interactively communicate with engineering designers and procurement agents and thereby to interactively review and comment on design requirements during the design requirements off - loading process . aspects of disclosed embodiments may be implemented in software , hardware , firmware , or a combination thereof . the various elements of the system , either individually or in combination , may be implemented as a computer program product tangibly embodied in a machine - readable storage device for execution by a processor . various steps of embodiments may be performed by a computer processor executing a program tangibly embodied on a computer - readable medium to perform functions by operating on input and generating output . the computer - readable medium may be , for example , a memory , a transportable medium such as a compact disk or a flash drive , such that a computer program embodying aspects of the disclosed embodiments can be loaded onto a computer . although the above - description describes a web - based system and method for facilitating a design requirements off - loading process for airplane parts in the aviation industry in accordance with faa regulation , it is contemplated that the web - based system and method may be implemented to facilitate a design requirements off - loading process for any type of part in any industry in accordance with the applicable industry standards . although various aspects of disclosed embodiments have been shown and described , modifications may occur to those skilled in the art upon reading the specification . the present application includes such modifications and is limited only by the scope of the claims . | 6 |
fig2 shows one exemplary embodiment of an image processing apparatus 200 incorporating dynamic skew control in accordance with this invention . as shown in fig2 an image data source 100 and an input device 120 are connected to the image processing apparatus 200 over links 110 and 122 , respectively . the image data source 100 can be a digital camera , a scanner , or a locally or remotely located computer , or any other known or later developed device that is capable of generating electronic image data . similarly , the image data source 100 can be any suitable device that stores and / or transmits electronic image data , such as a client or a server of a network . the image data source 100 can be integrated with the image processing apparatus 200 , as in a digital copier having an integrated scanner , or the image data source 100 can be connected to the image processing apparatus 200 over a connection device , such as a modem , a local area network , a wide area network , an intranet , the internet , any other distributed processing network , or any other known or later developed connection device . for example , the image data source can be the raster image processor ( rip ) of a digital copier . it should also be appreciated that , while the electronic image data can be generated at the time of printing an image from electronic image data , the electronic image data could have been generated at any time in the past . moreover , the electronic image data need not have been generated from an original physical document , but could have been created from scratch electronically . the image data source 100 is thus any known or later developed device which is capable of supplying electronic image data over the link 110 to the image processing apparatus 200 . the link 110 can thus be any known or later developed system or device for transmitting the electronic image data from the image data source 100 to the image processing apparatus 200 . the input device 120 can be any known or later developed device for providing control information from a user to the image processing apparatus 200 . thus , the input device 120 can be a control panel of the image processing apparatus 200 , or could be a control program executing on a locally or remotely located general purpose computer , or the like . as with the link 110 described above , the link 122 can be any known or later developed device for transmitting control signals and data input using the input device 120 from the input device 120 to the image processing apparatus 200 . as shown in fig2 the image processing apparatus 200 includes a controller 210 , an input / output interface 220 , a memory 230 , a dynamic skew control circuit 240 and an image output terminal 300 , each of which is interconnected by a control and / or data bus 250 . the links 110 and 122 from the image data source 100 and the input device 120 , respectively , are connected to the input / output interface 220 . the electronic image data from the image data source 100 , and any control and / or data signals from the input device 120 , are input through the input interface 220 , and , under control of the controller 210 , are stored in the memory 230 and / or provided to the controller 210 . the memory 230 preferably has at least an alterable portion and may include a fixed portion . the alterable portion of the memory 230 can be implemented using static or dynamic ram , a floppy disk and disk drive , a hard disk and disk drive , flash memory , or any other known or later developed alterable volatile or non - volatile memory device . if the memory includes a fixed portion , the fixed portion can be implemented using a rom , a prom , an eprom , and eeprom , a cd - rom and disk drive , a dvd - rom and disk drive , a writable optical disk and disk drive , or any other known or later developed fixed memory device . the dynamic skew control circuit 240 adjusts the control information for the electronic image data stored in the memory 230 for each different color image separation layer of the electronic image data based on the current value for the skew of the photoreceptor belt in the image output terminal 300 . the dynamic skew control circuit 240 then outputs the adjusted control signals for controlling the output of the electronic image data by the image output terminal 300 . it should be appreciated that the steering of the photoreceptor belt 350 can also be controlled based on the current value for the skew of the photoreceptor belt 350 . this steering control system is described on u . s . patent application ser . no . 09 / 240 , 880 , incorporated herein by reference in its entirety . furthermore , it should also be appreciated that the lateral position of the photoreceptor belt 350 can be controlled using a passive system instead of the active steering control system described in the incorporated &# 39 ; 880 application . this passive system is described in u . s . pat . no . 5 , 383 , 006 to castelli , incorporated herein by reference in its entirety . the dynamic skew control circuit 240 can also adjust the control information used to control the position of the receiving substrate to place it into proper registration with the color images based on the current value for the skew of the photoreceptor belt in the image output terminal 300 . the dynamic skew control circuit 240 then outputs the adjusted control signals for controlling the position of the receiving substrate from the memory 230 to the image output terminal 300 over the control and / or data bus 250 . while fig2 shows the dynamic skew control circuit 240 and the image output terminal 300 as portions of an integrated system , the dynamic skew control circuit 240 could be provided as a separate device from the image output terminal 300 . that is , the dynamic skew control circuit 240 may be a separate device attachable upstream of a stand alone image output terminal 300 . for example , the dynamic skew control circuit 240 and the sensors 352 and 354 may be devices which interface with both the image data source 100 and the image output terminal 300 . for example , the dynamic skew control circuit 240 may be incorporated into a network print server that forms a portion of the image data source 100 and that receives the sensor signals from the sensors 352 and 354 and controls the input of the image data to the image output terminal 300 . furthermore , the dynamic skew control circuit 240 may be implemented as software on the image processing apparatus 200 or the image data source 100 . other configurations of the elements shown in fig2 and 3 may be used without departing from the spirit and scope of this invention . fig3 shows one exemplary embodiment of the image output terminal 300 according to this invention . as shown in fig3 the image output terminal 300 includes a plurality of color imagers 310 - 340 , a photoreceptor belt 350 , a transfer station 360 , and a cleaning station 380 . each of the color imagers 310 - 340 are located along the length of the photoreceptor belt 350 from a steering end s of the photoreceptor belt 350 to a transfer end t of the photoreceptor belt 350 , respectively . in particular , each of the color imagers 310 - 340 includes a charging station 312 , 322 , 332 , and 342 , respectively , an exposure station 314 , 324 , 334 , and 344 , respectively , and a developing station 316 , 326 , 336 , and 346 , respectively . it should be appreciated that the color imagers 310 - 340 may be located on different spans of the photoreceptor belt 350 . for example , one or more of the imagers 310 - 340 may be located on a span of the photoreceptor belt 350 that extends from the transfer end t to the steering end s of the photoreceptor belt 350 . in this case , any such imager will be located on the opposite side of the image output terminal 300 than the other imagers . it should also be appreciated that while fig3 shows a photoreceptor as the imaging substrate affected by skew , the image output terminal 300 may use other imaging substrates . for example , the dynamic skew control can be applied with equal effectiveness to a non - photoreceptor intermediate belt system which builds color image separation layers on a separate photoreceptor and transfers the images to an intermediate belt before transferring the images from the intermediate belt to a final substrate . this intermediate belt system is described on u . s . pat . no . 5 , 406 , 359 to fletcher , incorporated herein by reference in its entirety . alternatively , the dynamic skew control can be applied to a transport belt system which forms the images on a separate photoreceptor and transfers the color image separation layers to a final substrate carried by a transport belt . this transfer belt system is described on u . s . pat . no . 4 , 916 , 547 to katsumata et al ., incorporated herein by reference in its entirety . in these systems the imaging stations can be considered to also include the photoreceptor on which the images are formed and from which the images are transferred . it should be appreciated that , according to the systems and methods of this invention , each image forming station is controlled to form the image based on the lateral position of the belt , so that , when the image is formed on , or transferred to , the belt , that image will be registered with the other images carried or to be carried on the belt . in each of the imagers 310 - 340 , the respective charging station 312 - 342 uniformly charges the photoreceptor belt 350 in preparation for forming a latent electrostatic image . in each of the imagers 310 - 340 , the respective exposure station 314 - 344 exposes the uniformly charged photoreceptor belt 350 to form the latent electrostatic image on the photoreceptor belt 350 . then , in each of the imagers 310 - 340 , the respective developing station 316 - 346 applies toner of a different color to develop the latent electrostatic image formed on the photoreceptor belt 350 using a differently colored toner . it should be appreciated that each of the exposure stations 314 - 344 may be implemented using any known or later developed device for forming an electrostatic latent image on the photoreceptor belt 350 . for example , the exposure stations 314 - 344 could be a rotating polygon raster output scanner ( ros ), a full width printbar containing light emitting diodes , laser diodes , organic light emitting diodes or the like . because each of the imagers 310 - 340 is located at a different position along the photoreceptor belt 350 , if the lateral position of the belt changes as a particular portion of the belt travels from the steering end s to the transfer end t and back to the steering end , an image formed by a downstream imager will not be exactly aligned with an image formed by an upstream imager , due to the lateral movement of the photoreceptor belt 350 . if the positions of the imagers are constant relative to the steering and transfer ends s and t , their positions relative to one or both of the steering and transfer ends s and t can be measured and appropriate adjustments can be made to the control signals for each of the imagers 310 - 340 . furthermore , for each portion of the photoreceptor belt 350 , if the lateral position of that portion of the photoreceptor belt 350 changes from a constant setup position as that portion of the photoreceptor belt 350 travels from the steering end s to the transfer end t , the unadjusted color image separation layers formed by each of the imagers 310 - 340 will not be exactly aligned to each other , or due to the further lateral movement of the photoreceptor belt 350 between the fourth imager 340 and the transfer station 360 , to the receiving substrate 20 at the transfer station 360 . accordingly , the image output terminal 300 further includes a steering end sensor 352 and a transfer end sensor 354 . each of the steering and transfer end sensors 352 and 354 senses the instantaneous lateral position of the photoreceptor belt 350 at the steering and transfer ends , respectively . the steering and transfer end sensors 352 and 354 output signals indicative of the instantaneous lateral position of the photoreceptor belt 350 over the control and / or data bus 250 to the dynamic skew control circuit 240 . the dynamic skew control circuit 240 inputs the signals from the sensors 352 and 354 and determines the difference in lateral position of the photoreceptor belt between the steering and transfer ends of the photoreceptor belt 350 based on the sensor signals and the previously measured and recorded edge profile of the photoreceptor belt 350 . the difference in the lateral position of the photoreceptor belt 350 at the steering and transfer ends s and t indicated by the sensor signals must be adjusted based on the characteristics of the photoreceptor belt 350 . the difference in lateral positions is adjusted by removing a predetermined variation in the edge profile for the currently - sensed portions of the photoreceptor belt 350 from the positions measured by the sensors 352 and 354 . this adjusted difference generally represents the skew in the photoreceptor belt 350 . the dynamic skew control circuit 240 then determines the amounts of lateral displacement from the belt position determined by the steering end sensor 352 at the belt positions to the various positions where the exposure stations 314 - 344 are writing the electrostatic latent images on the photoreceptor belt 350 . based on the lateral offsets at the writing positions of each of the exposure stations 314 - 344 determined by the dynamic skew control circuit 240 , the dynamic skew control circuit 240 modifies the control signals for outputting the image data by at least three of the imagers 310 - 340 so that the electrostatic latent images written by each of the exposure stations 314 - 344 will be substantially aligned . accordingly , when the electrostatic latent images developed at each of the developing stations 316 - 346 are developed , the resulting color image separation layers formed by each of the imagers 310 - 340 will be substantially aligned with each other , thus minimizing the misregistration between the various color image separation layers formed by the imagers 310 - 340 . furthermore , the dynamic skew control circuit 240 can also correct for skew between the imager 340 and the location of the receiving substrate at the transfer station 360 . if the dynamic skew control circuit 240 also corrects for skew between the imager 340 and the transfer station 360 , either the position of the receiving substrate or output of the image data by the imagers 310 - 340 is controlled . in particular , the position of the receiving substrate is controlled based on the lateral offsets determined by the dynamic skew control circuit 240 between the imager 340 and the transfer station 360 . alternatively , output of the image data for the imagers 310 - 340 is further controlled based on the skew between the imager 340 and the transfer station 360 . in either case , the resulting color image separation layers formed by each of the imagers 310 - 340 will be substantially aligned with each other . accordingly , when the resulting color image separation layers are transferred onto the receiving substrate 20 at the transfer station 360 , the resulting color image separation layers formed by each of the imagers 310 - 340 will be substantially aligned with the desired position on the receiving substrate 20 . this minimizes , for example , any misregistration between the various color image separation layers formed by the imagers 310 - 340 and any other images or any specified image - to - substrate tolerances on the receiving substrate 20 . fig4 shows one embodiment of the image output terminal 300 and the dynamic skew control circuit 240 shown in fig2 and 3 in greater detail . as shown in fig4 in this exemplary embodiment of the image output terminal 300 , each of the imagers 310 - 340 are implemented using a raster output scanner to expose the photoreceptor belt 350 . as shown in fig4 each of the exposure stations 314 - 344 includes a modulator 3141 that modulates one or more light beams based on the input image data and a light emitting device 3142 connected to the modulator 3141 that emits the at least one light beam 3143 modulated by the modulator 3141 . each light beam 3143 emitted by the light emitting device 3142 is imaged onto a facet 3145 of a rotating polygon 3144 by a set of input optics ( not shown ). each light beam reflected from the current facet 3145 of the rotating polygon 3144 is imaged onto the photoreceptor 350 using a set of output optics ( not shown ). it should be appreciated that the image output terminal 300 can also be employed with imagers of other styles as well . these include , but are not limited to , devices such as linear arrays of exposure devices or led bars . as shown in fig4 a particular color image separation layer 317 formed on the photoreceptor 350 comprises a plurality of scanlines 318 . each scanline 318 has a beginning point and an ending point . the beginning point , or &# 34 ; start of scan &# 34 ; point , is the point at which the current facet 3145 of the rotating polygon mirror 3144 directs each of the one or more light beams 3143 onto an appropriate portion of the photoreceptor belt 350 such that image data can be recorded . each start - of - scan sensor 319 independently determines the &# 34 ; start of scan &# 34 ; reference point for the corresponding exposure station and independently provides suitable feedback signals to the corresponding exposure station . feedback signals from the start - of - scan sensors 319 to the imager 310 - 340 provide reference points indicating the position of the one or more light beams 3143 on the photoreceptor 350 . these feedback signals are input to the modulator 3141 of the corresponding exposure station of the imagers 310 - 340 . the dynamic skew controller 240 , based on the current value for the skew of the photoreceptor belt 350 , generates , for each imager 310 - 340 , an imager specific control signal used by the corresponding modulator 3141 to determine , in response to receiving the start - of - scan signal from the corresponding start - of - scan sensor 319 , when to begin modulating the one or more light beams 3143 based on the image data for the current scan line . that is , based on the timing control signals from the dynamic skew controller 240 and the feedback signals from the start - of - scan sensor 319 , the modulator 3141 begins modulating the light beam 3143 based on the image data for the current scan line at a point in time which eliminates the effects of skew . the modulated light beam 3143 is then emitted by the light emitting device 3142 and is imaged onto a facet 3145 of a rotating polygon 3144 . the control of the output of the image data by the modulator 3141 , and possibly the position of the substrate , by the dynamic skew control circuit 240 is based on the observation that the photoreceptor belt 350 laterally moves in a linear fashion between any two points , such as between the sensors 352 and 354 . fig5 shows an exemplary linear relationship between the skew and the various imagers 310 - 340 . as shown in fig5 by measuring the lateral position of the edge of the photoreceptor belt 350 at the sensors 352 and 354 , the lateral position of the photoreceptor belt 350 anywhere between the sensors 352 and 354 can be approximated . the lateral position at any point of interest is determined by multiplying the total photoconductor belt skew , which is the difference in lateral position at the at the sensors 352 and 354 , by the ratio of the distance from that point of interest to the sensor 352 to the distance between the sensors 352 and 354 . if the point of interest is the position along the photoreceptor 350 at which a particular imager 310 - 340 is forming the corresponding scanline 318 , the amount of skew at that position can thus be determined . it should be appreciated that the reference point for corrections could be at the sensor 354 , but due to sampling delays and dynamic behavior of the skew , the sensor 352 is the preferred reference point . the dynamic skew control circuit 240 adds a dynamic delay to the modulators 3141 to a predetermined lateral start - of - scan delay already applied by the modulators . this predetermined lateral start - of - scan delay is used to remove any offset errors caused by a physical imager misalignment of the imagers 310 - 340 from each other . as shown in fig6 and 7 , for each imager 310 - 340 , this physical imager misalignment between the color image separation layers can be removed by adding an imager - specific time delay between 1 ) sensing the laser beam being at the start - of - scan position , as sensed by the corresponding start - of - scan sensor ; and 2 ) beginning the modulation of the corresponding light beam based on the image data . fig7 illustrates the differing amount of physical offset relative to the photoreceptor belt 350 that can occur between two imagers . as shown in fig7 different imager - specific delays for the physical imager misalignment are introduced for each of the two images to produce registered images . by introducing an imager - specific delay , the different color image separation layers are then aligned accordingly to be correctly registered with one another , assuming there is no skew . by knowing the amount of skew , the imager - specific start - of - scan delay and the position of the one or more light beams 3143 along the photoreceptor belt 350 , the dynamic skew control circuit 240 can suitably control the output of the image data by the imagers 310 - 340 to compensate for the amount of dynamic skew added to the static physical imager misalignment . that is , the image data is recorded on the photoreceptor belt 350 . in particular , the electrostatic latent image is formed by modulating each light beam 3143 emitted by the light emitting device 3142 based on the electronic image data received from the memory 230 via the control and / or data bus 250 , the feedback signals from the start - of - scan sensor 319 and the timing control signals from the dynamic skew control circuit 240 . thus , by controlling , based on the amount of skew and the imager - specific start - of scan delay , when the modulators 3141 output the modulation signals to the light emitting devices 3142 to form the current scanlines 318 relative to the start - of - scan signals output from the start - of - scan sensors 319 , the relative lateral location of each scanline 318 on the photoreceptor belt 350 can be very precisely controlled . as shown in fig4 the dynamic skew control circuit 240 includes a dynamic skew controller 242 , an input controller 244 , and an output controller 246 . the output controller 246 controls the timing of the output of the image data by the exposure stations 314 - 344 and the timing of the transfer station 360 . the input controller 244 receives the signals output from the steering and transfer end sensors 352 and 354 . it should be appreciated that while fig4 shows the modulators 3141 as part of the exposure stations 314 - 344 , the modulator 3141 for each of the exposure stations 314 - 344 could be incorporated into the output controller 246 as a portion of an integrated system . that is , the output controller 246 may directly output the modulator signals to the light emitting device 3142 to modulate the light beams 3143 by combining the timing and modulation functions . in this case , the signal lines from the start - of - scan sensors 319 of the imagers 310 - 340 will be connected directly to the output controller 246 . after the steering and transfer end sensors 352 and 354 sense the instantaneous lateral position of the photoreceptor belt 350 at the steering and transfer ends s and t , respectively , the sensed results are input to the input controller 244 . the dynamic skew controller 242 then modifies the timing control signals for the modulators 3141 and for the timing control of the transfer station 360 . the output controller 246 then controllably outputs the timing control signals to the exposure stations 314 - 344 , and the transfer station 360 , accordingly . in a first exemplary embodiment , to remove skew , the dynamic skew controller 242 controls the output of the image data by the modulators 3141 and the position of the receiving substrate using , for example , a nominal edge position table . the nominal edge position table serves to link the set - up measurements that correct for any static misalignment error and the dynamic skew adjustment measurements . the nominal edge position table is used because the photoreceptor belt edge , which is used as a surrogate for direct registration measurement , is not straight and large errors in measurement will otherwise be generated . measured belt position values are compared to nominal values in the nominal edge position table stored for the current sample position along the photoreceptor belt 350 to determine the instantaneous belt skew based on the difference between the nominal belt edge positions and the sensed current belt edge positions . the nominal edge position table is obtained when the image processing apparatus 200 is first , or subsequently , set up . during set - up , the dynamic skew controller 242 collects data on the nominal position of the edge of the photoreceptor belt 350 at each of the sensors 352 and 354 for a number of sample positions along the photoreceptor belt 350 . the dynamic skew controller 242 reduces one or more belt revolutions of this belt position data to an average or suitably filtered edge profile and stores the filtered edge profile as the nominal edge position table . the nominal edge position table has one entry for each sample position along the photoreceptor belt 350 . the dynamic skew nominal controller 242 then uses this nominal edge position table when determining the skew adjustments to be made during a print run . fig8 illustrates examples of generating and using the nominal edge profile of the photoreceptor belt 350 . as shown in fig8 nominal edge profile data a - h are taken at the sensors 352 and 354 for each sampling positions 1 to n . the profile data a - h are then saved in the nominal edge position table for dynamic skew control . in this first exemplary embodiment , during the print run , the dynamic skew controller 242 subtracts , for each sample position , the value in the nominal edge position table for each sensor from the value of the corresponding sensor signal to determine the actual lateral position of the photoreceptor belt 350 at each of the sensors 352 and 354 . the dynamic skew controller then determines the instantaneous belt skew k as the difference between the actual belt position at each of the sensors 352 and 354 . thus , the instantaneous belt skew value is : m 1 is the measured position value of the belt at the first sensor ; n 1 is the nominal position value of the current belt position at the first sensor ; m 2 is the measured position value of the belt at the second sensor ; and n 2 is the nominal position value of the current belt position at the second sensor . alternatively , in a second embodiment , the dynamic skew controller 242 modifies the image data and the receiving substrate registration using a nominal skew table . the nominal skew table stores skew measurements rather than edge profile data . during set - up , the dynamic skew controller 242 obtains the belt edge positions at each of the sensors 352 and 354 for each of a number of positions along the photoreceptor belt 350 . the dynamic skew nominal controller 242 then determines the difference between belt edge positions at the sensors 352 and 354 at each of the positions along the photoreceptor belt 350 , and stores the determined difference , i . e ., the nominal skew between the measured belt edge positions when there is no actual skew , as the nominal skew table . the nominal skew table has one entry for each sample position along the photoreceptor belt 350 . the dynamic skew nominal controller 242 then uses this nominal skew table when determining the skew adjustments to the timing control signals to be made during a print run . in this second exemplary embodiment , during the print run , the dynamic skew controller 242 measures the belt edge position at each of the sensors 352 and 354 , for a particular sample position , and determines the difference between the measured belt edge positions to determine a measured skew value . the dynamic skew controller 242 then subtracts the nominal skew value in the nominal skew table for that sample position from the measured skew value to determine the actual skew of the photoreceptor belt 350 between the sensors 352 and 354 . thus , in this second exemplary embodiment , the actual skew value k is : n 1 is the nominal position value of the current belt position at the first sensor ; n 2 is the nominal position value of the current belt position at the second sensor ; m 1 is the measured position value of the belt at the first sensor ; and m 2 is the measured position value of the belt at the second sensor . the nominal edge position or skew table , depending on whether the first or second exemplary embodiment is used , and the sampled data are synchronized to the photoreceptor belt 350 . based on the resulting actual skew measurement , the adjustments to be made to the timing control signals based on the positions of the images 310 - 340 and lateral paper position are determined . the dynamic skew controller 242 continues to determine the instantaneous skew throughout the print run to keep the images and the receiving paper laterally registered . in particular , for each imager , the total timing signal adjustment value a is : a i is the total timing signal adjustment value for the ith imager ; p i is the physical imager misregistration value for the ith imager determined at setup ; k t is the actual skew for a given sample time ; and g i is the gain for the ith images , i . e ., the ratio of the distance between the first or second sensor 352 or 354 and the imager to the distance between the first and second sensors 352 and 354 . it should be appreciated that this procedure also works for imagers on two different belt spans . as discussed above , all of the imagers 310 - 340 are not limited to being located on one span , or one side , of the photoreceptor belt 350 , i . e ., the side of the photoreceptor belt 350 extending from the steering end s to the transfer end t . one or more of the imagers 310 - 340 may be located on the other side of the photoreceptor 350 , i . e ., from the transfer end t to the steering end s . it should also be appreciated that the timing signals can be modified in various ways . in a second exemplary embodiment of the systems and methods that dynamically adjust the timing signals to remove or reduce skew of this invention , the timing signals for the imager 310 are not modified based on the dynamic skew , while the timing signals for the imagers 320 - 340 are modified based on the dynamic skew to place the images formed by the imagers 320 - 340 into registration with the image formed by the imager 310 based on the unmodified timing signals used to control the placement of the scanline 318 formed by the imager 310 . it should also be appreciated that the actual controlled adjustment could be filtered or modified in any manner known to provide better performance . in contrast , in a third exemplary embodiment of the systems and methods that dynamically adjust the timing signals to remove or reduce skew of this invention , the timing signals for the imager 340 are not modified , while the timing signals for the imagers 310 - 330 are modified to place the images formed by the imagers 310 - 330 into registration with the image formed by the image 340 . alternatively , in a fourth exemplary embodiment of the systems and methods that dynamically adjust the timing signals to remove or reduce skew of this invention , the timing signals for all the imagers 310 - 340 are modified to place the images formed by the imagers 310 - 340 into registration with a reference position on the photoreceptor belt 350 . moreover , in a fifth exemplary embodiment of the systems and methods that dynamically adjust the timing signals to remove or reduce skew of this invention , when the timing signals for all the imagers 310 - 340 are modified to place the images formed by the imagers 310 - 340 into registration with the substrate , as outlined above , the reference position may be determined from the additional skew from the last imager 340 and the transfer station 360 to place the images from the imagers 310 - 340 into registration with the substrate . it should also be appreciated that , rather than further altering the timing signals to place the images into registration with the substrate , the position of the substrate relative to the photoreceptor belt at the transfer position can be modified based on the additional skew from the last imager 340 and the transfer station 360 . fig9 is a flowchart outlining one exemplary embodiment of the set - up method of this invention . starting in step s100 , control continues to step s200 , where the photoreceptor belt edge profile for each position along the belt for each sensor is determined through a process of data collection from each belt edge sensor . then , in step s300 , the relative gain difference in the two sensors is determined to obviate any differences in the signals representing the edge profiles due to the gain differences in the sensors . that is , for the same position along the belt , with no skew , the outputs of the sensors should be the same . any differences in the sensor output signals is thus due to a gain difference between the sensors . by determining the gain difference , the sensor outputs can be compensated for the gain difference to sense the lateral belt position identically at both of the sensors . control then continues to step s400 . in step s400 , the position of the photoreceptor belt at each of the sensors and relative to the position of transfer station during the registration set - up procedure is measured as the nominal belt position . alternatively , for each position along the photoreceptor belt 350 , the difference between the positions sensed by the sensors during the registration set - up procedure may be calculated as the nominal skew . next , in step s500 , the nominal edge profile table or the nominal skew table is generated . the nominal edge profile or skew table serves to link the set - up measurements and the dynamic skew adjustment measurements . then in step s600 , the control routine ends . fig1 is a flowchart outlining one exemplary embodiment of a method for dynamically adjusting for skew according to this invention . beginning at step s1000 , control continues to step s1100 , where the electronic image data is input . next , in step s1200 , the instantaneous belt edge values of the photoreceptor belt are measured . then , in step s1300 , the measured belt position values are compared to each other and to the values in the nominal edge profile or skew table to determine the instantaneous belt skew k . in particular , the instantaneous belt skew k is the difference between the nominal belt edge positions or values from the nominal skew table and the sensed current belt edge positions . the current belt edge position measurements for each sensor obtained during image processing are adjusted based on the corresponding nominal belt edge positions for the current position along the belt using either the nominal edge position table or the nominal skew table according to equation 1 or equation 2 , respectively , to remove the belt edge signature . control then continues to step s1400 . in step s1400 , based on the determined skew between the sensors , the image specific dynamic skew adjustments to the timing signals for the imagers and for the transfer station are determined to ensure the images remain laterally registered with each other and with the receiving substrate . that is , the dynamic skew timing signals for each imager are adjusted and dynamic skew timing signals for the transfer station are adjusted , so that any displayed or printed image will appear without skew . then , in step s1500 , the dynamic - skew - adjusted timing signals for each imager are combined with the corresponding imager - specific start - of - scan delay and output to the appropriate imager . next , in step s1600 , each color image separation layer is formed by the appropriate imager using the adjusted timing signals , received start - of - scan signals and image data . control then continues to step s1700 . in step s1700 , the timing signals for the transfer station are adjusted to modify the receiving substrate &# 39 ; s position to maintain proper registration between the images and the receiving substrate at the transfer station . control then continues to step s1800 , where the control routine ends . fig1 is a flowchart outlining in greater detail one exemplary embodiment of the method for adjusting the timing signals of step s1400 . starting at step s1400 , control continues to step s1410 , where the skew - eliminated adjustments to the timing signals for each imager are determined based on the determined amount of skew and the gain ratio . it should be appreciated that the adjustments may be made by modifying the timing signals for the three of the imagers to place the images formed by the three imagers into registration with the image formed by the fourth imager based on the unmodified timing data used by it , as disclosed in the second and third embodiments , by modifying the timing signals for all the imagers to place the images formed by the imagers into registration with a reference position on the photoreceptor belt , as disclosed in the fourth embodiment , by modifying the timing signals for all the imagers to place the images formed by the imagers into registration with the substrate , as disclosed in the fifth embodiment , or any like process . next , in step s1420 , for each imager , the image - specific physical misalignment adjustment determined at set - up is added to the skew - eliminating timing signal adjustment . then , in step s1430 , the transfer station timing signals that keep the resulting color layers formed by each of the imagers laterally registered with a desired position on the receiving paper substrate are determined . next , in step s1440 , control returns to step s1500 . as shown in fig2 the image processing apparatus 200 is preferably implemented on a programmed general purpose computer . however , the image processing apparatus 200 can also be implemented on a special purpose computer , a programmed microprocessor or microcontroller and peripheral integrated circuit elements , an asic or other integrated circuit , a digital signal processor , a hardwired electronic or logic circuit such as a discrete element circuit , a programmable logic device such as a pld , pla , fpga or pal , or the like . in general , any device , which is capable of implementing the finite state machine that is in turn capable of implementing the flowcharts shown in fig9 - 11 , can be used to implement the image processing apparatus 200 . this invention has been described in connection with the preferred embodiments . however it should be understood that there is no intent to limit the invention to the embodiments described above . on the contrary , the intent is to cover all alternatives , modification , and equivalents as may be included within the spirit and scope of the invention . for example , it is to be appreciated that this invention need not only be used to determine skew in an image . for example , the invention could be used to determine the relative angle between line segments in an image . thus , it should be appreciated that various other modifications and changes may occur to those skilled in the art without departing from the spirit and scope of this invention . | 7 |
as used in this specification and in the appended claims , the term “ indicia ” broadly encompasses not only symbol patterns composed of alternating bars and spaces of various widths commonly referred to as bar code symbols , but also other one - or two - dimensional graphic patterns , as well as alphanumeric characters . in general , the term in “ indicia ” may apply to a type of pattern or information which may be recognized or identified by scanning a light beam and by detecting reflected or scattered light as a representation of variations in light reflectivity at various points of the pattern or information . a bar code symbol is one example of an “ indicia ” which the present invention can scan . as a preferred embodiment , the implementation of the present invention in a handheld reader 10 , as illustrated in fig1 , is described . the reader 10 includes a housing 12 having a handle 14 on which a trigger switch 16 is mounted . the housing includes a canopy above the handle , but removed for clarity from fig1 . a window module 18 is situated adjacent a front end of the housing . an optical module 20 is situated behind the window module 18 . a printed circuit board ( pcb ) 22 , whose front side is shown more clearly in fig2 , and whose rear side is shown more clearly in fig3 - 4 , is situated behind the optical module 20 at a rear end of the housing . the pcb slides into the handle 14 at an obtuse angle relative to a horizontal plane to accommodate the slanted - back slope of the handle . as shown in fig2 , a sensor 24 is mounted on the front side of the pcb . light returning from a symbol being read passes through the window module 18 through a collection lens and filter 26 in the lower part of the optical module 20 to the sensor 24 for detection . as described below , light from a light source passes through an aperture 28 in the pcb through another aperture 30 in the upper part of the optical module 20 and , in turn , through the window module 18 en route to the symbol for reflection therefrom . fig3 - 4 are similar , except that various supporting structures shown in fig3 have been removed to better see the components supported thereby . thus , as best seen in fig4 , a light source , such as a semiconductor laser 32 is mounted at the rear side of the pcb 22 and is operative for emitting a laser beam 34 horizontally through a focusing lens assembly 33 to a first scan mirror 36 for reflection upwardly to a second scan mirror for reflection forwardly through the aperture 28 . the first scan mirror 36 is , as described more fully below , mounted for reciprocal oscillation by a first motor drive 40 operating in a self - resonant mode , while the second scan mirror is also mounted for reciprocal oscillation by a second motor drive 42 operating in a driven mode synchronous with the first motor drive 40 . fig4 also depicts a first electromagnetic coil 44 for the first drive 40 and a second electromagnetic coil 46 for the second drive 42 . the coils 44 , 46 are mounted at the rear side of the pcb , and each has a drive winding ( 94 , 98 as seen in fig8 ) operative for generating an electromagnetic field in response to energization by a periodic drive signal . coil 44 also has a feedback winding 96 whose operation is described below . fig3 shows a support chassis 48 operative for supporting the laser 32 , the focusing lens assembly 33 , the first drive 40 , the second drive 42 , and the coils 44 , 46 . the chassis 48 also provides shock protection and is fastened to the rear of the pcb . as shown in the successive views of fig5 - 7 , either or both drives 40 , 42 can be fabricated as follows : a stator 50 has a pair of stator portions 52 , 54 spaced apart and symmetrically positioned relative to an axis of symmetry . the stator portions have through holes 56 , 58 . the stator includes a support bracket 60 having a pair of arms 62 , 64 having stub shafts 66 , 68 . a rotor 70 has a pair of rotor portions 72 , 74 spaced apart and symmetrically positioned relative to the axis of symmetry . the rotor portions have through holes 76 , 78 . the rotor also has an elongated central support portion 80 integral at one end therewith and extending along the axis of symmetry . the support portion 80 has an inclined mounting portion 82 at one side , and a cut - out section 84 at an opposite end thereof to reduce the mass of the support portion 80 . the rotor and the stator are separate molded resilient parts of synthetic plastic material . these parts are placed in a liquid silicon injection mold , and a pair of generally planar , elongated , leaf springs 86 , 88 of silicon is overmolded onto the stator and rotor portions . specifically , spring 86 is molded onto stator portion 52 and rotor portion 72 and enters the holes 56 , 76 for a secure anchorage . spring 88 is molded onto stator portion 54 and rotor portion 74 and enters the holes 58 , 78 for a secure anchorage . the springs are thicker at their ends overlying the holes , and thinner therebetween to enable their ready flexing about an axis perpendicular to the axis of symmetry . as shown in fig7 , the first scan mirror 36 , or the second scan mirror , is adhered to the mounting portion 82 at an angle of 45 ° relative to a common plane in which the stator portions , the rotor portions and the springs lie . at the opposite side of the support portion 80 , a permanent magnet 90 is likewise adhered . returning to fig4 , the scan mirror 36 of the first drive 40 is facing upwardly , while its permanent magnet is facing the first coil 44 . also , the scan mirror of the second drive 42 is facing forwardly , while its permanent magnet 90 is facing the second coil 46 . the drives 40 , 42 are mounted at right angles to each other , thereby enabling the drives 40 , 42 to sweep the beam in mutually orthogonal directions . the first and second drives are each operated differently to best suit the requirements of the raster pattern . the first drive 40 is required to oscillate its scan mirror at a large scan angle , e . g ., 45 °, and at a high speed , e . g ., 50 - 60 hz , lengthwise across the symbol along the x - direction . the second drive 42 is required to oscillate its scan mirror at a small scan angle , e . g ., 4 °, and at a lower speed , e . g ., 10 hz , along the height of the symbol along the y - direction . the second scan mirror needs to be larger than the first scan mirror to accommodate the moving beam . the larger inertia for the second mirror is not a problem due to its lower speed . in accordance with this invention , the first drive 40 is operated in a self - resonating mode . as shown in fig8 , a bidirectional drive circuit 92 measures the natural resonant frequency of the first drive 40 and drives a drive winding 94 of the latter at or near that frequency . driving the first drive near its natural frequency reduces the amount of power needed to drive the first drive . a suitable bidirectional drive circuit is described in u . s . pat . no . 5 , 280 , 163 , the entire contents of which are incorporated herein by reference thereto . in addition to the drive winding 94 , the coil 44 includes a feedback winding 96 operative for generating a feedback signal by the movement of the permanent magnet of the first drive 40 . the drive circuit 92 uses the feedback signal to determine which direction the rotor is moving , how fast it is moving , and when it changes direction . the drive circuit 92 processes the feedback signal into a start - of - scan ( sos ) signal having a square waveform which is high when the rotor is moving in one direction , low when the rotor is moving in the opposite direction , and transitions when the rotor changes direction at the end of each scan . the frequency of the sos signal is the same as the resonant frequency of the first drive because it is generated from the feedback signal which is created by the motion of the rotor . the multiple line raster pattern generated by the two drives 40 , 42 is determined by the relative speeds and amplitudes of the motions of their rotors . it is the ratio of the frequencies of the rotors that determines the appearance of the raster pattern , not the absolute frequencies . as mentioned , the first drive 40 operates in the self - resonating mode . however , the resonant frequency of one rotor will vary from one reader to the next due to unavoidable differences in the mass of the scan mirror 36 , the magnet 90 and plastic parts , and due to differences in the stiffness of the springs 86 , 88 caused , for example , by ambient temperature . it therefore becomes necessary to drive the second drive 42 in one reader at a different speed than in another reader because their first drives will not be running at exactly the same speed . it is always possible to operate the second drive in a driven mode so that is has a desired frequency relationship with that of the first drive despite the differences mentioned above by insuring that the frequency of the second drive is derived from the frequency of the first drive . this can be done by locking the frequency of the second drive into a predetermined relationship with the frequency of the sos signal which , as previously discussed , exactly represents the actual operating frequency of the first drive . a microprocessor 100 , preferably but not necessarily , the same one used to decode the digitized signal , has an input for receiving the sos signal and is operative to detect when the first drive has changed direction and is starting a new scan . the microprocessor preferably has built - in digital - to - analog converters and changes the voltage at its output by a predetermined amount each time the sos signal transitions from low to high , or from high to low . the analog output voltage can be amplified and applied through a drive circuitry 102 to a drive winding 98 of the second drive 42 , thereby moving the rotor of the second drive a predetermined amount each time the sos signal indicates that the first drive is starting a new scan . various kinds of raster patterns can be produced . for example , the second drive can have its rotor turned upwards by one degree for each of a first three sos transitions , and then downwards by one degree for each of the next three sos transitions , brining the rotor back to its original position . during the next three sos transitions , the rotor can be turned downwards by one degree for each transition , and then upwards in one degree increments over the following three transitions . this creates a raster pattern of seven individual scan lines , which is stable and repeatable even if the first drive changes frequency because the motion of the rotor of the second drive is always synchronized with the sos signal and the first drive . other kinds of raster patterns can be made by varying the amount that the output voltages changes at each transition . for example , the rotor of the second drive can move upwards by one degree as described above , but then move downwards half way between the scan lines on the way up . the raster pattern can be changed at will , or stopped altogether under predefined conditions . the small motion of the second drive compared to that of the first drive requires a correspondingly small electrical current , thereby minimizing power consumption , even when the second drive is operated far from its resonant frequency . if the microprocessor 100 is the same as the one responsible for decoding , then it is desirable to move the second drive only upon an sos transition when the first drive has reached the end of its scan , and no new symbol data is being swept . the microprocessor is available for decoding the rest of the time that the laser beam is being swept across the symbol . it may be desirable to start the second drive moving slightly before an sos transition , because it will not move instantaneously when the drive voltage changes . the microprocessor can measure the time between scans and predict when the sos signal is about to transition and thus change the drive voltage slightly before the sos transition . the second drive is driven open loop , without any feedback to assure that it is accurately tracking the drive voltage . yet , the motor of fig5 - 7 has proven to be reliable and consistent , except for ambient temperature variations that can change the stiffness of the springs 86 , 88 . a temperature transducer 104 is connected to the microprocessor to correct the drive voltage applied to the drive winding 98 to compensate for temperature variations . if the microprocessor does not have a built - in analog - to - digital converter , then the transducer 104 can be made to produce a frequency signal that varies with temperature . the microprocessor can measure the frequency to obtain temperature information and adjust the drive voltage accordingly . the microprocessor can also correct the drive voltage applied to the drive winding 94 of the first drive to compensate for temperature variations . it will be understood that each of the elements described above , or two or more together , also may find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in synchronous and resonant drives for producing multiple scan line pattern for electro - optically reading indicia , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention and , therefore , such adaptations should and are intended to be comprehended within the meaning and range of equivalence of the following claims . | 6 |
a preferred embodiment of the invention is illustrate in fig1 - 3 and includes a holder 2 for tape cartridges 4 wherein the holder 2 comprises housing mean 6 integrally molded from a relatively rigid plastic material such as high impact polystyrene or other materials having similar characteristics . the housing means 6 has opposite end wall portions 8 and 10 , a top wall portion 12 , a bottom wall portion 14 , a back wall portion 16 and an open side 18 . the housing means 6 has a flange portion 20 extending upwardly from the top wall portion 12 at an angle of about 90 degrees with the top wall portion 12 and a flange portion 22 extending downwardly from the bottom wall portion 14 at an angle of about 90 degrees with the bottom wall portion 14 , which flange portions 20 and 22 cooperate to position the holder 2 on shelf means ( not shown ). a partition means 24 divides the housing means 6 into an upper section 26 and a lower section 28 . the partition means comprises an upper ledge means 30 and spaced a distance therefrom a lower ledge means 32 , each of which is integral with the back wall portion 16 and the opposite end wall portions 8 and 10 . the upper ledge means 30 has a front edge portion 34 and the lower ledge means 32 has a front edge portion 36 . the front surfaces 38 and 40 of the flange portions 20 and 22 , the front edges 42 and 44 of the opposite end wall portions 8 and 10 and the front edge portions 34 and 36 lie in a common plane . the back wall portion 16 has an inwardly directed recess 46 having a wall portion 48 which serves as a reinforcing means for the upper and lower ledge means 30 and 32 . also , at least two reinforcing beams 50 and 52 integral with the wall portion 48 and the upper and lower ledge means 30 and 32 add additional reinforcement . the upper section 26 is provided with a plurality of compartment forming means 54 which are integral with the top wall portion 12 , the back wall portion 16 and the upper surface 56 of the upper ledge means 30 to form a plurality of compartments 58 . the lower section 28 is provided with a plurality of compartment forming means 60 which are integral with the lower ledge means 32 , the back wall portion 16 and the upper surface 62 of the bottom wall portion 14 to form a plurality of compartments 64 . each of the compartments 58 and 60 is dimensioned to accommodate one tape cartridge 4 . a plurality of equal length abutment forming means 66 , for purposes described below , are integral with the upper and lower ledge means 30 and 32 . a plurality of resilient tab means 70 are located in front of the front edge portions 34 and 36 of the upper and lower ledge means 30 and 32 and have a plurality of upper tab portions 72 and a plurality of lower tab portions 74 . as described below , each of the tab portions 72 and 74 are located so that as a tape cartridge 4 is inserted , into a compartment 58 or 64 , the tab portion 72 or 74 will be displaced by the tape cartridge 4 as it is inserted into the compartment 58 or 64 but after the tape cartridge has been inserted into the compartment 58 or 64 , the resilient tab means 70 will cause the tab portion 72 or 74 to resile back into its initial position . an upper recess 76 and a lower recess 78 are provided in each tape cartridge 4 and when the tab portions 72 and 74 have resiled back to their initial position , a portion thereof is located in an upper recess 76 or a lower recess 78 to retain the tape cartridge 4 in a compartment 58 or 64 until it is desired to remove such tape cartridge 4 from the compartment 58 or 64 . the resilient tab means 70 is illustrated in fig4 and 8 - 10 and is integrally molded using a relatively rigid plastic material such as an acetal resin such as that marketed by du pont under the trade designation debrin 10 or other materials having similar properties and comprises an elongated base member 90 having a linear extent with a length greater than its width and having a plurality of spaced apart openings 92 formed therein . a plurality of spaced apart upper arms 94 extend outwardly from and are integral with the elongated base member 90 and terminate in the upper tab portions 72 having a vertical planar surface 96 and an arcuate bearing surface 98 over which a portion of the tape cartridge 4 slides as it is inserted into a compartment 58 . a plurality of spaced apart lower arms 100 extend outwardly from and ar integral with the elongated base member 90 and terminate in the lower tab portions 74 having a vertical planar surface 102 and an arcuate bearing surface 104 which contacts a portion of the tape cartridge 4 as it is inserted into a compartment 64 . the arcuate bearing surface 98 is located in a plane between the upper ledge means 30 and the top wall portion 12 and the arcuate bearing surface 104 is located in a plane between the lower ledge means 32 and the bottom wall portion 14 so that each of the arcuate bearing surfaces 98 or 104 is displaced by a tape cartridge 4 as it is inserted into or withdrawn from a compartment . the portion of each upper tab portion 72 above the arcuate bearing surface 98 and the portion of the lower tab portion 74 below the arcuate bearing surface 104 function to guide a tape cartridge 4 into a compartment 58 or 64 . the portions 106 of the elongated base member 90 between the openings 92 are each provided with an opening 108 . the width of the elongated base member 90 is substantially the same but slightly less than the distance between the bottom surface 110 of the upper ledge means 30 and the top surface 112 of the lower ledge means 32 . the resilient tab means 70 are inserted between the lower surface 110 and the top surface 112 until the elongated base member 9 contacts the abutments 66 as illustrated in fig9 . a locking means 120 , illustrated in fig6 - 10 , is provided for locking the resilient tab means 70 in position between the upper and lower ledge means 30 and 32 . the locking means 120 is integrally molded using a relatively rigid plastic material such as high impact polystyrene or other materials having similar characteristics . the locking means 120 comprises an elongated member 122 having a length greater than its width and a generally planar front surface 124 . a plurality of spaced apart upper projections 126 extend outwardly from the rear surface 128 of the elongated member 122 and form a plurality of upper openings 130 therebetween . a plurality of upper flanges 132 extend upwardly from the elongated member 122 in the area of the spaced apart upper projections 126 . a plurality of spaced apart lower projections 134 extend outwardly from the rear surface 128 of the elongated member 122 and form a plurality of lower openings 136 therebetween . a plurality of lower flanges 138 extend downwardly from the elongated member 122 in the area of the spaced apart lower projections 134 . a plurality of spaced apart studs 140 extend outwardly from the rear surface 128 of the elongated member 122 and terminate with plug portions 142 which are located so as to fit into the openings 108 as illustrated in fig8 an upper recess 144 is formed in the front edge 34 and a lower recess 146 is formed in the front edge 36 . the assembly of the resilient tab means 70 and the locking means 120 in the housing means 6 is illustrated in fig9 . the resilient tab means 70 has been inserted between the upper and lower ledge means 30 and 32 until the elongated base member 90 contacts the abutment forming means 66 . the locking means 120 has a flange portion 148 and a flange portion 150 which guide the locking means 120 during assembly by contacting the inner surface 152 of the side wall portion 8 and the inner surface 154 of the side wall portion 10 so that the locking mean 120 is positioned with the upper tab portions 72 in the upper openings 130 and the lower tab portions 74 in the lower openings 136 . the locking means 120 is moved inwardly until the upper flanges 132 are in contact with the walls defining the upper recess 144 and the lower flanges 138 are in contact with the walls defining the upper recess 146 . suitable means , such as ultrasonic welding , are used to secure the upper and lower flanges 132 and 138 to the upper and lower ledges 30 and 32 . when it is desired to insert a tape cartridge 4 into an upper compartment 58 , the lower portion thereof contacts the arcuate surface 98 of an upper tab portion 72 and pushes it downwardly into the recess 130 . the tape cartridge 4 is then moved into the upper compartment 58 by sliding over the arcuate surface 98 . when the lower recess 78 of the tape cartridge 4 is over the upper tab portion 72 , the resilient characteristics of the upper tab portion 72 will move it into the lower recess 78 . the upper tab portion 72 is constructed so that it will move into the lower recess 78 but will not put any upward pressure on the tape cartridge 4 but will be located so that the vertical surface of the lower recess 78 is opposite to the vertical planar surface 96 of the upper tab portion 72 to restrict movement of the tape cartridge 4 out of the compartment 58 . when the tape cartridge 4 is seated on the upper surface 56 , there is sufficient clearance between the top of the tape cartridge 4 and the bottom of the top wall portion 12 so that when it is desired to remove the tape cartridge 4 from the compartment 58 , the tape cartridge is tilted upwardly so that the edge of the lower recess 78 will contact the arcuate bearing surface 98 and move the upper tab portion 72 into the recess 130 so that the tape cartridge 4 may be removed . the insertion of a tape cartridge 4 into a compartment 64 in the lower section 28 is similar to the operation described above with the upper portion of the tape cartridge 4 contacting the arcuate surface 104 and pushing the lower tab portion 74 up into the recess 136 until tape cartridge 4 reaches a position at which the upper recess 76 is beneath the lower tab portion 74 so that it can move into the upper recess 76 so that a vertical surface of the upper recess 76 is opposite to the vertical planar surface 102 so as to restrict movement of the tape cartridge 4 out of the compartment 64 . there is sufficient clearance so that the tape cartridge 4 can be tilted downwardly so that the edge of the upper recess 76 will contact the arcuate bearing surface 104 and move the lower tab portion into the recess 136 so that the tape cartridge 4 may be removed . while an illustrative and presently preferred embodiment of the invention has been described in detail herein , it is to be understood that the inventive concepts may be otherwise variously embodied and employed and that the appended claims are intended to be construed to include such variations except insofar as limited by the prior art . | 6 |
the preferred embodiments of the present invention are further described in detail with the following embodiment and the accompanying drawings . fig1 to 10 illustrate the construction of an embodiment of the present invention . as shown in fig1 and 2 , the embodiment comprises a casing which is composed of an outer casing 1 , a fixed blade holder 2 and a retractable blade holder 3 , blades 4 , a reset spring 5 , a pushbutton 6 , a spring 7 , a plug 8 and a blade changer 9 . blades 4 are short blades each with an aperture 41 and are for industrial hand - held cutters , and in this embodiment , blades of number 11 are used , while in other embodiments , other sizes of blades may be used . in this embodiment , the head of the fixed blade holder 2 is disposed with a plane surface 21 , and a projection 22 is disposed on the plane surface 21 , and by inserting the projection 22 into the aperture 41 of one of the blades 4 , the blade 4 can be fixed securely on the head of the fixed blade holder 2 . the fixed blade holder 2 is disposed with a hollow 23 that fixes the blade 4 on the head of the fixed blade holder 2 , and the shape and dimension of the hollow 23 corresponds to the shape and dimension of the rear half of the blade 4 . the retractable blade holder 3 is disposed with a plane surface 31 which faces the plane surface 21 of the fixed blade holder 2 , the plane surface 31 of the retractable blade holder 3 can slide on the plane surface 21 of the fixed blade holder 2 . the bottom of the retractable blade holder 3 is disposed with a protrusion 32 that engages with one end of the reset spring 5 , and the bottom or the part near the bottom of the fixed blade holder 2 is disposed with a protrusion 25 that engages with the other end of the reset spring 5 . the fixed blade holder 2 is disposed with a receiving slot 26 that provides a cavity for the movement of the reset spring 5 . the retractable blade holder 3 can retract and restore to its original position as against the fixed blade holder 2 by means of the reset spring 5 . in this embodiment , the fixed blade holder 2 and the retractable blade holder 3 are each semielliptical in shape respectively , and when the plane surface 31 of the retractable blade holder 3 engages with the plane surface 21 of the fixed blade holder 2 , they together are in the shape of an ellipse , and in other embodiments , the fixed blade holder 2 and the retractable blade holder 3 can be semicircular in shape respectively , and when the plane surface 31 of the retractable blade holder 3 engages with the plane surface 21 of the fixed blade holder 2 , they together are in the shape of a circle , or alternatively the fixed blade holder 2 and the retractable blade holder 3 can be in any other shape . these are not shown in the accompanying drawings . an opening 27 is disposed on one side of the bottom or the part near the bottom of the fixed blade holder 2 , the pushbutton 6 is disposed with an inserting member for connection 61 which has a fastening block 62 on the surface near the pushbutton 6 , a spring 7 is disposed in the center of the inserting member for connection 61 , one end of the spring 7 is exposed from the inserting member for connection 61 , and the inserting member for connection 61 together with the spring 7 is inserted into and connected with the opening 27 . the inserting member for connection 61 is disposed with a positioning block 63 , the opening 27 is disposed with a corresponding limiting groove 24 , and the positioning block 63 is inserted into the limiting groove 24 to limit the pushbutton 6 not to rotate sidewise . the bottom of the outer casing 1 is disposed with a sliding groove 11 which has at least two positioning slots 12 , 13 , and in this embodiment , the sliding groove 11 is disposed with three positioning slots 12 , 13 , 14 , the fixed blade holder 2 and the retractable blade holder 3 are entirely and completely inserted from the bottom of the outer casing 1 into the outer casing 1 , the inserting member for connection 61 is partly inserted into the sliding groove 11 , the pushbutton 6 is exposed from the outer casing 1 outside the sliding groove 11 . an inserting groove 81 is disposed along the outer edge of the bottom of the plug 8 , the bottom of the outer casing 1 is disposed with a corresponding inserting part 15 , and the plug 8 removably engages with the bottom of the outer casing 1 to prevent the fixed blade holder 2 , the retractable blade holder 3 , the blade 4 and the pushbutton 6 from sliding out from the bottom of the outer casing 1 . the sliding of the inserting member for connection 61 in the sliding groove 11 actuates the fixed blade holder 2 and the retractable blade holder 3 to slide in the outer casing 1 , by means of the movement of the spring 7 the fastening block 62 of the inserting member for connection 61 can removably engage with the positioning slots 12 , 13 , 14 , and the fixed blade holder 2 and the retractable blade holder 3 can slide in the outer casing 1 till their heads are exposed from the head of the outer casing 1 . the pushbutton 6 is in the shape of a clip which can clip onto another object . in this embodiment , the outer casing 1 is in the shape of an elliptical cylinder , while in other embodiments which are not shown in the accompanying drawings , the outer casing 1 can be in the shape of a circular cylinder , rectangular cylinder or in any other shape . in this embodiment , the sliding groove 11 is disposed with three positioning slots 12 , 13 , 14 , and the first positioning slot 12 is disposed near the bottom of the outer casing 1 , the second positioning slot 13 is disposed in the middle section of the sliding groove 11 and the third positioning slot 14 is disposed near the other end of the sliding groove 11 . as shown in fig7 , when the fastening block 62 of the inserting member for connection 61 engages with the first positioning slot 12 , the fixed blade holder 2 and the retractable blade holder 3 are entirely and completely disposed inside the outer casing 1 and the blade 4 is not exposed from the outer casing 1 . as shown in fig8 , when the fastening block 62 of the inserting member for connection 61 engages with the second positioning slot 13 , the blade 4 is exposed from the head of the outer casing 1 and only a small section of each of the heads of the fixed blade holder 2 and the retractable blade holder 3 is exposed from the head of the outer casing 1 . as shown in fig9 , when the fastening block 62 of the inserting member for connection 61 engages with the third positioning slot 14 , the heads of the fixed blade holder 2 and the retractable blade holder 3 together with the blade 4 are exposed from the head of the outer casing 1 . the length of the exposed sections is 20 centimeters , and in other embodiments , the length of the exposed sections can be of any other length . in other embodiments , which are not shown in the accompanying drawings , the sliding groove 11 is disposed with two positioning slots , and the first positioning slot is disposed near the bottom of the outer casing 1 while the second positioning slot is disposed near the other end of the sliding groove 11 . when the fastening block 62 of the inserting member for connection 61 engages with the first positioning slot , the fixed blade holder 2 and the retractable blade holder 3 are entirely and completely disposed inside the outer casing 1 and the blade 4 is not exposed from the outer casing 1 . when the fastening block 62 of the inserting member for connection 61 engages with the second positioning slot , the heads of the fixed blade holder 2 and the retractable blade holder 3 together with the blade 4 are exposed from the head of the outer casing 1 . as illustrated in fig1 to 5 , in this embodiment , the blade changer 9 is in the shape of a box , and in other embodiments which are not shown in the accompanying drawings , the blade changer 9 can be in any other shape . the blade changer 9 is divided into a blade unloading chamber 91 and a blade loading chamber 92 , each chamber is disposed with an inserting cavity 911 , 912 near the top , the shape and dimension of each inserting cavity 911 , 912 corresponds to the shape and dimension of the inserting sections of the fixed blade holder 2 and the retractable blade holder 3 . the lower half of each inserting cavity 911 , 912 is disposed with a stopping block 912 , 922 . the fixed blade holder 2 must be positioned on the top and the retractable blade holder 3 must be positioned at the bottom so that they together can be inserted into the inserting cavity 911 , 921 , and the stopping block 912 , 922 can just block the front end of the retractable blade holder 3 , thereby causing the retraction of the retractable blade holder 3 . the blade loading chamber 92 is disposed with a limiting member 923 which only allows horizontal overlapping placement of a plurality of new blades 4 , the end of the new blades 4 having the aperture 41 is positioned near the stopping block 922 , and the blade changer 9 has a bottom cover 93 which is disposed with a compression spring 94 in position that corresponds to the new blades 4 , the compression spring 94 exerts force upward against the new blades 4 so that the topmost new blade 4 is just higher than the stopping block 922 . as shown in fig4 and 5 , the blade unloading chamber 91 is disposed with a stopping plate 95 at the inserting cavity 911 , the stopping plate 95 is connected with and disposed inside the blade unloading chamber 91 by a torsion spring 96 , the shorter end 961 of the torsion spring 96 is disposed in the depression 952 of the stopping plate 95 , the longer end 962 of the torsion spring 96 leans against the plane surface 915 , and the rotational shaft end 951 of the stopping plate 95 that is near the torsion spring 96 is disposed in the depression 913 of the blade unloading chamber 91 . the stopping plate 95 removably covers the inserting cavity 911 , and when the fixed blade holder 2 is inserted into the inserting cavity 911 , the stopping plate 95 is pushed open , and when the fixed blade holder 2 is removed from the inserting cavity 911 , the force of the torsion spring 96 actuates the stopping plate 95 to restore to its original position immediately , the stopping plate 95 therefore prevents the old blades from falling out from the inserting cavity 911 . the upper half of the inserting cavity 921 of the blade loading chamber 92 is disposed with a depression 924 of size and dimension corresponding to the shape and dimension of the inserting section of the fixed blade holder 2 so as to fix the position of the inserting section of the fixed blade holder 2 , thereby allowing the projection 22 to precisely pass through the aperture 41 of the topmost new blade 4 to fix the new blade 4 on the head of the fixed blade holder 2 . the upper half of the inserting cavity 911 of the blade unloading chamber 91 is disposed with a depression 914 of size and dimension corresponding to the shape and dimension of the inserting section of the fixed blade holder 2 so as to fix the position of the inserting section of the fixed blade holder 2 , thereby allowing easy unloading of the old blade 4 . the bottom cover 93 can removably or securely engage with the bottom of the blade changer 9 . the bottom cover 93 can be disposed in position that corresponds to the blade unloading chamber 91 with one or a plurality of magnets or a magnetic layer to attract the unloaded blades 4 at the bottom , which is not shown in the accompanying drawings . as shown in fig7 , when the embodiment is in a standby state , the fastening block 62 of the inserting member for connection 61 engages with the first positioning slots 12 , the fixed blade holder 2 and the retractable blade holder 3 are entirely and completely disposed inside the outer casing 1 and the blade 4 is not exposed from the outer casing 1 . the user can carry around or store the outer casing 1 for use , for example , by inserting the pushbutton 6 into the inner pocket of a tool box or a shoulder bag or the like , and the blade changer 9 can also be stored for use . as shown in fig8 , to use the present invention , the fastening block 62 of the inserting member for connection 61 engages with the second positioning slot 13 , the blade 4 is exposed from the head of the outer casing 1 , and a large section or only a small section of each of the heads of the fixed blade holder 2 and the retractable blade holder 3 is exposed from the head of the outer casing 1 . the user can use the sharp pointed end of the blade 4 to cut objects . as shown in fig7 , after finishing using , the user only needs to engage the fastening block 62 of the inserting member for connection 61 with the first positioning slot 12 . as shown in fig9 , when the pointed end of the blade 4 has become blunt and it is required to be replaced with a new blade 4 , the user only needs to engage the fastening block 62 of the inserting member for connection 61 with the third positioning slot 14 , the heads of the fixed blade holder 2 and the retractable blade holder 3 together with the blade 4 are exposed from the head of the outer casing 1 . then , insert the heads of the fixed blade holder 2 and the retractable blade holder 3 together with the blade 4 into the inserting cavity 911 of the blade unloading chamber 91 , the fixed blade holder 2 must be positioned on the top and the retractable blade holder 3 must be positioned at the bottom so that they together can be inserted into the inserting cavity 911 , otherwise the stopping block 912 will block the front end of the fixed blade holder 2 and they cannot be inserted . when the heads of the fixed blade holder 2 and the retractable blade holder 3 together with the blade 4 are inserted , the stopping plate 95 is pushed open , the stopping block 912 can just block the front end of the retractable blade holder 3 , thereby causing the retraction of the retractable blade holder 3 as against the fixed blade holder 2 , and the blade 4 is therefore entirely exposed and simultaneously it falls onto the bottom cover 93 owing to gravity , and if the corresponding position on the bottom cover 93 is disposed with one or a plurality of magnets or a magnetic layer , the unloaded blade 4 will be attracted at the bottom . the user then pulls out the fixed blade holder 2 and the retractable blade holder 3 , the force of the torsion spring 96 actuates the stopping plate 95 to restore to its original position immediately , the stopping plate 95 therefore blocks the inserting cavity 911 and prevents the old blades 4 from falling out from the inserting cavity 911 . the user then inserts the heads of the fixed blade holder 2 and the retractable blade holder 3 into the inserting cavity 921 of the blade loading chamber 92 , the stopping block 922 can just block the front end of the retractable blade holder 3 , thereby causing the retraction of the retractable blade holder 3 as against the fixed blade holder 2 , the plane surface 21 of the fixed blade holder 2 is therefore exposed . as the compression spring 94 of the bottom cover 93 exerts force upward , the projection 22 on the plane surface 21 of the fixed blade holder then passes through the aperture 41 of the topmost new blade 4 , and as the topmost new blade 4 is just higher than the stopping block 922 , when the user pulls out the fixed blade holder 2 and the retractable blade holder 3 , the plane surface 31 of the retractable blade holder 3 will immediately fix the topmost new blade 4 in between the plane surfaces 21 , 31 of the fixed blade holder 3 and the retractable blade holder 3 . therefore , during the whole process of changing the blades , the user is not required to touch the blades directly and the whole process is completely automatic . when all the overlapping horizontally placed new blades 4 in the blade loading chamber 92 are used up , the user can dispose of the whole blade changer 9 , and there is no need to take out from the blade changer 9 the old blades 4 that requires to be disposed of . for the purposes of protecting the natural environment , the user can also open the bottom cover 93 to dispose of the old blades 4 and place some new blades 4 , and the blade changer 9 can be reused . the above embodiment is a preferred embodiment of the present invention . the present invention is capable of other embodiments and is not limited by the above embodiment . any other variation , decoration , substitution , combination or simplification , whether in substance or in principle , not deviated from the spirit of the present invention , is replacement or substitution of equivalent effect and falls within the scope of protection of the present invention . | 1 |
the present invention is directed to methods for preventing and treating the inhibition of gastrointestinal motility , particularly constipation , that arises in the group of patients taking chronic or maintenance doses of opioids . these patients include late stage cancer patients , elderly patients with osteoarthritic changes , methadone maintenance patients , neuropathic pain and chronic back pain patients . it has been discovered that the group of patients chronically taking opioids is surprisingly responsive to doses of quaternary derivatives of noroxymorphone that were previously considered too low to be clinically efficacious . treatment of these patients is important from a quality of life standpoint , as well as to reduce complications arising from chronic constipation , such as hemorrhoids , appetite suppression , mucosal breakdown , sepsis , colon cancer risk , and myocardial infarction . in the invention , a preferred quaternary derivative of noroxymorphone is methylnaltrexone . preferred side effects to be treated include constipation and gastrointestinal motility inhibition , dysphoria , pruritus , and urinary retention . when used as a treatment for these opioid - induced side effects , methylnaltrexone ( mntx ) or other quaternary derivatives of noroxymorphone ( qdmn ) provide prolonged relief of the side effects . idiopathic constipation , i . e ., that due to causes other than exogenous administration of opioids , may be mediated by opioid sensitive mechanisms . endogenous opioid receptors have been identified in the gut and these receptors may modulate gut motility . thus , administration of an opioid antagonist with peripheral action , such methylnaltrexone or other quaternary derivatives of noroxymorphone , would block the effects of endogenous opioids . quaternary derivatives of noroxymorphone are described in full in goldberg et al ., u . s . pat . no . 4 , 176 , 186 ( herein incorporated by reference ), and in general are represented by the formula : wherein r is allyl or a related radical such as chlorallyl , cyclopropyl - methyl or propargyl , and x is the anion of an acid , especially a chloride , bromide , iodide or methylsulfate anion . the presently preferred quaternary derivative of noroxyrnorphone is methylnaltrexone . methylnaltrexone is a quaternary amine derivative of naltrexone . methylnaltrexone has been found to have only 2 to 4 % of the opiate antagonistic activity of naltrexone in vivo due to its inability to pass the blood - brain - barrier and bind to the opiate receptors in the central nervous system . opioids are typically administered at a morphine equivalent dosage of . 0 . 005 to 0 . 15 mg / kg body weight for intrathecal administration ; 0 . 05 to 1 . 0 mg / kg body weight for intravenous administration ; 0 . 05 to 1 . 0 mg / kg body weight for intramuscular administration ; 0 . 05 to 1 . 0 mg / kg body weight / hour for transmucosal or transdermal administration . by “ morphine equivalent dosage ” is meant representative doses of other opioids which equal one milligram of morphine , for example 10 mg meperidine , 1 mg methadone , and 80 μg fentanyl . in accordance with the present invention , methylnaltrexone is administered at a dosage of : 0 . 001 to 1 . 0 mg / kg body weight for intravenous administration ; 0 . 001 to 1 . 0 mg / kg body weight for intramuscular administration ; 0 . 001 to 1 . 0 mg / kg body weight for transmucosal administration and 0 . 1 to 40 . 0 mg / kg body weight for oral administration . the administration of the methylnaltrexone is preferably commenced prior to administration of the opioid to prevent opioid - induced side effects , including constipation . it is desirable to commence administration of methylnaltrexone about 5 minutes for parenteral mntx administration and 20 minutes for enteral mntx administration prior to administration of opioids in order to prevent these opioid - induced side effects , while the prevention of symptoms is preferred , in some patients , such as those chronically on opioids , prevention is not possible . however , methylnaltrexone administration may also be commenced after the administration of the opioid or after the onset of opioid induced symptoms as a treatment for those symptoms . methylnaltrexone is rapidly absorbed after oral administration from the stomach and bowel . initial plasma levels of the drug are seen within 5 - 10 minutes of the administration of non - enteric coated compound . addition of an enteric coating which prevents gastric absorption is associated with lower plasma levels of the methylnaltrexone . for intravenous or intramuscular administration , methylnaltrexone ( from , e . g ., mallinckrodt pharmaceuticals , st . louis , mo .) is formulated with saline or other physiologically acceptable carriers ; for transmucosal administration the methylnaltrexone is formulated with a sugar and cellulose mix or other pharmacologically acceptable carriers known in the art ; and for oral administration , the methylnaltrexone is provided in granules which can be coated or left uncoated , and can be put in gelatin capsules . an enteric coating manufactured by coating place , inc ., verona , wis . can be made as follows . the drug was prepared by encapsulating mntx powder with a eudragit l100 and myvacet 9 - 45 mixture . the final substance used in the study was the 45 - 80 mesh fraction which was 50 % mntx by weight . this was demonstrated to decrease release of the drug at gastric ph by 77 % based on the methods of the usp / nf . these microencapsulated granules were then put into gelatin capsules for administration . alternatively , methylnaltrexone is formulated with pharmacologically acceptable binders to make a tablet or capsule with or without an enteric coating . methods for such formulations are well known to those skilled in the art ( see e . g ., remington : the science and practice of pharmacy , 19 th ed . ( 1995 ) mack publishing company , easton , pa . ; herein incorporated by reference ). any art - known transdermal application may be used , but transdermal administration is preferably via a patch applied to the skin with a membrane of sufficient permeability to allow diffusion of mntx at a fixed rate in the range of 1 . 0 to 10 . 0 mg / hr . the rate of administration may be varied by varying the size of the membrane contact area and / or applying an electrical wiring potential to a drug reservoir . the patch preferably holds 25 mg to 1 gram of available drug in the reservoir plus additional drug as needed for the mechanics of the system . in the description above and below , methylnaltrexone is used as an example of a particularly effective qdnm . it is apparent that other qdnms may be used as desired , and appropriate dosage can readily be determined empirically by those of skill in the art to account for e . g ., variable affinity of the qdnm for opiate receptors , different formulations , etc . the following examples are intended to illustrate aspects of the invention and are not to be construed as limitations upon it . with approval from the institutional review board at the university of chicago , two male and two non - pregnant female adults participating in a methadone maintenance program were enrolled in this study . all four subjects were african americans . their mean age ± sd ( range ) was 45 . 3 ± 8 . 6 ( 35 - 56 ) years . subjects in this study met the following inclusion criteria : ( 1 ) they were currently enrolled in a methadone maintenance program for at least 1 month ; ( 2 ) they experienced methadone - induced constipation , i . e . less than one bowel movement in the previous 3 days or less than three bowel movements in the previous week ( o &# 39 ; keefe et al ., j gerontol ., 50 : 184 - 189 ( 1995 ); parup et al ., scand . j gastroenterol , 33 : 28 - 31 ( 1998 )). exclusion criteria were as follows : ( 1 ) history or current evidence of significant cardiovascular , respiratory , endocrine , renal , hepatic , hematological or psychiatric disease ; ( 2 ) any laboratory findings indicating hepatic or renal impairment , or abnormal physical examination findings ; ( 3 ) current use of other medications , or evidence of illicit drug use ; ( 4 ) known hypersensitivity to lactose or lactulose ; ( 5 ) participation in any investigational new drug study in the previous 30 days ; ( 6 ) subject is breastfeeding . subjects also agreed not to take any laxatives for 2 days before the beginning of the study and during the study . after obtaining written , informed consent , subjects were admitted to the clinical research center at the university of chicago medical center for up to 8 days . methylnaltrexone dose of 0 . 45 mg / kg was chosen to start this trial because this dose was previously given in normal volunteers and prevented opioid - induced delay of the oral - cecal transit time without any side effects ( yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 )). drug administration was performed single blind to the subjects in this pilot study . thus , methylnaltrexone dose could be adjusted based on subjects &# 39 ; clinical response during the study . all four subjects received test drug ( normal saline or methylnaltrexone ( n - methylnaltrexone bromide , prepared by mallinckrodt specialty chemicals , st . louis , mo )) twice daily at 09 : 00 h and 21 : 00 h , except on the last day of the study in which they received test drug only at 09 : 00 h . all four subjects received placebo ( normal saline ) on day 1 . thereafter , subjects received intravenous methylnaltrexone until the end of the study . on day 2 at 09 : 00 hours ( h ), subjects 1 and 2 were given 0 . 45 mg / kg intravenous methylnaltrexone over 1 min . subject 2 experienced severe abdominal cramps after receiving the compound and was withdrawn from the study . subject 1 did not experience abdominal cramps after the first dose of methylnaltrexone , but was given placebo in place of the compound at the regularly scheduled dosing times for day 2 and day 3 to maintain the single blind study while the reaction of subject 2 was investigated . beginning on day 4 , the study was resumed for subject 1 using 0 . 45 mg / kg of methylnaltrexone , diluted with 50 ml normal saline and administered over 30 min . infusion could be stopped at any time for complaints of abdominal pain . for subjects 3 and 4 , the study was shortened from 8 to 5 days , methylnaltrexone dosage was decreased , and a new , three - step dosing procedure was established . methylnaltrexone 0 . 05 mg / kg , mixed in 30 ml normal saline ( first syringe ), was infused intravenously over 10 min . the subject was then observed 10 min for drug response . if there was no response , then methylnaltrexone 0 . 1 mg / kg ( second syringe ), mixed in 30 ml normal saline , was infused over 15 min . subject was observed 15 min for drug response . if there was no response , then methylnaltrexone 0 . 3 mg / kg ( third syringe ), mixed in 30 ml normal saline , was infused over 15 min . vital signs were obtained at 0 , 5 , 10 , 30 , 60 , 90 and 120 min after each test drug administration . for oral - cecal transit time measurement , 10 g lactulose ( solvay pharmaceuticals , marietta , ga .) was administered orally at 09 : 00 h of day 1 , day 5 and day 8 for subject 1 ; of day 1 for subject 2 and of day 1 , day 3 and day 5 for subjects 3 and 4 . illicit drug use was monitored by random urine drug screens . after each test drug administration , seven blood samples ( 5 ml each ) were obtained at time 0 , 5 , 30 min , and 1 , 2 , 4 , 8 h , and three urine samples were collected at time 0 , 2 , and 4 h . plasma and urine methylnaltrexone levels were determined by an hplc technique with a detection limit of 2 ng / ml ( kim et al ., 1989 ; yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 ); both herein incorporated by reference ). subjects were asked to record frequency and consistency of stools during the study period . subjects &# 39 ; bowel movements were witnessed and recorded by a research nurse . the oral - cecal transit time was assessed by the pulmonary hydrogen ( h 2 ) measurement technique , which measures pulmonary h 2 that is produced when unabsorbed lactulose is fermented by colonic bacteria and excreted in the breath . this h 2 production is reflected by a concomitant increase in breath h 2 excretion . the time between ingestion and the earliest detectable and sustained rise in pulmonary hydrogen excretion , i . e ., a sudden rise to peak (& gt ; 25 ppm ), or an increase of at least 2 ppm above the baseline , maintained and increased in three consecutive samples , indicates that lactulose has reached the cecum and represents the oral - cecal transit time ( see e . g ., yuan , et al ., clin . pharmacol ther ., 59 : 469 - 475 ) ( 1996 ); bond and levitt , j . lab clin . med , 85 : 546 - 555 ( 1975 ); read , et al ., gut ., 26 : 834 - 842 ( 1985 ) bailisco , et al , dig . dis . sci ., 32 : 829 - 832 ( 1987 )). hydrogen breath tests were conducted every 15 min until oral - cecal transit time was determined . to evaluate possible opioid withdrawal with methylnaltrexone , subjects were asked to rate on a 5 - point scale from 0 ( not at all ) to 4 ( extremely ) an objective checklist withdrawal scale ( fraser et al ., j pharmacol exp . ther , 133 : 371 - 387 ( 1961 ); jasinski , drug addiction j ., 197 - 258 ( 1977 ); both herein incorporated by reference ). items to be rated were : muscle cramps , flushing , painful joints , yawning , restless , watery eyes , runny nose , chills or gooseflesh , sick to stomach , sneezing , abdominal cramps , irritable , backache , tense and jittery , sweating , depressed / sad , sleepy , shaky ( hands ), hot or cold flashes , and bothered by noises . the ratings for individual items were summed for a total score for each scale . the total scores were compared before and after methylnaltrexone administration to see if there was a significant difference . all four subjects showed no response to placebo injection . subjects 1 and 2 , who received a methylnaltrexone dose of 0 . 45 mg / kg , showed immediate positive laxation during or immediately after intravenous drug infusion . during 7 days of methylnaltrexone administration , subject 1 did not experience any significant side effects , and reported mild abdominal cramping after each injection . subject 2 , however , had severe abdominal cramping after a single dose of methylnaltrexone , but showed no signs of systemic withdrawal such as lacrimation , diaphoresis , mydriasis , or hallucinations . subject 2 was released without receiving additional methylnaltrexone . subjects 3 and 4 received intravenous methylnaltrexone ( 0 . 05 - 0 . 15 mg / kg ) twice daily for 4 consecutive days . this 0 . 05 - 0 . 15 mg / kg dose range induced immediate laxation response in these two subjects , therefore , the third syringe injection ( methylnaltrexone dose 0 . 3 mg / kg dose ) was not administered during the study . no significant side effects were observed . like subject 1 , both subjects described mild abdominal cramping , similar to a defecation sensation , without discomfort involved . the stool frequency of these subjects increased from 1 - 2 times per week before the study to approximately 1 . 5 stool per day during the treatment period ( table 1 ). for subjects 1 , 3 , and 4 , oral - cecal transit times were reduced from 150 , 150 and 150 min ( after placebo ) to 90 , 60 and 60 min ( after methylnaltrexone , at the end of the study ), respectively . the baseline transit time for subject 2 was 180 min . due to the discontinuation . of this subject , no other transit time was recorded after day 1 . peak plasma methylnaltrexone levels for subjects 1 , 2 , 3 and 4 were 1 . 65 , 1 . 10 , 0 . 25 and 0 . 53 μg / ml , respectively . in previous healthy volunteer studies , intravenous 0 . 45 mg / kg methylnaltrexone effectively prevented opioid - induced delay in oral - cecal transit time without affecting analgesia ( yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 )). however , that study was performed in normal volunteers after acute single administration doses of opioid and methylnaltrexone . thus , the dose relationship of agonist to antagonist remained unknown in opioid - tolerant individuals , such as subjects in methadone maintenance programs as well as advanced cancer patients with chronic opioid pain medications . when this study was designed , 0 . 45 mg / kg intravenous methylnaltrexone was chosen , the dose previously administered in normal volunteers that did not cause gastrointestinal symptoms ( e . g . abdominal cramping ) or laxation response . to achieve positive laxation while limiting the possibility of adverse effects , bid dosing was planned for 7 days . due to the fact that the elimination half - life of intravenous methylnaltrexone is approximately 2 h ( yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 ); foss et al ., j clin . pharmacol , 37 : 25 - 30 ( 1997 )), no drug accumulation was expected in this study . after intravenous injection , immediate bowel movements were observed in the first two subjects . while methylnaltrexone has been demonstrated to not reverse the analgesic effects of opioids ( yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 )), the potential effects of the compound in a population of chronic opioid users was unknown . gastrointestinal symptoms are one of the hallmarks of gut withdrawal , and the persistent severe cramping in subject 2 , which required treatment , prompted a modification of the protocol . it is important to note , however , that none of the other primary indicators of opioid withdrawal were noted in this or any of the other subjects . for the next two subjects , the drug dose was reduced and the study duration shortened . while no effects were observed after placebo , positive laxation and significant reduction of the gut transit time were observed after a lower intravenous dose of methylnaltrexone in these two chronic methadone subjects . peak plasma levels of methylnaltrexone in all subjects were determined and were comparable to those seen in volunteers given similar doses ( yuan et al ., clin . pharmacol ther ., 59 : 469 - 475 ( 1996 ); foss et al ., j clin . pharmacol , 37 : 25 - 30 ( 1997 )). subject 1 , who had laxation but no other symptoms actually had higher peak plasma levels than subject 2 ( with the severe abdominal cramping ), suggesting a difference in subject 2 &# 39 ; s pharmacological response rather than a difference in pharmacokinetics . the three subjects who completed the study reported mild abdominal cramping during intravenous methylnaltrexone infusion . the mild cramping appears to be a physiological desire to move the bowels , because the cramping disappeared after their bowel movement . since the half - life of methylnaltrexone is approximately 2 h , one would expect that cramping caused by hyperactivity of the gut to be more prolonged . this indicates that methylnaltrexone and similar qdnms are safe and ideal candidates to resolve opioid induced constipation without stimulant / laxative type side effects . this example was a double - blind , randomized , placebo - controlled trial , evaluating the effects of methylnaltrexone in treating chronic opioid - induced constipation . we conducted this trial using subjects in a methadone maintenance program , in which approximately 60 % of the chronic methadone users have constipation . these subjects served as a proxy group for advanced cancer patients to evaluate the efficacy of methylnaltrexone on chronic opioid - induced constipation . with approval from the institutional review board , 9 male and 13 non - pregnant , non - breastfeeding female adults were enrolled ( fig1 ). their mean age ± s . d . ( range ) was 43 . 2 ± 5 . 5 ( 25 - 52 ) years . subjects met the following inclusion criteria : ( 1 ) enrollment in a methadone maintenance program for & gt ; 1 month ; ( 2 ) methadone - induced constipation , i . e ., 0 - 1 bowel movement in the previous three days , or 0 - 2 bowel movements in the previous week ; ( 3 ) no laxative use two days before the study nor during the study . exclusion criteria were as in the previous example . an investigator explained the study procedures and obtained written , informed consent from 22 paid subjects . these subjects , who continued to receive their usual dose of methadone during the study , were admitted to the clinical research ( center at the university of chicago medical center for two days . an intravenous catheter was placed in each arm , one for test drug administration ( placebo or methylnaltrexone [ n - methylnaltrexone bromide ], prepared by mallinckrodt specialty chemicals , st . louis , mo . ), and the other for blood drawing . on day 1 , at 9 am , after a restricted supper of no fiber the night before ( required for the oral - cecal transit time measurement , see below ) and overnight fasting , subjects were instructed to ingest 10 g lactulose ( solvay pharmaceuticals , marietta , ga .) in 1 . 00 ml tap water . subjects were also given placebo ( normal saline ) in four syringes ( 35 ml each ) for intravenous injection ( single - blinded to the subject ). on day 1 , at 5 pm , subjects were given placebo or methylnaltrexone up to 0 . 365 mg / kg over four syringes . each syringe contained placebo or methylnaltrexone in 35 ml of normal saline , and was administered intravenously over nine minutes . for the methylnaltrexone group , syringes 1 , 2 , 3 and 4 contained 0 . 015 , 0 . 05 , 0 . 1 and 0 . 2 mg / kg study drug , respectively . the interval between administration of each syringe in both groups was one minute . the continued administration of each syringe depended on the absence of a clinical laxation response ( i . e ., elimination of any stool ) and / or potential side effects . immediate laxation was defined as defecation either during or within one minute after cessation of the infusion . the injection was discontinued if the subject had a bowel movement . after a non - fiber supper the night before and overnight fasting , subjects on day 2 at 9 am , were again given test drug intravenously . subjects were also given 10 g lactulose at this time . day 2 studies were done to test the constancy of effect and to measure the oral - cecal transit time ; this study did not have a crossover design . injection assignment was prepared using a table of random numbers from which sealed envelopes were prepared and opened sequentially as subjects were enrolled in the study . no stratification or blocking factors were used , except to insure that equal numbers of subjects were assigned to each treatment group after enrollment of the last ( 22 nd ) subject . randomization and test drug preparation were done by a biostatistician and a physician , respectively , who did not participate in data acquisition and evaluation . vital signs were obtained at 0 , 5 , 10 , 30 , 60 , 90 and 120 min after each test drug administration . illicit drug use was monitored by random urine drug screens . blood and urine sampling and analysis were performed as in example 1 . subjects were asked to record frequency and consistency of stools during the study period . subjects &# 39 ; bowel movements were confirmed and recorded by a research nurse blinded to the group assignment . at the end of the study , the subjective opinion of each participant was gathered in order to rate subjects &# 39 ; satisfaction in respect to bowel movement . to evaluate possible opioid withdrawal with methylnaltrexone , before and 10 min after the completion of test drug administration , subjects were asked to complete an objective checklist of withdrawal symptoms modified from fraser et al . ( j . pharmacol exp . ther ., 133 : 371 - 387 ( 1961 )) and jasinski ( drug addiction j ., 197 - 258 ( 1977 )). items rated ( none , mild , moderate , severe ) were yawning , lacrimation ( excessive tearing ) rhinorrhea ( nasal discharge ), perspiration , tremor , piloerection ( goosebumps ), and restlessness . the ratings for individual items were translated to a 0 - 3 scale and summed to give a total symptom score . the total scores before and after test drug administrations were compared between the groups . potential opioid withdrawal symptoms were also monitored by an investigator throughout the study . laxation responses were compared between groups using fisher &# 39 ; s exact test . the mann - whitney u test was used to compare the change from baseline in oral - cecal transit time between the two groups and to evaluate statistical differences between genders in oral - cecal transit times with p & lt ; 0 . 05 considered statistically significant . changes in opioid withdrawal symptoms were analyzed similarly . the mean stool frequency per week of the 22 subjects before the study was 1 . 5 ± 0 . 7 . all 22 subjects showed no response to placebo in the morning of day 1 . eleven subjects were randomized to each treatment group . those randomized to placebo received all four syringes in day 1 afternoon and day 2 morning sessions . as shown in table 2 , none of them showed any laxation response after placebo , and no abdominal cramping was reported . at the end of the trial , seven of them were disappointed in respect to bowel movement satisfaction . there were no significant bowel movement frequency changes before and during the study . there were no opioid withdrawal and no significant side effects in these subjects . ten subjects in the methylnaltrexone group had immediate laxation response in the day 1 afternoon session , and all 11 subjects had immediate laxation in the day 2 morning session ( fisher &# 39 ; s exact p value & lt ; 0 . 0001 when compared with placebo group response for both days 1 and 2 ). the stool of most subjects ( over 90 %) was soft to loose and in large quantity . the methylnaltrexone dose received was 0 . 09 ± 0 . 10 ( 0 . 01 - 0 . 37 ) mg / kg and 0 . 10 ± 0 . 10 ( 0 . 01 - 0 . 37 ) mg / kg for day 1 and day 2 , respectively . fig2 shows the relationship between effective methylnaltrexone dose and peak plasma concentration . during and immediately after each study drug injection , all subjects reported mild to moderate abdominal cramping , which they described as being similar to a defecation sensation , without discomfort involved . there was no opioid withdrawal symptoms observed in any of these subjects during the study . no significant side effects were reported by the subjects . subject 13 reported mild light - headedness which resolved spontaneously . no subject demonstrated any clinically significant change in blood pressure or heart rate from baseline with either the placebo or study drug infusions . subjects did not have additional bowel movements after drug - induced - immediate laxation , except subject 15 who reported mild diarrhea . at the end of the study , all 11 subjects were satisfied with their bowel movement activity ( table 2 ). oral - cecal transit time data are presented in fig3 . the transit times for subjects in the placebo group ( n = 11 ) at baseline and after placebo injection were 126 . 8 ± 48 . 3 ( 60 - 195 ) min and 125 . 3 ± 45 . 0 ( 60 - 180 ) min , respectively . the transit times for subjects in the methylnaltrexone group ( n = 11 ) showed that the study drug reduced the transit time from the baseline level of 132 . 3 ± 36 . 0 ( 60 - 180 ) min to 54 . 5 ± 19 . 3 ( 30 - 105 ) min . the average change in the methylnaltrexone group (− 77 . 7 ± 37 . 2 ( min ) was significantly greater than the average change in the placebo group ( 1 . 4 ± 12 . 0 min ) ( p & lt ; 0 . 001 ). there were no statistical differences in oral - cecal transit times between genders . peak plasma levels of 11 subjects in methylnaltrexone group for day 1 and day 2 were 162 ± 237 ( 30 - 774 ) ng / ml and 166 ± 177 ( 33 - 658 ) ng / ml , respectively . the percentage of the intravenous dose excreted , unchanged in urine from 0 to 4 hr for day 1 and day 2 was 23 . 7 ± 10 . 5 ( 9 . 6 - 39 . 9 ) % and 37 . 6 ± 17 . 8 ( 13 . 2 - 73 . 6 ) %, respectively . the effect of opioids on gastrointestinal motility and transit is well appreciated as a clinical phenomenon . opioids inhibit gastric emptying and propulsive motor activity of the intestine , thereby decreasing the rate of intestinal transit and producing constipation . it has been shown that opioid receptors and endorphins are widely distributed in the central nervous system and throughout the gastrointestinal tract . based on data obtained from previous animal experiments , the site of opioid action ( central vs . peripheral ) of exogenous opioid - induced gut motility change or constipation is still controversial ( daniel , et al ., gastroenterology , 36 : 510 - 523 ( 1959 ); stewart , et al ., j . pharmacol exp . ther ., 205 : 547 - 555 ( 1978 ); tavani , et al ., life sci ., 27 : 2211 - 2217 ( 1980 ); galligan and burks , j pharmacol exp . ther ., 226 : 356 - 361 ( 1983 ); manara , et al ., j . pharmacol exp . ther ., 237 : 945 - 949 ( 1986 )). since the translation of animal experiment data in the literature to humans is problematic due to differences in the physiology of the opioid systems , the action site for opioid - induced constipation in humans remains a matter of investigation . methylnaltrexone , a peripheral opioid receptor antagonist , very effectively reversed chronic opioid constipation in this clinical trial . the data in these examples provide the first strong evidence that the methadone constipating effect in humans is predominantly mediated by receptors located in the peripheral gastrointestinal tract . all 11 subjects who received intravenous methylnaltrexone had an immediate laxation response , and all reported some degree ( mild to moderate ) of abdominal cramping prior to their bowel movement . we interpret their abdominal cramping as a physiological desire to defecate , because the cramping disappeared after their bowel movement . because the half - life of methylnaltrexone is approximately two hours , one would expect that cramping caused by hyperactivity of the gut to be much more prolonged . the lactulose hydrogen breath test was used , and subjects always received placebo the morning of day 1 to establish an oral - cecal transit time baseline . compared to baseline levels , we observed a significant reduction in gut transit time in all subjects after methylnaltrexone treatment . this result is consistent with the methylnaltrexone - induced clinical laxation response in these individuals . lactulose , a non - absorbable osmotic agent that acts in the colon by increasing water content of the stool without directly stimulating gut peristaltic activity , may have laxative effects itself and could affect interpretation of our results . however , the dose used in this study ( 10 g ) is ½ to ⅓ of a single dose and ⅙ th { fraction ( 1 / 12 )} th the daily dose recommended to produce soft stools . this small dose of lactulose had no effect in our study , as indicated by the absence of a laxation response as well as no change in oral - cecal transit time in the placebo group . a relatively wide dose range of intravenous methylnaltrexone was used to achieve clinical laxation . in terms of individual subjects , however , the laxation doses for day 1 and day 2 were very similar , and no tachyphylaxis was noticed . in this study , no opioid withdrawal symptoms were observed in our chronic methadone subjects , which further indicates that methylnaltrexone does not penetrate into the brain in humans . none of the 11 subjects in the methylnaltrexone group experienced significant side effects . since oral medication is a safer and more convenient way to deliver drugs than is intravenous administration , the efficacy of oral mntx in relieving constipation in methadone maintained patients was evaluated . twelve constipated adults (≦ 2 stool / week ) were enrolled . their daily methadone dose was 73 . 3 ± 16 . 2 mg ( 41 - 100 mg ), mean ± sd ( range ). on day 1 at 9 am , subjects ingested 10 g lactulose ( solvay pharmaceuticals ) to assess oral - cecal transit time as described above , and a placebo capsule . on day 2 at 9 am , subjects again received lactulose , and a capsule containing methylnaltrexone ( mallinckrodt ). ascending oral methylnaltrexone doses ( 0 . 3 , 1 . 0 , and 3 . 0 mg / kg ) were given to 3 groups of 4 subjects per group . drug administrations were single - blinded to the subject . laxation response and potential opioid withdrawal were recorded and blood samples were collected . none of the 12 subjects showed laxation response to placebo on day 1 . on day 2 , 3 out of 4 subjects had a bowel movement 18 . 0 ± 8 . 7 hr ( 8 - 24 hr ) after receiving 0 . 3 mg / kg mntx . all subjects in the 1 . 0 mg / kg group and 3 . 0 mg / kg group had bowel movements at 12 . 3 ± 8 . 7 hr ( 3 - 24 hr ) and 5 . 2 ± 4 . 5 hr ( 1 . 2 - 10 hr ) after receiving oral compound , respectively . most subjects reported very mild abdominal cramping after oral mntx . bowel movements , in most cases , were loose and in large quantity . there was no opioid withdrawal in any subjects , and no adverse effects were reported . dose - related reduction of oral - cecal transit times is shown in fig4 . oral mntx has a significant dose - response effect ( p & lt ; 0 . 05 ) using the spearman rank correlation coefficient test and linear regression model . eight subjects had undetectable methylnaltrexone in their plasma . peak plasma level for another 4 subjects ( one from 1 . 0 mg / kg group and three from 3 . 0 mg / kg group ) was 17 . 8 ± 6 . 6 ng / ml ( 10 - 26 ng / ml ). with approval from the institutional review board at the university of chicago , seven men and seven nonpregnant women were enrolled in this double - blind , randomized placebo - controlled study . mean age ± sd was 25 . 8 ± 8 . 4 years : age range was 18 to 43 years . subjects were screened for drug abuse disorders or medical contraindications that would keep them from participating in the study . subjects fasted from midnight the night before the study day and were admitted for each experimental day ( or session ) in the morning to the clinical research center at the university of chicago medical center . sessions were separated by at least 1 week . each session lasted approximately 7 hours , and the subjects received one of three injections : ( 1 ) placebo plus placebo , ( 2 ) placebo plus 0 . 05 mg / kg morphine , or ( 3 ) 0 . 45 mg / kg methylnaltrexone plus 0 . 05 mg / kg morphine . injection 1 was given at the first session , and the subjects were blinded to the medication . injections 2 and 3 were given in a random order , and the subjects and observers were blinded to the medication . injection assignments were prepared by random selection on a computer and were sealed in envelopes . drug preparation and administration was done by a physician who did not participate in subject observation and data acquisition . after completion of the above three injections , we asked six of the subjects , beginning with those who had completed the study last , to return for a fourth injection ( 0 . 45 mg / kg methylnaltrexone plus 0 . 1 mg / kg morphine ). this was done to evaluate the effects of methylnaltrexone with a higher does of morphine . the following drugs were used : morphine sulfate ( elkins - sinn , cherry hill , n . j . ), n - methylnaltrexone bromide ( mallinckrodt specialty chemicals , st . louis , mo . ), and lactulose ( duphalac , solvay pharmaceuticals , marietta , ga .). results of the hydrogen breath test after different injections were analyzed with the use of the wilcoxon matched - pairs signed - rank test , with p & lt ; 0 . 05 considered to be statistically significant . the mann - whitney u test was used to evaluate statistical differences between genders in oral - cecal transit times and in cold - indicted paid scores . two female subjects were excluded from the study after the first ( placebo plus placebo ) session . one of them showed a relatively high and unstable baseline h 2 peak value ( 12 ppm ) 2 hours after drinking lactulose . h 2 production requires a colonic bacterial flora capable of fermenting carbohydrate and yielding h 2 . in in vivo studies of humans who had ingested lactulose and in vitro studies of fecal incubates with varying carbohydrates , h 2 was not produced in 2 % to 27 % of individuals tested . oral - cecal transit times are reported in fig5 . transit time increased after morphine administration in all 12 subjects and methylnaltrexone prevented the morphine - induced delay in every subject . morphine significantly increased oral - cecal transit time from a baseline level of 104 . 6 ± 31 . 1 minutes ( mean ± sd ) to 163 . 3 ± 39 . 8 minutes p & lt ; 0 . 01 ). methylnaltrexone plus morphine did not increase transit time ( 106 . 3 ± 39 . 8 minutes , not significant compared with baseline ; p = 0 . 56 ). methylnaltrexone prevented 97 % of morphine - induced changes in oral - cecal transit time ( p & lt ; 0 . 01 compared with morphine alone ). there were not statistical differences in oral - cecal transit times between genders . table 3 summarizes the results . humans do not appreciably de - methylate methylnaltrexone . results from a phase i trial with eight normal volunteers showed that doses of methylnaltrexone up to 0 . 32 mg / kg did not cause side effects ; doses of 0 . 64 to 1 . 25 mg / kg were associated with transient orthostatic hypotension ( foss et al ., unpublished data , 1993 ). the effect of opioids on gastrointestinal motility and transit is appreciated as a clinical phenomenon . however , the mechanism of the opioid constipating action is not fully understood . the major factors responsible include the delay of gastric emptying and changes in the motility and transit in the small intestine and the colon . increased intestinal absorption may also contribute to morphine - induced constipation because of the change in the consistency of the stools . in this study , we observed a significant delay in oral - cecal transit time after intravenous morphine injection in human subjects and the delay was effectively antagonized by concomitant administration of methylnaltrexone . this result suggests that methylnaltrexone can reverse morphine - induced peripherally mediated effects on the gastrointestinal tract . in the united states , approximately 500 , 000 patients die of cancer annually . opioid pain medication is used in the terminal phase of care for over 50 % of these patients , and constipation , a significant clinical problem , affects 40 - 50 % ( approximately 125 , 000 ) of patients with metastatic malignancy who receive opioid pain medications ( schug , et al ., j . pain & amp ; symptom management , 7 : 259 - 266 ( 1992 ); wingo , et al ., ca : a cancer j . for clin ., 45 : 8 - 30 ( 1995 )). a significant number of hospice patients receiving chronic opioids for pain would rather endure their pain than face the severe incapacitating constipation that opioids cause . results described herein demonstrate that chronic methadone subjects are very sensitive to intravenous methylnaltrexone compared to normal opioid naive subjects in a previous trial , who received 0 . 45 mg / kg methylnaltrexone without any laxation response ( yuan et al ., clin . pharnacol ther ., 59 : 469 - 475 ( 1996 )). comparison of the results of example 4 with examples 1 - 3 demonstrates the increased responsiveness of chronic opioid patients to the effects of methylnaltrexone . lower doses of methylnaltrexone provide constipation relief to these patients comparable to that observed in normal patients administered higher doses of methylnaltrexone . thus , patients having increased sensitivity to methylnaltrexone , such as chronic methadone users or cancer patients receiving chronic opioids , can benefit from very low doses of methylnaltrexone to manage their opioid induced constipation . this invention can substantially improve the quality of life for terminally ill patients and others chronically using opioids . the preceding description and examples are intended to be illustrative . those skilled in the art to which the invention pertains will appreciate that alterations and changes in the described protocols may be practiced without departing from the meaning , spirit , and scope of this invention . therefore , the foregoing description should be read consistent with and as support to the following claims , which are to have their fullest and fair scope . | 0 |
the present art overcomes the prior art limitations by assembling a fragrance formulation from its components then mixing the fragrance with one of two classes of polymer , the fragrance may go in between phases or just in one phase based on our u . s . pat . no . 7 , 700 , 665 for which a solvent can be added as an option , and then mixing the polymer carrying the fragrance with the dissolved polymer resulting in a gel product with minimal syneresis and a more consistent setting time . though the components of the invention are few in number , the sequence of mixing forms the key to the present invention . turning to fig1 , a block diagram shows the fragrant gel polymer system from initial components to the resulting product . the present invention 1 begins with the components of a fragrance formulation selected by a fragrance house or manufacturer . a fragrance may have as many components as determined by the designers and chemists of the fragrance house . the present invention then mixes the components to form the fragrance f , generally in a liquid state , as at 4 . the fragrance is then mixed with either a polymer , as at a , or a cross linking agent , as at b , with the mixing step shown as at 5 . the polymer derives from butadiene , isoprene or chloroprene . preferably the polymer , as at a , is maleinized polybutadiene of at least 5000 molecular weight . alternatively , the polymer includes maleinized polyisoprene of at least 200 , 000 molecular weight . these polymers are readily available from commercial chemical sources . a preferred polymer is lithene ® by synthomer ®, typically lithene ® n4 - 9000 10 ma , which is a maleinized polybutadiene of a 9000 molecular weight before maleinization . the other component , a cross - linking agent comes from the amine family of polymers , including polypropoxy diamines , polypropoxy triamines and polyethoxydiamines . a preferred cross linking agent , as at b , is jeffamine ® by huntsman ® corp ., such as the jeffamine ® d - 400 , which is polyetheramine . in a liquid state , the fragrance is then blended with either a polymer or a cross linking agent . the fragrance carrying polymer then proceeds for further manufacturing as at 9 . segregated from the fragrance carrying polymer , the polymer or cross linking agent not used in the preceding mixing step , as at 6 , is optionally blended as at 8 with a solvent 7 . when optionally blended with the solvent , the non - fragrance carrying polymer becomes a homogeneous liquid . preferably the solvent is benzyl benzoate . alternatively , the solvent includes di - propylene glycol , isopropyl myristate , alcohol , mineral oil , and the like . alternatively , the solvent includes substitutes for benzyl benzoate having similar function , particularly esters . such esters include di - ethyl phthalate , diisoheptyl phthalate a / k / a jayflex 77 ® from exxonmobil of houston , tex ., triethyl citrate , 2 - tert - butylcyclohexyl acetate a / k / a argumex a / k / a green acetate from symrise gmbh of teterboro , n . j . and holzminden , germany , diethyl malonate , ethyl benzoate , benzyl butyrate , and methyl benzoate . di - ethyl phthalate is a plasticizer of low risk to humans with a boiling point of approximately 563 ° f . diisoheptyl phthalate a / k / a jayflex 77 ® from exxonmobil of houston , tex . is another plasticizer with a flash point of 113 ° c . triethyl citrate serves as a plasticizer that also stabilizes foams and it has a boiling point of 235 ° c . green acetate , 2 - tert - butylcyclohexyl acetate a / k / a argumex dissolves in alcohol and paraffin oil but not water and it has a boiling point of 221 ° c . diethyl malonate also plasticizes perfume formulations while it has a boiling point of 199 ° c . ethyl benzoate , a plasticizer , is nearly insoluble in water but blends with others solvents to provide a component for fruit like perfume . ethyl benzoate has its boiling point of approximately 211 ° c . benzyl butyrate does not dissolve in water but does dissolve in alcohol and select oils for use as a plasticizer and while it has a boiling point of approximately 238 ° c . and , methyl benzoate also does not dissolve in water but blends with organic solvents as a plasticizer to provide a fruit like smell to perfumes . methyl benzoate has its boiling point of approximately 199 ° c . the solvents solely modify the viscosity of the non - fragrance carrying polymer and prepare it for mixing with the fragrance carrying polymer , 5 , to form a gel . with the fragrance carrying polymer prepared as at 9 and the non - carrying fragrance polymer ready as at 10 , the liquid fragrance carrying polymer is blended with the liquid non - fragrance carrying polymer in a mold to a desired shape , often an air freshener or fragrance sample , thus the present invention forms a gel product 1 . the preferred embodiment of the process for this invention assembles a fragrance formulation from its components then mixing the fragrance in two portions , one with a polymer and the second with a cross linking agent . the cross linking portion then receives water or a wetting agent 11 and an alcohol , preferably ethanol . then both the polymer portion and the cross linking portion have dyes and solvents added , and then the polymer portion and the cross linking portions are mixed , resulting in a gel product nearly transparent and with reduce steric hindrance from the fragrance materials . though the components of the invention are few , their mixing sequence again forms the key to the present invention . so , turning to fig2 , a block diagram shows the fragrant gel polymer system from initial components to the resulting product . the present invention 1 begins with the components of a fragrance formulation selected by a fragrance house or manufacturer . as before , a fragrance may have many components provided by third parties , often subject to trade secrets , and at other times unknown . the present invention then separates the fragrance into a major portion f , as at 4 , and a minor portion f ′, as at 4 a , generally in a liquid state . the major portion 4 is then blended with a polymer , as at a , with the later mixing step shown as at 5 . the polymer derives from butadiene , isoprene or chloroprene . preferably the polymer , as at a , is maleinized polybutadiene of at least 5000 molecular weight . alternatively , the polymer includes maleinized polyisoprene of at least 200 , 000 molecular weight . these polymers are readily available from commercial chemical sources . a preferred polymer is lithene ® by synthomer ®, typically lithene ® n4 - 9000 10 ma , which is a maleinized polybutadiene of a 9000 molecular weight before maleinization . in a liquid state , the major portion of the fragrance dissolves into the polymer , preferably lithene ®. the major portion of fragrance is generally miscible with the polymer where the major portion dissolves into the polymer at all proportions . the polymer with dissolved fragrance then receives various dyes for a select coloration and at least one solvent , s as at 7 , to aid in liquefying the polymer and dissolved fragrance . the solvents operate to aid fluid mixing during manufacturing . in the preferred embodiment , the polymer component has about 16 % to about 21 % by weight of maleinized polybutadiene , about 30 % to about 60 % by weight of major fragrance portion , an optional solvent , and an optional dye . meanwhile as the polymer component is blended , the cross linking agent undergoes separate blending . the cross linking agent comes from the amine family of polymers , including monoamines , polypropoxy diamines , and polyethoxydiamines but not triames . a preferred cross linking agent , as at b , is jeffamine ® by huntsman ® corp ., such as the jeffamine ® d - 400 , which is polyetheramine . the cross linking agent then has an optional solvent , s as at 7 , blended with it also shown at step b . after blending the cross linking agent , and the optional solvent , the cross linking component achieves a liquid state where the solvent is miscible with the cross linker . then in the liquid state , the cross linking agent receives aliphatic alcohol and water , as at c , where the aliphatic alcohol is provided by pride solvents & amp ; chemicals , inc ., holtsville , n . y . the cross linking agent , alcohol , and water are mixed until in a uniform liquid state . the preferred alcohol for the process of the invention is ethanol . ethanol has two carbon atoms that allow it to dissolve in water at all proportions , that is , ethanol has high miscibility with water . then the minor portion 4 a of fragrance is blended with the cross linking agent component and an accelerator made by huntsman ® but excluding tea as at step d . the accelerator allows the process of the invention to cure a gel more quickly than it would otherwise . in the preferred embodiment , the cross linking component has about 1 % to about 5 % by weight of polyetheramine , about 1 % to about 10 % by weight of solvent , about 1 % to about 8 % by weight of aliphatic alcohol , about 1 % to about 5 % by weight of water , about 0 . 0001 % to about 30 % by weight of minor fragrance portion , about 0 . 05 % to about 2 % by weight of accelerator , and an optional dye . with the fragrance carrying polymer component prepared , as at 9 , and is the cross linking component ready as at 10 , the two components are mixed , as at 5 , with the polymer component on the high side and the cross linking component on the low side . the combined solution is then placed in a mold of a desired shape , often an air freshener or fragrance sample , to cure and thus the present invention forms a gel product 1 . from the aforementioned description , a fragrant gel polymer with water system has been described . the system is uniquely capable of combining all of the fragrance components with a polymer and a cross linking agent in liquid form and then mixing the fragrance carrying polymer with the cross linking component , including water , to make a transparent gel product providing a fragrance . the system may be manufactured from many materials , including but not limited to , lithene ®, jeffamine ®, polymers , cross linking agents , water , alcohol , ethanol , solvents , esters , blends and combinations thereof . | 0 |
the following description is presented to enable a person skilled in the art to make and / or use the invention . for purposes of explanation , specific nomenclature is set forth to provide a thorough understanding of the present invention . the present invention includes a variety of aspects , which may be combined in different ways . descriptions of specific embodiments or applications are provided only as examples . various modifications to the embodiments will be readily apparent to those skilled in the art , and general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest possible scope consistent with the principles and features disclosed herein . at least one of the inventive embodiments of the wakeboard , particularly as it relates to twin tip wakeboards , is a wakeboard 1 that comprises a first tip section 2 at the first end 3 of the wakeboard 1 and a second tip section 4 at the second end 5 of the wakeboard 1 . the inventive embodiment further comprises an intermediate longitudinal section 6 between the first tip section 2 and the second tip section 4 , where the first tip section has a first tip section terminus 7 and the second tip section has a second tip section terminus 8 . the intermediate longitudinal section 6 includes a first edge or rail 9 and a second edge or rail 10 . the wakeboard 1 of the invention has a longitudinal axis 13 which is generally parallel to the rails ; a perpendicular latitudinal axis 12 which runs between first rail 9 and a second rail 10 and is generally parallel to the board &# 39 ; s first tip section 2 and the second tip section 4 . fig1 is a side view an embodiment of the inventive wakeboard 1 . as depicted in fig1 , the wakeboard 1 includes a first tip section 2 located at the first end 3 of the wakeboard 1 and a second tip section 4 at the second end 5 of the wakeboard 1 . the wakeboard also has a centerline 11 that is located at the mid - point between the first tip terminus 7 and the second tip terminus 8 , and is generally positioned between the rider &# 39 ; s feet when the board is in use . the centerline 11 runs along the latitudinal axis 12 ( fig2 ) of the board which is oriented parallel to the first tip section 2 and the second tip section 3 . in fig1 the board &# 39 ; s rockerline can be seen starting from the first tip section 2 . in the first tip section 2 the board &# 39 ; s rockerline rapidly descends from the first tip section terminus 7 all the way across the board &# 39 ; s latitudinal axis 12 to the intermediate longitudinal section 6 of the wakeboard 1 . in preferred embodiments , the descent may occur at angles between 60 and 30 degrees . the rockerline then descends less rapidly through the intermediate longitudinal section 6 all the way across the board &# 39 ; s latitudinal axis 12 to the first low point 14 . in preferred embodiments , this descent may occur at angles between 30 and 3 degrees . at the first low point 14 the rockerline inverts and ascends through the intermediate longitudinal section 6 all the way across the board &# 39 ; s latitudinal axis 12 between the first low point 14 and the centerline 11 . in preferred embodiments , this descent may occur at angles between 10 and 0 . 05 degrees . at the centerline 11 the rockerline inverts again and descends through the intermediate longitudinal section 6 all the way across the board &# 39 ; s latitudinal axis 12 between the centerline 11 and the second low point 15 . in preferred embodiments , this ascent may occur at angles between 10 and 0 . 05 degrees . at the second low point 15 the rockerline inverts again and ascends through the remainder of the intermediate longitudinal section 6 all the way across the board &# 39 ; s latitudinal axis 12 between the second low point 14 and the second tip section 4 . in preferred embodiments , this ascent may occur at angles between 30 and 3 degrees . in the second tip section 4 the board &# 39 ; s rockerline rapidly descends all the way across the board &# 39 ; s latitudinal axis 12 from the second tip section terminus 8 to the intermediate longitudinal section 6 of the wakeboard 1 . in preferred embodiments , the descent may occur at angles between 60 and 30 degrees . this creates a rockerline in which the lowest point of the board is not generally centered between the board &# 39 ; s first tip section 2 and second tip section 4 . fig2 is a perspective view of the top of an embodiment of the inventive wakeboard 1 . as depicted in fig2 , the wakeboard 1 includes a longitudinal axis 13 that runs from the first tip section terminus 7 to the second tip section terminus 8 . a first low point 14 and a second low point 15 are also depicted . preferably , the intermediate longitudinal section 6 ( fig1 ) is between one quarter and two inches thick . the intermediate longitudinal section 6 has a tapered edge 16 as it approaches both the first rail 9 and the second rail 10 . tapered edge 16 preferably starts between one half and five inches from either the first rail 9 or the second rail 10 . holes 17 for the attachment of fins 18 ( fig3 ) may be located in the intermediate longitudinal section 6 . in a preferred embodiment , four holes 17 are placed at the first end 3 near the junction of the intermediate longitudinal section 6 and first tip section 2 . two holes 17 are generally oriented parallel to the longitudinal axis 13 and positioned one to three inches from the first rail 9 . two holes 17 are generally oriented parallel to the longitudinal axis 13 and positioned one to three inches from the second rail 10 . four holes 17 are placed at the second end 5 near the junction of the intermediate longitudinal section 6 and second tip section 4 . two holes 17 are generally oriented parallel to the longitudinal axis 13 and positioned one to three inches from the first rail 9 . two holes 17 are generally oriented parallel to the longitudinal axis 13 and positioned one to three inches from the second rail 10 . fins 18 may be inserted into each set of holes 17 . fig4 is a rear , perspective view of the top of an embodiment of the inventive wakeboard 1 . in fig4 , binding mounting holes 19 generally located near the first low point 14 and a second low point 15 are also depicted . in a preferred embodiment , six binding mounting holes 19 are drilled along the longitudinal axis near the first low point 14 . six binding mounting holes 19 are drilled along the longitudinal axis near the second low point 15 . each set of binding mounting holes 19 is generally centered over low points 14 and 15 with three holes placed on each side . holes 19 are placed six inches apart to accommodate a standard six inch binding mount . fig3 is a side , perspective view of the bottom of an embodiment of the inventive wakeboard 1 . as depicted in fig3 , a preferred embodiment of the inventive wakeboard 1 includes channels 20 running parallel to the longitudinal axis 13 between the first tip section 2 and the first low point 14 and the second tip section 4 and the second low point 15 . in preferred embodiments , channels 20 are positioned one to five inches from the first rail 9 at the second end 5 ; one to five inches from the second rail 10 at the second end 5 ; one to five inches from the first rail 9 at the first end 3 ; and one to five inches from the second rail 10 at the first end 3 . thus the reader will see that the wakeboard of the invention includes a rockerline in which the lowest point of the board is not generally centered between the board &# 39 ; s tip and tail . while the above description contains many specifics , these should not be construed as limitations on the scope of the invention , but rather as an exemplification of one preferred embodiment thereof many other variations are possible including a rockerline with multiple cambers , a rockerline with at least one camber that does not peak at the centerline , etc . accordingly , the scope of the invention should be determined not by the embodiments illustrated , but by the appended claims and their legal equivalents . | 1 |
the granular refractory materials used in the present invention may be of any of the refractory materials employed in the foundry industry for the production of moulds and cores , such as silica sand , chromite sand , zircon or olivine sand . the compositions of the invention have the particular advantage that the difficulties commonly associated with the bonding of sands of alkaline reaction such as olivine and chromite or beach sands containing shell fragments and which arise from the neutralization or partial neutralization of the acid catalyst used , are completely overcome since in the invention the binder is cured under alkaline conditions . the invention is , therefore , of particular utility where it is necessary or desirable to employ alkaline sands . the nature of the phenol - formaldehyde resin used is an important feature of the present invention . there are several features of the resin which are important . since the present invention is directed to cold set techniques , the resin binder will be used as an aqueous solution of the resin . the solids content of the aqueous solution is in the range 50 to 75 % by weight . solids contents below 50 % are not used because they contain too much water which reduces the effectiveness of the binder . solids contents above 75 %, are not used because the viscosity becomes too high . the phenol - formaldehyde resins used in this invention have a weight average molecular weight ( m w ) of from 600 to 1500 . resins with m w outside this range give products which are relatively weak or build up strength more slowly . we have , to date , obtained best results using resins having m w in the range 700 to 1100 . the resins used in this invention are potassium alkaline phenol - formaldehyde resins by which is meant that the alkali in the resin is potassium alkali . this alkali will usually be present in the resin during manufacture but can be added to the resin subsequently as koh , preferably in aqueous solution of suitable strength . the alkalinity of the resin is expressed in terms of its koh content and specifically by the molar ratio of koh to the phenol in the resin . other alkalis are not expressly excluded and may be present in minor amounts but will not be specifically added because they give products having lower strength . the molar ratio of koh : phenol in the resin solution is in the range 0 . 2 : 1 to 1 . 2 : 1 preferably 0 . 3 : 1 to 1 : 1 . outside this range the products have relatively poor strength and , above the top range limit , the resin is hazardously alkaline . we have obtained best results using resin solutions having a koh : phenol molar ratio in the range 0 . 4 to 0 . 6 . the resins used have a formaldehyde to phenol molar ratio of from 1 . 2 : 1 to 2 . 6 : 1 , preferably 1 . 5 : 1 to 2 . 2 : 1 . lower ratios are not used because the resins are relatively unreactive . higher ratios are not used because the resins produced contain undesirably high levels of unreacted formaldehyde and give products having lower strength . it is a subsidiary aspect of this invention that the resin used satisfies the following criteria : a silane is included in the binder to improve strength . amounts as low as 0 . 05 % by weight on the weight of resin solution provide a significant improvement in strength . increasing the amount of silane gives greater improvements in strength up to about 0 . 6 % by weight on the resin solution . higher silane concentrations are not preferred because of added cost . further , because the silane typically used is γ - aminopropyltriethoxy silane which contains nitrogen , use of excess silane may increase the risk of pinholing defects and for these reasons amounts in excess of 3 % by weight on the resin solution are not used . the binder and particulate refractory material can be mixed and formed by conventional techniques . the vented core and mould boxes used can also be of conventional type as are used in prior art gassing systems . the binder is cured , according to the present invention , by gassing with a c 1 to c 3 alkyl formate , very preferably methyl formate . the alkyl formate curing catalyst will not usually be used as a pure gas but as a vapour or aerosol in an inert carrier gas . by inert carrier gas we mean a gas which does not react with the formate catalyst or have an adverse effect on the curing reaction or the properties of the product . suitable examples include air , nitrogen or carbon dioxide . the gassing catalyst is a c 1 to c 3 alkyl formate preferably dispersed in a carrier gas as vapour or an aerosol . other esters e . g . formate esters of higher alcohols such as butyl formate , and esters of c 1 to c 3 alcohols with higher carboxylic acids such as methyl and ethyl acetates , are not effective as gassing catalysts . methyl formate is significantly more active as a catalyst than ethyl formate which is better than the propyl formates . the reasons for the catalytic activity of the c 1 to c 3 alkyl formates and , within this group , the marked superiority of methyl formate , are not clear . the relative volatility of these compounds enables their use as gassing catalysts . this is especially true of methyl formate which is a volatile liquid having a boiling point at atmospheric pressure of 31 . 5 ° c . at ambient temperatures ( below 31 . 5 ° c . ), typically 15 ° to 25 ° c ., it is sufficiently volatile that passing carrier gas through liquid methyl formate ( maintained at ambient temperature ) gives a concentration of methyl formate vapour in the carrier gas sufficient to act as catalyst to cure the binder . ethyl and the propyl formates are less volatile than the methyl ester , having boiling points in the range 54 ° to 82 ° c . at atmospheric pressure . in order to entrain sufficient of these esters in the gas phase to enable effective catalysis , we have found it appropriate to heat the esters to near their boiling point and use a stream of carrier gas preheated to e . g . 100 ° c . an alternative to true vaporization is to form an aerosol in the carrier gas . methyl formate is so volatile as to make this impractical . using ethyl and propyl formates it is desirable to pre - heat them to enhance even distribution in the core or mould during gassing . as is indicated above , methyl formate is the most active catalyst and , by virtue of its volatility , is the easiest to use . accordingly , the use of methyl formate in a stream of inert carrier gas as the gassing catalyst forms a particular aspect of this invention . a further practical advantage of these formate esters , especially methyl formate is their relative low toxicity and the fact that their toxicity is well understood . the concentration of the formate catalyst in the carrier gas is preferably at least 0 . 2 % by volume and typically from 0 . 5 to 5 % by volume . the total amount of catalyst used will typically be from 5 to 60 % preferably from 15 to 35 %, by weight on the weight of the resin solution . the time required for adequate gassing depends on the size and complexity of the core or mould and on the particular resin used . it can be as short as 0 . 1 secs but more usually is in the range 1 sec to 1 min . longer times e . g . up to 5 mins can be used if desired or for large moulds or cores . after gassing the core or mould is stripped from the box . sufficient time must elapse to permit the strength of the mould or core to build up to enable stripping without damage . production speed can be enhanced by purging the mould or core box with a suitable inert gas such as air which removes residual catalyst vapour and water and other by - products of the curing reaction . the amount of resin solution used as binder is from 0 . 5 to 8 %, preferably 1 to 3 %, by weight on the weight of the refractory particulate material . use of lower amounts of binder gives cores of poor strength . higher amounts of binder give no significant advantage and give generally poorer breakdown on casting and increase the difficulty of sand recovery . 100 % phenol was dissolved in 50 % aqueous koh in an amount corresponding to the desired koh : phenol molar ratio ( from 0 . 2 to 1 . 2 ). the solution was heated to reflux and 50 % aqueous formaldehyde was added slowly , whilst maintaining reflux , in an amount corresponding to the desired formaldehyde : phenol molar ratio ( 1 . 6 , 1 . 8 or 2 . 0 ). the reaction mixture was maintained under reflux until it attained a pre - determined viscosity corresponding to the desired value of m w . ( if desired the solids content can be adjusted by distillation , but this is not usually necessary , a further advantage of the invention . in some cases minor amounts of koh solution were added to adjust the koh : phenol ratio , but this would not be necessary in full scale production .) the resin solution was cooled to 40 ° c . and 0 . 4 % by weight on the weight of the resin solution of γ - aminopropyl triethoxy silane was added . ( b ) solids content -- measured by heating a weighed sample ( 2 . 0 ± 0 . 1 g ) in an air circulating oven for 3 hrs at 100 ° c . ( c ) molecular weight m w )-- measured using gel permeation chromatography . samples were prepared by precipating resin from the resin solution by adding h 2 so 4 ; separating , washing and drying the precipitate and dissolving it in tetrahydrofuran . 1 kg of the selected sand was charged into a fordath laboratory core mixer and mixed for 2 mins , with 20 g phenol - formaldehyde resin prepared as described above . the mix was discharged into a tin and sealed immediately to prevent evaporation of water . 5 × 5 cm cylinder compression test pieces were prepared by the standard procedure recommended by i . b . f . working party p but using a perforated bottom plate of the cylinder with a recess which could be connected to a source of negative pressure . the top of the cylinder was sealed with another perforated plate connected to a bubbler containing liquid methyl formate at ambient temperature . when vacuum was applied to the bottom plate air was bubbled through the methyl formate and the ester vapour conveyed in the air stream through the sand resin mix in the cylinder core box . compression strength was determined on the resultant cores after storing at 20 ° c ., 50 % relative humidity for 1 min , 5 mins , 1 hr . 2 hrs . 3 hrs . and 24 hrs . initial tests indicated that 30 secs . was sufficient time to produce the optimum strength and this was used as a standard in the examples below . test cores were made using solutions of resins having the following properties : 0 . 4 % by weight on the resin solution of γ - aminopropyltriethoxy silane was added . the sand used was chelford 50 and the amount of resin was 2 % by weight resin solution on the sand . the results are set out in tables 1 and 2 . table 1 gives the results for resins with m w = 960 and table 2 for resins with m w = 1000 . the data in the table show that cores of adequate strength can be made but that the strength falls of somewhat at koh : phenol ratios greater than 0 . 6 . table 1______________________________________test no . 1 2 3 4 5______________________________________koh : phenol 0 . 4 0 . 5 0 . 6 0 . 7 0 . 8viscosity ( cp ) 500 390 313 250 -- compressionstrength ( mpa ) 1 min 1 . 2 2 . 2 2 . 6 2 . 6 2 . 95 min 1 . 9 3 . 6 3 . 1 3 . 0 3 . 01 hr 2 . 2 3 . 4 3 . 5 3 . 2 3 . 03 hr 2 . 1 3 . 9 4 . 0 3 . 5 3 . 124 hr 3 . 0 4 . 3 4 . 8 3 . 2 2 . 2______________________________________ table 2______________________________________test no . 6 7 8 9______________________________________koh : phenol 0 . 4 0 . 5 0 . 6 0 . 7viscosity ( cp ) 688 500 375 -- compressionstrength ( mpa ) 1 min 1 . 7 2 . 4 2 . 9 2 . 95 min 2 . 4 3 . 2 3 . 2 3 . 31 hr 2 . 4 3 . 4 3 . 7 3 . 63 hr 3 . 2 4 . 1 3 . 2 3 . 424 hr 4 . 4 4 . 8 3 . 9 2 . 9______________________________________ test cores were made using solutions of resins having the following properties : 0 . 4 % by weight γ - aminopropyltriethoxy silane was added to the resin solution . the sand used was chelford 50 and the amount of resin solution used was 2 % by weight on the sand . the experiment was reported using similar solutions to which 50 % koh solution was added to increase the koh : phenol ratio to 0 . 85 . the solids contents of these resin solutions were 64 %. the results are set out in table 3 . the data for the resins with koh : phenol = 0 . 65 is in the ( a ) columns and for resins with koh : phenol = 0 . 85 in the ( b ) columns . as in example 1 the use of higher koh : phenol ratios gives inferior results especially at the higher values of m w . table 3______________________________________ test no . 10 11 12 13 -- m . sub . w 718 849 966 1050 a b a b a b a b______________________________________koh : phenol 0 . 65 0 . 85 0 . 65 0 . 85 0 . 65 0 . 85 0 . 65 0 . 85solids (%) 66 64 66 64 66 64 66 64viscosity 107 81 220 111 320 144 405 167 ( cp ) compressionstr . ( mpa ) 1 min 2 . 7 2 . 3 2 . 9 2 . 2 2 . 6 2 . 0 1 . 9 2 . 05 min 3 . 4 2 . 7 3 . 3 2 . 6 3 . 0 1 . 1 2 . 2 2 . 01 hr 3 . 0 2 . 7 3 . 5 2 . 7 2 . 7 2 . 2 2 . 2 2 . 03 hr 3 . 6 3 . 2 3 . 5 2 . 6 2 . 9 1 . 7 1 . 9 2 . 024 hr 4 . 5 2 . 9 3 . 5 1 . 1 1 . 8 0 . 8 1 . 2 0 . 9______________________________________ resins with varying properties were used to make test cores as described above . the sand used was chelford 50 , the amount of resin solutions was 2 % by weight on the sand and all the resin solutions contained 0 . 4 % by weight γ - aminotreithoxy silane . the results are set out in table 4 . table 4______________________________________test no . 14 15 16 17 18 19 20 21______________________________________ -- m . sub . w 850 850 850 1000 1000 1000 1000 1000koh : phenol 0 . 72 0 . 72 0 . 45 0 . 34 0 . 57 0 . 68 0 . 85 1 . 02formalde - 1 . 6 1 . 6 1 . 6 2 . 0 2 . 0 2 . 0 2 . 0 2 . 0hyde : phenolsolids (%) 60 . 2 66 . 2 65 . 4 64 . 0 64 . 0 64 . 0 64 . 0 64 . 0viscosity 277 414 600 -- -- -- 150 --( cp ) compressionstrength ( mpa ) 1 min 2 . 4 2 . 3 1 . 8 0 . 9 2 . 7 2 . 5 2 . 3 1 . 65 min 2 . 5 2 . 4 2 . 5 2 . 7 2 . 8 2 . 7 2 . 4 1 . 81 hr 2 . 5 2 . 7 2 . 0 2 . 3 2 . 8 2 . 8 2 . 4 2 . 03 hr 2 . 5 3 . 2 2 . 1 2 . 2 3 . 9 3 . 2 2 . 3 -- 24 hr 1 . 2 3 . 0 3 . 5 3 . 1 4 . 5 2 . 2 1 . 8 1 . 9______________________________________ while the invention has been disclosed in this patent application by reference to the details of preferred embodiments of the invention , it is to be understood that this disclosure is intended in an illustrative rather than in a limiting sense , as it is contemplated that modifications will readily occur to those skilled in the art , within the spirit of the invention and the scope of the appended claims . | 2 |
fig2 through 10 , discussed below , and the various embodiments used to describe the principles of the present disclosure in this patent document are by way of illustration only and should not be construed in any way to limit the scope of the disclosure . those skilled in the art will understand that the principles of the present disclosure may be implemented in any suitably arranged wireless communications network . the following description of the present invention will be given about a method for allocating an uplink burst to a frame through use of a c - sm mode according to the present invention . the method for allocating an uplink burst to a frame through use of the c - sm mode is divided into a part for determining a simo mode or the c - sm mode for a selected burst , a part for adding a burst of the simo mode to a frame , and a part for adding a burst of the c - sm mode to a frame . fig2 is a flowchart illustrating an uplink scheduling and uplink burst allocating algorithm according to an exemplary embodiment of the present invention . hereinafter , the uplink scheduling and uplink burst allocating - algorithm according to an exemplary embodiment of the present invention will be described in detail with reference to fig2 . more particularly , the following description will be given about an operation for determining a transmission format of a burst according to a selected mode . a base station calculates priorities of connections with a plurality of terminals in step 210 , and proceeds to step 212 . in step 212 , when the maximum value “ max ( n slot , remain , simo , n slot , remain , a , n slot , remain , b )= n slot , remain , max ” among the number “ n slot , remain , simo ” of slots that can be additionally allocated to the simo mode , the number “ n slot , remain , a ” of slots that can be additionally allocated to pilot pattern a of the c - sm mode , and the number “ n slot , remain , b ” of slots that can be additionally allocated to pilot pattern b of the c - sm mode are greater than zero , and when the number of allocated bursts is less than the maximum number of bursts “ n burst , max ,” the base station proceeds to step 216 . in step 216 , the base station selects a connection having the highest priority from among the remaining connections . in step 218 , the base station determines if a burst of the connection selected in step 216 corresponds to a cdma allocation information element . when the burst of the selected connection corresponds to a cdma allocation information element , the base station proceeds to step 220 where the base station determines the simo - mode - based transmission format for the burst of the selected connection . in contrast , when it is determined that the burst of the selected connection does not correspond to a cdma allocation information element in step 218 , the base station establishes the selected connection to be used for the transmission of traffic to a terminal and proceeds to step 224 . in step 224 , the base station determines if the selected mode corresponds to the simo mode . when the selected mode corresponds to the simo mode , the base station proceeds to step 226 where the base station applies a worst fit ( wf ) heuristic for selecting a pilot pattern of the simo mode . in contrast , when the selected mode does not correspond to the simo mode , the base station proceeds to step 232 where the base station applies an first fit ( ff ) heuristic for selecting a pilot pattern of the c - sm mode . when a pilot pattern is successfully selected as a result of the application of the wf heuristic in step 226 , the base station proceeds to step 228 where the base station determines the transmission format to be in the simo mode . in contrast , if the base station fails to select a pilot pattern as a result of the application of the wf heuristic in step 226 , the base station proceeds to step 230 where the base station determines the previously backed - up transmission format to be used for the selected connection and skips the selected connection . meanwhile , when a pilot pattern is successfully selected as a result of the application of the ff heuristic in step 232 , the base station proceeds to step 234 where the base station determines the transmission format to be in the c - sm mode . in contrast , if the base station fails to select a pilot pattern as a result of the application of the ff heuristic in step 232 , the base station proceeds to step 230 where the base station determines the previously backed - up transmission format to be used for the connection selected in step 216 and skips the selected connection . detailed operations of the wf heuristic and ff heuristic will be described later with reference to fig6 and 8 . fig3 is a block diagram illustrating the configuration of a system for selecting the simo mode or the c - sm mode for a selected burst according to an exemplary embodiment of the present invention . the system for selecting the simo mode or the c - sm mode for a selected burst according to an exemplary embodiment of the present invention includes a base station 320 and a terminal 310 , wherein the base station 320 includes a modem 322 and an uplink scheduler 324 . when the modem 322 of the base station receives uplink transmission power from the terminal , the modem 322 takes the average of the received uplink transmission power and transmits the average to the uplink scheduler 324 . the uplink scheduler 324 determines whether to use the simo mode or the c - sm mode according to the average , and determines a transmission format according to an mcs level by performing the procedure described with reference to fig2 . when the transmission format has been determined , the uplink scheduler 324 transmits the determined transmission format to the modem 322 , and the modem 322 creates map information expressing a burst position . in addition , the map information includes information representing the transmission format , and simo mode or c - sm mode information , as well . thereafter , the base station 320 transmits the map information to the terminal 310 . the terminal 310 generates a burst according to the transmission format information and simo mode or c - sm mode information that are included in the map information received from the base station 320 . the terminal 310 transmits the generated burst to the base station 320 . fig4 is a flowchart illustrating a method for determining the simo mode or c - sm mode for a selected burst according to an exemplary embodiment of the present invention . a base station transmits a burst in either the simo mode or the c - sm mode by taking into consideration the type of data to transmit and the channel state . selecting the simo mode or the c - sm mode is performed through use of an average value that is obtained by normalizing uplink transmission power “ p ul , tx ,” that is received from a terminal based on uplink transmission power of a non - harq burst with qpsk 1 / 2 . before allocating an uplink burst to a frame , the base station predetermines which mode of the simo and c - sm modes is to be used . basically , after a specific threshold value has been set , the terminal having a normalized uplink transmission power “ p ul , tx ” higher than the specific threshold value is established to use the simo mode , while a terminal having a normalized uplink transmission power “ p ul , tx ” equal to or less than the specific threshold value is established to use the c - sm mode . since a terminal located in a boundary area has a high path loss , the terminal has high normalized uplink power so that the terminal comes to use the simo mode . also , the normalized uplink transmission power threshold value for dividing into the simo mode and the c - sm mode is determined by taking capacity and coverage into consideration . when the normalized uplink transmission power threshold value is set to a large value , most terminals come to use the simo mode , and thus , the frequency of the utilization of the c - sm mode becomes low so that the capacity is reduced . meanwhile , when the normalized uplink transmission power threshold value is set to a small value , interference to neighboring cells increases so that a coverage problem is created . in order to prevent unnecessary changes to the simo mode or the c - sm mode from occurring , a hysteresis margin is used when changing from the simo mode to the c - sm mode . that is , a threshold value “ t simo , c - sm ” used when changing from the simo mode to the c - sm mode and a threshold value “ t c - sm , simo ” used when changing from the c - sm mode to the simo mode are set to mutually different values . hereinafter , a method for determining the simo mode or c - sm mode for a selected burst according to an exemplary embodiment of the present invention will be described in detail with reference to fig4 . in step 410 , a base station checks if a last mode used by a terminal is the simo mode . when the last mode used by the terminal is the simo mode as a result of the check , the base station proceeds to step 412 . in step 412 , when uplink transmission power “ p ul , tx ” transmitted from the terminal is less than a first threshold value “ t simo , c - sm ” used as a criterion for changing from the simo mode to the c - sm mode , the base station proceeds to step 414 , where the base station establishes the c - sm mode for the terminal . the uplink transmission power is a normalized average value . in contrast , when the uplink transmission power transmitted from the terminal is not less than the first threshold value used as a criterion for changing from the simo mode to the c - sm mode , the base station proceeds to step 416 , where the base station establishes the simo mode . meanwhile , when the last mode used by the terminal is not the simo mode as a result of the check in step 410 , the base station proceeds to step 418 . in step 418 , when the uplink transmission power is less than a second threshold value “ t c - sm , simo , ” the base station proceeds to step 420 where the base station establishes the c - sm mode for the terminal . in contrast , when the uplink transmission power is not less than the second threshold value in step 418 , the base station proceeds to step 420 where the base station establishes the simo mode for the terminal . a part for adding a simo burst to a frame determines if a selected burst can be allocated to the simo mode by newly determining the disposition of a pre - allocated burst . minimizing the number of slots allocated to the c - sm mode is maximizing the number of slots that can be allocated to the simo mode . therefore , in order for the number of slots using one - side pilot pattern to be similar to the number of slots using the other - side pilot pattern , pre - allocated c - sm bursts are evenly divided and allocated to a layer using pilot pattern a and a layer using pilot pattern b . accordingly , in consideration of the complexity in implementation , a wf heuristic is used . a first method is to arrange all pre - allocated c - sm bursts according to the number of slots . that is , since the first method is to add one burst , to decide a sequence , and to determine a pilot pattern whenever the need arises , a separate operation for arrangement is not required . a second method is to determine pilot patterns in the sequence from a burst allocated the most slots to a burst allocated the fewest slots . when a pilot pattern of a certain burst belonging to a terminal is to be determined and a pilot pattern of another burst belonging to the terminal has already been determined , the certain burst is established to use the same pilot pattern as the another pattern . a pilot pattern of a first burst is determined by the wf heuristic . that is , if the number of slots determined for pilot pattern a is relatively greater , the burst is determined to have pilot pattern b , and if not , the burst is determined to have pilot pattern a . when the number of slots determined for pilot pattern a is equal to the number of slots determined for pilot pattern b , the burst is determined to have pilot pattern a . hereinafter , a method for adding a simo burst to a frame according to an exemplary embodiment of the present invention will be described in detail with reference to fig5 . in step 510 , an uplink scheduler backs up the pilot patterns and the number of slots allocated for every connection relating to a plurality of terminals . the base station releases slots allocated to bursts including selective connections with the terminals in step 512 and proceeds to step 514 where the base station resets pilot patterns of all c - sm bursts and then recalculates the number of remaining slots . in step 516 , if pilot patterns of every burst have been determined , the base station proceeds to step 518 , and if not , the base station proceeds to step 524 . when it is determined , in step 518 , that the number “ n slot , remain , simo ” of slots that can be additionally allocated to the simo mode is not less than the number of released slots , the base station determines that the wf heuristic has been performed successfully in step 520 . in contrast , when it is determined , in step 518 , that the number “ n slot , remain , simo ” of slots that can be additionally allocated to the simo mode is less than the number of slots released in step 512 , the base station proceeds to step 522 where the base station restores the number of slots and the pilot patterns , which have been backed up , for every connection with the plurality of terminals . when one or more bursts for which a pilot pattern has not been determined remain in step 516 , the base station proceeds to step 524 where the base station selects a burst allocated the most slots from among the remaining bursts . next , in step 526 , when a pilot pattern of another burst belonging to a terminal , to which the selected burst belongs , has already been determined , the base station proceeds to step 528 where the base station determines if the number of allocation slots of the selected burst is less than the number of remaining slots of the determined pilot pattern . when the number of allocation slots of the selected burst is less than the number of remaining slots of the determined pilot pattern , the base station proceeds to step 530 where the determined pilot pattern identified in step 526 is used for the selected burst . in contrast , when it is determined , in step 528 , that the number of allocation slots of the selected burst is not less than the number of remaining slots of the determined pilot pattern identified in step 526 , the base station proceeds to step 522 where the base station restores the pilot patterns and the number of slots , which have been backed up , for every connection with the plurality of terminals . meanwhile , when it is determined in step 526 that a pilot pattern of another burst ( i . e ., a burst in step 512 ) belonging to the terminal has not yet been determined , and when it is determined , in step 532 , that the number “ n slot , remain , a ” of slots that can be additionally allocated to pilot pattern a of the c - sm mode is not less than the number “ n slot , remain , b ” of slots that can be additionally allocated to pilot pattern b of the c - sm mode , the base station proceeds to step 534 where the base station compares the number of allocation slots of the selected burst with the number of slots that can be additionally allocated to pilot pattern a of the c - sm mode . when the number of allocation slots of the selected burst is less than the number of slots that can be additionally allocated to pilot pattern a of the c - sm mode as a result of the comparison in step 534 , the base station proceeds to step 540 where pilot pattern a is determined . when it is determined , in step 536 , that the number of allocation slots of the selected burst in step 512 is less than the number of slots that can be additionally allocated to pilot pattern b of the c - sm mode , the base station proceeds to step 538 where pilot pattern b is determined . in contrast , when it is determined , in step 534 , that the number of allocation slots of the selected burst in step 512 is greater than the number of slots that can be additionally allocated to pilot pattern a of the c - sm mode , or when it is determined , in step 536 , that the number of allocation slots of the selected burst is not less than the number of slots that can be additionally allocated to pilot pattern b of the c - sm mode , the base station proceeds to step 522 where the base station restores the pilot patterns and the number of slots , which have been backed up , for every connection with the plurality of terminals . fig6 is a view explaining the selection of pilot patterns based on a wf heuristic algorithm according to an exemplary embodiment of the present invention . according to the wf heuristic algorithm , all the slots are divided into slots of the simo mode , slots of pilot patterns , and the remaining slots that can be allocated . when the number of slots used for the pilot patterns are minimized , the number of remaining slots that can be additionally allocated to the simo mode becomes maximized . the part of adding a c - sm burst to a frame newly determines the disposition of a pre - allocated burst , thereby checking if a selected burst can be allocated to the c - sm mode . if the selected burst can be allocated to the c - sm mode as a result of the check , the selected burst is determined to be allocated to the c - sm mode ; and if not , the selected burst is not allocated . when as many as possible of the remaining slots , except for slots allocated to the simo mode , are used , and simultaneously , the pilot patterns of pre - allocated c - sm bursts are determined to be gathered into one layer as much as possible , the number of slots that can be additionally allocated to the c - sm mode becomes maximized . therefore , pre - allocated c - sm bursts are divided and allocated to a layer using pilot pattern a and a layer using pilot pattern b so that the number of slots using pilot pattern a is greater than the number of slots using pilot pattern b . accordingly , in consideration of the complexity in implementation , the ff heuristic is used . a first method is to arrange all pre - allocated c - sm bursts according to the number of slots . in this case , since one burst is added whenever the need arises , and a sequence is determined , a separate operation for arrangement is not required . when a slot allocation for a selected connection is added to a pre - allocated burst , the arrangement is performed with the exception of the pre - allocated burst . a second method is to determine pilot patterns in the sequence from a burst allocated the most slots to a burst allocated the fewest slots . a burst belonging to the same terminal as a burst , of which a pilot pattern is to be determined , is established to use pilot pattern b . in addition , when a pilot pattern of a certain burst belonging to a terminal is to be determined , and a pilot pattern of another burst belonging to the terminal has already been determined , the certain burst is established to use the same pilot pattern as the another pattern . in the other cases , if a space where pilot pattern a can be used remains , pilot pattern a is determined , and if not , pilot pattern b is determined . a pilot pattern of a burst to be allocated changes whenever a new connection is selected . the pilot pattern of the burst is finally determined after all connection selections have been completed . that is , during a scheduling process , only a temporary pilot pattern of a burst is determined and changes every time in the direction of increasing the probability of selecting a new connection is as high as possible . this is because it is preferred that pre - allocated bursts are evenly divided into two - side layers when a connection to be next selected uses the simo mode and it is performed such that the bursts are gathered into one - side layer so as to empty the other - side layer as much as possible when a connection to be next selected uses the c - sm mode . it should be noted that one terminal must not simultaneously use pilot pattern a and pilot pattern b of one slot . to this end , one terminal is allowed to use only one of pilot pattern a and pilot pattern b in one frame . according to the standard , one terminal may use pilot pattern a and pilot pattern b for differently positioned slots , respectively , but it is allocated to use only one pattern in consideration of the complexity . hereinafter , a method for adding a c - sm burst to a frame according to an exemplary embodiment of the present invention will be described in detail with reference to fig7 . in step 710 , an uplink scheduler backs up the pilot patterns and the number of slots allocated for every connection . the base station releases slots allocated to a burst , which is to include a selected connection with a terminal , in step 712 . the base station proceeds to step 714 where the base station resets pilot patterns of all c - sm bursts and recalculates the number of remaining slots . in step 716 , if pilot patterns of all bursts have been determined , the base station proceeds to step 718 , and if not , the base station proceeds to step 722 . when it is determined , in step 718 , that no burst of which a pilot pattern has not been determined remains and the number of slots that can be additionally allocated to pilot pattern b of the c - sm mode is not less than the number of slots released in step 712 , the base station determines that the ff heuristic has been successfully performed in step 720 . in contrast , when it is determined in step 718 that the number “ n slot , remain , b ” of slots that can be additionally allocated to pilot pattern b of the c - sm mode is less than the number of slots released in step 712 , the base station proceeds to step 738 , where the base station restores the number of slots and the pilot patterns , which have been backed up , for every connection with a plurality of terminals . meanwhile , when one or more bursts for which a pilot pattern has not been determined remain in step 716 , the base station proceeds to step 722 where the base station selects a burst allocated the most slots from among the remaining bursts . next , in step 724 , when a pilot pattern of another burst belonging to a terminal , to which the selected burst belongs , has already been determined , the base station proceeds to step 732 where the base station determines if the number of allocation slots of the selected burst is less than the number of remaining slots of the determined pilot pattern . when the number of allocation slots of the selected burst is less than the number of remaining slots of the determined pilot pattern , the base station proceeds to step 734 where the determined pilot pattern is used for the selected burst . in contrast , when it is determined in step 732 that the number of allocation slots of the selected burst is not less than the number of remaining slots of the determined pilot pattern , the base station proceeds to step 738 where the base station restores the pilot patterns and the number of slots , which have been backed up , for every connection with the plurality of terminals . meanwhile , when it is determined , in step 724 , that a pilot pattern of another burst belonging to the terminal has not yet been determined and when it is determined , in step 726 , that there is no burst allocated to the terminal , to which a connection selected by the scheduler belongs , the base station proceeds to step 728 . when the number of allocation slots of the selected burst is less than the number “ n slot , remain , a ” of slots that can be additionally allocated to pilot pattern a of the c - sm mode , the base station proceeds to step 740 where pilot pattern a is determined . when it is determined in step 730 that the number of allocation slots of the selected burst is less than the number of slots that can be additionally allocated to pilot pattern b of the c - sm mode , the base station proceeds to step 736 where pilot pattern b is determined . in contrast , when it is determined in step 730 that the number of allocation slots of the selected burst is not less than the number of slots that can be additionally allocated to pilot pattern b of the c - sm mode , the base station proceeds to step 738 where the base station restores the pilot patterns and the number of slots , which have been backed up , for every connection with the plurality of terminals . fig8 is a view explaining the selection of pilot patterns based on an ff heuristic algorithm according to an exemplary embodiment of the present invention . the ff heuristic algorithm is to maximize the number of slots that can be additionally allocated to the c - sm mode by maximizing the number of slots for pilot pattern a among all the slots . fig9 is a view illustrating burst allocations based on pilot patterns according to an exemplary embodiment of the present invention . bursts of the c - sm mode are allocated both pilot patterns a and b . pilot patterns a and b are allocated together with the simo mode and the c - sm mode ( wherein , bursts of the simo mode using pilot pattern b have not been shown ). fig1 is a view illustrating a result of a simulation of an uplink burst allocation algorithm according to an exemplary embodiment of the present invention . c - sm mode bursts are arranged in order of size , e . g ., in the sequence of 40 , 30 , 20 , and 10 . as shown in fig1 , when a sufficient number of connections exist , the burst allocation algorithm according to the present invention can obtain a throughput gain of about 10 %, as compared with the baseline . according to the present invention , as described above , since a terminal located in a cell boundary is controlled to use the simo mode , it is possible to prevent coverage reduction and it is possible to minimize damage in the priority , so that unnecessary increases in delay can be prevented . in addition , according to the present invention , since bursts using the c - sm mode are properly disposed , it is possible to increase the probability that a newly selected burst will be additionally allocated . although the present disclosure has been described with an exemplary embodiment , various changes and modifications may be suggested to one skilled in the art . it is intended that the present disclosure encompass such changes and modifications as fall within the scope of the appended claims . | 7 |
the following description of the preferred embodiment is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . for purposes of clarity , the same reference numbers will be used in the drawings to identify similar elements . as used herein , the term module refers to an application specific integrated circuit ( asic ), an electronic circuit , a processor ( shared , dedicated , or group ) and memory that execute one or more software or firmware programs , a combinational logic circuit , or other suitable components that provide the described functionality . referring now to fig1 , an exemplary internal combustion engine system 10 is illustrated . the engine system 10 includes an engine 12 , an intake manifold 14 and an exhaust manifold 16 . air is drawn into the intake manifold 14 through an air filter 17 and a throttle 18 . the air is mixed with fuel , and the fuel and air mixture is combusted within a cylinder 20 of the engine 12 . more specifically , the fuel and air mixture is compressed within the cylinder 20 by a piston ( not shown ) and combustion is initiated . the combustion process releases energy that is used to reciprocally drive the piston within the cylinder 20 . exhaust that is generated by the combustion process is exhausted through the exhaust manifold 16 and is treated in an exhaust after - treatment system ( not shown ) before being released to atmosphere . although a single cylinder 20 is illustrated , it is anticipated that the pre - throttle estimation control of the present invention can be implemented with engines having more than one cylinder . a control module 30 regulates engine operation based on a plurality of engine operating parameters including , but not limited to , a pre - throttle static pressure ( p pre ), a pre - throttle stagnation pressure ( p pre0 ) ( i . e ., the air pressures upstream of the throttle ), an intake air temperature ( t pre ), a mass air flow ( maf ), a manifold absolute pressure ( map ), an effective throttle area ( a eff ), an engine rpm and a barometric pressure ( p baro ). p pre0 and p pre are determined based on a pre - throttle estimation control , which is disclosed in commonly assigned , co - pending u . s . patent application ser . no . 11 / 464 , 340 , filed aug . 14 , 2006 . t pre , maf , map and engine rpm are determined based on signals generated by a t pre sensor 32 , a maf sensor 34 , a map sensor 36 and an engine rpm sensor 38 , respectively , which are all standard sensors of an engine system . a eff is determined based on a throttle position signal that is generated by a throttle position sensor , which is also a standard sensor . a throttle position sensor 42 generates a throttle position signal ( tps ). the relationship between a eff to tps is pre - determined using engine dynamometer testing with a temporary stagnation pressure sensor 50 ( shown in phantom in fig1 ) installed . production vehicles include the relationship pre - programmed therein and therefore do not require the presence of the stagnation pressure sensor . the p baro estimation control of the present disclosure estimates p baro without the use of a barometric pressure sensor . more specifically , in the air intake system , the mass air flow ( maf ) or { dot over ( m )} can be treated as an incompressible flow before the throttle . accordingly , { dot over ( m )} can be determined based on the following relationship : { dot over ( m )}= c d · a inlet ·√{ square root over ( 2ρ ·( p baro − p pre ))} ( 1 ) { dot over ( m )} is the rate of mass air flow ( maf ); c d is a drag or loss coefficient ; a inlet is the effective cross - sectional area of pre - throttle inlet system including air filter ; p pre is the inlet or pre - throttle absolute pressure ; and ρ is the air density ( i . e ., a function of p inlet , iat , r ). c d can be determined as a function of { dot over ( m )} and an air filter healthy status ( afhs ). the afhs is a variable that indicates the degree to which the air filter is dirty . a clean air filter enables a minimally restricted air flow therethrough , while a dirty air filter more significantly restricts the air flow therethrough . the learning of afhs can be independent of barometric conditions and can be updated within the control module 30 . the afhs can be determined based on one of the following relationships : where t is a current time of a measured flow rate and t − 1 is a previous time of another measured flow rate . p pre can be either physically measured or calculated from throttle flow dynamics . afhs is learned using minimum resources . more specifically , afhs is event - based calculated using a known p baro , but is a more slowly updated variable than a time - based calculation of p baro . for example , the values of ( p baro − p pre ) t and ( p baro − p pre ) t - 1 can be determined over a long time period provided that the value ({ dot over ( m )} t −{ dot over ( m )} t - 1 ) ( δ { dot over ( m )}) is greater than a threshold value ( δ { dot over ( m )} thr ). further , p barot and p barot - 1 can be different in this case . under limited operating conditions , the afhs can be determined based on the following relationship : for example , if the difference between time steps ( δt ) is less than a threshold difference ( δt thr ) and the vehicle travel distance ( δd ) is less than a threshold difference ( δd thr ) ( i . e ., the vehicle does not move too far ), it can be assumed that any change in p baro is negligible . referring now to fig2 , exemplary steps that are executed by the p baro estimation control will be described in detail . in step 200 , control initializes c d and monitors the vehicle operating parameters . in step 201 , control event - based determines whether δ { dot over ( m )} is greater than δ { dot over ( m )} thr . if δ { dot over ( m )} is greater than δ { dot over ( m )} thr , control continues in step 202 . if δ { dot over ( m )} is not greater than δ { dot over ( m )} thr , control continues in step 212 . in step 202 , control determines whether the time difference ( δt ) between the sufficiently high airflow rate change is less than δt thr . if δt is less than δt thr , control continues in step 204 . if δt is not less than δt thr , control continues in step 206 . in step 204 , control determines whether δd is less than δd thr . if δd is less than δd thr , control continues in step 208 . if δd is not less than δd thr , control continues in step 206 . in step 206 , control determines afhs based on maf ({ dot over ( m )}), p pre and a known p baro , and control continues in step 210 . in step 208 , control determines afhs based on maf and p pre and control continues in step 210 . in step 210 , control determines c d based on maf and afhs . in step 212 , control updates p baro based on maf , c d and p pre and control ends . the engine can be subsequently operated based on the updated p baro . referring now to fig3 , exemplary modules that execute the p baro estimation control will be described in detail . the exemplary modules include a first comparator module 300 , a second comparator module 302 , a third comparator module 303 , an and module 304 , an afhs module 306 , a c d module 308 and a p baro update module 310 . the first comparator module 300 determines whether δt is less than δt thr and outputs a corresponding signal to the and module 304 . similarly , the second comparator module 302 determines whether δd is less than δd thr and outputs a corresponding signal to the and module 304 . the and module 304 generates a signal indicating the manner in which afhs is to be calculated based on the outputs of the first , second and third comparator modules 300 , 302 , 303 . for example , if the first comparator module 300 indicates that δt is less than δt thr and the second comparator module 302 indicates that δd is less than δd thr , the signal generated by the and module 304 indicates that afhs is to be determined based on p pre and maf . if , however , the first comparator module 300 indicates that δt is not less than δt thr or the second comparator module 302 indicates that δd is not less than δd thr , the signal generated by the and module 304 indicates that afhs is to be determined based on p pre , maf and a known p baro . the third comparator module 303 determines whether δ { dot over ( m )} is greater than δ { dot over ( m )} thr and outputs a corresponding signal to the afhs module 306 . the afhs module 306 determined afhs based on maf , p pre and a known p baro , depending upon the output of the and module 304 . the c d module 308 determines c d based on afhs and maf . the p baro update module 310 updates p baro based on c d , maf and p pre . the engine can be subsequently operated based on the updated p baro . those skilled in the art can now appreciate from the foregoing description that the broad teachings of the present invention can be implemented in a variety of forms . therefore , while this invention has been described in connection with particular examples thereof , the true scope of the invention should not be so limited since other modifications will become apparent to the skilled practitioner upon a study of the drawings , the specification and the following claims . | 5 |
the following discussion describes in detail one embodiment of the invention ( and several variations of that embodiment ). this discussion should not be construed , however , as limiting the invention to those particular embodiments , practitioners skilled in the art will recognize numerous other embodiments as well . for definition of the complete scope of the invention , the reader is directed to appended claims . fig1 is an illustrative view of the central multi direction transmission system of the present invention 10 in use . the present invention 10 refers to a dual chassis frame having a unifiable front chassis 12 and rear chassis 14 with a central multi direction transmission system 16 that works by activating each of its mechanisms or gears with electric motors or hydraulic injection motors . the object of the invention 10 is to provide a totally different chassis then the ones that exist in the market , based in the innovation of a central multi directional mechanism 17 in the chassis which main function consists on a system that will drive its force multi directionally , semi mechanisms that allow the vehicle &# 39 ; s ample mobility and grip as needed on hard to reach terrain as shown in the illustration . when the central multi - directional mechanism 17 is activated both sides , left or right , on first position and opening and closing the main central piston , will ride imaging a worm , making it strong and safe on any hard to reach terrain due to this mechanism that makes it even more self protected because of its multiple positions . the novelty consists in the front chassis 12 and the rear chassis 14 joined by the central multi - directional mechanism 17 with maximum torsion of 50 ° or more between each other , bending its mechanism 17 60 ° to both sides with the mechanism 17 on first position turning the mechanism 17 90 ° to the left will put in position to bring it up or down . the front chassis 12 and rear chassis 14 each have a pair of distally disposed fixed wheels 18 and medially disposed retractable wheels 20 . fig2 is a perspective view of the multi direction transmission system of the present invention 10 . the present invention 10 is a dual chassis with a central multi - direction transmission 16 shown as a traditional unified chassis . the front chassis 12 and rear chassis 14 are joined together by two central bars 30 and the multi direction mechanism 17 . when the front chassis 12 and the rear chassis 14 are connected by the two central bars 30 , it works as a traditional chassis with little torsion . the novelty consists in the essential technical characteristics that the present invention 10 withholds in order to activate all positions and functions . shown is the present invention 10 during the initial transitional phase between unified chassis operation and dual chassis operation with the central bars 30 extended from the front chassis 12 but still secured to the rear chassis 14 and the retractable wheels 20 lowered to the operational position . the retractable wheels 20 are in the raised position during unified chassis operation . the front chassis 12 comprises a pair of side frames 22 connected by a front bridge 32 and a rear bridge 34 . the rear chassis 14 comprises a pair of side frames 23 connected by first bridge 24 and a rear bridge 26 with a secondary bridge 28 disposed therebetween . fig3 is a perspective view of the present invention 10 with the central bars 30 retracted . the present invention 10 is a dual chassis with a central multi - direction transmission system 10 shown with front chassis 12 and the rear chassis 14 with the two retracted central bars 30 retracted upon release of the pressure locks 60 and joined only by the multi direction central mechanism 17 thereby forming a gap between the front chassis 12 and the rear chassis 14 . on its first position and the central hydraulic piston 36 opened , and the multidirection mechanisms will be ready to be activated in all of their multiple positions . fig4 is a detailed view of the multi direction transmission system of the present invention 10 . the present invention 10 is shown with the front chassis 12 and the rear chassis 14 connected . to operate the system , the first step is to deactivate and retract the two central bars 30 within the half chassis tips . they are deactivated , retracting them in or out on pressure into the front chassis 12 and are attached by automatic pressure locks 60 and by its two hydraulic pistons , generating a primary gap between the two chassis . fig5 is a detailed view of the present invention 10 with central bars 30 retracted to a primary gap during the transition to dual chassis operation mode . to operate the system , the first step is to deactivate and retract the two central bars 30 within the tips of the side frames 22 of the front chassis 12 . they are deactivated , retracting them in or out on pressure into the front chassis 12 and are attached by automatic pressure locks 60 and by its two hydraulic pistons , generating a primary gap 68 between the front chassis 12 and the rear chassis 14 which are now only joined by the central multi - directional mechanism 17 . fig6 is a detailed view of the present invention 10 with the shaft 38 of the central hydraulic piston 36 extended to form a maximum gap separating the front chassis 12 from the rear chassis 14 . the central hydraulic piston 36 will attach on its stable side to the rear chassis 14 on the secondary bridge . the second moving part consists in the central hexagonal bar 40 which is guided on a bearing 58 in its hexagonal guide placed in the first bridge 24 of the rear chassis 14 that will allow for the hexagonal bar &# 39 ; s 40 displacement in a lineal form in the rear chassis 14 and when the two central bars 30 open and the central hydraulic piston 36 is fully extended will add a second gap 70 to the primary gap 68 to provide a maximum gap to allow the flexion of its main or initial position and in this position the central multi - directional mechanism 17 will be ready to be activated by its main worm screw 64 that transfers the strength to the main central gear 62 placed in its peripheral section to the hexagonal center bar 40 in its central part , the transference of said force is obtained by three gears that allow the flexion of the mechanism and with the strength of an electric motor . the advancement of the horizontal bar 40 is affected by the turning auxiliary mechanism 56 and it &# 39 ; s related worm drive 66 to result in the rotation thereof thus turning the central multi - directional mechanism 17 to the vertical position . fig7 is a detailed view of the present invention 10 showing the front chassis 12 separated from the rear chassis 14 and ready to be activated in its first position . shown in its detail is the 25 ° torsion , or more , of each chassis half . being 50 ° or more of proper torsion , for a continued circulation in this position the mechanism will bend the chassis to its both sides . the central multi - directional mechanism 17 remains in the horizontal position until the central hydraulic piston is activated to advance the hexagonal bar 40 . the shock absorbers 54 remain in the first position . fig8 is a detailed view of the present invention 10 showing the separated front chassis 12 and rear chassis 14 with the two central bars 30 retracted and its central hydraulic piston opened and showing a front view of the shock absorber 54 system and its torsion system in the 25 ° or more of torsion from each side including the 90 ° or more , turn of the mechanism from first to second position . in this position , when the central multi - directional mechanism 17 is activated , it will go up and down . the shaft 38 of the central hydraulic piston has advanced the hexagonal bar 40 which was rotated by the turning auxiliary mechanism 56 and its related worm gear 66 thereby rotating the central multi - directional mechanism 17 to the second vertical position . fig9 is an exploded view of the central multi - direction transmission 16 wherein the piston shaft 38 of the central hydraulic piston 36 extends and retracts the hexagonal bar 40 which is rotated during its linear movement by the turning auxiliary mechanism 56 . the hexagonal bar 40 travels through a bearing 58 and is affixed to the central multi - directional mechanism 17 thus allowing it to be rotated simultaneously . a pair of yokes 76 retain the various components of the central multi - directional mechanism 17 including the main central gear 62 and the main worm screw 64 . a main bar 42 extends from the central multi - directional mechanism 17 opposite the hexagonal bar 40 . the components related to the main bar 42 include a back central gear 50 , a pair of bumps 44 offset 90 degrees from one another , a central disc brake 46 , a clutch gear 48 and arm supports 52 for securing the shock absorbers 54 . cardan joints 74 and shafts assist with stabilizing the central multi - directional mechanism 17 . fig1 is a top view showing the flexion process of the present invention 10 showing the flexion process and chassis advancement . three gears allow the flexion of the mechanism and with the strength of an electric motor , the mechanism will give a 60 ° or more in the chassis , this will allow it to make “ u ” turns . fig1 is a top view showing the flexion process of the present invention 10 showing the flexion process and chassis advancement . three gears allow the flexion of the mechanism and with the strength of an electric motor , the mechanism will give a 60 ° or more in the chassis , this will allow it to make “ u ” turns . fig1 is a side view of the present invention 10 prior to flexion . shown is the first step of the flexion process and chassis advancement of the present invention 10 . the following fig1 through 17 are a continuation of the flexion process and are illustrated in steps . fig1 is a side view of step two of the flexion process of the present invention 10 . shown is step two of the flexion process and chassis advancement of the present invention 10 . fig1 is a side view of step three of the flexion process of the present invention 10 . shown is step three of the flexion process and chassis advancement of the present invention 10 . fig1 is a side view of step four of the flexion process of the present invention 10 . shown is step four of the flexion process and chassis advancement of the present invention 10 . fig1 is a side view of step five of the flexion process of the present invention 10 . shown is step five of the flexion process and chassis advancement of the present invention 10 . fig1 is a side view of step six of the flexion process of the present invention 10 . shown is step six of the flexion process and chassis advancement of the present invention 10 . fig1 is a graph showing an example of divided torsion between the two half chassis &# 39 ; s . the objectives of the present invention is that when driving the vehicle in hard to reach terrain , the torsion is divided in two half chassis that will be 25 ° or more for each half chassis . for example , 36 ° for one half chassis and 14 ° for the other half chassis , or 39 ° one half chassis and 11 ° the other half chassis , or as shown by fig1 ; 44 ° for one half chassis and 46 ° for the other half chassis , according to the terrain for which it is designed for . it will be understood that each of the elements described above , or two or more together may also find a useful application in other types of methods differing from the type described above . while certain novel features of this invention have been shown and described and are pointed out in the annexed claims , it is not intended to be limited to the details above , since it will be understood that various omissions , modifications , substitutions and changes in the forms and details of the device illustrated and in its operation can be made by those skilled in the art without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . | 1 |
the following detailed description of the invention refers to the accompanying drawings . the detailed description does not limit the invention . as described herein , an easy entry point is provided through which users may annotate web pages and see other users &# 39 ; annotations . the annotations may be taken from blog posts relating to the web page being annotated . a “ blog ,” which is a shortened term for weblog , may be defined as a website through which an individual or a group generates text , photographs , video , audio files , and / or links , typically but not always on a daily or otherwise regular basis . authoring a blog , maintaining a blog or adding an article to an existing blog is called “ blogging ”. individual articles on a blog are called “ blog posts ”, “ posts ”, or “ entries ”. the person who posts these entries is called a “ blogger ”. frequently , bloggers generate posts that comment on and / or link to other web pages . consistent with an aspect of the invention , a user viewing a web site may concurrently view blog posts about the web site . by using blog posts as annotation information for a web site , inappropriate or spammy comments about a web site can be reduced , as blog posts tend to have an inherent level of seriousness associated with them and the blog posts can be ranked or otherwise filtered based on the quality of the underlying blog . fig1 is an exemplary diagram of a system 100 in which concepts consistent with the principles of the invention may be implemented . system 100 may include clients 110 coupled to servers 120 and 122 via a network 140 . network 140 may include a local area network ( lan ), a wide area network ( wan ), a telephone network , such as the public switched telephone network ( pstn ), an intranet , the internet , or a combination of networks . two clients 110 and two servers 120 and 122 have been illustrated as connected to network 140 for simplicity . in practice , there may be more clients and / or servers . also , in some instances , a client may perform the functions of a server and a server may perform the functions of a client . clients 110 may include a device , such as a wireless telephone , a personal computer , a personal digital assistant ( pda ), a lap top , or another type of computation or communication device , a thread or process running on one of these devices , and / or an object executable by one of these devices . clients 110 may include software such as a browser 115 that is used to access and display web pages from a web server such as server 120 or 122 . browser 115 may include , for example , the firefox ™ browser . clients 110 may additionally include a software component designed to interact with browser 115 to allow users to annotate and view annotations relating to web pages . this software component will be referred to herein as dcom ( distributed web comments ) component 118 . dcom component 118 may be , for example , in some implementations , a web browser plugin or extension . in other implementations , dcom component 118 may be a separate program on client 110 . servers 120 and 122 may provide services on behalf of clients 110 , and may include , for example , a web server , a file server , or an application server . in one implementation , server 120 may include a search engine 125 usable by clients 110 . search engine 125 may be a query - based document search engine . search engine 125 may be designed to return links to web pages that include information relevant to a search query . search engine 125 may be a specialized search engine , such as a blog search engine designed to return blog posts or links that are relevant to user &# 39 ; s search query . search engine 125 may respond to user search queries based on documents stored in database 135 . the documents stored in database 135 may include web pages that are connected to network 140 and that were previously crawled and indexed by search engine 125 . when search engine 125 is a blog search engine , the documents stored in database 135 may be indexed blog posts or blogs . although shown as a single database in fig1 , database 135 could be distributed over multiple storage devices . similarly , although shown as a single device in fig1 , servers 120 / 122 and search engine 125 may be implemented in a distributed manner over multiple computing devices . fig2 is an exemplary diagram of a client 110 , server 120 , or server 122 , referred to as computing device 200 , according to an implementation consistent with the principles of the invention . computing device 200 may include a bus 210 , a processor 220 , a main memory 230 , a read only memory ( rom ) 240 , a storage device 250 , an input device 260 , an output device 270 , and a communication interface 280 . bus 210 may include a path that permits communication among the components of computing device 200 . processor 220 may include any type of processor , microprocessor , or processing logic that may interpret and execute instructions . main memory 230 may include a random access memory ( ram ) or another type of dynamic storage device that stores information and instructions for execution by processor 220 . rom 240 may include a rom device or another type of static storage device that stores static information and instructions for use by processor 220 . storage device 250 may include a magnetic and / or optical recording medium and its corresponding drive . input device 260 may include a mechanism that permits a user to input information to computing device 200 , such as a keyboard , a mouse , a pen , voice recognition and / or biometric mechanisms , etc . output device 270 may include a mechanism that outputs information to the user , including a display , a printer , a speaker , etc . communication interface 280 may include any transceiver - like mechanism that enables computing device 200 to communicate with other devices and / or systems . for example , communication interface 280 may include mechanisms for communicating with another device or system via a network , such as network 140 . software components of system 100 , such as search engine 125 , browser 115 , and dcom component 118 may be stored in a computer - readable medium , such as memory 230 . a computer - readable medium may be defined as one or more physical or logical memory devices and / or carrier waves . the software instructions defining the software components may be read into memory 230 from another computer - readable medium , such as data storage device 250 , or from another device via communication interface 280 . the software instructions contained in memory 230 cause processor 220 to perform processes that will be described later . alternatively , hardwired circuitry may be used in place of or in combination with software instructions to implement processes consistent with the present invention . thus , implementations consistent with the principles of the invention are not limited to any specific combination of hardware circuitry and software . fig3 a is a diagram illustrating an exemplary graphical user interface 300 for a web browser 115 presented to a client 110 using dcom component 118 . user interface 300 may include menu section 305 , navigation toolbar 310 , a web page display section 315 , and a status bar 320 . menu section 305 presents a number of menus to the user through which the user may control the operation of web browser 115 . navigation toolbar 310 may include one or more controls through which the user can control web browser 115 when navigating the web , such as “ forward ” and “ back ” buttons and an input box to enter uniform resource locators ( urls ). web page display section 315 may present the web page currently being visited and status bar 320 may display status information relating to the operation of web browser 115 . status bar 320 may additionally display an indication of how highly the web site or web page currently being visited ( i . e ., the site in display section 315 ) is annotated . in the example shown in fig3 a , this function is performed via a “ buzz ” icon 325 , which is illustrated as a graphical meter . buzz icon 325 may be displayed in status bar 320 on behalf of or under the control of dcom component 118 . buzz icon 325 may change based on a “ buzz rating ” determined based on the annotations associated with the current web site . for example , when a user is visiting a web site with no associated annotations , buzz icon 325 may not be shown or may be shown as an graphical bar or meter with an empty or zero reading . when a user is visiting a web site with annotations , buzz icon 325 may change to reflect the number , quality , and / or temporal relevance of the annotations . for example , a user visiting a site with a lot of annotations may see a buzz icon with a full meter reading . in some implementations , the size or color of buzz icon 325 may also change . the particular design used by buzz icon 325 to reflect the annotations for a site is not critical . in general , buzz icon 325 may be designed so that sites with a high “ buzz ” rating are given a “ stronger ” icon , where the buzz rating may be based on some combination of the number , quality , or timeliness of the annotations associated with the web site . in some implementations , timeliness of the annotations for a site may be based on timeliness relative to the last time the user visited a site . in other words , buzz icon 325 may indicate how much the annotations for the site have changed since the last time the user visited the site . additionally , in some implementations , the functionality of buzz icon 325 may be presented to the user in sections of browser 115 other than status bar 320 . fig3 b is a diagram illustrating a second exemplary graphical user interface 350 for a web browser 115 presented to a client 110 using dcom component 118 . graphical user interface 350 is similar to graphical user interface 300 , except that a sidebar 355 is additionally shown within web page display section 315 . sidebar 355 may be displayed in response to the user indicating an interest in the annotations for a site . for example , the user may be able to toggle sidebar 355 by clicking on buzz icon 325 , by typing a specific keyboard combination , or by selecting the sidebar from menu 305 . sidebar 355 may display the annotations , portions of the annotations , or links to the annotations associated with a particular site . sidebar 355 may additionally allow the user to post comments to his / her blog about the site . as shown in the example of fig3 b , sidebar 355 displays portions of three blog posts , labeled as posts 360 - 362 , that link to the current web site . each blog post 360 - 362 may include a link ( i . e ., the underlined portion ), that , when selected by the user , may take the user to the web page corresponding to the selected blog post . sidebar 355 may additionally include a “ more ” link 365 that , when selected , causes additional annotations to be shown , and a “ create post ” link 367 that , when selected , may provide a convenient entry point through which the user may create a blog post in their own blog about the web site . the operation of dcom component 118 in conjunction with browser 115 will next be described in more detail with reference to the flow charts shown in fig4 - 6 . fig4 is a flowchart illustrating exemplary operations through which a user may initially install or configure dcom component 118 . the user may initially install dcom component 118 at client computer 110 at which dcom component 118 is to be used ( act 401 ). dcom component 118 may be a browser plugin , extension , or other browser addon component that is downloaded from server 120 or 122 . in other implementations , dcom component 118 may be script or other code that can be downloaded and run by client 110 on an as - needed basis . in still other implementations , dcom component 118 may be a separate application that runs in parallel with browser 115 at client 110 . when initially running dcom component 118 , the user may be queried to determine whether they have a blog hosted at a site recognized by dcom component 118 ( act 402 ). if yes , the user may enter their registration information , such as their username and password , for their blog ( act 403 ). this information may be later used to allow the user to post or to begin a post from within sidebar 355 . if the user does not have a blog hosted at a site recognized by dcom component 118 , the user may be prompted to determine whether they would like to sign up for a new blog ( act 404 ). if the user decides they would like to sign up for a new blog , a new web page may be opened at a registration page for the new blog . after the initial installation , login , and / or registration shown in acts 401 - 404 , dcom component 118 may execute normally on client 110 ( act 405 ). normal execution of dcom component 118 will be described in more detail below with reference to fig5 and 6 . after initial installation and registration , acts 401 - 403 may not need to be performed each time the user uses client 110 . fig5 is a flow chart illustration exemplary operations that may be performed during minimized operation of dcom component 118 . dcom component 118 may monitor the browsing session of the user for changes to the web site or web page the user is viewing ( act 501 ). when dcom component 118 detects a new site , or possibly , a new web page within a site , dcom component 118 may obtain the buzz rating , or information that can be used to obtain the buzz rating , for the site ( acts 502 and 503 ). the buzz rating is designed to generally reflect the likelihood that a user will want to view the annotations for the site . as previously mentioned , the buzz rating may be based on some combination of the number , quality , or timeliness of the annotations associated with the web site . in one implementation , dcom component 118 may calculate the buzz rating based on the examination of the annotations ( i . e ., blog posts ) that correspond to a site . the annotations may be obtained by querying a blog search engine , such as search engine 125 , in a manner that restricts the search results to blog posts that link to the current site . for example , queries to the existing google ™ blog search engine of the form “ link : & lt ; url & gt ;” restricts results to blog posts that link to “ url .” using the example web site shown in fig3 a , dcom component may submit the query “ link : labs . google . com ”. the results of this query from search engine 125 may include a number of blog posts for this web site “ labs . google . com ”. based on the number , timeliness , and / or quality of these blog posts , dcom component 118 may generate the buzz rating . as one example of generating a buzz rating , the buzz rating may be equal to the number of blog posts returned from search engine 125 that is more recent than a particular cut - off date ( such as the date associated with the last time the user visited the site ). the buzz rating calculated in act 503 may be presented to the user ( act 504 ). for example , the buzz rating may be visually presented to the user via buzz icon 325 . as previously mentioned , buzz icon 325 may be designed so that sites with a high “ buzz ” rating are given a “ stronger ” ( visually more distinctive ) icon . fig6 is a flow chart illustrating exemplary operations that may be performed during operation of dcom component 118 when the user is viewing the main user interface for dcom component 118 ( e . g ., when the user has clicked buzz icon 325 to display sidebar 355 ). dcom component 118 may retrieve the annotations , or links to the annotations , for the current site , such as by querying search engine 125 ( act 601 ). the annotations may previously have been downloaded by dcom component 118 in generating the buzz rating ( fig5 ). in this situation , dcom component 118 may not need to re - query search engine 125 . the annotations , or a pre - selected number of the annotations , may then be displayed to the user ( act 602 ). in the example shown in fig3 b , three annotations for the current site are shown to the user in sidebar 355 . dcom component 118 may appropriately respond to user actions in sidebar 355 . for example , if the user clicks on a link associated with one of the annotations , browser 115 may be directed to display the complete blog or blog post corresponding to the annotation ( act 603 ). in situations where more annotations are available , the user may choose to see more annotations in sidebar 355 , such as by selecting the “ more ” link 355 ( act 604 ). still further , the user may choose to post a comment about the current site by creating a post for their blog ( act 605 ). the user may initiate their blog post by selecting “ create post ” link 367 . doing so may , for example , take the user to a web page at which the user may manage the blog and , in particular , create a new post for the blog . the new blog post may be preset to include a link back to the current site ( i . e ., “ labs . google . com ” in the example shown in fig3 b ). as mentioned , the user interface shown in fig3 a and 3b are exemplary . additional exemplary user interfaces that may be provided by dcom component 118 will now be described with reference to fig7 a - 7d . in this exemplary implementation of dcom component 118 , dcom component 118 may communicate with the user through popup windows instead of through the sidebar shown in fig3 b . in some implementations , how dcom component 118 communicates with the user , such as a popup window or browser sidebar windows , may be a user - configurable parameter . fig7 a is a diagram illustrating an exemplary graphical user interface 700 for a web browser 115 presented to a client 110 using dcom component 118 . graphical user interface 700 may include a buzz icon 725 that functions similarly to buzz icon 325 . instead of sidebar 355 , graphical user interface 700 may include a popup window 755 that displays a number of annotations for the site currently being viewed . popup window 755 may include a header link 760 for each annotation , a “ show lots more ” link 765 , and an “ add comment ” link 767 . header link 760 , when selected by the user , may open a web browsing window at the blog post corresponding to the header . show lots more link 765 and add comment link 767 may function similarly to “ more ” link 365 and “ create post ” link 367 , respectively . specifically , show lots more link 765 , when selected , causes additional annotations for the web site , if available , to be displayed in popup window 755 . add comment link 767 may provide a convenient entry point through which the user may create a blog post in their own blog about the web site . fig7 b is a diagram illustrating an exemplary graphical user interface 702 in which popup window 755 is shown as a smaller popup window . users may switch between the larger version of popup window 755 and the smaller version of popup window 755 using standard sizing icons in the upper right corner of the window . fig7 c is a diagram illustrating an exemplary popup dialog 704 that may be provided to the user when the user selects “ add comment ” 767 link without having a registered blog . as shown , dialog 704 provides fields through which users may enter their blog username and password . additionally , dialog 704 provides a link through which the user may register for a new blog and a link through which the user may recover a forgotten password . fig7 d is a diagram illustrating an exemplary dialog 706 that may be provided to the user when the user selects “ add comment ” link 767 and the user has registered their blog . as shown , dialog 706 provides an area 770 in which the user may compose their blog post . area 770 may be pre - populated with a link back to the web page currently being viewed . in the example shown in fig7 d , this link is illustrated as the underlined text “ read . . . ”. when the user is ready to publish the blog post to his / her blog , the user may select “ publish ” button 772 . although dcom component 118 was generally described above as receiving and operating on web annotations from a blog search engine , dcom component 118 may more generally operate to receive annotations from other search engines in which the search results are in someway limited by the site or web page currently being visited . more generally , dcom component 118 may operate to receive annotation information from any other website that links to and in someway comments on the current web site . the linking websites may include websites that in someway provide reviews , commentary , critiques , or feedback to the current website or webpage . additionally , instead of receiving annotations from a search engine , dcom component 118 may receive the annotations from a different server , such as an annotation server designed to operate specifically with dcom component 118 . techniques for providing decentralized user web annotations were described above . the web annotations may be based on blog posts , providing the system with an existing initial base of web annotations . additionally , because the annotations may be received from a blog search engine , which may already provide quality and / or spam filtering controls on the blogs it is indexing , the annotations are likely to be less spammy or inappropriate relative to existing web annotation systems . the foregoing description of exemplary embodiments of the invention provides illustration and description , but are not intended to be exhaustive or to limit the invention to the precise form disclosed . modifications and variations are possible in light of the above teachings or may be acquired from practice of the invention . for example , while a series of acts have been described with regard to fig4 - 6 , the order of the acts may be varied in other implementations consistent with the invention . moreover , non - dependent acts may be implemented in parallel . it will also be apparent to one of ordinary skill in the art that aspects of the invention , as described above , may be implemented in many different forms of software , firmware , and hardware in the implementations illustrated in the figures . the actual software code or specialized control hardware used to implement aspects consistent with the principles of the invention is not limiting of the invention . thus , the operation and behavior of the aspects of the invention were described without reference to the specific software code — it being understood that one of ordinary skill in the art would be able to design software and control hardware to implement the aspects based on the description herein . further , certain portions of the invention may be implemented as “ logic ” or as a “ component ” that performs one or more functions . this logic or component may include hardware , such as an application specific integrated circuit or a field programmable gate array , software , or a combination of hardware and software . no element , act , or instruction used in the description of the invention should be construed as critical or essential to the invention unless explicitly described as such . also , as used herein , the article “ a ” is intended to include one or more items . where only one item is intended , the term “ one ” or similar language is used . further , the phrase “ based on ” is intended to mean “ based , at least in part , on ” unless explicitly stated otherwise . | 6 |
fig1 depicts a diagram 100 of an example of a system for maintaining complex equipment . in the example of fig1 , the diagram 100 includes a computer - readable medium 102 , a complex equipment maintenance server 104 , clients 106 - 1 to 106 - n ( collectively , clients 106 ), complex equipment 108 , a complex equipment sensor reporting engine 110 , a complex equipment parameters datastore 112 , and a complex equipment parameter provisioning engine 114 . in the example of fig1 , the computer - readable medium 102 can include communications hardware within a single computer , a device locally attached to a computer , or a networked system that includes several computer systems coupled together , such as a local area network ( lan ), campus area network ( can ), municipal area network ( man ), or wide area network ( wan ), but could include any applicable type of network , such as a personal area network ( pan ). a computer system , as used in this paper , is intended to be construed broadly . in general , a computer system will include a processor , memory , non - volatile storage , and an interface . a typical computer system will usually include at least a processor , memory , and a device ( e . g ., a bus ) coupling the memory to the processor . the processor can be , for example , a general - purpose central processing unit ( cpu ), such as a microprocessor , or a special - purpose processor , such as a microcontroller . the memory can include , by way of example but not limitation , random access memory ( ram ), such as dynamic ram ( dram ) and static ram ( sram ). the memory can be local , remote , or distributed . as used in this paper , the term “ computer - readable storage medium ” is intended to include only physical media , such as memory . as used in this paper , a computer - readable medium is intended to include all mediums that are statutory ( e . g ., in the united states , under 35 u . s . c . 101 ), and to specifically exclude all mediums that are non - statutory in nature to the extent that the exclusion is necessary for a claim that includes the computer - readable medium to be valid . known statutory computer - readable mediums include hardware ( e . g ., registers , random access memory ( ram ), non - volatile ( nv ) storage , to name a few ), but may or may not be limited to hardware . the bus can also couple the processor to the non - volatile storage . the non - volatile storage is often a magnetic floppy or hard disk , a magnetic - optical disk , an optical disk , a read - only memory ( rom ), such as a cd - rom , eprom , or eeprom , a magnetic or optical card , or another form of storage for large amounts of data . some of this data is often written , by a direct memory access process , into memory during execution of software on the computer system . the non - volatile storage can be local , remote , or distributed . the non - volatile storage is optional because systems can be created with all applicable data available in memory . software is typically stored in the non - volatile storage . indeed , for large programs , it may not even be possible to store the entire program in the memory . nevertheless , it should be understood that for software to run , if necessary , it is moved to a computer - readable location appropriate for processing , and for illustrative purposes , that location is referred to as the memory in this paper . even when software is moved to the memory for execution , the processor will typically make use of hardware registers to store values associated with the software , and local cache that , ideally , serves to speed up execution . as used herein , a software program is assumed to be stored at any known or convenient location ( from non - volatile storage to hardware registers ) when the software program is referred to as “ implemented in a computer - readable storage medium .” a processor is considered to be “ configured to execute a program ” when at least one value associated with the program is stored in a register readable by the processor . in one example of operation , the computer system can be controlled by operating system software , which is a software program that includes a file management system , such as a disk operating system . one example of operating system software with associated file management system software is the family of operating systems known as windows ® from microsoft corporation of redmond , wash ., and their associated file management systems . another example of operating system software with its associated file management system software is the linux operating system and its associated file management system . the file management system is typically stored in the non - volatile storage and causes the processor to execute the various acts required by the operating system to input and output data and to store data in the memory , including storing files on the non - volatile storage . the bus can also couple the processor to the interface . the interface can include one or more input and / or output ( i / o ) devices . the i / o devices can include , by way of example but not limitation , a keyboard , a mouse or other pointing device , disk drives , printers , a scanner , and other i / o devices , including a display device . the display device can include , by way of example but not limitation , a cathode ray tube ( crt ), liquid crystal display ( lcd ), or some other applicable known or convenient display device . the interface can include one or more of a modem or network interface . it will be appreciated that a modem or network interface can be considered to be part of the computer system . the interface can include an analog modem , isdn modem , cable modem , token ring interface , satellite transmission interface ( e . g . “ direct pc ”), or other interfaces for coupling a computer system to other computer systems . interfaces enable computer systems and other devices to be coupled together in a network . networks can include enterprise private networks and virtual private networks ( collectively , private networks ). as the name suggests , private networks are under the control of an entity rather than being open to the public . where context dictates a single entity would control a network , it should be understood that reference to a network is a reference to the private portion subset of that network . for example , a lan can be on a wan , but only the lan under the control of an entity ; so if an engine controls policy on the network , it may be that the engine only controls policy on the lan ( or some other subset of the wan ). private networks include a head office and optional regional offices ( collectively , offices ). many offices enable remote users to connect to the private network offices via some other network , such as the internet . the term “ internet ” as used herein refers to a network of networks that uses certain protocols , such as the tcp / ip protocol , and possibly other protocols such as the hypertext transfer protocol ( http ) for hypertext markup language ( html ) documents that make up the world wide web ( the web ). content is often provided by content servers , which are referred to as being “ on ” the internet . a web server , which is one type of content server , is typically at least one computer system which operates as a server computer system and is configured to operate with the protocols of the world wide web and is coupled to the internet . the physical connections of the internet and the protocols and communication procedures of the internet and the web are well known to those of skill in the relevant art . for illustrative purposes , it is assumed the computer - readable medium 102 broadly includes , as understood from relevant context , anything from a minimalist coupling of the components , or a subset of the components , illustrated in the example of fig1 , to every component of the internet and networks coupled to the internet . in the example of fig1 , the computer - readable medium 102 can include a data path , such as a bus , in a computer . in such an implementation , one or more of the components illustrated in the example of fig1 can be implemented on the same machine . referring once again to the example of fig1 , in the example of fig1 , the complex equipment maintenance server 104 is coupled to the computer - readable medium 102 . the complex equipment maintenance server 104 can be implemented on a known or convenient computer system . the complex equipment maintenance server 104 is intended to illustrate one server that has the novel functionality , but there could be practically any number of servers coupled to the computer - readable medium 102 that meet this criterion . moreover , partial functionality might be provided by a first server and partial functionality might be provided by a second server , where together the first and second server provide the full functionality . functionality of the complex equipment maintenance server 104 can be carried out by one or more engines . as used in this paper , an engine includes a dedicated or shared processor and , typically , firmware or software modules that are executed by the processor . depending upon implementation - specific or other considerations , an engine can be centralized or its functionality distributed . an engine can include special purpose hardware , firmware , or software embodied in a computer - readable medium for execution by the processor . in the example of fig1 , the clients 106 are coupled to the computer - readable medium 102 . the clients 106 can be implemented on one or more known or convenient computer systems . as used in this example , the clients 106 are clients of the complex equipment maintenance server 104 . ( the various components of the example of fig1 can have other client - server relationships , as well .) in a specific implementation , the clients can both receive information about complex information from the complex equipment maintenance server 104 and provide inputs to the complex equipment maintenance server 104 . the complex equipment 108 is intended to represent the complex equipment that is being maintained by the system . in the example of fig1 , the complex equipment is coupled to the computer - readable medium 102 by the complex equipment sensor reporting engine 110 . in an alternative , the complex equipment 108 can receive maintenance - related inputs , as well . ( of course , the complex equipment 108 can receive other types of inputs , too .) in the example of fig1 , the complex equipment sensor reporting engine 110 receives sensor results from sensors operationally connected to the complex equipment 108 . the complex equipment sensor reporting engine 110 can preprocess the sensor results or send the raw data to the complex equipment maintenance server 104 for interpretation , reporting , or the like . devices that act as sensors local to the complex equipment 108 , but that are not dedicated sensors operationally connected to the complex equipment 108 , such as a smart phone camera , diagnostic tool , or the like , can be treated as sensors coupled to the complex equipment sensor reporting engine 110 . conceptually , the complex equipment sensor reporting engine 110 is treated as the engine responsible for reporting on conditions of or environment surrounding the complex equipment 108 , while the complex equipment parameter provisioning engine 114 ( described below ) is responsible for reporting installation - agnostic data about complex equipment . in the example of fig1 , the complex equipment parameters datastore 112 is coupled to the computer - readable medium 102 by the complex equipment parameter provisioning engine 114 . the complex equipment parameters datastore 112 can store information useful to an understanding of complex equipment operation , maintenance scheduling recommendations , or the like . the complex equipment parameters datastore 112 , and other datastores described in this paper , can be implemented , for example , as software embodied in a physical computer - readable medium on a general - or specific - purpose machine , in firmware , in hardware , in a combination thereof , or in any applicable known or convenient device or system . this and other repositories described in this paper are intended , if applicable , to include any organization of data , including tables , comma - separated values ( csv ) files , traditional databases ( e . g ., sql ), or other known or convenient organizational formats . in an example of a system where the complex equipment parameters datastore 112 is implemented as a database , a database management system ( dbms ) can be used to manage the complex equipment parameters datastore 112 . in such a case , the dbms may be thought of as part of the complex equipment parameters datastore 112 or as part of the complex equipment parameter provisioning engine , or as a separate functional unit ( not shown ). a dbms is typically implemented as an engine that controls organization , storage , management , and retrieval of data in a database . dbmss frequently provide the ability to query , backup and replicate , enforce rules , provide security , do computation , perform change and access logging , and automate optimization . examples of dbmss include alpha five , dataease , oracle database , ibm db2 , adaptive server enterprise , filemaker , firebird , ingres , informix , mark logic , microsoft access , intersystems cache , microsoft sql server , microsoft visual foxpro , monetdb , mysql , postgresql , progress , sqlite , teradata , csql , openlink virtuoso , daffodil db , and openoffice . org base , to name several . database servers can store databases , as well as the dbms and related engines . any of the repositories described in this paper could presumably be implemented as database servers . it should be noted that there are two logical views of data in a database , the logical ( external ) view and the physical ( internal ) view . in this paper , the logical view is generally assumed to be data found in a report , while the physical view is the data stored in a physical storage medium and available to a specifically programmed processor . with most dbms implementations , there is one physical view and an almost unlimited number of logical views for the same data . a dbms typically includes a modeling language , data structure , database query language , and transaction mechanism . the modeling language is used to define the schema of each database in the dbms , according to the database model , which may include a hierarchical model , network model , relational model , object model , or some other applicable known or convenient organization . an optimal structure may vary depending upon application requirements ( e . g ., speed , reliability , maintainability , scalability , and cost ). one of the more common models in use today is the ad hoc model embedded in sql . data structures can include fields , records , files , objects , and any other applicable known or convenient structures for storing data . a database query language can enable users to query databases , and can include report writers and security mechanisms to prevent unauthorized access . a database transaction mechanism ideally ensures data integrity , even during concurrent user accesses , with fault tolerance . dbmss can also include a metadata repository ; metadata is data that describes other data . in the example of fig1 , the complex equipment parameter provisioning engine 114 acts as a data server for the complex equipment parameters datastore 112 . typically , the term “ server ” is reserved for situations where the engine has a client - server relationship with some other component . in an implementation where , e . g ., the complex equipment parameters 112 and the complex equipment maintenance server 104 are local to one another , the complex equipment parameter provisioning engine 114 could be considered “ part of ” the complex equipment maintenance server 104 , or in a database implementation , a database interface . in the example of fig1 , the complex equipment parameter provisioning engine 114 can include data from any applicable sources , including maintenance requirements datastores ( such as documents ), data feeds , schedules , work orders , work lists , manual input , or the like . the platform can include an application programming interface ( api ) to facilitate integration of the system with various sources of data ( and for outputs , as well ). thus , the complex equipment parameters datastore 112 can represent any applicable source of complex equipment data available from a source other than the complex equipment 108 itself ( or sensors operationally connected thereto ). advantageously , the complex equipment parameter provisioning engine 114 can provide information about complex equipment even if the complex equipment was implemented prior to an implementation of the system illustrated in the example of fig1 . thus , the platform can integrate with existing equipment systems . moreover , the platform can be upgraded or improved without interfering with installed equipment . advantageously , the platform is designed to satisfy underserved customer needs in the job of maintaining complex equipment . from the customer &# 39 ; s perspective , better satisfying customer needs is how the platform helps them get the job done better . for example , the platform can synchronize with a calendar to schedule maintenance , identify maintenance issues from sensors on the complex equipment , calculate time required for maintenance , create a maintenance plan , and monitor maintenance activities . if maintenance requirements change , for example , the platform can modify the maintenance schedule and notify regarding the new requirements . the features of the platform help customers achieve one or more of the 102 identified outcomes for 14 job steps of a job map for maintaining complex equipment . fig2 depicts a flowchart 200 of an example of a job map for maintaining complex equipment . in the example of fig2 , the flowchart 200 starts at module 202 where equipment &# 39 ; s maintenance requirements are determined . maintenance requirements can be standard for equipment , as set by a manufacturer , installer , or the like . the requirements need not be from an “ official ” source if other data is deemed to be more useful . the maintenance requirements can be considered a baseline maintenance schedule that does not take into account use or environmental factors ( though such factors could be generally input in advance ). in the example of fig2 , the flowchart 200 continues to module 204 where unscheduled maintenance issues are determined . any maintenance issues that can be identified based upon the maintenance requirements that have not been scheduled can be scheduled . in the example of fig2 , the flowchart 200 takes a parallel path to module 206 where equipment utilization is tracked . equipment utilization can be tracked using sensors at or near a complex equipment installation site , mobile sensors carried by people ( and perhaps animals or machines ), manual inputs from workers , or the like . in the example of fig2 , the flowchart 200 continues to module 208 where upcoming inspection issues are determined . based upon equipment utilization , environmental factors , and maintenance requirements or suggestions , it may be desirable to schedule inspections . in the example of fig2 , the flowchart 200 takes a parallel path to module 210 where upcoming maintenance items are determined . based upon equipment utilization , environmental factors , and maintenance requirements or suggestions , upcoming maintenance items can be determined . in the example of fig2 , the three parallel paths ( from modules 204 , 208 , and 210 ) converge as flowchart 200 continues to module 212 where needed parts are determined . a complex equipment maintenance platform can make a determination regarding maintenance and determine needed parts based upon that determination . in the example of fig2 , the flowchart 200 continues to module 214 where scope of work is determined . scope of work can include amount of time complex equipment will be taken out of service , amount of human resources that must be allocated to the maintenance , cost and time for third party contributions , and the like . in the example of fig2 , the flowchart 200 continues to module 216 where equipment is scheduled for service . it may be noted that scheduling the equipment for service may or may not entail re - determining needed parts or re - determining scope of work ( modules 212 and 214 , respectively ). scheduling the equipment for service can include synchronizing users &# 39 ; calendars with a maintenance schedule . the scheduling can take into account open time slots on user calendars , locations of users with relevant expertise , third party availability , and the like . in a specific implementation , the scheduling is fully automated . in the example of fig2 , the flowchart 200 continues to module 218 where maintenance schedule is confirmed . confirmation can include an administrative sign - off on the scheduled activity , confirmation from relevant parties that the schedule is acceptable , etc . in the example of fig2 , the flowchart 200 continues to optional module 220 where equipment is delivered to maintenance site . part of scheduling can include scheduling delivery , if applicable . in the example of fig2 , the flowchart 200 continues to module 222 where maintenance activities are monitored . it is generally desirable to monitor maintenance so as to adjust maintenance needs as new action items are uncovered , if any . in the example of fig2 , the flowchart 200 continues to module 224 where maintenance documentation is inspected . regulations may require certain historical logs . it can also be desirable to maintain historical logs for later reference . in the example of fig2 , the flowchart 200 continues to module 226 where maintenance discrepancies are resolved , if any . whether maintenance discrepancies exist will depend upon what is identified during monitoring of the maintenance . in the example of fig2 , the flowchart 200 ends at module 228 where equipment is put back in service . it may or may not be necessary to take equipment out of service for maintenance , but it is to be expected for certain equipment and / or for certain maintenance actions . in such cases , the equipment must be put back into service . business process management ( bpm ), as used in this paper , is a technique intended to align organizations with the needs of clients by continuously improving processes . bpm is an advantageous implementation because it tends to promote business efficacy while striving for innovation and integration with technology . it should be noted that business process modeling and business process management are not the same , and , confusingly , share the same acronym . in this paper , business process management is given the acronym bpm , but business process modeling is not given an acronym . business process modeling is often , though not necessarily , used in bpm . business process modeling is a way of representing processes in systems or software . the models are typically used as tools to improve process efficiency and quality , and can use business process modeling notation ( bpmn ) or some other notation to model business processes . a business process , as used in this paper , is a collection of related , structured activities or tasks that produce a service or product for a particular client . business processes can be categorized as management processes , operational processes , and supporting processes . management processes govern the operation of a system , and include by way of example but not limitation corporate governance , strategic management , etc . operational processes comprise the core business processes for a company , and include by way of example but not limitation , purchasing , manufacturing , marketing , and sales . supporting processes support the core processes and include , by way of example but not limitation , accounting , recruiting , technical support , etc . a business process can include multiple sub - processes , which have their own attributes , but also contribute to achieving the goal of the super - process . the analysis of business processes typically includes the mapping of processes and sub - processes down to activity level . a business process is sometimes intended to mean integrating application software tasks , but this is narrower than the broader meaning that is frequently ascribed to the term in the relevant art , and as intended in this paper . although the initial focus of bpm may have been on the automation of mechanistic business processes , it has since been extended to integrate human - driven processes in which human interaction takes place in series or parallel with the mechanistic processes . fig3 depicts a diagram 300 of an example of a complex equipment maintenance platform . the platform is intended to help a user maintain complex equipment with minimal or no input or decision - making by the user . in a specific implementation , the platform obtains relatively large amounts of data and information that impacts maintaining complex equipment and informs the user of recommended actions . solution features can be integrated into the platform and delivered to the user through one or more devices and / or applications . in the example of fig3 , the diagram 300 includes an information datastore 302 , a protected gateway 304 , a time elements engine 306 , a location elements engine 308 , a real - time elements engine 310 , a historic and predictive elements engine 312 , an optimization of parameters engine 314 , an api for multiple input sources 316 , an equipment connectivity engine 318 , a feedback engine 320 , an api for third party developers 322 , a continuous calculations and decisions engine 324 , a self - scaling engine 326 , a notification engine 328 , and a privacy safeguard engine 330 . in the example of fig3 , the information datastore 302 incorporates information from multiple datastores such a maintenance requirements datastore , an equipment utilization information datastore , an equipment sensor datastore , etc . the information datastore 302 thus includes any information useful in determining maintenance needs , whether inherent in the design of the equipment , or based upon use after deployment . design - specific datastores can even be updated based on data derived from deployment to tweak maintenance recommendations across an enterprise or for all users of the equipment . in the example of fig3 , the protected gateway 304 ensures the platform does not become a “ hacker &# 39 ; s pathway ” to equipment control systems . known or convenient security techniques can be employed to ensure system security . in the example of fig3 , the time elements engine 306 ensures the platform knows what time it is and can schedule maintenance . in the example of fig3 , the location elements engine 308 can identify where complex equipment is located . it may also be desirable to locate users , at least relative to the complex equipment location . in the example of fig3 , the real time elements engine 310 delivers real - time information to users , such as a notification or display that equipment is currently operating . in a specific implementation , the platform can incorporate up - to - date data as rapidly as the data becomes available . in the example of fig3 , the historic and predictive elements engine 312 can combine historic logs with a prediction engine . in a specific implementation , the platform can modify generic maintenance parameters for equipment based upon historic data for deployed equipment . in the example of fig3 , the optimization of parameters engine 314 can optimize parameters to find a solution . in a specific implementation , the platform has a robust algorithm implemented in order to allow the platform to make a decision . a goal is to minimize the need for a customer to think about how to best maintain a complex piece of equipment . the result is a platform that does not need any user input regarding maintenance ( though some input may or may not be desirable in certain instances ). in the example of fig3 , the api for multiple input sources 316 enables the platform to communicate with a variety of different sources of or destinations for data . this can be useful for receiving data from sensors , data feeds , and manual inputs , and for providing instructions to sensors or output to display devices . the api for multiple input sources 316 can include a number of different apis that are referred to collectively as the api for multiple input sources . in the example of fig3 , the equipment connectivity engine 318 includes a communication link between equipment and the platform . in a specific implementation , the equipment connectivity engine 318 can use equipment systems and sensors to connect to the platform . in the example of fig3 , the feedback engine 320 includes a feedback channel for improving decision - making capabilities . in a specific implementation , the platform learns over time and becomes more accurate in order to understand maintenance requirements of complex equipment . in the example of fig3 , the api for third party developers 322 makes it easier for third party developers to create applications on the platform . the api for third party developers 322 can include a number of different apis that are referred to collectively as the api for third party developers . in the example of fig3 , the continuous calculations and decisions engine 324 enables the platform to continuously deliver information . continuous calculations and decisions can be accomplished by using a server that is not taken off - line to the extent that is possible . moreover , a breakdown in communications links does not necessarily mean the platform ceases to perform calculations and make decisions . in a specific implementation , the continuous calculations and decisions engine 324 can operate without wireless connectivity . for example , the platform can cache data in case of a lapse in cellular or other wireless coverage and , if connectivity is lost , the system does not “ go blank ” and will have the latest information as of when connectivity was lost ( and perhaps updated through other channels while connectivity is down ). in the example of fig3 , the self - scaling engine 326 ensures no additional end - user hardware is required . in a specific implementation , the platform can detect resources available and scale service to the available resource . thus , minimally essential capability should be available on user owned device , regardless of the capabilities of the device beyond a certain constant threshold . as more resources become available , service scales upward . in a specific implementation , the platform can work on a variety of popular devices , such as web - enabled devices , pcs , tablets , smartphones , etc . in the example of fig3 , the notification engine 328 can provide notifications to users . devices with the capability can receive sms notifications or other types of messages depending upon the capabilities of the device and implementation - and / or configuration - specific capabilities of the platform . the platform provides end user alerts , for example , an updated maintenance requirement based on utilization of the equipment . in the example of fig3 , the privacy safeguard engine 330 provides privacy safeguards that are determined to be appropriate generally or for a given implementation . the platform can minimize privacy barriers to adoption and use of the system . in a specific implementation , individually identifiable information is not retained at any central server sites longer than necessary . alternatively or in addition , individual historical data is retained only on user - controlled devices . fig4 depicts a diagram 400 of an example of a system for maintaining complex equipment . in the example of fig4 , the diagram 400 includes a maintenance recommendation engine 402 , an equipment synchronization engine 404 , an inspection recommendation engine 406 , a maintenance parts engine 408 , a scope of work determination engine 410 , a calendar synchronization engine 412 , a notification engine 414 , an equipment delivery engine 416 , a maintenance monitoring engine 418 , maintenance documentation engine 420 , and a maintenance resolution engine 422 . in the example of fig4 , the maintenance recommendation engine 402 has access to standard maintenance information associated with a relevant complex equipment system , historical maintenance data associated with the relevant complex equipment system , and perhaps other data that is considered useful in determining whether unscheduled maintenance issues exist . in the example of fig4 , the equipment synchronization engine 404 is coupled to the maintenance recommendation engine 402 . the equipment synchronization engine 404 enables a job executor to automatically monitor maintenance recommendations based upon utilization of the equipment . monitored parameters can include operating parameters ( e . g ., temperature , fluid levels , frequency of use , etc .) and environmental parameters ( e . g ., humidity , temperature , particulates , etc .). the equipment synchronization engine 404 can provide the maintenance recommendation engine 402 with data to facilitate the maintenance recommendation engine 402 in determining upcoming maintenance items for the relevant complex equipment system . in the example of fig4 , the inspection recommendation engine 406 is coupled to the equipment synchronization engine 404 . the inspection recommendation engine 406 receives data from the equipment synchronization engine 404 ( or from sensors associated with the relevant complex equipment system ). in an alternative , the inspection recommendation engine 406 and the maintenance recommendation engine 402 can be considered a single maintenance recommendation engine that determines unscheduled maintenance issues , determines upcoming inspection issues , and determines upcoming maintenance issues . in the example of fig4 , the maintenance parts engine 408 is coupled to the maintenance recommendation engine 402 and the inspection recommendation engine 406 . the maintenance parts engine 408 determines needed parts based upon recommended maintenance and inspections . in a specific implementation , the maintenance parts engine 408 can also place orders for parts or send a notification to a user to complete the order , request a bid for parts , and / or manage parts inventory for the relevant complex equipment system ( and potentially other applicable equipment systems if parts are shared , space must be managed , or the like ). in the example of fig4 , the scope of work determination engine 410 is coupled to the maintenance parts engine 408 . the scope of work determination engine 410 can make decisions about what maintenance and / or inspections can be carried out . the scope of work can be determined from standard maintenance information and historical maintenance data . the scope of work determination engine 410 can be considered part of a maintenance decision engine that can also include the maintenance recommendation engine 402 and / or the inspection recommendation engine 406 . in the example of fig4 , the calendar synchronization engine 412 is coupled to the scope of work determination engine 410 . the calendar synchronization engine 412 can synchronize a user calendar with the platform . in a specific implementation , when a user &# 39 ; s calendar is synchronized with the platform , the system can automatically calculate a maintenance schedule , determined maintenance recommendations , and schedule the maintenance on the user &# 39 ; s calendar . the calendar synchronization engine 412 enables the platform to track the user &# 39 ; s and the relevant complex equipment system &# 39 ; s maintenance schedules and allocate time for maintenance . in the example of fig4 , the notification engine 414 is coupled to the calendar synchronization engine 412 . the notification engine 414 can provide a user with recommended maintenance for approval by the user . notifications can also be sent to update a user regarding changes to a previously scheduled action . the user can modify details of the maintenance schedule , respond to open items regarding parts that need be ordered or other issues , and ultimately confirm the maintenance schedule and related action items . actions taken by the user may or may not result in the need for additional determinations related to needed parts , changes to the scope of the work , changes to scheduling , etc . in the example of fig4 , the equipment delivery engine 416 is coupled to the notification engine 414 . in some instances , which can vary depending upon the equipment , the type of maintenance required , etc ., it may become desirable to deliver the relevant complex equipment system , or a portion thereof , to a maintenance site . the equipment delivery engine 416 can handle the equipment delivery details , including scheduling third parties to pick up and return , a job executor to be present for delivery or other purposes , handling payments to third parties , etc . not all implementations will need an equipment delivery engine 416 , and not all maintenance scheduling will necessarily entail equipment delivery . in the example of fig4 , the maintenance monitoring engine 418 is coupled to the equipment delivery engine 416 . the maintenance monitoring engine 418 periodically , occasionally , or continuously monitors activities taken in association with maintenance . information about the maintenance can be input from more than one source , including sensors installed at the site of the relevant complex equipment system , manual inputs by technicians or workers , inputs from mobile sensors ( e . g ., carried by the technicians ), or the like . using the inputs , the platform can revisit determinations regarding upcoming maintenance items , determining needed parts , determining scope of work , scheduling the equipment for service , confirming maintenance schedules , etc . in the example of fig4 , the maintenance documentation engine 420 is coupled to the maintenance monitoring engine 418 . the maintenance documentation engine 420 enables a user to document maintenance and verify compliance with regulations or other requirements . in a specific implementation , the maintenance documentation engine 420 enables the user to review historical documentation and compliance . in the example of fig4 , the maintenance resolution engine 422 is coupled to the maintenance documentation engine 420 . the maintenance resolution engine 422 enables the user to resolve maintenance discrepancies . the maintenance resolution engine 422 can also make decisions on behalf of a user about discrepancy resolution based upon one or more input sources . the maintenance resolution engine 422 can also put the relevant complex equipment system back in service or schedule the system to be put back in service , if the complex equipment had to be taken out of service for maintenance or inspection . fig5 depicts a flowchart 500 of an example of a method for maintaining complex equipment at a complex equipment maintenance platform . in the example of fig5 , the flowchart 500 starts at module 502 with identifying maintenance requirements and continues to module 504 with tracking equipment utilization ; module 506 with determining needed parts from the identified equipment maintenance requirements and tracked equipment utilization ; module 508 with determining scope of work for maintenance of the equipment ; module 510 with establishing a maintenance schedule in accordance with a job executor calendar ; module 512 with notifying the job executor of the maintenance schedule ; module 514 with confirming the maintenance schedule with the job executor ; module 516 with scheduling the equipment for delivery to a maintenance site ; module 518 with receiving an indication that the equipment has been taken out of service for maintenance ; module 520 with monitoring maintenance activities by the job executor ; and module 522 with providing documents for inspecting maintenance documentation , and ends at module 524 with receiving an indication that the equipment has been put back in service following the maintenance . the detailed description discloses examples and techniques , but it will be appreciated by those skilled in the relevant art that modifications , permutations , and equivalents thereof are within the scope of the teachings . it is therefore intended that the following appended claims include all such modifications , permutations , and equivalents . while certain aspects of the invention are presented below in certain claim forms , the applicant contemplates the various aspects of the invention in any number of claim forms . for example , while only one aspect of the invention is recited as a means - plus - function claim under 35 u . s . c . sec . 112 , sixth paragraph , other aspects may likewise be embodied as a means - plus - function claim , or in other forms , such as being embodied in a computer - readable medium . ( any claims intended to be treated under 35 u . s . c . § 112 , ¶ 6 will begin with the words “ means for ”, but use of the term “ for ” in any other context is not intended to invoke treatment under 35 u . s . c . § 112 , ¶ 6 .) accordingly , the applicant reserves the right to add additional claims after filing the application to pursue such additional claim forms for other aspects of the invention . | 6 |
embodiments of the invention are described herein in the context of a urinalysis system , and particularly to an in - vitro urinalysis diagnostic device that generally utilizes the technologies disclosed in u . s . pat . nos . 4 , 338 , 024 and 4 , 393 , 466 . however , it is to be understood that the embodiments provided herein are just preferred embodiments , and the scope of the invention is not limited to the applications or the embodiments disclosed herein . a “ particle ,” as used herein , is any substance that may be carried in a fluid sample , including but not limited to a cell . “ misclassification ,” as used herein , includes identifying a particle as something that belongs to a class that is different from the actual class it belongs to . “ reclassification ” of a particle is changing the class of a particle from one class to another , and includes moving a particle between an artifact class and a class with a predefined set of criteria . the invention includes a systematic method of correcting the classification errors so that the particle concentrations can be determined with a reasonable level of accuracy while demanding less time from the operator . if the operator chooses to perform a manual review , the concentration results calculated by the method of the invention will help the operator perform the review more efficiently by providing a reasonably accurate guideline as to what the end result will look like . the method of the invention assigns a class weight ( cw ) to each particle class . the class weight is a unit - less parameter obtained from statistical evaluation of the correlation between average results of the preliminary classification and perfect , error - free results . the class weight , in effect , is a multiplier that compensates for the fact that the preliminary classification commits errors at a certain frequency ( e . g ., one misclassification out of every x particles ). the class weight is usually different for each particle class . all particles belonging to a particular particle class share the same class weight value . in an exemplary sample that contains red blood cells and white blood cells , there are three particle classes : a red blood cell class ( r ), a white blood cell class ( w ), and an artifact class . an artifact class is a “ catch - all ” type class that is used for particles that are not clearly identified as belonging to one of the predefined classes . if it is known from prior runs and edits that only 50 % of all the red blood cells are correctly classified as red blood cells , and only 30 % of all the white blood cells are classified as white blood cells on the average , the class weights for red blood cells and white blood cells , respectively , would be 2 and 3 . 3 . if the number of particles that are in class r is multiplied by the class weight for red blood cells ( 2 ), and the number of particles in class w is multiplied by the class weight for white blood cells ( 3 . 3 ), the resulting numbers will approximate the correct numbers of red blood cells and white blood cells in the sample . the class weight takes into account the possibility that a red blood cell may have erroneously been classified as a white blood cell , and vice versa . in addition , the class weight also accounts for the fact that statistically determined fractions of all the red blood cells and all the white blood cells are preliminarily classified in the artifact class . one way of determining the class weight for a particle class is to use a look up curve . a look up curve can be established that correlates the results obtained by the preliminary classification process ( e . g ., apr ) and the results after a more complete review and correction by a human operator . the inverse of this look up curve equals the class weight . a regression analysis using a linear model could be used to approximate the class weight . a class weight of 1 means that the apr process and the human - corrected process produce the same results ( i . e ., the apr result is error free ). a class weight higher than 1 indicates that less than all the particles of the class are properly classified in that class by the initial classification method . thus , the initial class weights are usually 1 or higher , with artifacts having a class weight of 1 . if a class weight is determined based on statistical evaluation and subsequently there is a reclassification by the operator , the class weight ( i . e ., the class weight before reclassification ) is recalculated to reflect the reclassification . since each class is associated with a particular class weight and the different classes usually have different class weights , an operator &# 39 ; s re - classifying a particle affects the particle concentrations for a few different classes . for example , if the concentration of red blood cells is determined to be c r , old and the concentration of white blood cells is determined to be c w , old based on the preliminary classification , moving a misclassified particle from class w to class r will affect the concentrations c r , new and c w , new . once the number of particles in each class is determined by using the class weight , concentrations are calculated . details on how to calculate the concentration are provided below . as used herein , i represents the total number of particles in a sample . fig1 is a flowchart depicting a complete classification process 10 in accordance with an embodiment of the invention . the complete classification process 10 includes a preliminary determination process 20 and a full edit process 30 . as described above , frames ( still pictures ) of the sample are taken and particle images are extracted from the frames ( step 21 ). then , a preliminary classification is performed whereby the particle images are placed into one of a predefined set of classes ( step 22 ). during this preliminary classification process , particles that are not identified as belonging to one of the predefined set of classes with a pre - selected level of certainty are classified in the artifact class . at the end of the preliminary classification process , all i particles in the sample are classified . this preliminary classification may be performed through an automatic process such as the apr process , which is a neural net based process described in u . s . patent application ser . no . 09 / 841 , 941 filed on apr . 24 , 2001 and u . s . patent application ser . no . 10 / 716 , 589 filed on nov . 18 , 2003 , both of which are incorporated herein by reference . during preliminary classification , the system that runs the process 10 may maintain a record of which frame each particle image was extracted from . although the apr process is an automatic process , preliminary classification may be performed using any well known classification method and does not have to be a 100 % automatic process . after the preliminary classification , the edit weights are determined for the particles ( step 23 ). in the case of the complete classification process 10 where all i particles are classified , the edit weight for each particle is 1 because each particle represents itself . after the edit weights are determined , the preliminary concentrations are calculated ( step 24 ). the concentration for a class of particles is typically calculated by multiplying the number of particles in the class ( i . e ., the sum of the edit weights of particles in the class wherein each edit weight = 1 ) with the class weight and dividing the product by the sample volume . the concentrations may be calculated in any desired unit , such as number of particles per volume or the percentage of a particular class of particles out of the total number of particles . if the operator chooses to see the concentrations based on the preliminary classification ( step 25 ), the concentrations are displayed to the operator ( step 26 ). the operator may choose to accept the calculated concentration results without a detailed review of the classifications , or conduct a manual review ( step 12 ). if the operator chooses to release the results without further review , the results are compiled into a report ( step 14 ). on the other hand , if the operator chooses to review the results , the full edit process 30 begins . during the full edit process 30 , the operator may reclassify particles or simply “ approve ” the preliminary classification on a particle - by - particle basis . the system senses whether a reclassification is made by moving a particle from one class to another ( step 31 ). when a change is sensed , a class weight modification process is triggered whereby the class weight is modified to reflect the particle reclassification ( step 32 ). the class weight is adjusted according to the following equation : cw new =[( n − n moved )· cw old + n moved ]/ n ( 1 ) cw old = old class weight before the adjustment ; n = total number of particles that are classified ( including artifacts ); and n moved = effective number of particles that are reclassified . when the operator approves a preliminary classification result without making any edits , the class weight modification process is not triggered . preferably , the class weight is modified in response to every change the operator makes , so that the change in concentration due to a single move will not be dramatic . if a particle is moved from class a to class b and then back to class a , n moved is incremented and then decremented to cancel out the effect of the moves . also , if a particle is reclassified a number of times , only the first and the last classifications affect the class weight regardless of the steps in between . for example , if a particle is moved from class a to class b , then from class b to class c , and then from class c to class d , the ultimate effect on the class weight is the same as if the particle had been moved from class a to class d in a single move . after the operator completes the edit process , the system automatically recalculates the concentrations to reflect the changes made by the operator ( step 33 ), using the following equation : where ref is the run equivalency factor ( i . e ., the volume of the sample or the total number of the particles that were classified , depending on the desired units of concentration ). ew is the edit weight for a particle ( defined in more detail below ), and σ ( class a ) ew is the sum of all the edit weights of the particles in class a . in the case of complete classification , where the edit weight of each particle is 1 , σ ( class a ) ew is the same as the current number of particles in class a ( i . e ., after the most recent reclassification ). depending on the embodiment , the recalculated concentration may be displayed to the operator . steps 31 , 32 , and 33 are repeated until there are no more changes to be made ( step 34 ), at which point the reviewed results are incorporated into a report ( step 14 ). when asked if more changes are desired in step 34 , the operator may make further changes to the same particle that was already reclassified before , or reclassify a new particle . eventually , when the operator is satisfied with the classification , the full edit process 30 ends . theoretically , the only classification error that appears in the report 14 should be from human error committed by the operator . if the operator were to continue to review and edit all the particle images captured from the sample , the class weights for all the different particle classes should converge to 1 . fig2 is a flowchart depicting a first partial classification process 40 in accordance with another embodiment of the invention . the first partial classification process 40 includes a preliminary classification process 50 and an abbreviated edit process 60 . similarly to the complete classification process 10 , the preliminary classification process 50 starts with extraction of particle images from the frames ( step 51 ). the extracted particle images are then divided among a certain number of bins ( step 52 ). unlike in the complete classification process of fig1 , only n of the i particles in the sample are placed in the bins ( n & lt ; i ) and only the particles that are placed in the bins are reviewed by the operator . the particles that are placed in the bins are , in effect , “ selected ” for operator review and the remaining particles are skipped and / or discarded . the n particles that are classified may not be the first n particles in the sample because classifying the first n particles could result in classification of only the particles that exist in high concentration and failure to classify any of the particles that exist in low concentrations . the method of sampling n particles into a number of bins is disclosed in detail in u . s . pat . no . 6 , 141 , 624 , which is incorporated by reference herein . in an exemplary embodiment , there are three bins : bin a , bin b , and bin c , wherein each bin is defined by a particle size range . the number of bins and the criteria for the bins may be determined by trial and error or some type of iterative procedure . whatever the criteria may be , however , the bins must be mutually exclusive and cover the entire domain of observed particles . for example , bins a , b , and c may each hold small , medium , and large particle sizes , respectively , with size ranges assigned as follows : class a : particles having an image size between 0 and s a pixels ( e . g ., 69 pixels ), class b : particles having an image size between ( s a + 1 ) to s b pixels ( e . g . 109 pixels ), and class c : particles having an image size larger than ( s b + 1 ) pixels , wherein the pixels refer to pixels of the particle images that were extracted in step 51 . depending on the application , any visually discernable characteristic of the particles ( e . g . average particle brightness , color , shape , etc .) could be used instead of particle size as a selection criteria for the bins . as used herein , particles are “ selected ” if they are placed into one of the bins . the first partial classification process 40 uses various parameters to ensure that the subgroup of particles that are classified reflect the particle mix of the total sample as closely as possible . these parameters include a maximum number of selected particles ( n max ) and maximum bin capacities ( max bin a , max bin b , max bin c ). n max is the maximum number of particles that may be selected from one sample , and maximum bin capacities ( max bin a , max bin b , max bin c ) are numbers that are assigned to each of the bins to limit the number of particles each bin can hold . in the preferred embodiment , the system sequentially goes through the particle images ( e . g . in the order that they were acquired ) and places the particle images according to the particle bin criteria until either n max has been reached or all particles have been examined ( i . e ., if i & lt ; n max ). if the maximum bin capacity max bin is reached for any of the bins , no more particles are placed into the particular bin even if they meet the criteria for the particular bin . for example , particles that belong to bin a are skipped and not placed into any bin if bin a has reached max bin a . while none of the maximum bin capacities is greater than n max , the sum of all the maximum bin capacities is greater than n max . in an exemplary embodiment , each of the maximum class sizes max bin a , max bin b , and max bin c is 500 particles and n max is 750 particles . if the sample contains a high concentration of particle type a , medium concentration of particle type b , and a low concentration of particle type c , bin a will reach its maximum capacity before the other bins . at the time max bin a is reached ( i . e ., 500 particles are in it ), there may be 100 particles in bin b and 20 particles in bin c . once max bin a is reached , particle selection into bin a stops and the sample volume at which the last particle was added to bin a is noted . sampling continues into the other bins until n max is reached . if either bin b or bin c reaches its maximum capacity before n max is reached , no more particles are placed into that bin . particles that are determined to be type - a are skipped if bin a is already full , and the operator does not review them . once n max is reached , the partial classification process 50 stops . the division of particles into bins is used for edit weight determination ( step 53 ). a particle edit weight ( ew ) is assigned to each bin and all the particles in a bin have the same edit weight . the edit weight is used to calculate the concentration for each class of particles , for example according to equation ( 2 ) above . there are four possible scenarios for edit weight calculations : 1 . if n max has been reached for the sample during the above described selection process , but no bin is full , then ew = file volume ratio ( fvr ) for all the selected particle images , where fvr is calculated by dividing the number of captured image frames by the number of the last frame at which n max was reached . for example , suppose the bin selection process stopped with 400 , 300 , and 50 particles in bin a , bin b , and bin c , respectively , where n max is 750 . suppose also that n max was reached after 150 frames were reviewed , and that the entire sample contains 400 frames . the fvr for the particles in this example would be 400 / 150 = 2 . 67 , indicating that each particle in this example represents 2 . 67 particles of the same particle type . 2 . if n max for the sample was not reached , but the bin maximum number ( max bin ) has been reached for any of the bins , then ew = bin volume ratio ( bvr ) for the particle images in those bins , where bvr for each bin is calculated by dividing the number of captured image frames by the number of the last frame at which max bin was reached for that bin . so , for example , if 500 type - a particles are in bin a , particle placement into bin a stopped at the 100th frame , and the total sample volume contains 400 frames , the edit weight is 400 / 100 = 4 . in this example , every particle a that is captured stands for 4 type - a particles . 3 . if both n max and max bin are reached , then the ew of particles in the bin whose max bin is reached is calculated with the bvr . on the other hand , the ews of particles in the bins that are less than full are calculated with the fvr . 4 . if i & lt ; n max and all the particles in the sample are placed into the bins without reaching either n max or a max bin , ew = 1 . the n particles that are selected into the bins are subjected to the preliminary classification process according to the visual criteria for each class ( step 54 ). usually , some of the n particles are classified into an artifact class because they cannot be clearly identified as belonging to one of the predefined classes . after the partial classification process , the concentrations are calculated using the class weight and the edit weight ( step 55 ). the concentration of a particle class is the sum of the edit weights of the particles in the class multiplied by the class weight and divided by the sample volume or total number of particles i to obtain the concentration . if the operator chooses to see the concentrations ( step 56 ), the resulting concentration is displayed to the operator ( step 57 ), who then decides whether to manually review the preliminary classification ( step 42 ). if the operator chooses not to conduct a manual review , the concentrations determined in step 55 are incorporated into the report 44 . on the other hand , if the operator chooses to conduct a manual review , the abbreviated edit process 60 begins . the operator makes changes or approves a preliminary classification on a particle - by - particle basis . the system senses the operator action ( step 61 ) so that each time a reclassification is made , the class weight is modified in response to the reclassification ( step 62 ). by updating the class weight in response to each edit , clinically accurate concentrations for all particle classes are provided throughout the editing process as well as after the editing process is completed . the class weight is modified using equation ( 1 ) provided above . then , using the new class weight , the concentrations are recalculated ( step 63 ). the concentrations are recalculated using equation ( 2 ) provided above , except that unlike in the case of full edit process , the edit weight of a particle ( ew ) is not unity in the case of partial classification . as long as there is at least one particle that is skipped for every particle of the same type that is classified , the edit weight will be greater than 1 . the same edit weight applies to all the particles in each bin , and subsequent reclassification does not affect the edit weight for a given particle . each newly calculated concentration may be presented to the operator . by updating the concentration with each change , the operator sees small incremental changes rather than a dramatic change in concentration . if there are no more edits to be made ( step 64 ), the current results are incorporated into the report 44 . on the other hand , if the operator wishes to reclassify any of the new or previously reclassified particles , the reclassification is made and the process loops back to step 61 . fig3 is a flowchart depicting a second partial classification process 70 in accordance with yet another embodiment of the invention . unlike in the first partial classification process 40 , the preliminary classification is performed before the bin selection process in the second partial classification process 70 . the second partial classification process 70 may yield results that are different from the first partial classification process 40 because , the preliminary classification that is performed before the bin selection may affect the bin selection results . for example , particle classification or some trait associated with a class of particles may be used as part of the bins selection criteria . the second partial classification process 70 includes a preliminary classification process 80 and an abbreviated edit process 90 . in the preliminary classification process 80 , i particle images are extracted from frames ( step 81 ), and all of the i particle images are preliminarily classified ( step 82 ). after each particle is associated with a class , n of the i particle images are divided into bins using predefined bin selection criteria ( step 83 ). the edit weights are determined for each particle ( step 84 ), and the concentrations are calculated using the class weight and edit weight ( step 85 ). if the operator wishes to see the concentrations ( step 86 ), they are displayed to the operator ( step 87 ). the abbreviated edit process 90 is substantially similar to the abbreviated edit process 60 of the first partial classification process 40 . the following examples illustrate the effects of reclassification on particle concentrations . this example illustrates the effect of reclassification on class weight and concentration . suppose there is a three - class system having class r , class w , class c , and an artifact class . suppose also that cw r = 2 , cw w = 1 . 5 , and cw c = 4 . after the apr process , there are 40 particles in class r , 20 particles in class w , 5 particles in class c , and 50 particles in the artifact class per unit volume . the total number of particles ( n ) is 115 . the initial concentrations should be as follows : the reclassification results show that there is no dramatic change in concentration by moving one particle ( overall result of the three moves being reclassifying a w to r ). it should be noted that although class c was not directly affected by the reclassification , its concentration was affected . this example illustrates the effect of classifying particles that were originally classified in the artifact class . the same initial conditions are assumed as in example 1 . during reclassification , five artifacts are moved to class c . again assuming ref = 1 and using equations ( 1 ) and ( 2 ), the new concentrations are as follows : moving five artifacts into class c almost doubled the concentration of class c . now , an alternative method for recalculating the class weight and concentration will be presented . the preliminary classification steps are the same for this alternative method as for the method described above . in this alternative method , decreasing of the class weight is preferably performed using the following equation : { cw n = 1 | cw = 1 cw n = maximum ( 1 , [ ∑ { class } ew ] - ew moved particle ∑ { class } ew cw old ) ( 3 ) wherein cw n = the newly calculated class weight after reclassification ( similar to cw new in the first method ). according to equation ( 3 ), the class weight is left at 1 if it was already 1 before the reclassification . otherwise , the class &# 39 ; new class weight ( cw n ) is the product of its old class weight ( cw old ) and a coefficient , which is the sum of the class &# 39 ; s particle edit weights ( σ ( class ) ew ) after the move , minus the edit weight of the moved particle , divided by the sum of the class &# 39 ; s particle edit weights ( σ ( class ) ew ) after the move . if the product of the coefficient and cw old is less than 1 , then the new class weight is 1 ( 1 is the lowest possible value of cw n for equation ( 3 )). { cw n = 1 | cw = 1 cw n = [ ∑ { class } ew ] + ew moved particle ∑ { class } ew cw old ( 4 ) again , if the class weight was already 1 before the move , it is left at 1 . otherwise , the class &# 39 ; new class weight ( cw n ) is the product of its old class weight ( cw old ) and a coefficient , which is the sum of the class &# 39 ; s particle edit weights ( ew ) after the move , plus the edit weight of the particle moved into the class , divided by the sum of the class &# 39 ; s particle edit weights ( ew ) after the move . when a particle is reclassified by the operator , the particle concentration for each class affected by the move is recalculated using the following equation : equation ( 5 ) is similar to equation ( 2 ) except that cw n , which is calculated using equations ( 3 ) and ( 4 ), is used instead of cw new , which is obtained by equation ( 1 ). in the case of complete classification , σ ( class ) ew is equal to the number of particles in class a after the most recent reclassification , since the edit weight of each particle is 1 . in the case of partial reclassification , however , the value of σ ( class ) ew is typically greater than 1 , since at least some of the particles represent more than one particle . the class weight cw for each particle class may change depending upon the type of edit made by the operator . for example , suppose that the operator reclassifies a particle image by moving it from class a to class b . the following changes to class weight cw are made at the time the move is made depending upon the particle classes affected by the move : i ) if class a has a class weight ( cw ) of 1 ( i . e . an artifact class ), and class b has a class weight ( cw ) strictly superior to 1 ( i . e . not an artifact class ), then : the calculated concentration of class a will decrease per equation 5 , and the class weight cw of class a will stay the same , and the calculated concentration of class b will stay the same per equation 5 by decreasing the class weight ( cw ) of class b preferably using equation 3 . ii ) if class a has a class weight ( cw ) strictly superior to 1 ( i . e . not an artifact class ), and class b has a class weight ( cw ) of 1 ( i . e . an artifact class ), then : the calculated concentration of class a will stay the same per equation 5 by increasing the class weight ( cw ) of class a preferably using equation 4 , and the calculated concentration of class b will increase per equation 5 , and the class weight cw of class b will stay the same . iii ) if class a has a class weight ( cw ) strictly superior to 1 ( i . e . not an artifact class ), and class b has a class weight ( cw ) strictly superior to 1 ( i . e . not an artifact class ), then : the calculated concentration of class a will decrease per equation 5 , and the class weight cw of class a will stay the same , and the calculated concentration of class b will increase per equation 5 and the class weight cw of class b will stay the same . iv ) if class a has a class weight ( cw ) of 1 ( i . e . an artifact class ), and class b has a class weight ( cw ) of 1 ( i . e . an artifact class ), then : the calculated concentration of class a will decrease per equation 5 , and the class weight cw of class a will stay the same , and the calculated concentration of class b will increase per equation 5 , and the class weight cw of class b will stay the same . v ) if class b is created ( by moving the particle into it ), then class weight cw for class b is initially assigned a class weight value equal to the initial class weight that would have been used had there been a particle in the class , as discussed above . vi ) if class a is emptied ( by removing the only particle in it ), then class a will have no defined class weight cw . should a particle image subsequently be moved back into class a , then it is initially assigned a class weight value equal to cw old ( i . e . the last class weight before the class was emptied ) as discussed above . vii ) once an operator moves any particle image from class a ( its original apr determined class ) to class b as described above , and then subsequently moves that same particle image from class b to class c , then : apply the above rules to move the particle image from class b to class a , and then apply the above rules to move the particle image from class a to class c . this example illustrates the effect of reclassification on class weight and concentration using equations ( 3 ), ( 4 ), and ( 5 ). suppose the same initial conditions as that provided above in example 1 . if the operator reclassification moves two of the particles that were originally in class w to class r and one of the particles in class r to class w ( total number of reclassified particles = 3 ), the class weights do not change , per situation iii ) described above . using the same class weights and ref = 1 , the concentrations calculated with equation ( 5 ) are as follows : suppose the same initial condition as that described in examples 1 and 3 . suppose also that one particle is now moved from the artifact class to class c . the class weight for the artifact class remains the same but the class weight of class c decreases per equation ( 3 ), as described in situation i ) above . thus , the concentrations are as follows : this example demonstrates that moving one particle from the artifact class to class c does not affect the concentration of class c when using the alternative method . suppose the same initial conditions as in example 4 except that this time , 20 particles are moved from the artifact class to class c . the concentrations will now be as follows : when 20 particles are moved from the artifact class to class c , the concentration of class c is changed . the application of class weights may be implemented in a program as a set of computer - readable instructions in a machine that executes the apr process . similarly , the modification of class weights and calculation of concentrations may be implemented in a program to minimize human involvement . although fig1 and fig2 illustrate complete classification and partial classification separately , this is done for clarity of explanation and the same system may be used to perform both types of classifications . preferably , the system has a local switch so the operator can toggle between the full edit mode and abbreviated edit mode . although preferred embodiments of the present invention have been described in detail hereinabove , it should be clearly understood that many variations and / or modifications of the basic inventive concepts herein taught which may appear to those skilled in the present art will still fall within the spirit and scope of the present invention . | 6 |
referring now to fig1 there is illustrated a feeding apparatus having a means for automatically coupling or releasing a cigarette tray transporting vehicle to or from said feeding apparatus embodying the present invention . a frame 1 is fixedly attached to a lower portion of a cigarette manufacturing machine 45 . a guide rail 5 is fixed to the frame 1 and comprises , as shown in fig2 guide plates 2 and 3 and a supporting member 4 to form a channel 4 - a . entrance portions 2 - a and 3 - a are notched , as depicted , for easy entry of rollers attached to the cigarette tray transporting vehicle . behind the guide rail 5 , there is provided a shuttling member 7 having slots 7 - a and 7 - b . the shuttling member 7 is slidably connected to the frame 1 by guide pins 8 and 8a . an l - shaped feed pawl 9 and an auxiliary l - shaped feed pawl 9 - a are pivotally connected to the shuttling member 7 respectively by pins 10 and 10 - a with a spacing which is an integral multiple of the distance between any two adjacent pins on the cigarette tray transporting vehicle , which will be explained later . two adjusting plates 11 and 11 - a are provided on the shuttling member 7 to adjust the angles of the l - shaped feed pawl 9 and the auxiliary l - shaped pawl 9 - a with respect to the shuttling member . a hook 14 projects from the end of the wing of the l - shaped feed pawl 9 and a hook 13 projects from one end of the adjusting plate 11 . a tension spring 12 is connected to the hook 14 at one end and to the hook 13 at the other end . similarly , a hook 14 - a projects from the end of the wing of the auxiliary l - shaped feed pawl 9 - a and a hook 13 - a projects from one end of the adjusting plate 11 - a . a tension spring 12 - a is connected to the hook 14 - a at one end and to the hook 13 - a at the other end . the slots 7 - a and 7 - b are planned to be longer than the spacing of two adjacent pins on the cigarette tray transporting vehicle , which will be explained later , to give allowance . there is provided a cam 15 on the forward end of the shuttling member which is adapted to actuate the sensor 37 - a . the sensor 37 - a is adapted to send a signal when actuated to switch off a valve 39 , which will be explained later . similarly there is provided a cam 15 - a on the rear end portion of the shuttling member adapted to actuate the sensor 37 - b . the sensor 37 - b is adapted to send a signal , when actuated , to switch on the valve 39 . there is also provided a channel - shaped member 16 fixedly connected to the shuttling plate 7 . a first air cylinder 22 is fixedly connected to the frame 1 by a pin 24 and a speed regulator 26 is directly fixed to the frame 1 . a rocking arm 18 is connected to a rod 23 of the first air cylinder 22 by a bearing 21 and to a rod 27 of the speed regulator 26 by a bearing 25 . said rocking arm 18 is pivotally connected to the frame 1 by a pin 19 at one end . at the other end of said rocking arm , there is provided a roller 17 , which is held by the channel - shaped member 16 as depicted . an angle plate 33 is fixedly attached to the frame 1 above and in parallel with the guide rail 5 . a second air cylinder 31 is provided on said angle plate 33 . a bridge 46 is provided substantially above said second air cylinder spanning between the cigarette manufacturing machine and the feeding apparatus . a piston rod 31 - a extends from the bottom of the second air cylinder 31 and a fork 28 is fixed to the lower end of said piston rod 31a . around said piston rod 31a , there is provided a compression spring 32 abutting against the bottom of the second air cylinder 31 at one end and against the top of the fork 28 at the other end . when the fork 28 is lowered under the influence of the compression spring 32 , the fork 28 is adapted to hold a pin 59 provided on a cigarette tray transporting vehicle , which will be explained later , so that the cigarette tray transporting vehicle may not move . an inclined plate 29 is fixed to the pawl side of the fork 28 and is adapted to guide the pawl 9 without its contacting the fork 28 if the shuttling plate is moved toward the right in the figure while the fork 28 is kept lowered . on a side of the angle plate 33 , there are provided five intermediate portion sensing means 34a , 34b , 34c , 34d and 34e for sensing a magnet disposed on the intermediate portion of a cigarette tray transporting vehicle , which will be explained later . on the top of the angle 33 , there are provided a magnet 35 - a , as a magnetism transmitting body and a magnet 35 - b as an auxiliary magnetism transmitting body and a magnetism transmitting coil 36 - b and an auxiliary magnetism transmitting coil 36 - a . the magnets 35 - a and 35 - b are positioned at a different level than the magnetism transmitting coil 36 - b and the auxiliary magnetism transmitting coil 36 - a . the sensors 34 - a , 34 - b , 34 - c , 34 - d and 34 - e , are reed relays . said five intermediate portion sensing means , said magnets 35 - a and 35 - b , magnetism transmitting coil 36 - b and auxiliary magnetism transmitting coil 36 - a are aligned on the angle plate in the following order : the feed - in side , the magnet 35 - b , the sensor 34 - c , the auxiliary magnetism transmitting coil 36 - a , the sensor 34 - d , the magnet 35 - a , the sensor 34 - e , the magnetism transmitting coil 36 - b , the sensor 34 - a and the sensor 34 - b . said sensor 34 - a is adapted to transmit a signal , in response to a magnet disposed on the intermediate portion of the cigarette tray transporting vehicle when the intermediate portion passes the sensor 34 - a , which starts a succeeding cigarette tray transporting vehicle , on standby , moving to the feeding apparatus . said magnet 35 - a is disposed in the vicinity of and on the feed - in side of a portion above the auxiliary feed pawl 9 - a thereby allowing said succeeding cigarette tray transporting vehicle to coast until the auxiliary feed pawl engages a first feed pin of said succeeding cigarette tray transporting vehicle . said sensor 34 - b is adapted to transmit , in response to the magnetic field of the magnet disposed on the intermediate portion of a preceding cigarette tray transporting vehicle when the intermediate portion passes the sensor 34 - b , a signal to the magnetism transmitting coil 36 - a to energize the same , from which a signal to start a succeeding cigarette tray transporting vehicle is transmitted . said sensor 34 - c is adapted to transmit , in response to the magnetic field from the magnet disposed on the intermediate portion of a succeeding cigarette tray transporting vehicle when the intermediate portion passes the sensor 34 - c , a signal to switch on a valve 39 which will be explained later . said sensor 34 - d is adapted to transmit , in response to the magnetic field from the magnet disposed on the intermediate portion of a succeeding cigarette tray transporting vehicle when the intermediate portion passes the sensor 34 - d , a signal to switch off the valve 39 . said sensor 34 - e is adapted to transmit , in response to a magnetic force from the magnet disposed on the intermediate portion of a succeeding cigarette tray transporting vehicle when the intermediate portion passes the sensor 34 - e , a signal to start unloading a cigarette tray loaded on the head portion of said succeeding cigarette tray transporting vehicle and a signal to switch off the valve 42 . said magnet 35 - a is adapted to transmit a signal to a head portion of the cigarette tray transporting vehicle to switch off a motor 64 which will be explained later . said magnetism transmitting coil 36 - b is adapted to be energized , when the last tray on a preceding cigarette tray transporting vehicle has been filled with cigarettes and loaded back onto the cigarette tray transporting vehicle viz , when a sensor 38 - a to be discussed below is energized and when the sensor 34 - b is energized by the magnet 62 on the preceding cigarette tray transporting vehicle . the coil 36 - b transmits a signal to a tail portion of the proceding cigarette tray transporting vehicle to switch on a motor 64 , which will be explained later , and be deenergized , when the sensor 34 - c senses a passage of a magnet 62 on the intermediate portion of the succeeding cigarette tray transporting vehicle . said magnet 35 - b is adapted to transmit a signal to a head portion of a succeeding cigarette tray transporting vehicle to switch off the motor 64 of the succeeding cigarette tray transporting vehicle . said magnetism transmitting coil 36 - a is adapted to be energized , when the magnet 62 on the preceding cigarette tray transporting vehicle passes the sensor 34 - b , and transmit a signal to the head portion of the succeeding cigarette tray transporting vehicle to switch on the motor 64 and be deenergized , when the sensor 34 - c senses a passage of the magnet 62 on the intermediate portion of the succeeding cigarette tray transporting vehicle . referring now to fig3 and 4 , there is illustrated a cigarette tray transporting vehicle 51 . a front wheel 52 and two rear wheels 53 are driven by a driving means such as a motor 64 . said motor 64 is energized by a storage battery provided on the cigarette tray transporting vehicle . a pair of sensing coils 54 , facing the front wheel on both sides thereof , is adapted to detect an electromagnetic wave emitted from a cable 55 buried under the floor . the voltages produced by the electromagnetic waves detected by the respective sensing coils 54 are amplified . a steering motor 65 is energized by a difference between the amplified voltages of the detected electromagnetic waves to control the front wheel 52 so that the front wheel 52 follows the cable 55 buried under the floor . when the cigarette tray transporting vehicle is coupled to the feeding apparatus , the motor 64 is turned off and the cigarette tray transporting vehicle is guided by the guide rail 5 of the feeding apparatus along the cigarette manufacturing machine . an angle plate 58 is fixedly attached to the cigarette tray transporting vehicle 51 on the feeding apparatus side thereof . on the side of the angle plate 58 , there are provided feed pins 59 . the number of said feed pins 59 is equal to that of cigarette trays loaded on the cigarette tray transporting vehicle 51 . each two adjacent pins of said pins 59 are aligned with a spacing equal to that of each two adjacent cigarette trays of the trays loaded on the cigarette tray transporting vehicle 51 . on the bottom of the angle plate 58 , there are provided rollers 60 , 60 - a and 60 - b . the pins are adapted to be engaged by the feed pawls 9 and 9 - a for intermittently feeding the cigarette tray transporting vehicle 51 . the rollers 60 , 60 - a and 60 - b are adapted to engage the channel 4 - a of the guide rail 5 and guide the cigarette tray transporting vehicle 51 in cooperation with the guide rail 5 while the cigarette tray transporting vehicle is being intermittently fed . there is provided , on the intermediate portion of the angle plate 58 of the cigarette tray transporting vehicle , a magnet body 62 . sensors 63 - c and 63 - b are positioned at the head portion of the cigarette tray transporting vehicle . at the tail portion of the cigarette tray transporting vehicle , there is provided a sensor 63 - c . said sensor 63 - a is positioned at a level equal to those of the magnets 35 - a and 35 - b . said sensors 63 - b and 63 - c are disposed at a level equal to those of the magnetism transmitting coils 36 - a and 36 - b . said sensor 63 - a is adapted to switch off the motor 64 in response to a signal from the magnet 35 - a or the magnet 35 - b . said sensor 63 - b is adapted to switch on the motor 64 in response to a signal from the magnetism transmitting coil 36 - a . said sensor 63 - c is adapted to switch on the motor 64 in response to a signal from the magnetism transmitting coil 36 - b . on top of the cigarette tray transporting vehicle 51 , there is provided a guide 57 for guiding a tray in a direction normal to the direction in which the cigarette tray transporting vehicle proceeds to unload a tray . on top of the cigarette tray transporting vehicle , ten cigarette trays 56 are loaded . the cigarette tray 56 is a rectangular parallelepiped container which is open at the front , in terms of the direction in which the cigarette tray transporting vehicle proceeds , and at the top . referring to fig5 there is illustrated an apparatus for transferring a cigarette tray from the cigarette tray transporting vehicle to the cigarette manufacturing machine 45 . the apparatus is installed on the cigarette manufacturing machine . a pusher 47 is provided in the apparatus and is actuated , along a guide 48 - a , by a chain 48 which is further actuated by a motor 49 . said motor 49 is adapted to be energized by a signal from the sensor 37 - a when either the sensor 34 - c or the sensor 34 - d is not energized . a cigarette tray 56 - a is a cigarette tray filled with cigarettes . a guide 50 sets the cigarette tray 56 - a in position for transferring the same to the guide 57 . said guide 50 is at a level equal to that of the guide 57 . plates 47 - a and 47 - b extend from each end of the pusher 47 . the tray 56 - a is positioned between the plate 47 - a and the plate 47 - b and pushed by the plate 47 - a when the tray is to be transferred from the guide 50 to the tray guide 57 and pushed by the plate 47 - b when the tray is to be transferred from the tray guide 57 to the guide 50 . a bridge 46 is provided between the guide 50 and the tray guide 57 . one end of said bridge 46 is pivotally supported by the cigarette tray transporting vehicle side of the guide 50 and the other end of said bridge 46 is provided with a roller 46 - a which is movably disposed on a guide 57 - a . a sensor 38 - a is provided above the cigarette tray transporting vehicle and adapted to transmit a signal to a valve 42 which will be explained later . a sensor 38 - b is provided above the position of the plate 47 - a when an empty cigarette tray unloaded from the cigarette tray transporting vehicle and transferred to the guide 50 can not proceed any further . a cam 47 - c is provided on the chains 48 and is adapted to actuate the sensor 38 - a when the tray 56 - a has been transferred from the guide 50 to the tray guide 57 and actuate the sensor 38 - b when an empty cigarette tray has been transferred from the tray guide 57 to the guide 50 . referring to fig6 there are shown a valve 39 , a valve 40 and a valve 42 . compressed air is constantly supplied by a compressor x . the valve 39 is provided with a solenoid 39 - a , the valve 40 is provided with a solenoid 40 - a and the valve 42 is provided with a solenoid 42 - a . the valve 39 abuts against a compression spring 39 - b , the valve 40 abuts against a compression spring 40 - b and the valve 42 abuts against a compression spring 42 - b as depicted . when the valve 40 is switched off and the valve 39 is switched on in response to a signal from the sensor 34 - c , the sensor 37 - b or the sensor 38 - a , the valve 40 functions with a section 40 - d and the valve 39 functions with a section 39 - c . accordingly , the compressed air flows into the first air cylinder 22 through a port 41 to actuate the piston rod 23 in a direction 23 - f . by this action , the feed pawl 9 and the auxiliary feed pawl 9 - a move the cigarette tray transporting vehicle by one increment , viz . through the distance between two adjacent feed pins 59 . when the solenoid 39 - a is switched off in response to a signal from the sensor 37 - a or the sensor 38 - b , leaving the valve 40 as it is , the valve 39 functions with a section 39 - d and the compressed air flows into the first air cylinder 22 through a port 41 - a to actuate the piston rod 23 in a direction opposite to the direction 23 - f . by this action the feed pawl 9 and the auxiliary feed pawl 9 - a return to the original position . when the solenoid 40 - a of the valve 40 is switched on , the valve 40 functions with a section 40 - c and the air in the first air cylinder 22 can be exhausted from the valve 40 when the cigarette tray transporting vehicle is manually returned by one increment . ( this will be explained later .) when the solenoid 40 - a of the valve 40 is switched off , the valve 40 functions with the section 40 - d . if the valve 39 - a is kept on at this time , the compressed air flows into the first air cylinder 22 through the valve 39 . when the solenoid 42 - a of the valve 42 is switched on in response to a signal from the sensor 38 - a , the valve 42 functions with the section 42 - c . as a result , the compressed air flows into the second air cylinder 31 through an air port 43 . consequently the fork 28 is lifted resisting the force of the compression spring 32 , disengaging the feed pin 59 . on the other hand , when the solenoid 42 - a of the valve 42 is switched off in response to a signal from the sensor 34 - e or the sensor 37 - a , the valve 42 functions with the section 42 - d and the air in the second air cylinder 31 is exhausted from the valve 42 while the fork 28 is lowered under the influence of the compression spring 32 . as a result , the pin 59 is engaged with the fork 28 , thus holding the cigarette tray transporting vehicle 51 . the second air cylinder 31 is provided with a port 43 - a which is always open . in operation , when a cigarette tray filled with cigarettes is transferred from the cigarette manufacturing machine 45 through the bridge 46 to the tray guide 57 , the sensor 38 - a is actuated by the cam 47 - c . as a result , the solenoid 39 - a of the valve 39 and the solenoid 42 - a of the valve 42 is switched on . thus , the fork 28 is disengaged from a feed pin 59 and the feed pawl 9 pushes a succeeding feed pin 59 by one increment viz . by the distance between two adjacent feed pins , thus feeding a cigarette tray transporting vehicle alongside the guide rail 5 . therefore , the cigarette tray filled with cigarettes leave the bridge 46 and a succeeding cigarette tray faces the bridge 46 and disposed between the plate 47 - a and the plate 47 - b of the pusher 47 . in this way , when the sensor 37 - a is actuated by the cam 15 , the solenoid 42 - a of the valve 42 is switched off and the motor 49 is switched on . as a result , the fork 28 holds the feed pin 59 and the plate 47 - b of the pusher 47 pushes the succeeding cigarette tray through the bridge 46 onto the guide 50 . when the transferring operation is completed , the sensor 38 - b is actuated , thus switching off the solenoid 39 - a of the valve 39 . as a result , the feed pawl 9 and the auxiliary feed panel 9 - a return to the original position and a succeeding feed pin 59 is engaged with the feed pawl 9 . at this instant , the cam 15 - a actuates the sensor 37 - b . this state continues until the transferred cigarette tray is returned to the guide rail 57 , being filled with cigarettes . when the cigarette tray filled with cigarettes is set on the guide rail 57 , the sensor 38 - a is actuated by the cam 47 - c and the feed pawl 9 pushes the engaged succeeding feed pin 59 by one increment . in this way , the feeding operation repeats . when the magnet body 62 faces the sensor 34 - a ( position iv ) as shown in fig7 the sensor 34 - a is energized and transmits a signal to a succeeding cigarette tray transporting vehicle on standby . said succeeding cigarette tray transporting vehicle starts and moves to the feeding apparatus when the succeeding cigarette tray transporting vehicle receives the signal . when the roller 60 is engaged with the guide rail 5 , the sensor 63 - a faces the magnet 35 - b , thus switching off the motor 64 of the succeeding cigarette tray transporting vehicle 51 . after that , the cigarette tray transporting vehicle 51 coasts until the first feed pin 59 - a comes to a stop between the position a and the position a &# 39 ;. since the distance of coasting varies , the distance between the position a and the position a &# 39 ; is preferably enough to cover the maximum coasting distance . in the present embodiment , the magnetism transmitting coil 36 - a has a length equal to the distance between the position a and the position a &# 39 ; . when a succeeding cigarette tray transporting vehicle is disposed in such a way that the sensor 63 - b of the succeeding cigarette tray transporting vehicle faces the magnetism transmitting coil 36 - a and preceding cigarette tray transporting vehicle is disposed in such a way that the last cigarette tray faces the bridge 46 , the first feed pin 59 - a is at the position g , the last feed pin 59 - b is substantially below the fork 28 ( position e ) and the magnet 62 faces the sensor 34 - b . the sensor 34 - b is energized by the magnet 62 of the preceding cigarette tray transporting vehicle and transmits a signal to the magnetism transmitting coil 36 - a . as a result , the magnetism transmitting coil 36 - a is energized and the sensor 63 - b of the succeeding cigarette tray transporting vehicle senses the magnetic field of said energized magnetism transmitting coil 36 - a and sends a signal to the motor 64 to start the succeeding cigarette tray transporting vehicle . when the sensor 63 - a of said succeeding cigarette transporting vehicle faces the magnet 35 - a , the motor 64 of said succeeding cigarette transporting body is switched off and said succeeding cigarette tray transporting vehicle coasts until its first pin comes to a stop between the position b and the position c . during the coasting , the magnet 62 faces the sensor 34 - c . as a result , the sensor 34 - c transmits a signal to switch on the solenoid 39 - a . accordingly , the auxiliary feed pawl 9 - a pushes the engaged feed pin 59 - a to feed the cigarette tray transporting vehicle . although the fork 28 is holding the feed pin 59 - b of a preceding cigarette tray transporting vehicle at this time , the feed pawl 9 does not collide against the fork 28 since the inclined plate 29 guides the feed pawl 9 until the position e . if the distance between the position b and the position c is equal to twice the distance between two adjacent feed pins , the feed pin 59 - a which is at a standstill at the position d &# 39 ; between the position b and the position d is shifted to the position d ( if the distance between the position b and the position d is equal to the distance between two adjacent feed pins .) at this time , the sensor 37 - a is energized so the solenoid 39 - a is switched off . as a result , the feed pawls 9 and 9 - a return to the original position , energizing the sensor 37 - b . with this energization of the sensor 37 - b , the auxiliary feed pawl 9 - a pushes a next succeeding feed pin from the position d to the position c . when said next succeeding feed pin reaches the position c , the magnet 62 of the cigarette tray transporting vehicle faces the sensor 34 - d . as a result , the solenoid 39 - a is switched off and the pawl 9 - a returns to the original position , putting an end to this series of feeding operation . in this way , the feed pawl 9 and the auxiliary feed pawl 9 - a continue to shuttle from the energization of the sensor 34 - c to the energization of the sensor 34 - d . therefore , if the foremost feed pin 59 - a comes to a stop at the position d &# 34 ;, it reaches the position c after one pushing . if the first feed pin 59 - a of the succeeding cigarette tray transporting vehicle is at the position c while the last feed pin 59 - b of the preceding is at the position e , the distance between the first cigarette tray on the succeeding cigarette tray transporting vehicle and the last cigarette tray on the foregoing cigarette tray transporting vehicle is equal to the distance between two adjacent feed pins . we call this state that two cigarette tray transporting vehicles are connected . in the embodiment of his invention , two cigarette tray transporting vehicles are connected by the feed pawls . however , it is also possible to connect three cigarette tray transporting vehicles by arranging the feed pawl 9 and the feed pawl 9 - a with a spacing equal to the distance between the first tray and the last tray on one cigarette tray transporting vehicle and additionally providing another feed pawl after the feed pawl 9 - a . operations after the completion of unloading and loading of cigarette trays are as follows . when the last tray on the preceding cigarette tray transporting vehicle among two connected cigarette tray transporting vehicles is loaded back onto the tray guide 57 , the sensor 38 - a is actuated by the cam 47 - c and thereby energized . at the same time , the magnetism transmitting coil 36 - b is energized since the sensor 34 - b facing the magnet 62 on the preceding cigarette tray transporting vehicle transmits a signal to the magnetism transmitting coil . as a result , the solenoid 39 - a of the valve 39 and the solenoid 42 - a of the valve 42 are energized . accordingly , the fork 28 is disengaged from the feed pin 59 - b and the sensor 63 - c receives a signal from the magnetism transmitting coil 36 - b to switch on the motor 64 , thus releasing the preceding cigarette tray transporting vehicle . at the same time , the pawl 9 starts intermittently feeding the succeeding cigarette tray transporting vehicle . when there is no succeeding cigarettte tray transporting vehicle connected , the preceding cigarette tray transporting vehicle leaves the feeding apparatus and the magnetism transmitting coil 36 - b is switched off . however , the magnetism transmitting coil 36 - a is kept on so that the first feed pawl of a succeeding cigarette tray transporting vehicle which has reached the feeding apparatus is started , after being stopped due to the influence of the magnet 35 - b , and stopped again by the magnet 35 - a between the position b and the position c . then , the first feed pin of the vehicle is further fed to the position c in response to a signal from the sensor 34 - c which has sensed the magnet 62 at the intermediate portion of the succeeding cigarette tray transporting vehicle . further , the first feed pin is advanced to the position e . at this moment , the sensor 34 - e senses the magnet 62 ( position iii ) and start the motor 49 to actuate the pusher 47 . since the magnetism transmitting coils 36 - a and 36 - b are switched off when the sensor 34 - c senses a passage of the magnet 62 on the intermediate portion of the cigarette tray transporting vehicle . when it is observed that some defective cigarettes are placed on a cigarette tray , filling is immediately stopped . said cigarette tray is loaded back onto the cigarette tray transporting vehicle and after the succeeding empty tray is transferred onto the cigarette manufacturing machine , said cigarette tray filled with some defective cigarettes is manually removed from the vehicle . after that , the cigarette tray transporting vehicle is backed by one increment and receives a filled cigarette tray from the cigarette manufacturing machine . for conducting the above mentioned operation , a push - button ( not shown ) is provided . when said push - button is pressed , the solenoid 40 - a and the solenoid 42 - a are switched on . as a result , the fork 28 is lifted to disengage the pin 59 while the air in the second air cylinder 22 is exhausted . then , the cigarette tray transporting vehicle is reversed by one increment . for resuming the feeding apparatus to the automatic operation , there is provided another push - button ( not shown ). when the button is pressed , the solenoid 40 - a and the solenoid 42 - a are switched off . as a result , the fork 28 is lowered to engage the feed pin 59 and the air cylinder 22 is supplied with air . the magnet 35 - b and the magnetism transmitting coil 36 - a can be dispensed in the present invention . in this case , a succeeding cigarette tray transporting vehicle is started as soon as a pin below the last tray on a preceding cigarette tray transporting vehicle is pushed by one increment by the feed pawl . ( the sensor 34 - a and the sensor 34 - b may be provided in contact with each other .) as mentioned above , according to the present invention , a cigarette tray transporting vehicle can be automatically set to and released from a feeding apparatus and a succeeding cigarette tray transporting vehicle can be automatically set to a feeding apparatus while a preceding cigarette tray transporting vehicle is coupled to the feeding apparatus and a succession of loading and unloading operations are being conducted so that a whole operation of transporting cigarettes from a cigarette manufacturing machine to the packing machine is conducted in succession . | 0 |
fig1 schematically illustrates a drug delivery device 10 according to the prior art designed as a pen - type injector . the device 10 comprises a proximal housing component 12 as well as a distal housing component 14 . the distal housing component 14 may be designed as a protective cap , alternatively as a cartridge holder 18 to keep a cartridge 26 filled with a medicament in position . at a proximal end 15 , the drug delivery device comprises a dose button 16 by way of which a dose to be dispensed by the device 10 can be individually selected and dispensed . the distal end 17 of the drug delivery device 10 and in particular the distal section of a cartridge holder 18 is adapted to be releasably coupled with a piercing assembly , such like an injection needle , in order to dispense a pre - defined amount of the liquid medicament by way of injection . therefore , distally located end section 17 of the cartridge holder 18 comprises a threaded socket . the cartridge holder 18 further comprises at least one inspection window 19 in order to visually inspect the filing level of the cartridge 26 . the cartridge 26 itself is at least partially filled with a medicament to be dispensed by the device 10 . the cartridge 26 comprises a distally located seal 28 adapted to be intersected or pierced by a piercing assembly , which is not particularly illustrated here . towards its proximal end section the cartridge 26 comprises a displacable seal in form of a piston to become operably engaged with the piston rod 30 of a drive mechanism arranged in the proximal housing component 12 . in fig3 , a simplified view of a drug delivery device 10 according to the present invention is illustrated . the device 10 comprises a proximally located housing component 12 and a protective cap 14 at least partially covering the distally located directed and downward pointing cartridge holder 18 . the protective cap 14 is pivot mounted by way of a hinge 20 on a distal portion of the housing 12 . as illustrated in the course of fig3 to 5 , the protective cap 14 starting from an initial configuration as shown in fig3 can be flapped away in a sideward direction 36 in order to provide access to the cartridge holder 18 and its distal end portion 32 . the protective cap 14 is connected with the hinge 20 near its proximal portion in order to enable a respective displacement of its distal portion relative to the cartridge holder 18 . in order to provide and to enable a pivoting motion of the protective cap 14 , the cap itself comprises at least one lateral slit 22 , which , in fig3 to 5 , is only indicated . said lateral slit or through opening 22 is arranged on a lateral side wall portion of the protective cap 14 facing away from the initial pivot direction 36 as indicated in fig3 . this way , the cartridge holder 18 with its distal end section 32 may penetrate said slit or through opening 22 when the protective cap 14 is flapped away . similarly , when starting from a position of use as indicated in fig5 , said lateral opening 22 in the protective cap 14 allows to receive the cartridge holder 18 of the drug delivery device 10 . in the embodiment according to the fig6 to 8 , the protective cap 34 is pivot mounted on the cartridge holder 18 . furthermore , the protective cap 34 comprises two oppositely located slits or through openings 22 , 24 . by way of the second through opening 24 facing towards the pivot direction 36 , the protective cap 34 can even be pivoted or rotated by about 180 °. the cap 34 may therefore receive the proximally located housing 12 of the drug delivery device 10 . in such a position of use as indicated in fig8 , an easy and intuitive handling of the drug delivery device 10 can be provided . additionally or according to another embodiment , the protective cap 34 may even be slidingly supported relative to the cartridge holder 18 and / or relative to the housing 12 in distal and / or proximal direction as indicated by the double - tipped arrow 38 in fig6 . by way of a longitudinal , distally or proximally directed relative displacement of protective cap 34 and cartridge holder 18 , mutual interlocking of protective cap 34 and cartridge holder 18 and / or interlocking of protective cap 34 with the housing 12 can be provided . hence , unintentional pivoting of the protective cap 34 relative to the cartridge holder 18 or relative to the housing 12 can be impeded . additionally , by providing a translational displacement between cartridge holder 18 and protective cap 34 or between housing 12 and protective cap 34 , the size and geometry of the lateral slit or slits 22 , 24 can be adapted accordingly . | 0 |
referring first to fig1 a deck portion , which here is a generally rectangular integrated deck of tubular or plate girder steel construction indicated generally by the reference letter a , is arranged to mate onto a base portion , which here is a tubular steel jacket indicated generally by the reference letter b , to form a platform . the deck has twelve legs , comprising four corner legs 10 and eight inner legs 11 ( see fig2 ), the lower end of each of which is arranged to abut end - to - end with a respective corner or inner leg 12 , 13 of the jacket . many other possible arrangements of legs may be envisaged , for example eight legs in two groups of four , or sixteen in two groups of eight . referring now to fig3 to 5 and 10 , within each of the deck legs 10 and 11 is a stabbing pin indicated generally by the reference numeral 14 , comprising a cylindrical body 15 with a convex conical bottom end cap 16 and with an outwardly extending flange 17 at its upper end . a stop collar 18 secured to the inside of the deck leg 10 encircles the cylinder 15 near the bottom end of the deck leg . a bearing 19 fixed to the flange 17 slidably engages the inner surface of the deck leg 10 . bearings 20 and 21 fixed to the stop collar 18 and a secondary mating cone 22 , respectively , slidably engage the cylinder 15 . the bearings 19 to 21 permit the stabbing pin 14 to move axially while maintaining it co - axial with the deck leg 10 , 11 . the bearings 19 to 21 are plain bearings . collar 18 and secondary mating cone 22 may each be provided with a plurality ( six or eight ) of equally spaced reinforcing fins 18 &# 39 ; and 22 &# 39 ;, respectively . a hydraulic ram 23 is connected at its lower end to a bracket 24 on the top of the cylindrical body 15 and at its upper end to a bracket 25 on a crossbar 26 fixed within the deck leg 10 . when the hydraulic ram 23 is fully retracted , as shown in fig3 the conical cap 16 is at the level of the bottom end of the deck leg . the cylinder of the hydraulic ram 23 is attached to the crossbar 26 and the piston rod is attached to the stabbing pin 14 . the hydraulic ram 23 is connected by pipes ( not shown ) to a source of hydraulic power ( not shown ). within the jacket legs 12 and 13 ( fig4 ) is a capture member indicated generally by the reference numeral 27 that comprises a cylindrical tube 28 , the internal diameter of which is somewhat larger than the external diameter of the stabbing pin 14 . at the upper end of the tube 28 the capture member 27 spreads out to form a concave secondary capture cone 29 , the extreme diameter of the funnel being somewhat less than the internal diameter of the legs 10 - 13 . two flanges 30 and 31 extend outwardly from the tube 28 . the capture member 27 stands on , but is not secured to , the top end of resilient means in the form of a spring stack 32 . throughout the specification when the terms &# 34 ; resilient &# 34 ; and &# 34 ; resiliency &# 34 ; are used , it will be understood that the important characteristic being described is the ability of the material to elastically deform thereby dampening motion . the spring stack 32 is long compared with the stroke of the ram 23 , and is preferably made of elastomeric material with spacers so that it can deform and be compressed axially fairly easily . as shown , the spring stack 32 comprises a stack of separate elastomeric members which may each be of generally annular form . these elastomeric members are maintained in alignment by guide pin 36 which passes through a central aperture 37 in each member . within the capture member 27 , a concave primary capture cone 33 stands on , and is preferably secured to , the top of the spring stack 32 . the tube 28 is encircled at its upper part by a resilient thrust bearing 34 in the form of a collar of elastomeric material which may be secured either to the outside of the tube 28 or to the inside of legs 12 and 13 . the resilient bearing 34 may be stiffened by one or more metal tubes embedded in the elastomer . the resilient bearing 34 serves mainly to stabilize the capture member 27 against radial displacement and tilting ( fig5 ). there is a thickened rim 35 around the upper end of the jacket legs 12 and 13 . an annular second spring 38 in the form of a sleeve of elastomeric material encircles the tube 28 below flange 30 and is supported by flange 39 on the inside of jacket legs 12 and 13 . the second spring 38 is much stiffer than the first spring 32 , and may have metal disc annuli embedded in it to increase its stiffness . the operation of this first embodiment of the mating device is as follows : the jacket b is installed at a desired location and may be either standing on the bottom or may be a floating jacket that is moored to the ocean floor by tension legs , or the like . then the deck a is maneuvered over the jacket while being supported by a barge c , or the like . the deck is so positioned that each leg 10 , 11 is approximately coaxial with its respective jacket leg 12 , 13 , with the conical cap 16 of the stabbing pin 14 separated from the primary capture cone 33 by a distance slightly shorter than the stroke of the ram 23 . the ram 23 is fully retracted as shown in fig3 . it will be appreciated , however , that because of the action of wind and waves , it will not normally be possible to align the deck legs 10 and 11 and the jacket legs 12 and 13 exactly , except transiently . the ram 23 is then actuated extending the stabbing pin 14 . this may be done quickly when legs 10 and 11 are sufficiently closely aligned with legs 12 and 13 , respectively . the extension of a plurality of stabbing pins 14 may occur separately as when the opportunity arises ; however , it is preferred to extend all of the stabbing pins simultaneously . the conical cap 16 either enters the capture member 27 directly or , is guided into it by the secondary capture cone 29 and then seats in the primary capture cone 33 . the stabbing pin 14 is kept coaxial with leg 10 or 11 by the bearings 19 to 21 . the stabbing pin preferably pushes down the primary capture cone 33 and compresses the first spring 32 slightly so that the cap 16 and cone 33 will remain in engagement even if the large c carrying the deck a is lifted by a wave . due to the configuration of the leg mating system of the present invention , a significant misalignment ( 5 °) can be tolerated without disengagement of stabbing pin 14 and cone 33 ( fig5 ). the cylindrical thrust bearing 34 will tend to realign capture member 27 and the stabbing pin 14 with the longitudinal axis of base leg 12 , 13 . the deck is then lowered , by ballasting the barge for example , while keeping ram 23 extended . part of the weight of the deck is then transmitted from legs 10 , 11 through ram 23 to primary capture cone 33 to the first spring 32 , which is thereby compressed and the engagement of the stabbing pin 14 with the capture cone 33 keeps the legs 10 , 11 approximately aligned with 12 and 13 . the process continues in this manner , with the pressure exerted through the ram 23 gradually increasing until the secondary mating cone 22 engages and seats on the secondary capture cone 29 , which is supported by the second spring 38 abutting flange 30 ( i . e ., the capture member 27 no longer stands on the first spring 32 as a result of the spring &# 39 ; s compression by stabbing pin 14 ). because first spring 32 is both long and comparatively soft , only a minor portion of the weight of the deck is ever carried by the rams 23 . as the lowering of the deck continues , weight will be transferred from the deck legs 10 , 11 through the secondary mating cone 22 and the capture member 27 to the second spring 38 . the secondary mating cone 22 and the capture member 27 will maintain a closer alignment of legs 10 , 11 and 12 , 13 than stabbing pin 14 and the primary capture cone 33 . because of the stiffness of the springs 38 , they rapidly take a substantial portion of the weight of the deck a , with the result that fluctuations in the upthrust on the barge caused by the waves , and the like , are absorbed with only small movements of the legs 10 , 11 and eventually , the bottoms of deck legs 10 , 11 seat on the tops of the jacket legs 12 and 13 in a controlled manner and with sufficiently accurate alignment . a small misalignment of the axes of the deck legs 10 , 11 and jacket legs 12 , 13 can be accomodated due to the thickness of the rims 35 on which the deck legs seat . because the second spring acts between legs 10 , 11 and 12 , 13 by way only of secondary mating cone 22 , capture member 27 , and the flange 39 , the ram 23 is never subjected to the full load on the second spring ( fig1 ). the legs 10 , 11 and 12 , 13 can now be welded together and it may then be possible to dismantle the mating device and to remove at least part of it from inside the leg . in the alternate embodiment depicted in fig6 through 9 and 11 , the second spring 38 is omitted from the leg mating devices . rather , structurally similar sets of mating devices are placed in base legs 12 and 13 , with the set of devices in legs 13 having the stronger springs ( i . e ., containing elastomeric discs with a larger spring rate ). parts of the apparatus shown in fig7 and 8 which are similar in structure or function to corresponding parts in fig3 to 6 are given the same reference numerals with 100 added and will not be described again . the operation of the second embodiment of the mating device is as follows : the deck is so positioned that each deck corner leg 10 is approximately coaxial with its respective jacket corner leg 12 , with the conical cap 116 of the stabbing pin 114 separated from the primary capture cone 133 by a distance slightly shorter than the stroke of the ram 123 as was done in the first embodiment . the rams 123 of two diagonally opposite corner legs are extended , extending the stabbing pin 114 into engagement with primary capture cones 133 . then , the same procedure is followed with the other two corners . once all four corner sets of leg mating devices are engaged , the mating devices of the inner leg combinations 11 and 13 are brought into operation . these mating devices are identical in all essential respects to those of the corner legs 10 and 12 , with the exceptions that the spring stacks 132 of the jacket inner legs 13 are of a substantially larger spring rate than the spring stacks 132 of the corner legs , those stacks are shorter , and the primary capture cone 133 is omitted from the mating devices of legs 13 . as a result of these changes , none of the load is transmitted from legs 11 to legs 13 through rams 123 . stabbing pins 114 function only as alignment devices . the entire loading of the spring stacks of legs 13 is accomplished by cone 122 engaging capture member 127 . when the mating devices of all of the inner leg combinations 11 , 13 have been operated , the deck is now lowered by ballasting the barge c , while keeping all of the rams 123 extended . part of the weight of the deck is now transmitted from the legs 10 through the rams 123 and the primary capture cones 133 to the spring stacks 132 , which are compressed , and the engagement of the stabbing pins 114 with the capture cones keeps the legs 10 and 12 , approximately aligned . at this time , however , there is no compression of the spring stacks 132 in the legs 13 , as their stabbings pins 114 have not yet engaged them . lowering continues in this fashion , with the force in the rams 123 gradually increasing , until about 30 percent of the deck weight has been transferred . when about 30 percent of the weight of the deck has thus been taken up by way of the mating devices in the corner legs , the secondary mating cone 122 in the inner legs 13 engage the capture member 127 compressing spring stacks 132 and the next about 20 percent of the load transfer is taken up by the stiffer spring stacks 132 . at approximately 50 percent of load transfer the mating surfaces of the leg tubulars make contact . ballasting then continues with no relative motion between the deck and the jacket until about 80 percent of the deck weight has been transferred , whereafter the barge is separated from the deck by the actuation of drop blocks on the barge which do not form part of the present invention . the leg tubulars may now be welded together to complete the operation of assembling the deck and jacket . further details of the structure of the spring stacks 132 and the resilient bearings 134 , in a typical case , for this second embodiment , are as follows . the spring stack 132 for the corner legs is manufactured as a series of standard rubber layer elements , each incorporating steel plate reinforcement to form a stack height of 6 . 47 m . the steel plate is arranged to operate as an internal bearing around a central guide pin , and provide clearance to avoid rubber bulging inwards and binding on the guide pin . the rubber is bonded to the reinforcement during vulcanization , which would be carried out in a large flat bed press . shaping is included both on the internal and external diameters to minimize bulging and maximize tear resistance . proposed sizes for the spring stack 132 are 104 elements 1250 mm od , 525 mm id with a rubber thickness of 58 mm to provide a total stack height of 6 . 47 m and axial stiffness of 1250 tonne / m . the specification is as follows : the spring stack 132 for the intermediate legs would utilize similar elements as specified for the stack 132 for the corner legs and operate under similar conditions . proposed sizes for the stack 132 consist of 61 elements 1250 mm od , 525 mm id with a rubber thickness of 58 mm to provide a total stack height of 3 . 9 m and axial stiffness of 2125 tonne / m . the specification is as follows : the resilient bearing 134 for the corner legs is manufactured as a set of four complete rings , stacked vertically . each ring element is 2 . 2 m od and 0 . 5 m high . moulding is in an antoclave , the elastomer rings being bonded to a back flange for attachment to the capture cone body . the lateral stiffness of the assembly is 12500 tonne / m . the bearings for the corner legs 134 are , designed to accommodate 0 . 2 m of lateral deflection and form an integral part of the total composite lateral stiffness of the jacket leg ends . this feature minimizes overloading of the jacket leg , the bearing deflection being limited by external stops on the capture cone body . the specification is as follows : the requirements for resilient bearing 134 for the intermediate legs are similar to , but much less severe than , those specified for the corner legs , since most of the lateral support is handled by the latter bearings . the specification is as follows : the characteristics of the materials used in the first spring and the resilient bushing of the first embodiment are similar to those set forth above . the second spring is much shorter in this embodiment than in the second and , hence , requires a higher spring rate , which , as suggested earlier , can be achieved by interspersing steel plates in the resilient material . it is to be clearly understood that there are no particular features of the foregoing specification , or of any claims appended hereto , which are at present regarded as being essential to the performance of the present invention , and that any one or more of such features of combinations thereof may therefore be included in , added to , omitted from or deleted from any of such claims if and when amended during the prosecution of this application or in the filing or prosecution of any divisional application based thereon . various changes , alternatives and modifications will become apparent to a person of ordinary skill following a reading of the foregoing specification . it is intended that all such changes , alternatives and modifications as come within the scope of the appended claims be considered a part of the present invention . | 4 |
an internal combustion engine 1 according to fig1 of a motor vehicle ( not shown in more detail ) includes a piston 2 that is capable of back - and - forth movement in a cylinder 3 . standard internal combustion engines 1 include a plurality of pistons 2 and cylinders 3 . in the following , only one cylinder is presented in order to illustrate the concepts applied . as a rule , internal combustion engine 1 will include a plurality of cylinders . cylinder 3 includes a combustion chamber 4 that is limited inter alia by a piston 2 , an inlet valve 5 , and an outlet valve 6 . an intake pipe 7 is coupled to inlet valve 5 , and an exhaust pipe 8 is coupled to outlet valve 6 . in the area of inlet valve 5 and of outlet valve 6 , an injection valve 9 and a spark plug 10 extend into combustion chamber 4 ( in a spark - ignition engine having direct fuel injection ). in a diesel engine , here only one injection valve 9 , or a plurality of injection valves 9 , will be present , while in a spark - ignition engine only one or a plurality of spark plugs 10 will be present . via injection valve 9 , fuel can be injected into combustion chamber 4 . the fuel in combustion chamber 4 can be ignited by spark plug 10 . in intake pipe 7 , a rotatable throttle valve 11 is housed via which air is able to be supplied to intake pipe 7 . an air mass sensor 15 is situated upstream or downstream from throttle valve 11 . the quantity of supplied air is dependent on the angular position of throttle valve 11 . in a spark - ignition engine , in exhaust gas pipe 8 there is situated a lambda probe 13 for the measurement of the λ value of the fuel combustion in combustion chamber 4 . downstream from lambda probe 13 , there is situated a catalytic converter 12 that is used for additional chemical conversion of harmful materials contained in the exhaust gases . piston 2 is connected via a connecting rod 14 ( shown schematically ) to a crankshaft ( not shown ) of the internal combustion engine . piston 2 is set into motion by the combustion of the fuel / air mixture in combustion chamber 4 during a power stroke , and this movement is converted into a rotational movement in a known manner by connecting rod 14 and the crankshaft . a control device 18 is charged with input signals 19 that represent operating quantities , measured by sensors , of internal combustion engine 1 . for example , control device 18 is connected to air mass sensor 15 , lambda sensor 13 , a rotational speed sensor , an air temperature sensor , and the like . in addition , control device 18 is connected to an accelerator pedal sensor that produces a signal that indicates the position of an accelerator pedal that is able to be actuated by a driver , and thus indicates the required torque . control device 18 produces output signals 20 with which the behavior of internal combustion engine 1 can be influenced via actuators or actuating elements . for example , control device 18 is connected to injection valve 9 , spark plug 10 and throttle valve 11 , and the like , and produces the signals required to control these . control device 18 is provided for , inter alia , the purpose of controlling or regulating the operating quantities of internal combustion engine 1 . for example , the fuel mass injected into combustion chamber 4 by injection valve 9 is controlled or regulated by control device 18 in particular with respect to low fuel consumption and / or low production of pollutants . for this purpose , control device 18 is provided with a microprocessor that has stored in a storage medium , such as for example a read - only memory ( rom ), a program that controls the above - named method steps . on combustion chamber 4 , a cylinder pressure sensor 16 is situated that is connected to control device 18 by an electrical line 17 . between cylinder pressure sensor 16 and combustion chamber 4 , there is situated a duct 21 having length l . the installation position of cylinder pressure sensor 16 is indicated only schematically , and can vary according to the available constructive space and other requirements . the curve of the cylinder pressure provided by cylinder pressure sensor 16 , and quantities derived therefrom , are used as the input signal for various control functions . output signals of the control unit are for example control signals for the fuel metering and for controlling the ignition of the mixture . cylinder pressure sensor 16 supplies a signal according to fig2 ; whistle oscillations due to duct 21 are superposed on the actual pressure curve . fig2 shows the combustion chamber pressure p z in pascals over crankshaft angle kw in degrees ; via the rotational speed , kw can be converted into a time series . the method is based on a modeling of the whistle oscillation , so that a suitable filtering of the measured cylinder pressure curve can take place before the actual thermodynamic features are calculated from the cylinder pressure . the basic idea is to suppress the singular frequency of the whistle oscillation using a filter that blocks this frequency ( known as a band - stop characteristic ). using a digital method , a digital filter , this is possible for the measured pressure curve after the complete working cycle has been acquired . one embodiment is the storing of the filter coefficients ( once determined ) in the control unit for the various frequencies of the whistle oscillation , or else the calculation of the respective coefficients dependent on the operating point of the internal combustion engine . from the literature , the relation between the frequency of the excited whistle oscillation f and the sound velocity c is known . c is determined from the length 1 of duct 21 between combustion chamber 4 and cylinder pressure sensor 16 , as well as from gas temperature t , the gas constant r , and the isentropic exponent χ : that is , for the operating points of the internal combustion engine ( e . g . described by rotational speed , load , air / fuel ratio ), the frequency f can be determined . here the most important variable parameter is the gas temperature t . this temperature can be determined once during the calibration of the control unit , and stored in characteristic fields . another possibility is calculation using a suitable thermodynamic model . another possible realization is the spectral analysis of the cylinder pressure signal . the whistle oscillation can in this way be determined in its frequency dependent on the operating point . the spectral analysis can take place offline during the calibration for different operating points of the internal combustion engine , or can take place online for each operating cycle . the suitable filter can then again be selected in order to sufficiently suppress this frequency . a particular advantage of the almost complete storing of a working cycle is the possibility of compensating the undesired phase shift of the cylinder pressure signal by running through the filter twice ( null phase filtering ). in this way , the important relations between the crankshaft angle and the cylinder pressure curve are not falsified . to sum up , the sequence of the correction method is described below : sampling of the cylinder pressure curve for a complete working cycle with sufficient sampling frequency , and storing of the signal determination of the gas temperature and calculation of the whistle oscillation frequency determination of the filter coefficients for a band - stop filter filtering of the cylinder pressure curve for engine controlling systems , this method can effectively compensate the basic disadvantage of the situation of the cylinder pressure transducer away from the combustion chamber . the advantages of the situation , namely advantageous placement in a component and low thermal loading of the pressure transducer , are retained . | 6 |
consider the use of height as a biometric measure . it will be realised that the following description uses a height variable for illustrative purposes only . in particular , the skilled person will realise that the preferred embodiment is not limited to a height measurement variable . on the contrary , the preferred embodiment is applicable to any measurement variable ; and particularly ( but not exclusively ) to non - scalar variables . indeed , the main benefits of the preferred embodiment are seen when it is applied to multi - dimensional measures and multi - biometrics . referring to fig1 , as will be recalled , the first operational phase of a biometric system is the enrolment phase 20 . in the present case , a template of a registrant is formed from a measurement of the height of the registrant . as will be recalled , in the verification operational mode , the biometric system is provided , by a user , with a claim to a particular identity . thus , in the present case , the biometric system acquires a height measurement of the user and compares it against the height measurement in the template of the registrant whose identity is claimed by the user ( for simplicity , this registrant will be referred to henceforth as the claimed registrant ). in the event the height of the user matches that of the claimed registrant , the user is deemed to be the claimed registrant . otherwise , the user is deemed to be an impostor . let the height of the registrant be 1 . 7321564 m ( approx 5 ′ 9 ″). accordingly , a value of 1 . 7321564 m ( or some processed derivative thereof ) forms the template for the registrant . it will be understood that the above measurement value is provided for illustrative purposes only . in particular , the skilled person will understand that the preferred embodiment is not limited to a particular value of a height measurement . instead , as will be seen , the preferred embodiment is capable of capturing and processing substantially any valued height measurement . in a first example , let the height of the user be 1 . 7321564 m . in this case , the difference between the height of the registrant and the user is zero . thus , the user is deemed to be the claimed registrant ( i . e . the user has passed the height test of the biometric system ). in the event the user &# 39 ; s height is 1 . 7121564 m , the difference between the height of the registrant and the user is 0 . 02 m . accordingly , in a biometric system which makes a decision on the basis of exactly matching values of height measurements , the user would be deemed to be an impostor ( i . e . the user has failed the height test of the biometric system ). however , if the height measurement is not accurate ( i . e . not zero error ) a user who is genuinely a registrant ( henceforth known , for simplicity , as a true person ) will be rejected by the biometric system because the user &# 39 ; s height will not exactly equal that of the claimed registrant . this could happen , for example , if the user is wearing shoes of different height than they were during enrolment . similarly , even if zero measurement error was possible , a small but non - zero number of people would have the same height as the claimed registrant . thus , these other people ( and potential imposters to the registrant ) would pass the height test of the biometric system . in practice , the first of the above - mentioned problems is the most serious because there will always be some error in a measurement . furthermore , under normal circumstances , it would be expected that a biometric system is more likely to be testing a true person than an imposter . accordingly , to compensate for the first above - mentioned problem , a tolerance is added to the comparator for the measurement . in the present example , if the tolerance is ± 0 . 03 , the user &# 39 ; s height can now lie between 1 . 7021564 and 1 . 7621564 and the user will still pass the height test of the biometric system . referring to fig2 , the bell curve 26 shows the frequency distribution of the height of the general population , and the base of the shaded region 28 therein defines the acceptable region for passing the height test of the biometric system . in other words , anyone with a height in the shaded region 28 will pass the height test of the biometric system ( and be recognised as the registrant ). accordingly , the false acceptance fa of the biometric system is the area of the shaded region 28 divided by the area under the whole bell curve 26 . thus , widening the shaded region 28 ( i . e . increasing the tolerance on the comparator ) will decrease the risk of incorrectly rejecting a true person but will increase the risk of incorrectly accepting impostors . the measurement accuracy in the present example is approximately 0 . 06 / 1 . 732 = 3 . 4 %. however , this level of accuracy is only achievable with the user &# 39 ; s cooperation . in particular , if the user was to stoop slightly , lean to one side , or bend his / her knee and wobble , the measured height would be inaccurate , insofar as the measured height would be less than the user &# 39 ; s actual height . thus , in the event the user is uncooperative , the false reject rate increases ( i . e . the biometric system will reject the true person more often ). it is worth noting that whilst many prior art biometric methods ( e . g . iris scanning ) are very accurate , they also require very co - operative users . this causes these prior art methods to perform very poorly for casual users . referring to fig3 , one mechanism for overcoming this problem would be to implement a quantised biometric method , through , for example , passage 30 comprising a base member 32 and first and second opposing sides 34 , 36 disposed substantially perpendicular to the base member 32 . the first side 34 is provided with a plurality of infra - red emitters e 1 - e 7 disposed at different heights relative to the base member 32 and the second side 36 is provided with a plurality of infra - red sensors s 1 - s 7 disposed at corresponding heights to the infra - red emitters e 1 - e 7 . in use , the infra - red emitters e 1 - e 7 produce a plurality of infra - red beams 42 at different heights relative to the base member 32 and the infra - red sensors s 1 - s 7 detect the respective infra - red beams 42 . depending on his / her height relative to the infra - red emitters e 1 - e 7 , a user 44 in the passage 30 will break a one or more of the infra - red beams 42 . the resulting profile of infra - red signals detected by the infra - red sensors s 1 - s 7 will provide a rough measure of the user &# 39 ; s height . more particularly , the highest infra - red beam 42 broken by the user 44 gives a measure of the user &# 39 ; s height . referring to fig4 , the bell curve 46 of the height distribution of the general population is divided into a plurality of regions r 1 - r 8 . the centre of each region r 1 - r 8 is defined by the height of the corresponding infra - red emitter e 1 - e 7 in fig3 . the width of each such region r 1 - r 8 is defined by the above - mentioned tolerance τ of the comparator ( on the height measurement ). it will be understood that to ensure the regions r 1 - r 8 are contiguous , the infra - red emitters / sensors are spaced apart in the passage of fig3 , by a distance equal to the above - mentioned tolerance . during enrolment in the quantised biometric method , a registrant &# 39 ; s height measurement will fall within one of the regions r 1 - r 8 . for simplicity , the region in question will henceforth be known as the registrant model . to verify the identity of a user in the quantised biometric method , the user &# 39 ; s height measurement 48 is compared with each of the regions r 1 - r 8 in turn , to determine the region in which the user &# 39 ; s height measurement 44 falls . for simplicity , the region in question will be referred to henceforth as the user &# 39 ; s height region . in the event the user &# 39 ; s height region corresponds to the registrant model of the claimed registrant , the user will be deemed to be the claimed registrant ( i . e . the user has passed the height test of the quantised biometric method ). referring to fig5 , this process can be represented as a feature classifier 50 , in which any particular feature measurement 52 is classified into one of eight possibilities ( also known as classification bins ) a 1 - a 8 . the classification bins correspond with the regions r 1 - r 8 shown in fig4 . referring to fig6 , and extending from the operational phases shown in fig1 of a prior art biometric method , the quantised biometric method comprises at least three phases , namely a configuration phase 53 , an enrolment phase 60 and a identity verification phase 66 . the preconfiguration phase 53 comprises the steps of : defining 54 a tolerance for the comparator ; defining 56 the number of classification bins for the classifier ( of fig5 ); and determining 58 the relative positioning of the classification bins within the overall measurement range of the relevant measurement variable . acquiring 62 a value of the relevant measurement variable of a registrant ; determining 64 the classification bin for the acquired value of the registrant &# 39 ; s measurement variable . acquiring 68 a value of the relevant measurement variable of a user ; determining 70 the classification bin for the acquired value of the user &# 39 ; s measurement variable ; determining 72 whether the classification bin for the acquired value of the registrant &# 39 ; s measurement variable matches the classification bin for the acquired value of the user &# 39 ; s measurement variable ; and establishing 74 that the user has passed the quantised biometric method in the event that a match has been found ; or establishing 76 that the user has failed the quantised biometric method in the event that a match has not been found . the width of the classification bins ( i . e . tolerance τ of the comparator ) are adapted so that even if a registrant is stooping etc ., on a given occasion , the registrant will still be recognised by the quantized biometric system . in other words , the width of the classification bins are tunable to ensure that the false rejection ( fr ) rate of the quantised biometric system is 0 % or as close as practicably possible thereto . in the present example , there are eight different classification bins . thus , there is a 1 in 8 registrant model of the claimed registrant . or in other words , the false acceptance ( fa ) rate of the quantised biometric system is ⅛ = 12 . 5 %. thus , the total average error for an equal number of trials =( fa + fr )/ 2 = 6 . 25 % and the average accuracy = 93 . 75 %. however , it will be realised that in a quantised biometric system in which the regions ( and corresponding classification bins ) have fixed positioning determined by the arrangement of the infra - red emitters / sensors in the passage ( of fig3 ), the false rejection rate will not always be zero . in particular , the templates ( i . e . heights in this instance ) of some registrants acquired during enrolment will be disposed proximal to the edge of a given classification bin . in view of the above - mentioned sources of measurement error , these registrants are more likely to be falsely classified and hence rejected during the verification operational mode of the quantised biometric system . the preferred embodiment overcomes this problem by altering the edges of the classification bins on a per registrant basis , so that every registrant &# 39 ; s template ( i . e . height measurement in this instance ) acquired during enrolment , is centered in the classification bin . for brevity , the quantized biometric method of the preferred embodiment will be referred to henceforth as the adaptive quantised biometric method . thus , the registrant is more likely to be recognised by the adaptive quantised biometric system during the verification operational mode . in a more general sense , this would amount to training the adaptive quantised biometric system so that the registrant model ( or classification bin of the registrant ) comprises the registrant &# 39 ; s template ( i . e . height measurement in this case ) with the desired tolerance bounds disposed on either side thereof . the remaining classification bins would be adjusted accordingly . for simplicity and clarity , the remaining classification bins will henceforth be known as imposter models . in other words , during the enrolment process , the adaptive quantised biometric system creates a registrant model and a plurality of impostor models ( i . e . the remaining classification bins ) based on the registrant model . the impostor models effectively act as a rejecting mechanism for the adaptive quantised biometric system . in doing so , the adaptive quantised biometric system has removed the need for the threshold operation and replaced it with a simpler operation . more particularly , expanding from the present example of a simple height measurement , to a more complex biometric measurement variable , the acquired values of the measurement variables from the user are compared with all the classification bins , and the one which is closest passes . this is simpler than thresholding . with a complex multi - dimensional biometric variable , the preferred embodiment allows each dimension to contribute to a decision in a simple way which is not possible using thresholding alone . in particular , in a traditional thresholding approach , dimensional distances are combined in the same way ( e . g . euclidean ) prior to thresholding . to clarify , referring to fig7 a , during the enrolment phase , the prior art quantised biometric method determines the classification bin α n into which the value of a registrant &# 39 ; s measurement variable ( v reg ) falls . the classification bin α n is centred at fixed value γ ; and has width τ ( defined by the tolerance on the comparator ). depending on the value of the registrant &# 39 ; s measurement variable relative to the centre of the classification bin α n ; and the tolerance τ on the comparator ; the value of a registrant &# 39 ; s measurement variable ( v reg ) may be disposed close to the peripheries ( p 1 , p 2 ) of the classification bin α n . in contrast , referring to fig7 b , during the enrolment phase of the adaptive quantised biometric method , given a set of q potential classification bins α ε 1 × q , the adaptive quantised biometric method , forms an initial estimate of the classification bin α n into which the value of a registrant &# 39 ; s measurement variable ( v reg ) falls . given a predetermined tolerance τ on the comparator , the peripheries ( p n1 , p n2 ) of the classification bin α n are adjusted so that the classification bin α n is centred at the value of a registrant &# 39 ; s measurement variable ( v reg ). the peripheries ( p m1 , p m2 , m = 1 to n − 1 ) and ( p o1 , p o2 , o = n + 1 to q ) of the remaining q − 1 classification bins ( α m , m = 1 to n − 1 and α o , o = n + 1 to q ) are adjusted accordingly . it will be realised that the remaining q − 1 classification bins are the above - mentioned imposter models . the above discussion has focussed on a single scalar biometric variable . extending this approach to a one or more vector biometric variables and / or a plurality of scalar biometric variables , and assuming that each of the m elements thereof is represented by the same number q of classification bins , it can be seen that the set of classification bins is given by αε m × q . the adaptive quantised biometric method employs the above - mentioned quantisation approach to each of the m elements of the vector and / or scalar biometric variables . more particularly , referring to fig8 , the adaptive quantised biometric method comprises at least three phases , namely a configuration phase 78 , an enrolment phase 80 and an identity verification phase 82 . the preconfiguration phase 78 comprises the steps of : defining 84 a tolerance for the comparator ; defining 86 the number of classification bins for the classifier ; and determining 88 an initial relative positioning of the classification bins within the overall measurement range of the relevant measurement variable . acquiring 82 a value of the relevant measurement variable of a registrant ; determining 84 the classification bin for the acquired value of the registrant &# 39 ; s measurement variable ( from the initial positioning thereof during the preconfiguration phase 78 ); adapting 86 the boundaries of the relevant classification bin , so that the registrant &# 39 ; s measurement variable is centered in the relevant classification bin , adapting 88 the boundaries of the remaining classification bins so that the boundaries of the remaining classification bins abut ; and storing 89 the boundary values of the classification bins for the registrant . acquiring 90 a value of the relevant measurement variable of a user ; receiving 90 a claimed identity from the user ; retrieving the boundary values of the classification bins for the registrant whose identity is claimed by the user ; determining 92 the classification bin whose retrieved boundary values embrace the acquired value of the user &# 39 ; s measurement variable ; determining 94 whether the classification bin whose retrieved boundary values embrace the acquired value of the user &# 39 ; s measurement variable matches the classification bin for the acquired value of the registrant &# 39 ; s measurement variable ; and establishing 96 that the user has passed the quantised biometric method in the event that a match has been found ; or establishing 98 that the user has failed the quantised biometric method in the event that a match has not been found . extending from the present example to a multi - dimensional biometric measurement variable , the classification bins would be applied to each dimension of the variable . indeed , in the complex biometric and the multi - biometric scenario ; for a particular user , the classification bins for different biometric measurement variables will not be in the same order for each variable . in particular , the impostor features will not all fall into the same classification bin relative to the true person but will be varied in distribution . referring to fig9 , a quantised biometric apparatus 100 comprises a booth ( in which a user 104 stands ) or a tunnel 102 ( through which the user 104 walks ). the booth / tunnel 102 comprises a weighing scales 106 which measures the weight of the user 104 . the booth / tunnel 102 further comprises a camera 108 adapted to film the user in the booth / tunnel 102 . the camera 108 is further connectable to a feature recognition facility ( not shown ) capable of determining for example , the colour of the user &# 39 ; s hair or eyes etc . the booth / tunnel 102 further comprises a microphone 110 adapted to record for example the user &# 39 ; s voice . the microphone 110 is further connectable to a voice recognition facility ( not shown ) capable of detecting particular identifying phonic patterns in the user &# 39 ; s voice . similarly , the booth / tunnel 102 comprises a plurality of infra - red or other sensor / emitter couples 110 adapted to detect the user &# 39 ; s height . the skilled person will understand that the above - mentioned sensors are provided for illustrative purposes only . in particular , the skilled person will realize that the quantised biometric apparatus 100 is not limited to these sensors , number of sensors or even deployment / arrangement of sensors . instead , the skilled person will understand that the quantised biometric apparatus 100 is adaptable to include any number of sensors in any given deployment within the booth / tunnel 102 . the sensors from the quantised biometric apparatus 100 are coupleable ( wirelessly or hard - wired ) to a data processing unit 114 of a biometric processing unit 112 . during an enrolment phase , the biometric processing unit 112 determines the registrant models and imposter models for each of the biometric measurement variables of an identified registrant . the registrant and imposter models are stored in a database 116 . the biometric processing unit 112 further comprises a claim receiving unit 118 . during the verification operational phase , the claim receiving unit 118 receives a claim from the user 104 to a particular identity . the data processing unit 114 separately determines the classification bin for each biometric measurement variable acquired from the user 104 . a decision unit 120 compares the classification bin for a given biometric measurement variable against the registrant model for the biometric measurement variable associated with the claimed identity . in the event , of a match , the user is deemed to have passed the adaptive quantised biometric method . alterations and modifications may be made to the above without departing from the scope of the invention . | 6 |
in accordance with the present invention , a garbage collection algorithm is provided that achieves hierarchical copy order with parallel garbage collection threads . fig2 and 3 illustrate , as an example , one suitable computer system in which the present invention may be used . this computer system 100 , according to the present example , includes a controller / processor 102 , which processes instructions , performs calculations , and manages the flow of information through the computer system 100 . additionally , the controller / processor 102 is communicatively coupled with program memory 104 . included within program memory 104 are a garbage collector 106 , operating system platform 110 , java programming language 112 , java virtual machine 114 , glue software 116 , a memory allocator 202 , java application 204 , a compiler 206 , and a type profiler 208 . it should be noted that while the present invention is demonstrated using the java programming language , it would be obvious to those of ordinary skill in the art , in view of the present discussion , that alternative embodiments of the invention are not limited to a particular computer programming language . the operating system platform 110 manages resources , such as the data stored in data memory 120 , the scheduling of tasks , and processes the operation of the garbage collector 106 in the program memory 104 . the operating system platform 110 also manages a graphical display interface ( not shown ) that directs output to a monitor 122 having a display screen 124 , a user input interface ( not shown ) that receives inputs from the keyboard 126 and the mouse 130 , and communication network interfaces ( not shown ) for communicating with a network link ( not shown ). additionally , the operating system platform 110 also manages many other basic tasks of the computer system 100 in a manner well known to those of ordinary skill in the art . glue software 116 may include drivers , stacks , and low level application programming interfaces ( api &# 39 ; s ) and provides basic functional components for use by the operating system platform 110 and by compatible applications that run on the operating system platform for managing communications with resources and processes in the computing system 100 . each computer system 100 may include , inter alia , one or more computers and at least a computer readable medium 132 . the computers preferably include means 134 for reading and / or writing to the computer readable medium 132 . the computer readable medium 132 allows a computer system 100 to read data , instructions , messages or message packets , and other computer readable information from the computer readable medium . the computer readable medium , for example , may include non - volatile memory , such as floppy , rom , flash memory , disk drive memory , cd - rom , and other permanent storage . it is useful , for example , for transporting information , such as data and computer instructions , between computer systems . the present invention , as mentioned above , provides a garbage collection algorithm that achieves hierarchical copy order with parallel garbage collection threads . the prior art has not been able to achieve this . in order to best understand the significance and advantages of the present invention , several prior art garbage collection algorithms , shown in fig4 - 10 , are discussed below . fig4 illustrates cheney &# 39 ; s copying gc algorithm [ c . j . cheney . a nonrecursive list compacting algorithm . communications of the acm ( cacm ), 13 ( 11 ), 1970 ]. memory has two semi - spaces , from - space and to - space . at gc start , all heap objects are in from - space , and all o 1 to - space is empty . gc first scans the program variables for pointers to heap objects , and copies their target objects from - space to - space . copied objects are gray , and a “ free ” pointer keeps track of the boundary between gray objects and the empty part of to - space . next , gc scans copied objects for pointers to from - space , and copies their target objects to - space . scanned objects are black , and a “ scan ” pointer keeps track of the boundary between black objects and gray objects . when the scan pointer catches up to the free pointer , gc has copied all heap objects that are transitively reachable from the program variables . from - space is discarded , and the program continues , using the objects in to - space . cheney &# 39 ; s algorithm copies in breadth - first order ( see fig1 a ), because it scans gray objects first - in - first - out . one advantage of cheney &# 39 ; s algorithm is that it requires no separate stack or queue to keep track of its progress , saving space and keeping the implementation simple . cheney &# 39 ; s algorithm uses only one thread for garbage collection , it is not parallel . moon modified cheney &# 39 ; s algorithm to improve locality by copying in hierarchical order instead of breadth - first . fig5 illustrates moon &# 39 ; s algorithm [ david a . moon . garbage collection in a large lisp system . in lisp and functional programming ( lfp ), 1984 ]. to - space is now divided into blocks . as before , objects are copied by bumping the free pointer , which separates gray objects from empty space . but instead of just one scan pointer , moon maintains two scan pointers . the primary scan pointer is always in the same block as the free pointer . for example , in fig5 , both the primary scan pointer and the free pointer point into block d . if there are gray objects at the primary scan pointer , moon scans them . if the free pointer reaches the next block ( for example e ), moon advances the primary scan pointer to the start of that block , even though there may still be gray objects in the previous block ( for example d ). the secondary scan pointer keeps track of the earliest gray objects ( for example , in block b ). if the primary scan pointer catches up with the free pointer , moon scans from the secondary scan pointer , until the primary scan pointer points to gray objects again . if the secondary scan pointer catches up with the free pointer as well , gc is complete . moon &# 39 ; s algorithm copies objects in hierarchical order . for example , in fig1 c , moon &# 39 ; s algorithm first copies o 1 and its children , o 2 and o 3 , into the same block . next , it copies o 4 ( the first child of o 2 ) into a different block . at this point , the block with o 4 has a gray object at the primary scan pointer , so moon proceeds to copy the children of o 4 into the same block as o 4 . only when it is done with that block does it continue from the primary scan pointer , which still points into o 2 . the mutator is the part of an executing program that is not part of the gc : the user program , and run time system components such as the jit compiler . moon &# 39 ; s gc is concurrent to the mutator , but there is only one active gc thread at a time , no parallel gc threads . one problem with moon &# 39 ; s algorithm is that it scans objects twice when the secondary scan pointer advances through already black objects ( for example in block c in fig5 ). wilson , lam , and moher , [ paul r . wilson , michael s . lam , and thomas g . moher , “ effective : ‘ static - graph ” reorganization to improve locality in a garbage - collected system ” in programming language design and implementation ( pldi ), 1991 ] improve moon &# 39 ; s algorithm by avoiding re - scanning of black objects . fig6 illustrates wilson , lam , and moher &# 39 ; s algorithm . it keeps track of the scan pointers in all partially scanned blocks . when the block with the free pointer contains gray objects ( for example block d ), scanning proceeds in that block ; otherwise , it proceeds from the earliest block with gray objects ( for example block b ). the copy order of wilson , lam , and moher &# 39 ; s algorithm is identical to that of moon &# 39 ; s algorithm ( see fig1 c ). the hierarchical copying gc algorithm by wilson , lam , and moher is neither parallel nor concurrent . in 1985 , halstead published the first parallel gc algorithm [ robert h . halstead , jr . multilisp : a language for concurrent symbolic computation . transactions on programming languages and systems ( toplas ), 7 ( 4 ), 1985 ]. it is based on baker &# 39 ; s gc [ henry g . baker , jr . list processing in real time on a serial computer . communications of the acm ( cacm ), 21 ( 4 ), 1978 ], which is an incremental variant of cheney &# 39 ; s gc [ c . j . cheney . a nonrecursive list compacting algorithm . communications of the acm ( cacm ), 13 ( 11 ), 1970 ]. halstead &# 39 ; s gc works on shared - memory multiprocessor machines with uniform access time to the shared memory . the garbage collector works in simd ( single instruction , multiple data ) style : each worker thread performs the same gc loop on different parts of the heap . the mutator may be simd or mimd ( multiple instruction , multiple data ). as illustrated in fig7 , at any given point in time , either gc threads are running or mutator threads are running , but not both . the gc is parallel , but not concurrent . halstead &# 39 ; s algorithm partitions to - space into n equally sized parts on an n - processor machine . fig8 illustrates the heap organization for n = 2 . worker thread i has a scan pointer scans and a free pointer frees , which point to gray objects and empty space in their respective parts of to - space . termination detection is simple : when scan i = free i for all i , then there are no more gray objects to scan anywhere . since each thread has its own private part of to - space , the threads do not need to synchronize when scanning objects in to - space or allocating memory in to - space . but they do need to synchronize on individual objects in from - space : if two worker threads simultaneously encounter pointers to the same object in from - space , only one of them should copy it and install a forwarding pointer . like cheney , halstead has the advantage of requiring no separate queue or stack to keep track of gray objects , because within the part of to - space that belongs to a thread , the objects themselves are laid out contiguously and form an implicit fifo queue . the algorithm therefore copies in breadth - first order ( fig1 ). unfortunately , the static partitioning of to - space into n parts for n processors leads to work imbalance . this imbalance causes two problems : overflow and idleness . overflow occurs when a worker thread runs out of empty space to copy objects into . halstead solves this problem by providing additional empty space to worker threads on demand . idleness occurs when one thread runs out of gray objects to scan while other threads are still busy . halstead does not address the idleness problem caused by work imbalance . in 1993 , imai and tick published the first parallel gc algorithm with load balancing [ akira imai and evan tick . evaluation of parallel copying garbage collection on a shared - memory multiprocessor . ieee transactions on parallel and distributed systems , 4 ( 9 ), 1993 ]. their algorithm extends halstead &# 39 ; s algorithm by over partitioning : on an n - processor machine , it partitions to - space into m blocks , where m & gt ; n . fig9 illustrates imai and tick &# 39 ; s gc . each gc worker thread has one scan block with gray objects to scan , and one copy block with empty space to copy objects into . these blocks may be separate ( a and e in thread 1 ) or aliased ( d in thread 2 ). a shared work pool holds blocks currently unused by any thread . when a copy block has no more empty space , it is completely gray or black and gray . the thread puts the copy block into the work pool for future scanning , replacing it with a new empty block . when the scan block has no more gray objects , it is completely black , and thus done for this garbage collection : the thread gets rid of it . then , the thread checks whether its private copy block has any gray objects . if yes , it aliases the copy block as scan block . otherwise , it obtains a new scan block from the shared work pool . in addition to having to synchronize on from space objects like halstead &# 39 ; s algorithm , the algorithm by imai and tick also has to synchronize operations on the shared work pool . the aliasing between copy and scan blocks avoids a possible deadlock where the only blocks with gray objects also have empty space . in addition , it reduces contention on the shared work queue when there are many gc threads . imai and tick &# 39 ; s gc only checks for an aliasing opportunity when it needs a new scan block because the old scan block is completely black . imai and tick evaluated their algorithm on 14 programs written in a logic language . they report parallel speedups of 4 . 1 × to 7 . 8 × on an 8 - processor machine . their metric for speedup is not based on wall - clock time , but rather on gc “ work ” ( number of cells copied plus number of cells scanned ); it thus does not capture synchronization overhead or locality effects . the present invention effectively achieves hierarchical copy order with parallel gc threads . the implementation of parallel hierarchical copying gc is based on the generational gc implemented in ibm &# 39 ; s j9 jvm . it uses parallel copying for the young generation and concurrent mark - sweep with occasional stop - the - world compaction for the old generation . this is a popular design point in products throughout the industry . the baseline gc has exactly two generations , and young objects remain in the young generation for a number of birthdays that is adapted online based on measured survival rates . we are only concerned with copying of objects within the young generation or from the young generation to the old generation . the baseline gc uses imai and tick &# 39 ; s algorithm for the young generation . to accommodate tenuring , each worker thread manages two copy blocks : one for objects that stay in the young generation , and another for objects that get tenured into the old generation . either block may be aliased as scan block . parallel hierarchical gc achieves hierarchical copy order by aliasing the copy and scan blocks whenever possible . that way , it usually copies an object into the same block that contains an object that points to it . this is the parallel generalization of the single - threaded algorithm by wilson , lam , and moher that uses the scan pointer in the block with empty space whenever possible . blocks serve both as the work unit for parallelism and as the decomposition unit for hierarchical copying . it may be noted that the term “ block ”, as used herein including the claims , refers to a cache line or page or other unit of os and hw support for memory hierarchy . fig1 shows the possible states of a block in to - space as circles . transitions labels denote the possible coloring of the block when a gc thread changes its state . blocks in states freelist , scanlist , and done belong to the shared work pool . no gc thread scans them or copies into them , and thus , their coloring cannot change . blocks in states copy , scan , and aliased belong to a gc thread . for example , a copy block must have room to copy objects into ; therefore , all incoming transition labels to state copy are at least partially empty . if the copy block has some gray objects and some empty space , then it can serve both as copy block and as scan block simultaneously , and the gc aliases it ; therefore , the transition from state copy to state aliased is labeled with colorings that include both gray and empty . the state machine in fig1 is non - deterministic : the state and coloring of a block alone do not determine which transition it takes . rather , the transitions depend on the colorings of both the copy block and the scan block of the worker thread . table 1 shows the actions that the gc thread performs after scanning a slot in an object . for example , if the copy block contains both gray slots and empty space , and the scan block is already aliased with the copy block ( column scan = aliased ), no action is necessary before the next scanning operation . if the copy block contains gray and black and no empty space , or is completely gray , and the scan block is not aliased , the thread transitions the copy block to the aliased state , and either puts the scan block back on the scanlist if it still has gray slots , or transitions it to the done state if it is completely black . as described in table 1 , parallel hierarchical gc leads to increased contention on the scanlist . to avoid this , the preferred implementation caches up to one block from the scanlist with each thread . thus , if there is a cached block , the action scanlist → scan really obtains that cached block instead . likewise , the transition scan → scanlist really caches the scan block locally , possibly returning the previously cached block to the scanlist in its stead . presented below is an evaluation of parallel hierarchical copying gc ( ph ), compared to parallel breadth - first copying gc ( bf ). like cheney &# 39 ; s algorithm and the other cheney - based algorithms , parallel hierarchical gc requires no separate mark stack or queue of objects . instead , the gray objects are consecutive in each block , thus serving as a fifo queue . on the other hand , like imai and tick &# 39 ; s algorithm , the gc of this invention requires a shared work pool of blocks to coordinate between gc threads . in addition , it requires per - block data to keep track of its state and coloring . after scanning a gray slot , parallel hierarchical gc checks immediately whether it became possible to alias the copy block and the scan block . since this check happens on the innermost loop of the gc algorithm , it must be fast . the immediacy of this check is what leads to hierarchical order like in the algorithms by moon and by wilson , lam , and moher . the goal of hierarchical copy order is improved mutator locality . but of course , it also affects gc locality and load balancing . this effect can be positive or negative . as mentioned earlier , in the preferred implementation , each gc thread actually manages two copy blocks , one each for young and old objects . only one of them can be aliased at a time . experiments were conducted with a modified version of ibm j2se 5 . 0 j9 ga release ( ibm &# 39 ; s product jvm ), running on real hardware in common desktop and server operating systems . this section discusses the methodology . the platform for the following four sections was a dualprocessor ia32 smt system running linux . the machine has two 3 . 06 ghz pentium 4 xeon processors with hyperthreading . the memory hierarchy consists of an 8 kb l1 data cache ( 4 - way associative , 64 byte cache lines ); a 512 kb combined l2 cache ( 8 - way associative , 64 byte cache lines ); a 64 entry data tlb ( 4 kb pages ); and 1 gb of main memory . the platforms for other sections are described there . table 2 shows the benchmark suite , consisting of 26 java programs : specjbb2005 , the 7 specjvm98 programs , the 10 da - capo benchmarks , 2 ashes benchmarks , and 6 other big java programs . column “ mb ” gives the minimum heap size in which the program runs without throwing an outofmemoryerror . the rest of this discussion reports heap sizes as n × this minimum heap size . to reduce the effect of noise on the results , all experiments consist of at least 9 runs ( jvm process invocations ), and usually several iterations ( application invocations within one jvm process invocation ). for each specjvm98 benchmark , a run contains around 10 to 20 iterations at input size 100 . each run of a dacapo benchmark contains two or more iterations on the largest input . this section shows the effect of hierarchical copying on runtime for 25 java programs . a 26th program , specjbb2005 , is discussed in more detail below . the speedup columns of table 3 show the percentage by which parallel hierarchical copying ( ph ) speeds up (+) or slows down (−) run time compared to the baseline parallel breadth - first copying ( bf ). they are computed as where ph and bf are the respective total run times . for example , at a heap size of 4 × the minimum , parallel hierarchical copying speeds up db &# 39 ; s run time by 23 . 5 % compared to breadth - first . when the speedup or slowdown is too small to be statistically significant ( based on student &# 39 ; s t - test at 95 % confidence ), the table shows a “ 0 ”. column “ c . i .” shows the confidence intervals for the 4 × numbers as a percentage of the mean run time . the confidence intervals at other heap sizes are similar . finally , column “# gcs ” shows the number of garbage collections in the runs at heap size 10 ×; smaller heaps cause more garbage collections . none of the benchmarks experienced speedups at some heap sizes and slowdowns at others . the benchmarks are sorted by their maximum speedup or slowdown at any heap size . out of these 25 programs , 13 speed up , 4 are unaffected , and 8 slow down . the discussion below will show that specjbb2005 also speeds up . while speedups vary across heap sizes , we observed no pattern . the program with the largest slowdown is ipsixql , which maintains a software lru cache of objects . because the objects in the cache survive long enough to get tenured , but then die , ipsixql requires many collections of the old generation . the program with the largest speedup is db , which experiences similar speedups from depth - first copy order . depth - first copy order requires a mark stack , hence it is not considered further herein . parallel hierarchical copy order speeds up the majority of the benchmarks compared to breadth - first copy order , but slows some down . it may be possible to avoid the slowdowns by deciding the copy order based on runtime feedback . parallel hierarchical copying gc tries to speed up the mutator by improving locality . the discussion above showed that most programs speed up , but some slow down . the discussion immediately below explores how mutator and garbage collection contribute to the overall performance . table 4 breaks down the results of running in 4 × the minimum heap size into mutator and collector . the “ time ” columns show improvement percentages of parallel hierarchical copying ( ph ) compared to breadth - first ( bf ); higher numbers are better , negative numbers indicate degradation . the “ tlb misses ” columns show miss rates per retired instruction , in percent ( lower is better ; which tlb and other hardware characteristics will be discussed below in more detail ). a (+) indicates that ph has a higher miss rate than bf , a (−) indicates that it has a lower miss rate , and a ( 0 ) indicates that there is no statistically significant difference . the benchmarks are ordered by the total speedup from table 3 . when there is a measurable change , with few exceptions , the mutator speeds up and the collector slows down . even fop and kawa , which experienced no overall speedup , experience a small mutator speedup . usually , tlb miss rates decrease both in the mutator and in the gc . for the mutator , this explains the speedup ; for the gc , this does not prevent the slowdown caused by executing more instructions to achieve hierarchical order . the large reduction in mutator tlb misses for db ( from 7 % to 5 . 5 %) leads to an overall speedup despite having the largest gc slowdown ( of 37 . 6 %). hierarchical copying only slows down collections of the young generation , but since most objects in db die young , collections of the young generation dominate gc cost . to conclude , parallel hierarchical copying trades gc slowdown for mutator speedup . this is a reasonable tradeoff as long as gc scaling on multiprocessors is not impacted . the discussion herein shows how to achieve hierarchical copy order in a parallel gc . the goal of parallel gc is to scale well in multi - processor systems by using all cpus for collecting garbage . this is necessary to keep up with the mutator , since it uses all cpus for allocating memory and generating garbage . the present discussion investigates how well parallel hierarchical copying gc scales . fig1 shows how the collector scales for specjbb2005 . specjbb2005 , the spec java business benchmark , models a server that uses multiple parallel mutator threads to service transactions against a database . for this experiment , the number of mutator threads is fixed at 8 , and when the mutator threads are stopped for collection , the gc uses between 1 and 8 threads . the platform is an ia32 windows system with four 1 . 6 ghz pentium 4 xeon processors with hyperthreading ( i . e . 8 logical cpus ), 256 kb of l2 cache , 1 mb of l3 cache , and 2 gb of ram . the heap size is 1 gb , out of which the young generation uses 384 mb . all numbers in fig1 are mutator transactions per gc time . higher numbers indicate that the mutator gets more mileage out of each second spent in gc , indicating better gc scaling . there are curves for parallel breadth - first ( bf ) copying , parallel hierarchical ( ph ) copying , and ph with no cached block ( phncb ). all numbers are normalized to bf at 1 thread . the error bars show 95 % confidence intervals . with 8 gc worker threads , both bf and ph run around 3 times faster than with 1 thread . without the cached block optimization from the above section , ph would not scale : it would run 46 % slower with 8 threads than with only 1 thread ( phncb ). whereas fig1 shows how specjbb2005 &# 39 ; s gc time scales , fig1 shows how its total throughput scales on three hardware platforms . specjbb2005 measures throughput as transactions per second , which should increase with the number of parallel mutator threads (“ warehouses ”). the three platforms are : a . a 2 - processor em64t system running linux . the machine has two 3 . 4 ghz pentium 4 xeon processors with hyperthreading , with 1 mb of l2 cache and 4 gb of ram . on this machine , specjbb2005 used a 1 gb heap with a 384 mb young generation . b . the 4 - processor ia32 windows system from fig1 . c . an 8 - processor power system running aix . the machine has eight 1 . 5 ghz power 5 processors with hyperthreading , with a total of 144 mb of l3 cache and 16 gb of ram . on this machine , we ran specjbb2005 in a 3 . 75 gb heap with a 2 . 5 gb young generation . in each of the graphs 12 a - c , the x - axis shows the number of warehouses ( parallel mutator threads ), and the y - axis shows the throughput ( transactions per second ) relative to the bf throughput with 1 warehouse . higher is better in these graphs , because it means that more transactions complete per second . on all three platforms , throughput increases until the number of warehouses reaches the number of logical cpus , which is twice the number of physical cpus due to hyperthreading . at that point , parallel hierarchical gc has a 3 %, 8 %, and 5 % higher throughput than the baseline gc . increasing the number of threads further does not increase the throughput , since there are no additional hardware resources to exploit . but hierarchical gc sustains its lead over the baseline gc even as threads are increased beyond the peak . fig1 shows gc scaling for the specjvm98 benchmarks except mpegaudio ( which does very little gc ). the platform is the same as for fig1 , and the heap size is 64 mb . except for mtrt , all of these programs are single - threaded . since the amount of mutator work is constant between the different collectors , fig1 measures parallel gc scaling as the inverse of gc time , normalized to gc throughput for bf with 1 thread . for most specjvm98 benchmarks , neither ph nor bf scale well . this is in part due to their small memory usage compared to specjbb2005 : there is not enough work to distribute on the parallel gc worker threads . as for specjbb2005 , ph with no cached block ( phncb ) scales worse than either ph or bf . to conclude , parallel hierarchical copying gc scales no worse with increasing load caused by parallel applications than parallel breadth - first copying gc . a single - threaded gc , on the other hand , would have a hard time keeping up with the memory demands of several parallel mutators . in a small heap , gc has to run more often , because the application exhausts memory more quickly . this increases the cumulative cost of gc . on the other hand , in a small heap , objects are closer together , which should intuitively improve locality . this section investigates how these competing influences play out . fig1 shows the run times of two representative benchmarks , specjvm98 db and javac , at 6 different heap sizes from 1 . 33 × to 10 × ( occupancy 75 % to 10 %). the x - axis shows the heap size ; each graph carries labels for absolute heap size at the top and labels for relative heap size at the bottom . the y - axis shows run time relative to the best data point in the graph . in these graphs , lower is better , since it indicates faster run time . there are three graphs for each benchmark , one each for total time , mutator time , and gc time . while the y - axis for total and mutator time goes to 1 . 5 , the y - axis for gc time goes to 3 . fig1 a + d show that parallel hierarchical copying ( ph ) speeds up the mutator for both db and javac . fig1 b + e show that , as expected , total gc cost is higher in smaller heaps . but this effect is more significant for javac than for db , because javac has a higher nursery survival rate [ martin hirzel , johannes henkel , amer diwan , and michael hind . understanding the connectivity of heap objects . in international symposium on memory management ( ismm ), 2002 ]. that is also the reason why ph slows down the collector for db , while causing no significant change in collector time for javac . the overall behavior of db is dominated by the mutator speedup caused by ph ( fig1 c ), whereas the overall behavior of javac is dominated by the decrease of gc cost in larger heaps ( fig1 f ). this confirms the conclusions from above : parallel hierarchical gc performs well in both small and large heaps . the goal of hierarchical copying is to reduce cache and tlb misses by colocating objects on the same cache line or page . this section uses hardware performance counters to measure the impact of hierarchical copying on misses at different levels of the memory subsystem . pentium processors expose hardware performance counters through machine specific registers ( msrs ), and many linux distributions provide a character device , / dev / cpu /*/ msr , to access them . doing modprobe msr ensures the presence of this device ; for experiments in user mode , the files must be readable and writeable for users . the jvm sets up the registers for collecting the desired hardware events at the beginning of the run , and reads them at the beginning and end of gc , accumulating them separately for the mutator and the gc . fig1 shows the results . the x - axis shows the heap size ; each graph carries labels for absolute heap size at the top and labels for relative heap size at the bottom . the y - axis shows the hardware metric ; each graph carries labels for relative miss rate at the left and labels for absolute miss rate at the right . in these graphs , lower is better , since it indicates fewer misses . the denominator of all ratios is retired instructions . see table 4 for statistical confidence on the tlb miss rates ; there are some variations due to noise . the “ bus cycles ” event measures for how many cycles the bus between the l2 cache and main memory was active . this indicates l2 misses , for which pentium 4 does not provide a reliable direct counter . note that bus clock speeds are usually an order of magnitude slower than processor clock speeds . parallel hierarchical copying reduces mutator misses on all measured levels of the memory subsystem : l1 data cache , combined l2 cache , and tlb . it reduces misses for both db and javac , at all heap sizes . as expected , the reduction in tlb misses is the most significant , because the hierarchical gc uses 4 kb blocks as the decomposition unit , which coincides with the page size . with bf , db has high l1 and tlb miss rates , and ph reduces the miss rates significantly . that explains the large speedup that the above sections report for db . to conclude , parallel hierarchical copying gc reduces tlb misses most , while also reducing l1 and l2 cache misses significantly . these reduced miss rates translate into reduced run time . the above section already demonstrated that hierarchical copying reduces cache and tlb misses . this section validates that it achieves that by colocating objects on the same cache line or page . for this experiment , the gc records the distance between the address of a pointer and the address of the object it points to just after a copying or forwarding operation . pointers with an absolute distance under 64 b are classified as “ line ”, and pointers with an absolute distance between 64 b and 4 kb are classified as “ page ”. the numbers only consider pointers from objects in the young generation to other objects in the young generation , and from newly tenured objects in the old generation to other newly tenured objects in the old generation . among other things , this disregards pointers between young and old objects ; those have longer distances , but are rare , and hierarchical copying cannot colocate them on the same page . table 5 shows pointer distances . for example , db with breadthfirst copying yields 9 . 4 % pointers that are longer than 64 bytes but under 4 kb , whereas parallel hierarchical copying improves that to 65 . 1 %. except for specjbb2005 , all runs used heaps of 4 × the minimum size . these numbers show that parallel hierarchical copying succeeds in colocating objects on the same 4 kb page for the majority of the pointers . this explains the reduction in tlb misses observed in table 4 . also , parallel hierarchical copying colocates objects on the same 64 - byte cache line much more often than the baseline garbage collector . this explains the noticeable reduction in l1 and l2 cache misses observed above . while hierarchical copying is tremendously successful at improving spatial locality of connected objects , wall - clock numbers from a real system ( table 3 ) paint a more sober picture . this discrepancy underlines three points : ( i ) hierarchical copying trades gc slowdown for mutator speedup . the result of this tradeoff is determined by the concrete benchmark , gc implementation , and platform . ( ii ) hierarchical copying aims at decreasing tlb and cache miss rates . when the application working set is small compared to the memory hierarchy of the machine , miss rates are already so low that decreasing them further helps little . ( iii ) hierarchical copying optimizes for the “ hierarchical hypothesis ” that connectivity predicts affinity . in other words , it assumes that objects with connectivity ( parents or siblings in the object graph ) also have affinity ( the application accesses them together ). not all applications satisfy the hierarchical hypothesis . it should be noted that the present invention , or aspects of the invention , can be embodied in a computer program product , which comprises all the respective features enabling the implementation of the methods described herein , and which — when loaded in a computer system — is able to carry out these methods . computer program , software program , program , or software , in the present context mean any expression , in any language , code or notation , of a set of instructions intended to cause a system having an information processing capability to perform a particular function either directly or after either or both of the following : ( a ) conversion to another language , code or notation ; and / or ( b ) reproduction in a different material form . while it is apparent that the invention herein disclosed is well calculated to fulfill the objects stated above , it will be appreciated that numerous modifications and embodiments may be devised by those skilled in the art , and it is intended that the appended claims cover all such modifications and embodiments as fall within the true spirit and scope of the present invention . | 6 |
the repair system of the present disclosure can be used in surgical procedures and has particular application in securing soft tissue , including tendons , ligaments , etc ., to bone . the system can be used in conjunction with surgery performed on the elbow , shoulder , back , ankle , knee , etc . and has particular application in biceps repair , elbow repair , shoulder repair , knee repair , foot repair , and ankle repair . such biceps repair operations include , but are not limited to , reattachment of a torn or damaged biceps tendon , for example distal biceps tendon repair . such elbow repair operations include , but are not limited to , repair of a torn or damaged elbow ligament , for example , by ulnar collateral ligament ( ucl ) surgery . such shoulder repair operations include , but are not limited to , repair of a torn or damaged shoulder ligament , for example , by acromioclavicular ( ac ) surgery . other procedures are also envisioned . a repair system as disclosed herein can include , for example , at least three components , in particular , a sleeve for mounting to a side of a bone and / or positioning within a bone tunnel , a tension securing means for securing tension on the flexible material , and a flexible material ( e . g ., a suture ). suitable tension securing means include a set screw . for example , a set screw as described in united states published patent application number us 2010 / 0262185 , which is incorporated herein in its entirety . referring to fig3 , another suitable tension securing means is an insertion piece 800 having a spherical portion 801 integrally formed with a base portion 802 , for example , which can have a convex face 803 . the insertion piece can have a shaft 804 for passing a flexible material , such as a suture , therethrough . the shaft can be positioned where the spherical portion and base portion meet . the sleeve of the repair system can be adapted for use with the insertion piece , for example , by having a flange and a smooth internal bore for reception of the spherical portion , in addition to passage of the flexible material . the internal bore of the sleeve can decrease in diameter away from the flange so that the spherical portion can be inserted within the sleeve such that the edge of the base portion is flush with the top of the internal bore or slightly inside the internal bore . the sleeve can also have a shaft connecting the internal bore to the edge of the flange for passage of the flexible material . in other words , a flexible material can pass through the insertion piece and sleeve . the flexible material can pass through the shafts in the insertion piece and the flange of the sleeve such that application of tension to the flexible material urges the insertion piece into the sleeve . this provides a self - energizing mechanism in which securing strength builds up as more tension is applied to the flexible material . the securing means can further comprise a removable rod to act as a cantilever spring to exert pressure on the insertion piece to bias it into locking engagement with the sleeve and to prevent lateral slipping of the insertion piece upon initial tensioning of the flexible material . the repair system described herein can further comprise means for imparting tension to the flexible material ( not shown ). one suitable means for imparting tension on a flexible material is described in u . s . patent application ser . no . 12 / 944 , 379 filed nov . 11 , 2010 , the entire contents of which are specifically incorporated herein by reference . as another suitable means for imparting tension , the repair system can further comprise at least one anchoring means for anchoring the flexible material , for example a hook or cleat . the hook or cleat can have a base . a plurality of hooks or cleats can be integrally formed on a single base . the means for imparting tension can further comprise a threaded piece having a channel in which a base portion of the at least one hook is slidably disposed . a tension adjustment knob can be placed around the threaded piece and over at least a portion of the base of the cleat . the tension adjustment knob can be a knob as shown in fig1 and 2 or a wing nut - type knob as shown in fig3 . rotation of the tension adjustment knob can slide the base and cleat within the channel thereby adjusting the tension of the flexible material anchored to the cleat . the cleat can be constructed to bias towards the distal end of the shuttle body as tension on the anchored flexible material is increased . for example , as tension on the flexible material is increased , the cleat can bend towards the distal end of the shuttle body and , as it approaches becoming perpendicular to the base portion , can be an indication that proper tension is imparted to the flexible material . the means for imparting tension can be integrated with the repair system . in another embodiment , a repair system disclosed herein can be adapted for use in surgical procedures to repair joints , for example , elbows , shoulders , and knees . this repair system can have an integrated means for imparting tension to a flexible material ( e . g ., suture means ). referring to fig1 to 3 , the repair system 11 can comprise a shuttle body 201 having a proximal end 202 , a distal end 203 , and a shaft connecting the proximal end and the distal end and which can provide external communication therethrough ; an inserter 301 slidably disposed in the shaft ; a sleeve member 110 disposed at the distal end of the shuttle body ; and means for imparting tension to a flexible material integrated with the shuttle body , for example at the proximal end of the shuttle body . the repair system can further comprise tension securing means , as described above . as used with reference to fig1 to 3 , “ proximal end ” refers to the end of the shuttle body near the operator of the repair system and “ distal end ” refers to the end of the shuttle body away from the operator of the repair system . the shuttle body can have any cross - section , for example , it can have a square cross - section . other cross - sections can include , but are not limited to , circular , oval , and polygonal ( e . g ., hexagonal ) cross - sections . the shuttle body can be integrated with the means for imparting tension . for example , the proximal end of the shuttle body can be a threaded portion 502 of a means for imparting tension . the threaded portion 502 can define a channel 503 in which a base 504 of at least one cleat 505 , e . g ., a hook , is slidably disposed . a tension adjustment knob 506 ( fig1 and 2 ) or 506 ′ ( fig3 ) can be threadedly attached to the threaded portion and over the base in order to slide the base and hook within the channel to adjust the tension of the flexible material anchored to the hook . the shuttle body can further comprise a grip section 205 on the outside of the body between the proximal end and the distal end to increase the ease of handling the repair system by an operator . the channel defined by the threaded portion can extend into the grip section thereby increasing the distance range for movement of the base and cleat . the shaft of the shuttle body can have any cross - section , for example , it can have a square cross - section and is disposed in the housing . other cross - sections can include , but are not limited to , circular , oval , and polygonal ( e . g ., hexagonal ) cross - sections . the distal end of the shuttle body can be adapted to hold the sleeve member in place . additionally , the distal end of the shuttle body can have an opening 206 for passage of a flexible material . the sleeve member 110 can have a flange 114 , which may be formed as part of the sleeve or may be a separate piece ( e . g ., a washer ), and which is shaped for insertion into the distal end of the shuttle body . as shown in fig4 , the flange 114 can be generally circular with at least one flat side 116 . the sleeve member can have an internal bore , for example a threaded or non - threaded bore , for passage of a flexible material and distal portion of the inserter therethrough . the sleeve member can be configured based on a particular means for imparting tension and tension securing means . for example , when using a set screw as means for securing tension , the sleeve member can have a threaded internal bore . when using the above - described insertion piece as means for securing tension , the sleeve member can have a smooth internal bore . the inserter 301 can have a proximal end 302 and a distal end 303 and can be , for example , a toggle inserter . the shape and dimensions of the inserter are not particularly limited ; however , the inserter should be formed so as to be able to slide through the shaft of the shuttle body from application of pressure by a user and to maintain its position within the shaft when the user is not applying pressure . the proximal end of the inserter can be shaped so as to prevent complete insertion of the inserter into the shaft of the shuttle body . as shown in fig2 , the inserter may be concave at its proximal end and may have a rim protrusion 304 which allows the user to easily apply pushing pressure for movement of the inserter through the shaft to the distal end of shuttle body and to pull the inserter for movement towards and removal through the proximal end of the shuttle body . as shown in fig2 , the inserter can comprise sections which decrease in diameter from the proximal end to the distal end . the distal - most end of the inserter can be adapted for placement of a toggle 305 , for example , by being slightly angled in relation to the rest of the inserter to form a hook . the toggle 305 can be provided with closed ends , as shown in fig2 . alternatively , the toggle can be provided with partially open ends 306 , as shown in fig6 . when provided with partially open ends , the toggle can be positioned on the inserter as shown fig7 . for example , the distal - most end of the inserter can be provided with protrusions 308 for receiving a connecting section 307 of the toggle . a repair system having the toggle as shown in fig7 can operate without a shuttle suture . such a configuration allows placement of a suture through soft tissue , for example , a tendon , before positioning the toggle on the bone of a patient . thus , it is not necessary to pass the suture through the toggle which avoids passing the toggle through a hole to a side of a patient &# 39 ; s bone which is not accessed . in use , for example , in joint repair surgery , the repair system 11 can be assembled as shown in fig1 or fig3 , with a shuttle body 201 having an integrated means for imparting tension to a flexible material 1401 , i . e ., a tension adjustment knob 506 and a threaded portion 502 defining a channel 503 in which a plurality of cleats 505 on a base 504 are slidably disposed . the sleeve member 110 is inserted in the distal end of the shuttle body . the inserter 301 is positioned through the shaft of the shuttle body and extending through the distal end of the shuttle body and through the internal bore of the sleeve member 110 . a toggle 305 is positioned on the distal - most end of the inserter 301 . a flexible material 1401 is threaded through the toggle and passes through the internal bore of the sleeve and the opening 206 and the distal end of the shuttle body . referring to fig8 a to 8c , a hole is drilled through a patient &# 39 ; s bone 610 . the inserter and toggle 305 , with a flexible material 1401 , for example , a suture relay , are inserted through the hole and the toggle is positioned onto one side of the hole . the toggle is detached from the inserter and the inserter is withdrawn through the hole . in order to facilitate detachment of the toggle , the hole can be drilled to have a diameter smaller than the length of the toggle . as the toggle passes through the hole , it is compressed . upon passing to the other side of the drilled hole , the release of compression can cause the toggle to detach from the inserter . the inserter is then removed from the shuttle body . removal of the inserter from the shuttle body permits insertion of additional components for use in repair procedures , for example , a torque driver . an additional flexible material 1402 , for example , a whip stitch suture which is attached at its opposite end to soft tissue 710 , is attached to an end of the flexible material and pulled through an opening of or around a connecting section of the toggle 305 and then through the sleeve member 110 and the shuttle body opening and affixed to the cleat of the integrated means of imparting tension ( not shown ). the sleeve member 110 is then positioned on the side of the drilled hole opposite the toggle 305 and the additional flexible material is tensioned by rotating the tension adjustment knob ( not shown ). a tension securing means ( not shown ) is inserted into the sleeve to maintain the tension generated by the means for imparting tension . the additional flexible material is removed from the cleat and shuttle body is detached from the sleeve . fig9 illustrates a device disclosed herein positioned for use in surgical repair of a knee , particularly for reattaching soft tissue 711 to the patella 620 ( show in front of femur 621 ). toggle 305 is positioned on one end of a hole drilled through the patella using an inserter ( not shown ). in order to facilitate detachment of the toggle , the hole can be drilled to have a diameter smaller than the length of the toggle . as the toggle passes through the hole , it is compressed . upon passing to the other side of the drilled hole , the release of compression can cause the toggle to detach from the inserter . the inserter is then removed from the shuttle body . removal of the inserter from the shuttle body permits insertion of additional components for use in repair procedures , for example , a torque driver . a flexible material 1402 , for example , a whip stitch suture which is attached at its opposite end to soft tissue 711 , is attached to an end of the flexible material and pulled through an opening of or around a connecting section of the toggle 305 and then through the sleeve member 110 and the shuttle body opening and affixed to the cleat 505 of the integrated means of imparting tension . the sleeve member 110 is then positioned on the side of the drilled hole opposite the toggle 305 and the additional flexible material is tensioned by rotating the tension adjustment knob 506 . a tension securing means ( not shown ) is inserted into the sleeve to maintain the tension generated by the means for imparting tension . the additional flexible material is removed from the cleat and shuttle body is detached from the sleeve . fig1 illustrates another repair system as disclosed herein . repair system 10 generally includes three components , in particular , a sleeve 110 for mounting to a side of the bone , tension securing means 701 for securing tension on the flexible material , and a flexible material 1401 ( e . g ., suture means ). in use , for example in a distal biceps tendon repair surgery , sleeve 110 rests on a posterior aspect of the proximal radius 604 just opposite to the radial tuberosity 606 . the sleeve 110 can have a flange 114 which may be formed as part of the sleeve or may be a separate piece ( e . g ., a washer ). the flange 114 supports the sleeve on the posterior aspect of the proximal radial cortex while the body of the sleeve passes partially through a drilled hole 602 connecting the posterior and anterior surfaces of the proximal radius at a level of a normal , intact biceps insertion . the sleeve 110 may include a passage for a flexible material 1401 , ( e . g . suture , tape , or other suitable material ) that is attached on its proximal end to an avulsed , injured , biceps tendon 700 . the free ends of the flexible material are passed through the sleeve , tensioned appropriately and secured by inserting tension securing means ( not shown ), for example , the tension securing means as described in united states published patent application number us 2010 / 0262185 , in the sleeve . in one embodiment the flexible material 1401 is secured to the injured , avulsed biceps tendon 700 through an anterior incision about the elbow 800 . the radial tuberosity 606 is exposed and a small gauge pin or drill which has an eyelet for receiving free ends of said flexible material ( suture to be placed through eyelet later in procedure ) is advanced through the proximal radius 604 from anterior to posterior at the site of the normal insertion of the biceps tendon 700 . the pin may then be advanced out the posterior aspect of the forearm . the flexible material 1401 is then threaded through the eyelet in the pin . in one embodiment a cannulated device may be placed over the pin as it protrudes out the posterior aspect of the forearm and advanced over the wire so that it rests on the posterior aspect of the radius . this cannulated device is designed to protect the surrounding soft tissues during the remainder of the procedure . a cannulated drill may then be passed over the previously placed pin and drilled through the posterior cortex . the sleeve may then be passed down cannulated device to rest on posterior cortex - as previously mentioned . the pin can then be pulled out posteriorly with the flexible material threaded through its trailing end so that when the pin is removed free ends of flexible material now protrude out of the cannulated device . a tensioner may be mounted on cannula or may engage threaded sleeve 110 through an engagement member , tension can then be applied to flexible material 1401 so that biceps tendon 700 is brought into anterior hole 602 that will be created in the radial tuberosity through an earlier step . with appropriate tension maintained on flexible material , a tension securing means will be passed down cannula and inserted into sleeve using appropriate torque . for the purposes of illustration and without limitation , the term “ suture ”, “ suture means ”, “ flexible material ” as used herein may be a cable , filament , thread , wire , fiber tape , or any other flexible member suitable for soft tissue and bone fixation in the body . while the foregoing disclosure has been described in some detail for purposes of clarity and understanding , it will be appreciated by one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the disclosure and appended claims . all patents and publications cited herein are entirely incorporated herein by reference . | 0 |
according to fig1 , a testing pin 2 is located on a holder 1 , wherein it is to be presumed , of course , that generally a plurality of such testing pins 2 is provided on this holder 1 . a printed circuit board 3 is to be tested using this testing pin 2 . in the present exemplary embodiment , the testing pin 2 penetrates the holder 1 , which is implemented as a perforated plate , with a shaft 4 . this shaft 4 is arranged in a corresponding recess in the perforated plate 1 so it is rotatable around an axis a . a testing tip 5 is located eccentrically in relation to this axis a , which testing tip can be varied in its location in relation to the workpiece ( printed circuit board 3 ) upon rotation of the shaft 4 . of course , it is additionally possible to also implement the recess in the perforated plate 1 , which is penetrated by the shaft 4 , accordingly , so that the location of the testing tip 5 can additionally be changed . for example , the recess could be an oblong hole or the like . a magnet 6 is provided on the shaft 4 for fixing the testing pin 2 in relation to the perforated plate 1 . in this case , the perforated plate 1 is preferably implemented as at least partially magnetic , so that an attractive force acts between the magnet 6 and the perforated plate 1 , as indicated by the arrows . in a simple exemplary embodiment , the rotation of the shaft 4 is performed by a wrench ( not shown in greater detail ), which can be applied to an adjustment auxiliary square 7 . if a different location of the testing tip 5 in relation to the printed circuit board 3 is therefore desired , the testing pin 2 can thus be rotated around its axis a by the wrench and the testing tip 5 can be moved in a circle . simultaneously or additionally , it is also considered that either the perforated plate 1 and / or the printed circuit board 3 is moved two - dimensionally in the horizontal , so that the testing tip 5 can thus approach every point on the printed circuit board 3 . such a movement mechanism for the printed circuit board 3 is disclosed , for example , in de 10 2012 106 291 . 9 . in the exemplary embodiment of a device according to the invention for testing a workpiece according to fig2 , a fixing plate 8 is additionally associated with the perforated plate 1 , wherein a spacing a between perforated plate 1 and fixing plate 8 is variable . this fixing plate 8 has the task , inter alia , of fixing the individual testing pins 2 in relation to the perforated plate 1 after they are adjusted , i . e ., it essentially assists the magnet 6 so that the testing pins 2 are not lifted off the perforated plate 1 during the lowering toward the printed circuit board 3 and the location of the testing pins 2 is unintentionally changed . in the exemplary embodiment of a device according to the invention for testing workpieces according to fig3 , a semi - magnetic plate is used instead of a perforated plate as the holder 1 . 1 . this means that the fundamental position of the testing pins 2 . 1 is not dependent on the hole grid of a perforated plate in this case , but rather the testing pin 2 . 1 can be moved freely along a lower side 9 of the holder 1 . 1 . a rotation of the testing pin 2 . 1 around its axis a is caused by a drive magnet 10 , which is associated with the holder 1 . 1 beyond the testing pin 2 . 1 . this drive magnet 10 can be moved along the holder 1 . 1 in any arbitrary direction , but also rotated , so that the magnet 6 follows it and an alignment of the testing pin 2 . 1 in relation to a printed circuit board ( not shown ) can be performed . a magnetically conductive fixing plate 8 . 1 , using which the entire arrangement can be fixed , is also provided above the drive magnet 10 . the embodiment of a device according to the invention for testing a workpiece according to fig4 differs from that according to fig3 only by way of the arrangement of an additional tool 11 , using which a further activity can be performed . for example , this can be a spring - loaded holddown in this case , which presses on the workpiece , or also a camera , which observes the testing tip 5 . in a further exemplary embodiment of a device according to the invention for testing a workpiece 3 according to fig5 , the testing pin 2 . 2 is located on a carriage 11 , which can be moved arbitrarily . reference is again made to de 10 2012 106 291 . 9 here only as an example . the movement of the carriage 11 or the location of the testing pin 2 . 2 in relation to the printed circuit board 3 can be observed and monitored by a separate camera 12 and / or also by a camera 13 associated with the carriage 11 . it is indicated in fig6 that the activity of the testing pin 2 is observed by two inclined cameras 12 . 1 and 12 . 2 . however , the exemplary embodiment according to fig7 is also particularly in the scope of the invention , according to which the testing pin 2 or a testing tip 5 directly penetrates the objective 14 of a camera , so that this objective 14 is aligned directly on a point of incidence 15 of the testing tip 5 on the printed circuit board 3 . a special embodiment of the present invention is shown in fig8 to 13 . it relates in this case to the possibility of moving a testing pin 2 by means of electroactive polymers 16 , which act as actuators for the testing pin 2 . fig9 to 13 show a further possibility for moving the testing pins 2 , which is caused by so - called intrinsically active polymers . they move similarly to muscles . above all electroactive polymers ( eap ) are preferred for the present inventive idea , since the polymer can be influenced directly and in a targeted manner by means of an electrical field variable . according to fig9 , a corresponding testing pin 2 is guided in a perforated plate 1 . eap actuators , which engage on the testing pin 2 , are located on or above the perforated plate 1 . this is schematically shown above all in fig1 and 11 . the corresponding eap actuator encloses the testing pin 2 , wherein an electrical field variable is applied on four sides to the eap actuator 16 itself according to fig1 . for example , this causes a middle region of the eap actuator to bulge and to lift up the testing pin 2 at the same time , as shown in fig1 . a rotation of the testing pin 2 can also be caused by appropriate application of the electrical field variable to the eap actuator . fig1 and 13 show how a corresponding testing pin 2 is integrated in a housing 17 , wherein the testing pin 2 is enclosed by an eap actuator 16 in the upper region or inside the housing 17 . in this case , a plurality of testing pins 2 protrude out of the housing 17 . these contact needles or testing pins 2 are collected by a polymer reactor 16 , which is embedded in the housing 17 . this hydrogel - based actuator has the task of adjusting the contact needles freely in the x - y plane with maximum positioning distances of +/− 500 μm starting from the normal position with a positioning precision of approximately 25 μm . this complicated multiaxial positioning may be implemented with a flexible solid - state reactor , which deforms in an analogous way upon appropriate activation so that it can approach any arbitrary point in the positioning plane via the contact needles . this requires finding a suitable constructive design and dimensioning . the achievable positioning precision is additionally determined by the performance of the actuator control electrodes . the resistive control electrodes are segmented and implement a control of the temperature field , which is electronically rotatable around 360 °. essential examination criteria are the required number of electrodes to be able to position the contact needles sufficiently precisely , the required heating power , the curve of the heating field , the heat coupling , and the heat management for stabilizing the controlling temperature field . the contact needle positioning drive is only responsible for the actual positioning procedure . if the contact needles have reached their end position , a locking mechanism is activated , which fixes the needles in their position . it is to be ensured during the needle positioning that the head has a uniform , defined temperature in the region of the positioning drives , to ensure the independence of the positioning procedures from possible variations of the ambient temperature . the active temperature management may be implemented , for example , by peltier elements or active water cooling . the drive housing not only ensures the mechanical protection of the positioning drive , but rather also carries its mechanical and electrical interfaces . the head must additionally have adjustment capabilities , to be able to adjust or pre - position it optimally . in the ideal case , a global adjustment may be implemented for the positioning drives , alternatively , concepts of individual adjustment are studied . | 6 |
with reference now to the drawings , fig1 shows a typical arrangement in which the bag 10 of this invention can be used . the bag 10 is contained in a paperboard box 12 and supplies liquid , such as soft drink syrup , to a post - mix dispenser 14 through a line 16 via a pump 18 . as the liquid is withdrawn , the bag 10 collapses . it is desirable to be able to put the bag in any orientation ( such as with the spout 24 at the top as shown in fig1 ) and still have all of the liquid dispensed from the bag leaving little or no liquid remnant . the reinforcing strip 26 of the present invention provides this advantage . fig2 - 4 show the collapsible bag 10 according to one embodiment of the present invention including a pair of liquid - tight , flexible bag walls 20 and 22 , joined at their peripheries , a spout 24 connected to one bag wall 20 and having a spout opening 30 therethrough in liquid communication with the inside 25 of the bag 10 , and an elongated reinforcing strip 26 attached to the outside surface of the bag wall 20 and extending from adjacent to the spout 24 to remote therefrom . the strip 26 , and the portion of the bag wall to which the strip is sealed , include a plurality of straight , elongated , grooves 27 . these grooves form liquid passageways 28 inside of the bag 10 . the passageways 28 have a depth and a width such that as the bag wall collapse during dispensing of liquid from the bag , the bag wall cannot collapses into and block the liquid flow through the passageways 28 , such that these passageways remain open and permit and achieve complete withdrawal of the liquid from the bag as the bag collapses . fig3 and 6 show a spout 24 having a spout opening 30 therethrough , a spout flange 32 sealed to the bag wall 20 , and a spout extension 34 extending into the bag a sufficient distance to provide an open channel 40 between the passageways 28 and the spout opening 30 even as the bag wall 22 collapses against the spout extension 34 . the extension 34 preferably includes a plurality of radial ribs 38 to hold the bag wall 22 out of the opening 30 . the extension 34 also includes an opening 36 which is part of the open channel 40 . fig3 also shows the proximal end 29 of the reinforcing strip 26 located adjacent to the spout flange 32 . fig4 is a cross - sectional view through the strip 26 showing the grooves 27 and the liquid passageways 28 defined by the grooves 27 . fig4 shows the bag 10 after it is formed and ready for shipment and also as it looks after the liquid has been dispensed and the bag wall 22 has collapsed against the bag wall 20 leaving the open passageways 28 for allowing any remaining liquid in the bag 10 a passageway out of the collapsed bag . fig7 and 8 show a spout 42 according to another embodiment of this invention . this spout is similar to the spout 30 except for a different spout extension 44 comprising a plurality of flat , straight , parallel , spaced - apart , plates 46 that serve the same purpose as does the spout extension 34 described above . fig9 - 11 show a bag 60 according to a preferred embodiment of the present invention . the bag 60 includes a pair of bag walls 62 and 64 , a spout 66 having a spout opening 68 therethrough and a flange 70 sealed to the bag wall 62 . in this embodiment , the reinforcing strip 72 is sealed to the bag wall 64 , that is , the bag wall opposite to the wall 62 to which the spout 66 is attached . the strip 72 includes grooves 74 formed therein and in the attached portion of the bag wall 64 to provide the liquid passageways 76 . the strip 72 is located as shown in fig9 - 11 from underneath the spout 66 to remote from the spout . because it is possible for the two bag walls to twist slightly , in which case the passageways 76 might not remain directly under the spout 66 , it is preferred to seal the two bag walls 62 and 64 together adjacent to the spout such as along a seal line 78 , to prevent such shifting . this additional seal line 78 will assure that the passageways 76 will be in liquid communication with the spout opening 68 at all times . fig1 illustrates the method of making the bag 60 according to the present invention . fig1 shows a manufacturing system 80 including a pair of rolls 82 and 83 supplying layers 84 and 85 of material to make bag wall 20 , a pair of rolls 86 and 87 supplying layers 88 and 89 of material to make bag wall 22 , a bag hole cutter 90 , a spout sealer 92 , a valve inserter 94 , a side sealer 96 for sealing the side edges of the bag 60 , an end sealer 98 for sealing the end edges of the bag 60 , a perforator 100 for providing perforations between each bag 60 in the continuous web 102 of bags , a roll 104 of reinforcing strip material 106 , a cutter 108 , a pair of heated rolls 110 to tack the strip 72 to bag wall 64 , a pair of plates 112 to seal the strip 72 to the bag wall 64 and to preheat the material prior to forming the grooves , and a pair of water cooled , pressure forming plates 114 , for forming the grooves 74 . a bag valve ( that is inserted into the spout by the valve inserter 94 is well - known and forms no part of this invention ). it usually snaps into the spout and closes the spout opening until a disconnect attached to line 16 is connected to the valve . the reinforcing strip of this invention is preferably made of lldpe having a thickness of 10 mil . however , other thickness and other materials can be used . it is preferably heat sealed to the wall but it could be sealed in other ways . the temperature of the groove forming plates preferably between about 300 °- 450 ° f . and they close for 1 - 3 seconds . however , other temperatures and times can be used , as well as other methods of forming the grooves . the bag walls and the reinforcing are preferably plastic . the flexible wall layers may comprise any desired number of layers , although two are preferred . layers 85 and 89 are preferably a web of 2 mil . eva disposed adjacent to the layers 84 and 88 which are preferably a bonded web made up of the following three sheets : 2 mil . eva , 1 / 2 mil . metalized pet , and a 2 mil . eva . the reinforcing strip is preferably 10 mil . lldpe . the size and shape of the passageways is such as to prevent the bag wall from collapsing thereinto and closing off the passageway . the dimensions depend , for example , on the stiffness of the bag wall . for example , the passageways can have a width of about 2 . 5 millimeters and a depth of about 4 . 5 mm . while the preferred embodiment of this invention has been described above in detail , it is to be understood that variations and modifications can be made therein without departing from the spirit and scope of the present invention . for example , while only one reinforcing strip has been shown , two or more can be used , if desired . other shapes , widths and lengths of the strip can be used . other shapes and numbers of grooves ( and passageways ) can be used . other materials can be used . other numbers of bag wall layers ( such as 1 , 3 etc .) can be used . other ways of forming the grooves and sealing the strip to the wall can be used . the strip can have the grooves therein prior to sealing it to the bag wall . the method can use a continuously moving strip , rather than an intermittently moving strip . other shapes of sealing lines 78 can be used . the bag is preferably formed by joining two separate rectangular bag walls together , however , other numbers of bag walls can be joined together to form the bag . the spout is preferably connected to a bag wall before the walls are joined to form the bag , however , the spout can be attached after the bag is formed , if desired . | 1 |
fig2 , fig5 and fig6 show in each case a detail of a plan view of a circumferential groove 10 , in which rotor blades 12 a , 12 b of an axial compressor of a gas turbine are inserted . instead of the compressor , the invention could also be applied in a steam turbine or in a turbine unit of the gas turbine . the endlessly encompassing circumferential groove 10 is provided on an external surface 11 of the rotor of the compressor . the circumferential groove 10 could also be provided on an annular inner casing of the compressor , in which stator blades are fastened . the circumferential groove 10 , as seen in the axial direction of the rotor , has a front side wall 16 and a rear side wall 18 upon which projections 20 , 22 , which extend in the circumferential direction and extend in the axial direction , are arranged in each case and respectively form a front and a rear undercut 24 , 26 ( fig1 , fig3 and fig4 ). rotor blades 12 a , 12 b , which have inverted t - shaped blade roots which are constructed to correspond to the undercuts 24 , 26 , are inserted in the circumferential groove 10 . for installation , the rotor blades 12 a , 12 b are inserted into the circumferential groove 10 and then rotated enough , for example by 45 ° or 60 °, until the inverted t - shaped blade roots fit behind the projections 20 , 22 . the gap , which remains between the first rotor blade 12 a and the last rotor blade 12 b , of the circumferential groove which is otherwise completely fitted with blades 12 of a blade ring and , if applicable , intermediate pieces which are arranged between them , has to be closed by means of a special device , which is referred to as locking sub - assembly 33 , blade lock or even rotor lock . the first development of the invention , which is shown in fig1 and fig2 , is essentially characterized in that the locking sub - assembly only comprises a front side piece 30 and a rear side piece 32 , wherein only the front side piece 30 is interlocked with the projection 20 of the circumferential groove 10 . the front side piece 30 , as seen in cross section , is c - shaped in form ( fig1 ), and has an outer arm 50 and an inner arm 52 which are interconnected via a bridge 54 which extends in the radial direction . the inner arm 52 engages in the undercut 24 which is formed by the projection 20 . subsequently , the arm 52 abuts against the projection 20 and prevents falling out from the circumferential groove 10 . the rear side piece 32 closes the opening of the gap 28 after the front side piece 30 has been inserted into the gap 28 of the circumferential groove 10 . the first development of the invention is especially characterized in that the rear side piece 32 , as seen in cross section , is simply l - shaped and not c - shaped like the front side piece 30 . the rear side piece 32 does not engage in the undercut 26 and is not interlocked with the projection 22 . the front side piece 30 , as shown in fig2 , is interlocked with the rear side piece 32 in a positive locking manner via a dovetail guide 46 . the dovetail guide 46 comprises two elements , these being a recess with undercuts , and an extension which is formed correspondingly to it and which can fit behind the undercuts of the recess . one each of the elements is provided on one of the pieces which is interlockable with the dovetail guide . both the recess with the undercuts and the extension , as seen in cross section , that is to say perpendicular to the guide direction , have in this case a contour in the form of a dovetail . the dovetail guide 46 of the locking sub - assembly 33 is oriented so that during the radial inserting of the rear side piece 32 into the circumferential groove 10 this is interlocked with the front side piece 30 which is already inserted . the dovetail guide 46 prevents a possible gap formation between the two side pieces 30 , 32 . the front side piece 30 and the rear side piece 32 abut in a contact plane 48 . a hole 62 which has a female thread 61 , in which the locking element 36 , which is formed as a locking screw 64 , is screwed , is provided in the contact plane 48 . the female thread 61 is arranged in halves in the front side piece 30 and in the rear side piece 32 . in halves means that one half of each thread flight of the female thread 61 is formed on the front side piece 30 , and the other half of each thread flight is formed on the rear side piece 32 . by the screwing - in of a locking screw 64 , which for example is formed as a grub screw , into the female thread 61 , the two side pieces 30 , 32 are interconnected in a way in which they can be released again . the grub screw can be tensioned in the tapering female thread 61 , forming a particularly tight frictional lock . by means of the axial gap formation between the two pieces 30 , 32 , which is prevented by the dovetail guide 46 , the locking screw 64 is reliably screwed into the female thread 61 , although this is formed by two separate pieces 30 , 32 . the assembled locking sub - assembly 33 is retained as a whole in the circumferential groove 10 via the interlocking of the front side piece 30 with the projection 20 and therefore is secured against disengaging from the circumferential groove 10 . the rear side piece 32 is securely retained in the circumferential groove , despite a faulty interlocking with the projection 22 , since the centrifugal forces which act upon the rear side piece 32 are transmitted by means of the locking screw 64 onto the front side piece 30 , so that the rear side piece 32 is indirectly also supported by the projection 20 which serves as an abutment for the interlocked inner arm 52 . although the centrifugal forces which act upon the locking screw 64 and upon the two side pieces 30 , 32 prevent a self - acting loosening of the locking screw 64 , this can additionally be secured once more against unscrewing by means of peening , as a result of which a locking sub - assembly 33 , which is particularly secured against disengaging from the circumferential groove 10 , is disclosed . fig3 shows a second development of the invention , in which the locking sub - assembly comprises three pieces 130 , 131 , 132 which are inserted into the gap 28 . the two lateral side pieces 130 , 131 , which are c - shaped in cross section , are individually inserted one after the other into the circumferential groove 10 and axially displaced so that their inner arms 52 are interlocked in each case with the projections 20 or 22 by each arm 52 engaging in each case in one of the undercuts 24 , 26 . after that , the gap which remains between these two side pieces 130 , 131 is filled by the inserting of an intermediate piece 132 , which secures the two side pieces 130 , 131 against axial displacement and prevents loosening of the interlock . the intermediate piece 132 has a width b , extending in the axial direction , which corresponds at least to the dimension a by which the projection 20 or 22 penetrates into the circumferential groove 10 in the axial direction . the pieces 130 and 132 abut in a contact plane 148 , and the pieces 131 and 132 abut in a contact plane 149 . a hole 162 extends obliquely through the contact planes 148 and 149 . in order to interconnect the pieces 130 , 131 , and 132 in a non - positive locking manner , a pin - like locking element 136 is provided , which can be inserted into the hole 162 . the hole 162 extends along an axis 140 which obliquely penetrates the contact faces 148 , 149 and penetrates the three pieces 130 , 132 , 131 in alignment . a female thread 161 is provided inside the hole 162 , into which the locking element 136 , which is formed as a locking screw 164 , can be screwed . consequently , the three pieces 130 , 131 , 132 , which have in each case a threaded section , are releasably interconnected , as a result of which the intermediate piece 132 and also the locking sub - assembly 133 as a whole are secured against disengaging from the circumferential groove . it is even possible that only the intermediate piece 132 features the female thread 161 and that the locking screw 164 is supported on the groove base of the circumferential groove 10 in order to secure the locking sub - assembly 133 as a whole . furthermore , instead of a support on the groove base of the circumferential groove , a locking screw 164 , which is provided with a screw head , can clamp the side pieces 130 , 132 together in a non - positively locking manner . likewise , the pieces 130 , 131 , 132 of the locking sub - assembly 133 can be interlocked by a dovetail guide according to the first development . alternatively to the development which is shown in fig3 , the three pieces 130 , 132 , 131 could also be secured by means of two locking elements which are axially offset to each other . for this case , the locking element 136 would only interconnect the side piece 131 with the intermediate piece 132 in a non - positively locking manner , and a further locking element , which is not shown and also extends obliquely , would only interconnect the two pieces 130 and 132 in a non - positively locking manner . in addition , in the second development a dovetail guide can also interconnect the pieces 130 , 132 , and 131 , 132 . fig4 shows a third development of the invention in a cross - sectional representation , and fig5 shows this third development in a plan view . the side pieces 230 , 231 , which can be inserted one after the other into the circumferential groove 10 , are interlocked in each case with one of the projections 20 or 22 . the two side pieces 230 , 231 are essentially c - shaped in form , as seen in cross section , and have in each case an outer arm 250 , which partially closes the gap 28 partially on the outside , and an inner arm 252 , which is interlocked with the projections 20 , 22 . the inner arms 250 are interconnected with the outer arms 252 in each case by means of a bridge 254 . an intermediate piece 232 is provided between the two side pieces 230 , 231 , which secures the two side pieces 230 , 231 against axial displacement and therefore against loosening of the interlock . the intermediate piece 232 has a width b , extending in the axial direction , which corresponds at least to the dimension a by which each projection 20 or 22 penetrates into the circumferential groove 10 in the axial direction . if this condition is not fulfilled , then the side piece 130 or 131 , which is to be inserted into the groove as the second side piece , cannot be inserted . fig5 shows the plan view of the third development of the invention according to fig4 . the intermediate piece 232 abuts against the front side piece 230 in a contact face 248 , and is interlocked with this via a first dovetail guide 246 . for this purpose , a dovetail - shaped extension is formed on the intermediate piece 232 , and the corresponding recess which is associated with it is formed on the front side piece 230 . in a similar manner , the rear side piece 231 is interlocked with the intermediate piece 232 , wherein these abut in a contact face 249 . in the case of the second dovetail guide 247 , or dovetail toothing , the dovetail - shaped extension is provided on the rear side piece 231 , and the recess which is formed correspondingly to it is provided on the intermediate piece 232 . in this case , the second dovetail guide 247 , as seen in the circumferential direction , can be constructed narrower than the first dovetail guide 246 in order to enable an axial sliding of the narrower dovetail - shaped extension in the larger recess during installation of the side piece 231 or 230 which is inserted as the second side piece , and in this way to achieve a maximization of the centrifugal force - stressed cross sections of the bridges 254 . in a similar way to the first development according to fig1 and fig2 , a pin - like locking element 236 , which is formed as a locking screw 264 , is provided in each case in the contact faces 248 , 249 . at least one hole 262 is provided in each contact plane 248 , 249 for accommodating the locking element 236 . each hole 262 is provided with a female thread 263 which are arranged in each case in halves in two pieces 230 , 231 , and 231 , 232 . the pin - like locking element 236 , which is formed as a locking screw 264 , can be screwed in each case into this female thread 263 for the non - positive and / or positive connecting of the pieces 230 , 231 , 232 of the locking sub - assembly 233 . although each female thread 263 is arranged in each case in halves in two pieces 230 , 232 , and 231 , 232 , a threaded connection which is reliable and secured against loosening is possible , since by means of the respective dovetail guide 246 , 247 the two pieces 230 , 232 , or 231 , 232 which form each female thread 263 cannot be axially moved apart . fig6 shows the plan view of a variant of the third development . in this case , the dovetail guide 247 is formed between the pieces 232 and 231 the other way round in relation to fig5 . the two dovetail - shaped extensions are arranged on the intermediate piece 232 , and each side piece 230 , 231 has a recess in the corresponding contact faces 248 , 249 for accommodating the respective extension . if in the exceptional case the blades 12 of the blade ring wander so that a gap occurs between the locking sub - assembly 33 , 133 , 233 and a directly adjacent blade 12 a or 12 b , the locking sub - assembly as a whole could possibly disengage from the circumferential groove 10 by rotating . this can be prevented by the bridges 54 , 254 of each side piece 30 , 32 , 130 , 131 , 230 , 231 abutting against the side walls 58 of the projections 20 , 22 like a flange , as fig4 exemplarily shows it . instead of a locking screw 64 , 164 , 264 , a pin - like bolt , which is secured against loosening by means of a press fit , could also be inserted into the hole 62 , 162 , 262 . for removing the locking sub - assembly , this bolt would have to be simply drilled out . furthermore , a locking screw 64 , 164 , 264 , which is provided with a screw head , could be screwed into each locking sub - assembly 33 , wherein the screw head , which is recessed in one or more of the pieces 30 , 32 , 130 , 131 , 132 , 230 , 231 , 232 , abuts against this with pretensioning in a non - positively locking manner . in all , by the locking sub - assembly a device for closing the remaining gap between the first and the last blades of a blade ring which are inserted in a circumferential groove , can be disclosed , which can be easily installed and disassembled . since the installation of the locking sub - assembly does not necessitate plastic deformation of the components , but proposes the non - positive locking connection of the components , these can be loosened and disassembled by means of working steps carried out in reverse . all the components of the locking sub - assembly can be used again . moreover , the simple type of construction enables a relatively favorable manufacturing cost . | 5 |
with reference to fig1 a - c , a key blank 10 is comprised of a key head or key bow 101 , a key blade portion 103 extending from the key bow 101 as is conventional , and a key stop 102 . the key stop 102 limits the insertion of a key into a lock cylinder plug . the key blade 103 is divided vertically into two areas , the top area is a skewed cut bitting area 104 and the bottom area is a slider contact rib area 105 . variations in the key blank 10 are achieved in part by the length of a slider contact rib 106 . these variations are measured longitudinally from the key stop 102 to a fore end 107 of the slider contact rib 106 . on the key blank 10 , as illustrated in fig1 a - c , the fore end 107 of the slider contact rib 106 is positioned at predetermined location 1 . [ 0054 ] fig2 a - c show a similarly configured key blank 20 with a key stop 202 and a fore end 207 of a slider contact rib 206 which is positioned at predetermined location 2 . with reference to fig3 a - c , a key blank 30 similar to the key blanks described above has a key stop 302 and a slider contact rib 306 with a fore end 307 positioned at predetermined location 3 . [ 0056 ] fig4 a - c show a key blank 40 having a key stop 402 and a slider contact rib 406 . the slider contact rib 406 has two separate fore end portions : an inner part 407 and an outer part 408 . as can be seen , the inner part 407 of the fore end is positioned at predetermined location 1 while the outer part 408 of the fore end is positioned at predetermined location 6 . with regard to fig5 a key blank 50 is of similar configuration having a key stop 502 and a slider contact rib 506 with an inner part 507 of a fore end positioned at predetermined location 2 and an outer part 508 of the fore end positioned at predetermined location 6 . similarly , the key blank 60 illustrated in fig6 has a key stop 602 . a fore end of a slider contact rib 606 has two portions : an inner part 607 and an outer part 608 . the inner part 607 of the fore end is positioned at predetermined location 3 and the outer part 608 of the fore end is positioned at predetermined location 6 . with reference to figs . 14 a - c , a key blank 4000 has a key stop 4002 and a slider contact rib 4006 . the slider contact rib 4006 has two contact end portions 4007 and 4008 . the contact end portion 4007 is at a predetermined position 1 and the contact end portion 4008 is at a predetermined position 3 . a medeco biaxial ® lock can be modified to utilize the slider contact rib on a key blank of the present invention . fig1 a illustrates the medeco biaxial ® key incorporating the slider contact rib on the side of the key . referring to fig1 a - c , a key 5000 has a stop 5002 and a slider contact rib 5007 . an original medeco cylinder lock can also be modified to utilize the slider contact rib on a key blank of the present invention . fig1 a illustrates the original cylinder medeco key incorporating the slider contact rib on the side of the key . referring to fig1 a - c , a key 6000 has a stop 6002 and a slider contact rib 6007 . with regard to fig7 and 8 , a slider 70 has at least one projection 707 on its top surface that must be precisely positioned before the lock cylinder can open , as explained in the above - referenced application . on the bottom edge of the slider 70 is a key contact rib 708 that contains contact areas that mate with a slider contact rib on a key . on the slider 70 , contact area 713 is configured to a predetermined location 3 so that the contact area 713 mates with a fore end of the slider contact rib on the key . the other contact area 721 is configured to a predetermined location 1 and has a contact surface to mate with a fore end of the slider contact rib on the key . [ 0063 ] fig9 shows another embodiment of a slider 71 which has a slider body 709 and a key contact rib 708 ′ that contains contact areas 712 , 721 . the contact areas 712 , 721 mate with a slider contact rib on a key , and are configured to two predetermined locations . the contact area 712 closest to the slider body 709 is configured to predetermined location 2 for mating with a fore end of the slider contact rib on the key . the contact area 721 farthest from the slider body 709 is configured to predetermined location 1 for mating with a fore end of the slider contact rib on the key . with regard to fig1 , a further slider configuration is shown . a slider 72 contains contact areas 711 , 721 that mate with a slider contact rib on a key . similarly , the contact areas 711 , 721 are configured to two predetermined locations . the contact area 711 closest to the slider body 709 is configured to predetermined location 1 for mating with the fore end of the slider contact rib on the key . the contact area 721 furthest away from the slider body 709 is also configured to predetermined location 1 for mating with a fore end of the slider contact rib on the key . the operation of the key for locking / unlocking a cylinder lock or locks with rotating reciprocating ( twisting ) tumblers will now be described with reference to fig1 - 13 . as illustrated in fig1 a - c , a lock cylinder plug 90 contains tumbler pin holes 91 to house medeco - type chisel pointed rotatable tumbler pins ( not shown ). contained within the lock cylinder plug 90 is a sidebar 80 with sidebar legs 81 as is known in the art of medeco locks . the sidebar 80 has at least one notch 82 to receive the corresponding projection 707 on the slider 70 ( fig7 - 10 ) when the key correctly positions the slider 70 . the slider 70 fits into a cavity 93 in the lock cylinder plug 90 and is biased by a spring ( not shown ) towards a face 92 of the lock cylinder plug 90 . when the key 30 , illustrated in fig3 a - c , for example , is inserted into the lock cylinder plug 90 , the contact area 713 on the slider 70 mates with the fore end 307 on the key to correctly position the slider 70 within the lock cylinder plug 90 . as illustrated in fig1 a - c , the lock cylinder plug 90 containing slider 70 can also be operated , for example , with the key 40 , as illustrated in fig4 a - c . the slider contact rib 406 on the key 40 is provided with the inner part 407 of the fore end and the outer part 408 of the fore end . the inner part 407 of the fore end is positioned at predetermined location 1 and the outer part 408 of the fore end is positioned at predetermined location 6 . the inner part 407 of the fore end mates with the contact area 721 on the slider 70 and positions the slider 70 in a correct operating location . the outer part 408 of the fore end is sufficiently clear of the contact area 713 on the slider 70 and does not mate with the contact area 713 . as illustrated in fig1 a - c , the lock cylinder plug 90 containing slider 70 cannot be operated , for example , with the key 20 ( fig2 a - c ). the fore end 207 of the slider contact rib 206 is positioned at predetermined location 2 . when the key 20 is inserted into the lock cylinder plug 90 , the key contact rib 713 on the slider 70 mates with the fore end 207 of the slider contact rib 206 . the slider 70 moves so far away from the face 92 of the lock cylinder plug 90 that the projection 707 will not fit within the notch 82 on the sidebar 80 . when a key with the unique slider contact rib as disclosed herein is inserted into a lock cylinder plug containing the unique slider described in the aforementioned application , the first contact surface on the slider contact rib to mate with the key contact surface on the slider will position the slider in the lock cylinder plug . however , if the key 4000 ( fig1 a - c ), for example , is used in a lock cylinder containing the slider 70 , both surfaces 4007 , 4008 will mate with contact areas 712 , 721 simultaneously , and thus , both surfaces 4007 , 4008 will position the slider 70 . by positioning the slider contact rib on the key blank to six predetermined locations and dividing the slider contact rib into two horizontal contact surfaces , it is possible to configure 21 ( twenty one ) different key blanks to fit into one keyway of a cylinder lock . a key blank could be configured into any one of the following 21 possibilities by identifying the inner part or innermost horizontal contact surface as 1 a , 2 a , 3 a , 4 a , 5 a and 6 a , and the outer part or outermost horizontal contact surface as 1 b , 2 b , 3 b , 4 b , 5 b and 6 b : similarly , sliders of cylinder locks can be configured into the same 21 different arrangements . a lock containing a 3 b - 1 a slider can be operated by keys with the following configurations : with the above key blank and slider configurations , and the existing medeco master keying techniques , a much larger and more complex master keying system can be provided than that previously known and available . although the present invention has been described with reference to the particular embodiments disclosed , it is understood that these embodiments are merely illustrative of the application and principles of the invention . numerous other configurations can be made and other arrangements can be devised without departing from the spirit and scope of the invention as defined in the appended claims . | 8 |
fig1 is a block diagram of the pulse induction metal detector of the present invention . astable pulse generator 10 generates a train of pulses of 60 microseconds duration which occur at intervals of 1 . 65 msec . this corresponds to a transmit frequency of approximately 600 pulses per second . the pulses from astable generator 10 are amplified by a power amplifier 12 which drives a search coil 14 . a suitable resistance ( not shown ) is placed in parallel with search coil 14 . the resulting transmit and reflected pulses which occur across the search coil 14 are amplified by a high gain amplifier 16 . the resulting signals at the output of high gain amplifier 16 are sampled by electronic switches 18 and 20 . the pulses from astable generator 10 are processed by a time delay circuit 22 to provide three sample pulses . the sample pulse on line 5a has a duration of 30 microseconds and occurs 20 microseconds after the leading edge of the reflected portion of the waveform as measured at the output of high gain amplifier 16 . the sample pulse on line 5b has a duration of 30 microseconds and occurs 150 microseconds after the sample pulse on line 5a . an audio chopper pulse on line 5c has a duration of 150 microseconds . the audio chopper pulse provides the switching signal for generating the audio tone . a variable scale factor circuit 24 is user adjustable to increase the delay of pulses on lines 5a , 5b and 5c by up to 100 microseconds for the purposes of eliminating the response to certain lower conductivity targets . the reflected portion of the signal from the high gain amplifier 16 is sampled by electronic switches 18 and 20 . switch 18 is connected to the inverting input of a differential integrator 26 . switch 20 is connected to the non - inverting input of the differential integrator 26 . the purpose of the differential integrator 26 is to cancel the effects of any residual dc voltage or sinusoidal waveform so as to improve stability and reduce noise . the sampled pulses from switches 18 and 20 are converted to a dc reference voltage by the differential integrator 26 which has an integration time constant of about 100 msec which aids in locating non - ferrous metals and permits a faster sweep . the varying dc output voltage of the differential integrator 26 is directly proportional to the width of the reflected pulse , which changes in relation to the presence of metal objects within the search coil field . the dc voltage at the output of the differential integrator 26 is connected to an rc coupling circuit 28 . this circuit prevents any static dc voltage at the output of the differential integrator 26 from being amplified by a dc amplifier 30 while passing the changing output of the integrator . an increase in the integrator output results in an increase in the dc level at the input to amplifier 30 , after which this input voltage is reduced to zero by the rc coupling circuit 28 . an offset adjustment 32 sets the minimum reference , or threshold , level for the following audio section . the purpose of the rc coupling circuit 28 is to provide dynamic coupling with a self - adjusting threshold action to improve the ease of use and overall stability of the system . as used herein , the term &# 34 ; rc coupling circuit &# 34 ; refers to a network that includes a dc blocking capacitor and a resistor connected to ground for discharging the capacitor . the time constant of the rc coupling circuit 28 is 100 msec which is equal to the time constant of the differential integrator 26 . the fast response characteristic of the integrator together with rc coupling allows the operator to identify certain types of buried metals . most ferrous objects will produce a broader audio tone . elongated ferrous objects , such as nails , will often produce a double tone . nonferrous objects , such as gold and silver , will produce a much more intense and abrupt audio response . this response would ordinarily be missed by detectors having slower integration time constants , standard dc coupling and long sampling delays . the signal voltage that appears at the output of the dc amplifier 30 is connected to chopper switch 34 and the input of a power amplifier 36 . the chopper switch 34 is controlled by the audio sample pulse on line 5c from time delay network 22 . the audio sample pulse on line 5c is derived from the astable pulse generator 10 by the time delay 22 which results in an audio tone of approximately 600 hertz . this is the same as the pulse transmission frequency . when the output of amplifier 30 increases , the resulting dc voltage is converted to an ac signal by the chopper switch 34 . this ac signal is amplified by a power amplifier 36 to drive an indicator device 38 , which may be either a speaker or headphone . a light emitting diode , lamp or other visual indication device ( not shown ) may also be connected across the audio output indicator 38 . the intensity and duration of the resulting audio tone is directly proportional to the size and distance of the metal object being detected in relation to the search coil . in the power supply a battery 40 supplies power to positive voltage rail 42 and to power supply voltage converter 44 . power supply voltage converter 44 produces the negative voltage rail 46 required by the circuit components . the voltage converter 44 operates at a higher frequency than the astable generator 10 , however , it is synchronous with astable generator 10 , time delay 22 and audio chopper 34 to reduce or eliminate internally generated noise . the converter frequency is thus integrally related to the frequency of the aforementioned components . if desired , the converter frequency may be the same as that of these other components . referring now to fig2 and 4 , waveform a shows the transmit signal as viewed across the search coil 14 and its damping resistor ( not shown ). the positive portion of waveform a represents the transmit current pulse supplied by the power amplifier 12 . in the preferred embodiment , this pulse typically has an amplitude of ten volts and a duration of 60 microseconds . the negative portion of waveform a represents the reflected pulse induced by the collapse of the current pulse from the transmitter . in the preferred embodiment , the amplitude of the reflected pulse is between 100 and 130 volts and the transmit pulses are repeated at intervals of approximately 1 . 65 msec . waveform b represents the signal present at the output of the high gain amplifier 16 . the signal at the input of the high gain amplifier 16 is limited by clamping diodes to less than one volt peak to peak . the voltage gain of high gain amplifier 16 is typically in the order of 60 decibels . the positive portion of waveform b represents the transmitted current pulse and the negative portion represents the corresponding reflected pulse as it decays to zero . in the preferred embodiment , the width of said transmit pulse is 60 microseconds and the width of the reflected pulse is approximately 20 microseconds as measured at the zero reference . waveform c represents a sample pulse on line 5a from the time delay circuit 22 with the variable scale factor 24 adjusted for minimum delay . in the preferred embodiment , this pulse has a duration of 30 microseconds and a delay of 20 microseconds with reference to the leading edge of the reflected pulse b as measured at the output of the high gain amplifier 16 . the short delay time picks up signals caused by metals of lower conductivity such as gold jewelry and the like . waveform d represents a sampling pulse on line 5a with variable scale factor 24 adjusted for maximum pulse delay . in the preferred embodiment , the delay of a sampling pulse with reference to the leading edge of the reflected pulse at the output of the high gain amplifier 16 is adjustable with pulse delays from the variable scale factor 24 in the range of 20 to approximately 100 microseconds to provide selective target rejection of aluminum foil , cupro - nickel , gold , aluminum pull tabs , steel bottle caps and similar non - ferrous material . waveforms e and f represent sample pulses on line 5b from the time delay circuit 22 . they are adjustable like sample pulses c and d , however , in the preferred embodiment , pulses d and f have an additional delay of approximately 150 microseconds with reference to sample pulses c and d . waveform g represents the audio chopper reference signal on line 5c . in the preferred embodiment , pulse g has a duration of 150 microseconds . the position of pulse g relative to the leading edge of the reflected pulse at the output of high gain amplifier 16 will vary with the setting of the pulse delay variable scale factor 24 . pulse g is used to generate the audio output signal and will remain synchronized with sample pulse c or d to reduce noise and improve the stability of the system . referring to fig3 waveform h represents the signal which appears at the output of the differential integrator 26 as a metal object moves into , and remains stationary within , the search coil field . the peak amplitude of this signal occurs when the metal object is in the center of the search coil . waveform i represents the signal which appears at the output of differential integrator 26 as a metal object moves into and out of the search coil field . waveform j represents the signal which appears at the output of the rc coupling circuit 28 as a metal object moves into and remains stationary within the search coil field . the amplitude increases briefly in a positive direction as the metal object nears the search coil . the waveform amplitude then decreases to ground in a ramp function as the resistor in the rc coupling circuit discharges the signal voltage to zero . waveform k represents the signal which appears at the output of rc coupling circuit 28 as a metal object moves into and out of the search coil field . as the target passes the center of the search coil , the signal briefly goes negative before returning to zero . in the preferred embodiment , the time constant of the rc coupling circuit is 100 msec and is substantially equal to the time constant of differential integrator 26 . waveform l represents the output signal of dc amplifier 30 when a metal object enters and remains stationary within the search coil field . the width of the output pulse is proportional to the size of the object being detected and its distance from the search coil . waveform m represents the output signal of dc amplifier 30 when a metal object moves into and out of the search coil field . the signal represented by waveform m is positive when the metal object moves toward the search coil and is negative when the metal object moves away . a dc offset adjust 32 is used to set the zero - signal dc reference level at the output of dc amplifier 30 for the purposes of adjusting the audio threshold level under zero - signal conditions . waveform n represents the output signal from the power amplifier 36 under full signal conditions . in the preferred embodiment , power amplifier 36 operates under class c conditions . electronic chopper switch 34 is connected so as to ground the input of power amplifier 36 whenever audio chopper reference signal g is positive at the control terminal of switch 34 . the action of chopper switch 34 converts the pulse at the input of power amplifier 36 to an audio signal . in the preferred embodiment , the frequency of the audio tone is approximately 600 hertz which corresponds to a transmit pulse repetition rate of approximately 600 pulses per second . both of these frequencies are in any event integrally related to the frequency of the power supply voltage converter so that they are synchronized with the switching signals generated therein . in the preferred embodiment , the output of power amplifier 36 is connected to a waterproof , piezoelectric headphone , although a dynamic speaker , bone conduction device , mechanical vibrator or similar transducer may be used . a visual indication device ( not illustrated ) may also be connected to the output of power amplifier 36 . the power source for the preferred embodiment consists of eight aa sized alkaline dry batteries which provide an expected useful life of 25 to 35 hours . the required differential power supplies are provided by a fixed voltage regulator and a voltage inverter / regulator . in the preferred embodiment , the voltage inverter / regulator operates at a frequency that is higher than , but synchronized with , the astable pulse generator 10 to minimize noise from the power supply . the terms and expressions which have been employed in the foregoing specification are used therein as terms of description and not of limitation , and there is no intention , in the use of such terms and expressions , of excluding equivalents of the features shown and described or portions thereof , it being recognized that the scope of the invention is defined and limited only by the claims which follow . | 6 |
it should be noted that while the present invention is described for use with a surge brake actuator coupler , the present invention may be used with any type trailer coupler and is not limited by the description herein . the present invention provides for a trailer coupler pivot assembly comprising a pivot mount member connected to the trailer and a hinge bracket connected to the coupler wherein the hinge bracket is pivotally connected to the pivot mount member so that the coupler can be pivoted away from the trailer to decrease the overall length of the trailer . with reference now to the drawings , fig1 shows a trailer coupler pivot assembly 10 comprising a hinge bracket 12 pivotally connected to a pivot mount member 14 by pivot pin 16 so as to define pivotal axis zz . for ease of manufacture and construction , both the hinge bracket 12 and the pivot mount member 14 are preferably single members connected to the coupler and trailer respectively . preferably , both the hinge bracket 12 and the pivot mount member 14 are made from cast metal , such as steel , metal powder , or other suitable material . and while it is preferred that axis zz be vertical or substantially vertical so that the coupler swings open through a horizontal plane , other axis angles may be utilized and still perform the desired operation . as best shown in fig6 , hinge bracket 12 comprises a single metal cast member having a pair of confronting welding flanges 21 capable of being welded to coupler 18 . hinge bracket 12 further includes two pairs of mutually opposed bores having a pivot mount receiving portion 22 located therebetween . hinge bracket 12 includes bores 24 that partially define axis zz and bores 26 designed to receive removable locking hinge pin 29 as further described below . pivot mount receiving portion 22 is configured so that pivot mount member 14 may be pivotally connected to hinge bracket 12 and be pivotally received within hinge bracket 12 when the pivot assembly is in a closed position as shown in fig3 . as best shown in fig5 , pivot mount member 14 comprises a single metal cast member having a pair of confronting welding flanges 28 capable of being welded to trailer beam 20 . pivot mount member 14 further includes an aperture 30 therethrough so as to provide access to the interior of trailer beam 20 , where wiring or other components are stored , when pivot mount member 14 is connected to trailer beam 20 . pivot mount member 14 further includes bore 32 for pivotally connecting pivot mount member 14 to hinge bracket 12 and partially defining axis zz and bore 34 capable of receiving hinge pin 29 . pivot mount member 14 is configured to be pivotally received with the pivot mount - receiving portion 22 of hinge bracket 12 when the pivot assembly is in a closed position as shown in fig3 . the pivot mount member 14 and the hinge bracket 12 have relatively little running clearance between the bores and pivot pin 16 . this minimizes the potential for rust bonding of the two components . to prevent this situation from happening , a grease zerk 36 is formed in the center of the pivot mount member 14 on both sides such that the end user can apply grease to the components during storage times , yet while towing or parking , the grease zerks are hidden inside the pivot assembly . the grease zerks are installed on both sides so that the end user can determine which way they want the tongue of the trailer to pivot by interchanging the positions of the pivot fastener and the lock pin . in construction , pivot mount member 14 is connected to the trailer frame ( not shown ) by any suitable means . preferably , pivot mount member 14 is welded to trailer beam 20 . however , other connection means may be utilized to connect pivot mount member 14 to the trailer frame . likewise , hinge bracket 12 is connected to coupler 18 by any suitable means . preferably , hinge bracket 12 is welded to the coupler 18 ( herein the brake actuator coupler cover ). however , other connection means may be utilized to connect the hinge bracket 12 to the coupler 18 . pivot mount member 14 is pivotally connected to hinge bracket 12 by pivot pin 16 which can be a typical threaded bolt . therefore , the coupler 18 can pivot about axis zz from an open position shown in fig1 to a closed position shown in fig3 . when in a closed position , hinge bracket 12 is pivoted about axis zz and receives pivot mount member 14 within pivot mount receiving portion 22 . when pivot mount member 14 is fully nested within pivot mount receiving portion 22 , bores 26 and bore 34 align so that removable hinge pin 29 can be inserted therethrough to maintain the connection and prevent further axial movement . removable hinge pin 29 may also include a self - locking member so that the hinge pin 29 cannot be accidentally removed from the bores 26 and bore 34 . in order to pivot the coupler 18 about axis zz , hinge pin 29 can be removed from hinge bracket bores 26 and pivot mount member bore 34 , thereby permitting the coupler to swing about axis zz to the side of trailer beam 20 . as best shown in fig2 , there is a planned interference between the pivot mount member 14 and the hinge bracket 12 when the coupler assembly is pivoted to the open position . a pre - determined minimum clearance is established between the couple 18 ( or herein the actuator cover ) and the trailer beam 20 . the planned interference , or pivot stop 38 , prevents the accidental breakage of equipment such as clearance lights that may be mounted to the sides of the trailer beam 20 . the prior art shows coupler pivot assemblies where a plate and tube sandwich construction where an upper and lower plate is welded to a trailer beam and two vertical sleeves are welded to the sides of the actuator housing . based on the relative flatness of the two plates , required alignment of both plates to each other and the orientation of the two vertical sleeves in three axes all in relationship to one another , the sandwich design becomes a difficult fabrication process to control . the present invention does not have these inherent fabrication difficulties . each bore of the pivot mount and hinge bracket is established in three axes and relative to themselves through the casting and boring process . this eliminates the need for precision alignment of upper and lower plates and vertical sleeves . to further ease the fabrication process , the hinge bracket and pivot mounts have shapes cast into them that provide self - locating datums to the trailer beam and actuator cover . it is also obvious that this design can allow for differing trailer beam shapes through minor changes to the pivot mount and hinge bracket castings . this allows the trailer manufacturer to crudely place the pivot mount on the trailer beam and weld without the necessary precision as required with prior art . safety chains are also an important safety feature for any trailer . with pivoting tongue trailers , manufacturers typically opt to anchor the safety chains to the trailer beam rather than the pivoting portion of the tongue . as a result , these safety chains can be rather long and may sag to the point that they may drag on the pavement during towing . to alleviate this condition , the present invention also provides for a chain retainer 40 attached to the pivoting coupler 18 . as best shown in fig7 , chain retainer 40 is a u - shaped member connected to the coupler 18 ( herein the brake actuator coupler cover ) and extending below thereof . the chain retainer 40 has a horizontal member of sufficient length to prevent the links of the safety chain ( not shown ) from catching on the edges of the chain retainer . the overall inside height of the chain retainer 40 is set to allow for the possibility of the chains doubling up and thereby permitting the safety chains to slide freely on the chain retainer which is expected during normal towing events such as cornering . trailer manufacturers also typically exit the wiring harness , which routes the electrical signals from the towing vehicle to the trailer , out of the trailer beam prior to the pivot mechanism . this is done largely because most couplers or brake actuator couplers on the market do not have enough room inside them to route the harness therethrough . therefore , this results in very long wiring harnesses that can drag on the pavement during towing or be in the way during storage . the present invention addresses these problems by routing the wiring harness 42 through the interior of the coupler 18 . as best shown in fig1 , the wiring harness 42 extends through the coupler body and exits out the front and rear of the coupler body . with the wiring harness 42 routed through the coupler body , it is now protected from unwanted road abrasion due to dragging and accidental damage during storage . the wiring harness 42 can be attached to the existing wiring harness ( not shown ) provided by the trailer manufacturer which exists the trailer beam . it is presently preferred that the wiring harness 42 , as best shown in fig4 , is attached to the lower slide plate 44 of the surge brake actuator coupler by a series of routing hooks 46 molded to the lower slide plate 44 . the wiring harness 42 is secured to the lower slide plate 44 to limit the position of the wiring harness 42 relative to the internal components of the surge brake actuator coupler and provide strain relief . however , it is also contemplated that the wiring harness can be secured to the interior of a traditional coupler . the invention has been described with reference to the preferred embodiment . obviously , modifications and alternations will occur to others upon a reading and understanding of this specification . the claims as follows are intended to include all modifications and alterations insofar as they come within the scope of the claims or the equivalent thereof . | 1 |
the high - sensitivity image sensor 1 according to the invention is based on the reduction of photo - charge measurement bandwidth , simultaneously for a large number of photo - charge measurements . this is realized by a construction as illustrated in fig2 . a plurality of pixels 2 . 11 , 2 . 21 , . . . is connected to a common signal line 3 . 1 , making use of select switches such as field effect transistors . in the example of fig2 , the common signal line 3 . 1 is a column line ; alternatively , it could be a row line . a plurality of these signal lines 3 . 1 , 3 . 2 , . . . is connected to one or several output circuits 4 . each of the signal lines 3 . 1 , 3 . 2 , . . . , has its own , independent low - pass filter 30 . 1 , 30 . 2 , . . . , and programmable gain amplifier ( pga ) 41 . 1 , 41 . 2 , . . . . the amplifiers 41 . 1 , 41 . 2 , . . . , are all connected to an analog multiplexer 42 . the independent low - pass filters 30 . 1 , 30 . 2 , . . . , provide for the simultaneous reduction of signal bandwidth in all signal lines 3 . 1 , 3 . 2 , . . . , effectively reducing the statistical noise of the photo - charge detection process without impairing the overall pixel readout speed . in a preferred mode of operation , this requires a bandwidth limitation through the low - pass filter 30 . 1 , 30 . 2 , . . . , that corresponds to less than half of the readout time of one signal line 3 . 1 , 3 . 2 , . . . ( column or row ). since cds relies on two measurements of a pixel value , the maximum time that is available for low - pass filtering and reading out the two corresponding pixel signals is the time during which the pixels 2 . 11 , 2 . 21 , . . . , of one row or one column are connected to the signal line 3 . 1 . according to the invention , the obtainable reduction of photo - charge measurement noise is , therefore , given by the square root of the low - pass filter bandwidth . the low - pass filtered signals are processed by electronic circuits 41 . 1 , 41 . 2 , . . . , in each signal line 3 . 1 , 3 . 2 , . . . , that buffer the signals or amplify them with a suitable factor . this factor can be fixed , or it can be programmable . the latter is advantageous when a large dynamic range is desired : when the pixel 2 . 11 , 2 . 21 , . . . , is illuminated with very weak optical signals , a large amplification factor is desirable ; when an intense optical signal arrives , a small amplification factor is more suitable ; the goal is the efficient use of the available voltage swing of the implemented amplifier chain . each pixel 2 . 11 , 2 . 12 , . . . , must be of a type that allows the implementation of a cds technique . this implies that two measurements must be possible within a very short time of typically less than a few microseconds : a first measurement is made right after the reset operation of the photo - charge measurement capacitance ; a second measurement is carried out after the photo - charge packet has been physically moved to the same measurement capacitance . for this reason , preferential pixel types are photo - gate pixels , as described for example by u . s . pat . no . 5 , 841 , 126 ( fossum , “ cmos active pixel sensor type imaging system on a chip ”), pinned photodiodes , as described for example by i . inoue et al ., “ low dark current pinned photodiode for cmos image sensor ”, proc . 1999 ieee workshop on ccd and ais , or dendritic - gate pixels , as described for instance in european patent application no . 04 ′ 405 ′ 1489 . 8 ( b . büttgen et al ., “ large - area pixel for use in an image sensor ”). fig5 illustrates a dendritic - gate pixel 2 for use in the image sensor 1 according to the invention . it is suited for detecting incident radiation over a large area with high sensitivity and low power consumption . a snake - like dendritic gate structure 20 is arranged on top of a thin insulating layer covering a semiconductor substrate . the dendritic gate 20 is electrically connected at two contacts c 1 , c 2 with voltage sources , leading to the flow of a current and a position - dependent potential distribution in the gate 20 and in the semiconductor material underneath . the snake - like structure 20 combines high - resistive and low - resistive gate materials 21 , 22 . the combination of high - resistive material 21 with low - resistive material 22 leads to a controlled uniform potential distribution . due to the use of dendritic structures and various materials 21 , 22 , the pixel 2 can be optimized for a certain application , in particular in terms of the electric field distribution , the rc time constant , the power consumption and the spectral sensitivity . dendritic - gate pixels 2 as shown in fig5 are a preferred implementation of the opto - electronic transformation circuitry . they allow for a complete charge transfer of the photo - generated charge - carrier pairs by utilizing drift - field charge separation and hence enable the implementation of a cds readout scheme . implementation of the first stage in the proposed low - noise read - out scheme for two - dimensional image sensors 1 according to the invention is not limited to the usage of dendritic - gate pixels : any high - sensitivity pixel structure fits into the proposed framework and may be used to the benefit of a very - low - noise image - sensor circuit fabricated in cmos and other semiconductor technologies . each signal line 3 . 1 , 3 . 2 , . . . is connected to one or several output lines 5 . the signal lines 3 . 1 , 3 . 2 , . . . are read out sequentially or in parallel , in the analog or in the digital domain . fig2 illustrates a readout in the analog domain ; electronic switches in the analog multiplexer 42 connect one signal line 3 . 1 , 3 . 2 ., . . . at a time to the output line 5 through its associated buffer - amplifier circuit 41 . 1 , 41 . 2 , . . . . if several output lines 5 and corresponding output buffer amplifier circuits are available , more than one signal line 3 . 1 , 3 . 2 , . . . can be read out at the same time . alternatively , it is possible to convert the signal - line values directly into digital numbers , by employing a plurality of analog - to - digital converters ( adc ). in an extreme but desirable embodiment , shown in fig3 , each signal line 3 . 1 , 3 . 2 , . . . has its own adc 43 . 1 , 43 . 2 , . . . , whose speed matches the bandwidth of the low pass filter 30 . 1 , 30 . 2 , . . . . the analog - to - digital converters 43 . 1 , 43 . 2 , . . . are all connected to a digital multiplexer 44 . traditional implementations of a low - pass filter ( lpf ) that limits the bandwidth on the column line of the image - sensor array consist , e . g ., in adding lumped capacitances to this column line , utilizing the capacitive load of switched - capacitance circuits or employing simple active lpf structures . in modern sensor implementations using advanced deep - submicron technologies , the pixel size shrinks constantly and hence the overhead created by such additional circuitry to simultaneously limit the bandwidth of the data paths grows at the same time . the reason for this is that poly - poly capacitances or metal - insulator - metal ( mim ) capacitances do not increase their surface - dependent capacitance value much . preferred embodiments according to the present invention try to avoid such limitations by more efficiently utilizing the available silicon area . a particularly preferred embodiment of the image sensor 1 according to the invention is sketched in fig4 . in this embodiment , the parasitic capacitance on the column - line data path is deliberately increased by placing a power line 31 . 1 , either the positive or negative supply voltage , in parallel to the signal line 3 . 1 close to each other over a long length . the parasitic capacitance can be further increased if these line pairs 3 . 1 , 31 . 1 are laid out as metal - insulator - metal ( mim ) capacitance devices in the silicon semiconductor process , i . e ., using a very thin oxide between the two parallel signal lines that are stacked on top of each other . in combination with the input impedance of the subsequent amplifier stage the line pairs form the desired low - pass filter circuit . the filtering effect increases linearly with the length of the pixel field , and hence the proposed embodiment according to fig4 is most suitable for large - area - pixel fields with long column lines 3 . 1 , 3 . 2 , . . . . preferably , polysilicon - polysilicon capacitances are used for at least part of the signal line 3 . 1 . according to fig4 , the polysilicon signal line 3 . 1 is connected at both ends and may also be tapped in between , in order to establish the electrical connections to the individual pixels 2 . 11 , 2 . 21 , . . . . this configuration explicitly increases the resistance of the column data line 3 . 1 in order to increase the time constant of the passive rc low - pass filter and thus decrease the dominant pole of the low - pass filter circuit towards lower frequencies . for the preferred embodiment of fig4 , the combination with a column - wise adc , a common adc or another adc topology is an alternate choice which does not interfere with the considerations made before . although column - wise adc structures have the advantage of a low frequency data path which supports the arguments of a better noise performance in such cases , single or only a few output channels can be handled with excellent noise performance . this is because gain has been applied to the signals in the low - bandwidth domain and thus additional bandwidth does not reduce the overall performance of the image - sensing device anymore . nevertheless , careful design has to be applied to the output path if low - noise and high - dynamic - range operation is required simultaneously . this invention is not limited to the preferred embodiments described above , to which variations and improvements may be made , without departing from the scope of protection of the present patent . i bias bias current for source follower transistor t 1 | 7 |
applicants have surprisingly discovered that the compounds of formula ( i ) do reduce one or several symptoms of ocd in a mammal . accordingly , an object of the present invention is a method for treating ocd in a mammal by administering to the mammal an effective amount of a compound of formula ( i ) or a pharmaceutically acceptable salt thereof . another object of the invention is a method for treating ocd in a mammal by administering to the mammal an effective amount of a compound of formula ( i ) or a pharmaceutically acceptable salt thereof together with a benzodiazepine or an antidepressant . the antidepressant may be a tricyclic antidepressant , such as clomipramine , a ssri , such as fluoxetine or paroxetine , or a snri , such as venlafaxine . for the purposes of this disclosure and claims the term “ treatment ” is relating to treatment in order to cure or alleviate the disease or its symptoms , and to treatment in order to prevent the development or the exacerbation of the disease or its symptoms . pharmaceutically acceptable salts of the compound of formula ( i ) can be formed with inorganic acids , e . g . hydrohalogenic acid such as hydrochloride acid or hydrobromic acid , sulfuric acid , phosphoric acid or nitric acid , or organic acids e . g ., tartaric acid , succinic acid , malic acid , maleic acid , fumaric acid , citric acid , or lactic acid . salt with fumaric acid is preferred . pharmaceutical compositions containing a compound of formula ( i ) or a pharmaceutically acceptable salt thereof as the active ingredient include the usual oral dosage forms , such as tablets , capsules , and liquid preparations . in oral dosage forms , the active ingredient can be mixed with suitable pharmaceutically acceptable excipients , such as starch , lactose , sucrose and magnesium stearate , in accordance with conventional pharmaceutical practice . the precise amount of the drug to be administered to a mammal for treating or preventing ocd is dependent on numerous factors known to one skilled in the art , such as the compound to be administered , the general condition of the patient , the condition to be treated etc . for example , the usual recommended oral daily dose of deramciclane would be about 5 - 150 mg , preferably 30 - 60 mg . the invention will be further clarified by the following example , which is intended to be purely exemplary of the invention . the efficacy of deramciclane in the treatment of ocd , is illustrated with two patients having obsessive - compulsive symptoms . these patients received one 15 mg tablet of deramciclane twice daily (= 30 mg / day ) for an eight - week active treatment period . as assessed by the responsible physician , the obsessive - compulsive symptoms were reduced in a clinically significant way during the 8 week treatment period . although the invention has been illustrated by the preceding example , it is not to be construed as being limited to the materials employed therein . rather , the invention is directed to the generic area as herein disclosed . various modifications and embodiments thereof can be made without departing from the spirit or scope thereof . | 0 |
exemplary embodiments of the present invention are described with reference to the accompanying drawings in detail . the same reference numbers are used throughout the drawings to refer to the same or like parts . detailed descriptions of well - known functions and structures incorporated herein may be omitted to avoid obscuring the subject matter of the present invention . it is understood that the term “ vehicle ” or “ vehicular ” or other similar term as used herein is inclusive of motor vehicles in general such as passenger automobiles including sports utility vehicles ( suv ), buses , trucks , various commercial vehicles , watercraft including a variety of boats and ships , aircraft , and the like , and includes hybrid vehicles , electric vehicles , plug - in hybrid electric vehicles , hydrogen - powered vehicles and other alternative fuel vehicles ( e . g ., fuels derived from resources other than petroleum ). as referred to herein , a hybrid vehicle is a vehicle that has two or more sources of power , for example both gasoline - powered and electric - powered vehicles . hereinafter , an airbag control unit with imu integration according to the present invention will be described with reference to fig3 and 4 . fig3 is a view illustrating a configuration of an airbag control unit ( acu ) with imu integration according to an exemplary embodiment of the present invention . the integrated acu 200 with imu integration according to an exemplary embodiment of the present invention includes an airbag collision sensor 210 , a micom 220 , a power supply unit 230 and a digital sensor 240 . specifically , the airbag collision sensor 210 is used to sense acceleration and roll rate . the micom 220 filters and measures an output value of the airbag collision sensor 210 and an output value of the digital sensor 240 , and performs a data conversion thereon to enable controller area network ( can ) communication . to this end , the micom 220 includes an spi interface 221 , a filter 222 , a determination unit 223 and a data conversion unit 224 , as shown in fig4 . the spi interface 221 receives the output value of the digital sensor 240 that is output in an spi mode . the filter 222 filters data received at the spi interface 221 , and the determination unit 223 detects an error condition of the filtered data by identifying whether the filtered data is within a measurable range of the sensor . the data conversion unit 224 converts data outputted from the determination unit 223 to a data in compliance with can communication protocol and transmits the converted data to an electronic stability control ( esc ) unit 100 . the power supply unit 230 provides power to the airbag collision sensor 210 , the micom 220 and the digital sensor 240 . the digital sensor 240 measures dynamic force such as a vehicle &# 39 ; s yaw rate ( angular velocity ) around a vertical axis of the vehicle , acceleration along an x - axis and a y - axis of the vehicle , and vibration and impact of the vehicle the digital sensor then converts the detected value to a digital signal , and performs filtering and calibration on the converted digital signal . to this end , the digital sensor 240 may have the exemplary detailed configuration as shown in fig4 . in fig4 , the digital sensor 240 includes a digital - to - analog converter ( dac ) for converting a digital signal to an analog signal , a capacitance - to - voltage conversion ( cv ), an automatic gain control ( agc ) for controlling a gain of a received signal , an analog - to - digital ( ad ) converter for converting an analog sensing value into a digital signal , a phase locked loop ( pll ), a filter filter for filtering a signal , an one - time programmable ( otp ) 300 , a safety controller ( scon ) 290 for performing an offset calibration according to vehicle set - up conditions , a temperature sensor ( temp sens ) 270 for correcting an output according to temperature characteristics , and a serial peripheral interface ( spi ) 280 for outputting a corrected value in the spi mode . the digital sensor 240 converts the yaw rate value and the acceleration value , which are physically measured , to a digital signal , and performs filtering and calibration on the digital signal to send to the micom 220 . next , the micom 220 filters the calibrated data , identifies whether the data is within a measurable range of the sensor , and converts the data into a data in compliance with the can protocol . the converted data is outputted to a can communication bus so that the data is transmitted to the esc unit 100 . as described above , according to the present invention , a micom 220 and a power supply unit 230 of an integrated acu 200 can be used in replacement of the power supply unit 42 of the vertical g sensor unit 40 and the micom 55 and the power supply unit 54 of the horizontal g / yaw rate sensor unit 50 , thereby providing an improved layout and reducing the number of components , which results in lower manufacturing costs . in addition , according to the present invention , the output of the yaw rate sensor and the output of the vertical / horizontal g sensor are processed through the micom of the air bag control unit , thereby minimizing a load of esc unit . although exemplary embodiments of the present invention have been described in detail hereinabove , it should be clearly understood that many variations and modifications of the basic inventive concepts herein taught which may appear to those skilled in the present art will still fall within the spirit and scope of the present invention , as defined in the appended claims . | 1 |
the present invention will be apparent from the following detailed description , which proceeds with reference to the accompanying drawings , wherein the same references relate to the same elements . in the process of manufacturing drugs , many acidic solutions such as acetic acid , phosphoric acid and hydrochloric acid are usually used as reactants . because smuggled drugs are secretly manufactured without deacidifying , a lot of incompletely reacted acidic substances remain in the drugs . the smuggled drugs are usually packed with materials made of polymers such as polyvinyl chloride ( pvc ) or polypropylene ( pp ). after being delivered for several hours , the acidic substances in the drugs evaporate to acidic gases and permeate through the materials as mentioned above under the condition of 1 atmosphere , 35 ° c . hence , it is considerably possible to primarily detect drug via detecting whether unusual acidic gases exist nearby the surface of clothed individual . it needs to be noted that the smell of perfumes and fruit could not interfere with the detection of drugs by the drug detection apparatus of the present invention , and this will be described in the following description . fig2 a is a schematic figure illustrating the drugs detection apparatus in accordance with the first embodiment of the present invention . as shown in fig2 a , the drugs apparatus 10 includes a reactor 11 , a detection reagent 13 containing an oxidant and a reductant and a catalyst 14 . reactor 11 is , for example , a cylindrical container , and there is a space with 500 - ml volume in the center of the reactor 11 . of course , except for cylindrical container , the shape of the reactor 11 can for example but not limited to be square , polyhedral , circular or other shaped . the side portion of the reactor 11 has a gas inlet 12 collecting a gas sample in the air and introducing into the reactor 11 to contact with the detection reagent 13 . to improve the efficiency of collecting gas sample and mixing the gas sample and the detection reagent 13 , in this embodiment , the gas inlet 12 can be equipped with a guiding unit 121 , and the guiding unit 121 can have , for example , an extracting air element , and the extracting air element can rapidly extract gas sample from the environmental air , and then the gas sample can be introduced through the gas inlet 12 and mixed to the detection reagent 13 . the detection reagent 13 is disposed in the space in the center of the reactor 11 and contains an oxidant and a reductant , the volume of the detection reagent 13 is 500 ml . it should be noted that , the term “ oxidant ” herein refers to a dual reagent , which can serve as an oxidant under acidic environment , and serve as a reductant under basic environment . the oxidant in the detection reagent 13 includes hydrogen peroxide , ozone , potassium permanganate , sodium chlorate , or the combinations thereof . the concentration of the oxidant is between 0 . 15 m and 1 . 5 m . the reductant in the detection reagent 13 includes halogeneted metal compounds such as potassium iodide ( ki ), potassium chloride ( kcl ), or potassium bromide ( kbr ). the concentration of the reductant is between 0 . 25 m and 2 . 5 m . it should be noted that the concentrations of the oxidant and reductant are relatively excessive compared with the concentration of the hydrogen ion ( h + ) in the gas sample , such that the amounts of the oxidant and the reductant are enough to involve a serial of chain reactions and repeatedly detect different gas samples . therefore , this may not cause a variance to the detection results . the catalyst 14 can be disposed on the inner surface of the reactor 11 or added in the detection reagent 13 . in this embodiment , the catalyst 14 is coated on the inner surface of the reactor 11 at a high temperature . the catalyst 14 includes ferric iron oxide ( feo ( oh )), cupper oxide ( cuo ), silver oxide ( ag 2 o ), nickel oxide ( nio ), ferrious oxide ( fe 2 o 3 ), chromium oxide ( cr 2 o 3 ), cerium oxide ( ce 2 o 3 ), molybdenum sesquioxide ( mn 2 o 3 ), tricobalt tetraoxide ( co 3 o 4 ), vanadium pentaoxide ( v 2 o 5 ), or silicon dioxide ( sio 2 ). the catalyst 14 of another aspect of the present invention is shown in fig2 b . as shown in fig2 b , the catalyst 14 is dissolved or suspended in the detection reagent 13 . as shown in fig2 c , the catalyst 14 can also be molded into a columnar form , and the catalyst 14 can gradually dissolve when the detection reagent 13 is stirred or flows . in this embodiment , energy generated by heating the detection reagent 13 to 70 ˜ 80 ° c . is enough to overcome the energy barrier of the chemical reaction of the catalyst , oxidant and reductant , so as to successfully generate the following chemical reactions . to dissolve the extremely trace amounts of the hydrogen ions of the acidic gases into the detection reagent 13 , the drugs detection apparatus of the present invention further includes a stirrer . as shown in the fig2 d , a stirrer 41 is disposed in the space in the center of the drugs detection apparatus 40 . the stirrer 41 includes rotating shaft 411 and a plurality of impellers 412 , and an example of the number of the impellers 412 are six herein . the impellers 412 are disposed in pair in the rotating shaft 411 , and each pair of the impellers 412 is separately disposed along the rotating shaft 411 . however , the number of the impeller 412 of the present invention can be more or less than six depending on the requirements . besides , the drugs detection apparatus 40 can further includes a motor 43 . the motor 43 is disposed on the base 15 and electrically connected with the rotating shaft 411 . when the motor 43 runs , the rotating shaft 411 is driven and swirls , such that the detection reagent 13 forms eddy currents . the configurations of a plurality of baffles 42 closely disposed to the inner wall of the reactor 11 or a plurality of steel pins 412 a disposed on the impellers 412 are used to produce a turbulence , so as to improve the efficiency of dissolving the gas sample to the detection reagent 13 . the following will illustrate the chemical reactions generated in the drugs detection apparatus . the example of the gas sample , the oxidant and the reductant in the detection reagent 13 is acetic acid , hydrogen peroxide ( h 2 o 2 ) and potassium iodide ( ki ), respectively , and the example of the catalyst 14 is ferric iron oxide ( feo ( oh )). when the hydrogen ions dissolve in the detection reagent 13 and contact with the catalyst 14 , the following chemical reactions are generated : ch 3 cooh ( g ) + h 2 o 2 + ki → ch 3 coo − + h + + h 2 o 2 + k + + i − when the acetic acid is mixed in the detection reagent 13 , the hydrogen ions also dissociate from the acetic acid in the detection reagent 13 and decrease the ph value of the detection reagent 13 , such that the dual reagent , hydrogen peroxide , is being an oxidant herein . h 2 o 2 can oxidize the iodine ions in the detection reagent 13 to molecular iodine so as to develop color . simultaneously , the hydrogen peroxide are absorbed with ferric iron oxide through chemical absorption , and serious of large amounts of the free radicals with strong oxidizing potential such as ho ., . o —, . o 2 − and . o 2 + are generated to proceed a serial of chain reactions , so as to oxidize more iodine ions and amplify the reaction of developing color caused by molecular iodine . among the chemical equations mentioned above , the molecules with the ability of developing color are molecular iodine , and it results in a change of the color of the detection reagent 13 into brown . when the concentration of the hydrogen ions in the detection reagent 13 are gradually reduced due to consuming in a serial of chemical reactions , the ph value of the detection reagent 13 gradually restores to neutral and the hydrogen peroxide loses the oxidizing ability . thus , the reaction of developing color is terminated . the drugs detection apparatus 40 of the present invention can be further connected with a monitoring unit 44 . the monitoring unit 44 can further includes an image capturing and analyzing unit . according to the results of the developing color of the detection reagent 13 , the image capturing and analyzing unit can catch an image of the detection reagent 13 and determine whether the degree of the color change of the detection reagent 13 is greater than a threshold value . certainly , the image capturing and analyzing unit can be also replaced by using naked eyes or other machines having the ability of discriminating the color difference to achieve the purpose of monitoring . the image capturing and analyzing unit has , for example , the combination of a camera 44 and image analysis software shown in the fig2 d . the camera 44 is disposed at a position around the reactor 11 to serially or randomly photographing . to confirm whether the color change degree of the detection reagent 13 is greater than a threshold value , the image captured by the image capturing and analyzing unit is used to measure the value of gray by the image analysis software . a gray - i 2 quantity line is regressed according to the relationship between the values of gray of various known amounts ( mole ) of molecular iodine and the corresponding concentrations . blank is estimated at 25 ° c ., and the concentration of the molecular iodine of the blank is calculated according to the value of gray of blank and obtains the standard deviation ( sd ). the instruments detection limit ( idl ) is determined by three times of the standard deviation . the situation of measured value of gray greater than idl means that the color change degree of the detection reagent 13 is greater than the threshold value . in this embodiment , the drug detection apparatus 40 is electrically connected with a warning unit ( not shown ). when the color change degree of the detection reagent 13 detected by the monitoring unit 44 is greater than the threshold value , it indicates that the monitored gas sample contains acidic gases . then , the warning unit of the drug detection apparatus 40 generates a warning signal . the warning signal of the present invention includes a warning alarm or warning light , and it can be used to notify the detecting personnel of the border inspection . the present invention also provides a drug detection method applied to the drug detection apparatus . as shown in fig3 , the drug detection method includes the following steps of collecting a gas sample ( step s 10 ), dissolving the gas sample into the detection reagent to react with the catalyst , an oxidant and a reductant ( step s 20 ), and detecting a change in the color of the detection reagent and determining whether the change degree is greater than a threshold value ( step s 30 ). additionally , the step of the drug detection method of the present invention further includes generating a warning signal when the degree of the color change in the detection reagent is greater than the threshold value ( step s 40 ). the detailed specification of the steps is described as mentioned above , and it is omitted herein . in an embodiment of the present invention , it is demonstrates that the drug detection apparatus of the present invention can detect 1 ppb gaseous acetic acid . moreover , the chemical reactions for detecting acidic gases in the drug detection apparatus of the present invention could not be effected by common odorous molecules originated from volatile organic compounds such as fruit odor , or perfume , thus , the drug detection of the present invention is highly sensitive . because the chemical reactions can immediately complete in 1 . 5 seconds and sequentially develop color in the detection reagent , the drug detection of the present invention can rapidly detect gas samples . the chemical reactions for the detecting blank between two detection items can not be effected by the chemical reactions of previous test item , thus the detection of the drug detection apparatus of the present invention is extremely stable . the characteristics of the drug detection apparatus in accordance with the present invention are further demonstrated by the following experiments . the drug detection apparatus of this experiment is shown in fig2 d . first of all , the detection reagent is prepared in the reactor . to prepare the detection reagent , weigh out 20 g of potassium iodide ( ki ) and 50 ml of 50 % hydrogen peroxide ( h 2 o 2 ) and dissolve in distilled water . the final concentrations of ki and h 2 o 2 in the detection reagent are 0 . 15 m and 0 . 25 m , respectively . the liquid level of the detection reagent is equal to the height of the rotating shaft in the reactor . the catalyst used in this experiment is ferric iron oxide ( feo ( oh )). 20 g of feo ( oh ) is uniformly coated on the inner surface of the reactor at temperature of 500 ° c . then , the detection reagent is heated , the stirrer whirls the detection reagent at speed of 1 , 800 rpm . the gas sample is extracted from the outside of the gas inlet , passes through the gas inlet and dissolves in the detection reagent . the operation of extracting the gas sample in this experiment is in semi - batch mode . the extracting period of the gas sample is approximately 3 seconds each time , and the volume of the extracted gas sample is about 0 . 1 - 1 . 0 nl / min each time . the gas samples used in this experiment are 1 ppb acetic acid gas and saturated vapors of 20 ml ethylene ( a common volatile hormone in plants ), perfume ( channel no . 5 ) and acetyl acetate . as shown in fig4 , different detecting conditions of acetic acid gas and saturated vapors of ethylene , perfume and acetyl acetate as gas samples are respectively grouped into detection groups a to h and detected by the drug detection apparatus . in detection group a , the gas sample is 1 ppb acetic acid gas , and the temperature of the detection reagent is controlled between 25 ˜ 60 ° c . in detection group b , the gas sample is 1 ppb acetic acid gas , and the temperature of the detection reagent is controlled at 70 ° c . in detection group c , the gas sample is 1 ppb acetic acid gas , and the temperature of the detection reagent is controlled at 80 ° c . in detection group d , the gas sample is 20 ml saturated vapor of ethylene , and the temperature of the detection reagent is controlled at 80 ° c . in detection group e , the gas sample is 1 ppb acetic acid gas , and the temperature of the detection reagent is controlled at 85 ° c . in detection group f , the gas sample is 20 ml saturated vapor of perfume , and the temperature of the detection reagent is controlled at 80 ° c . in detection group g , the gas sample is 1 ppb acetic acid gas , and the temperature of the detection reagent is controlled at 90 ° c . in the detection group h , the gas sample is 20 ml saturated vapor of acetyl acetate , and the temperature of the detection reagent is controlled at 80 ° c . as shown in fig4 , the amounts of the molecular iodine in each detection item of detection group d , detection group f and detection group h is lower that idl ( 1 . 35 × 10 − 8 mole ). this indicates that the common volatile compound such as ethylene , perfume and acetyl acetate could not generate chemical reactions in the drug detection apparatus of the present invention to interfere with the chemical reactions in the detection process . furthermore , the energy generated by heating the detection reagent up to 70 ° c . are enough to process a serious of chemical reactions to develop color in the detection reagent . however , the amounts of the molecular iodine will not obviously increase as the detection reagent is heated to higher temperature such as 80 ° c ., 85 ° c . and 90 ° c . fig5 shows a data of 1 g heroin and amphetamine as emission source of drug odor detected by the drug detection apparatus of the present invention . in detection group a , 0 . 1 l of heroin and amphetamine are extracted and introduced to the detection reagent . in detection group c , 0 . 3 l of heroin and amphetamine are extracted and introduced to the detection reagent . in detection group e , 0 . 5 l of heroin and amphetamine are extracted and introduced to the detection reagent . in detection group g , 1 l of heroin and amphetamine are extracted and introduced to the detection reagent . detection groups b , d , f and h are detecting blank prior to detecting next gas sample . the retention time of each detection item of each detection group is 1 . 5 seconds , and the temperature of the detection reagent is controlled at 70 ° c . as shown in fig5 , the amounts of molecular iodine are generated from low to high in detection group a , detection group c , detection group e and detection group g in order . this indicates that more amounts of the molecular iodine are going to be generated if more volume of the drugs gas is extracted and dissolved to the detection reagent . in addition , the detecting results in detection group b , detection group d , detection group f and detection group h as detecting blank are not individually effected by chemical reactions generated in their previous detection group , so this demonstrates that the drug detection apparatus of the present invention has excellent detection stability . in summary , the drug detection apparatus and the drug detection method of the present invention can effectively detect trace of acidic gases through dissolving the gas sample into the detection reagent and contacting with the catalyst to generate a serial of chain reactions resulting in a color change in the detection reagent . therefore , the drug detection apparatus and the drug detection method of the present invention can be used to primarily detect drugs and have the advantages of immediately detecting , reducing production cost and high sensitivity , so that they are suitable to be used to detect drugs at border inspection stations where the large number of crowd frequently passed through . although the invention has been described with reference to specific embodiments , this description is not meant to be construed in a limiting sense . various modifications of the disclosed embodiments , as well as alternative embodiments , will be apparent to persons skilled in the art . it is , therefore , contemplated that the appended claims will cover all modifications that fall within the true scope of the invention . | 8 |
in fig1 the toy telephone 10 of the present invention is shown provided with a 3 - conductor cord 11 leading to stereo sound unit 12 such as a record player or tape recorder / player . unit 12 is provided with at least one output jack 13 , which receives stereo phone plug 14 , the latter being electrically and physically connected to the 3 - conductor cord 11 . in common parlance , the plug 14 is generally referred to as a stereophonic headphone plug . in one form of the invention the plug 14 will be inserted in the stereophonic headphone jack 13 normally supplied in a stereo sound unit . as to the toy telephone 10 , the same is shown to include a telephone base 15 , the latter comprising a base member 16 and a cover 17 secured thereover as shown in fig2 . cover 17 may be secured to base member 16 by screws , by a detent at 18 , or by any other conventional means . base member 16 is provided with upstanding attachment bosses 20 - 23 which are drilled and tapped to receive screw attachments 24 . the same is utilized to mount the speaker 25 into the position shown in fig2 the speaker may be selected from those having normally a 31 / 2 inches diameter , and having the characteristics of 2 - watt output 8 ohm impedance . it will be seen in fig2 that base member 16 and cover 17 make up a composite housing 19 for the telephone base 15 . cover 17 is provided with a series of depressions 26 , normally twelve , the same being provided with resilient , bubble - type springs 27 which supply an outer restoring force to each of the several &# 34 ; dialing &# 34 ; push - buttons 28 . these push - buttons will be electronically and functionally inoperative ; however , the child using the phone will get the &# 34 ; feel &# 34 ; of true telephone operation by selectively depressing these buttons as may be instructed , as hereinafter explained , and thereafter release the buttons so that the same will return from the position shown in fig3 to the initial position shown in fig4 . to mount and retain the buttons a mask 29 may be employed and snapped in place at a snap detent 30 in the usual manner as in the case of conventional telephones . other types of securement can be employed . the handset 31 of the toy telephone , see fig2 includes a mouthpiece portion 32 , a receiving portion 33 , and is provided with cord 81 as shown . mouthpiece portion 32 will include a counter weight 34 , of no functional purpose other than to offer a balance to the handset 31 by counterbalancing the speaker 35 that is mounted by screws or other means 35a to the interior of receiving portion 33 . any type of press - fit or retentive mounting , of course , may be employed in connection with the mounting of speaker 35 . the speaker 35 itself , see fig6 may include capacitor 36 and potentiometer 37 , the latter which is preset at the factory for optimum speaker performance . the speaker may be selected from those having normally a 13 / 4 inches diameter , and having the characteristics of 0 . 1 watt output 8 ohm impedance . fig6 illustrates an electrical schematic of the circuit used in connection with this invention . the plug 14 , see also fig1 is shown as is also the 3 - conductor cable 11 . each of the electrical leads 38 - 40 respectively connected to potentiometer 37 , to switch terminal 41 and also to speaker 25 . the remaining side of speaker 25 is coupled by lead 42 to switch contact 43 . switch contacts 43 , 44 , and terminal screw 41 are in fact part of the switch means 45 , the same also including switch connector means 56 . the position of switch means 45 is shown in fig6 corresponding to the handset - in cradle position . switch member 57 is generally y - configured , made of a plastic insulative material , and includes a pair of upstanding actuation prongs 58 and 59 joined by crossbar 71 which is integral with an upstanding leg 60 . prongs 58 and 59 proceed through apertures 85 , 86 of base portion 19a . leg 60 is provided with an electrically conductive , spring - tempered copper strip 61 which is doubled back at its extremities 62 and 63 and retained in position by such screws 64 and 65 . switch contact 44 is seen in fig5 a and also in fig6 . correspondingly , switch contact 43 is shown in fig5 a and 6 . conductive strip 61 is shown schematically as its functional equivalent , &# 34 ; switch arm &# 34 ; 56 , which follows the up - and - down movement of switch member 57 . terminal screw 41 , see fig5 a and 6 , is secured at 66 to the aforementioned conductive strip and supplies electrical connection for lead 39 . electrical connection may be made by solder menas , by crimping , by a conductive screw , or by other suitable means . it is noted that the base member 16 is provided with an upstanding sleeve boss 67 , the same having aperture 75 , for passage of lead 42 , and also being provided with an internal compression spring 68 . the compression spring seats against the bottom 69 , generally , and its upper extremity engages the upper surface 70 of crossbar 71 of the switch member 57 . from an electrical standpoint , the wire segments 42a and 42b of fig2 shorted by one of the representative bus bar segments 76 of terminal strip 77 , will comprise the composite lead or connector 42 seen in fig6 . kindly note fig2 in this regard . the terminal strip 77 includes a plural pairs of terminal strip screws 78 , individual pairs of which are electrically connected together by any suitable conductive means . the respective pairs of screws , that is screws disposed directly across from each other in fig2 are , of course , not connected to any other pair . for desirability and ease of contact , it is desirous that the ends 62 and 63 of the conductive strip be curved as indicated , this to provide for some resiliency or &# 34 ; give &# 34 ; as these ends engage the respective screw terminals 43 and 44 in fig5 a . switch contact 44 is provided with conductive lead 72 and this is illustrated in fig2 . the operation and over - all description of the structure is as follows : unit 12 in fig1 is representative of many stereo sound units that may be employed to operate the toy telephone . such units may comprise a record player and / or tape player . the stereo sound unit 12 in any event will include a start or play button 83 and , in the embodiment shown , will have a replaceable cassette 82 . in accordance with the principles of the invention , that is , whether a record or a tape is employed , there will be recorded on such record or tape , for example , on one channel , a telephone ring sound which is audibly similar to that which one hears when his own telephone rings . on the other channel , and after the recording of the telephone ring sound , there will appear a voice recording of a given fantasy character , for example . in fact , on the remaining channel there can be a series of messages which the child will be able to receive . the type of recording on the tape or record can vary , of course ; one type will best be understood by reference to the following description of operation , giving primary attention to the toy telephone handset and base . toy telephone 10 will preferably be placed at some remote point from unit 12 , and a parent will put the record or tape into play by turning the unit 12 on to &# 34 ; play &# 34 ; position . at some future point in time , generally a very brief time interval , the telephone ring recorded on one channel of the record or tape will be reproduced in speaker 25 it is noted that speaker 25 is directly connected to unit 12 through the 3 - conductor cable 11 and that the ring will be received by the telephone base speaker 25 only when the handset 31 is down so as to depress the switch member 57 such that there exists an electrical connection between terminal screw 43 through the conductive strip 61 to lead 39 . at this point then , the child hears the ring and will be prompted to pick up the handset . when he does so , then the switch member 57 , being under the pressure of compression spring 68 , will lift upwardly so as to break contact between the conductive strip 61 and switch contact 43 . also , at this point , there is a connection now as between conductor 39 and conductor 72 , this via the uppermost curved portion 62 of conductive strip 61 . this action serves to cut off the lower speaker 25 , by virture of the disconnection of conductive screw 43 with the bottom of the conductive strip 61 , and produces a completion of the circuit relative to speaker 35 of handset 31 . it is noted in fig2 that lead 72 is connected through the terminal strip 77 to lead 74 , see fig2 and 6 . thus , the child continues to listen but this time , instead of hearing the telephone ring , will hear a recorded message or instruction from the &# 34 ; telephone operator ,&# 34 ; or fantasy character . the &# 34 ; telephone operator &# 34 ; may indicate to the child that he will shortly receive a telephone call from a fantasy character , in which event the child will return the handset to the cradle to receive the next telephone ring on the first channel . it will be understood that there are many types of sounds that can be employed on either one or both channels . as to a preferred embodiment of the invention herein , however , the ring known as the conventional &# 34 ; audible ring ,&# 34 ; audible to a calling party , will appear solely on the second or message channel to actuate speaker 35 . the &# 34 ; telephone ring &# 34 ; signal , on the first channel , will actuate solely the speaker 25 in the telephone base in fig2 to indicate that a call is being received . in sum , and to recapitulate , one channel will include the usual &# 34 ; audible ring ,&# 34 ; i . e . that ring which is heard by a user when he has just placed a call . also this channel will include voices , background , and so forth . the &# 34 ; telephone ring ,&# 34 ; i . e . that heard when one is receiving a call will be recorded on the remaining channel . it wil be understood that rather than prerecorded fantasy character voices , there may be voices &# 34 ; from the past &# 34 ; so that a child may figuratively talk to abraham lincoln , alexander graham bell , as so forth . additionally , other types of audible information may be recorded on one or both channels of the tape or record , but generally one , for a variety of instructional and / or entertainment purposes . there are several optional and alternate ways of making connection to the stereo sound unit . one way , of course , is shown in fig1 wherein connection is made to the stereophonic headphone jack 13 . another way is shown in fig7 wherein rca - type phono plugs 79 and 80 can be employed in connection with the 2 - conductor cables and inserted in the right and left speaker jacks . optionally , though not shown , is the fact that connection can be made directly to the solderless speaker screw terminals if present on the sound unit , in which case the plugs 79 and 80 in fig7 would be replaced by solderless lugs . the following observations are made in connection with the subject toy telephone and its system . telephone programs intended for use can be recorded on standard 331 / 3 and 45 rpm phonograph records , standard cassettes , cartridge tapes , and open - reel recording tapes . whatever the medium of recording used on this stereo sound unit , the toy telephone herein is a &# 34 ; talking &# 34 ; telephone which utilizes a stereophonic sound system requiring in any event that the sound be recorded on two independent channels . one of the channels contains periodic recordings of a telephone ring ; the other contains recorded speech and sound effects , including periodic recordings of an &# 34 ; audible ring ,&# 34 ; i . e . the ring - signal heard through a conventional telephone when one is placing a telephone call . as to playback of the program by the toy telephone herein , the initial ring is heard on the base speaker of the telephone when the child lifts the handset then this base speaker is cut off and the message comes through the speaker in the handset . should the &# 34 ; operator &# 34 ; instruct a child to &# 34 ; dial &# 34 ; a number , and the child does so , then the &# 34 ; message &# 34 ; channel can give the &# 34 ; audible ring ,&# 34 ; which may be prerecorded on the tape or record to simulate a phone call being placed . it is to be noted that in most stereophonic sound systems there is a slight amount of &# 34 ; cross - talk &# 34 ; from one channel to another . such &# 34 ; cross - talk ,&# 34 ; however , will normally not be detectable while operating the toy telephone herein . it is noted that the subject telephone elminates conventional problems of ( 1 ) poor - quality sound reproductions , ( 2 ) recordings of limited duration , ( 3 ) necessity of continuous remote operation , ( 4 ) battery operation , and ( 5 ) large expense . thus , existing sophisticated sound equipment can be used to play the messages , such that the child will receive high - quality sound reproductions of , e . g . long - playing records . a large number of american families already own stereophonic sound equipment capable of operating the subject toy telephone . no special adaption is required and no inconvenience created ; rather , a stereophonic , programmed record or tape is simply put into play on the external machine so that the child may enjoy it at a point remote therefrom by use of his telephone herein . it should be noted that when the volume level of the sound system utilized is adequate to play recorded speech and sound effects through the handset speaker , it may be inadequate to effectively produce the telephone ring through the base speaker . this volume level problem is or may be overcome by recording the ring at the greatest possible level without causing serious distortion in the playback , recording the speech and sound effects on the other channel at a normal volume level , and utilizing a potentiometer in the handset speaker , as at 37 in fig2 so as to reduce the speaker &# 39 ; s volume capacity . it is noted that the perforated base at 84 maximizes the volume of the &# 34 ; telephone ring ,&# 34 ; allowing the sound to pass freely from the telephone housing enclosure . background noise in the sound system can be filtered from the handset speaker by means of capacitor 36 in fig2 . it is noted that the switch means 57 operates to open one speaker circuit and close the other speaker circuit , and vice versa . the same , again , is operated by engagement of the actuation prongs 58 and 59 by the handset . the toy telephone of the present invention is , of course , intended for connection to any standard sound system which will include but not be limited to standard playback units utilizing 331 / 3 and 45 rpm phonograph records , cassettes , 8 - track cartridges , and open - reel recording tapes . while particular embodiments of the present invention have been shown and described , it will be obvious to those skilled in the art that changes and modifications may be made without departing from this invention in its broader aspects , and , therefore , the aim in the appended claims is to cover all such changes and modifications as fall within the true spirit and scope of this invention . | 0 |
the total ammonia uptake is below referred to as irreversbly bound nitrogen and reversibly bound nitrogen . the irreversibly bound nitrogen is measured as the increase in raw - protein - n ( determined by kjeldahl analysis ). in addition to the irreversibly bound nitrogen , the straw also absorbs ammonia in the form of more lighty bound or reversibly bound nitrogen . some of the reversibly bound nitrogen will remain in the straw after venting , but can be removed by raising the temperature or by destillation using a basic medium to strip off the ammonia . when a container with straw is charged with ammonia the ammonia will be rapidly absorbed . as time passes part of the absorbed ammonia will react with the straw and become irreversibly bound . the amount of irreversibly bound nitrogen will depend upon the amount of reversibly bound nitrogen , and an increase in the amount of reversibly bound nitrogen above a given threshold value , as explained below , will provide a driving force promoting optimal , irreversible nitrogen binding . the partial pressure of ammonia in a container filled with straw is initially high if gaseous ammonia is used , and low if liquid ammonia is used . this of course , is because liquid ammonia is evaporated gradually . in a relatively short time , however , the partial pressure of ammonia in the container , in both cases approaches some constant value , depending on temperature , amount of ammonia added , and moisture content of the straw . typically , at 5 °- 10 ° c and with addition of 30 kg nh 3 / ton straw dry matter , the equilibrium partial pressure is 2 - 5 percent by volume , which is an unexpectedly low value . the amount of irreversibly bound nitrogen in untreated straws varies normally in the range from 0 . 5 - 1 . 0 % abs . optimal irreversibly bound nitrogen after treatment varies normally in the range from 1 . 0 - 2 . 0 % abs . when treatment is to be finished , excess ammonia is vented off . the desorbtion of ammonia is accompanied by a temperature drop . even after extensive ventilation where there is hardly a faint smell of ammonia from the straw , there is still present a substantial amount of reversibly bound nitrogen in the straw . typically , this reversibly bound nitrogen amounts to about 0 . 5 - 0 . 7 % n abs . at temperatures from 5 °- 25 ° c . this is illustrated by the equilibrium curves shown in fig1 . to ammonia treated straw containing optimal amounts of irreversible bound nitrogen , was added varying amounts of fresh ammonia and the amount of ammonia in gas - phase ( ppm ) was plotted against reversibly bound ammonia ( kg nh 3 / ton straw ) after the equilibrium stage was reached . these measurements are rather complicated , but as shown in fig1 the resultant curves at 5 ° and 25 ° c are converging towards a minimum value of approximately 6 - 8 kg nh 3 / ton straw dry matter . thus , at normal outdoor temperatures there will always be a substantial amount of ammonia in the form of reversibly bound nitrogen which can not be driven off by conventional venting . this ammonia is according to the present invention not stripped off . in this way we obtain a combined or in fact a synergistic effect , optimal irreversible nitrogen binding is secured and simultaneously also an improved nutritional value is obtained . as long as the lightly bound ammonia is present in amounts above the recorded threshold value of approximately 6 - 8 kg nh 3 / ton straw dry matter , there will be present a driving force to promote irreversible nitrogen binding . even if most of the increase in nitrogen binding may be obtained in a few days , 10 days or less , the improvement in nutritional value may go on for a long time as long as the driving force is present . several weeks , eight weeks or more , is sometimes needed to obtain the full effect when the amount of ammonia added is just above the calculated , theoretical value shown below . the threshold amount of ammonia to be used may be calculated as follows : ______________________________________irreversibly bound - n ( raw protein ) 1 . 0 % abs = 10 kg n / ton straw dry matterreversibly bound - nafter venting = 7 kg n / ton straw dry mattertotal = 17 kg n / ton straw dry matterin terms of nh . sub . 3 ( 17 / 0 . 8 ) = 21 kg nh . sub . 3 / ton straw dry matter______________________________________ the total amount of ammonia added should thus exceed 21 kg nh 3 / ton straw dry matter to secure the driving force to obtain an increase of 1 . 0 % abs . in raw protein n within a reasonable time . satisfactory results are obtained within 3 - 8 weeks with amounts of from 20 - 30 kg nh 3 / ton straw dry matter , 20 - 35 kg nh 3 / ton straw dry matter are considered as the preferred amounts , but even greater amounts of ammonia , such as 40 kg nh 3 / ton straw dry matter or more , can be used . however , the waste of ammonia will then be considerable , unless a recovery system is used , which greatly increases the cost . all common types of straw or other lignocellulose containing material can be used either as it is or chopped to smaller pieces . baled straw is preferred due to its higher density , which gives more straw per unit volume . concerning the container , there are no requirements for rigidity and strength to withstand heat and high pressures . for economic reasons plastic foil is preferred . plastic foils have relatively high ammonia permeability , but , because of the low partial pressures of ammonia in the container , according to the present invention , the ammonia losses through the foils are negligible . to obtain satisfactory mechanical strength , foil thickness of 0 . 1 - 0 . 25 mm is normally used . polyethylene foil is the cheapest and the least permeable . pvc foil can also be used , but this material has been found to have higher nh 3 - permeability and is more expensive . any material may be used to contain the straw as long as it is reasonably inert and impervious to ammonia . a practical way of introducing the ammonia is in liquid form and concentrated within one area of the material to be treated . this gives even penetration and the partial gas - pressure and ammonia gas concentrations will be kept so low that hazards of explosive gas concentrations will practically be eliminated . any shape and size of pile and container can be used . the straw can also be directly collected from the harvester and filled into plastic cylinders , bags or the like . in vivo digestibility and nutritional value experiments have been carried out on sheep . so far the results from 30 single tests have been evaluated giving the following average results : the nutritional value is increased from 4 . 2 to 2 . 4 kg straw per feed unit . these results are very positive and the substantial improvement in nutritional value seems to confirm that the reversibly bound ammonia is also utilized by the animals . piles in the form of prisms were made up from bales of straw 1 placed on top of a sheet of plastic foil 2 placed on the ground , cfr . fig2 . the prism form is preferred due to low surface to volume ratio . between the bales 1 was placed a stick 3 , which later was retracted to give access for a pipe for the introduction of ammonia . after the piles had been completed , the amount of straw varied from 800 - 6000 kg . after the piles had been completed an upper plastic foil 4 was folded around the pile and rolled together with the bottom foil -- fig3 and 4 -- and kept closed with the help of sand bags 5 , weights or the like . liquid ammonia was added through a perforated pipe , which was pushed into the pile after the stick 3 was retracted . the plastic foil cover was kept open in one end , while liquid ammonia was added at the far end . some of the air present in the pile was pushed out through the opening as the liquid ammonia evaporated . due to the strong affinity of ammonia to the straw , negligible amounts of ammonia escaped through the opening . after addition of 20 - 35 kg nh 3 / ton straw the opening was closed and the pile tied with string 6 -- fig4 . after 3 - 8 weeks the piles were vented and the straw ready for use . by adding liquid ammonia in the far end of the pile , there will be no problems with nh 3 - fumes for the operator . liquid nh 3 should also be added high up in the pile to facilitate evaporation and spreading , and to avoid accumulation of liquid nh 3 on the bottom foil . | 0 |
the present invention is directed to providing porous ceramic membranes and porous ceramic materials in other forms for separation and / or catalysis having a network of continuous macroscopic channels therethrough . a schematic depiction of such a porous ceramic material is shown in the drawing . the term &# 34 ; membrane &# 34 ; as used herein , is also intended to encompass a broad range of porous ceramic materials in other forms , such as pellets , wherein the ceramic materials have continuous macroscopic channels therethrough . &# 34 ; macroscopic &# 34 ; channels are not necessarily visible to the naked eye . the term &# 34 ; macroscopic &# 34 ; describes a channel that would be apparent within a membrane to one observing the membrane at magnifications typically used to evaluate membranes . the membranes are formed from metal sols deposited upon a removable organic support matrix . the organic support matrix attracts the sol , which ultimately dries and is sintered to form a membrane . when formed , the membrane adopts the shape of the organic support . for instance , when the organic support is a woven matrix , the membrane itself assumes the form of a woven matrix , even after the organic support has been removed . an organic support appropriate for use in forming the membranes of the present invention has an affinity for a metal sol , is formed of continuous fibers , and is easily removed after the solid membrane forms . in the preferred embodiment , the organic support was 100 % cotton cheesecloth with 40 - 50 threads per inch . alternatively , the support may be an organic material such as thread or string and may be spooled . preferably , though not essentially , the organic support is washed thoroughly before use to remove impurities that might otherwise remain within the membrane after the support is removed . the support can include an organic portion and a metal portion . such a combined support would be partially removable by burning or other treatment and would advantageously leave behind the metal portion in the membrane to provide a desired chemical activity or to increase structural integrity . one type of combined support is a metallic cheesecloth in which a certain percentage of the support fibers are metal fibers . to produce a membrane having a network of channels therethrough , a metal sol is applied to the support matrix until the sol just saturates the support . the organic support is pre - cut to a desired size and is placed on a horizontal surface , such as a polystyrene weighing boat before the sol is applied . the metal sol may be formed of any transition metal or metal oxide or combination of transition metals or metal oxides . to prepare metal sols , alkoxides of one or more transition metals in solution are hydrolyzed under conditions that favor the formation of metal oxide particles in the resulting colloidal suspension , or sol . as noted , the catalytic and separation qualities of the membrane are determined by the nature of the sol particles , which are in turn determined by the sol formation conditions . for example , the ph of the alkoxide solution must be carefully controlled , to suspend the resulting particles in the solution so that a stable sol can result . the sol that coats the organic support is dried until it becomes a semi - solid xerogel , which can be further dried to form a gel . the gel and the immobilized support are then heated at a temperature that is sufficiently high to sinter the gel , thereby forming a ceramic membrane having a matrix of small pores formed during sintering . references in this patent application to &# 34 ; ceramic &# 34 ; membranes are intended to encompass all porous metal membranes formed by sintering , firing , or heating a gel . typically , the heat of sintering the gel to form the membrane is sufficiently high to pyrolyze the organic support . however , depending upon the support matrix and sintering temperature chosen , it may be necessary to take further steps , such as an acid , basic , or organic degradation , to remove the support embedded in the membrane . after the support is removed , continuous channels remain throughout the membrane interior . as noted above , the porous ceramic membrane assumes the shape of the organic support and , therefore , void spaces form between the fibers of the support matrix . the membrane thus formed is quite fragile after the support is removed , and it may be desirable to apply a second coating of sol onto the membrane to prevent the membrane from breaking . the second coat is preferably applied on a teflon ® surface , such as a weighing boat . the second coat of sol may be applied with a pipet , taking care to avoid the channels at the membrane sides . even if some colloidal sol does enter the channels , it is unlikely that the channels would become blocked , insofar as a large quantity of sol would be required to fill the macroscopic channels . the excess sol may be poured from the teflon ® surface and the sol - coated membrane dried lying on the teflon ® surface . because the channel - containing porous ceramic membrane of the present invention is fragile , it is also desirable that the mechanical strength of the membrane be increased by filling the void spaces of the membrane with a less fragile ceramic support , such as a sintered ceramic powder suspension of a silica - based material , such as clay or glass . the ceramic support can be inorganic or organic . the suspension may be applied to the membrane in liquid form using a pipet , and then dried to form a green body . the suspension is preferably dried slowly overnight in ambient conditions to prevent cracking of the unfired green body and disruption of the membranous fabric network . after drying , the ceramic powder green body may be fired at a temperature that sinters the powder and permits the membrane fibers to bind to the mechanical support . this temperature will vary depending upon the ceramic powder material used , but is preferably in the range of 500 ° c .- 700 ° c . the sintered ceramic reinforcing phase should be porous and should not restrict access of liquid or gas to the membrane . instead , the composition and pore size of the membrane , not the reinforcing phase , should dictate the catalytic or separative process that occurs . a most preferred method for depositing and reinforcing a sol onto a support involves dipping the support two or more times into the sol then dipping the coated support into a ceramic powder suspension such as powdered glass or alumina whiskers one or more times prior to drying and firing . to obtain a thicker membrane , the two dipping steps may be sequentially repeated before drying and firing . in the preferred embodiment , an alumina - silica sol was used to form the membrane , although any metal or metal oxide sol that can form a porous ceramic membrane , using a sol - gel process known to one skilled in the art , is intended to be within the scope of the present invention . in an alumina - silica sol , molecular or atomic scale mixing of alumina and silica can occur to give a single - phase solid . to prepare a membrane using this procedure , a silicon alkoxide , such as tetramethyl orthosilicate ( tmos ) dissolved in butanol , and aluminum tri - sec - butoxide ( atsb ), also dissolved in butanol , are mixed in the desired aluminum to silicon ratio and allowed to react for a suitable time period , such as an hour . an equal quantity of butanol , containing a small amount of water and concentrated nitric acid , is dropped into the mixed alkoxide system slowly at room temperature . the final resulting sol , which preferably contains about one mole of water and 0 . 07 moles of the concentrated nitric acid per mole of total alkoxide ( tmos and atsb ), is then heated to the boiling point for approximately two hours . the resulting cloudy solution is centrifuged to obtain a transparent sol . in the aluminosilicate system , the particles of the membrane are atomic - level combinations of aluminum and silicon oxides . this , and other methods , such as mixing of separate alumina and silica sols , will produce membranes of mixed alumina and silica materials . using the second procedure , separate particles of alumina and silica oxides are fused in a common particulate membrane creating a continuous fused ceramic material of mixed alumina and silica particles . the sol thus created , and applied to the organic support as described above , may then be dried slowly at room temperature to form a xerogel . such xerogels , once finally dried , may subsequently be fired at temperatures up to 1000 ° c . to produce aluminosilicate or mixed alumina - silica microporous ceramic membranes . at higher temperatures , the porous structure of the membrane would be lost and a unitary solid formed instead . a preferred temperature for sintering aluminosilicate membranes is about 500 ° c . sintering temperatures as low as 200 ° c . have been shown to be sufficient to sinter some porous metal oxide membranes . porous ceramic materials such as those described above have porosities that may be varied for use in catalytic or separation processes . the pore sizes of the materials are determined by the size of the sol particles which are fused together to form the membranes . in essence , if the particles are joined in a close - packing model , the pores of the material are simply determined by the spaces between the spherical particles . thus , the smaller the particle , the smaller the pores . by tightly controlling the sol processing , the particles can be created in a relatively uniform size distribution , resulting in a membrane which has a relatively tight range of mean pore sizes . such materials are particularly useful for separation processes including ultrafiltration , reverse osmosis , and gas separation . pore sizes in the membrane of less than 100 angstroms , which can readily be achieved , permits effective use in ultrafiltration . materials with pore sizes less than 20 angstroms , which have also been made , offer utility particularly for gas separation and molecular sieving . it is noted , however , that while membranes having micropores are described herein , the mean diameter of the pores in a porous ceramic membrane produced according to the method is not intended to limit the scope of the invention . membranes having a mean pore diameter other than those described are prepared by adjusting the size of the particles in the precursor sols from which the membranes are formed . the art is cognizant of the relationship between the size of particles in a precursor sol and the diameter of the pores in membranes formed from the sol . therefore , one of ordinary skill would be able to select an appropriate sol having particles of any desired size for use in the method of the present invention to achieve a microporous or macroporous membrane having a network of macroscopic channels wherein the mean pore diameter of the pores were desired for a particular application . moreover , for purposes of the present invention , the above described membranes are particularly useful in that the channels formed by the removable organic or metal - organic support provide a network within the membrane through which small molecules may be eliminated after the molecules pass through the membrane pores and into the macroscopic channels . the invention may be better understood by consideration of the following examples which are intended to be exemplary rather than limiting : to prepare an aluminosilicate sol , quantities of tetramethyl orthosilicate ( tmos ) and aluminum tri - sec - butoxide ( atsb ) were mixed in butanol . the relative proportions between the tmos and the atsb were adjusted to produce a 15 % alumina : 85 % silica sol . each of the alkoxides was separately dissolved in butanol , and then the two butanol solutions were themselves mixed . the mixture was then allowed to react for approximately one hour . separately , an equal quantity of butanol was prepared containing a small amount of ultrapure water and concentrated nitric acid . the amount of water and nitric acid was calculated so that the final solution contained one mole of water and 0 . 07 moles of concentrated nitric acid per mole of total alkoxide . the aliquot of butanol containing the water and nitric acid was then dripped into the combined alkoxide solution slowly at room temperature . the final solution was then aged by stirring at the boiling point for approximately two hours . the resulting cloudy solution was then centrifuged to obtain a transparent sol . a piece of 100 % cotton cheesecloth with 40 - 50 threads per inch was washed thoroughly in hot water with detergent , rinsed very thoroughly in deionized water , and dried at room temperature . the prepared cheesecloth was cut into roughly circular sheets of approximately 4 &# 34 ; diameter . the cheesecloth , placed in a polystyrene weighing boat , was then barely saturated with the alumino - silicate sol , which had been prepared as described in the preceding example . approximately 5 ml of sol was drizzled from a pipet over each 4 &# 34 ; piece of cheesecloth . the saturation step was performed in a fume hood . the sol - saturated cheesecloth was lifted from the weighing boat with a pair of tweezers to allow excess sol to drip off . to initiate the gelling step , the saturated cheesecloth was then hung from parafilm - lined bulldog clips in a closed box for several hours . after several hours , the box was opened and the sol was allowed to dry further for one day . the gelling step was also performed in a fume hood . the dried , coated cheesecloth was sandwiched between two flat , clean ceramic discs in preparation for firing . the plates minimized uneven shrinkage during subsequent firing steps . also , evenly distributing weight on the cheesecloth during firing results in a more uniform membrane . the gel - coated cheesecloth was fired under the following firing profile : the furnace temperature was increased from room temperature to 1000 ° c . at a rate of 2 ° c . per minute . the 1000 ° c . temperature was maintained for 2 hours , at which time the furnace was turned off and the temperature was allowed to ramp down to room temperature . when cool , the plates were carefully removed from the furnace , examined and tested . in this firing protocol , the cheesecloth organic support was completely pyrolyzed and the resulting membrane assumed the matrix shape of the cheese cloth support , in that the membrane surrounded the support , but gaps existed between the strands of the matrix . henceforth , the membrane formed around a cheesecloth support in the preferred embodiment is termed a &# 34 ; ceramic fabric .&# 34 ; the ceramic fabric of the previous example was stabilized by filling in the void spaces between strands of the ceramic fabric with a powdered ceramic suspension . to form the powdered ceramic suspension , high - temperature resistant glass ( e . g ., pyrex ®) beakers or plate glass sheets were crushed to a powder which was suspended in water . alternatively , alumina whiskers ( ceramic fibers ), or mixtures of powdered pyrex ® glass with alumina whiskers , were resuspended in water . the suspension was carefully applied , using a pipet , to the void spaces . care was taken to avoid the channel exit holes at the sides of the ceramic fabric . the ceramic powder suspension was air dried slowly at ambient temperature for one day and was then sintered at 500 ° c .- 750 ° c . the results indicate that porous ceramic membranes may be produced by forming the membrane around removable organic supports . these porous membranes are useful for catalytic or separation processes like existing porous metal oxide membranes . however , the novel addition of macroscopic channels into the membranes expands their utility for both catalytic and separation processes . it is believed that the advantageous utility of these membranes arises from their increased surface area to volume ratio . as a further result of that feature , these membranes are less expensive to manufacture than existing membranes with lower surface area to volume ratios . because of the combination of the acidic alumina molecules and the basic silica molecules within the same membrane , these materials exhibit catalytic properties . in addition , the materials have higher temperature stabilities than other comparable membranes made with transition metals . the materials thus combine high temperature stability , very small pore size , and a ph stability greater than that achieved with either silica or alumina membrane materials by themselves . thus the materials seem aptly configured for applications in separation and catalysis . | 2 |
a 6xxx aluminum alloy having both copper and zinc ( the “ 6xxx + cu + zn alloy ”) is direct chill cast as an ingot . this alloy is similar to that disclosed in u . s . pat . no . 6 , 537 , 392 . the 6xxx + cu + zn alloy has the composition provided for in table 3 , below . after casting , the ingot is homogenized and then hot rolled to an intermediate gauge of 2 . 0 inches . the 2 . 0 inch body is split into five sections , bodies a - e . body a is conventionally processed into sheet by hot rolling the 2 . 0 inch plate to a second intermediate gauge of 0 . 505 inch , then cold rolling into sheet having a final gauge of 0 . 194 inch , after which it is solutionized ( sheet a ), stretched about 1 % for flatness . bodies b - e are processed into sheet using the new process by hot rolling to second intermediate gauges of 1 . 270 inches ( body e ), 0 . 499 inch ( body d ), 0 . 315 inch ( body c ), and 0 . 225 inch ( body b ), and then solutionizing , and then cold rolling these bodies to a final sheet gauge of about 0 . 200 inch . sheet b receives about 11 % cw , sheet c receives about 35 % cw , sheet d receives 60 % cw and sheet e receives about 85 % cw . a sample of sheet a is thermally treated at 350 ° f . since sheet a was solutionized and then thermally treated , i . e ., no cold work was applied between the solutionizing and thermal treatment step , sheet a is considered to be treated to a t6 temper . the mechanical properties of the sample from sheet a are measured as a function of time at various intervals . various samples from sheets b - e are thermally treated . a first set is thermally treated at 300 ° f ., a second set is thermally treated at 325 ° f ., a third set is thermally treated at 350 ° f ., a fourth set is thermally treated at 375 ° f ., and a fifth set is thermally treated at 400 ° f . the mechanical properties of each the samples from of sheets b - e are measured as a function of time at various intervals . fig1 - 23 illustrate the thermal treatment response of sheets a - e . the sheets made by the new process ( sheets b - e ) achieve higher strength and in a shorter period of time relative to the conventional sheet product ( sheet a ). table 4 , below illustrates some of the tensile properties using the 350 ° f . thermal treatment condition , all values in ksi and in the lt ( long transverse ) direction . as illustrated in table 4 , above , and fig1 , sheets c - e made by the new process and having at least 25 % cold work realize an increase in strength over sheet a . indeed , sheet e with 85 % cw and thermally treated at 350 ° f . realizes about a strength of 70 . 9 ksi and with only 2 hours of thermal treatment ( its peak strength may be higher since it achieved high strength so quickly ). the conventionally processed sheet ( sheet a ) in the t6 temper reaches its measured highest strength around 16 hours of thermal treatment , and then only realizes a strength of about 55 . 3 ksi . in other words , new sheet e achieves about a 28 % increase in tensile yield strength over the strength of the conventionally prepared material , and with only 2 hours of thermal treatment ( i . e ., 87 . 5 % faster , ( 1 − 2 / 16 )* 100 %= 87 . 5 %). stated differently , new sheet e achieves about a 28 % increase in strength over conventional sheet a and in about 1 / 10 th of the time required for sheet a to its peak strength of 55 . 3 ksi . sheets c , d and e with more than 25 % cold work realize tensile yield strengths in excess of 60 ksi . sheets d and e with 60 % and 85 % cold work , respectively , realize tensile yield strengths in excess of 65 ksi , indicating that more than 35 % cold work , such as more than 50 % cold work , may be required to regularly achieve tensile yield strengths in excess of 60 ksi for this particular alloy . fig1 - 21 illustrate the yield strengths for sheets b - e at various thermal treatment temperatures . as illustrated , at higher thermal treatment temperatures the time required to attain a given yield strength gets progressively shorter . due to this short thermal treatment time , it is possible that paint baking cycles or coating cures could be used to thermally teat new 6xxx aluminum alloy bodies , making them particularly useful for automotive applications and rigid container packaging applications , among others . given these significant strength increases , a significant drop in ductility would be expected for sheets b - e . however , as shown in table 5 , below and fig2 , the 6xxx + cu + zn aluminum alloy bodies realize good elongation values . all elongation values are in percent . similar elongation values are measured for the samples thermally treated at 300 ° f ., 325 ° f ., 375 ° f ., and 400 ° f . samples from sheets a - e are thermally treated , the conditions of which are provided in table 6 , below (“ the test 2 samples ”). mechanical properties are measured , the averages of which are also provided in table 6 . sheets c - e of the new process and having more than 25 % cold work achieve higher strengths than the sheet a product of the old process , and in all directions , while sheet b with less than 25 % cold work realizes similar properties to that of sheet a . the test 2 samples from sheets a - e are also subjected to strain fatigue testing in accordance with astm e606 , the results of which are illustrated in fig2 - 25 . as shown , the sheets made by the new process and with more than 25 % cold work realize high cycle fatigue performance over the conventionally processed material , i . e ., sheet a in the t6 temper . in the low cycle ( high strain ) regime , these sheets are similar or better than sheet a . the test 2 samples from sheets a - e are subjected to fracture toughness testing in accordance with astm e561 and b646 . the fracture toughness is measured using m ( t ) specimens with a width of about 6 . 3 inches and a thickness of about 0 . 2 inch , with an initial crack length of from about 1 . 5 to about 1 . 6 inches ( 2a 0 ). the measured k app values from the fracture toughness test are provided in table 7 , below . the above - noted strength values are also reproduced for convenience . sheets d - e realize only slightly lower fracture toughness than sheet a , even though sheets d - e have much higher strength . all of the results are within a relatively narrow range of ˜ 57 to 63 ksi √ in . r - curve data ( not shown ) indicates that , despite the range in strength of the material , all of sheets a - e have similar r - curves . fig2 illustrates the strength and fracture toughness values using the k app values of table 7 and the lt strength values of table 6 . generally , the new alloy bodies produced by the new process and having more than 25 % cold work realize a similar or better combination of strength and fracture toughness relative to the conventionally produce t6 product . for example , sheet e of the new process with 85 % cw realizes about a 37 % increase in strength , with only about a 1 . 6 % decrease in fracture toughness over sheet a in the t6 temper . the test 2 samples from sheets a - e are tested for corrosion resistance in accordance with astm g110 . the test results are summarized in table 8 , below . the average and maximum depth - of - attack ( from 10 readings ) for each of sheets a - e are provided . overall , the results indicate that the new processing methodology does not significantly affect the corrosion performance of the alloy . in fact , increasing cold work appears to decrease the average and max depth of attack . the 6xxx + cu + zn alloy bodies are also tested for grain structure as per the oim procedure , described above . the results are provided in table 9 , below . the new 6xxx + cu + zn alloy bodies with more than 25 % cold work have a predominately unrecrystallized microstructure , having a volume faction of not greater than 0 . 12 first type grains ( i . e ., 88 % unrecrystallized ) in all instances . conversely , the control body is nearly fully recrystallized having a volume fraction of 0 . 98 first type grains ( i . e ., 2 % unrecrystallized ). the r - values of the 6xxx + cu + zn alloy bodies are also tested as per the r - value generation procedure , described above . the results are illustrated in fig1 and table 2 , described above . the new 6xxx + cu + zn alloy bodies with 60 % and 85 % cold work have high normalized r - values , both achieving a maximum r - value of more than 3 . 0 , and achieving this maximum normalized r - value at an orientation angle of 50 °. these high r - values may be indicative of the unique texture , and thus microstructure , of the new 6xxx + cu + zn alloy bodies described herein . the new 6xxx + cu + zn alloy bodies with 60 % and 85 % cold work also realize about 369 % to 717 % higher maximum r - values as compared to the r - value of the control body ( for the purpose of measuring r - values , the control is in the t4 temper , not the t6 temper ). several multi - layered products comprising aa3104 as the cladding and aa6013 as the core is produced similar to the methodology of fig1 , described above , and in the h temper . the multi - layered product is produced in both the 2 - layer ( 3014 - 6013 ) and the 3 - layer ( 3104 - 6013 - 3104 ) form . the mechanical properties of the multi - layered products are tested in both the h1x temper and after curing of the coating . the results are provided in table 10 , below . all multi - layered products realize an improved combination of strength and ductility over the standard 3104 alloy product , realizing an increase in tys ( after cure ) of from about 17 ksi to 30 ksi , and with similar or better ductility . the clad layer of 3104 may be used to restrict pick - up of aluminum and oxides on the ironing dies during can making . the core layer of 6013 may be thermally treated during the coating cure , which may increase its strength . aluminum association alloy 6013 is produced in manner similar to that of example 1 , and its mechanical properties are measured . alloy 6013 is a zinc - free , copper - containing 6xxx alloy . the composition of the tested 6013 alloy is provided in table 11 , below . the mechanical properties are illustrated in fig2 - 35 . alloy 6013 achieves a peak lt tensile yield strength of about 64 - 65 ksi with 75 % cold work and 60 - 61 ksi with 55 % cold work , which is several 8 - 13 ksi higher than the peak strength of the control alloy ( t6 ). the 75 % and 55 % cold worked alloys realize these strengths faster than the control ( t6 ) alloy . the optical properties of the control , 55 % cold work and 75 % cold work 6013 sheets is evaluated using a hunterlab dorigon ii ( hunter associates laboratory inc , reston , va .). the sheets are first mechanical polished to a mirror finish , cleaned , chemically polished , anodized to 0 . 3 mil oxide thickness and sealed . the specular reflectance , image clarity and 2 degree diffuseness are measured to quantify the appearance of the anodized surface . higher specular reflectance and image clarity values are indicative of brighter and more uniform appearance . lower 2 degree diffuseness indicates a reduced level of haze in the reflected image . high specular reflectance and image clarity and low 2 degree diffuseness are valued for applications where the product is used as a reflector ( as in lighting applications ) and in other consumer electronics applications where a bright , uniform surface may be desired . having aluminum alloy products with bright surfaces and high strength may be advantageous in these ( and other ) applications . the measured optical properties of these 6013 sheets are provided shown in table 15 . as shown in the table , the optical properties for the 55 % and 75 % cold work 6013 sheets are improved over the control . the 55 % and 75 % cold work 6013 sheets also have improved strength , as shown above . aluminum association alloys 6022 and 6061 are produced in manner similar to that of example 1 , and their mechanical properties are measured . alloy 6022 is a low copper , zinc - free alloy , having 0 . 05 wt . % cu . alloy 6061 is another low - copper , zinc - free alloy , having 0 . 25 wt . % cu . the compositions of the tested 6022 and 6061 alloys are provided in tables 12 and 13 , below . the mechanical properties are illustrated in fig3 - 37 . neither alloy 6022 nor 6013 is able to achieve an lt tensile yield strength of more than 60 ksi . the results of examples 1 - 4 indicate that the strengthening response of an alloy relative to the new process disclosed herein may be dependent upon the type and amount of alloying elements used . it is believed that alloying elements that promote strain hardening and / or precipitation hardening may provide improved properties . it is also believed that the alloys may require sufficient solute to achieve improved properties . it is believed that the 6xxx + cu + zn alloy and the 6013 alloy are able to achieve the more than 60 ksi strengths because they contain sufficient solute ( e . g . additional copper and / or zinc ) to facilitate a high degree of hardening response ( strain and / or precipitation ). it is believe that alloys 6061 and 6022 do not achieve the 60 ksi strength level because they do not appear to have sufficient solute to facilitate a high degree of hardening response when high cold working and an appropriate thermal treatment are applied . the r - values of the 6061 and 6022 alloys are also tested as per the r - value generation procedure , described above , the results of which are illustrated in fig3 - 39 . the results indicate that these alloys have a different microstructure than the higher solute 6xxx + cu + zn and 6013 alloys . the 6022 alloy ( fig3 ) does not have a maximum r - value in the orientation angle range of from 20 ° to 70 °, as was realized by the 6xxx + cu + zn alloy . indeed , the shape of the r - curve nearly mirrors the control specimen , realizing its maximum r - value at an orientation angle of 90 °. as shown in fig3 , the 6061 alloy attains a maximum r - value at an orientation angle of 45 °, but achieves an r - value of less than 3 . 0 . a 6xxx alloy with high magnesium ( 6xxx - high - mg alloy ) is produced in sheet and plate form in a manner similar to that of example 1 . the final thickness of the sheet is 0 . 08 inch and the final thickness of the plate is 0 . 375 inch . the composition of the 6xxx - high - mg alloy is provided in table 14 , below . the 6xxx - high - mg alloy has low copper at 0 . 14 wt . % and is zinc - free ( i . e ., contains zinc only as an impurity ). the mechanical properties of the 6xxx - high - mg alloy are illustrated in fig4 - 51 . the 6xxx - high - mg alloy in sheet form achieves an lt tensile yield strength of more than 60 ksi when cold worked and with good elongation . the results of examples 4 and 5 show that such high - mg 6xxx alloys may achieve at least 60 ksi lt yield strength , with low levels of copper and without zinc ( i . e ., zinc as an impurity only ). the high magnesium may promote a strain hardening response and / or precipitation hardening response . other high - magnesium alloy bodies may realize a strength level of less than 60 ksi , but may still find utility in various product applications . while various embodiments of the present disclosure have been described in detail , it is apparent that modifications and adaptations of those embodiments will occur to those skilled in the art . however , it is to be expressly understood that such modifications and adaptations are within the spirit and scope of the present disclosure . | 2 |
as illustrated in fig1 and 2 , the present invention provides a specially designed adapter / tooth point assembly 10 which may be suitably secured to a front edge section 12 a of a lip portion 12 of a bucket structure used in excavation operations . assembly 10 is elongated in a left - to - right or front - to - rear direction and longitudinally extends along a horizontal axis a 1 . the assembly 10 includes an adapter member 14 , a wear member representatively in the form of a removable tooth point 16 , and a suitable elongated connector structure 18 which is representatively a connector pin having a circular cross - section along its length , but which may be of an alternate construction if desired . connector pin 18 longitudinally extends along a horizontal axis a 2 which is transverse to axis a 1 . the adapter 14 includes a generally u - shaped base portion 20 having a closed left or front end section 22 from which vertically spaced apart top and bottom side legs 24 , 26 rearwardly extend , legs 24 , 26 defining a cavity 28 therebetween . front end section 22 has a forwardly facing , convexly curved outer end surface 30 from which a reduced cross - section tapered nose portion 32 forwardly projects , the rear end of the nose 32 being circumscribed by the convexly curved end surface 30 of the adapter base 20 . outer or front end surface 30 curves rearwardly about a horizontal axis a 3 which is parallel to and spaced rearwardly apart from the axis a 2 . adapter nose 32 has , at its front end , a stabilizing tip portion 34 with generally horizontal top and bottom sides 36 , 38 and a front end surface 40 . diverging top and bottom side surfaces 42 , 44 of the adapter nose 32 respectively slope upwardly and downwardly from the tip portion 34 to the convexly curved outer end surface 30 . a circular connection opening 46 , positioned rightwardly or rearwardly from the tip portion 34 , extends horizontally through the adapter nose 32 between its opposite left and right sides as viewed from the front end of the adapter nose 32 . tooth point 16 has a pointed leading or front edge portion 48 , opposite left and right vertical side walls 50 and 52 , and rearwardly and vertically diverging top and bottom side walls 54 and 56 disposed at the rear of the tooth point 16 . the right or rear end surface 58 of the tooth point 16 has a forwardly concave curvature substantially identical to the forwardly convex curvature of the outer end surface 30 of the adapter base portion 20 . a forwardly and inwardly tapered pocket 60 extends forwardly into the tooth point 16 through its concavely curved rear end surface 58 and is laterally enveloped by the outer side wall section of the tooth point 16 . pocket 60 has a shape generally complementary to that of the adapter nose 32 , and forwardly terminates within the tooth point 16 at a vertical front end surface 61 . aligned connection openings 62 ( only one of which is visible in the drawings ) are formed through the opposite vertical side walls 50 , 52 and are spaced apart along the axis a 2 . openings 62 have non - circular configurations , are slightly elongated in the vertical direction , and are curved generally parallel to the curvature of rear tooth point surface 58 . for purposes later described herein , the sloping top and bottom side walls 54 , 56 have rear portions 54 a , 56 a that rearwardly extend past the top and bottom edges of the concavely curved rear end surface 58 of the tooth point 16 . the adapter 14 is operatively mounted on the front edge section 12 a of the bucket lip 12 by placing the lip section 12 a in the adapter cavity 28 and then securing the top and bottom adapter legs 24 , 26 to the lip section 12 a in a suitable known manner not pertinent to the present invention . tooth point 16 is mounted on the adapter 14 by inserting the adapter nose 32 into the point pocket 60 , so that the entire lateral periphery of the inserted nose 32 is enveloped by the tooth point 16 , and then inserting the connector pin 18 through the aligned tooth point openings 62 and the adapter nose opening 46 . as illustrated , the diameter of the connector pin 18 is somewhat less than the horizontal widths of the tooth point openings 62 . in this manner , the pin 18 is protected against the imposition of rearwardly directed tooth point loads as the point / adapter interface areas begin to wear away prior to tooth point replacement . with the tooth point 16 mounted on the adapter 14 in this manner , the front end surface 40 of the adapter nose tip portion 34 abuts the forward end surface 61 of the point pocket 60 , and the concavely curved rear end surface 58 of the tooth point 16 slidingly and complementarily abuts the identically curved convex front end surface 30 of the adapter base 20 along essentially the entire extent of the curved tooth point surface 58 . the rearwardly projecting portions 54 a , 56 a of the top and bottom walls 54 , 56 of the tooth point 16 respectively overlap and shield from abrasion front top and bottom exterior surface portions of the adapter base 20 . for a purpose later described herein , the rearwardly projecting wall portions 54 a , 56 a ( which function as abrasion shield structures ) are spaced outwardly apart from their underlying surface portions of the adapter base 20 and form gaps 64 therewith . although the adapter nose 32 and the point pocket 60 have generally complementary configurations , the point pocket 60 is slightly laterally oversized relative to the adapter nose 32 in a manner such that a small interior pocket surface lateral clearance 66 extends around the inserted adapter nose tip portion 34 , and a somewhat larger interior pocket surface lateral clearance 68 extends around the balance of the inserted adapter nose 32 . representatively , but not by way of any limitation , the width of the lateral clearance 66 is approximately 0 . 030 ″, and the width of the lateral clearance 68 is approximately 0 . 060 ″. as will be readily appreciated by those of ordinary skill in this particular art , this designed - in lateral clearance between the adapter nose 32 and the interior surface of the tooth point pocket 60 is in sharp contrast to the snug lateral abutment conventionally provided between a tooth point pocket and an adapter nose operatively inserted therein . this unique lateral clearance between the adapter nose 32 and the interior side surface of the point pocket 60 , coupled with the sliding engagement between the complementarily curved and slidingly abutting adapter base and tooth point surfaces 30 and 58 , permits the tooth point 16 to pivot upwardly and downwardly through a limited vertical arc , as indicated by the arrows 70 , relative to the adapter nose 32 about the horizontal axis a 3 during excavation operations . during this limited pivotal movement of the tooth point 16 , the tooth point surface 58 slides along the corresponding adapter base surface 30 , and the tooth point openings 62 are circumferentially shifted relative to opposite end portions of the pin 18 . the degree of clockwise and counterclockwise pivoting of the tooth point 16 relative to the adapter nose 32 is respectively limited by the abutment of a top point pocket interior surface area with the top side 36 of the adapter nose tip portion 34 , and by the abutment of a bottom point pocket interior surface area with the bottom side 38 of the adapter nose tip portion 34 . the gaps 64 between the rearward abrasion shielding extensions 54 a , 56 a on the tooth point 16 and their underlying adapter base surfaces prevents the extensions 54 a , 56 a from undesirably being brought into forcible contact with the adapter base 20 during this designed - in limited pivotal movement of the tooth point 16 and the adapter nose 32 . during excavation operations , rearward digging forces imposed on the tooth point 16 are transmitted from the front pocket surface 61 to the front end surface 40 of the stabilizing tip 34 , with the reactive force being borne by convexly curved adapter base surface 30 which is pivotally and slidingly engaged by the correspondingly curved tooth point surface 58 . this positioning of the reactive force directly on the adapter base 20 gives the assembly 10 a desirable strength advantage compared to conventional tooth point / adapter assemblies in which such reactive force is borne by the less massive adapter nose portion of the assembly . the unique lateral clearance 66 , 68 extending around the adapter nose 32 advantageously prevents the adapter nose 32 , in response to rearwardly directed digging forces imposed on the tooth point 16 , from wedging into and elastically deforming the tooth point 16 in a manner causing the tooth point 16 to be frictionally locked onto the adapter nose 32 such that removal of the tooth point 16 from the adapter nose 32 becomes an inordinately difficult task . as will readily be appreciated , the relatively small tooth point 16 functions as a replaceable wear member for the adapter nose portion 32 of the much larger adapter portion 14 of the overall assembly 10 . however , the principles of the present invention are not limited to a tooth point / adapter assembly , and may be advantageously employed in a variety of other types of excavation assemblies in which a wear member is mounted on another excavation structure for limited pivotal movement relative thereto . also , while the tooth point 16 has been representatively illustrated and described herein as being pivotable relative to the adapter nose 32 about the horizontal axis a 3 , the tooth point 16 ( or another wear structure such as an intermediate adapter connected to the adapter 32 ) could also be pivotable about a differently oriented axis . furthermore , the illustrated stabilizing adapter nose tip 34 could be shortened or eliminated , if desired , the result being that the pivotal stop surface area on the adapter nose 32 , which functions to limit the pivotal movement of the tooth point 16 relative to the adapter 14 would be shifted rearwardly along the adapter nose 32 . moreover , while the front surface 30 of the adapter base 20 has been representatively illustrated and described herein as having a forwardly convex curvature , and the rear surface 58 of the tooth point 16 has been representatively illustrated and described herein as having a forwardly concave curvature complementary to the curvature of the adapter base surface 30 , it will be appreciated that these curvatures could be reversed , if desired , such that the front surface 30 and the rear surface 58 were respectively provided with complementary concave and convex curvatures . the foregoing detailed description is to be clearly understood as being given by way of illustration and example only , the spirit and scope of the present invention being limited solely by the appended claims . | 4 |
nickel aluminide is found in the nickel - aluminum binary system and as the gamma prime phase of conventional gamma / gamma prime nickel - base superalloys . nickle aluminide has high hardness and is stable and resistant to oxidation and corrosion at elevated temperatures which makes it attractive as a potential structural material . nickel aluminide , which has a face centered cubic ( fcc ) crystal structure of the cu 3 al type ( ll 2 in the stukturbericht designation which is the designation used herein and in the appended claims ) with a lattice parameter a o = 3 . 589 at 75 at . % ni and melts in the range of from about 1385 ° to 1395 ° c ., is formed from aluminum and nickel which have melting points of 660 ° and 1453 ° c ., respectively . although frequently referred to as ni 3 al , tri - nickel aluminide is an intermetallic phase and not a compound as it exists over a range of compositions as a function of temperature , e . g ., about 72 . 5 to 77 at . % ni ( 85 . 1 to 87 . 8 wt . %) at 600 ° c . polycrystalline ni 3 al by itself is quite brittle and shatters under stress as applied in efforts to form the material into useful objects or to use such an article . it was discovered that the inclusion of boron in the rapidly cooled and solidified alloy system can impart desirable ductility to the rapidly solidified alloy as taught in u . s . pat . no . 4 , 478 , 791 . it has been discovered that certain metals can be beneficially substituted in part for the constituent metal nickel . this substituted metal is designated and known herein as a substituent metal , i . e . as a nickel substituent in the ni 3 al structure or an aluminum substituent . by a substituent metal is meant a metal which takes the place of and in this way is substituted for another and different ingredient metal , where the other ingredient metal is part of a desirable combination of ingredient metals which ingredient metals form the essential constituent of an alloy system . for example , in the case of the superalloy system ni 3 al or the tri - nickel aluminide base superalloy , the ingredient or constituent metals are nickel and aluminum . the metals are present in the stoichiometric atomic ratio of 3 nickel atoms for each aluminum atom in this system . the beneficial incorporation of substituent metals in tri - nickel aluminide to form tri - nickel aluminide base compositions is disclosed and described in the copending applications referenced above . moreover , it has been discovered that valuable and beneficial properties are imparted to the rapidly solidified compositions which have the stoichiometric proportions but which have a substituent metal as a quaternary ingredient of such a rapidly solidified alloy system . this discovery , as it relates to a cobalt substituent , is described in copending application ser . no . 647 , 326 filed sept . 9 , 1984 and assigned to the same assignee as the subject application . this application is referenced above and has been incorporated herein by reference . the alloy compositions of the prior and also of the present invention must also contain boron as a tertiary ingredient as taught herein and as taught in u . s . pat . no . 4 , 478 , 791 . a preferred range for the boron tertiary additive is between 0 . 25 and 1 . 50 %. by the prior teaching of u . s . pat . no . 4 , 478 , 791 , it was found that the optimum boron addition was in the range of 1 atomic percent and permitted a yield strength value at room temperature of about 100 ksi to be achieved for the rapidly solidified product . the fracture strain of such a product was about 10 % at room temperature . the composition which is formed must have a preselected intermetallic phase having a crystal structure of the ll 2 type and must have been formed by cooling a melt at a cooling rate of at least about 10 3 ° c . per second to form a solid body the principal phase of which is of the ll 2 type crystal structure in either its ordered or disordered state . the alloys prepared according to the teaching of u . s . pat . no . 4 , 478 , 791 as rapidly solidified cast ribbons have been found to have a highly desirable combination of strength and ductility at room temperature . the ductility achieved is particularly significant in comparison to the zero level of ductility of previous samples . however , it was found that annealing of the cast ribbons led to a loss of ductility . an annealing embrittlement was observed . it is described in copending application ser . no . 783 , 718 , filed oct . 3 , 1985 . such annealing embrittlement leads to a low temperature brittleness . a significant advance in overcoming the annealing embrittlement is achieved by preparing a specimen of tri - nickel aluminide base alloy through a combination of atomization and consolidation techniques . this is also described in the copending application ser . no . 783 , 718 , filed oct . 3 , 1985 . it has been found that tri - nickel aluminide base compositions are also subject to an intermediate temperature ductility minimum . this minimum has been found to occur in the intermediate temperature range of about 600 ° c . to about 800 ° c . we have discovered that the hot - short problem can be overcome through a combination of alloying and thermomechanical processing steps . a set of tri - nickel aluminide base alloys were each individually vacuum induction melted to form a ten pound heat . the compositions of the alloys in atomic percent are listed in table i below . in all of the alloys set forth in this application , the ingredients are given in the amounts and percentages which were added to form the compositions and are not based on analysis of the alloy after formation . table i______________________________________alloy ni co al b______________________________________t - 18 bal . -- 24 . 77 0 . 93t - 19 bal . 9 . 91 24 . 75 0 . 98t - 56 bal . -- 23 . 82 0 . 75______________________________________ the ingots formed from the vacuum melting were re - melted and were then atomized in argon . the atomization was carried out in accordance with one or more of the methods taught in copending applications for patent of s . a . miller , ser . nos . 584 , 687 ; 584 , 688 ; 584 , 689 ; 584 , 690 and 584 , 691 , filed feb . 28 , 1984 and assigned to the assignee of this application . these applications are incorporated herein by reference . other and conventional atomization processes may be employed to form rapidly solidified powder to be consolidated . the powder produced was screened and the fraction having particle sizes of - 100 mesh or smaller were selected . the selected powder was sealed into a metal container and hipped . the hip process is a hot - isostaticpressing process known in the art . in this example , the selected powder specimens were hipped at about 1150 ° c . and at about 15 ksi pressure for a period of about 2 hours . room temperature mechanical properties of the consolidated specimens were evaluated in the as - hip condition . the results are set forth in table iia below . in the tables and other presentation of data which follows , the abbreviations used and their meanings are as follows : y . s . is yield strength in ksi ; ksi is thousand pounds per square inch ; t . s . is tensile strength in ksi ; u . l . is uniform elongation in percent ; uniform elongation is the elongation as measured at the point of maximum strength of a test sample ; e . l . is total elongation in percent ; total elongation is the amount of elongation of a test specimen at the point of failure . where e . l . is greater than u . l ., this is an indication that necking has occurred . table iia______________________________________room temperature properties of as hipped samplesalloy sample t - 18 t - 19 t - 56______________________________________y . s . ( ksi ) 72 79 66t . s . ( ksi ) 138 203 193u . l . (%) 13 35 42e . l . (%) 13 35 45______________________________________ each of these samples has a desirable combination of strength and ductility properties at room temperature or at about 20 ° c . however , each sample displays a substantial loss of ductility at elevated temperature as is made evident from tests of the properties of samples of the same alloys at elevated temperatures as set out in table iib for alloy t - 18 ; table iic for alloy t - 19 and table iid for alloy t - 56 below . table iib______________________________________elevated temperature properties of as - hippedsamples of alloy t - 18testtemp ys ts ul el (° c .) ( ksi ) ( ksi ) (%) (%) ______________________________________t - 18 20 72 138 13 13t - 18 400 111 156 12 12t - 18 500 109 148 9 9t - 18 600 115 122 1 1t - 18 700 -- 25 0 0t - 18 800 -- 12 0 0t - 18 900 -- 42 0 0t - 18 1000 31 31 1 1______________________________________ table iic______________________________________elevated temperature properties of as - hippedsamples of alloy t - 19testtemp ys ts ul el (° c .) ( ksi ) ( ksi ) (%) (%) ______________________________________t - 19 20 79 203 35 35t - 19 400 118 184 29 29t - 19 500 118 178 26 26t - 19 600 123 132 1 1t - 19 700 -- 75 0 0t - 19 800 -- 53 0 0t - 19 900 43 43 1 1t - 19 1000 27 27 1 2______________________________________ table iid______________________________________elevated temperature properties of - hippedsamples of alloy t - 56test t56 t56temp ys ts ul el (° c .) ( ksi ) ( ksi ) (%) (%) ______________________________________t - 56 20 66 193 42 45t - 56 400 92 185 41 41t - 56 600 100 122 12 16t - 56 800 -- 61 0 0t - 56 1000 33 33 0 0______________________________________ the data in the above tables iia , iib , iic and iid are plotted in fig1 and 2 . from the plot of fig1 it is evident that there is a substantial reduction in strength starting at about 600 ° c . from the plot of fig2 it is further evident that each of these alloy samples suffers a ductility minimum in the temperature range of about 600 ° c . to about 900 ° c . essentially all of the as hipped alloy samples have a ductility of zero at a temperature of 800 ° c . also , from the plot of fig2 it is evident that at temperatures above the ductility minimum the ductility increases . the ductility of each sample alloy is higher at 1000 ° c . than it is at 800 ° c . this is characteristic of a hot - short condition in that the ductility minimum occurs over a temperature range but the ductility is higher at lower temperatures outside the range and also at higher temperatures outside the range . a set of three samples of as - hipped alloys prepared as described in example 1 were annealed . the physical properties of the annealed samples were tested and are listed with those of the as - hipped samples in table iiia . table iiia lists hipping and annealing temperatures for the specimens of example 1 and table iiib , table iiic and table iiid list room temperature mechanical properties for the as - hipped samples and also for the as - hipped and annealed samples . table iiia______________________________________temperature of hip and anneal temperatureand time of sample specimens t - 18 t - 19 t - 56______________________________________hip temp : 1165 ° c . 1143 ° c . 1150 ° c . anneal temp : 1000 ° c . 1000 ° c . 1000 ° c . anneal time : 2 hrs . 2 hrs . 1 hr . ______________________________________ table iiib______________________________________room temperature properties of as - hipped and of hippedand annealed specimens of t - 18 alloy ys ts ul el______________________________________t - 18 as hip 72 138 13 13t - 18 hip and 72 154 17 17anneal______________________________________ table iiic______________________________________room temperature properties of as - hipped and of hippedand annealed specimens of t - 19 alloy ys ts ul el______________________________________t - 19 as hip 79 203 35 35t - 19 hip and 84 203 33 33anneal______________________________________ table iiid______________________________________room temperature properties of as - hipped and of hippedand annealed specimens of t - 56 alloy ys ts ul el______________________________________t - 56 as hip 66 193 42 45t - 56 hip and 66 192 41 46anneal______________________________________ it is evident that there was no significant change of values of elongation for any of the specimens measured following the anneal as compared to the as - hipped specimens . consolidated specimens of the t - 18 alloy powder prepared as described in example 1 were subjected to various combinations of heating , cooling and cold working and to various sequences of heating , cooling and cold working . in this example , the specimens of t - 18 referenced in example 1 were treated and tested as set forth in table iv below . the steps applied are listed under the heading processing conditions and the values of the room temperature mechanical properties found are also listed in the accompanying table iv . table iv______________________________________effect of thermo - mechanical processing on room temperaturetensile properties of alloy t - 18processing y . s . t . s . el . condition ( ksi ) ( ksi ) (%) ______________________________________as - hipped ( at 1165 ° c . 72 138 13and 15 ksi for 2 hours ) hipped and annealed at 1100 ° c . 73 85 3for 2 hours and salt bath quenchedhipped and annealed at 1000 ° c . 72 154 17for 2 hourshipped and cold rolled and 1150 ° c . 73 181 28annealed for 1 hour and waterquenchedhipped and cold rolled and 1150 ° c . 73 194 36annealed for 2 hours and chambercooledhipped and cold rolled and 1150 ° c . 73 183 30annealed for 1 hour and furnacecooledhipped and cold rolled and 1000 ° c . 73 194 33annealed for 24 hours and chambercooled______________________________________ it is evident from the property values listed in the above table that , compared to just annealing , significant improvements in strength and ductility can be achieved through a combination of cold working and annealing of boron doped tri - nickel aluminide base alloys which have been atomized from a melt to powder and which have then been consolidated by hipping . consolidated specimens of the t - 18 , t - 19 and t - 56 alloy powders prepared as described in example 1 and then cold worked and annealed were tested at temperatures in the range whre the tri - nickel aluminide base compositions have exhibited a ductility minimum , namely in the temperature range of 600 ° c . to 800 ° c . the tensile properties of the samples of the consolidated t - 18 , t - 19 and t - 56 alloy powders as - hipped and following thermo - mechanical processing were measured and the test values determined are listed in the accompanying table va , vb and vc . the as - hipped properties are as listed in table ii above but are included here for side by side comparison . table va______________________________________property comparison between as - hipped andthermo - mechanically processed t - 18 alloytesttemp ys ts ul el______________________________________t - 18 * 600 115 122 1 1t - 18 * 800 12 0 0t - 18 ** 600 122 125 1 1t - 18 ** 800 35 0 0______________________________________ * as - hipped ** hipped , cold worked 10 % and annealed 1 hour at 1000 ° c . the value of ductility found for the t - 18 alloy at 800 ° c . as listed in table va above is deficient so that an alloy of this composition prepared as described has no utility at intermediate temperatures of 800 ° c . however , from other data in this application , it is evident that the cold worked and annealed consolidated powder composition of t - 18 has a highly useful and valuable set of properties for use at room temperature and at temperatures up to about ( 1137 ° f .) 600 ° c . the same is true for the alloy t - 56 , the test property values of which are listed in table vc below . table vb______________________________________property comparison between as - hipped andthermo - mechanically processed t - 19 alloytesttemp ys ts ul el______________________________________t - 19 * 600 123 132 1 1t - 19 * 800 53 0 0t - 19 ** 600 131 152 13 17t - 19 ** 800 73 82 2 4______________________________________ * as - hipped ** hipped , cold worked 25 % and annealed 1 hour at 1000 ° c . table vc______________________________________property comparison between as - hipped andthermo - mechanically processed t - 56 alloytesttemp ys ts ul el______________________________________t - 56 * 600 100 122 12 16t - 56 * 800 61 61 0 0t - 56 ** 600 108 130 9 13t - 56 ** 800 77 80 0 0______________________________________ * as - hipped ** hipped , cold worked 10 % and annealed 1 hour at 1000 ° c . from this data , it is evident that there is no loss of strength properties as a result of the thermo - mechanical processing , i . e ., cold rolling followed by annealing . it is evident from a consideration of the data of table vb and from comparison of the values determined at 600 and 800 ° c . that the boron doped cobalt containing tri - nickel aluminide of alloy t - 19 has a very surprising high ductility after cold working and annealing which is not present or achieved in the as - hipped material . further , from the data of this and the accompanying tables , it is evident that there is a remarkable improvement in the ductility of the cold worked and annealed sample at both 600 ° c . and at 800 ° c . experimental data as to the improvement made possible by the cold work and anneal of the consolidated t - 19 alloy powder is presented in the accompanying fig3 and 5 as an alternative way of displaying the novel findings of this invention and the advantages which are made possible . in fig3 the yield strength is plotted as ordinate against the temperature of the test sample as abscissa . the values of yield strength found for the as - hipped composition is plotted as a solid line connecting the plus , +, signs . the values found for the cold worked and annealed specimens are plotted as diamonds . as is evident from the figure , the cold working and annealing of the t - 19 tri - nickel aluminum base composition did not result in any loss of yield strength . rather at each temperature where a measurement was made , the value for the cold worked and annealed specimens was higher . in the case of the measurements made at 800 ° c ., the value found for the thermo - mechanically treated specimen was approximately 40 % higher . a similar result was obtained from measurements of tensile strength as is evident from fig4 . the results plotted in fig5 demonstrate that not only are higher values of tensile strength and yield strength obtained from the cold worked and annealed specimens but most important of all , the cold worked and annealed specimens retain significant measures of ductility at elevated temperatures . this is in sharp and dramatic contrast to the values of elongation ( ductility ) which are obtained from the as - hipped sample of t - 19 alloy , the values of which are also plotted in fig5 . it is one of the unique findings of the present invention that the intermediate temperature ductility of a cobalt - containing boron doped tri - nickel aluminide may be improved by preparing a melt of the cobalt containing tri - nickel aluminide to contain 0 . 2 to 1 . 5 atomic percent boron , rapidly solidifying the melt to a powder by gas atomization , consolidating the powder to a solid body by high temperature isostatic pressing , and cold working the consolidated body . a boron doped tri - nickel aluminide alloy was prepared by conventional casting techniques and mechanically worked . the alloy had the composition as set forth in table via . the ingredients are given in atomic percent . table via______________________________________alloy nickel cobalt aluminum boron______________________________________t - 5 balance 14 . 85 23 . 76 1 . 0______________________________________ the ingredients were formed into a melt by induction melting , introduced into a copper chill mold and then allowed to cool to form an ingot . the ingot was processed through a series of cold rolls and anneals with each cold roll being followed by an anneal for two hours at 1100 ° c . samples of the rolled ingot were taken following the series of cold rolls and anneals to test mechanical properties . the mechanical properties found are listed in table vib . table vib______________________________________test y . s . t . s . u . l . t . l . temp . ( ksi ) ( ksi ) (%) (%) ______________________________________ 24 76 180 38 39400 100 163 31 31500 121 141 4 . 8 5 . 2600 123 129 0 . 6 0 . 6700 -- 59 0 . 0 0 . 0______________________________________ it is evident from the test data plotted in table vib that despite extensive thermo - mechanical processing the ductility of the cast samples are inadequate and deficient in the hot - short temperature range of 600 ° c . and 700 ° c . the alloy t - 5 as set forth in example 5 above was formed into a second ingot by the method described in example 5 . the second ingot was thermo - mechanically processed by a more severe set of rollings and a set of anneals at lower temperature and specifically at 1000 ° c . rather than the 1100 ° c . temperature employed in example 5 . the initial reduction was 12 % followed by a 1000 ° c . anneal for two hours . the next two reductions were at higher percentages and each was followed by a two hour anneal at 1000 ° c . the fourth and final rolling reduction was about a 30 % reduction and was followed by a two hour anneal at 1000 ° c . the above practice of rolling reductions and anneals were carried out as described in a journal article by liu et al . and specifically c . t . liu , c . l . white and j . a . horton ; acta . met . 33 ( 1985 ) p . 213 . test specimens were prepared from the rolled ingot and mechanical properties were measured . the mechanical properties determined from these tests are listed in table vii below . table vii______________________________________testtemp y . s . t . s . u . l . e . l . (° c .) ( ksi ) ( ksi ) (%) (%) ______________________________________ 24 89 189 45 48600 116 123 0 . 7 0 . 7700 90 94 0 . 6 0 . 6______________________________________ from the data of table vii it is evident that the ductility of the cast and mechanically worked and annealed sample in the hot - short temperature range of 600 ° c . and 700 ° c . is deficient and that the material of the cast ingot of the alloy is accordingly defective in this respect . an ingot was formed by vacuum melting to have the following composition as set out in table viiia . the concentrations indicated are based on quantities of ingredients added . table viiia______________________________________alloy nickel cobalt aluminum boron______________________________________t - 6 balance 9 . 93 23 . 82 0 . 75______________________________________ the melt was atomized and collected as a dense body on a cold collecting surface according to a spray forming process . one such spray forming process is disclosed in u . s . pat . nos . 3 , 826 , 301 and 3 , 909 , 921 . other processes may also be employed . the deposit formed was removed and subjected to a series of treatments including thermal and thermo - mechanical processing . as for each of the processing steps of this and the other examples above , a test specimen was prepared from the material following each step of processing so that changes in mechanical properties could be determined as they are modified by each processing stage . the processing steps and the test results determined following each processing step are listed in table viiib below . table viiib______________________________________mechanical properties at 600 ° c . ( strain rate 0 . 11 per minute ) y . s . t . s . e . l . u . l . condition ( ksi ) ( ksi ) (%) % ______________________________________as - deposited 104 104 0 . 26 0 . 21two hour anneal 109 109 0 . 31 0 . 31at 1000 ° c . cold work 22 % 114 148 38 25followed by 2hour anneal at1000 ° c . ______________________________________ as is evident from the data recorded in table viiib , the properties of the sample are greatly improved as a result of the cold working practice of the present invention . not only is the tensile property significantly improved , but the ductility is also very markedly improved from a fractional percent to about 25 %, an improvement of some 7500 %. | 2 |
the following description should be read with reference to the drawings , in which like elements in different drawings are numbered in like fashion . the drawings , which are not necessarily to scale , depict selected embodiments and are not intended to limit the scope of the invention . although examples of construction , dimensions , and materials are illustrated for the various elements , those skilled in the art will recognize that many of the examples provided have suitable alternatives that may be utilized . fig1 is a schematic cross - sectional side view of an illustrative solar cell 10 . in the illustrative example shown in fig1 , there may be a three - dimensional intermingling or interpenetration of the layers forming solar cell 10 , but this is not required . the illustrative solar cell 10 includes a quantum dot layer 12 . quantum dot layer 12 may schematically represent a single quantum dot . in some cases , quantum dot layer 12 may be considered as representing a large number of individual quantum dots . in the illustrative embodiment of fig1 , a bifunctional ligand layer 14 is provided , and may schematically represent a single bifunctional ligand , such as those discussed below . in some cases , bifunctional ligand layer 14 may represent a large number of individual bifunctional ligands , with at least some of the bifunctional ligands within bifunctional ligand layer 14 bonded to corresponding quantum dots within quantum dot layer 12 . the illustrative solar cell 10 of fig1 also includes an electron conductor layer 16 . in some cases , electron conductor layer 16 may be an n - type conductor as discussed below . the illustrative solar cell 10 may further include a hole conductor layer 18 . as discussed below , the hole conductor layer 18 may be a p - type conducting electrode layer . quantum dot layer 12 may include one quantum dot or a plurality of quantum dots . quantum dots are typically very small semiconductors , having dimensions in the nanometer range . because of their small size , quantum dots may exhibit quantum behavior that is distinct from what would otherwise be expected from a larger sample of the material . in some cases , quantum dots may be considered as being crystals composed of materials from groups ii - vi , iii - v , or iv - vi materials . the quantum dots employed herein may be formed using any appropriate technique . examples of specific pairs of materials for forming quantum dots include , but are not limited to , mgo , mgs , mgse , mgte , cao , cas , case , cate , sro , srs , srse , srte , bao , bas , base , bate , zno , zns , znse , znte , cdo , cds , cdse , cdte , hgo , hgs , hgse , hgte , al 2 o 3 , al 2 s 3 , al 2 se 3 , al 2 te 3 , ga 2 o 3 , ga 2 s 3 , ga 2 se 3 , ga 2 te 3 , in 2 o 3 , in 2 s 3 , in 2 se 3 , in 2 te 3 , sio 2 , geo 2 , sno 2 , sns , snse , snte , pbo , pbo 2 , pbs , pbse , pbte , an , alp , alas , alsb , gan , gap , gaas , gasb , inn , inp , inas and insb . fig2 is a schematic cross - sectional side view of an illustrative solar cell that is similar to solar cell 10 ( fig1 ). in some cases , a reflective and / or protecting layer may be disposed over the hole conductor layer , as shown . the reflective and / or protecting layer may be a conductive layer . in some instances , the reflective and / or protecting layer may include a pt / au / c film as both catalyst and conductor , but this is not required . alternatively , or in addition , a flexible and optically transparent substrate , shown at the lower side ( in the illustrated orientation ) of fig2 , may be an electron conductor such as an n - type electron conductor . the n - type electron conductor may be transparent or at least substantially transparent to at least some wavelengths of light within the visible portion of the electromagnetic spectrum . in some cases , the n - type electron conductor may include or be formed so as to take the form of a structured pattern or array , such as a structured nano - materials or other structured pattern or array , as desired . the structured nanomaterials may include clusters or arrays of nanospheres , nanotubes , nanorods , nanowires , nano - inverse opals , or any other suitable nanomaterials or shapes as desired . the quantum dots are shown electrically coupled to or otherwise disposed on the electron conductor . in at least some embodiments , the quantum dots may be disposed over and “ fill in ” the structured pattern or array of the electron conductor , as shown in fig2 . it is contemplated that the electron conductor may be formed of any suitable material . in some cases , the electron conductor layer 16 may be an n - type electron conductor . in some instances , the electron conductor layer 16 may be metallic , such as tio 2 or zno . in some cases , electron conductor layer 16 may be an electrically conducting polymer such as a polymer that has been doped to be electrically conductive or to improve its electrical conductivity . as described with respect to fig1 , solar cell 10 may include a bifunctional ligand layer 14 . in some cases , bifunctional ligand layer 14 may include a single bifunctional ligand or a large number of bifunctional ligands . a bifunctional ligand may , in some cases , be considered as improving electron transfer by reducing the energy barriers for electron transfer . a bifunctional ligand may provide a conduit so that electrons which are ejected by the quantum dots can travel to and through the electron conductor . a bifunctional ligand may , for example , secure the quantum dot relative to the electron conductor and / or any other related structure . a variety of bifunctional ligands may be used . in an illustrative but non - limiting example , a bifunctional ligand may be 2 -[ 2 - ethoxycarbonylmethylsulfanyl ) ethyl ]- 1 , 3 - thiazolidine - 4 - carboxylic acid , which has the structure : another illustrative but non - limiting example of a suitable bifunctional ligand is 2 - acetylamino - 3 - benzylsulfanyl propanoic acid , which has the structure : another illustrative but non - limiting example of a suitable bifunctional ligand is isocysteine , which has the structure : another illustrative but non - limiting example of a suitable bifunctional ligand is 2 -[( 2 - oxothiolan - 3 - yl ) carbamoylmethylsulfanyl ] acetic acid , which has the structure : another illustrative but non - limiting example of a suitable bifunctional ligand is phytic acid , which has the structure : another illustrative but non - limiting example of a suitable bifunctional ligand is pentetic acid , which has the structure : as discussed with respect to fig1 , the illustrative solar cell 10 may include a hole conductor layer 18 . a variety of hole conductor materials are contemplated . for example , hole conductor layer 18 may be formed of a p - type electrically conductive polymer . in some instances , hole conductor layer 18 may be formed of or otherwise include : as a repeating unit , where n is an integer ranging from about 6 to about 12 . in some cases , such a material may be formed via a williamson ether synthesis process by combining an appropriate hydroxy - terminated alkyl thiophene with 5 - chloromethyl - 8 - hydroxy quinoline in the presence of sodium hydride . another illustrative but non - limiting example of a polymeric material suitable for forming hole conductor 18 may be formed by combining poly ( 3 , 6 - hydroxyhexyl thiophene ) with 5 - chloromethyl - 8 - hydroxy quinoline in the presence of sodium hydride to provide the following structure as a repeating unit : another illustrative but non - limiting example of a polymeric material suitable for forming hole conductor 18 may be formed by combining poly ( 3 , 11 - hydroxyundecyl thiophene ) with 5 - chloromethyl - 8 - hydroxy quinoline in the presence of sodium hydride to provide the following structure as a repeating unit : another illustrative but non - limiting example of a polymeric material suitable for forming hole conductor 18 may be formed by combining poly ( 3 , 12 - hydroxydodecyl thiophene ) with 5 - chloromethyl - 8 - hydroxy quinoline in the presence of sodium hydride to provide the following structure as a repeating unit : a particular example solar cell may have the following structure : an electron conductor including tio2 ; a bifunctional ligand including 2 -[ 2 -( ethoxycarbonylmethylsulfanyl ) ethyl ]- 1 , 3 - thiazolidine - 4 - carboxylic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 6 - hydroxyhexyl thiophene ) functionalized with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including 2 - acetylamino - 3 - benzylsulfanyl - propanoic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 6 - hydroxyhexyl thiophene ) functionalized with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including isocysteine ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 6 - hydroxyhexyl thiophene ) functionalized with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including 2 -[( 2 - oxothiolan - 3 - yl ) carbamoylmethylsulfanyl ] acetic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 6 - hydroxyhexyl thiophene ) functionalized with 5 chloromethyl - 8 - hydroxylquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including phytic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 6 - hydroxyhexyl thiophene ) functionalized with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including pentetic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 6 - hydroxyhexyl thiophene ) functionalized with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including 2 -[ 2 -( ethoxycarbonylmethylsulfanyl ) ethyl ]- 1 , 3 - thiazolidine - 4 - carboxylic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 11 - hydroxyundecyl thiophene ) with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including 2 - acetylamino - 3 benzylsulfanyl - propanoic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 11 - hydroxyundecyl thiophene ) with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including isocysteine ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 11 - hydroxyundecyl thiophene ) with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including 2 -[( 2 - oxothiolan - 3 - yl ) carbamoylmethylsulfanyl ] acetic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 11 - hydroxyundecyl thiophene ) with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including phytic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 11 - hydroxyundecyl thiophene ) with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including pentetic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 11 - hydroxyundecyl thiophene ) with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including 2 -[ 2 -( ethoxycarbonylmethylsulfanyl ) ethyl ]- 1 , 3 - thiazolidine - 4 - carboxylic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 12 - hydroxydodecyl thiophene ) with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including 2 - acetylamino - 3 benzylsulfanyl - propanoic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 12 - hydroxydodecyl thiophene ) with 5 - chloromethyl - 8 - hydroxyquinoline , as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including isocysteine ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 12 - hydroxydodecyl thiophene ) with 5 - chloromethyl - 8 hydroxyquinoline , as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including 2 -[( 2 - oxothiolan - 3 - yl ) carbamoylmethylsulfanyl ] acetic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 12 - hydroxydodecyl thiophene ) with 5 - chloromethyl - 8 - hydroxyquinoline , as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including phytic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 12 - hydroxydodecyl thiophene ) with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . another particular example solar cell may have the following structure : an electron conductor including tio 2 ; a bifunctional ligand including pentetic acid ; cdse and / or other quantum dots ; and a hole conductor including poly ( 3 , 12 - hydroxydodecyl thiophene ) with 5 - chloromethyl - 8 - hydroxyquinoline as pendant group . these are merely examples and are not intended to be limiting in any way . the disclosure should not be considered limited to the particular examples described above , but rather should be understood to cover all aspects of the invention as set out in the attached claims . various modifications , equivalent processes , as well as numerous structures to which the invention can be applicable will be readily apparent to those of skill in the art upon review of the instant specification . | 8 |
the following detailed description is of the best currently contemplated modes of carrying out the invention . the description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating the general principles of the invention , since the scope of the invention is best defined by the appended claims . various inventive features are described below that can each be used independently of one another or in combination with other features . however , any single inventive feature may not address any of the problems discussed above or may address only one of the problems discussed above . further , one or more of the problems discussed above may not be fully addressed by any of the features described below . as will be appreciated by one skilled in the art , aspects of the present invention may be embodied as a system , method , or computer program product . accordingly , aspects of the present invention may take the form of an entirely hardware embodiment , an entirely software embodiment ( including firmware , resident software , micro - code , etc .) or an embodiment combining software and hardware aspects that may all generally be referred to herein as a “ circuit ,” “ module ” or “ system .” furthermore , aspects of the present invention may take the form of a computer program product embodied in one or more computer readable media having computer readable program code embodied thereon . any combination of one or more computer readable storage media may be utilized . a computer readable storage medium is an electronic , magnetic , optical , or semiconductor system , apparatus , or device , or any suitable combination of the foregoing . more specific examples ( a non - exhaustive list ) of the computer readable storage medium would include the following : a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), a portable compact disc read - only memory ( cd - rom ), an optical storage device , a magnetic storage device , or any suitable combination of the foregoing . in the context of this document , a computer readable storage medium is any tangible medium that can store a program for use by or in connection with an instruction execution system , apparatus , or device . a computer readable signal medium may include a propagated data signal with computer readable program code embodied therein , for example , in baseband or as part of a carrier wave . such a propagated signal may take any of a variety of forms , including , but not limited to , electro - magnetic , optical , or any suitable combination thereof . a computer readable signal medium may be any computer readable medium that is not a computer readable storage medium and that can communicate , propagate , or transport a program for use by or in connection with an instruction execution system , apparatus , or device . program code embodied on a computer readable medium may be transmitted using any appropriate medium , including but not limited to wireless , wireline , optical fiber cable , rf , etc ., or any suitable combination of the foregoing . computer program code for carrying out operations for aspects of the present invention may be written in any combination of one or more programming languages , including an object oriented programming language such as java , smalltalk , c ++ or the like and conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the program code may execute entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the users computer through any type of network , including a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). aspects of the present invention are described below with reference to flowchart illustrations and / or block diagrams of methods , apparatus ( systems ) and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer program instructions . these computer program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which execute via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer program instructions may also be stored in a computer readable storage medium that can direct a computer , other programmable data processing apparatus , or other devices to function in a particular manner , such that the instructions stored in the computer readable storage medium produce an article of manufacture including instructions which implement the function / act specified in the flowchart and / or block diagram block or blocks . the computer program instructions may also be loaded onto a computer , other programmable data processing apparatus , or other devices to cause a series of operational steps to be performed on the computer , other programmable apparatus or other devices to produce a computer implemented process such that the instructions which execute on the computer or other programmable apparatus provide processes for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . the present invention generally provides an environmental control system ( ecs ) that can continuously adapt to changing particulates in contaminated air in the ecs . the contaminated air may include outside air entering the ecs through engines or an apu , or other air sources including ground supplies and electric compressors , as well as recirculating air in the ecs . a controller of the ecs may receive particulate concentration signal ( s ) from one or more sensors that sense particulate concentration ( s ) in the contaminated air . one or more of these particulate concentration signals can then be compared against one or more predicted particulate concentration thresholds ( i . e ., predicted sensory response thresholds ) or average predicted particulate concentration thresholds based on individual predicted particulate concentration thresholds ( i . e ., average sensory response thresholds based on individual predicted sensory response thresholds ). the predicted sensory response threshold ( s ) can be based on one or more sensory thresholds for contaminants , such as odor detection thresholds and / or sensory irritancy thresholds . the odor detection threshold can be characterized by a probability of odor detection . the sensory irritancy threshold can be characterized by a probability of sensory irritancy . if the predicted sensory response threshold is exceeded , the controller may send control signals to an air purification subsystem of the ecs to alter , for example , fan speed , air flow rate , or modulating the operating rate of an air purification system , or opening and closing valves to such an air purification subsystem in the outside air and / or recirculating air entering , for example , an environment . the thresholds of the supply air , the recirculated air , and the cabin air may be different . the method of determining thresholds can be the same for each air source or location . the threshold of the outside air divided by its sensory limit times the flow rate , plus the threshold of the recirculated air divided by its sensory limit times the flow rate , determines the total threshold of the cabin air . the environment may be a cabin of an aircraft or other vehicle , or other space such as a building intended to be occupied by humans . once the particulate concentration signal ( s ) drops below the total threshold of the cabin air , the controller may discontinue commanding the alteration of the contaminated air . thus , the present invention thus enables continuous control of particles in the environment . fig1 is a block diagram of an ecs 10 according to an exemplary embodiment of the present invention . the ecs 10 may include a controller 11 , such as a computer having a processor and a memory , in continuous or intermittent communication with an air purification subsystem 13 and one or more sensors 12 . the sensors 12 may be positioned in various points throughout the ecs to sense particulates in the outside air supplied through engine or apu bleeds , or other air sources including ground supplies and electric compressors , and / or recirculating air in the ecs and / or , in particular , an environment 14 , such an aircraft cabin . in addition to ultrafine particles ( ufps ), contaminants in the ecs may include , for example , vocs and / or svocs . the sensor 12 can be any sensor capable of sensing the anticipated particulates in the contaminated air . one or more of the sensors can sense the concentration of particulates in the contaminant air . for example , the sensor 12 may be a smoke detector , such as a faast aspirating smoke detector by sensor systems of lincolnshire , ill . these types of sensors and their operation is described on the sensor systems website in detailed operating instructions , http :// www . systemsensor . com / en - us / pages / aspiration . aspx , which is incorporated herein by reference in its entirety . the sensors must be optimized for continuous particle detection since they were originally optimized for long term averaging to minimize false alarms that are called in by the unit to a monitoring company or fire station . an example configuration of multiple sensors in an ecs that can be employed in the present invention is shown in us patent application entitled “ aircraft environmental control system that optimizes the proportion of outside air from engines , apus , ground air conditioning units and the recirculated cabin air to maintain occupant comfort and maximize fuel economy ”, filed on jan . 27 , 2015 as ser . no . 14 / 606 , 315 and incorporated herein by reference in its entirety . the air purification subsystem 13 may include various coolers , fans , and filters to alter the contaminated air . an example of an air purification subsystem that can be employed in the present invention is shown in us patent application , entitled “ aircraft environmental control system that optimizes the proportion of outside air from engines , apus , ground air conditioning units and the recirculated cabin air to maintain occupant comfort and maximize fuel economy ,” filed on jan . 27 , 2015 as ser . no . 14 / 606 , 315 and incorporated herein by reference in its entirety . fig1 b is a functional block diagram of the controller 11 according to an exemplary embodiment of the present invention . the controller 11 can include a processor ( not shown ) and a memory ( not shown ) that can store instructions to be executed by the processor to implement a method of removing particulates from a space to be occupied by humans , such as the cabin of an aircraft , according to the present invention . the controller 11 may receive a particulate concentration signal ( s ) from a sensor ( s ) 12 a which may sense ufps from , for example , a cabin filter , a filter to a mix manifold , an ecs pack to a mix manifold , and the mix manifold to the cabin . the controller 11 may also receive a particulate concentration signal ( s ) from a sensor ( s ) 12 b which may sense ufps from bleed air . the controller 11 may then compare the particulate concentration signal ( s ) to a particulate concentration look up table that may have information / data of particulate concentration versus population percentile of a sample database ( e . g ., fig6 a ). in embodiments , the look up table 6 a may include one or more predicted particulate concentration thresholds that are based on and correlate to one or more probabilities of odor detection and / or sensory irritancy detection . based on the foregoing comparison , the controller 11 may then command a valve 13 a to alter valve opening / closing and thereby alter a flow of outside air . also , in addition to or in lieu of the foregoing command , the controller may command a fan 13 b to alter a fan speed of recirculated air . alternatively , the response of the controller may be to modulate an air purification device , increasing or decreasing its power to effect the desired change in air particle concentrations either alone or in combination with commanding the valve 13 a and the fan 13 b , the controller may command an outflow valve 13 c to open or close . the valve 13 c may enable different combinations of outside air and recirculated air to enter the cabin as cabin air 14 c . fig2 a is a flow chart that depicts general exemplary steps of a method 20 , which may be implemented by a controller , such as controller 11 , for altering or removing ufps from an environment such as an aircraft cabin . the method 20 may include , in an embodiment , a step 22 , as further shown in exemplary fig3 a - 3c , which may generally include calculating predicted ( as opposed to actual ) particle concentrations at various sample population percentiles , such as the 75th , 90th , 95th , and 99th percentiles , as well as calculating a mean concentration . the method 20 may include , in an embodiment , a step 23 , as further shown in exemplary fig4 , which may generally include looking up in a database or table predicted , individual ( and / or multiple ) contaminant odor detection thresholds ( i . e ., responses ). the odor detection thresholds can be at various sample population percentiles , which can be the same or different percentiles as the particle concentrations above , as well as a mean odor threshold . the foregoing database or table may further include dose addition odor ratios ( i . e ., probabilities , thresholds or responses ) based on conversions of the individual and / or multiple odor detection thresholds . the method 20 may include , in an embodiment , a step 24 , as further shown in exemplary fig5 , which may generally include looking up in a database or table predicted , individual ( and / or multiple ) contaminant sensory irritancy detection thresholds ( i . e ., responses ). the sensory irritancy detection thresholds can be at various sample population percentiles , which can be the same or different percentiles as the particle concentrations and / or odor thresholds above , as well as a mean irritancy threshold . the foregoing database or table may further include dose addition irritancy ratios ( i . e ., probabilities , thresholds or responses ) based on conversions of the individual and / or multiple irritancy detection thresholds . the method 20 may include , in an embodiment , a step 26 , as further shown in exemplary fig6 a - 6d , which may generally include comparing one or more of predicted sensory response thresholds based on odor detection thresholds ( or dose addition odor ratios ), at various sample population percentiles , to one or more particulate concentration signals from one or more sensors . step 26 may also include , in addition to or in lieu of the foregoing comparison , comparing one or more predicted sensory response thresholds based on sensory irritancy detection thresholds ( or dose addition irritancy ratios ), at various sample population percentiles , to one or more particle concentration signals from one or more sensors . the particulate concentration signals can be based on a combination or mixture of the individual particulate concentration signals determined in steps 12 a , 12 b . the method 20 may include , in an embodiment , a step 27 which may generally include adjusting one or more of the contaminant air sources based on the foregoing comparison ( s ). the adjusting may occur prior to or when the particulate concentration ( s ) reach a predicted particulate concentration threshold ( i . e ., predicted sensory response threshold ). referring to fig3 a , step 22 can include sub - steps 22 a , 22 b , and 22 c according to an exemplary embodiment . in the sub - step 22 a , and as shown in fig3 b 1 - 3 , a database can be created of particulate concentrations from a plurality of air samples at four operations or phases of flight . in the exemplary embodiment of fig3 b , the database can be created from existing data , such as from crump et . al ., “ aircraft cabin air sampling study ; part 2 of the final report ”, institute of environment and health , cranfield university ( 2011 ), and incorporated herein by reference in its entirety . in other embodiments , the database can be created from gathering actual samples and measuring actual concentrations . in the sub - step 22 b , and as shown in fig3 c , sample population percentile can be plotted against actual particulate concentration at one or more of the four phases of flight . also in sub - step 22 b , one or more distribution model plot ( s ) of population percentile versus predicted particulate concentration can be compared against the actual concentration plots to determine which distribution model best fits or matches the actual concentration plots . in the exemplary embodiment shown in fig3 c , four distribution models are used — weibull , 2 - parameter exponential , 3 - parameter weibull , and normal — at one phase of flight . however , more or less than four models can be used , and models other than the ones used in fig3 c can be used . in the example of fig3 c , the 3 - parameter weibull model appears to be the best fit . in the sub - step 22 c , and as shown in fig3 c , using the best fit between model plots and actual plots , predicted particulate concentrations at one or more population percentiles can be determined . therefore , as an example , using the 3 - parameter weibull model as the best fit , predicted particulate concentrations in the model at the 75 th , 90 th , 95 th and 99 th percentiles , as well as a median , can be determined from reading the concentrations on the plotted model . these predicted concentrations at population percentiles can then be included in a database or table , such as in fig6 a , or in a graph , such as in fig6 b , described below . without intending to limit the scope of the present invention , it is noted that the relationship between the concentrations of contaminants in a mixture to predicted odor is believed to be similar to the relationship of concentrations of contaminants in a mixture to predicted sensory irritancy . cometto - muñiz , j . e ., cain , w . s ., abraham , m . h ., & amp ; gola , j . m . r . ( 1999 ). chemosensory detectability of 1 - butanol and 2 - heptanone singly and in binary mixtures . physiology & amp ; behaviour , 67 , 269 - 276 . doi : 10 . 1016 / s0031 - 9384 ( 99 ) 00074 - 8 , which is incorporated herein by reference in its entirety . a strong correlation between dose additivity of a mixture on predicted odor detection levels half - way between chance and perfect detection has been reported at a probability level of 0 . 3 ( 0 . 00 & lt ; p & lt ; 0 . 35 ). cometto - muñiz , j . e ., cain , w . s ., & amp ; abraham , m . h . ( 2003 ). dose - addition of individual odorants in the odor detection of binary mixtures . behavioural brain research , 138 , ( 1 ), 95 - 105 . doi : 10 . 1016 / s0166 - 4328 ( 02 ) 00234 - 6 which is incorporated herein by reference in its entirety . a strong correlation between dose additivity at sensory irritancy detection levels half - way between chance and perfect detection has been reported at a probability level of 0 . 6 ( 0 . 55 & lt ; p & lt ; 0 . 65 ) by cometto - muñiz et al . ( 2003 ). in fig6 b , a graph is of predicted particulate concentration versus sample population percentile — for four phases of flight . a notation 6 b - 1 in fig6 b indicates that studies have shown occupants reporting odor detection at a particulate concentration between about 400 , 000 and 600 , 000 particles per cm 3 . this range of particulate concentrations intersects , in fig6 b , with the plots of take - off and descent . accordingly , in an embodiment , the present invention may be implemented to control the amount of particulates in air particularly during take - off and / or descent . referring back to fig2 and step 23 therein , an exemplary lookup table of predicted contaminant odor detection thresholds is shown in fig4 a - 4b . the manner of creating the lookup table is described in us patent application entitled “ human factors approach to control contaminant concentrations in aircraft supply air from engine bleed and ground sources , and in recirculated air being delivered to aircraft cabins for the optimization of user experience and energy consumption ,” filed on jan . 17 , 2015 , ser . no . 14 / 606 , 617 , and incorporated herein by reference in its entirety . the odor detection thresholds can be at one or more population percentiles , which can be the same or different from those in other steps of the method 20 . as described in u . s . ser . no . 14 / 606 , 617 , predicted contaminant odor detection thresholds can be converted into dose addition odor ratios ( i . e ., probabilities of odor detection ) on a population percentile basis — and either on an individual contaminant basis and / or multiple contaminant basis — as shown for example in fig4 c - 4d . these dose addition odor ratios at different population percentiles and different phases of flight can then be included in a database or table , such as in fig6 a , or in a graph , such as in fig6 c , described below . in fig6 c , a graph is of predicted particle concentration versus voc mass for the dose addition odor ratio versus dose addition odor ratio ( i . e ., probability ). one plot ( 6 c - a ) is of voc mass versus dose addition odor ratios ( i . e ., probabilities of odor detection ). the data points of voc mass , and the data points of dose addition odor ratios , can be obtained from fig6 a . another plot ( 6 c - b ) is of predicted particulate concentration versus dose addition odor ratios — for the take - off phase ( although other phases of flight can be used , such as descent ). the data points of particulate concentration , and the data points of dose addition odor ratios , can be obtained from fig6 a . in fig6 c , a notation 6 c - 1 indicates that at about 500 , 000 particles / cm 3 where there is about a 1 . 0 probability of odor detection , i . e ., all occupants report the detection of odor , the voc mass is about 700 ug / m 3 . a notation 6 c - 2 indicates that at about 150 , 000 particles / cm 3 where there is about a 0 . 3 probability of odor detection , i . e ., only very sensitive occupants report the detection of odor , the voc mass is about 350 ug / m 3 . accordingly , in the region of notation 6 c - 3 , between about 150 , 000 and 400 , 000 particles / cm 3 where there is about a 0 . 3 to 0 . 8 probability of odor detection ( i . e ., predicted sensory response threshold and / or average sensory response threshold ), in an exemplary embodiment , the present invention may be implemented to control the amount of particulates in air , as further described below . again referring back to fig2 and step 24 therein , an exemplary lookup table of predicted contaminant sensory irritancy detection thresholds is shown in fig5 a - 5b . the manner of creating the lookup table is described in us patent application entitled “ human factors approach to control contaminant concentrations in aircraft supply air from engine bleed and ground sources , and in recirculated air being delivered to aircraft cabins for the optimization of user experience and energy consumption ,” filed on jan . 17 , 2015 , ser . no . 14 / 606 , 617 , and incorporated herein by reference in its entirety . the sensory irritancy detection thresholds can be at one or more population percentiles , which can be the same or different from those in other steps of the method 20 . as described in u . s . ser . no . 14 / 606 , 617 , predicted contaminant sensory irritancy detection thresholds can be converted into dose addition sensory irritancy ratios ( i . e ., probabilities of sensory irritancy ) on a population percentile basis — and either on an individual contaminant basis and / or multiple contaminant basis — as shown for example in fig5 c . these dose addition sensory irritancy ratios at different population percentiles and at different phases of flight can then be included in a database or table , such as in fig6 a , or in a graph , such as in fig6 d , described below . in fig6 d , a graph is of predicted particulate concentration versus voc mass for the dose addition irritancy ratio versus dose addition irritancy ratio ( i . e ., probability ). one plot ( 6 d - a ) is of voc mass versus dose addition irritancy ratios ( i . e ., probabilities of sensory irritancy ). the data points of voc mass , and the data points of dose addition irritancy ratios , can be obtained from fig6 a . another plot ( 6 d - b ) is of predicted particulate concentration versus dose addition irritancy ratios — for the take - off phase ( although other phases of flight can be used , such as descent ). the data points of particle concentration , and the data points of dose addition irritancy ratios , can be obtained from fig6 a . in fig6 d , a notation 6 d - 1 indicates that at about 500 , 000 particles / cm 3 where there is about a 1 . 0 probability of sensory irritancy , i . e ., all occupants report sensory irritancy , the voc mass is about 400 ug / m 3 . a notation 6 d - 2 indicates that at about 300 , 000 particles / cm 3 where there is about a 0 . 3 probability of odor detection , i . e ., only very sensitive occupants report the detection of odor , the voc mass is about 300 ug / m 3 . accordingly , in the region of notation 6 c - 3 , between about 300 , 000 and 400 , 000 particles / cm 3 where there is about a 0 . 6 to 0 . 8 probability of sensory irritancy ( i . e ., predicted sensory response threshold and / or average sensory response threshold ), in an exemplary embodiment , the present invention may be implemented to control the amount of particulates in air , as further described below . again referring back to fig2 , step 26 can include , according to an exemplary embodiment , sub - steps 26 a and 26 b . in an embodiment of sub - step 26 a , a comparison can be made between one or more predicted sensory response thresholds ( based on one or more probabilities of odor detection ) and actual particulate concentration detected by one or more sensors 12 . in an embodiment of sub - step 26 b , a comparison can be made between one or more predicted sensory response thresholds ( based on one or more probabilities of sensory irritancy detection ) and actual particulate concentration detected by one or more sensors 12 . in other embodiments , sub - step 26 a and sub - step 26 b need not be combined and can be alternative sub - steps . again referring back to fig2 and in step 27 therein , adjustments to the outside air and / or recirculating air may be made based on the comparisons made in step 26 . in other words , if the detected particle concentration falls in the predicted threshold range of particle concentration ( s ), adjustments to the outside air and / or recirculating air can be implemented . in some embodiments , the controller 11 can command adjustments to the air purification subsystem 13 . as depicted in fig1 b , a valve controlling air flow from an ecs pack to a cabin can be altered 13 a . in addition to , or in lieu thereof , a fan speed can be altered 13 b . it should be understood , of course , that the foregoing relates to exemplary embodiments of the invention and that modifications may be made without departing from the spirit and scope of the invention as set forth in the following claims . | 1 |
referring to fig1 of the drawings , the numeral 11 designates a multi - overlapped coreless filter element constructed according to the principles of the invention . it includes a first multi - overlapped nonwoven fabric strip 13 , a second multi - overlapped nonwoven fabric strip 15 , a third multi - overlapped nonwoven fabric strip 17 , and a fourth multi - overlapped nonwoven fabric strip 19 . each fabric strip 13 , 15 , 17 , 19 is spirally or helically wound in overlapping layers to form overlapping bands 14 , 16 , 18 , 20 , respectively . the radially interior surface 21 of band 14 forms the periphery of an axially extending annular space that extends from one end 25 of the filter element to the oppositely facing end 27 of the filter element 11 . in the drawings the thickness of the fabric is exaggerated . in fig2 of the drawings , the numeral 47 designates a hollow cylindrical mandrel with an annular exterior surface 49 and an annular interior surface 51 , said annular interior surface 51 forming the periphery of a cylindrical channel 53 , through which flows a liquid or gas heat exchange medium ( not shown ). band 14 of multi - overlapped nonwoven fabric strip 13 , is shown overlapped by band 16 of multi - overlapped non - woven fabric strip 15 , which in turn is overlapped by band 18 of multi - overlapped nonwoven fabric strip 17 , which is then overlapped by band 20 of multi - overlapped nonwoven fabric strip 19 . as shown in fig3 of the drawings , only three stages are shown of the multi - stage winding machine shown in greater detail in fig4 . in fig3 a first compression belt 55 is shown wrapping , in a multi - overlapped fashion , nonwoven fabric strip 13 about the hollow mandrel 47 . a second compression belt 57 is shown wrapping , in a multi - overlapped fashion , nonwoven fabric strip 15 about multi - overlapped nonwoven fabric strip 13 . a third compression belt 59 is shown wrapping , in a multi - overlapped fashion , non - woven fabric strip 17 about multi - overlapped nonwoven fabric strip 15 . a first heater array of preferably infrared heaters 63 is shown in a position to apply heat , simultaneously with the compression of compression belt 55 , to multi - overlapped nonwoven fabric strip 13 . a second heater array of infrared heaters 65 is shown in a position to apply heat , simultaneously with the compression of compression belt 57 , to multi - overlapped nonwoven fabric strip 15 . a third heater array of infrared heaters 67 is shown in a position to apply heat , simultaneously with the compression of compression belt 59 , to multi - overlapped nonwoven fabric strip 17 . referring now to fig4 of the drawings , numeral 71 designates a multi - stage winding machine for manufacturing multi - overlapped coreless filter elements 11 . a roll of nonwoven fabric strip 13 is shown mounted on a roll support 75 consisting of an upright member 77 onto which are mounted one or more cylindrical roll support shafts 79 extending perpendicularly outward from the upright member 77 to receive the tubular core ( not shown ) of the roll of non - woven fabric strip 13 . each roll support shaft 79 is connected to the upright member 77 at a point along the length of the upright member 77 . the upright member 77 is connected at its base to a plurality of horizontal legs ( not shown ) which extend perpendicularly outward to such length as to provide support for the upright member 77 , each roll support shaft 79 , and each roll non - woven the fabric strip 13 loaded onto each roll support shaft 79 . a feed tray 81 consists of a rectangular plate with its two longest opposing edges 83 and 85 each turned up at a right angle so as to form a channel which supports and guides and is adjustable to the width of the nonwoven fabric strip 13 . each stage of the winding machine 71 has a feed tray 81 and a tensioner roller 147 connected to an air cylinder ( not shown ). heater array support 87 , a mounting plate for the first heater array 63 , stands vertically in a plane which is perpendicular to the axis 89 of the winding machine 71 . the heater array support 87 is connected along its base edge to a machine support structure 91 which extends parallel to the axis 89 of the winding machine 71 and supports each stage thereof . the heater array support 87 has an input surface ( not shown ) and an output surface 93 . connected to the output surface 93 and extending along the axis 89 and through each stage of the winding machine 71 is a hollow mandrel 47 . attached to the input surface of the heater array support 87 is a conduit ( not shown ) for transporting the heat exchange medium from a pumping device ( represented schematically in fig7 numeral 324 ) to the heater array support 87 , through an aperture ( not shown ) in the heater array support 87 , and into the cylindrical channel 53 ( see fig2 ) of the hollow mandrel 47 . connected to the output surface 93 of the heater array support 87 is a plurality of heater actuators 97 each of which consists of a dial adjustment mechanism 99 connected through a gear mechanism ( not shown ) to a heater actuator plate 101 . attached to each heater actuator plate 101 and extending outward from the output surface 93 of the heater array support 87 and parallel to the axis 89 of the winding machine 71 is an infrared heater 63 . each infrared heater 63 is attached to a corresponding heater actuator plate 101 in such a fashion as to direct the heat perpendicular to and in the direction of the hollow mandrel 47 . each infrared heater 63 extends outward from the output surface 93 of the heater array support 87 a selected distance . a pair of capstans consisting of a driving capstan 105 and a driven capstan 106 stand vertically with their axes ( not shown ) perpendicular to and on either side of the axis 89 of the winding machine 71 . the driving capstan 105 is mounted onto a driving capstan gearbox 107 and the driven capstan 106 is mounted onto a driven capstan gearbox 109 . the driving capstan gearbox 107 is connected at its base to a gearbox platform 113 . the gearbox platform 113 is a rectangular plate that sits atop the machine support structure 91 in a horizontal plane . a capstan driving motor ( represented schematically in fig7 numeral 314 ) is mounted underneath the gearbox platform 113 and has a shaft ( not shown ) which extends through an aperture ( not shown ) in the gearbox platform 113 and connects to the gears of the driving capstan gearbox 107 . the driving capstan gearbox 107 is connected to the driven capstan gearbox 109 by a splined shaft ( not shown in the first - stage , but identical to the splined shaft 111 of the fourth stage ) thereby providing a means for driving the capstans 105 and 106 at the same angular speed but in opposing directions . the driven capstan gearbox 109 is connected at its base to a gearbox sliding plate 115 . the underside of the gearbox sliding plate 115 has a plurality of grooves that extend along its length and parallel to the length of the gearbox platform 113 . the grooves of the gearbox sliding plate 115 receive the rails of a digital linear encoder 117 thereby allowing the digital linear encoders 117 to incrementally measure the location of the driven capstan 109 along the rails of the digital linear encoder 117 relative to a reference point on the digital linear encoder 117 . the digital linear encoder 117 can be of the type disclosed in u . s . pat . no . 4 , 586 , 760 or any other incremental linear measuring device known to persons skilled in the art . near the center of the gearbox platform 113 and cut through the thickness of the platform is an arc - shaped slot ( not shown in the first - stage , but identical to the arc - shaped slot 119 of the fourth stage ), the chord of which is parallel to the length of the gearbox platform 113 . a gearbox platform adjustment set screw ( not shown in the first stage , but identical to the gearbox platform adjustment set screw 121 of the fourth stage ) passes through the arc - shaped slot identical to slot 119 and is received into a threaded aperture ( not shown ) in the machine support structure 91 . the angle of the belt 55 relative to the mandrel 47 may be adjusted with this mechanism . capstan sleeves 123 and 125 are concentric about the axes of the driving capstan 105 and the driven capstan 106 , respectively . the radially interior surfaces of the capstan sleeves 123 and 125 are mated with the radially exterior surfaces of the driving capstan 105 and the driven capstan 106 , respectively , and are attached thereto by suitable means at a selected location on the driving capstan 105 and on the driven capstan 106 . annular capstan sleeve flanges 127 and 129 extend radially outward from the driving capstan 105 and the driven capstan 106 , respectively . compression belt 55 forms a closed loop around one half of the periphery of the driving capstan 105 and one half of the periphery of the driven capstan 106 and is placed in tension by the distance between the axes of the driving capstan 105 and the driven capstan 106 . the compression belt crosses over itself a single time between the driving capstan 105 and the driven capstan 106 . in addition , the compression belt 55 forms a single spiral around the hollow mandrel 47 . a tensioner air cylinder 133 is mounted onto the gearbox platform 113 at the same end as the driven capstan gearbox 109 . the tensioner air cylinder 133 is a commonly used pneumatic cylinder with a shaft 135 that extends from one end of the tensioner air cylinder 133 in parallel with the length of the gearbox platform 113 and is connected at the opposing end to the driven capstan gearbox 109 . three additional stages of the multi - stage winding machine 71 are shown in fig4 . each such additional stage consists of identical components as the first stage with the exception that the heater array support 137 of each additional stage includes an aperture 139 concentric about the axis 89 of the winding machine 71 through which the hollow mandrel 47 passes with sufficient clearance for bands 14 , 16 , 18 , 20 of the filter element 11 ; and with the exception that the feed tray 81 is replaced by a feed tensioner 141 consisting of a vertically upright member 143 connected at its base to a plurality of horizontal legs 145 and connected at the opposite end to feed tensioner rollers 147 . referring now to fig5 of the drawings , a block diagram of each step of the manufacturing process of the nonwoven fabric is illustrated . each significant step of the manufacturing process is depicted in a separate block . in block 151 , step 1 is the acquisition of fiber , usually in the form of a bale purchased from a textile fiber producer . each strip 13 , 15 , 17 , 19 is composed of one or more fibers . if a strip 13 , 15 , 17 , 19 is composed of only one fiber , it should be of the type which consists of a lower melting point outer shell and a higher melting point inner core . if a strip 13 , 15 , 17 19 is composed of two or more fibers , at least one of the fibers must have a lower melting point than the others or be of the shell and core type mentioned above . in block 153 , step 2 is opening and weighing of the fiber materials . the fibers are transported to a synchro - blender where they are further opened in preparation for final blending in block 155 . in block 155 , step 3 is the final blending of the fibers whereby the individual fibers are thoroughly intermixed by a series of cylindrical rollers and lickerins to provide a homogeneous dispersion of fibers . this step is performed in a blender similar to the blender disclosed in u . s . pat . no . 3 , 744 , 092 . in block 157 , step 4 is the transportation of the thoroughly mixed fibers via an air duct system consisting of a duct approximately 12 inches in diameter through which air is circulated at a rate of approximately 1 , 500 feet per minute from the blender to the feeder . in block 159 , step 5 is the feeding of the intermixed fibers into a feeder similar to the feeder disclosed in u . s . pat . nos . 2 , 774 , 294 and 2 , 890 , 497 . block 161 , step 6 is a web formation step in which the fibers are conveyed from the feeder to a webber similar to the webber disclosed in u . s . pat . nos . 2 , 890 , 497 and 2 , 703 , 441 , consisting of a plurality of cylindrical rollers and a lickerin such that a continuous web of the homogeneously dispersed fibers is formed . block 163 , step 7 is a liquefaction and compression step carried out in a series of air - draft ovens and / or alternative heat sources in which a flow of air heated to a selected temperature is blown down onto the web thereby causing liquefaction of all or part of particular types of the homogeneously dispersed fibers as more fully explained hereinafter . simultaneously with the liquefaction of all or part of particular types of the homogeneously dispersed fibers , is compression of the continuously formed web into a thin sheet . the air in the air - draft ovens is saturated to near 100 % with low pressure steam . liquid water is pumped through pipes into the air - draft ovens where it spilled onto heated stainless steel plates thereby creating low pressure steam . the saturation level required is dependent upon the temperature inside the air - draft ovens which ranges from 200 ° to 550 ° fahrenheit . the steam neutralizes the static electricity created by the air which is recirculated at rates of up to 40 , 000 cubic feet per minute . there is a pressure differential across the web in the air - draft oven of between 4 and 8 inches of water column . residence time for the web in the air - draft ovens is dependent upon and coordinated with the discharge rate of the web being produced at the webber . in block 165 , step 8 is the compression of the sheet of homogeneously dispersed fibers into a nonwoven fabric with a thickness required for the desired filtration efficiency by conveying the sheet between two cylindrical stainless steel rollers . in block 166 , step 8 - a , is the formation of a roller of the nonwoven fabric on a winder . in block 167 , step 9 of the manufacturing process is the formation of strips from the sheet of nonwoven fabric . cutting devices are positioned at selected spots across the width of the sheet of nonwoven fabric so as to cut the sheet into a plurality of strips of selected widths thereby forming strips of nonwoven fabric such as 13 , 15 , 17 , 19 . in block 169 , step 10 the nonwoven strips 13 , 15 , 17 , 19 are wound onto cores which are in the form of cylindrical tubes on a commonly known winder consisting of a plurality of cylindrical rollers for aligning and winding the strips of nonwoven fabric 13 , 15 , 17 , 19 onto cores . the entire nonwoven sheet manufacturing process takes place in a humidity - controlled environment . the relative humidity of the air in the environment ranges from 60 % to 80 % as measured by wet bulb / dry bulb thermometer and an enthalpy chart . referring now to fig6 of the drawings , a schematic diagram of the preferred computer based data processing and control system of the winding machine 71 is illustrated . it should be understood that the winding machine 71 may be manually operated . data processing system 200 is controlled primarily by computer readable instructions in the form of software such as intellution written by intellution , inc . of norwood , mass . such software is executed within central processing unit ( cpu ) 250 to cause data processing system 200 to control selected functions of winding machine 71 . cpu 250 retrieves , decodes , and executes instructions , and transfers information to and from other resources via the computer &# 39 ; s main data - transfer path , system bus 254 . system bus 254 connects the components in the data processing system 200 and defines the medium for data exchange . system bus 254 typically includes data lines for sending data , address lines for sending addresses , and control lines for sending interrupts and for operating the system bus . memory devices coupled to system bus 254 include random access memory ( ram ) 256 , read only memory ( rom ) 258 , and nonvolatile memory 260 . such memories include circuitry that allows information to be stored and retrieved . data stored in ram 256 can be read or changed by cpu 250 or other hardware devices . rom 258 contains stored data that cannot be modified . nonvolatile memory is memory that does not lose data when power is removed from it . nonvolatile memories include rom , eprom , flash memory , bubble memory , or battery - backed cmos ram 260 . battery - backed cmos ram 260 may be utilized to store system configuration information . access to ram 256 , rom 258 , and nonvolatile memory 260 may be controlled by memory controller 262 and bus controller 264 . memory controller 262 may provide an address translation function that translates virtual addresses into physical addresses as instructions are executed . memory controller 262 may also provide a memory protection function that isolates processes within the system and isolates system processes from user processes . thus , a program running in user mode can access only memory mapped by its own process virtual address space ; it cannot access memory within another process &# 39 ; s virtual address space unless memory sharing between the processes has been set up . an expansion card or expansion board is a circuit board that includes chips and other electronic components connected in a circuit that adds functions or resources to the computer . typical expansion cards add memory , disk - drive controllers 266 , video support , parallel and serial ports , and internal modems . thus , empty slots 268 may be used to receive various types of expansion cards . disk controller 266 and diskette controller 270 both include special - purpose integrated circuits and associated circuitry that direct and control reading from and writing to a hard disk drive 272 and a floppy disk or diskette 274 , respectively . such disk controllers handle tasks such as positioning read / write head , mediating between the drive and the microprocessor , and controlling the transfer of information to and from memory . a single disk controller may be able to control more that one disk drive . a cd - rom controller 276 may be included in the data processing system 200 for reading data from ( compact disk read - only memory ) cd - rom 278 . such cd - rom disks 278 use laser optics rather than magnetic means for reading data . keyboard mouse controller 280 is provided in the data processing system 200 for interfacing with keyboard 282 and a pointing device , such as mouse 284 . such pointing devices are typically utilized to control an on - screen element , such as a cursor , which may take the form of an arrow having a hot spot that specifies the location of the pointer when the user presses a mouse button . direct memory access ( dma ) controller 286 may be used to provide a memory access that does not involve cpu 250 . such memory accesses are typically employed for data transfer directly between memory and an &# 34 ; intelligent &# 34 ; peripheral device , such as between ram 256 and disk controller 266 . communication between data processing system 200 and other data processing systems may be facilitated by serial controller 288 and network adaptor 290 , both of which are coupled to system bus 254 . serial controller 288 is utilized to transmit information between computers , or between a computer and peripheral devices , one bit at a time over a single line . serial communications can be synchronous ( controlled by some time standard such as a clock ) or asynchronous ( managed by the exchange of control signals that govern the flow of information ). such a serial interface may be utilized to communicate with modem 292 . a modem is a communications device that enables a computer to transmit information over a standard telephone line . modems convert digital computer signals to analog signals suitable for communication over telephone lines . modem 292 may provide a connection to other sources of software , such as a file server , an electronic bulletin board , and the internet or world wide web . network adaptor 290 may be used to connect the data processing system 200 to a local area network ( lan ) 294 . lan 294 may provide computer users with means of communicating and transferring software and information electronically . additionally , lan 294 may provide distributed processing , which involves several computers and the sharing of workloads or cooperative efforts in performing a task . display 296 , which is controlled by display controller 298 , is used to display visual output generated by the data processing system 200 . such visual output may include text , graphics , animated graphics , and video . display 296 may be implemented with a crt - based video display , an lcd - based flat - panel display , or a gas plasma - based flat - panel display . display controller 298 includes electronic components required to generate a video signal that is sent to display 296 . printer 300 may be coupled to the data processing system 200 via parallel controller 302 . printer 300 is used to put text or a computer - generated image onto paper or on another medium , such as a transparency . other types of printers may include an image setter , a plotter , or a film recorder . parallel controller 302 is used to send multiple data and control bits simultaneously over wires connected between system bus 254 and another parallel communication device , such as printer 300 . the most common parallel interface is the centronics interface . during data processing operations , the various devices connected to system bus 254 may generate interrupts which are processed by interrupt controller 304 . an interrupt is a request for attention from cpu 250 that can be passed to cpu 250 by either hardware or software . an interrupt causes the microprocessor to suspend currently executing instructions , save the status of the work in progress , and transfer control to a special routine , known as an interrupt handler , that causes a particular set of instructions to be carried out . interrupt controller 304 may be required to handle a hierarchy of interrupt priorities and arbitrate simultaneous interrupt requests . interrupt controller 304 may also be used to temporally disable interrupts . referring now to fig7 of the drawings , a schematic diagram of the component control system of the winding machine 71 is illustrated . component control system 305 is controlled primarily by computer readable instructions in the form of software . such software is executed within control programmable logic controller ( plc ) 306 to activate component control system 305 . the control plc 306 retrieves , decodes , executes instructions , and transfers information to and from other resources via the component control system &# 39 ; s main data - transfer path , logic control bus 308 . the logic control bus 308 connects the components in the component control system 305 and defines the medium for data exchange . the logic control bus 308 typically includes data lines for sending data , address lines for sending addresses , and control lines for sending interrupts and for operating the logic control bus 308 . communication between component control system 305 and data processing system 200 is facilitated by serial controller 288 which is coupled to serial controller 307 . serial controller 288 is utilized to transmit information between the data processing system 200 and the component control system 305 , through serial controller 307 , one bit at a time over a single line . a plurality of digital logic controllers 310 , 311 , 313 , 315 , 317 , 319 are in communication with the control plc 306 via the logic control bus 308 . digital logic controller 310 is in communication with motor control box 312 which is coupled to and receives data from and transmits operational inputs to one or more capstan driving motors 314 of the winding machine 71 . digital logic controller 311 is in communication with digital linear encoder control box 316 which is coupled to and receives data from one or more digital linear encoders 117 of the winding machine 71 . digital logic controller 313 is in communication with tensioner air cylinder control box 318 which is coupled to and receives data from and transmits operational inputs to one or more tensioner air cylinders 133 of the winding machine 71 . digital logic controller 315 is in communication with heater array control box 320 which is coupled to and transmits operational inputs to heater arrays 63 , 65 , 67 , 68 of the winding machine 71 . digital logic controller 317 is in communication with heat transfer medium pump control box 322 which is coupled to and receives data from and transmits operational inputs to the heat transfer medium pump 324 of the winding machine 71 . digital logic controller 319 is in communication with temperature detecting device control box 323 which is coupled to and receives data from temperature detecting device 326 of the winding machine 71 . each non - woven fabric strip 13 , 15 , 17 , 19 , is composed of selected polymeric fibers such as polyester and polypropylene which serve as both base fibers and binder fibers . base fibers have higher melting points than binder fibers . the role of base fibers is to produce small pore structures in the coreless filter element 11 . the role of the binder fiber or binder material is to bond the base fibers into a rigid filter element that does not require a separate core . the binder fibers may consist of a pure fiber or of one having a lower melting point outer shell and a higher melting point inner core . if the binder fiber is of the pure type , then it will liquify throughout in the presence of sufficient heat . if the binder fiber has an outer shell and an inner core , then it is subjected to temperatures that liquify only the outer shell in the presence of heat , leaving the inner core to assist the base fiber in producing small pore structures . the role therefor of the binder fiber is to liquefy either in whole or in part in the presence of heat , the liquid fraction thereof to wick onto the base fibers to form a bond point between the base fibers , thereby bonding the base fibers together upon cooling . the binder material may be in a form other than fibrous . referring now to the preferred embodiment of the invention , the base fibers and binder fibers are blended according to the manufacturing process set forth in fig5 to form rolls of non - woven fabric strips 13 , 15 , 17 , 19 , each of a selected composition . upon completion of the manufacture of rolls of nonwoven fabric strips 13 , 15 , 17 , 19 , the rolls thereof are loaded onto the roll support shafts 79 of the roll support 75 at each stage of the winding machine 71 . each roll support 75 is positioned to introduce the non - woven fabric strips 13 , 15 , 17 , 19 , at a selected angle to the hollow mandrel 47 . the desired specifications for a multi - overlapped coreless filter element 11 are selected via the keyboard 282 or mouse 284 of the data processing system 200 . according to the software , the cpu 250 retrieves , decodes , executes instructions , and transmits the appropriate information to the control plc 306 of the component control system 305 . the control plc 306 retrieves , decodes , executes instructions , and transmits control information to the digital logic controllers 310 , 311 , 313 , 315 , 317 , 319 , which in turn analyze and format the control information . the control information is communicated to the appropriate motor control box 312 , tensioner air cylinder control box 318 , heater array control box 320 , or heat transfer medium pump control box 322 , which converts the control information into operational inputs and sends the operational inputs to the appropriate capstan driving motor 314 , tensioner air cylinder 133 , heater arrays 63 , 65 , 67 , 68 , or heat transfer medium pump 324 , each of which operates and performs work according to the operational inputs . a length of the non - woven fabric strip 13 is unrolled and fed over the feed tray 81 such that it lies between the upturned edges 83 and 85 of the feed tray 81 . the feed tray 81 is positioned such that the non - woven fabric strip 13 is introduced to the hollow mandrel 47 at a selected angle . according to the operational inputs from the motor control box 312 , the capstan driving motor ( represented schematically in fig7 numeral 314 ) turns the gears of the driving capstan gearbox 107 which turns the driving capstan 105 . the splined shaft of the first stage of the winding machine 71 transmits power to the driven capstan gearbox 109 , the gears of which turn the driven capstan 106 at the same angular speed but in the opposite direction as the driving capstan 105 . friction between the interior surface of the compression belt 55 and the radially exterior surfaces of the driving capstan 105 and the driven capstan 106 allows the belt to turn with the capstans 105 and 106 without tangential slippage . the capstan sleeve flanges 127 and 129 of the capstan sleeves 123 and 125 , respectively , prohibit the compression belt 55 from downward slippage on the driving and driven capstans 105 and 106 , respectively . the leading edge 31 of the non - woven fabric strip 13 is then fed between the annular exterior surface 49 of the hollow mandrel 47 and the compression belt 55 at the point where the compression belt 55 makes its single spiral loop around the hollow mandrel 47 . because the friction drag generated between the compression belt 55 and the non - woven fabric strip 13 is greater than the friction drag generated between the non - woven fabric strip 13 and the hollow mandrel 47 , the coreless filter element 11 is formed in a conical helix shape and is driven along the hollow mandrel 47 toward the free end thereof . the feed angle between the non - woven fabric strip 13 and the hollow mandrel 47 is such that the non - woven fabric strip 13 overlaps itself a plurality of times as it is compressed between the compression belt 55 and the hollow mandrel 47 producing the multi - overlapped conical helix feature of the present invention . the source of the selected compressive force of the compression belt 55 is the tension in the compression belt 55 which is determined by the selected distance between the axes of the driving capstan 105 and the driven capstan 106 . since the driven capstan 106 is connected to the driven capstan gearbox 109 which is connected at its base to the gearbox sliding plate 115 , the driven capstan 106 is free to translate along the rails of the digital linear encoder 117 . the digital linear encoder 117 is coupled to a digital linear encoder control box 316 whereby it transmits data to a digital logic controller 311 and a control plc 306 . the digital linear encoder 117 incrementally measures the location of the driven capstan gearbox 109 along the rails of the digital linear encoder 117 relative to a reference point on the digital linear encoder 117 and transmits that information to the component control system 305 . the location of the driven capstan gearbox 109 is transmitted to the component control system 305 whereby the speed of the capstan driving motor 314 is calculated and transmitted through the motor control box 312 to the capstan driving motor 314 . the compressive force delivered by compression belt 55 to the nonwoven fabric strip 13 is controlled and maintained by a selected pressure in the pneumatic tensioner air cylinder 133 , the shaft 135 of which is connected to the base of the driven capstan gearbox 109 . the pneumatic tensioner cylinder 133 is coupled to a tensioner air cylinder control box 318 whereby it receives operational inputs from a digital logic controller 313 and a control plc 306 . the pressure in the pneumatic tensioner air cylinder 133 is adjusted according to the operational inputs such that its shaft 135 is either extended or retracted thereby controlling and maintaining the compressive force delivered by compression belt 55 to the nonwoven fabric strip 13 . applied simultaneously with the aforementioned compression to the multi - overlapped non - woven fabric strip 13 is a selected amount of heat generated by an array infrared heaters 63 located a selected distance from the non - woven fabric strip 13 . each infrared heater 63 is connected to a heater actuator plate 101 which provides for movement of each infrared heater 63 toward or away from the hollow mandrel 47 . the dial adjustment mechanism 99 of the heater actuator plate 101 allows for incremental adjustment of the distance between each infrared heater 63 and the hollow mandrel 47 . each infrared heater 63 is coupled to a heater array control box 320 whereby it receives operational inputs from a digital logic controller 315 and a control plc 306 , as to a selected voltage of electricity to be supplied to and maintained at each infrared heater 63 for the purpose of heating the multi - overlapped non - woven fabric strip 13 to a selected temperature such that the base fibers of the multi - overlapped non - woven fabric strip 13 are bonded together both within the strip and between the multi - overlapped layers of band 14 by the wicking process of the liquified binder fibers . as the non - woven fabric strip 13 is simultaneously heated and compressed to produce the desired porosity , a heat exchange medium is pumped through the cylindrical channel 53 of the hollow mandrel 47 by a pumping device ( represented schematically in fig7 numeral 324 ) at a selected flow rate for the purpose of maintaining a selected temperature on the exterior surface 49 of the hollow mandrel 47 . the pumping device is coupled to a heat transfer medium pump control box 322 whereby it receives operational inputs from a digital logic controller 317 and a control plc 306 , as to the selected flow rate to be imparted to the heat exchange medium so as to maintain a selected temperature at the exterior surface 49 of the hollow mandrel 47 . one or more temperature detecting devices such as thermocouples ( not shown but represented schematically in fig7 numeral 326 ) are in communication with the heat exchange medium for the purpose of detecting the temperature of the heat exchange medium . each temperature detecting device is coupled to a temperature detecting device control box 323 whereby it transmits data relating to the temperature of the heat transfer medium to a digital logic controller 319 and a control plc 306 . the component control system 305 continuously receives and analyzes signals from the capstan driving motor 314 , digital linear encoder 117 , tensioner air cylinder 133 , heat transfer medium pump 324 , and the temperature detecting device 326 enabling the component control system 305 to continuously transmit updated operational inputs to the capstan driving motor 314 , tensioner air cylinder 133 , heater arrays 63 , 65 , 67 , 68 , and heat transfer medium pump 324 . the data transmitted from the digital linear encoder 117 of each stage of the winding machine 71 is used to calculate and determine the speed of the capstan driving motor 314 of each stage , thereby synchronizing the speed of each capstan driving motor with the first - stage capstan driving motor 314 . the non - woven fabric strip 13 continues to be overlapped upon itself thereby forming band 14 which is driven along the hollow mandrel 47 through the apertures 139 of the heater array supports 137 of each remaining stage of the winding machine 71 in a continuous unending fashion . once band 14 has passed through all stages of the winding machine 71 a length of the second - stage non - woven fabric strip 15 is unrolled and fed between the feed tensioner rollers 147 of a feed tensioner 141 . the leading edge 35 of the non - woven fabric strip 15 is then fed between the compression belt 57 and the annular exterior surface of band 14 at the point where the compression belt 57 makes its single spiral around the hollow mandrel 47 . the nonwoven fabric strip 15 is simultaneously compressed and heated by identical means as the first - stage nonwoven fabric strip 13 . the non - woven fabric strip 15 continues to be overlapped upon itself , thereby forming band 16 , the annular interior surface of which is bonded to the annular exterior surface of band 14 . the combined bands 14 and 16 are driven along the hollow mandrel 47 through the apertures 139 of the heater array supports 137 of each remaining stage of the winding machine 71 in a continuously unending fashion . once the combined bands 14 and 16 have passed through all remaining stages of the winding machine 71 a length of the third - stage non - woven fabric strip 17 is unrolled and fed between the feed tensioner rollers 147 of a feed tensioner 141 . the leading edge 39 of the non - woven fabric strip 17 is then fed between the compression belt 59 and the annular exterior surface of band 16 at the point where the compression belt 59 makes its single spiral around the hollow mandrel 47 . the nonwoven fabric strip 17 is simultaneously compressed and heated by identical means as the first - stage nonwoven fabric strip 13 . the non - woven fabric strip 17 continues to be overlapped upon itself , thereby forming band 18 , the annular interior surface of which is bonded to the annular exterior surface of band 16 . the combined bands 14 , 16 , 18 are driven along the hollow mandrel 47 through the apertures 139 of the heater array supports 137 of each remaining stage of the winding machine 71 in a continuously unending fashion . once the combined bands 14 , 16 , 18 have passed through all remaining stages of the winding machine 71 a length of the fourth - stage non - woven fabric strip 19 is unrolled and fed between the feed tensioner rollers 147 of a feed tensioner 141 . the leading edge 43 of the non - woven fabric strip 19 is then fed between the compression belt 61 and the annular exterior surface of band 18 at the point where the compression belt 61 makes its single spiral around the hollow mandrel 47 . the non - woven fabric strip 19 continues to be overlapped upon itself , thereby forming band 20 , the annular interior surface of which is bonded to the annular exterior surface of band 18 . the combined bands 14 , 16 , 18 , 20 are driven along the hollow mandrel 47 in a continuously unending fashion toward a measuring device ( not shown ) and a cutting device ( not shown ). once the combined bands 14 , 16 , 18 , and 20 have passed through the final stage of the winding machine 71 , the filter element 11 is measured by the measuring device and cut to length by the cutting device . the angular speed of the capstan driving motor is such that the non - woven fabric strips 13 , 15 , 17 , 19 remain in close enough proximity to the infrared heaters 63 , 65 , 67 , 68 for a selected duration of time so as to allow proper liquefaction of the binder fibers . also , sufficient distance between stages is provided so that the binder fibers are allowed to partially cool thereby bonding the base fibers within each nonwoven strip 13 , 15 , 17 , 19 , between each layer thereof , and between each band 14 , 16 , 18 , 20 , providing the desired porosity between each layer and between each band 14 , 16 , 18 , 20 . the simultaneous application of selected amounts of heat and compression to the layers of non - woven fabric strips 13 , 15 , 17 , 19 , is such that only selected properties are altered resulting in a coreless filter element 11 with sufficient structural strength to be self - supporting , i . e ., requiring no structural core , while maintaining the desired porosity . the simultaneous application of selected amounts of heat and compression to the non - woven fabric strips 13 , 15 , 17 , 19 , as described above , allow for systematic variation of the density of the layers of non - woven fabric strips 13 , 15 , 17 , 19 , across the wall of the filter element and the systematic variation of the porosity of the base fibers , of the element 11 . the direction of flow of filtrate through the filter element 11 can be either from the core toward the annular outside wall or from the annular outside wall toward the core , but in either case the filtrate flow is generally perpendicular to the axis of the filter element 11 . however , due to the conical helix nature of the layers of non - woven fabric strips 13 , 15 , 17 , 19 , the pores formed by the bonded base fibers lie at an angle to the axis of the filter element 11 making it more difficult for large particles of filtrate to pass through the filter element 11 . the filter element 11 may be finished by capping the ends 25 and 27 by any suitable means known to persons skilled in the art , such as potting in a polymeric resin . a cable - activated kill switch ( not shown ) extends over the length of the winding machine 71 for the purpose of halting the winding machine 71 . an example of the method and means of manufacturing a filter element of the type shown in fig1 is as follows : four different types of fibers were purchased from hoechst celanese of charlotte , n . c ., sold under the fiber designation &# 34 ; 252 ,&# 34 ; &# 34 ; 121 ,&# 34 ; &# 34 ; 224 ,&# 34 ; and &# 34 ; 271 &# 34 ;. fiber &# 34 ; 252 &# 34 ; was of the core and shell type , whereas fibers &# 34 ; 121 ,&# 34 ; &# 34 ; 224 ,&# 34 ; and &# 34 ; 271 &# 34 ; were of the single component pure type . the denier of fiber &# 34 ; 252 &# 34 ; was 3 and its length was 1 . 500 inches . the denier of fiber &# 34 ; 121 &# 34 ; was 1 and its length was 1 . 500 inches . the denier of fiber &# 34 ; 224 &# 34 ; was 6 and its length was 2 . 000 inches . the denier of fiber &# 34 ; 271 &# 34 ; was 15 and its length was 3 . 000 inches . a first blend of fibers was manufactured from fiber &# 34 ; 121 &# 34 ; and fiber &# 34 ; 252 &# 34 ; composed of 50 % by weight of each fiber type . a second blend of fibers was manufactured from fiber &# 34 ; 224 &# 34 ; and fiber &# 34 ; 252 &# 34 ; composed of 50 % by weight of each fiber type . a third blend of fibers was manufactured with a composition of 25 % by weight of fiber &# 34 ; 121 &# 34 ; and 25 % by weight of fiber &# 34 ; 224 &# 34 ; and 50 % by weight of fiber &# 34 ; 252 &# 34 ;. a fourth blend of fibers was manufactured from fiber &# 34 ; 271 &# 34 ; and fiber &# 34 ; 252 &# 34 ; composed of 50 % by weight of each fiber type . fiber &# 34 ; 252 &# 34 ; being of the core and shell type served as the binder fiber in each of the aforementioned blends . each blend of fibers was manufactured according to the process set forth in fig5 . each blend of fibers was formed into a web which was approximately 1 / 2 inch in thickness . the thickness of each web was reduced by approximately 50 % forming a mat during its residence time of ninety seconds in the air draft ovens due to the recirculation of steam - saturated air at approximately 40 , 000 cubic feet per minute at a temperature of 400 degrees fahrenheit . there was a differential pressure across the mat in the air draft ovens of 6 inches of water . upon exiting the air draft ovens , each mat was fed between two stainless steel cylindrical rollers which compressed the thickness of each mat by approximately 50 % into a sheet of nonwoven fabric with a width of about 37 inches . each 37 - inch wide sheet of nonwoven fabric was cut into 6 - inch wide strips 13 , 15 , 17 , 19 . the basis weight of each sheet of nonwoven fabric was determined and to be in the range of 0 . 5 to 1 . 2 ounces per square foot . as a quality assurance step , once the strips of nonwoven fabric were cut , they were tested on a frasier air flow tester to determine air permeability in cubic feet per minute per square foot . the strips of nonwoven fabric 13 , 15 , 17 , 19 were then loaded onto the roll support shafts 79 of the roll support 75 , one roll at each stage of the winding machine 71 . the specifications of the strips of nonwoven fabric 13 , 15 , 17 , 19 were input into the data processing system 200 with the keyboard 282 and the mouse 284 . the hollow mandrel 47 was made of stainless steel and had a nominal outside diameter of 1 inch . the heat transfer medium pumping device 324 was started and began pumping the heat transfer medium through the hollow mandrel 47 at varying flow rates such that the temperature of the annular exterior surface 49 of the hollow mandrel 47 was maintained at 200 degrees fahrenheit , according to data transmitted from the temperature detecting device 326 to the component control system 305 and operational inputs from the component control system 305 . the first - stage capstan driving motor 314 was started at a control speed of approximately 50 hertz , as instructed by the component control system 305 . the first - stage heater array 63 was turned on and supplied with a voltage of electricity sufficient to create a temperature at the hollow mandrel 47 of 300 degrees fahrenheit . the first band 14 of nonwoven fabric strip 13 was initiated by feeding the nonwoven fabric strip 13 between the hollow mandrel 47 and the first - stage compression belt 55 . the nonwoven fabric strip 13 was helically wound in an overlapping fashion upon itself forming band 14 as it was driven under the compression belt 55 and along the hollow mandrel 47 . as the outside diameter of band 14 increased , the driven capstan 106 moved toward the driving capstan 105 so as to shorten the distance therebetween and maintain a pressure of 10 pounds per square inch exerted on band 14 from compressed belt 55 . this compression pressure was a result of the tension in the compression belt 55 which was developed by the pressure in the tensioner air cylinder 133 of 50 pounds per square inch gage . the movement of the driven capstan 106 was accomplished by altering the pressure in the tensioner air cylinder 133 . the digital linear encoder 117 detected the movement of the driven capstan 106 thereby transmitting the outside diameter of band 14 to the component control system 305 so that appropriate modifications to the speed of the capstan driving motor 314 could be made by the component control system 305 . the temperature created by the infrared heater 63 was the &# 34 ; ironing point &# 34 ; temperature . this ironing point temperature of 300 degrees fahrenheit assisted compression and bonding of the base fibers between the layers of band 14 . under this simultaneous application of heat and compression , the thickness of the strips of nonwoven fabric 13 was compressed by approximately 50 % and there existed interlayer bonding . the band 14 was allowed to travel through each stage of the winding machine 71 and prior to encountering the compression belt at each stage , the capstan driving motor at that stage was turned on and set to the speed of the first - stage capstan driving motor 314 via operational inputs from the component control system 305 . once the band 14 progressed through all stages of the winding machine 71 , the second band 16 of nonwoven fabric strip 15 was initiated by feeding the nonwoven fabric 15 between the second - stage compression belt 57 and the annular exterior surface of band 14 . the nonwoven fabric 15 was helically wound in an overlapping fashion upon itself forming band 16 as it was driven under compression belt 57 and along the hollow mandrel 47 . the second - stage heater array 65 was turned on and supplied with a voltage of electricity sufficient to maintain an ironing point temperature of 300 degrees fahrenheit at the annular exterior surface of band 16 . as the outside diameter of band 16 increased , the second - stage driven capstan moved toward the second - stage driving capstan so as to shorten the distance therebetween and maintain a pressure of 10 pounds per square inch exerted on band 16 from compression belt 57 . this compression pressure was a result of the tension in the compression belt 57 which was developed by the pressure in the second - stage tensioner air cylinder of 50 pounds per square inch gage . the movement of the second - stage driven capstan was accomplished by altering the pressure in the second - stage tensioner air cylinder . the second - stage digital linear encoder detected the movement of the second - stage driven capstan thereby transmitting the outside diameter of band 16 to the component control system 305 so that appropriate modifications to the speed of the second - stage capstan driving motor could be made by the component control system 305 to synchronize the speed of the second - stage capstan driving motor with the first - stage capstan driving motor 314 . the ironing point temperature of 300 degrees fahrenheit assisted compression and bonding of the base fibers between the layers of band 16 . under this simultaneous application of heat and compression , the thickness of the nonwoven fabric strip 15 was compressed by approximately 50 % and there existed interlayer bonding . the annular interior surface of band 16 was bonded to the annular exterior surface of band 14 and band 16 progressed along the hollow mandrel 47 toward the third - stage compression belt 59 . the band 16 was allowed to travel through the remaining stages of the winding machine 71 and prior to encountering the compression belt at each stage , the capstan driving motor at that stage was turned on and set to the speed of the second - stage capstan driving motor 314 via operational inputs from the component control system 305 . once the band 16 progressed through all the stages of the winding machine 71 , the third band 18 of nonwoven fabric 17 was initiated by feeding the nonwoven fabric strip 17 between the third - stage compression belt 59 and the annular exterior surface of band 16 . the nonwoven fabric 17 was helically wound in an overlapping fashion upon itself forming band 18 as it was driven under compression belt 59 and along the hollow mandrel 47 . the third - stage heater array 67 was turned on and supplied with a voltage of electricity sufficient to maintain an ironing point temperature of 300 degrees at the annular exterior surface of band 18 . as the outside diameter of band 18 increased , the third - stage driven capstan moved toward the third - stage driving capstan so as to shorten the distance therebetween and maintain a pressure of 10 pounds per square inch exerted on the band 18 from compression belt 59 . this compression pressure was a result of the tension in the compression belt 59 which was developed by the pressure in the third - stage tensioner air cylinder of 50 pounds per square inch gage . the movement of the third - stage driven capstan was accomplished by altering the pressure of the third - stage tensioner air cylinder . the third - stage digital linear encoder detected the movement of the third - stage driven capstan thereby transmitting the outside diameter of band 18 to the component control system 305 so that appropriate modifications to the speed of the third - stage capstan driving motor could be made by the component control system 305 to synchronize the speed of the third - stage capstan driving motor with the first - stage capstan driving motor 314 . the ironing point temperature of 300 degrees fahrenheit assisted compression and bonding of the base fibers between the layers of band 18 . under this simultaneous application of heat and compression , the thickness of nonwoven fabric strip 17 was compressed by approximately 50 % and there existed interlayer bonding . the annular interior surface of band 18 was bonded to the annular exterior surface of band 16 and band 18 progressed along the hollow mandrel 47 toward the fourth stage compression belt 61 . the band 18 was allowed to travel through the remaining stage of the winding machine 71 and prior to encountering the fourth - stage compression belt , the fourth - stage capstan driving motor was set to the speed of the third - stage capstan driving motor via operational inputs from the component control system 305 . once the band 18 progressed through all the remaining stage of the winding machine 71 , the fourth band 20 of nonwoven fabric strip 19 was initiated by feeding the nonwoven fabric strip 19 between the fourth - stage compression belt 61 and the annular exterior surface of band 18 . the nonwoven fabric strip 19 was helically wound in an overlapping fashion upon itself forming band 20 as it was driven under compression belt 61 and along the hollow mandrel 47 . the fourth - stage heater array 68 was turned on and supplied with a voltage of electricity sufficient to maintain an ironing point temperature of 300 degrees at the annular exterior surface of band 20 . as the outside diameter of band 20 increased , the fourth - stage driven capstan moved toward the fourth - stage driving capstan so as to shorten the distance therebetween and maintain a pressure of 10 pounds per square inch exerted on the band 20 from compression belt 61 . this compression pressure was a result of the tension in the compression belt 61 which was developed by the pressure in the fourth - stage tensioner air cylinder of 50 pounds per square inch gage . the movement of the fourth - stage driven capstan was accomplished by altering the pressure of the fourth - stage tensioner air cylinder . the fourth - stage digital linear encoder detected the movement of the fourth - stage driven capstan thereby transmitting the outside diameter of band 20 to the component control system 305 so that appropriate modifications to the speed of the fourth - stage capstan driving motor could be made by the component control system 305 to synchronize the speed of the fourth - stage capstan driving motor with the first - stage capstan driving motor 314 . the ironing point temperature of 300 degrees fahrenheit assisted compression and bonding of the base fibers between the layers of band 20 . under this simultaneous application of heat and compression , the thickness of nonwoven fabric strip 19 was compressed by approximately 50 % and there existed interlayer bonding . the annular interior surface of band 20 was bonded to the annular exterior surface of band 18 and band 20 progressed along the hollow mandrel 47 toward the measuring and cutting devices whereby it was measured and cut to a length of 30 inches . the resulting filter element 11 had a 1 - inch nominal inside diameter , a 2 . 5 - inch nominal outside diameter and was cut to 30 inches long . it weighed one pound and had an airflow capacity of 20 cubic feet per minute , producing a 4 . 9 inches of water column differential pressure . in an alternate embodiment of the invention , an idler belt may be included at one or more stages of the multi - stage winding machine 71 so as to maintain the hollow mandrel 47 in a properly fixed position . in an alternate embodiment of the invention , a plurality of non - woven fabric strips are added in a single stage of the multi - stage winding machine 71 . while the invention is shown in only one of its forms , it is not just limited but is susceptible to various changes and modifications without departing from the spirit thereof . | 1 |
reference will now be made in detail to various embodiments of the present invention ( s ), examples of which are illustrated in the accompanying drawings and described below . while the invention ( s ) will be described in conjunction with exemplary embodiments , it will be understood that present description is not intended to limit the invention ( s ) to those exemplary embodiments . on the contrary , the invention ( s ) is / are intended to cover not only the exemplary embodiments , but also various alternatives , modifications , equivalents and other embodiments , which may be included within the spirit and scope of the invention as defined by the appended claims . fig2 is an exploded perspective view of an apparatus for locking a table of a seat back s , according to various embodiments of the present invention . the seat back table is installed on the seat back s and includes a front cover 1 , a table frame 10 , the table locking apparatus ( b ), a table support plate 30 and a rear cover 50 . the table frame 10 is fastened to a shaft 100 and rotated along with the shaft 100 . the shaft 100 is coupled to the locking apparatus b such that an angle at which the shaft 100 is rotated is determined in stages . actuating structures are provided on the respective opposite ends of the shaft 100 , that is , on portions designated by the reference characters a and b . the locking apparatus means the portion b . a latch unit c is provided in the lower end of the seat back , so that a latch of the table is inserted into the seat back through a seating hole s 10 and is selectively latched to the latch unit c . fig3 is a perspective view of the table locking apparatus of fig2 . the table frame 10 which is rotated along with the shaft 100 is fastened to the shaft 100 . a spring 120 is provided on a first end ( on the portion a ) of the shaft 100 to elastically support the table frame 10 . the table locking apparatus of the present invention is provided on a second end ( on the portion b ) of the shaft 100 . for the installation of the table locking apparatus , bases 300 are provided on the shaft 100 . fig4 and 5 are perspective views showing the table locking apparatus according to various embodiments of the present invention . the table locking apparatus is provided between the seat back s and the table t and selectively determines a position at which the table t is in a locked state . in detail , the table locking apparatus includes the shaft 100 , which is provided on one end of the table t and rotated along with the table t on the seat back s , and an actuating arm 200 , which is fastened to the shaft 100 and rotated along with the shaft 100 . actuating gear teeth 220 are formed in a distal end of the actuating arm 200 . the table locking apparatus further includes the bases 300 , which are provided on the shaft 100 , and a locking arm 500 , which is provided on one base 300 at a position spaced apart from the shaft 100 by a predetermined distance . locking gear teeth 520 which engage with the actuating gear teeth 220 of the actuating arm 200 are formed in an end of the locking arm 500 which is adjacent to the shaft 100 . the locking arm 500 is elastically supported by an elastic member 562 so that when the actuating arm 200 is rotated in a normal direction , the actuating gear teeth 220 pass over the locking gear teeth 520 in stages . the table locking apparatus further includes a locking arm holding unit 600 , which is provided between the actuating arm 200 and the locking arm 500 . the locking arm holding unit 600 moves the locking arm 500 backwards and holds it in the backwardly moved state after the actuating gear teeth 220 completely pass over the locking gear teeth 520 , thus preventing the actuating gear teeth 220 and the locking gear teeth 520 from interfering with each other when the actuating arm 200 is reversely rotated . furthermore , the locking arm holding unit 600 releases the backwardly moved and held state of the locking arm 500 when the actuating arm 200 is returned to its original position . the bases 300 are disposed on opposite sides of the table t and fastened to the seat back s . each base 30 may be made of several panels , and the shaft 100 may pass through the bases 30 . the shaft 100 is fastened to the table t so that when a user rotates the table t , the shaft 100 is rotated along with the table t . the actuating arm 200 is fitted over and fastened to the shaft 100 and is thus rotated along with the shaft 100 . furthermore , the locking arm holding unit 600 is fitted over the shaft 100 so as to be rotatable with respect to the shaft 100 . when the table t is extracted from the seat back and is rotated upwards , the shaft 100 and the actuating arm 200 rotate in normal directions . when the table t is rotated downwards and is retracted into the seat back , the shaft 100 and the actuating arm 200 rotate in reverse directions . here , the terms ‘ normal direction ’ and ‘ reverse direction ’ merely mean that the directions are opposite each other , but are not to be construed as limiting the present invention . meanwhile , the actuating arm 200 is fitted at a proximal end thereof over the shaft 100 and has the actuating gear teeth 220 in the distal end thereof . it is preferable that the actuating gear teeth 200 be spur gear teeth . furthermore , a guide pin 240 is provided on the actuating arm 200 . a guide slot 620 which guides the guide pin 240 therein and extends a predetermined length along a movement trajectory of the guide pin 240 is formed through the locking arm holding unit 600 . the guide pin 240 is moved along the guide slot 620 of the locking arm holding unit 600 when the actuating arm 200 is rotated . here , the guide pin 240 moves along the guide slot 620 , but the locking arm holding unit 600 maintains the stationary state . the locking arm 500 is provided on the base 300 by a hinge pin 560 below the locking arm holding unit 600 . the locking gear teeth 520 corresponding to the actuating gear teeth 220 are formed on a distal end of the locking arm 500 . it is also preferable that the locking gear teeth 520 are spur gear teeth . the locking arm 500 having the locking gear teeth 520 is supported by the elastic member 562 . when the table t , the shaft 100 and the actuating arm 200 rotate in normal directions , the actuating gear teeth 220 of the actuating arm 200 come into contact with the locking gear teeth 520 of the locking arm 500 . here , when the actuating gear teeth 220 push the locking gear teeth 520 , the locking arm 500 moves while overcoming the elastic force of the elastic member 562 , and the actuating gear teeth 220 pass over the locking gear teeth 520 in stages . the number of stages in which the table t is unfolded is determined depending on the number of actuating gear teeth 220 and the number of locking gear teeth 520 . the table t can maintain a state of having been unfolded at various angles in stages . meanwhile , a locking pin 540 is provided on the locking arm 500 . an insert depression 640 , into which the locking pin 540 is inserted , is formed in the lower end of the locking arm holding unit 600 . a locking depression 642 which extends from the insert depression 640 is formed in the locking arm holding unit 600 . while the locking pin 540 is in a state of having been inserted in the insert depression 640 of the locking arm holding unit 600 , the locking arm holding unit 600 maintains the stationary state as the locking arm 500 and the actuating arm 200 are engaged each other and the locking arm 500 is supported by the elastic member 562 . after the actuating arm 200 is rotated in the normal direction and the actuating gear teeth 220 completely pass over all the locking gear teeth 520 , if the actuating arm 200 is further rotated , the guide pin 240 of the actuating arm 200 pushes a first end 622 of the guide slot 620 , and the locking arm holding unit 600 is thus rotated in the normal direction . then , the locking pin 540 is pushed by the rotation of the locking arm holding unit 600 in the normal direction . thus , the locking pin 540 is removed from the insert depression 640 and locked to the locking depression 642 . when the locking pin 540 enters the locking depression 642 , the locking arm 500 overcomes the elastic force of the elastic member 562 and is moved backwards from its original position . when the locking pin 540 is in the state of having been locked to the locking depression 642 , the locking arm 500 maintains the state of being moved backwards . thereby , the locking gear teeth 520 of the actuating gear 220 no longer engage with the actuating gear teeth 220 of the actuating arm 200 . furthermore , a stop protrusion 660 is provided on an upper end of the locking arm holding unit 600 which is opposite the locking arm 500 . a subsidiary locking unit 700 is provided at a predetermined position on the base 300 . the subsidiary locking unit 700 hooks the stop protrusion 660 in the state in which the locking arm holding unit 600 rotates in the normal direction and the locking arm 500 is thus moved backwards and locked to the locking arm holding unit 600 , thus preventing the locking arm holding unit 600 from being undesirably rotated in the reverse direction . the subsidiary locking unit 700 includes a hook 720 , which is mounted to the base 300 by a hinge pin 722 and hooks the stop protrusion 660 to prevent the locking arm holding unit 600 from being rotated in the reverse direction , and a stopper 740 , which is rotated along with the hook 720 and is supported by a spring 760 . when the actuating arm 200 is rotated in the reverse direction , the stopper 740 is pushed upwards by the guide pin 240 and thus moves the hook 720 backwards to enable the locking arm holding unit 600 to rotate in the reverse direction . the hook 720 and the stopper 740 are mounted together to the base 300 by the hinge pin 722 . the stopper 740 is connected to a spring 760 , which biases the stopper 740 downwards . therefore , when the guide pin 240 of the actuating arm 200 pushes the stopper 740 , the stopper 740 and the hook 720 are rotated upwards . when the guide pin 240 is removed from the stopper 740 , the stopper 740 and the hook 720 are rotated downwards again . when the actuating arm 200 rotates in the normal direction and the locking arm holding unit 600 is rotated in the normal direction by the guide pin 240 , the stop protrusion 660 of the locking arm holding unit 600 is hooked to the hook 720 , thus preventing the locking arm holding unit 600 from rotating in the reverse direction . when the actuating arm 200 rotates in the reverse direction , the guide pin 240 pushes the stopper 740 upwards such that the hook 720 is removed from the stop protrusion 660 . when the guide pin 240 pushes a second end 624 of the guide slot 620 of the locking arm holding unit 600 , the locking arm holding unit 600 is rotated in the reverse direction , and the locking pin 540 is removed from the locking depression 642 and enters the insert depression 640 again . in addition , the locking arm 500 is returned to its original position . fig6 and 7 are sectional views illustrating the operation of the table locking apparatus of fig3 . in an initial stage , the actuating arm 200 is disposed at the upper end of the locking arm holding unit 600 , and the guide pin 240 is disposed on the second end 624 of the guide slot 620 . from this state , when the table t is rotated upwards , the actuating arm 200 is rotated along with the shaft 100 in the normal direction . at this time , the position of the table t is adjusted in stages while the actuating gear teeth 220 pass over the locking gear teeth 520 . after the guide pin 240 is brought into contact with the first end 622 of the guide slot 620 , when the actuating arm 200 is further rotated , the guide pin 240 rotates the locking arm holding unit 600 in the normal direction . then , the locking pin 540 of the locking arm 500 is removed from the insert depression 640 and enters the locking depression 642 . this means that the locking arm 500 overcomes the elastic force of the elastic member 562 and is locked to the locking arm holding unit 600 . hence , the locking arm 500 is maintained in the state of having been moved backwards and locked to the locking arm holding unit 600 . when the locking arm 500 is in the backwardly moved and locked state , the locking gear teeth 520 is prevented from interfering with the actuating gear teeth 220 . therefore , when the table t is rotated downwards , the table t , the shaft 100 and the actuating arm 200 can be rotated in the reverse directions and returned to their original positions . when the guide pin 240 of the actuating arm 200 pushes the second end 624 of the guide slot 620 by the reverse rotation of the actuating arm 200 , the locking arm holding unit 600 is also rotated in the reverse direction . then , the locking pin 540 of the locking arm 500 is removed from the locking depression 642 and inserted into the insert depression 640 again . thus , the locking arm 500 is returned to its original position , at which the locking gear teeth 520 of the locking arm 500 can engage with the actuating gear teeth 220 of the actuating arm 200 . as such , in the present invention , when the table t is rotated upwards , that is , in the normal direction , from the state in which it has been retracted in the seat back s , the angle of the table t with respect to the seat back s can be adjusted in stages . when the table t is maximally rotated upwards , the locking arm 500 is moved backwards and locked , so that the table t enters the state in which it can be rotated in the reverse direction and retracted into the seat back s . after the table t is rotated in the reverse direction at a predetermined angle , the locking arm 500 is returned to its original position . as described above , because the table locking apparatus is provided on one end of the shaft 100 , to which the table t is fastened , the table t can be flush with the surface of the seat back . furthermore , the present invention does not require a separate gas spring mechanism , thus reducing the production cost . fig8 and 9 are front views illustrating the operation of the table locking apparatus . when the guide pin 240 is disposed on the second end 624 which is the uppermost end of the guide slot 620 , the guide pin 240 pushes the stopper 740 upwards and thus supports it . in this state , when the table t , the shaft 100 and the actuating arm 200 are rotated in the normal directions , the guide pin 240 is moved downwards along the guide slot 620 , and the stopper 740 and the hook 720 are returned to their original positions . thereafter , when the guide pin 240 pushes the first end 622 of the guide slot 620 and the locking arm holding unit 600 is thus rotated in the normal direction , the locking pin 540 is removed from the insert depression 640 and inserted into the locking depression 642 while compressing the elastic member 562 . here , because the elastic member 562 of the locking arm 500 always biases the locking arm 500 to its original position , if the locking pin 540 is not in a state of being completely locked to the locking depression 642 , the locking arm 500 is returned to its original position by the elastic force of the elastic member 562 . then , the locking pin 540 strikes the locking arm holding unit 600 because of the force with which the locking arm 500 is returned to its original position . thereby , the locking arm holding unit 600 is rotated again in the reverse direction . to prevent this event , the stop protrusion 660 is provided on the upper end of the locking arm holding unit 600 . in detail , when the locking arm holding unit 600 is rotated in the normal direction , the stop protrusion 660 is hooked to the hook 720 , thus preventing the locking arm holding unit 600 from being undesirably rotated in the reverse direction . when the actuation arm 200 rotates in the reverse direction and thus pushes the stopper 740 upwards , the hook 720 is also pushed upwards and removed from the stop protrusion 660 . when the actuating arm 200 further rotates in the reverse direction until the guide pin 240 pushes the second end 624 of the guide slot 620 , the locking arm holding unit 600 is rotated in the reverse direction . the locking pin 540 is inserted into the insert depression 640 again by the reverse rotation of the locking arm holding unit 600 , and the locking arm 500 is returned to its original position . as described above , in an apparatus for locking a table of a seat back according to the present invention , the table can be locked to the seat back by a relatively simple structure without using a separate gas spring mechanism . furthermore , the angle at which the table is locked to the seat back is adjustable . in addition , a gap between the table and the seat back when the table is retracted into the seat back is minimized , thus ensuring a good appearance , and preventing the table from interfering with knees of a passenger . for convenience in explanation and accurate definition in the appended claims , the terms “ upper ”, “ lower ”, “ downward ”, “ forward ”, and “ reverse ” are used to describe features of the exemplary embodiments with reference to the positions of such features as displayed in the figures . the foregoing descriptions of specific exemplary embodiments of the present invention have been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teachings . the exemplary embodiments were chosen and described in order to explain certain principles of the invention and their practical application , to thereby enable others skilled in the art to make and utilize various exemplary embodiments of the present invention , as well as various alternatives and modifications thereof . it is intended that the scope of the invention be defined by the claims appended hereto and their equivalents . | 8 |
the present invention , as well as features and aspects thereof , is directed towards providing a vane that can be attached to an arrow shaft that provides substantial stabilization in arrow flight , while not increasing the weight of the arrow and / or creating clearance problems with a bow . the present invention includes an arrow vane structure which , through its design characteristics , generally promotes arrow flight stability and consistent flight with differing arrowhead weights , without requiring additional vane side or surface area . in general , embodiments of the invention include a primary vane member . the vane member is substantially rigid to maintain its shape and position during arrow flight , but may be constructed of resiliently bendable material , synthetic or otherwise , which allow bending when contacted by force , but which will subsequently return to its original shape . turning now to the figures in which like labels refer to like elements throughout the several views , various embodiments , aspects and features of the present invention are presented . fig . la is a side - profile diagram of an embodiment of a vane incorporating aspects of the present invention . the vane member 100 includes two main components , the vane fin 105 and the vane base 150 . the vane fin 105 is a flat piece of material having a right - side planar surface 110 and a left - side planar surface 120 ( not shown in this fig1 a ). the shape of the vane fin 105 is defined by a back - edge or rear - edge 130 , a front - edge 140 and a base edge 145 . traversing the contour of the vane fin 105 , the back - edge 130 an arc that extends upward from point 163 where it meets the base edge 145 , to point 160 ( the top of the vane 100 ) where it meets the rearward end of the front - edge 140 . the front - edge 140 then extends in downward and in a substantially linear fashion towards point 162 were it meets the base edge 145 ; however , at point 161 the front - edge 140 changes from linear to downward arc . the base edge 145 extends from point 163 in a linear fashion to point 162 . fig1 b is a rear - profile diagram of the embodiment illustrated in fig1 . fig1 c is a front - profile diagram of the embodiment illustrated in fig1 . as shown in fig1 b , the right - side planar surface 110 and the left - side planar surface 120 are spaced apart by width to form the back - edge 130 , front - edge 140 and base - edge 145 , which in the illustrated embodiment , is slightly increases from the top of the vane 160 at d 1 to the base 150 of the vane at d 2 . in other embodiments the width of the vane may be uniform from the top of the vane to the base 150 . in an exemplary embodiment , the width d 1 is approximately 0 . 025 inches at the top of the vane 160 , and increasing linearly to width d 2 of 0 . 029 inches near the base 150 . however , it will be appreciated that although a particular value or range of values for d 1 and d 2 may be considered in and of itself novel , the present invention is not limited to any particular value . the base 150 is substantially perpendicular to the vane fin 105 and has a top surface 152 and a bottom surface . the top surface 152 of the base 150 is attached , adhered , adjoined , integral with or other wise meets or corresponds with the bottom - edge 145 of the vane fin 105 . the bottom surface of the base 150 is attachable to the surface of an arrow shaft . in some embodiments , the base 150 may be substantially box - shape with the top surface and the bottom surface being two substantially parallel and flat surfaces , joined together by four edges that are substantially perpendicular to the top surface and the bottom surface 14 to form the box . in other embodiments , the bottom surface may be slightly arched similar to the surface of the shaft to which it will be attached . in yet other embodiments , the entire base may be slightly curved in accordance with the shaft . in yet even another embodiment , the bottom surface of the base 150 may be angled similar to an inverted v or may be slanted either left or right . although the present invention is not limited to any particular structure for the base 150 , it will be appreciated that the embodiments presented herein , may in and of themselves be considered novel aspects or features of various novel embodiments of the present invention . although the base 150 is described as mounting to the surface of an object , it will be appreciated that the base could also be embedded in a slot of the surface or a recess . the base 150 , in an exemplary embodiment of the invention is larger than the width of the vane fine . typically , the width of the base 150 d 3 is 0 . 1 ± 0 . 010 inches . although any means utilized for standard size vanes may be utilized for affixation purposes , and vane 100 need only be susceptible of affixation to meet the requirements of the invention . the illustrated base is mirrored around an axis extending through the vane from the base - edge 145 up through the top of the vane 160 as illustrated by the dotted line a . the height of the base h 2 from the point 163 to the bottom is approximately 0 . 240 inches . centered under the vane fin in the base 150 is a cup or recess 154 having a radius r 1 of approximately 0 . 016 radians and a depth of h 1 . the feet of the base then extend downward at an angle with the underside of the feet 155 having a radius r 2 of approximately 0 . 150 radians . fig2 a and 2b are side - profile diagrams of an embodiment of a vane incorporating aspects of the present invention and identifying particular dimensions and dimension ranges . the length l 1 of the vane 100 is the distance from point 262 to point 263 . the length l 2 of the vane fin 105 is the distance from point 162 to point 163 and basically is the length of the bottom - edge 145 . it will be appreciated that although the length l 1 of the base 150 is illustrated and described as being longer than the length l 2 of the vane fin , in some embodiments , the base 150 may be longer or shorter than the bottom - edge 145 ( l 1 & lt ; l 2 ) or the base 150 may be the same length as the base - edge 145 ( l 1 − l 2 ) and as such , the present invention is not limited to any particular relationship , although the various relationships may be considered as novel aspects of the present invention . thus , in some embodiments , the length l 1 is the length of the vane 100 , whereas in other embodiments , the length l 2 is the length of the vane 100 , and yet in other embodiments , the lengths l 1 and l 2 are equal and represent the length of the vane 100 . in the illustrated embodiment , the bottom - edge 145 , and hence , the length of the vane fin 105 is slightly shorter than the length of the base 150 , or in this case the length of the vane 100 . in an exemplary embodiment , the value of l 1 is approximately one ( 1 ) inch , which is substantially smaller than the length of typical vanes . length l 2 is slightly less than l 1 . more specifically , in one embodiment , the value of l 1 ranges from 0 . 988 inches to 1 . 018 inches where the value of l 2 is 0 . 982 inches ± 5 %. in a more preferred embodiment , the value of l 1 is 1 inch ± 2 % and the value of l 2 is 0 . 982 inches ± 2 %. the height of the vane 100 from the bottom surface of the base 150 to the top of the vane 160 is h 3 and the height of the vane fin 105 from the bottom - edge 145 to the top of the vane 160 is h 4 . in an exemplary embodiment , h 3 is 0 . 4 inches ± 2 % and more preferable ± 1 . 25 % and h 2 is 0 . 372 inches ± 2 % and more preferable ± 1 . 5 % and more preferably 1 . 34 %. the front - edge 140 and the bottom - edge 145 form an angle ø 1 with the apex of the angle being proximate to point 162 and opening towards the rear - edge of the vane fin 105 . in an exemplary embodiment , the value of ø 1 is approximately 26 °. in other embodiments , the value of ø 1 is 26 °± 1 ° or ± 0 . 4 %. the back - edge 130 is an arc extending from point 163 to point 160 , concave with relation to the point 162 . in an exemplary embodiment , the radius of the arc a 1 of the back - edge 130 is measured as approximately 0 . 818 inches and , more preferably as 0 . 818 inches ± 0 . 005 inches . the angle is 0 . 454 ± 0 . 17 radians wherein 1 degree = 0 . 0175 radians and 360 degrees is 6 . 2832 radians . as best seen in fig2 b , by extending a line ( 1 a ) from the top of the vane 160 towards the bottom - edge 145 and that is perpendicular to the bottom - edge , the intersection of line 1 a and the bottom edge d 4 is at approximately 0 . 278 inches from the point 163 and towards the point 162 . in addition , a line 1 b extending from point 163 to point 160 ( the chord of the radius ) results in a line that has a length of approximately 0 . 487 inches and that forms angles of ø 2 equal to approximately 35 ° and ø 3 equal to approximately 55 °. fig3 details the characteristics of the front - edge . in the illustration , the front - edge 140 is substantially linear from point 160 to point 161 and then the front - edge 140 arcs downwardly between point 161 and point 162 in a concave fashion relative to point 163 and at an arc a 2 radius of 0 . 125 ± 0 . 005 inches . in another embodiment of the invention , the front - edge 310 extends in a substantially linear fashion from point 160 to point somewhere between point 160 and 161 . from this point , the front - edge 310 then slightly tapers down at a greater angle , or slightly arcs downwardly towards point 161 in a concave fashion relative to point 163 . then the front - edge 310 then arcs downwardly from point 161 to point 162 concave relative to point 163 as described above . in yet another embodiment , not illustrated , the front - edge of the vane fin is not linear at all but rather has one arc segment from point 160 to point 161 and then another arc segment from point 161 to point 162 . in yet another embodiment , not illustrated , the front - edge of the vane fin is a continuous compound arc of decreasing radius from point 160 to point 162 . fig4 is a perspective drawing of an arrow constructed with the above - described vanes . fig5 is a front view of the arrow illustrated in fig4 . the arrow includes a shaft 410 and a plurality of vanes 100 . the vane 100 is normally attached in numerical combinations of three , as best seen in fig5 , although a greater number of vanes may be used and even lesser vanes can be used depending on the embodiment or use of the vane . it should be appreciated that the various embodiments of the described vane can be attached to a variety of objects or projectiles and although the embodiments have primarily been described as being affixed to an arrow , they may also be affixed to other projectiles , such as darts , lawn darts , spears , javelins , model airplanes , toy rockets , or the like . the vane 100 may be constructed of any material which provides a substantially rigid contour during arrow flight . plastics or other synthetic materials are among included possible materials . the material may be resiliently bendable , such that , if outside force causes it to alter shape , it will return to its original contour . in other embodiments , the material may be rigid . in some embodiments , the material may be hollow or include hollowed out sections to reduce the weight . the present invention can be fabricated in a variety of manners including casting individual vanes or fabricating a sheet from which the vanes can be cut . in another embodiment , strips of material with a pre - attached base can be fabricated and the vanes can be cut from the strips . in the description and claims of the present application , each of the verbs , “ comprise ”, “ include ” and “ have ”, and conjugates thereof , are used to indicate that the object or objects of the verb are not necessarily a complete listing of members , components , elements , or parts of the subject or subjects of the verb . the present invention has been described using detailed descriptions of embodiments thereof that are provided by way of example and are not intended to limit the scope of the invention . the described embodiments comprise different features , not all of which are required in all embodiments of the invention . some embodiments of the present invention utilize only some of the features or possible combinations of the features . variations of embodiments of the present invention that are described and embodiments of the present invention comprising different combinations of features noted in the described embodiments will occur to persons of the art . it will be appreciated by persons skilled in the art that the present invention is not limited by what has been particularly shown and described herein above . rather the scope of the invention is defined by the claims that follow . | 5 |
fig1 illustrates a problem addressed by the present invention . a fetal sensor probe 110 is shown having light emitters 114 and detector 118 mounted in housing 122 . three different light paths , 1 , 2 and 3 illustrate different possible penetration depths for light of different wavelengths . the light paths pass through different layers , including a blood - perfused layer 130 , a bloodless layer 132 , and surface layer 138 which can include such things as hair , mucus , etc . between the probe and skin 134 . although the sensor shown in fig1 is a reflectance oximeter sensor , a transmissive sensor would be subject to a similar effect , with the light spreading or scattering different amounts during transmission depending upon wavelength . under certain circumstances , and particularly at low saturation levels , the non - invasive pulse oximetry arterial oxygen saturation estimate , i . e . spo 2 , may be strongly affected by parameters other than the actual saturation level ( i . e ., sao 2 ). such effects are likely due , at least in part , to the fact that the penetration of light in living tissue is related to the wavelength - dependent absorption and scattering characteristics of the tissue , and that therefore two different wavelengths of light in the ranges typically employed for pulse oximetry penetrate such tissue to different extents . at high blood oxygen saturation levels the difference in extent of light penetration is relatively small and there is little effect on spo 2 . however , as saturation levels decrease , the difference in penetration can become great enough so that these other parameters have a significant and undesirable effect on the accuracy of spo 2 . for example , in oximetry systems which employ leds having wavelengths of 660 and 900 nm with the sensor configured in a &# 34 ; reflectance &# 34 ; geometry , as the saturation level drops , light from the red led ( 660 nm ) is detected from relatively shallow tissue depths , while light from the infrared led ( 900 nm ) typically penetrates the tissue more deeply . this phenomenon may be understood with reference to fig1 . as the penetration depths diverge it becomes apparent that the different wavelengths will encounter increasingly different transmission medium characteristics . as a result , the detected signals are affected differently by perturbations in tissue parameters caused by , for example , vasoconstriction or exsanguination in the superficial layers . because the detected signals encounter different perturbations , the effects of these perturbations in the two signals do not &# 34 ; cancel &# 34 ; each other out to the same extent as in circumstances in which the penetration depths are well matched . consequently , the accuracy of spo 2 may be negatively affected . fig2 illustrates a sensor 200 with a fulcrum point 202 biasing sensor 200 against the head of a fetus 204 by pressing against a uterine wall 206 . the need to press the sensor against the fetus to hold it in place may also exsanguinate the tissue , potentially causing a portion of it to be bloodless , adding a different variation in the tissue through which the light must scatter . fig3 illustrates in more detail how an alternate fetal sensor may be placed against a fetus 204 . as shown here , a fetal sensor 300 is attached to a stiff cable 302 which allows it to be inserted and placed against the fetus 204 . rather than using a fulcrum , sensor 300 may use a balloon to bias the sensor against the fetus . fig4 illustrates in more detail emitter 114 of fig1 . the emitter actually contains three separate emitters 402 , 404 and 406 . these are each connected between a ground line 408 and three activating lines 410 ( shown as one line in the diagram .) fig5 is a block diagram of an oximeter probe and monitor which can be used with the present invention . a complete description is set forth in u . s . pat . no . 5 , 348 , 004 . leds 14 transmit light through patient tissue 18 to a photosensor 16 in a sensor 10 . signals are provided to and from an oximeter monitor 34 which include an led drive 32 for alternately driving the leds in multiplexed fashion , either time multiplexed or frequency multiplexed . the received signals are provided through an input amplifier 20 to three different oversampling demodulators 36 which each include an analog switch 40 , low pass filter 42 and a / d converter 38 . a processing unit 44 includes a queue input module 46 , ram memory 52 and cpu 50 . a readout display 30 is also provided , along with control lines 68 . the memory may alternately be rom or a disk , which may contain a program for performing the calculations of the present invention . a calibration resistor ( or other active or passive element ) 17 encodes the mean wavelength of at least one led , and provides it to a calibration reader circuit 19 , which provides it to cpu 50 . the wavelength indicated is used to select coefficients stored in monitor 34 . such a calibration technique is described in more detail in u . s . pat . no . 4 , 621 , 643 , the disclosure of which is incorporated herein by reference . in order to compensate for errors resulting from a single estimate of spo 2 , a second measurement is conducted at substantially the same time and location in a different manner which has a different , but correlated , susceptibility to the perturbing influence . a first measurement of saturation is performed using a first group of components of the sensor . the value obtained , m 1 is equal to the true saturation sao 2 plus some error referred to here as δ : the error δ can come from a number of different causes but is considered here to describe the sensitivities of the measurement to parameters other than sao 2 . at substantially the same time as the first measurement , and at the same location , a second measurement m 2 is performed using a second group of components of the sensor . the second group of components is selected so that the second measurement has a different sensitivity to the perturbing factors than the first measurement , but nonetheless is still sensitive to the cause of the perturbation . as a result , the value m 2 can be written : where k represents the ratio of error in the spo 2 measurement present in m 2 to that present in m 1 , and may be approximated by a constant . k is , to a useful approximation , only a function of the physical sensor design ( constraints on k are that k ≠ 0 and k ≠ 1 .) the variation in error , as the sensor is used on different tissue sites , on different patients , or at different times , or as other physiological parameters vary , appears primarily in variations in the magnitude of δ , and only to a significantly smaller extent in the value of k . accordingly , an improved estimate of oxygen saturation ( m 3 ) is attained by solving equations ( 1 ) and ( 2 ) for sao 2 : notice that m 3 is not subject to the perturbation δ . realistically m 3 will have residual sensitivity to δ , but will nonetheless be less sensitive to the perturbation than either m 1 or m 2 because of their correlated sensitivities . the functional relationship of the perturbation - free value m 3 to the measured values m 1 and m 2 , and the coefficients used , would be empirically determined in a calibration process during instrument design . one cause of limited spo 2 accuracy is an imbalance in penetration depths of the detected light at two wavelengths . accordingly , a three - wavelength sensor can compensate for the resulting errors . the degree of error in a two - wavelength ( 2 - λ ) oximeter will relate to the degree of mismatch in detected light penetration . at low saturation , an error in spo 2 observed with , for example , a 660 / 900 nm light sensor is worse than the error that comes from a 735 / 900 nm light sensor under the same conditions , as described above . such errors , however , can be expected to be correlated since light penetration is smoothly distributed over a broad range , with significant overlap even when each different wavelength has a different average penetration depth . following the methodology described above , the correlation of the spo 2 &# 34 ; errors &# 34 ; can be used to compute a revised ( or &# 34 ; corrected &# 34 ;) estimate of spo 2 based on the difference of the two 2 - λ sensors &# 39 ; values : here , spo 2 ! 735 / 900 and spo 2 ! 660 / 900 refer to the conventionally computed saturations using 735 nm and 900 nm , or 660 nm and 900 nm wavelength pairs , respectively , while k is a proportionality constant . it should be recognized that equation ( 4 ) can be mathematically transformed in a variety of ways that result in fundamentally the same calculations . for example , the improved estimate of spo 2 corrected can be equivalently determined without specific intermediate calculations or determinations of the two 2 - λ estimates of spo 2 by replacing these values with their respective formulations based on their measured signal intensities . this will become more clear as the invention is further described below . in a preferred embodiment , the sensor is fabricated with three light emitting diodes and a spaced photodetector . the three leds are located as close to one another as possible so as best to illuminate the same region of tissue . spo 2 is calculated for each of the two red / ir combinations independently , following normal pulse oximetry protocols as known to those skilled in the art . the revised estimate of spo 2 is made based on the difference between the two initial estimates according to equation ( 4 ) or its equivalent . fig6 is a flowchart illustrating the steps of the present invention . first , radiation of three different wavelengths is emitted towards the tissue sample ( step a .) in step b , the radiation scattered by the tissue sample is detected . in step c , a first estimate of a blood parameter ( e . g ., arterial oxygen saturation ) corresponding to a first pair of wavelengths is determined . in step d , a second estimate of the blood parameter is determined according to a second pair of wavelengths . finally , a corrected estimate is calculated based in part on the difference between the first and second estimates ( step e .) alternately , the same result can be achieved by combining steps c , d and e to eliminate the intermediate calculations . although the three wavelengths 660 nm , 735 nm , and 900 nm are utilized in the described preferred embodiment , other wavelengths may be selected , preferably according to the following table . preferably , two wavelength pairs result in measurements of spo 2 that have at least a minimum sensitivity to changes in sao 2 ( e . g ., at least two wavelengths are chosen to be substantially different from the isosbestic wavelengths of oxygenated and deoxygenated hemoglobin ). simultaneously , two of the wavelengths should result in tissue penetrations of the detected light that are similar but not equivalent . the third wavelength is preferably chosen so that the degree of detected light penetration is not significantly different or substantially equivalent to either of the other two over the span of the saturation range of interest . it should be understood that typical light sources , such as leds , have relatively broad distributions of wavelengths in their output , and the ranges of wavelengths indicated in table i below are ranges from which the peak wavelengths of the distributions should preferably be selected . accordingly , preferred wavelength combinations are chosen to meet the following two criteria evaluated at 40 % sao 2 : 1 ) sufficient overlap in penetration of detected light between wavelengths 1 & amp ; 2 and wavelengths 2 & amp ; 3 ( difference in upper , as well as lower , half standard deviation penetration depths less than 2 mm and not less than 0 . 2 mm ), and 2 ) sufficient measurement sensitivity to changes in sao 2 for wavelength pairs 1 & amp ; 3 and 2 & amp ; 3 ( sufficient sensitivity determined by r 0 % sao 2 !& gt ; 2 · r 100 % sao 2 !, where r = β . sub . λi / β . sub . λj and β . sub . λ refers to the extinction coefficient at wavelength λ .) table i below was calculated utilizing the formulations for the average and standard deviation in detected light penetration found in weiss et al ., &# 34 ; statistics of penetration depth of photons re - emitted from irradiated tissue ,&# 34 ; journal of modern optics , vol . 36 , no . 3 , 1989 . for convenience , wavelength 1 is listed in 25 nm increments , and it should be noted that according to the above selection criteria , wavelengths 1 and 2 ( and in some cases all three wavelengths ) are interchangeable . in the table below , each row represents combinations of peak emitter wavelengths that satisfy the preferred selection criteria ( all wavelengths given in nanometers ): table i______________________________________wavelength 1 (± 12 . 5 nm ) wavelength 2 * wavelength 3 * ______________________________________450 450 - 525 600 - 700475 525 - 675 500 - 825500 525 - 675 575 - 775525 575 - 675 575 - 775550 475 - 525 600 - 675 575 - 650 450 - 775575 475 - 500 600 - 675 550 - 675 600 - 775600 450 - 600 625 - 675 600 - 675 450 - 600 600 - 675 775 - 950625 650 - 800 725 - 950 775 - 925 725 - 775650 600 - 625 450 - 600 675 - 800 775 - 950 775 - 950 700 - 775675 600 - 650 450 - 600 600 - 650 725 - 950 700 - 800 775 - 950 775 - 950 700 - 800700 600 - 675 450 - 600 600 - 675 725 - 950 775 - 950 725 - 775725 , 750 600 - 700 450 - 600 600 - 700 775 - 950 775 - 950 625 - 700775 600 - 700 450 - 600 600 - 700 800 - 950 800 - 950 625 - 725800 , 825 , 850 , 900 625 - 700 600 - 775 700 - 775 625 - 700______________________________________ * wavelengths chosen from overlapping ranges should be separated by at least 10 nm , preferably at least 30 nm , from one another . for a system designed to be practical in a clinical setting , other considerations will also affect the choice of emitter wavelengths such as emitter output efficiency , detector responsivity , and the optical density of blood perfused tissues at the given wavelengths . table i optimizes only the overlap criterion and the measurement sensitivity for a three wavelength system which considers a common ratiometric denominator ( wavelengths 1 and 3 are used for one spo 2 estimation and wavelengths 2 and 3 are used for a second .) similar optimizations can also be accomplished for variations of the spo 2 formulations . for example , wavelengths 1 and 2 can be used for one spo 2 estimation and 2 and 3 can be used for a second . in such a case , the sensitivity optimization would pair wavelengths 1 & amp ; 2 and 2 & amp ; 3 , instead of the pairings considered in generating table i . alternative light penetration overlapping schemes may be considered as well . described more fully , the following algorithm is used in the preferred embodiment . light at three wavelengths is provided at the emitter location using three leds or other suitable source ( for example delivered with an optical fiber ). in order to optimize sensitivity and overlap according to the above wavelength selection criteria , as well as detected signal strength ( affected by , for example , emitter output and the optical density of blood perfused tissue ), three emitter wavelengths are chosen with two coming from the range 625 - 800 nm , preferably 650 - 750 nm , and the third from 775 - 1000 nm . the peak of each emitter wavelength should be separated by at least 10 nm , preferably at least 30 nm , from the other wavelengths ; however , other combinations , ranges , and separations may be used while still conforming to the spirit of the invention . three emitters may be sequentially energized in a time multiplexed manner as described in u . s . pat . no . 4 , 653 , 498 ( new & amp ; corenman ), or in a frequency multiplexed manner as in u . s . pat . no . 4 , 807 , 630 ( malinouskas ). alternatively , either three continuously operating sources or white light may be used , with the different wavelength ranges being separated at the photodetector with filters or a dispersive element . in this latter case , separate photodetector cells will be needed for each of the three different wavelength ranges of light . for the time multiplexed systems , the cycle frequency should be chosen to permit cycling through all of the three or more wavelengths before significant physiological variation occurs over the cardiac - cycle period . for example , it would usually be sufficient for each complete wavelength cycle to occur within 5 % of a cardiac period , or about 50 ms for adult patients . a more preferred time multiplexing period would be 2 % or less of a cardiac period , which is to say 20 ms or less for adult patients and 10 ms or less for neonatal patients . detected signals at the three wavelengths are processed to obtain three signal modulation levels : where i ( t ) and i ( t &# 39 ;) are the detected light intensities at two points in time during the cardiac cycle ( e . g ., systolic and diastolic ). the logarithmic calculations above , which fundamentally define the signal modulations m 1 through m 3 , may be approximated for sufficiently small modulations by the ratio of the ac signal amplitude divided by the dc signal amplitude , since this approximates the first term of a taylor expansion of log ( 1 + x ), when x is small . two of the signal modulation values m 1 , m 2 are divided by the third modulation value m 3 to obtain two ratios . two spo 2 values are calculated according to prior art methods ( a linear formula is shown here and is used in the preferred embodiment , but other formulae may be alternatively used ): ## equ1 ## where a 1 , a 2 , b 1 and b 2 are empirically determined calibration coefficients selected by the usual methods of pulse oximetry calibration . alternative calculations to create two ratios using these or other chosen wavelengths are also possible , e . g ., m 1 / m 2 and m 1 / m 3 or m 1 / m 2 and m 2 / m 3 . calculations of the two ratios or spo 2 values that do not specifically utilize signals at only two specific points in the cardiac cycle can alternatively be used , for example as described in u . s . pat . no . 5 , 533 , 507 . once the two spo 2 values have been calculated , an improved estimate of spo 2 is made according to the difference in the initial estimates : the correlation factor ` k ` can be estimated theoretically , but is preferably determined empirically . by way of example , each of the following equations is mathematically equivalent to equation ( 8a ), yet not all of them necessarily require intermediate calculations of spo 2 ( 1 ) and spo 2 ( 2 ): ## equ2 ## where a = a 1 ( 1 + k ); b =- ka 2 ; c = b 1 ( 1 + k )- b 2 k !. equation ( 8e ) could also be rewritten by substituting log ( i ( t )/ i ( t &# 39 ;)) for the ac / dc terms , in accordance with equations ( 5a ), ( 5b ), and ( 5c ). it is also possible to establish general equations for solutions of this type , which can be written as follows , for n wavelengths ( n ≧ 3 ): ## equ3 ## the alternative ( but not mathematically equivalent ) calculations of the modulation ratios mentioned above can be written in general form for n wavelengths ( n ≧ 3 ) as ## equ4 ## for n & gt ; 3 wavelengths , various combinations of ( 9c ), ( 10a ), and ( 10b ) are also possible and are considered to be within the scope of the invention to the extent that they mathematically relate to combining multiple determinations of spo 2 . the different embodiments of the method of the invention outlined here are specifically different from prior art pulse oximeter techniques in one or more of the following ways : 1 ) the errors from many potential causes ( more than two ) are compensated for by the use of as few as three wavelengths , as opposed to supplying the same or more numbers of wavelengths as causes ( e . g ., one each wavelength for the number of functional and dysfunctional hemoglobins potentially present ). 2 ) tissues are not assumed to be homogeneous in the percentage of tissue volume which is blood , distribution of pulsatile vessels or of other non - absorbing and absorbing media , and resulting spo 2 readings are less affected by such heterogeneity than they would be in a standard two - wavelength pulse oximeter . 3 ) the specific perturbations to which the system will be exposed during use do not need to be present during the calibration . 4 ) no information other than spo 2 is determined during the calculations , such as whether a given sample is within certain boundaries defined by the calibration data set , or the concentration or saturation of any additional absorbers in the tissue . 5 ) arterial oxygen saturation is estimated with improved accuracy under conditions when light penetration into the tissues cannot be sufficiently matched for adequate accuracy with conventional two wavelength oximeters . 6 ) for the multiple calculations of saturation , all of the light is directed into the tissue at one emitter area and all of the detected light is collected in one detector area . numerical modeling numerical modeling has been performed to evaluate theoretically the relative behavior of two conventional 2 - λ and the new 3 - λ approaches . reflectance pulse oximetry was considered and various one - and two - layer tissue bed systems were modeled with the emitter and detector separated by 14 mm . varying tissue blood volumes , pulsatility , and layer thickness were considered . shown in fig7 a and 7b are the relative performances of two 2 - λ systems ( 660 / 900 nm and 735 / 900 nm ), and the revised 3 - λ estimate using a linear proportionality and fixed ` k ` value as in equation ( 4 ). data from six types of tissue beds are shown : homogenous distributions of low , moderate and high tissue blood content ; 3 mm layer of low pulsatility tissue over large pulsatility tissue ; 3 mm layer of large pulsatility over low pulsatility tissue ; and 3 mm layer of completely bloodless tissue over moderately perfused tissue . all three approaches were optimized ( calibrated ) to yield the minimum least - squares error in the saturation range 0 %- 60 %. in the example shown here , the heterogeneous perturbations were present during calibration . similar results are obtained for the improved algorithm when the calibration is performed using only the homogeneous conditions . as can be seen in the fig7 a graph of spo 2 versus sao 2 , the improved algorithm results in significantly less sensitivity to the modeled homogenous and heterogeneous perturbations at low saturation . the table shows the standard deviation of the errors in the low saturation range for the three systems , as well as the range of readings at 20 % sao 2 . although not shown , similar results are observed in the improved algorithm when a 690 nm emitter is used instead of 735 nm emitter . variations in equation ( 4 ) can also be utilized , e . g ., incorporating the difference term in a non - linear relationship such as a higher order polynomial or power - law : further improvements may be realized by varying the value of ` k ` according to a predetermined set of rules . for example , the value of ` k ` may depend on the calculated spo 2 difference δ : ## equ5 ## the values of &# 39 ; k j &# 34 ; and of the thresholds δ 0 and δ 1 may be empirically determined . alternatively , the value of ` k ` may be varied based on an estimate of saturation . for example , ` k ` need not be as large at high saturations as it is at low saturations : ## equ6 ## where spo 2est may be the improved spo 2 previously calculated , or one of the intermediate values determined from one or both of the wavelength pairs . ( as was shown above , algebraic equivalence to each of these variations is possible when the individual signals or intermediate calculations are substituted into the above equations . thus , in the spirit of these examples showing the use of variable k , it is also possible to write variants of the formulae of equations ( 8 ) and ( 9 ), in which the coefficients utilized are given different values depending on the values of an initial estimate of spo 2 .) any three wavelengths may be utilized with this algorithm while still following the spirit of the present invention . the concept exploits the correlated errors based on any two wavelengths &# 39 ; mismatched penetration depths and / or breadths . ( for example , comparable improvement was also modeled using 660 / 690 / 900 nm wavelengths using a different value of ` k ` in equation ( 4 ).) alternatively , four or more wavelengths could be utilized according to the present invention with the two intermediate estimates of spo 2 each made with two unique subsets of the four or more wavelengths ( 3 - λ spo 2 estimates could be made according to the present invention , or any of the prior - art techniques ). the use of more than a minimum of three wavelengths can be utilized for calculations isolating more than sao 2 . constituents other than arterial blood oxygen saturation ( e . g ., hemoglobin , dysfunctional hemoglobin , or glucose ) may be analyzed using the present invention . similarly , non - pulsatile signals may be used to initially estimate a variable , and a subsequent improved estimate may be obtained using the described algorithm . to the extent that any multiple wavelength system is limited in its accuracy ( due to , e . g ., mismatching light penetration ), making an additional estimate based on a different set of wavelengths with different interaction with tissue properties yields a different value with a correlated error . this error may be corrected , as described above , by utilizing further the difference of the estimates , or an algebraically equivalent calculation . as will be understood by those of skill in the art , the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . accordingly , the foregoing description is intended to be illustrative , but not limiting , of the scope of the invention which is set forth in the following claims . | 0 |
in one embodiment , a software application grades a set of photos to identify common composition mistakes . the user is given feedback and suggestions for improvement . the system and method identify and troubleshoot common camera / user problems , and provide help to assist the user in correcting these problems in subsequent images . in another embodiment , the system and method provide positive feedback on well - composed or well - executed images . in still another embodiment , the application has a “ teach mode ” and a “ fix mode ”. the teach mode provides multiple layers or levels of instruction , while the fix mode provides one or more alternatives that the user can select , automatically correcting the image . fig1 shows flowchart 10 which is an overall view of operation according to an embodiment . process 101 optionally establishes either teach mode 102 a or fix mode 102 b . in actual use , either or both modes may be used , if desired . teach mode of the illustrated embodiment provides instruction to improve images and eliminate errors . fix mode of the illustrated embodiment provides suggestions for the user to choose to improve the image , as well as actually correcting the mistakes . either selection in the illustrated embodiment leads to the fetch and display next image process 103 . once the image is fetched and / or displayed , it is analyzed at process 20 with different results available for different modes . point a , just before process 20 , refers to fig2 which provides a detailed description of steps in analyzing the image in process 20 according to the embodiment . point b , just after process 20 , indicates a return from the processes of fig2 . after analysis , process 104 queries whether all images have been examined . this may be accomplished by comparison to a user input of the number of pictures , a user response to a question , a computer generated count of images , or by some other method of comparing the current image number to the total number of images . if the current image was not the last image to be examined , the system returns to process 103 to fetch and display the next image . when all images have been examined , the score and final feedback will be displayed audibly , visually , textually , or in some combination thereof by process 105 . final feedback may include comparing scores ( grades ) with previously saved scores to provide a comparison with previous attempts merely providing relative improvement data . scores may also be dedicated to a particular user to provide a comparison between users and to personalize comparisons to each user . the aforementioned scores may provide an indication of relative skill level and / or may provide details with respect to areas of strengths and / or weaknesses . for example , a score may indicate a user has generally properly framed subject but has not achieved proper lighting in many of the images . additionally , or alternatively , a score may include a summary ranking , such as a letter , number , or title ( e . g ., professional , amateur , etc .) to provide a quick guide to a users current ability and / or progress . it should be appreciated that the foregoing steps of fig1 and associated feedback can be provided via a computer or a digital camera , or combinations thereof . for example , a digital camera may operate under control of an instruction set as described herein to provide real time guidance , instruction , correction , and / or feedback with respect to photos being taken by a camera user . additionally , or alternatively , some or all of the foregoing may be implemented on a computer system for post photography processing . such an embodiment might be desired in addition to a realtime camera embodiment to compile greater historical information and better guide a user in improving their photographic skills . of course , a camera and computer may interact to facilitate improvement , such as by the computer determining a user &# 39 ; s deficiencies and programming the camera to correct for some or all such deficiencies . fig2 shows flowchart 20 , which is a detailed description of an embodiment of the steps involved in analyzing the image in teach or fix mode . point a , at the start of the flowchart , refers to fig1 , just before process 20 . fig2 is a depiction of the processes that occurs in one embodiment of process 20 . after being sent to process 20 of the illustrated embodiment , process 30 n queries which analysis the user would like to invoke . in this example , horizontal analysis is the default setting . the horizontal analysis of process 30 and / or the other optional analysis of processes 30 a , 30 b , 30 c , or 30 d may be chosen . optionally , the system can select one or more of these processes , such as based upon an internal analysis . fig3 , which will be discussed hereinafter , further describes the steps of the horizontal analysis of process 30 to provide but one example of image processing as may be performed according to the present invention . process 30 a optionally performs one or more other analysis ( for example , a red eye check by finding the eyes and testing the coloring found there for high levels of red coloration ). finding the eyes in the picture may be found by comparison to a database of pictures or by some other method that estimates the placement of the eyes . process 30 b performs optional vertical analysis . this may be accomplished by dividing the picture into some number of sections vertically and determining if there are dominant objects in each divided section . process 30 c performs optional focus analysis . this may be accomplished by comparing the spatial contrast of various regions in the scene to determine their sharpness . process 30 d performs optional lighting analysis . this may be accomplished by checking the intensity of the color levels in the image against a set range . these and additional optional analyses may also be performed with the addition of software modules that allow for greater analysis as the user gains expertise and chooses to add additional testing routines . for example , one or more analysis modules may be implemented in a host system , e . g ., the aforementioned computer or digital camera , to provide desired and / or appropriate analysis . according to one embodiment , modules providing analysis with respect to common beginner or novice photographer errors may be initially supplied for use . additional individual modules and / or combinations of modules may be subsequently added , such as to provide analysis appropriate to the advancing skills of the photographer , to analyze particular subject matter and / or artistic aspects of a photographer &# 39 ; s pictures , to correspond to particular equipment and / or media ( e . g ., lenses , filters , film speed , etcetera ), and the like . various ones of the aforementioned modules may replace previous modules while other ones of the aforementioned modules may supplement modules already being utilized . returning now to fig2 , after initial analysis , process 200 checks across a picture set to determine a pattern of repetitive “ errors .” for example , if a similar fault , ( i . e ., a violation of a rule ) occurs in several pictures , it can be assumed that the user is not knowledgeable about the rule and this such repetitive pattern will be marked as a violation or error . note that for different “ rules ” the tolerance for violations can be different , if desired . if there are no repetitive errors , or the number of errors have been reduced over previous picture sets , results query 201 is positive ( good ). if the result is good , positive feedback is provided audibly , visually , textually , or in some combination by process 204 through the computer or digital camera . the score is increased by process 210 , and if no further analysis is to be conducted ( process 211 ) processing proceeds to point b , at the end of the flowchart , returning to fig1 , just after process 20 . positive feedback may reference improvements in individual pictures and improvements in the overall score of a user or in a set of pictures . note that “ errors ” in the above context are variations from accepted criterion and the degree of variation that shows an error can be adjusted , if desired . also note that variations from normal can be determined on a picture by picture basis , if desired . if the result from the query at process 201 is bad , process 201 a of the illustrated embodiment again compares across the picture set to check for camera problems that may be indicated by recurring problems over a set of pictures . process 201 b queries the result , and process 201 c provides a suggestion audibly , visually , textually , or in some combination through the computer or digital camera for improvement of the camera problem if one has been found . if no camera problem is found at 201 b , or after the suggestion has been made for correction of one that is found at 201 c , process 202 fixes the image under user control , and process 203 displays the fixed image . process 205 next queries the user as to whether the fixed image is better . if the fixed image is better , the score is increased by process 210 and , if no further analysis is to be conducted , point b returns to fig1 , just after process 20 . if the query at 205 finds that the fix is not better , the mode is queried by 206 . fix mode results in process 208 replacing the image with the “ fixed ” image and process 209 decreasing the score before point b returns to fig1 , just after process 20 . teach mode at process 206 causes a suggestion to be provided audibly , visually , textually , or in some combination through the computer or digital camera by process 207 . then the score is decreased by process 209 . process 211 queries whether the user desires to perform additional analysis . if the user desires additional analysis , e . g ., analysis as performed by any of processes 30 a and 30 d , the method of the illustrated embodiment returns to block 30 n and repeats the method shown in fig2 for that analysis . if the user does not desire additional analysis , the method continues to point b and returns to fig1 , just after process 20 . fig3 shows flowchart 30 , which depicts an embodiment of the horizontal analysis referenced by process 30 in fig2 . although details with respect to horizontal analysis of process 30 are provided herein , it should be appreciated that image processing to provide additional , or alternative , image attribute analysis may be implemented by one of skill in the art , many using steps corresponding to those shown in fig3 . in the embodiment illustrated in fig3 , an image is scanned by process 301 and the horizontal features are identified by process 302 . the horizontal features are queried at process 303 . if none are found , a “ good ” response of the horizontal analysis system is returned to process 201 of fig2 . if horizontal features are found at process 303 , process 304 chooses the strongest one . this may be accomplished by estimating the area of large objects and comparing them to find the largest object . process 305 queries whether that feature is near the center . if the response to process 305 is yes , process 307 identifies a “ rule of thirds ” problem and returns a “ bad ” response from the horizontal analysis system . if the response to process 305 is no , process 306 queries whether the feature is level . this may be accomplished by comparing the height of a horizontal feature at each side of the image . if the feature is not level , process 308 identifies a level problem and a “ bad ” result is returned from the horizontal analysis system to process 201 of fig2 . the rule of thirds is perhaps one of the most popular ‘ rules ’ in photography and yields pleasing compositions . the rule of thirds works by imaginary lines which divide the prospective image into thirds both horizontally and vertically . the most important elements of a composition are placed where these lines intersect . in addition to the intersections , the areas can be arranged into bands occupying a third of the image . also , elements can be placed along the imaginary lines . if the process 306 query responds that the feature is level , process 309 queries whether the subject is too far away . this may be accomplished by calculating the ratio of the area of the main feature to the area of the total image and comparing it to an acceptable ratio . if process 309 finds that the image is too far away , a suggestion is offered by process 312 and a “ bad ” response is returned from the horizontal analysis system to process 201 of fig2 . if the subject is not found to be too far away at 309 , process 310 queries to see if the foreground framing is okay . this may be determined by checking a set frame of the image for dominant objects and determining the area of those objects to compare to an acceptable level . if there is a problem in the foreground framing , a suggestion is offered by process 312 , and a “ bad ” response is returned from the horizontal analysis system to process 201 of fig2 . if there is no problem in the foreground framing , process 311 queries if the scene is back - lit . this may be checked by examining the relative brightness of dominant objects in the image . if the scene is back - lit , process 312 offers a suggestion and a “ bad ” response is returned from the horizontal analysis system to process 201 in fig2 . if process 311 finds that the scene is not back - lit , a “ good ” response is returned from the horizontal analysis system . fig4 depicts system 40 , a computer set - up configured to implement an embodiment . a computer central processing unit 41 , cpu , is connected to computer screen 42 for possible visual display of images , suggestions , or score comparisons . the cpu contains memory 401 , for processing and storage of images and scores , and provides speaker 405 for optional audio output of suggestions and score comparisons . the computer may be connected to network 44 , as may provide communication between processor based systems such as network server 45 , to provide general access to the system or method throughout an office or between several computers . the printer 407 is coupled to computer 40 for output of data and images , such as output of suggestions and score comparisons and / or output of the images . the user may also scan images to digital format using scanner 406 ( or any other imager ) connected to the computer to provide an image with which to work without the use of a digital camera . the scanner image could be a picture , or even text , and the system described herein could be used to improve faulty images and to teach a user how to improve scanner images . the computer system may be interfaced with a digital camera 43 that contains screen 402 to view the images , instructions , suggestions , or score reports and may contain speaker 404 to hear audible instructions , suggestions , or score reports provided during the picture taking process . the entire method may also take place solely on the digital camera without interface to a computer or computer network . also , it should be noted that the systems and methods discussed herein could apply to analog images as well as digital . | 6 |
in the following detailed description certain specific terminology will be employed for the sake of clarity and a particular embodiment described in accordance with the requirements of 35 usc 112 , but it is to be understood that this not intended to be limiting and indeed should not be so construed inasmuch as the invention is capable of taking many forms and variations within the scope of the appended claims . referring to fig1 the passenger compartment 10 of an automotive vehicle 12 is shown in fragmentary form with portion of the instrument panel 14 and part of the windshield 16 just forward of the instrument panel 14 . the instrument panel 14 extends transversely to the longitudinal axis of the vehicle , and is located forward of the occupant or passenger side of the front seat with an air bag &# 34 ; top mounted &# 34 ; in the instrument panel portion . the right hand instrument panel portion shown houses the passenger side air bag for the protection of the passenger sitting on the right side of the vehicle driver . the air bag will be deployed through an opening formed in the top of the instrument panel right - hand portion 14 and rapidly inflated to be disposed forwardly of the passenger to protect the passenger in the event of severe collisions in the manner well known in the art . the air bag deployment opening , referred to generally with the reference character 18 , according to the present invention is preferably of the so - called &# 34 ; invisible seam &# 34 ; design in which the outline of the deployment opening and the doors making up the opening are not visible to the passenger . the door panel door panel pattern fit into the air bag deployment opening according to the concept of the present invention is skewed and asymmetric in form to thus be incompatible with good interior trim design . however , the pattern may also be employed with visible door designs . the particular construction of invisible seam air bag deployment openings is described in u . s . pat . no . 5 , 082 , 310 issued on jan . 21 , 1992 , for &# 34 ; arrangement for providing an air bag deployment opening &# 34 ; in which a vinyl skin overlays a foam layer which in turn is supported on a door substrate panel . the vinyl skin is preweakened by an cutting of a groove on the inside along a pattern matching the door substrate panel and with door substrate contours concentrating the force exerted by an inflating air bag to cause the vinyl skin to be split along the free edges of each of the deployment door substrate panels which are hinged along one side to the instrument panel substrate at the perimeter of the deployment opening . the door substrate panels are themselves connected along one side opposite the hinge side by frangible tabs which are fractured at the time of the air bag deployment . another approach is described in u . s . pat . no . 4 , 991 , 870 issued on feb . 12 , 1991 , for a &# 34 ; method and arrangement for forming and air bag deployment opening in an auto interior trim piece &# 34 ;, u . s . pat . no . 5 , 217 , 244 issued on jun . 8 , 1993 , for an &# 34 ; arrangement for forming and air bag deployment opening &# 34 ; and u . s . pat . no . 5 , 080 , 393 issued on jan . 14 , 1992 , for a &# 34 ; method and apparatus for forming an air bag deployment openings &# 34 ;. these later patents describe a so - called linear energy generating element used to cut through the vinyl skin rather than to rely on severing of the outer decorative skin by the force exerted by the door substrate upon inflation of the air bag . such constructions are also suitable for use with the present invention . the air bag deployment opening 18 is normally overlain by a series of door substrate panels 20 , 22 , 24 , 26 interfit together when not opened to close off the deployment opening 18 . according to the concept of the present invention and the embodiment of fig1 each of the door substrate panels 20 , 22 , 24 , 26 are triangular in shape with the base side of each door substrate panel 28 , 30 , 32 , 34 respectively hingedly connected to the adjacent section of the substrate of the instrument panel 14 . the remaining two sides of each triangular door substrate panels are free when the seams 32 , 34 , 36 , 38 are broken incidental to opening of the deployment opening allowing each of the door substrate panels to hinge open outwardly towards the interior of the passenger compartment 10 . the seams may be constructed according to the above referenced patents as also can be the integral hinge extending along the base sides 28 , 30 , 32 , 34 . referring to fig1 a , which shows the door pattern in diagrammatic form , it can be seen that the interfit door substrate panels 20 , 22 , 24 , 26 form an unequal quadrangle . the door substrate panel 22 to the right has its hinging base side 30 skewed to the right and with the hinging side 30 substantially shorter than the hinging side 34 of the left door substrate panel 26 . this arrangement causes the right most triangular door substrate panel 22 to swing rearwardly when hinged open along the hinging side 30 and also to be of a smaller size , which , taken with its triangular shape having an apex intermediate the corners 40 , 42 , allows for the door substrate panel 22 to completely avoid the windshield will normally curves around towards the right side of the vehicle . the left side door substrate panel 26 hinges open to the left , and there is more clearance space with respect to the windshield in this direction . the door substrate panel 26 also swings away from the forward edge 44 of the instrument panel . the triangular door substrate panel 24 has its base or hinging side 32 extending parallel to the front rear edge of the instrument panel 44 . the triangular shape minimizes the overlying area adjacent the edge 44 to reduce the likelihood of contact with an out of position passenger having his or her hand on the edge of the instrument panel . the forward door substrate panel 20 has a hinge axis side 28 which is inclined rearwardly such as to taken with its triangular shape to obviate the possibility of contact with the windshield . referring to fig2 the opening position of the door substrate panels 20 , 22 , 24 , 26 is shown . the relatively small triangular door substrate panels 22 is completely clear of the windshield 16 . the rear door substrate panel 24 does not overlap to any significant degree the area along the edge 44 of the instrument panel 14 . the forward triangular door substrate panel 20 also remains clear of the windshield 16 . accordingly , an air bag inflated from the storage canister 46 may be deployed through the opening 18 with minimal hazard to the passenger . fig2 a shows an out of position child passenger having his or her hand on the instrument panel rear edge 44 , with the rear door substrate panel 20 not coming into contact with the hand or face of the child passenger . fig3 shows an alternative door pattern forming a triangular deployment opening 48 which three door substrate panel 50 , 52 , 54 are interfit together having a base edge 56 , 58 , 60 respectively which define hinging sides with invisible seams formed by the remaining adjacent sides 62 , 64 , 66 , 68 of the respective door substrate panels 50 , 52 , 54 . the common sides 62 , 64 , 66 , 68 forming seams which are freed at the start of the air bag system activation to allow each of the door substrate panel to hinge open along the hinge base sides 56 , 58 , 60 . fig3 a shows diagrammatically the door substrate panel 50 , 52 , 54 . the overall deployment opening patterns is triangular in shape and formed by the three triangular door substrate panel 50 , 52 , 54 interfit together in their closed condition . the triangular door substrate 50 forms a top right door section , the door substrate panel 52 forms a bottom right door substrate panel and the door section 54 forms a left door section . the hinged sides 56 , 58 of the forward and rear door substrate panel 50 , 52 are considerably longer than the hinge side 60 of the left door substrate panel 54 such that the deployment opening forms a relatively tall triangle lying on its side with its apex 70 to the right and with the base of the triangle formed by the hinge side 60 of the left door substrate 54 . thus the greatest depth of the forward and rear door substrate 50 , 52 is at their common apex 72 which is located well to the right of the apex 70 . accordingly , the edge 58 of the rear door substrate panel 52 extends approximately parallel to the instrument panel edge 44 . this arrangement avoids any possibility of contact with the windshield and also minimizes the possibility of contact with an occupant &# 39 ; s hands lying atop the instrument panel 44 as can be seen by reference to fig4 showing the top door substrate panel 50 , bottom door substrate panel 52 , and left door substrate panel 54 in their opened condition forming the triangular deployment opening 48 through which the air bag will have deployed from the storage canister 74 indicated in phantom , avoiding windshield 16 . fig4 a shows how the rear door substrate panel 52 has minimal area close to the edge 44 of the instrument panel 14 . thus minimize the hazard to a passenger such as the child shown having a hand on the instrument panel 14 . it should be noted that variations of these particular patterns shown will still yield the result described , i . e ., in the quadranglarly shaped pattern , the door substrate panel need not meet at a single point , i . e ., the left and right door panel substrate panels could comprise slightly truncated triangles forming a common seam line extending generally front to rear . the x pattern form may also take a form wherein the upper and lower v forming the x can have different angles of diversion without affecting the benefits realized by the invention . | 1 |
in trials preceding the present invention the inventors stretched a relatively short length of lay - flat tubular 0 . 10 mm thick hdpe film at 20 ° c ., and reeled it up without stabilizing it . immediately afterwards it was helically cut under 45 °, and then stabilized by passage over 70 ° c . warm rollers , closely spaced from each other . it was found that the stabilization thereby became more efficient and the splittability lower . in accordance with this finding , the present invention consists in carrying out the stretching in the tumbling unwinder , which is used in connection with the helical cutting , and to carry out the stabilization after the helical cutting . more exactly expressed the invention concerns a method of manufacturing a polymer film which is uniaxially oriented under an angle to its longitudinal direction , in which a lay - flat tubular film is longitudinally oriented between stretching rollers and is stabilized , and subsequently to its orientation is helically cut by first being unwound from a reel ( 9 ) in an unwinding stand ( 5 ) which performs a tumbling movement to rotate the lay - flat tube around its longitudinally extending middle line , and then being inflated by dragging over a mandrel ( 16 ) and evenly propelled in a screwing movement . hereby each point on the film surface follows a helix , and the cutting takes place by a knife ( 18 ) located in a fixed position , whereafter the helically cut film is pulled away from the mandrel . the invention is characterized in that said stretching rollers ( 108 to 112 ) are assembled in the tumbling unwinding stand to carry out the orientation as a step between the unwinding and the inflation of the lay - flat film , and is further characterised in that the stabilization is carried out after the helical cutting . as regards the unwinding stand , two principally different constructions are possible , both shown in each of the above mentioned u . s . pat . nos . 5 , 248 , 366 and 5 , 361 , 469 , fig1 and 3 . in fig1 the reel to be unwound is assembled in the tumbling unwind stand with its axis perpendicular to the axis of rotation , while in fig3 the axis of the reel coincides with the axis of rotation of the stand , and there is installed a spinner which turns the film such that its middle line will coincide with the axis of rotation of the unwinder . in the said two u . s . patents the lay - flat tuba is inflated to tubular shape by means of air , continuously blown through the mandrel , which is hollow . this air blows back to the ambience through the space between the outer surface of the mandrel and the inner surface of the tubular film , and thereby the passage of the film over the mandrel towards the cutting knife becomes air lubricated . furthermore the film is guided during the inflation by means of conveyor belts . these two precautions , the use of blown air and of support belts , is also preferable , but is not mandatory in connection with the present invention . alternatively rings of guide wheels arranged around the tip of the mandrel may carry out the inflation and the helical propelling of the tubular film . such wheels must be driven in coordination with the rotation of the unwind stand and with the means in which unwind the film in this stand . it has been found that the helically cut unstabilized film can be wound on a reel without causing any distortion , since the coefficient of elasticity ( e ) in the new machine direction is low , and therefore the needed stabilization can be carried out in a separate process line , but normally the stabilization should be carried out in line with the helical cutting . normally but not necessarily , the stabilization is established by heat , preferably by passing the film in s - path over a series of closely spaced heated rollers . the best result is achieved when these rollers also give the film a small stretching in the new machine direction , preferably between 5 - 10 % stretching . this serves to “ iron ” out small creases or other irregularities in the film , at the same time as it reduces the splittability . an alternative method of carrying out the stabilization , applicable especially when an embossed structure of the film is desirable , is to stretch the film by transverse stretching between intermeshing circular or helical grooved rollers . hereby sharp edged grooved rollers produces the most significant embossment and the most efficient stabilization . in one embodiment of the invention , the stretching in the unwind stand takes place between closely spaced grooved rollers , which the film passes in s - path . between the unwinding and the stretching in the unwind stand the film may be supplied with longitudinally extending pleats over its entire width , the size of each pleat being sufficiently fine , and the distribution of the pleats being sufficiently even to make the pleating disappear during the stretching . by this precaution the film is allowed to follow its inherent tendency to reduce its width while the length is extended , and this facilitates the orientation process . methods of pleating a film prior to longitudinal stretching are described in u . s . pat . no . 3 , 233 , 029 ( rasmussen ) and wo 09 / 056601 ( rasmussen ). as it will be understood from the foregoing , the present invention is useful in particular for stretching and helical cutting of low gauge film , where it is essential to simplify the manufacturing process and reduce the machine cost . such low gauge film will already exhibit a relatively high melt orientation , thus the stretch ratio in the tumbling unwinding stand will be relatively low , e . g . between 1 . 5 : 1 and 2 . 5 : 1 . consequently the required depth of the pleats will be low and the devices for pleating relatively simple . however , the stretching in the unwind stand between the closely spaced smooth rollers can also be carried out without a preceding pleating of the film . this means that the edges of the lay - flat tube will become thicker than the rest , since they reduce their transverse dimension , while the rest of the film is prevented from doing the same . therefore the thickness reduction at the edges will be less than the thickness reduction over the rest of the film . in a conventional stretching procedure in which no rotation and helical cutting of the film takes place , this means that an orderly winding up of the stretched film is impossible , since the thicknesses at the edges accumulate and gradually distort the film . when using the present invention , the edges of the lay - flat tube will also be thicker than the rest , but after the helical cutting the original edges will form an angle to the machine direction , and the thickness differences will not accumulate when the film is wound on reel . in another embodiment of the invention , at least a part of the stretching in the unwind stand is carried out between one or more pairs of rollers supplied with cogs extending in the direction of the roller axis , whereby the cogs in each pair of rollers intermesh with each other . also in this case the film may be supplied with longitudinally extending pleats before it meets the first pair of cog rollers or alternatively the stretching may be carried out without such pleating . the result of such cog roller stretching , which in itself is known art , will normally be a film in which the degree of orientation varies in sequences . this may in special cases be an advantage , namely when an embossed structure is wanted . it is also noted that there exists known technology in which two pairs of cog rollers , working in tandem , are coordinated such that together they form an almost evenly stretched film . no matter which of the above embodiments of the invention is used , a suitable composition of the film can for most application conveniently contain 50 % or more hdpe , lldpe or crystalline pp , since the prices of these polymers are relatively low , their stretchability very good and the achievable strength high . with reference to fig1 , the steps till and including “ helical cutting on mandrel ” shall be described in connection with fig2 . the step “ stabilization ” does normally mean stabilization by heat , but stabilization by passage between mutually intermeshing grooved rollers is also a possibility if an embossed shape of the film is acceptable or even wanted , and in very special cases stabilization by irradiation may be chosen . a stabilization by heat will normally be carried out by passage over a series of rollers heated e . g . to 70 - 90 ° c . and closely spaced from one another . during this passage the film is preferably stretched , normally in a ratio between 1 . 05 : 1 and 1 . 2 : 1 , since this can enhance the stabilization at the same time as the splitability is reduced . the rollers may be arranged in a similar fashion to those illustrated in fig2 for tumbling stretching rollers ( 107 )-( 112 ). a stabilization by passage between intermeshing grooved rollers will normally use circular grooved rollers , and in that case the pitch of grooves on each roller can mechanically be brought down to about 1 . 0 - 1 . 2 mm , which is advantageous . however , the grooving may also be helical . such grooved rollers &# 39 ; stabilization can be carried out at ambient or elevated temperature . the box “ optional further steps ” comprises different options . one is embossment . a second is fibrillation along the direction of orientation to form a fibrous network , as known from the art of fibrillating oriented films . most important , however , this optional step can consist in crosslamination with a similar , simultaneously produced , obliquedly oriented film . however , crosslamination can also take place subsequently in a separate production line . the apparatus of fig2 includes “ the tumbling stand ” unit ( 1 ), which has a shaft ( 2 ) at one end and rotates around the axis of the shaft supported by a column ( 3 ) through heavy roller bearings ( 4 ). the column ( 3 ) is mounted on the floor of the room . for simplicity the unwind unit ( 1 ) is shown as having a housing consisting of an end plate ( 5 ) and two side plates ( 6 ). the drawing shows the unit at the time of rotation when these side plates are in a horizontal position and only the upper plate , indicated by dotted lines , can be seen . in practice a framework mainly of profile steel may be preferable to plates since it will be lighter and more convenient . the “ tumbling stand ”, unit ( 1 ) including the rollers which shall be described below , is too heavy to be supported through the heavy roller bearings ( 4 ) alone , and therefore this support is supplemented by one or more big steel rings , which surround and form part of the rotating unwind unit , and which stand and roll on a number of support rollers or support wheels and so serve as bearing rings . alternatively , the support fixed to the floor may form part of one or more bearing rings , on which stand and roll one or more circular arrays of rollers or wheels , which surround and are mounted on the rotating unwind unit . such system is shown in fig3 of u . s . pat . no . 5 , 248 , 366 ( rasmussen ) and u . s . pat . no . 5 , 361 , 469 ( rasmussen ) but for the sake of simplification it is not shown in the present fig2 . the support column ( 3 ) carries a fixed gear wheel ( 7 ) which is engaged with another gear wheel ( 8 ) mounted on the end plate ( 5 ) and therefore carries a planetary movement . the wheel ( 8 ) supplies the drive to the various rollers and wheels in the unit ( 1 ), but for simplicity the transmission for these movements is not shown . a reel ( 9 ) of lay - flat , extruded tubular sheet ( 10 ) is mounted through bearings in the side plate and is supplied with a brake , the bearings and brake not being shown . the flat sheet ( 10 ) is taken off the reel ( 9 ) by means of a set of nip rollers ( 107 ) and ( 108 ), the latter being a driven steel roller , and the former being a rubber coated idle roller . steel roller ( 109 ) is closely spaced from ( 108 ) and is driven at the same circumferential velocity . steel roller ( 110 ) is driven at a higher circumferential velocity selected to produce the wanted stretch ratio ( variable by exchange of gear wheels or chain wheels ). steel roller ( 111 ) is driven at the same circumferential velocity as ( 110 ) to take up a part of the stretching force , and ( 112 ) is a rubber coated nip roller . nip rollers ( 11 ) rotate at the same circumferential velocity as ( 111 ) and ( 112 ). in order to avoid a gradual heating of rollers ( 109 ) and ( 110 ), it is important that each of these rollers are kept at a constant temperature by means of a circulating cooling / heating fluid , preferably water . for the entrance and exit of this water to and from the “ tumbling stand ” ( 1 ) the shaft ( 2 ) must consist of concentric pipes and be connected with a rotary fitting . however , most conveniently there is arranged one circulating water system for rollers ( 108 ) and ( 109 ) to allow stretching at an elevated temperature , and another circulating water system for rollers ( 110 ) and ( 111 ) to cool the stretched film , both systems passing through the shaft ( 2 ) and the rotary fitting . for the sake of simplification these circulation systems are not shown . between the reel ( 9 ) and the first roller ( 107 ) in the line of stretching rollers the film ( 10 ) may be supplied with fine and evenly distributed pleats , which will allow transverse contraction during the longitudinal stretching . devices for such pleating are , as mentioned above disclosed in u . s . pat . no . 3 , 233 , 029 and wo 09 / 056601 . when the film already has received an essential longitudinal melt orientation . and the ratio of stretching in the “ tumbling unwinder ” therefore is limited , e . g . to a range between 1 . 5 : 1 and 2 . 5 : 1 , the pleating devices can be simplified e . g . to consist of a crownshaped idle roller and one pair of mutually intermeshing grooved rollers , as shown in the above mentioned u . s . pat . no . 3 , 233 , 029 . the transmissions between the gear ( 8 ) and rollers ( 11 ), determines the cutting angle . preferably the gear ratios are made variable , for instance by providing the possibility of changing the gear wheels . there is a cylindrical cutting mandrel ( 14 ), and an air jet to inflate the sheet ( 10 ) is blown by a fan ( 13 ), such as a centrifugal fan , through the mandrel towards the rollers ( 11 ). the mandrel is mounted on the floor through a column ( 15 ) and makes a relatively tight fit with the tubular sheet ( 10 ) which slides over it . the air will escape through the narrow space between the mandrel and the sheet and will produce lubrication effect . the tip ( 16 ) of the mandrel may be rounded to avoid hang - up of the sheet . it will be seen that the axis of the inflated tube ( 23 ) coincides at least substantially with the axis of rotation of the unwind unit 1 , and the middle line of the lay - flat tubular film ( 10 ) passing between the rollers ( 11 ). in order to achieve a smooth screw movement of the inflated tubular sheet , it is very advantageous ( and may even be necessary if the sheet is wide ) to provide a driven support from the first position to a position at which the tube is inflated . appropriate support for the inflating tube may be a pair of belts , and as shown in fig1 there are two pairs of driven belts ( 17 ) which support the tube against the backwardly directed force of the air emerging from the mandrel ( 14 ) towards the first position , and promotes a smooth change in shape of the tube from the flat shape to the cylindrical shape . the belts are driven at generally the same velocity as that of the sheet , or at a higher velocity . instead of using two arrays of belts , a pair of single belts , or two arrays of rollers having a relatively small diameter ( only the last roller needing to be driven ) could be used . for a relatively narrow flat sheet , one pair of driven barrel - like rollers of a large diameter may be sufficient . the tubular sheet is cut by a simple knife or blade on a support ( 18 ) which conveniently can be fixed to the mandrel at an adjustable angle . the edge ( 19 ) that is shown on the drawing left of the knife , which becomes the right edge of the final sheet , moves first downwards and underneath the cutting mandrel . the knife may be rotating or vibrating to perform a sawing action . the cut sheet is pulled by a driven winding unit ( 20 ) that is shown diagrammatically . the angle of out , as mentioned , is determined by the ratio between the speeds of rotating of the unit ( 1 ) and the rolls ( 11 ), but the direction of the knife or blade and of the pull exerted by the unit ( 20 ) must also be adjusted so that they approximately fit with the rotation - determined cutting angle . the winding unit ( 20 ) includes a dancer roller ( 21 ) and two auxiliary idle rollers ( 22 ) to control the speed of the winder ( 20 ) and thereby set up a convenient tension . by appropriate adjustment of the air pressure inside the tube ( relative to the ambient air pressure around the tube ) high tensions can be applied by the unit ( 20 ) ( except in the case of very fragile sheets , when lower tensions must be used ). thus , when cutting a flat sheet of about 100 micron gauge and 1 m wide , tensions of from 5 to 20 kg / m final width are normally applicable . the roller arrangement shown in fig3 can substitute the roller arrangement from roller ( 107 ) to roller ( 112 ) in fig2 . it may even be arranged so that the two roller arrangements conveniently can be exchanged with each other in the same tumbling unwinder ( 1 ). the film ( 10 ) enters the nip rollers ( 101 ) and ( 102 ), possibly in a finely and evenly pleated state as described above . roller ( 102 ) is a driven steel roller , while roller ( 101 ) is a rubber coated idle roller . rollers ( 103 ) and ( 104 ) are driven cog rollers , i . e . axial grooved rollers , the cogs extending parallel with the axes and being mutually intermeshing during the operation . ( 105 ) and ( 106 ) are nip rollers , ( 105 ) being a driven steel roller and ( 106 ) a rubber coated idle roller . between rollers ( 102 ) and ( 103 ) there is established a stretching , which is at about the limit for giving the film a permanent elongation . the main permanent elongation should normally be produced by the intermeshing between the cogs on rollers ( 103 ) and ( 104 ), but some further permanent elongation may be produced by stretching between roller ( 104 ) and roller ( 106 ). | 1 |
acrylamide derivatives are preferred polymerisable groups as these tend to lead to less oxygen inhibition of the composition during crosslinking . this is particularly important for in situ crosslinking as is required when the preferred compositions are used as injectable intraocular compositions . crosslinked gels with different mechanical properties can be produced by irradiation of the macromonomer , depending on the degree of acrylamide functionalised and water content of the macromonomer formulation . the water content is preferably 10 – 70 % w / w and more preferably 20 – 60 %. the elasticity of the cured macromonomer is , as measured by the e modulus , in the range 0 . 01 – 100 kpa , preferably 0 . 1 – 10 kpa and more preferably 0 . 5 – 5 kpa . the e modulus is conveniently measured by equipment such as the bohlin controlled stress rheometer . this crosslinking has the advantage of being rapid and relatively insensitive to inhibition by oxygen . the crosslinking process is therefore preferably carried out in such a way that the essentially aqueous solution of the water - soluble polymer comprising crosslinking groups is free or essentially free from undesired constituents , in particular from monomeric , oligomeric or polymeric starting compounds used for the preparation of the water - soluble , cross - linkable polymer , or from by - products formed during the preparation of the water - soluble , cross - linkable polymer , and / or that the solution is used without addition of a comonomer . in the case of photo cross - linking , it is expedient to add an initiator which is capable of initiating free - radical crosslinking and is readily soluble in water . examples thereof are known to the person skilled in the art ; suitable photoinitiators which may be mentioned specifically are benzoins , such as benzoin , benzoin ethers , such as benzoin methyl ether , benzoin ethyl ether , benzoin isopropyl ether and benzoin phenyl ether , and benzoin acetate ; acetophenones , such as acetophenone , 2 , 2 - dimethoxyacetophenone and 1 , 1 - dichloroacetophenone ; camphorquinone ; benzil , benzil ketals , such as benzil dimethyl ketal and benzil diethyl ketal , anthraquinones , such as 2 - methylanthraquinone , 2 - ethylanthraquinone , 2 - tert - butylanthraquinone , 1 - chloroanthraquinone and 2 - amylanthraquinone ; furthermore triphenylphosphine , benzoylphosphine oxides , for example 2 , 4 , 6 - trimethylbenzoyl - diphenylphosphine oxide , benzophenones , such as benzophenone and 4 , 4 ′- bis ( n , n - dimethylamino ) benzophenone ; thioxanthones and xanthones ; acridine derivatives ; phenazine derivatives ; quinoxaline derivatives and 1 - phenyl - 1 , 2 - propanedione 2 - o - benzoyl oxime ; 1 - aminophenyl ketones and 1 - hydroxyphenyl ketones , such as 1 - hydroxycyclohexylphenyl ketone , phenyl 1 - hydroxyisopropyl ketone , 4 - isopropylphenyl 1 - hydroxyisopropyl 1 - hydroxyisopropyl ketone , 2 - hydroxy - 1 -[- 2 (- hydroxyethoxy ) phenyl ]- 2 - methylpropan - 1 - one , 1 - phenyl - 2 - hydroxy - 2 - methylpropan - 1 - one , and 2 , 2 - dimethoxy - 1 , 2 - diphenylethanone , all of which are known compounds . particularly suitable photoinitiators , which are usually used with uv lamps as light sources , are acetophenones , such as 2 , 2 - dialkoxybenzophenones and hydroxyphenyl ketones , in particular the initiators known under the trade names irgacure ® 2959 and darocure ® 1173 . another class of photoinitiators usually employed when argon ion lasers are used are benzil ketals , for example benzil dimethyl ketal . the photoinitiators are added in effective amounts , expediently in amounts of from about 0 . 3 to about 2 . 0 % by weight , in particular from 0 . 3 to 0 . 5 % by weight , based on the total amount of the water - soluble , cross - linkable polymer . the water - soluble , cross - linkable polymers which are suitable in accordance with the invention can be crosslinked by irradiation with ionising or actinic radiation , for example electron beams , x - rays , uv or vis light , ie electromagnetic radiation or particle radiation having a wavelength in the range from about 280 to 650 nm . also suitable are uv lamps , he / dc , argon ion or nitrogen or metal vapour or ndyag laser beams with multiplied frequency . it is known to the person skilled in the art that each selected light source requires selection and , if necessary , sensitisation of the suitable photoinitiator . it has been recognised that in most cases the depth of penetration of the radiation into the water - soluble , cross - linkable polymer and the rate of curing are in direct correlation with the absorption coefficient and concentration of the photoinitiator . if desired , the crosslinking can also be initiated thermally with an appropriate thermal free radical initiator , or by redox processes well known in the art . it should be emphasised that the crosslinking can take place in a very short time in accordance with the invention , for example , in less than five minutes , preferably in less than one minute , in particular in up to 30 seconds , particularly preferably as described in the examples . in general hydrophilic copolymers are preferably prepared by standard free radical polymerisation of dimethyl acrylamide with the active hydrogen comonomer , hydroxy butyl acrylate or n - hydroxy ethyl acrylamide , in dioxane to afford white powdery polymers . the feed ratio of monomers is varied to afford a range of copolymers with differing uptake of the hydroxyl monomer into the copolymer . the copolymers can then be activated by the 1 , 8 - diazabicyclo [ 5 . 4 . 0 ]- undec - 7 - ene ( dbu ) catalysed condensation in dioxane of 2 - vinyl - 4 , 4 - dimethylazlactone with the pendant hydroxy functions of the macromolecules . the resultant acrylamide active macromer is isolated by precipitation , and dried in vacuo at 40 ° c . for 4 hours . the acrylamide functionalised polymer was then dissolved in an excess of water ( ca . 50 wt %) 0 . 3 wt % of the photoinitiator irgacure 2959 was added , and then the aqueous solution was evaporated down to the appropriate water content , the invention will be further described by reference to preferred embodiments set out in the following examples . this example illustrates the preparation and testing of a composition according to the present invention . a hydrophilic poly ( hba - co - dma ) copolymer was synthesised by dissolving 2 . 0013 g 4 - hydroxybutyl acrylate monomer ( aldrich cat . no . 27 , 557 – 3 ) and 6 . 0755 g n , n - dimethylacrylamide monomer ( aldrich cat . no . 27 , 413 – 5 ) in 120 ml 1 , 4 - dioxane in a 250 ml round bottom flask equipped with a stirrer bar . 0 . 123 g ( 1 mole percent ) of azobisisobutyronitrile ( aibn ) initiator was added , and the monomer solution was freeze - thaw degassed four times . after reaction at 70 ° c . for 16 hours , the copolymer was isolated by precipitation into hexane , and was dried in vacuo at 40 ° c . for 4 hours to yield 6 . 25 g of a white , powdery polymer . 1 . 88 g of the polymer was dissolved in 20 ml 1 , 4 dioxane in a 50 ml round bottom flask equipped with a stirrer bar and nitrogen purge . 70 milligrams of 1 , 8 - diazabicyclo [ 5 . 4 . 0 ]- undec - 7 - ene ( dbu ) ( aldrich cat . no . 13 , 900 – 9 ) was added , followed by 0 . 4801 g 2 - vinyl - 4 , 4 - dimethylazlactone . the reaction mixture was heated at 70 ° c . for 17 hours and the polymer was isolated by pouring the reaction mixture into excess hexane . the polymer was then dried in vacuo at 40 ° c . for 4 hours . the acrylamide functionalised polymer was then dissolved in water to give a 30 wt % solution , and 0 . 3 wt % of the photoinitiator irgacure 2959 was added . the polymer solution was placed into polypropylene moulds ( designed to give a flat polymeric disc of 20 . 7 mm diameter and 1 . 0 mm depth ) and polymerised for ten minutes under irradiation from a 365 nm uv lamp . after polymerisation was complete , a transparent , rubbery polymer disc was removed from the moulds . the shear modulus of the polymer was measured with a bohlin controlled stress rheometer ( cs - 10 ) and the results are set out in table 1 . | 0 |
the present invention will now be described more fully hereinafter with reference to the accompanying drawings . in the drawings , the thicknesses of layers and regions are exaggerated for clarity . also , like reference numerals are used to designate like elements throughout the drawings . referring to fig2 a , a photo mask 200 according to the present invention includes a transparent substrate 205 , and a light - shielding layer pattern 210 on the transparent substrate 205 . in the case in which the photo mask 200 is a phase shift mask , the light - shielding layer pattern 210 is a phase shifter , i . e ., comprises a semi - transparent phase shifting material , and the photo mask 200 may further include a chrome pattern 215 at the outer periphery of the light - shielding layer pattern 210 . however , the photo mask of the present invention is not limited to a phase shift mask , but may embody other types of photo masks such as a binary mask . the transparent substrate 205 may be a quartz substrate , and has low transmissivity regions 230 in a predetermined area c 1 of its upper portion . the low transmissivity regions 230 have a transmissivity lower than that of the remainder of the transparent substrate 205 . the light - shielding layer pattern 210 is of material that shields ( completely blocks ) or shifts the phase of light incident thereon . for example , the light - shielding layer pattern 210 may comprise molybdenum ( mo ). in any case , the light - shielding layer pattern 210 defines transmission sites at which the transparent substrate 205 is exposed and whereat light is transmitted by the transparent substrate 205 . the critical dimension of the photo mask 200 corresponds to the width of a transmission site . thus , the photo mask 200 may have a distribution of critical dimensions in accordance with the widths of the transmission sites . accordingly , the area cl in which the low transmissivity regions 230 are formed preferably corresponds to a portion of the transparent substrate 205 where the critical dimensions of the photo mask 200 are higher than average . furthermore , the low transmissivity regions 230 may be formed by doping the substrate 205 with ions . the ions may be gallium ( ga ) ions , or may be germanium ( ge ) ions . in this case , the light is reflected or scattered by the ions so that the intensity of the light passing through the doped regions is reduced . moreover , the higher the concentration of the impurities in the doped regions , the greater the phenomenon , such as scattering , becomes and the greater is the reduction in the intensity of the light passing through the doped regions . referring to fig2 b , a photo mask 200 according to the present invention may have low transmissivity regions 230 at all of the transmission sites of the transparent substrate 205 . that is , all of the portions of the substrate 205 exposed by the light - shielding layer 210 are low transmissivity regions 230 . fig2 c illustrates the relationship between the transmissivity of the photo mask and the critical dimension of the photoresist pattern formed on the semiconductor substrate using the photo mask . when the intensities of portions of light passing through transmission sites of the photo mask , and to which the photoresist is exposed , are t 1 and t 2 , respectively , wherein ( t 1 & gt ; t 2 ), the critical dimensions of the corresponding portions of the photoresist pattern formed by developing the photoresist exposed to the light are l 1 and l 2 respectively , wherein ( l 1 & gt ; l 2 ). thus , if the transmissivity of the photo mask is decreased by a ratio of t 2 to t 1 , the critical dimension of the photoresist pattern formed using the photo mask is accordingly reduced from l 1 to l 2 . this is because the critical dimension is determined by the intensity of the light , when the intensity is above a predetermined level necessary to induce a reaction with the photoresist . thus , the critical dimension of a photoresist pattern formed using the photo mask 200 of fig2 a is smaller than that of the photoresist pattern formed using a similar photo mask without the low transmission regions 230 . accordingly , the distribution of the critical dimensions of a photoresist pattern formed using the photo mask 200 can be small even if the distribution of the critical dimensions of the photo mask is great . a small distribution of the critical dimensions of the photoresist pattern within a die allows for a high degree of uniformity to be achieved shot - to - shot , i . e ., over the entire semiconductor substrate . therefore , the low transmission regions 230 should be doped at a concentration that is as correspondingly great as the distribution of the critical dimensions of the transmission sites of the light - shielding layer pattern 210 . furthermore , the average critical dimension of a photoresist pattern formed using the photo mask 200 of fig2 b is smaller than the average critical dimension of the photoresist pattern formed using a similar photo mask without the low transmission regions 230 . thus , even if the critical dimension of the light - shielding layer 210 of the photo mask 200 is greater than its target ( design ) critical dimension , a photoresist pattern having its target critical dimension can be formed using the photo mask . therefore , the low transmission regions 230 should be doped at a concentration that is as correspondingly high as the difference between the average value of the actual critical dimensions of the photo mask 200 and the target critical dimension . fig3 a through 3e illustrate a method of correcting a photo mask according to the present invention . the method is used in fabricating a photo mask according to the embodiment of fig2 a of the present invention . referring to fig3 a , a photo mask is coated with a photoresist 320 . the photo mask includes a transparent substrate 305 , a light - shielding layer pattern 310 on the transparent substrate 305 , the light - shielding layer pattern 310 having transmission sites having a distribution of critical dimensions relative to a predetermined target critical dimension , and a chrome pattern 315 disposed at the outer peripheral edge of the light - shielding layer pattern 310 . the layer of photoresist 320 may be formed by a spin coating technique in which liquid photoresist is dispensed onto the center of the photo mask 300 and the photo mask 300 is rotated to distribute the photoresist across the mask . subsequently , the photoresist 320 may be subjected to a soft - bake . the soft - bake reduces the solvent contained in the liquid photoresist and improves the adhesiveness of the photoresist . the soft - bake bake is a heat treatment that can thus be performed using a convection oven , infrared rays or a hot plate , or the like and typically requires only several dozens of seconds to several dozens of minutes . referring to fig3 b , a predetermined area of the photoresist 200 is exposed to light using a separate photo mask in accordance with the critical dimensions of the photo mask 300 . the exposure facilitates a reaction between the photoresist and the light . reference numeral 320 ′ designates the exposed portion of the photoresist 320 . referring to fig3 c , the photoresist 320 is developed , thereby forming a photoresist pattern 320 b . the exposed portion 320 ′ of the photoresist is removed by the developing process . the developing process may be a wet etch method or a method wherein an etching solution is sprayed onto the photoresist . a post - bake may be performed after the developing process . the post - bake removes any solvent remaining in the photoresist pattern 320 b , improves the adhesiveness of the photoresist , and increases its etch resistance . referring to fig3 d , the front portion of the transparent substrate 305 is doped with ions ( an impurity ) 330 using the photoresist pattern 320 b as a mask . the ions 330 are integrated with the transparent substrate 305 and act to scatter or reflect light incident on the doped region of the substrate , thereby decreasing the transmissivity of the photomask at the doped region . the ions may be ga ions , or ge ions . the doping may be performed using an ion implanter or a fib apparatus . both an ion implanter and a fib apparatus implant ions by extracting particular ions from a source of ions , accelerating the ions , and focusing the ions into a beam . an ion implanter can accelerate the ions with a much higher energy than an fib apparatus , and implant a greater amount of ions . on the other hand , it takes one hour more or less to implant ions over the entire photo mask using an fib apparatus . however , it of course takes less time to scan only a part of the photo mask with an fib apparatus such as when the photo mask is being corrected to control its transmissivity locally . thus , the fabrication of a photo mask according to the present invention is simpler than the conventional method and , in particular , the time it takes to correct the transmissivity of the photomask is shorter than the conventional method which takes one or two days on average . referring to fig3 e , the photoresist pattern 320 b is removed . the photoresist pattern 320 b may be removed by either a wet etch or a dry etch . the low transmissivity regions of the transparent substrate 305 , which are doped with the ions 330 , are preferably located at the upper exposed surface of the transparent substrate 305 , at the transmission sites which have critical dimensions higher than the average critical dimension of all of the transmission sites . thus , the distribution of the critical dimensions a photoresist pattern formed using the photo mask 300 will be small even if the distribution of the critical dimensions of the photo mask 300 is large . therefore , a high degree of shot uniformity can be produced over the entire semiconductor substrate . fig4 a through 4f illustrate another method of correcting a photo mask according to the present invention . the method can also be used in fabricating a photo mask according to the embodiment of fig2 a of the present invention . referring to fig4 a , a semiconductor substrate 420 is coated with photoresist 425 . the coating operation may be carried out as described in connection with the embodiment of fig3 a - 3e . referring to fig4 b , the first layer of photoresist 425 is exposed to light through a photo mask 400 having a transparent substrate 405 , a light - shielding layer pattern 410 formed on the transparent substrate 405 , and a chrome pattern 415 extending along the outer peripheral edge of the light - shielding layer pattern 410 . reference numeral 425 ′ designates an exposed portion of the first photoresist 425 . the exposure operation can be performed using an exposure apparatus such as a stepper or a scanner . the light focused in the exposure apparatus passes through the transparent substrate 405 , i . e ., through the transmission sites that are devoid of the light - shielding layer pattern 410 , and reacts with the photoresist 425 . the transmission sites of the photo mask 400 thus have a one - to - one correspondence with the exposed portions 425 ′ of the first layer of photoresist . referring to fig4 c , the first layer of photoresist 425 is developed , thereby forming a first photoresist pattern 425 b . the developing process may be similar to that described in connection with the embodiment of fig3 a - 3e . next , the critical dimensions of the first photoresist pattern 425 b are measured . the dotted area al in the figure is representative of an area where the critical dimensions are higher than the average critical dimension of the entire first photoresist pattern . such differences in the critical dimensions may occur due to process errors in the formation of the photo mask , or non - uniformity in the exposure and the developing processes , or the like . referring to fig4 d , a second photoresist pattern 430 b is formed on the photo mask 400 , to expose an area b 1 that corresponds to the area a 1 ( fig4 c ) of the first photoresist pattern 425 b . the second photoresist pattern 430 b may be formed by a process similar to that used to form the first photoresist pattern 425 b . referring to fig4 e , the area b 1 of the transparent substrate 405 is doped with ions 435 ( an impurity ) using the second photoresist pattern 430 b as a mask . the ions 435 may be ga ions , or ge ions . the ions become integrated with the transparent substrate 405 , and thus act to scatter or reflect light , thereby decreasing the transmissivity of the doped region . the doping process may be performed using an ion implanter or an fib apparatus as described in connection with the previous embodiment . referring to fig4 f , the second photoresist pattern 430 b is removed . the second photoresist pattern 430 b may be removed by either a wet etch or a dry etch . therefore , the transmissivity of the photo mask 400 is less at area b 1 of the transparent substrate 405 , which is doped with the ions 435 , than before the substrate was doped . as a result , the distribution of the critical dimensions of a photoresist pattern on a semiconductor substrate using the doped photo mask 400 shown in fig4 f is smaller than the distribution of the critical dimensions of a photoresist pattern that could be formed by the photo mask shown in fig4 b ( i . e ., the photomask before it is doped ). furthermore , because the photo mask 400 can produce a photo resist pattern whose critical dimensions have a small distribution within a die , the photo mask 400 of the present invention also can be used to attain a high degree of shot uniformity , i . e ., uniformity in each of the patterns produced over the entire semiconductor substrate . fig5 a through 5d illustrate still another method of correcting a photo mask according to the present invention . the method is used in fabricating a photo mask according to the embodiment of fig2 b of the present invention . referring to fig5 a , a semiconductor substrate 520 is coated with a photoresist 525 . the coating of the substrate 520 may be performed as previously described in connection with the other embodiments of the present invention . referring to fig5 b , the photoresist 525 is exposed to light through a photo mask 500 having a transparent substrate 505 , a light - shielding layer pattern 510 formed on the transparent substrate 505 , and a chrome pattern 515 extending along the outer peripheral edge of the light - shielding pattern 510 . reference numeral 525 ′ designates the exposed portion of the photoresist 525 . the exposure process is similar to that previously described in connection with the other embodiments of the present invention . referring to fig5 c , the photoresist 525 is developed , thereby forming a photoresist pattern 525 b . the critical dimensions of the photoresist pattern 525 b are measured to determine the average critical dimension of the pattern . in the fabrication of a semiconductor device , a target critical dimension is predetermined for each element of the device and for the photoresist pattern used as an etch mask for forming elements of the device . if the actual critical dimension of an element of the semiconductor device is greater or smaller than the target critical dimension , the resultant device may have characteristics , resistances , or the like that cause the device to mal - function or operate poorly . according to the present invention , the photo mask is corrected , i . e ., the transmissivity thereof is adjusted , to compensate for the difference between the average critical dimension of the photoresist pattern that would otherwise be formed prior to correction and the target critical dimension of the photoresist pattern . fig5 c illustrates an example in which the average critical dimension is greater than the target critical dimension . referring to fig5 d , the upper portion of the transparent substrate 505 is doped with ions 535 ( an impurity ). the ions may be ga ions , or ge ions . as described above , the ions are implanted to decrease the transmissivity of the photo mask 500 . the doping of the substrate 505 may be performed using an ion implanter or an fib apparatus as also described above . the dose of the ions is directly proportional to the difference between the average critical dimension and the target critical dimension . therefore , the transmissivity of the transparent substrate 505 of the photo mask 500 is decreased . thus , when a photoresist pattern is formed on a semiconductor substrate using the photo mask 500 doped with the ions 535 as shown in fig5 b , the average critical dimension of the photoresist pattern conforms to the target critical dimension . according to the present invention as described above , the transmissivity of a photo mask is adjusted / corrected by merely doping a predetermined portion of the transparent substrate of the photo mask . this technique is simpler and requires less time than the conventional method . furthermore , defects and scratches on the front surface of the substrate are prevented unlike the conventional method . finally , although the present invention has been particularly shown and described with reference to the preferred embodiments thereof , it will be understood by those of ordinary skill in the art that various changes in form and details may be made thereto without departing from the true spirit and scope of the present invention as defined by the following claims . | 6 |
for a better understanding of the determination method described below with reference to an exemplary embodiment , the inventive apparatus for the implementation of this method , as shown , for example , in fig3 will be described first . this apparatus is composed of an irradiation unit 1 , for example in the form of a laser with a wavelength of 675 nm . a detector 3 is provided thereopposite . the region of a living subject to be examined , a finger 4 in the illustrated example , is placed between irradiation unit 1 and detector 3 . in the region of a joint to be examined , this finger 4 is composed of skin tissue 5 , cartilage and bone tissue 6 as well as joint capsule tissue 7 and joint fluid 8 . a control unit 9 controls the operation and a computer 10 determines the optimum examination location from the data obtained by the detector 3 . given this embodiment having only one radiation source 2 , the operation for determining the optimum examination location ensues such that the irradiation unit 1 together with the radiation source 2 is moved , for example , to five selected positions above the joint gap , whereby the mobility is indicated by the double arrow a . the positioning unit required for this purpose is not explicitly shown . a punctiform transillumination of the tissue then ensues at each of the selected locations . the respective scattered light distribution for each irradiation is registered with the detector 3 in the form of a point spread function and is supplied to the computer means 10 , which , on the basis of the method described below , determines the optimum examination site and supplies a signal indicating this site to the control unit 9 , which then causes the irradiation unit 1 to be driven and moved for the implementation of the actual examination , as already described , the scattered light distribution is registered for each of the predetermined irradiation locations around a defined zero position . such scattered light distributions are shown in fig1 wherein the location in mm around the zero position is indicated along the abscissa and the normalized irradiation intensity is indicated in 1 / cm 2 along the ordinate . the arrows respectively indicate the irradiation location for the respective curves . the irradiation locations shown here lie distributed ± 2 millimeters around the zero location , i . e . a total of five irradiation locations were selected . the respectively obtained scattered light distribution for each of the irradiation locations x − 2 . . . x 2 is indicated with the reference characters k − 2 . . . k 2 . as can be derived from fig1 the course of the curve is still relatively noise - infested and allows only an inexact determination of the optimum examination location . to this end , an approximation curve a + 2 . . . a + 2 is determined for each of the curves k − 2 . . . k + 2 by approximation with a number of gaussian functions . these approximation curves are shown in fig2 . moreover , the respective centers of gravity s − 2 . . . s + 2 of the curves are also determined for each curve a 2 . . . a 2 . the centers of gravity are not utilized for the determination of examination sites described below ; however , the determination method could likewise be implemented based on these values . a series of function - specific , location - related features are then determined for determining the optimum examination location , as can be derived from the following table . the x - values of the respective curve maximums e max are first determined on the basis of the approximation functions . as can be derived from line 2 of the table , these respectively lie in the negative range . it is already possible to calculate a first examination location from these values by averaging . this would lie at x average = 1 . 12 mm . for taking the actual amount of the scattered light distributions into consideration , it is expedient to determine a weighting factor and to take it into consideration in the formation of the average . certain properties of the scattered light distribution such as the overall irradiation intensity e gea (= area under the respective curve ) and the standard deviation (= width of the curve ) are available for calculating this weighting factor . the values therefor determined with respect to the approximation function can be derived from lines 3 and 4 . based thereon , it is possible to multiplicatively determine a weighting factor from these two values , whereby the values are recited in line 5 . subsequently , the identified weighting factor is normalized to the highest weighting factor ( line 6 ). when the identified x - values of e max ( column 2 ) are now multiplied by the normalized weighting factors , then the weighted x - values of e max are obtained , as indicated in line 7 . the weighted average that can be calculated from these weighted values amounts to x average = 1 . 004 mm and takes the respective amount of the individual scattered light distributions into account . compared to the position value calculated unweighted , a difference of 0 . 116 mm thus derives . subsequently , the weighted average that specifies the optimum location at the detector side must be back - transformed onto a coordinate of the excitation side . to this end , the offset between the irradiation location that supplies the highest weighting factor , or the highest e ges , and the position of e max of this scattered light distribution is employed in the illustrated exemplary embodiment , the irradiation position that supplies the scattered light distribution with the highest weighting factor is the irradiation location x 1 . the e max - position of this scattered light distribution is x emax = 1 . 4 mm . an offset of x 1 = x emax = 1 mm −(− 1 . 4 mm ) + 0 . 4 mm derives therefrom . for back - transformation , the calculated , weighted average of 1 . 004 mm is shifted by this offset , so that the new zero position in the irradiation plane is selected as x optimum = 0 . 604 mm . instead of employing the x - values of e max , the disclosed determination method can be implemented in the same way based on the centers of gravity of the respective approximation functions . finally , fig4 shows a further embodiment of an inventive apparatus . the structure is largely the same as shown in fig3 ; however , an irradiation unit 11 is employed in this embodiment that contains a number of radiation sources 12 . the radiation sources 12 are spaced from one another grid - like , whereby a grid of 500 μm or less , preferably 250 μm , is employed . in the illustrated exemplary embodiment , only seven radiation sources are indicated for clarity ; the number , of course , is substantially greater in view of the selected grid spacing . the operation of this apparatus is such that , for example , only every other radiation source 12 is driven , whereby , of course , only those are driven that are in a correspondingly close position to the suspected , optimum examination site . after determining the optimum examination site , a radiation source 12 that is more beneficial because it lies closer to the examination location can then be driven via the control unit 9 , which is also present in this embodiment . such an operation is possible given an adequately small spacing , for example 250 μm , insofar as a larger grid spacing is selected ( for example , 500 μm ), it is likewise conceivable to provide for positioning of the irradiation unit 11 in order to move a selected radiation source to the optimum examination location . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art . | 0 |
referring to fig1 , a cdpr system 100 generally comprises a retailer inventory management module 110 , a network 120 , and a vendor managed inventory module 130 . retailer inventory management module 110 includes on - hand inventory ( perpetual inventory ) amounts by product within shelf within store . planograms are transmitted over a network 120 ( e . g . the internet ) to a vendor managed inventory system ( i . e . cdpr system ). preferably , files are transferred using file transfer protocol ( ftp ), however various other protocols and technologies can be used to transfer planogram data 112 including transfers using http . it should also be recognized that all transmissions discussed herein can be accomplished using wired and / or wireless communication paths . planograms are used by retailers and others to design and allocate shelf space in a store . a planogram is generally depicted graphically , but in any case typically includes the following information : product code , product vendor , fixture ( i . e . location or shelf ), fixture capacity , and effective date . fig3 depicts some exemplary planogram information . note , however , that planogram information does not include store identification . for purposes of this specification , a fixture is the lowest level location of a product on a shelf . for example , if a retailer creates a planogram showing product configurations only to a shelf level of detail , the word “ fixture ” is synonymous with shelf . in fact , throughout much of this specification , the words fixture and shelf are interchangeable . however , if a shelf is further divided into multiple areas , a fixture is synonymous with a particular area on the shelf . thus , a fixture is always the most detailed location of a product . it should be noted that shelf and / or fixture configurations generally remain consistent across all stores of a multi - store retailer . planogram information is generally entered by a retail level employee such as a merchandising manager . in most cases , the merchandising manager will derive planograms as a result of sales data , trends , and other dynamic information , and as such , planogram information can change very quickly . not only can fixtures be added , deleted , and changed , but stores may open and close . all this adds to the dynamic nature of planograms . because current planogram information is important to calculations made in a vmi system , it is contemplated that future ( i . e . effective date in the future ) as well as current planograms will be accepted and thereafter implemented based on the effective date . in addition , preferred embodiments will store historical planograms for use in analyzing particular store configurations . performance data calculated at the vendor level is envisaged to be transmitted back to the retailer for input into store trait and planogram configurations . the vendor managed inventory module 130 or cdpr module is generally controlled by a product provider ( e . g . supplier , vendor , manufacturer , distributor , and so on ), and the product provider is responsible for maintaining the data integrity and functional aspects of the system . in the context of this application , a vendor or product provider is an entity that provides a product that is directly or indirectly sold at a retail level . the cdpr module uses the planogram information as well as other information including demographic , psychographic , and trend data to create forecasting data , rate of return data , performance data , and other outputs that are transmitted to the retail level inventory systems . significantly , such information is used by the product provider to replenish inventory on a timely basis . it is the collaboration between the retail level system and the vendor level system that results in the exchange of valuable information . for example , the cdpr module is also capable of making recommendations to the retail level entity by taking into consideration past and future planogram information . these recommendations are generally contemplated to include factors that account for trends in product demand down to the store level or even the fixture level . thus , a recommendation for one store will usually be different from that of another store because of demographic and psychogaphic differences . moreover , recommendations can vary depending on the location of a fixture in a store . past , current , and future planogram information is accepted by the vmi module . as such , the effective date of a planogram is important . a store may , for instance , transmit a series of planograms having successive effective dates as well as varying capacities , locations , and so on . the cdpr module is receptive to multiple planograms and can even accept and incorporate changes to planograms in a real - time manner . drawing your attention now to fig2 , a store trait data listing 200 generally includes the following fields : store identification 210 ( e . g . store number ), fixture 220 , and effective date 230 . store trait data basically represents the configuration of a store in terms of its fixtures . it should be noted that a multi - store retailer has stores that are divided up into fixtures ; so , for example , store 1 has fixtures a , b , and f . obviously , fig2 shows exemplary data and many more fixtures would likely be included in most retail stores . still , with reference to fig2 , one can see that fixtures b and f are part of the configuration of stores 1 and 2 and fixture b is part of the configuration of store 3 . fig3 depicts planogram information 300 including fields for product code 310 , fixture 320 , and fixture capacity 330 . focusing on fig3 , one can see that the capacity for item wp1432 is 25 on fixture b and 10 on fixture f . in fig4 , a listing of mapped data 400 includes store identification 410 , product code 420 , fixture 430 , and fixture capacity 440 . of course , other fields such as effective data may be included in a listing of mapped data , though not depicted for purposes of fig4 . it is contemplated that mapping includes a step of matching store trait data and planogram information by fixture identifier . using the mapped data , it becomes clear that stores 1 and 2 require 35 wp1432 while store 3 requires only 25 . it should be recognized that because capacities are at the fixture level , safety stock and replenishment amounts can be calculated by fixture thereby reducing the incidence of excess or insufficient inventory and at the same time increasing good will toward the retailer . now , with regard to fig5 , a safety stock and replenishment calculation system 500 generally comprises a vmi system 510 that calculates a safety stock 520 which , in turn , is input to a replenishment amount 530 . a purchasing manager 550 uses store sales figures , trends , demographics , psychographics , and so on to determine a fixture configuration for a store . it should be recognized that a purchasing manager is not required as there are other entities and automated methods that can be used to determine fixture configurations . in any case , fixture configuration by store is reflected in the store trait data 555 . on the other side of the equation , a merchandising manager 560 creates planogram information 565 based on product information as well as sales information , space limitations , and store layouts . again , another entity or automated method may be substituted for a merchandising manager in less preferred embodiments . both the store trait data 555 and planogram information 565 are input to the vendor managed inventory system 510 . it is contemplated that transmission of store trait data and planogram information may utilize various channels of communication including most especially those that use the internet . as planogram information and store trait data is often in a spread sheet format ( e . g . microsoft ® excel ), a preferred vmi system allows for import of such files formats . vmi system 510 receives demographic data and psychogaphic data 570 including ages , incomes , socioeconomic data and so on . such demographic and psychogaphic data can be applied to the capacity for a product before selecting a safety stock value . vmi system 510 also receives information which enables it to calculate economic order quantity ( eoq ) rules 575 . one of skill in the art will recognize that eoq rules may take into consideration lead times and economic order quantities in addition to other information . vmi system 510 also receives point of sale data 580 preferably including fixture level sales data . point of sale data 580 includes product id , store number , and quantity sold and may also include perpetual inventory amounts and a fixture identification , though the latter two items of data are not included in some embodiments . in a preferred class of embodiments , fixture level point of sales ( pos ) data is applied to current fixture level capacity which was received as part of the planogram information . it should be pointed out here that in most cases , current fixture level capacity is based on the effective date that was also received as part of the planogram information . collecting point of sale data at a fixture level is generally accomplished by affixing a fixture identifier on or in each product . preferably the fixture level identifier is in the form of an rfid chip which is read by the point of sale system in order to indicate a sale of a product from a particular fixture . a further aspect of the inventive matter is the inclusion of pos data to the day of the week . the following example , based on the data in fig4 , elucidates this aspect . store 1 has capacity of 25 for product wp1432 on fixture b . assume that a safety stock of 13 was calculated based on the inventive concepts provided herein . when the perpetual quantity of wp1432 on fixture b in store 1 dips below 13 , generation of a fixture level replenishment order is triggered . if the replenishment order is generated on a thursday and the lead time is 3 days , the vmi system is advantageously programmed to look at fixture level sales history for the days of friday , saturday , and sunday when calculating the quantity of wp1432 to send in the replenishment order . this aspect is important because sales for the days of friday , saturday , and sunday may far exceed sales of the days of monday , tuesday , and wednesday , for instance . it should be stressed that planogram information and store trait data are continuously being monitored by the vmi system and in that regard when an effective date becomes equal to the current date , the new planogram information and / or store trait data are put into effect . thus , specific embodiments and applications of a collaborative demand planning and replenishment system have been disclosed . it should be apparent , however , to those skilled in the art that many more modifications besides those already described are possible without departing from the inventive concepts herein . the inventive subject matter , therefore , is not to be restricted except in the spirit of the appended claims . moreover , in interpreting both the specification and the claims , all terms should be interpreted in the broadest possible manner consistent with the context . in particular , the terms “ comprises ” and “ comprising ” should be interpreted as referring to elements , components , or steps in a non - exclusive manner , indicating that the referenced elements , components , or steps may be present , or utilized , or combined with other elements , components , or steps that are not expressly referenced . | 6 |
fig1 illustrates a heat dissipation device in accordance with a preferred embodiment of the present invention . the heat dissipation device comprises a heat sink 10 , a fan holder 20 and a fan 30 mounted on the fan holder 20 . the heat sink 10 is integrally extruded from heat conductive material , such as aluminum , and comprises a base 12 and a plurality of fins 14 perpendicularly extending from the base 12 . the base 12 has a bottom face ( not labeled ) for contacting a heat - generating electronic device such as a cpu ( not shown ). a pair of slots 16 are defined in outer surfaces of two opposite outmost fins 14 of the heat sink 10 , respectively . each of the two opposite outmost fins 14 comprises a first portion 140 extending upwardly from the base 12 and a second portion 142 extending upwardly from a lateral side of the first portion 140 . the first portion 140 has a gradually decreasing thickness toward a top of the first portion 140 away from the base 12 . the slot 16 is defined when the second portion 142 is recessed in a connecting portion ( not labeled ) between the first portion 140 and the second portion 142 . seen from a direction of a lateral side view ( i . e ., fig2 ) of the heat sink 10 , the second portion 142 has an ear - like shape . the second portion 142 has an inclined surface 144 corresponding to a top end ( not labeled ) of the first portion 140 , for facilitating an engagement with the fan holder 20 . the inclined surface 144 extends upwardly and outwardly along a bottom - to - top direction of the heat sink 10 . the top end of the first portion 140 is located outside of and adjacent to the slot 16 . the fan holder 20 comprises a pair of brackets 200 attached on a top of the heat sink 10 . each bracket 200 comprises a first plate 210 arranged at a lateral side of the heat sink 10 and a second plate 220 connecting with the first plate 210 and attached to the top of the heat sink 10 . the first plate 210 has a rectangular shape and has a pair of positioning ribs 212 perpendicularly inwardly protruding from an inner side ( not labeled ) thereof . the positioning ribs 212 are stamped from the first plate 210 so that a pair of recesses 214 are defined in an opposing outer side ( not labeled ) of the first plate 210 , located corresponding to the positioning ribs 212 . a pair of threaded holes 222 are defined in opposing lateral edges of the second plate 220 . the second plate 220 has an arc - shaped side edge 224 between the threaded holes 222 . the arc - shaped side edges 224 of the second plates 220 of the brackets 200 together define a round opening ( not labeled ) below the fan 30 , for guiding airflow produced by the fan 30 to pass through to cool the fins 14 of the heat sink 10 . the fan 30 comprises a rectangular frame 32 . the frame 32 defines four orifices 320 in four corners corresponding to the threaded holes 222 of the second plates 220 of the brackets 200 of the fan holder 20 . referring to fig2 , in order to assemble the fan holder 20 to the heat sink 10 , bottoms of the first plates 210 of the brackets 200 of the fan holder 20 are slipped over the inclined surface 144 and inserted into the slots 16 of the opposite outmost fins 14 of the heat sink 10 . the positioning ribs 212 of the first plates 210 of the brackets 200 are held in the slots 16 and resist the second portion 142 of the outmost fin 14 . the positioning ribs 212 abut against a bottom surface ( not labeled ) of the second portion 142 of the outmost fin 14 , which is extended inwardly from a bottom end of the inclined surface 144 . the first plate 210 has an outer surface at a lower end thereof , which abuts against the top end of the first portion 140 , and an inner surface above the position ribs 212 , which abut against the inclined surface 144 . referring to fig1 - 3 , the second plates 220 of the brackets 200 of the fan holder 20 are located on the top of the heat sink 10 and the fan 30 is arranged on the brackets 200 of the fan holder 20 . four screws 40 are extended through the orifices 320 of the frame 32 and screwed in the threaded holes 222 of the second plates 220 of the brackets 200 to thereby fasten the fan 30 to the top of the heat sink 10 , with the airflow produced by the fan 30 passing through the opening ( not labeled ) of the fan holder 20 to cool the fins 14 of the heat sink 10 . in this case , the fan holder 20 can be made by steel instead of aluminum and surfaces of the fan holder 20 are coated with zinc so that the fan holder 20 has advantages of better strength and low cost . it is believed that the present embodiments and their advantages will be understood from the foregoing description , and it will be apparent that various changes may be made thereto without departing from the spirit and scope of the invention or sacrificing all of its material advantages , the examples hereto described merely being preferred or exemplary embodiments of the invention . | 7 |
this document discloses a standardized integration model for distributed business processes . the integration model includes two models : a delivery model and a configuration model . the delivery model is used to describe the business process during design time , and the configuration model is used to configure the business process for runtime . the integration model is includes an aggregated multigraph and an expanded multigraph . the aggregated multigraph forms the basis for the delivery model and the expanded multigraph forms the basis for the configuration model . the mathematical model includes a transformation from an aggregated multigraph to an expanded multigraph , and from an expanded multigraph to an aggregated multigraph . when used in the integration model , these transformations allows a user to automate the integration configuration for distributed business processes . fig1 depicts a functional block diagram of a business process management system 100 . the system 100 includes a process engine 104 integrated in an integration server 102 . the process engine 104 and integration server 102 , as they are called in their runtime configurations , are also respectively known as a process editor and an integration builder in their “ definition time ” configurations . process definition 106 and bpm runtime 108 in the bpm system 100 are based on different development platforms . for instance , the process definition 106 is based on java , such as a j 2 ee platform 105 , and the runtime 108 is based on abap . the bpm system 100 includes monitoring and administration tools 124 on the integration server 102 . the process definition 106 module utilizes xml objects and correlations to define processes , based on deployment rules imported from xi objects 112 from the integration directory 114 . the xi objects 112 are based on the routings and mappings defined for the system runtime configuration 116 . the xi objects 112 are also used to define business processes 118 in the integration repository 122 , and the design - time configuration 120 of the system landscape . business processes 118 are integrated with and linked with other objects and tools in the integration repository 122 . business processes 118 , in the form of patterns and templates , can be delivered to customers . application - specific content can also be delivered . the bpm system 100 includes an import / export framework 126 that imports and exports standards - based adapters for universal connectivity . the bpm system 100 can include an interface for receiving user - specified business process details . business process modeling scenarios , called “ patterns ,” are high - level building blocks that can be combined with each other and with atomic functions such as deadlines , exceptions , etc . of the process engine 104 . the following are example patterns : 1 ) send and receive : sending messages controlled by the process engine 104 is often combined with receive steps that wait for a correlated response message . a receive step should wait for the messages starting with the activation of the associated correlation as a queuing mechanism . 2 ) serialization : this pattern can include the following steps : 1 . receive messages and store them locally in the process data context ; 2 . keep the data context and start sending received messages when a certain condition has been fulfilled ; and 3 . send received messages in a given order respecting dependencies of receivers . this third step can be : a . without caring about responses / acknowledgements (“ fire and forget ”); or b . receiving a response or an acknowledgement ( enables serialization ). the process engine 104 can be configured to wait for a technical ack of or business response from a previously - sent message before sending a next message . 3 ) transformations / merge / split : the process engine 104 transforms messages within the process context . the following transformations can be performed : 1 . ( n : 1 ) transform several collected messages to one new message ( e . g . transform several invoices to one combined invoice or transform po header and several po positions into one po ); 2 . ( 1 : n ) transform one message into several other messages ( e . g . transform a combined invoice to invoice respecting the original pos ); and 3 . ( 1 : 1 ) is a special case of the transformations described above . n : m mappings are also possible if needed . 4 ) multicast : the process engine 104 can be configured to calculate the receivers of a message ( also using content - based conditions ) and to send the message to these receivers , either without regard to responses / acknowledgements (“ fire and forget ”) or based on receiving a number of responses / acknowledgements . messages may be sent out in parallel or sequentially . 5 ) collect : this pattern uses receive steps in which an arbitrary number of messages can be received . from a process point of view , the end of the collecting scenario can be defined via “ push ,” ( i . e . a certain condition is reached , such as n messages have arrived , a certain deadline has been reached , etc . ), or “ poll ” in which the process engine waits for a special message that indicates the end of collecting . the process definition 106 is based on the standardized integration model . the standardized integration model for distributed business processes is defined according to multigraphs with special properties , including vertex and edge categories , and classification rules . in the description below , g * represents an aggregated multigraph , g represents an expanded multigraph , t is an aggregation function , and t ′ is an expansion function . these representations apply to both the delivery and configuration models , as well as the transformation between delivery and configuration models . the expanded multigraph can be represented at a starting point as g =( v , e ) with v ={ v | v is a vertex }, where e ={ e | e is an edge }. the set of vertices can be categorized as follows : v *={ v *| v * is a vertex category }= set of all vertex categories . each vertex v v belongs to exactly one vertex category v * v *. classification rule k v : v → v * assigns each vertex v its vertex category v *. classification rule k v ‘: v *→ p ( v ) assigns each vertex category v * all assigned vertices . note that the name v * is used for the vertex category in line with the names of the aggregated multigraphs . the set of edges can be categorized as follows : c ={ c | c is an edge category }= set of all edge categories . each edge e e belongs to exactly one edge category c c . classification rule k e : e → c assigns each edge e its edge category c , and classification rule k e ‘: c → p ( e ) assigns each edge category c all assigned edges . fig2 shows an example of an expanded multigraph g =( v , e ), where v ={ v 1 , v 2 , v 3 } and e ={ e a 1 , e b 1 , e a 2 , e b 2 }. based on the expanded multigraph g , there are two vertex categories : v * 1 comprises v 1 and v 2 ; v * 2 comprises v 3 . there are also two edge categories : c a comprises e a1 and e a2 ; c b comprises e b1 and e b2 . the expanded multigraph has several conditions . one condition is uniqueness : no two edges have both the same ( connecting ) vertices and the same edge category . that is , for e 1 =( v 1i , v 1j ) and e 2 =( v 2i , v 2j ) e the following applies : v 1i ≠ v 2i or v 1j ≠ v 2j or k e ( e 1 )≠ k e ( e 2 ). each edge e =( v i , v j ) e can be represented uniquely as e =( v i , v j ) c , where c = k e ( e ) another condition is category : all edges of an edge category connect the vertices of the same vertex categories . that is , edges ( v 1 , v j ) c and ( v k , v l ) c exist ≠ k v ( v k )= k v ( v i ) and k v ( v l )= k v ( v j ). yet another condition is completeness : if an edge of category c exists between two vertices , then edges of the category c exist for all pairs of the corresponding vertex categories . that is , edge ( v 1 , v j ) c exists ≠ edge ( v k , v l ) c exists for all v k with k v ( v k )= k v ( v i ) and all v l with k v ( v l )= k v ( v j ). the multigraph g is used to define the configuration model of the integration model , and has the following properties : g =( v , e ), where v ={ v | v is a vertex corresponding to an address } and e ={ e | e is an edge corresponding to an interface between the addresses }, as shown in fig3 . an aggregated multigraph g * is derived from the expanded multigraph g , where g *=( v *, e *) with v *={ v *| v * is a vertex category } and e *:={( v * x , v * y ) c | c c ; v * x , v * y v *; edges of category c connect vertices of categories v * x and v * y }. the aggregated multigraph g * has several properties . the aggregated multigraph g * is an abstraction of the expanded multigraph g . c and e * are equivalent . further , transformations from g *- g and from g - g * are structure - preserving . fig4 illustrates an example of an aggregated multigraph g *=( v *, e *), where v *={ v * 1 , v * 2 } and e *={ e * a , e * b }. the aggregated multigraph g * is used to define a delivery model of the integration model , and has the following properties : g *=( v *, e *), where v *={ v *| v * is a vertex category corresponding to a ( business ) role in the i - model } and e *={ e *| e * is an edge category corresponding to an interface between two roles in the i - model }. the aggregated multigraph g * has several conditions . there are at least two roles , and each role is assigned interfaces . also , there is at least one interface between two roles in the i - model . fig5 illustrates an example of a delivery model of the standardized integration model . an aggregated multigraph g * can be transformed into an expanded multigraph g , and vice versa . given an aggregated multigraph g *=( v *, e *), the transformation t ′: g *→ g is executed as follows . first , the vertex categories are expanded as follows : transformation t v ‘= k v ‘: v *→ p ( v ), that is , all vertex categories v * are assigned the vertices to be assigned ( manually or automatically ). next , the edge categories are expanded as follows : transformation t e ‘: e *→ p ( e ): e *=( v * x , v * y )→ k v ‘( v * x ) x k v ‘( v * y ). calculating the cross product of the vertex sets results in all edges in multigraph g . this makes it possible to calculate the edges in g automatically the above - described transformation can be used as a transformation ( i . e . expansion ) from a delivery model to a configuration model of the integration model , as illustrated in the expansion tranisformation shown in fig6 . all addresses result from the assignment of the required systems to the roles . calculating the cross product of the addresses of the connected role categories for each interface category results in all interfaces between the addresses . an expanded multigraph g can be aggregated into an aggregated multigraph g * in a reverse transformation . given an expanded multigraph g =( v , e ), the transformation t : g → g * is executed as follows . first , the vertices are aggregated to vertex categories as follows : transformation t v = k v : v → v *, that is , all vertices are grouped into vertex categories ( manually or automatically ). then , the edges to edge categories are aggregated as follows : transformation te : e → e *: e =( v i , v j ) c → e *=( v * x , v * y ) c with v * x = k v ( v i ) and v * y = k v ( v j ). the result is an aggregated multigraph g * representing relationships between edges and vertices at a more abstract level the aggregation transformation can be used for classification of addresses : all addresses that perform the same role are grouped into one role ( i . e . creation of role categories ). the aggregation transformation can also be used for classification of interfaces : all identical interfaces between two roles are grouped into one interface ( i . e . creation of interface categories ). these uses are illustrated in fig7 . the standard integration model can be used to define distributed business processes at design time . fig8 shows an integration model of an integration scenario 200 , having roles 202 connected by connections 204 . each model includes a name that includes all roles 202 and connections 204 between roles 202 , and a name for a business role . each distributed business application or distributed business process is represented by one role . each connection 204 is used for asynchronous messaging for data flow from one role 202 to at least one other role 202 in a request / response mode . each connection 204 is defined at design time , by at least one relation between a sender role and a receiver role , an asynchronous or synchronous communication mode , a definition of sender role and receiver role of a messaging call , one sender interface ( ifout ), one receiver interface ( ifin ), and one mapping for ifout to ifin . the definition of a standardized integration model includes well defined characteristics . from the integration model , an integration scenario monitoring process can be generated . accordingly , for each connection between a sender and a receiver , an additional asynchronous connection can be generated as an integration scenario monitor . the integration scenario monitor collects all connections in the scenario , and can monitor the message exchanges thereof . given an existing integration scenario , an integration scenario monitoring process can be automatically created . an integration model defines all necessary messages and mappings , and can be used for automatic scenario configuration . correlation data on the inbound messages can be used to create instances of business processes . status tracking is possible . although a few embodiments have been described in detail above , other modifications are possible . the logic flows depicted herein do not require the particular order shown , or sequential order , to achieve desirable results . other embodiments may be within the scope of the following claims . | 8 |
an embodiment of the invention will now be described with reference to the drawings . referring to fig1 and 2 , a tractor 1 comprises an engine 2 mounted at a front portion thereof and covered by a bonnet 3 , and rear wheels 4 transversely opposed to each other and supported by a rear axle case 5 at a rear portion of the tractor 1 . the tractor 1 carries a driver &# 39 ; s cabin 6 fixed tothe rear portion thereof . the cabin 6 is defined by a main framework , a floor sheet 7 attached to a bottom of the main framework , and rear wheel fenders 8 attached to opposite lateral sides of the main frame work . the perspective view of the main framework is shown in fig1 . the main framework of the cabin 6 comprises a pair of right and light front struts 9 , a pair of right and left rear struts 10 , a pair of right and left intermediate struts 11 disposed between the front and rear struts 9 , 10 , and a plurality of top frame members 12 mounted on upper ends of these struts 9 , 10 and 11 . the main framework further comprises base frames 13 disposed at the bottom thereof and extending longitudinally of the tractor 1 . the base frames 13 are supported at front ends thereof by a bracket 14 projecting outwardly of the tractor 1 and at rear ends thereof by a bracket 15 mounted on the rear axle case 5 . there are shock absorbers 16 and 17 interposed between the front and rear ends of the base frames 13 and the brackets 14 and 15 , respectively . the cabin 6 includes a partition 18 at a front thereof extending between lower portions of the right and left front struts 9 , and a windshield comprising a main transparent glass plate 19 and a pair of right and left side transparent glass plates 20 fitted to the front struts 9 . the partition 18 is provided with a horseshoe - shaped center frame 36 intermediate between the right and left front struts 9 and surrounding or opposed to the bonnet 3 , and connector frames 21 connecting lateral sides of the center frame 36 to lower ends 9 &# 39 ; of the front struts 9 positioned below the bonnet 3 . the partition 18 has suitable projections and recesses for the interest of rigidity . the partition 18 , center frame 36 and connector frames 21 in combination constitute center frame means 50 . the connector frames 21 are provided with reinforcements 22 . the center frame 36 of the partition 18 is provided with a panel board 23 , a steering wheel 24 and a pedal 25 , all disposed inside the cabin . glass mounting ribs 26 - 29 are attached to or formed integral with inner sides of the front struts 9 , a lower sides of the top frame member 12 , upper and lateral sides of the center frame 36 and upper sides of the connector frames 21 , respectively , as shown in fig3 through 5 . the glass plates 19 and 20 are fitted to the ribs 26 - 29 through vibration absorbing rubber elements 30 each having an h - shaped section . it will be seen that the mainf ront glass plate 19 is supported by the upper edge portion 50 &# 39 ; of the center frame means 50 . each of the front struts 9 is bent at about a vertically midpoint to protrude laterally outwardly . the main front glass plate 19 has a trapezoidal shape having straight upper and lower edges and is fitted in a space surrounded by the center frame 36 , the right and left front struts 9 , and the top frame member 12 . each of the side glass plates 20 has an inverted trapezoidal shape tapering downwardly and is fitted in a space surrounded by the center frame 36 , one of the front struts 9 , one of the connector frames 21 and the main front glass plate 19 . as shown in fig6 there is provided a space 31 between a lower end of the main front glass plate 19 and an upper end of each of the side glass plates 20 , and this space 31 is substantially equal in dimension to a thickness t of the glass plates 19 and 20 . the space 31 is filled with a filling material comprising a transparent adhesive 32 which has elasticity after curing , whereby the upper and lower glass plates 19 and 20 are joined together . as seen in fig7 the main front glass plate 19 is curved to protrude forwardly but the glass plate 19 may be planar . reference number 32a denotes a driver &# 39 ; s seat mounted on the floor sheet 7 . reference number 33 denotes a cabin door , number 34 denotes lateral glass plates , and number 35 denotes a roof cover . the cabin 6 having the above construction is lifted , after assembly , by a crane or the like and placed on the tractor 1 with the shock absorbers 16 and 17 interposed therebetween . in manufacture , the main front glass plate 19 and side glass plates 20 are assembled by the following process . the main framework of the cabin is formed by interconnecting the lower ends of the right and left front struts 9 by means of the center frame 36 and the connector frames 21 . thereafter the vibration absorbing rubber elements 30 each having an h - shaped section are fitted on to the ribs 26 - 29 provided on the front struts 9 , the top frame member 12 , the center frame 36 and the connector frames 21 . then the main front glass plate 19 is placed as shown by a phantom line in fig8 . from this position the main front glass plate 19 is pushed upward as indicated by an arrow a to fit lateral edges and an upper edge thereof into grooves of the vibration absorbing rubber elements 30 on the front struts 9 and the top frame member 12 . the lower edge of the main front glass plate 19 is placed in a groove of the rubber element 30 on the center frame 36 , so that the weight of the main front glass plate 19 is borne by the center frame 36 . subsequently , each of the side glass plate 20 is lowered while adjusting its position relative to the rubber elements 30 on the center frame 36 , one of the front struts 9 and one of the connector frames 21 as indicated by an arrow b in fig8 to fit lateral edges and a lower edge of the side glass plate 20 into grooves of these rubber elements 30 . when the side glass plate 20 in the inverted trapezoidal shape is pushed downwardly into the rubber elements 30 , the side glass plate 20 receives a reaction acting upwardly . therefore , as shown in fig9 the lateral edges of the side glass plate 20 should conveniently have respective angles of inclination α and β in the order of 5 to 6 degrees . with such angles of inclination the side glass plate 20 is subjected to only a minor reaction when advanced downwardly , which facilitates its mounting and succeeding adhesion work without any stress acting thereon and also improves its durability . after the side glass plates 20 are mounted as above , a retainer 37 is used as shown in fig8 and 10 , to adjust the space 31 between the main front glass plate 19 and each of the side glass plates 20 to be substantially equal in dimension to the thickness t of the glass plates 19 and 20 . the retainer 37 comprises a pair of sticking disks 39 having diaphragms 38 , and a turn buckle 41 mounted on an intermediate position of a connecting rod 40 interconnecting the two sticking disks 39 . each of the sticking disks 39 is adapted to engage and disengage from glass plates or the like by operating a knob 42 attached thereto . thus , the sticking disks 39 are placed in engagement with the main front glass plate 19 and one of the side glass plates 20 , respectively , and the turn buckly 41 is operated to extend or contract the connecting rod 40 for adjustment of the space 31 . next , the space 31 is filled with a transparent adhesive 32 to cause the main front glass plate 19 and the side glass plate 20 to adhere to each other . the adhesive 32 will serve the purpose if it is transparent and has elasticity after curing . one suitable example for the adhesive 32 is a one component acetic type silicone adhesive such as pando 524a ( trademark ) manufactured by kabushiki kaisha three bonds . this adhesive has good transparency , adhesive power , weatherproofness , heat resistance and cold resistance , and an elongation of about 500 %. the space 31 filled with the adhesive 32 and having an equal dimension to the thickness t of the glass plates greatly facilitates the assembly work in that application of the adhesive 32 is carried out more easily than when the space is narrower and without requiring a backplate as when the space is very broad . part of the adhesive 32 as applied to the space 31 will advance from ends of the space 31 into the vibration absorbing rubber elements 30 as shown in fig1 , which results in the glass plates being secured to the rubber elements 30 when the adhesive cures . when the adhesive 32 cures , the main front glass plate 19 and the side glass plates 20 adhere to one another and become just as airtight as a single glass plate . moreover , since the adhering parts are transparent and equal in dimension to the thickness of the glass plates , the driver seated on the seat 32a has a good field of vision with hardly any distortion presented by the adhering parts . the retainer 37 may just be removed after the adhesive cures . after the main front glass plate 19 and the side glass plates 20 are fitted into the vibration absorbing rubber elements 30 , wedge members 44 are applied to the rubber elements 30 from inside the cabin in order to hold the glass plates tight . however , the wedge members 44 may be applied to the rubber elements 30 after the space 31 is adjusted by means of the retainer 37 or after the glass plate adhesion is completed . in the described embodiment the main front glass plate 19 has a straight lower edge for cutting expediency , but this is not absolutely necessary . the adhesive may be applied to the main front glass plate 19 and the side glass plates 20 after these glass plates are placed in position with respect to the rubber elements 30 . alternatively , the three glass plates 19 and 20 may first be fixed in position relative to one another by means of retainers 37 and , after the adhesive 32 is filled into the spaces 31 , fitted into the rubber elements 30 on the main framework of the cabin , the retainers 37 being removed thereafter . although in the described embodiment the main front glass plate 19 is placed in position prior to the side glass plate 20 , the order may be reversed . the adhesive 32 may be replaced by a mere filling material having transparency , such as a plastics material . each of the side glass plates 20 which is smaller in area that the main glass plate 19 may be slightly thinner than the latter . these plates may comprise transparent plastics plates instead of glass . other aspects of the embodiment will be described hereinafter with reference to fig1 through 15 . as shown in fig1 , each of the top frame members 12 comprises a square pipe having a parallelogram section . the top frame member 12 has a horizontal upper face a , outer and inner faces c and d inclined outwardly , and a lower face b at right angles to the inner face c . a corner defined by the outer face d and the lower face b is indented to form a recess α and an abutment face e for the glass plate 19 or 34 or for an edge 45 of the cabin door 33 . the square pipe has short sides g in the transverse direction and long sides h in the vertical direction . furthermore , lateral top frame members 12 have a smaller difference between an outside distance l and an inside distance l than in the prior art ( conventional structure ), and the inside distance l is greater than in the prior art when the outside distance l is the same as in the prior art . similarly , the front and rear top frame members 12 have a greater inside distance therebetween than in the prior art . each of the front struts 9 comprises the same square pipe as does each of the top frame members 12 as shown in fig1 . the extensive employment of square pipes having an identical sectional shape contribute toward low cost . each of the intermediate struts 11 comprises a square pipe having a rectangular section with two outer corners thereof indented as shown in fig1 . each of the rear struts 10 comprises a square pipe having a rectangular section with two diagonally opposite corners indented as shown in fig1 . each of these struts 9 , 10 and 11 also has short sides g in the transverse direction and long sides in the longitudinal direction of the cabin , and defines a recess or recesses α in a corner or corners between an outer face or faces and a face or faces opposed to the glass plate or plates , thereby to provide a spacious cabin interior . although the right and left front struts 9 do not define recesses for receiving the edges of the front glass plate 19 , the front strut 9 may comprise a square pipe having the same sectional shape with the recesses as the square pipe constituting the rear strut 10 . since the cabin interior can be designed to have a good longitudinal distance , the front and rear top frame members may each comprise a pipe having a quadrate section but should define a recess . the floor sheet 7 of the cabin 6 is formed of a single sheet metal and comprises a combination of flat portions 46 and 46 &# 39 ; and rising portions 47 and 48 . this construction is strong against a bending force acting transversely . right and left parts of the flat portion 45 constitutes steps 49 . since the floor sheet 7 is connected to the lower ends of the struts 9 , 10 and 11 , the entire cabin has an excellent strength particularly in the transverse direction . in the described embodiment each of the struts 9 , 10 and 11 comprises a square pipe having the short sides g transversely of the cabin and the long sides h longitudinally of the cabin , and each of at least the laterally disposed top frame members comprises a square pipe having the short sides transversely of the cabin and the long sides in the vertical direction . furthermore , each of the struts and top frame members defines a recess or recesses in the outer corner or corners to receive the edge or edges of the glass plate or plates . this construction has the advantage of allowing the cabin to have a large interior space in the transverse direction . in addition to the large accommodating space for the driver , the construction permits the glass plates to be mounted simply and economically . | 1 |
fig1 is a branch instruction in accordance with the preferred embodiment of the present invention . the branch instruction 501 consists of 32 bits of information used by the computer to execute the instruction . this instruction combines the function of branching with the operation of comparing two operands , although the present invention could be implemented by a branch only instruction as well . the instruction 501 contains a six bit operation code field 502 , a five bit first source register address field 503 , a five bit second source register address field 504 , a three bit condition code field 505 , a eleven bit branch displacement field 506 and one bit displacement field sign bit 508 , and a nullify bit 507 . the operation code field 502 identifies this instruction as a compare and branch instruction . the first and second source register address fields 503 and 504 identify the registers whose contents will be compared . the branch displacement , which may be positive or negative , is determined by fields 508 and 506 . this displacement is used to calculate the target address for the branch . the next instruction in the instructionpipeline may be nullified according to the preferred embodiment of the present invention by setting the nullify bit 507 . in the preferred embodiment of the present invention , the execution of the current instruction may be nullified . the purpose of nullification is to make the instruction appear as if it never existed in the pipeline even through the instruction may have been fetched and its operation performed . nullification is accomplished by preventing that instruction from changing any state of the cpu . to prevent changing the state of the computer , the nullification process must prevent the writing of any results of the nullified instruction to any registers or memory location and prevent any side effects from occurring , for example , the generation of interrupts caused by the nullified instruction . this is performed in the preferred embodiment by qualifying any write signals with the nullify signal generated in the previous instruction thus preventing the instruction fromstoring any results of any calculation or otherwise changing the state of the computer system . a simple way of qualifying the write signals of the current instruction is by ` and ` ing the write signals with a retained copy of the nullify signal signal generated in the previous instruction . the nullify signal generated by an instruction may , for example , be saved in the processor status word for use in the following instruction . nullification is a very useful technique because it permits an instructionto be fetched into the pipeline without concern as to whether a decision being made by another instruction in the pipeline may cause this instruction not to be executed . the instruction simply progresses through the pipeline until it comes time to store its results and the instruction may then be nullified at the last minute with the same effect as if the instruction never existed in the pipeline . in a pipelined computer system there are two distinct concepts as to the next instruction to be executed . the first concept is a time sequential instruction , which is the next instruction in the instruction pipeline after the current instruction . this instruction will be executed after thecurrent instruction and the results of the operation stored unless nullified . the second concept is a space sequential instruction . this is the instruction immediately following the current instruction in the program . generally , the space sequential instruction for the current instruction will be the time sequential instruction . the exception to the rule occurs with taken branch instructions , where the time sequential instruction is the instruction at the target address which is generally not the space sequential instruction of the branch instruction . the delay slot instruction is the time sequential instruction of a branch instruction . generally , the delay slot instruction will be the space sequential instruction of the branch instruction . the exception to this rule is the case of a branch following a branch instruction . for this case , the delay slot instruction for the second branch instruction will bethe target address of the first branch instruction rather than the space sequential instruction of the second branch instruction . unconditional branching in the preferred embodiment of the present invention clearly illustrates the concept of nullification and the delay slot instruction . with the nullify bit off , the delay slot instruction of the unconditional branch instruction is always executed . this is equivalent to always using delayed branching . with the nullify bit on , thedelay slot instruction of the unconditional branch instruction is always nullified . this is equivalent to never executing the delay slot instruction . fig2 illustrates a method of conditional branching in accordance with thepreferred embodiment of the present invention . a computer practicing the method of fig2 has a program 101 consisting of instructions 100 including a conditional branch instruction 102 . the space sequential instruction to the branch instruction 102 is instruction 103 . for a conditional branch instruction 102 with negative branch displacement , instruction 104 is at the target address . for a conditional branch instruction 102 with a positive branch displacement , instruction 105 is atthe target address . the execution of the program is illustrated by graphs 110 , 111 , 112 , 113 , and 114 . during normal execution , the program executesthe current instruction and then executes the space sequential instruction to the current instruction . graphs 110 , 111 and 113 illustrate the operation of a branch instruction with the nullify bit off . this corresponds to the ` never nullify ` or ` always execute ` case . the delay slot instruction following the branch instruction is always executed regardless of whether the branch if taken or not and whether it has a positive or negative displacement . when the branch condition is false , execution continues with the space sequential instruction 103 as shown in graph 110 . when the branch condition is true , the delay slot instruction is executed and then the instruction at the target address is executed as shown in graph 111 for a negative displacement branch and in graph 113 for a positive displacement branch . graph 110 , 111 , 112 and 114 illustrate the operation of a branch instruction with the nullify bit on . this corresponds to the ` sometimes nullify ` case as described below . with the nullify bit on , the delay slot instruction may be nullified depending on the direction of the branch and whether the condition determining whether the branch is taken or not is true or false . graphs 110 and 114 illustrate the operation of the branch instruction when the condition triggering the branch is false causing the branch not to be taken . if the branch displacement is positive , the delay slot instruction is executed as shown by graph 110 . if the branch displacement is negative , the delay slot instruction is nullified as shownby graph 114 . the dotted line in graphs 112 and 114 indicate that the delayslot instruction , although fetched , will be nullified as if it never existed in the instruction pipeline . graphs 111 and 112 illustrate the operation of the branch instruction with the nullify bit on when the condition triggering the branch is true causing the branch to be taken . if the branch displacement is positive , the delay slot instruction is nullified as shown in graph 112 and execution continues at the target address . if the branch displacement is negative , the delay slot instruction is executed as shown in graph 111 before continuing at the target address . fig3 is a flow chart of the method of branching . the graphs 111 through 114 may be more clearly understood by referring to the flow chart . the first step is to determine whether the nullify bit is on . if the nullify bit is off , then the delay slot instruction for the branch instruction is always executed . this occurs whether or not the branch is taken . if the nullify bit is on , then the delay slot instruction following the branch isnot executed unless the branch is taken and the branch displacement is negative , or unless the branch is not taken and the branch displacement ispositive . the operation of the preferred embodiment of the present invention embodiesa very simple but effective method of static branch prediction which predicts whether the branch will be taken or not , and therefore which instruction to fetch , based on how positive and negative displacement branches are taken . its effectiveness depends on computer software following a set of software conventions in implementing certain higher level program control constructs by means of a conditional branch instruction . for example , a loop construct is implemented by a backward conditional branch , so that a branch instruction with a negative displacement will be taken frequently . in fact , it will be taken n - 1 out of n times for a loop that is executed n times . another example of the software conventions assumed is that an if - then - else construct is implemented by a forward branch to the rarely taken part , allowing the more frequently executed part to lie immediately following the branch instruction in the not taken branch path . for example , the forward branch may be to an error handling routine which rarely gets executed in a normalprogram . in addition , the preferred embodiment of the present invention having a nullify bit generalizes and optimizes the use of the delay slot instruction in conjunction with the static branch prediction technique described above . with the nullify bit on , a backward conditional branch that is taken or a forward conditional branch that is not taken , being thetasks that are predicted to be frequent by the static branch prediction technique , cause the delay slot instruction to be executed . hence , some useful instruction in the frequent path may be executed as the delay slot instruction , for example , as described in the merger technique above . withthe nullify bit on , a backward conditional branch that is not taken or a forward conditional branch that is taken , being the tasks that are predicted to be rare , cause the delay slot instruction to be nullified . hence , nullification which reduces performance occurs only in the rare case . with the nullify bit off , the delay slot instruction is always executed . this corresponds to the case where an instruction common to both the branch taken and the branch not taken paths can be designated as the delayslot instruction . fig4 is a functional block diagram of an apparatus in accordance with thepreferred embodiment of the present invention . the apparatus contains six functional elements : an instruction memory 301 , an optional virtual address translation unit 302 , an instruction unit 303 , an execution unit 304 , an optional floating point unit 305 and an optional register file 306 . these functional elements are connected together through five busses : a result bus 310 , a first operand bus 311 , a next instruction bus 312 , a second operand bus 313 and an address bus 314 . only the execution unit 304and the instruction unit 303 are involved in performing the operation of the preferred embodiment of the present invention . the execution unit generates and / or stores the conditions on which the decision to branch or not to branch is made . the instruction unit performs the branch by generating the address of the next instruction to be fetched from the memory and provides means for storing the address into the program counter . in the preferred embodiment of the present invention , the memory unit is a high speed cache with speed on the order of the logic used in the execution unit . fig5 is a timing state diagram of the apparatus in fig4 . the timing diagram illustrates four stages involved in the execution of instructions 401 , 402 , 403 and 404 . time line 460 is divided into stages with the time progressing to the right . the four timing stages for each instruction are : an instruction address generation stage 410 , an instruction fetch stage 411 , an operation performance stage 412 , and a write stage 413 . the execution of instructions may be pipelined to any depth desired . the preferred embodiment of the present invention contains a four stage pipeline . as shown in fig5 four instructions are being executed at any one time . at time 450 , the write stage of instruction 401 is overlapped with the operation performance stage of instruction 402 , the instruction fetch stage of instruction 403 and the instruction address generation stage of instruction 404 . this means for a branch instruction that next instruction will have been fetched while the branch instruction is in the operation performance stage . during the instruction address generation stage , the address of the next instruction is calculated from the program counter which contains the address of the next instruction to be executed and is located in the instruction unit 303 . during the instruction fetch stage , the next instruction is fetched from the instruction memory 301 . this is performed by applying the contents of the address calculated in the instruction address generation stage onto the address bus 314 and transferring the contents of that address to the next instruction bus 312 where it is decoded by the instruction unit . the branch instruction may becombined with other operations , for example , a compare operation , which would be also decoded and performed at this time in the execution unit 304 . in the operation performance stage 412 , the branch operation is performed . during the execute phase 412 both the target address of the branch instruction and the address of the space sequential instruction to the branch instruction are generated . at this time if the instruction is combined with another operation , that operation is performed . at the end of the execution phase , one of the two addresses is transferred into the program counter . which address to transfer to the program counter is determined by the condition stored in the execution unit 304 . during the write phase 413 , no operation occurs unless a result from a combined instruction needs to be stored . by performing all writing of any results to memory or registers and any side effects like interrupt acknowledgementcaused by an instruction no earlier than stage 412 and 413 , this approach enables a simpler implementation of the concept of nullifying an instruction which is always in the pipeline . | 6 |
embodiments of the present invention will now be described with reference to the drawings where like numerals correspond to like elements . embodiments of the disclosed subject matter and appended claims are generally directed to fairing assembly suitable for mounting a fairing to a lower edge of the cabs and / or sleepers of vehicles such as class 8 trucks . although exemplary embodiments of the present disclosure and appended claims will be described hereinafter with reference to class 8 trucks , it will be appreciated that aspects of the claimed subject matter have wide application , and therefore , may be suitable for use with many types of vehicles wherein a mounted fairing moves relative to surrounding structure . accordingly , the following descriptions and illustrations herein should be considered illustrative in nature , and thus , not limiting the scope of the present disclosure , as claimed . in the following description , numerous specific details are set forth in order to provide a thorough understanding of exemplary embodiments of the disclosed and claimed subject matter . it will be apparent to one skilled in the art , however , that many embodiments of the claimed subject matter may be practiced without some or all of the specified features . although the vehicle depicted in fig2 represents one of the possible applications for the disclosed and claimed subject matter , it should be appreciated that the particular features of the disclosed subject matter can be modified for use with any vehicle on which the inclusion of fairings would be appropriate . as shown in fig2 , a vehicle 30 , such as a class 8 truck , includes a frame 32 supported by a plurality of wheels 34 rotatably mounted thereto . a cab 36 and an optional sleeper 38 are secured to the frame 32 by a suspension system ( not shown ). the cab 36 provides a sheltered enclosure from which an operator controls the vehicle 30 , and the sleeper 38 provides sleeping quarters and a living space for the operator . the suspension system provides a smoother ride for the vehicle operator by allowing relative motion to occur between the cab 36 and the frame 32 so that the operator is at least partially isolated from the motion of the frame 32 during vehicle operation . for the sake of simplicity , fairing panels will hereinafter typically be referred to as being mounted to the vehicle sleeper 38 ; however , it should be appreciated embodiments are contemplated wherein the fairing panels are mounted to a lower surface of a vehicle cab 36 , regardless of whether or not the vehicle has a sleeper 38 , or to lower surfaces of both the cab 36 and the sleeper 38 . embodiments wherein the fairing panels are mounted to other structure that moves relative to the vehicle frame are also contemplated . such embodiments should be considered within the scope of the disclosed and claimed subject matter . fig3 and 4 show lower outboard portion of a typical sleeper configuration , wherein the sleeper 38 has a frame 40 located at the base of the sleeper 38 . in the illustrated embodiment the sleeper frame 40 includes a c - channel positioned so that the web of the c - channel is substantially vertical , and the upper and lower flanges face inboard , toward the vehicle centerline . a floor panel 42 is supported by the upper surface of the sleeper frame 40 , and the lower edge of a side panel 44 extends vertically downward to cover the outboard edge of the frame 40 . both the floor panel 42 and the side panel 44 are attached to the sleeper frame 40 with conventional fasteners . the illustrated sleeper 38 is exemplary only , and should be apparent that other sleeper configurations are possible . in this regard , one of skill in the art would readily be able to modify the disclosed fairing assembly for use with various other sleeper configurations . still referring to fig3 and 4 , the fairing assembly 50 includes a fairing panel 52 hingedly coupled to a lower portion of the sleeper 38 . the fairing panel 52 has a substantially flat outboard surface such that when the fairing panel is mounted to the vehicle 30 , it serves as an extension of the side of the sleeper 38 , thereby increasing the aerodynamic efficiency of the vehicle . the fairing panel 52 also improves the aesthetics of the vehicle 30 by covering the vehicle frame 32 , and any components mounted thereto , such as fuel tanks 54 , wiring , fluid lines , etc . the illustrated fairing panel 52 includes upper and lower flanges , which provide an unseen interface for the mounting hardware , as well as additional stiffness to the fairing panel . it should be appreciated that the illustrated fairing panel 52 is exemplary only , and the disclosed fairing mounting system can be modified to mount fairing panels of a wide variety of configurations . for example , the fairing panel need not be flat , but can instead be contoured to provide particular aerodynamic or aesthetic effect . the fairing panel 52 is hingedly coupled to the sleeper 38 with one or more hinges 56 . in this regard , first half of the hinge 56 is coupled to the lower flange of the sleeper frame 40 using conventional fasteners . a second half of the hinge 56 is coupled to an upper , generally horizontal surface of a fairing panel 52 . attaching the second half of the hinge 56 to a horizontal fairing surface hides the attachment fasteners from view ; however , it should be appreciated that the hinge can be attached to any suitable portion of the fairing panel , including the vertical fairing web . in such a configuration , the lower portion of the hinge 56 may extend downwardly such that the hinge forms a 90 ° angle and is attached to an inner vertical surface of the fairing panel 52 , thereby allowing the upper horizontal flange of the fairing panel to be omitted . the hinge is arranged so that the hinge line is substantially horizontal and oriented along the longitudinal direction of the vehicle . it should be appreciated , however , that alternate embodiments are possible wherein the hinge is not horizontal , but instead is oriented at an angle relative to horizontal and / or the longitudinal direction of the vehicle . in the illustrated embodiment , the hinge 56 is a “ piano hinge ,” i . e ., a single elongate hinge spanning all or substantially all of the length of the fairing panel 52 . other embodiments are contemplated wherein a series of hinges are used instead of a single hinge . in yet another embodiment , the hinge is one or more pieces of flexible material coupled to both the fairing panel 52 and the sleeper 38 . the material , which can be fabric , a polymer , or any other suitable material , has sufficient strength to withstand normal operating loads experienced during operation , but is flexible enough to operate as a hinged connection between the sleeper 38 and the fairing panel 52 . the sleeper frame and the fairing panel are illustrated as being coupled to the hinge using conventional removable fasteners 46 , however , it should be appreciated that any suitable mechanical fastening means may be utilized , including permanent fasteners , epoxy , or any other known fastener . further , a portion or all of the hinge may be integrally formed with the fairing panel 52 , the sleeper 38 , or both . these and other embodiments are contemplated and should be considered within the scope of the present disclosure . still referring to fig3 and 4 , one or more elongate links 58 are rotatably coupled at a first end to a lower portion of the fairing panel 52 . the second end of each link 58 is rotatably coupled to the vehicle frame 32 . in the illustrated embodiment a first link 58 is located at the forward end of the fairing panel 52 , and a second link 58 is located at the rear end of the fairing panel 52 . it should be appreciated that the number and location of links can vary according to factors such as the size of the fairing panel 52 , the structure located behind the fairing panel , the flexibility of the fairing panel , and any other factors . when the links 58 are installed , they restrain a lower edge of the fairing panel 52 to limit rotation of the fairing panel about the hinge line . accordingly , the fairing panel 52 generally maintains its substantially vertical orientation . at the same time , the links 58 cooperate with the fairing panel 52 to form a linkage that articulates to accommodate relative motion between the frame 32 and the sleeper 38 . in the embodiment shown in fig3 and 4 , the first and second links are positioned to be substantially horizontal . because the bottom of the frame is located above the portion of the fairing panel 52 to which the link 58 is connected , a frame fitting 60 is coupled to the frame 32 and extends in a downward direction . in the illustrated embodiment , the frame fitting 60 is formed from l - shaped channel and is coupled at an upper end to the frame with known fasteners 62 . the link 58 is rotatably coupled to the lower end of the frame fitting 60 so that the link is substantially horizontal when coupled to both the fairing panel 52 and the frame fitting . still referring to fig3 and 4 , the links 58 of the illustrated embodiment are coupled for rotational movement about the fasteners 64 that attach the links to the fairing panel 52 and the frame fitting 60 . alternate embodiments are envisioned wherein one or both of the ends of at least one link 58 include a spherical joint to couple the link to the fairing panel 52 and the frame fitting 60 . in another alternate embodiment , the link 58 is coupled to one or both of the fairing panel 52 and the frame fitting 60 with a flexible joint that allows relative motion between the link and the fairing panel and / or frame fitting . flexibility in the joint can be achieved by the use of an elastomeric bushing or any other known method . in yet another embodiment , the link 58 is rigidly connected to the fairing panel 52 and / or the frame fitting 60 , but is constructed to have sufficient flexibility so that the link elastically deforms to accommodate relative motion between the fairing panel and the frame 32 . these and other alternate embodiments that allow for relative motion between the frame 32 and the lower edge of the fairing panel 52 are contemplated and should be considered within the scope of the present disclosure . in order to gain access to the area behind currently known fairing panels 52 , the fairing panels must typically be removed from the vehicle , a process that can be time consuming . alternately , the fairing panels can include removable or hinged access panels or doors , but such configurations can prove costly due to the increased number of parts and additional assembly time . in contrast , the presently disclosed fairing system allows an operator to gain access to the area behind the fairing panel 52 by simply disconnecting the one or more links 58 from the fairing panel and then rotating the fairing panel about the hinge line until the fairing panel is in a raised position and no longer impedes access . alternately , the operator can disconnect the link from the frame 32 , thus allowing the fairing panel 52 to be rotated upwardly and out of the way . in order to improve access to the area behind the fairing panel 52 , the links 58 are preferably coupled to the fairing panel and / or the frame 32 with commonly known removable fasteners 64 , which may include threaded fasteners , quick - release pins , and any other suitable fastener . in yet another alternate embodiment , the hinge 56 that couples the fairing panel 52 to the sleeper 38 has one or more removable hinge pins . in this configuration , an operator can remove the hinge pins to uncouple the fairing panel 52 from the sleeper 38 and then rotate the panel downwardly about its connection to the links 50 , thereby gaining access to the area behind the fairing panel . while illustrative embodiments have been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention . | 1 |
in the preferred embodiments of the present invention , the actuator arm utilizes microactuators to provide fine positioning of a read / write head to supplement the displacements of a primary actuator . the read / write head is displaced by the microactuators along an at least nearly straight line transverse to the longitudinal axis of the actuator arm . this transverse motion provides the advantage of keeping the read / write head substantially within a plane parallel to the surface of the data storage disk . the lack , or reduction , of out - of - plane motion , prevents damage to the slider and disk from possible contact between them , due to rolling caused by out - of - plane motions . another advantage is that bimorph actuators are used provide greater displacements to the read / write head , allowing greater data track coverage . this provides the read / write head the ability to not only follow data tracks but also to seek tracks . since no pivot arm is needed to move the read / write head about , still another advantage is that the actuator arm can be shortened , allowing the disk drive to be more compact . in the preferred embodiments an actuator arm 30 mounted on a bearing 10 , is moved through a displacement arc 44 above a data storage disk 20 by a voice coil motor ( vcm ) 11 . these elements are shown in both fig2 and fig3 . the displacement arc 44 is sufficient to allow a read / write head 42 mounted at the outboard end of the actuator arm 30 to be positioned over the entire usable disk surface 24 , as the disk 20 rotates . allowing the read / write head 42 to be positioned above any desired data storage track 26 . the width of the data storage tracks 26 are directly dependent upon the width of the read / write head 42 . the actuator arm 30 has a plane of rotation 12 which is substantially parallel to a disk plane 22 , such that as the read / write head 42 is moved through the displacement arc 44 , it is kept in a plane substantially parallel the disk plane 22 . this keeps the read / write head 42 at a nearly constant distance relatively close above the disk surface 24 . the vcm 11 acts as the primary actuator for moving the actuator arm 30 . movements of the read / write head 42 caused by the vcm 11 are relatively coarse as compared to the smaller , or fine , displacements imparted to the read / write head 42 by secondary actuators 50 and 60 . as seen in fig2 actuator arm 30 has a longitudinal axis 32 running along its length . the actuator arm 30 is mounted to the bearing 10 and extends outward therefrom over the disk surface 24 , so to position the read / write head 42 over the disk surface 24 . several disks 20 and actuator arms 30 can be used together in a stack arrangement . actuator arm 30 is divided into an inboard portion 34 and an outboard portion 36 , as seen in fig2 - 5 . the inboard portion 34 is mounted to the bearing 10 and the vcm 11 such that can be moved about the bearing 10 by the vcm 11 . the outboard portion 36 has an outboard end 38 from which a slider 40 is mounted . the separation between the inboard portion 34 and the outboard portion 36 can be placed anywhere between the bearing 10 and the slider 40 . for instance , in one embodiment , the separation is set between a base plate 46 and load beam 48 . such that the inboard portion 34 includes a support arm 45 and base plate 46 and the outboard portion 36 includes a load beam 48 . the slider 40 is an air bearing slider which is positioned in the air flow existing just above the disk surface 24 when disk 20 is rotating . slider 40 is shaped to provide a lifting force from the air flowing past it . this lifting force acts to keep the slider 40 at a nearly constant distance above the disk surface 24 . mounted in the slider 40 is the read / write head 42 . the read / write head 42 operates to read data by detecting the magnetic poles on the disk 20 and to write data by re - aligning the poles . the outboard portion 36 is separate from the inboard portion 34 such that the outboard portion 36 can be moved transversely , relative to the arm longitudinal axis 12 , along a displacement path 90 . this transverse motion is specifically shown in fig4 and 5 . the transverse motion of the outboard portion 36 causes the read / write head 42 to be moved over one or more data storage tracks 26 . this separate transverse head positioning provides a fine displacement of the read / write head 42 in addition to the relatively coarse positioning provided by the vcm 11 . the attachment of the outboard portion 36 to the inboard portion 34 can be carried out in a variety of different ways . in some embodiments of the present invention , the outboard portion 36 is mounted to the inboard portion by the first and second actuators 50 and 60 . in one embodiment , these actuators are bimorphs positioned substantially parallel to one another , as shown in fig2 - 5 . the bimorphs are made of a piezoelectric laminate having a first piezoelectric layer 70 and a second piezoelectric layer 72 . the first piezoelectric layer 70 and the second piezoelectric layer 72 are polarized in opposite directions such that one layer will contract and the other will expand when a voltage is applied . these bimorph actuators each have interfaces 74 to allow a voltage to be applied to them . the actuator arm 30 can include a voltage source 76 and a voltage controller 78 for applying a voltages across the electrical interfaces 74 of the bimorph actuators , as shown in fig4 a . thus , the actuators 50 and 60 are wired and controlled such that when one piezoelectric layer lengthens , the other shortens . that is , as a first voltage is applied to the bimorph actuators , the first piezoelectric layer 70 lengthens , and the second piezoelectric layer 72 shortens , in a manner well known to those skilled in the art . since the two layers are connected together to form a single beam , the lengthening of one side and the shortening of the other causes the laminate beam to deform as a cantilever . the resulting deformation of the actuator beam is towards the shortened piezoelectric layer . that is , with the first layer 70 lengthened , and the second layer 72 shortened , the beam deflects in a direction towards the second layer 72 , as shown in fig4 a . if instead , a second voltage is applied to the bimorph actuators , the first piezoelectric the first layer 70 is shortened and the second layer 72 lengthened , the actuator beam bends in the opposite direction towards the first piezoelectric layer 70 , as shown in fig5 . with these bimorph actuators mounted between the inboard portion 34 and the outboard portion 36 of actuator arm 30 , and with the piezoelectric laminates orientated side - by - side and substantially along the length of the actuator arm 30 ( e . g . aligned with the actuator arm longitudinal axis 32 ), the common deformation of the actuators in the same direction will cause the outboard portion 36 to move transverse to the arm longitudinal axis 32 . for the outboard portion 36 , and thus the read / write head 42 , to move laterally along an at least nearly straight line , it is preferred that the first actuator 50 and the second actuator 60 have the same configuration ( e . g . same overall undeflected length , same piezoelectric material , and the like ), as well as being aligned parallel to each other . as shown in fig4 and 5 , this allows the movement of the slider 40 and read / write head 42 , to remain in a plane parallel with the disk plane 22 , avoiding the out - of plane motion associated with deformation of an outboard portion of a device having push - pull movement about a hinge . this in - plane displacement provides the benefit of maintaining a constant and level flight height of the slider 40 without imparting any roll which might cause damage from an edge of the slider 40 contacting the disk surface 24 . the bimorph actuators are each mounted to the inboard portion 34 at an inboard actuator support 35 . specifically , the first actuator 50 is attached to an inboard actuator support 35 at a first actuator inboard end 52 , as shown in fig2 - 5 . likewise , the second actuator 60 is attached to an inboard actuator support 35 at a second actuator inboard end 62 , as shown in fig2 and 5 . also , the actuators are each attached to the outboard portion 36 at an outboard actuator support 37 . the first actuator 50 is attached to the outboard portion 36 at a first outboard actuator end 54 to an outboard actuator support 37 . the second actuator 60 is attached to the outboard portion 36 at a second outboard actuator end 64 to an outboard actuator support 37 . since the bimorph actuators deform as a cantilever , to achieve a straight line transverse displacement of the outboard portion 36 , one end of each actuator must be mounted in a fixed manner to prevent any rotation , and the opposing end must be attached at a pivot to allow rotation . one embodiment of this form of mounting is shown in fig2 - 5 . although either end of the actuators could be fixed with the opposing ends free to rotate , it is preferred that the first actuator inboard end 52 and the second actuator inboard end 62 each be rigidly attached to an inboard actuator support 35 , such that the inboard ends of the actuators cannot rotate . it is also preferred that the first actuator outboard end 54 and second actuator outboard end 64 be attached to the outboard portion 36 at outboard actuator support 37 in a manner which allows them to rotate about the attachment , so to allow the actuators bending together as cantilevers to displace the outboard portion 36 to one side or the other , as shown in fig4 and 5 . one advantage to using a two bimorph actuator arrangement for displacing the outboard portion 36 is that by operating as cantilever beams , the piezoelectric elements provide a greater displacement to the outboard portion 36 than the displacements which would be obtained orienting the piezoelectric elements in a push - pull manner and rotating the outboard portion about a pivot or hinge . because the displacement imparted upon the outboard portion 36 by the actuators 50 and 60 is substantially linear and not rotational , the actuator pair can be placed at nearly any position along the length of the actuator arm 30 . that is , the displacement of the read / write head 42 will be generally the same whether the actuators are placed near the bearing 10 , at the middle of the actuator arm 30 , or near the outboard end 38 . nevertheless , as noted , the actuators 50 and 60 can be placed between the base plate 46 and the load beam 48 , as shown in fig2 - 5 . this location is preferred as in most actuator arm designs the base plate 46 is the typical point of connection to a support arm 45 of the actuator arm 30 . the base plate 46 is connected to the support arm 45 at the swage 43 . the load beam 48 extends outward from base plate 46 to its attachment with slider 40 . it is common to manufacture a suspension assembly having a base plate and a load beam element , separately from the manufacture of the support arm and then attach the suspension assembly to the support arm at a swage point during the final stages of assembly of the actuator arm . as such , it is preferred that in order to simplify manufacturing , that the actuators 50 and 60 be positioned between the base plate 46 and the load beam 48 . nevertheless , the actuators can be placed at any of a variety of locations along the length of the actuator arm 20 . this is possible because the displacement provided by the actuators is translational , as opposed to rotational , and thus the displacement imparted to the read / write head 42 will be the same regardless of the position of the actuators along the length of the actuator arm 30 . in one embodiment , one or more additional bimorph actuators are added to operate along with the first and second actuators 50 and 60 . the added actuators are placed in parallel with the first two and are of the same length and have the same deformation . although , as noted herein , it is preferred that the outboard portion 36 be translated along an at least nearly straight line when the bimorph actuators 50 and 60 are deflected , the actuators can be configured to also impart some rotation to the outboard portion 36 . this can be achieved in many ways including positioning the two actuators so that they are not parallel to one another or altering the deformation of the piezoelectric layers of the actuators . in one embodiment , in place of using oppositely polarized piezoelectric layers , similarly polarized layers that have separate voltages applied to each layer is used . these piezoelectric elements each have interfaces 74 to allow a voltage to be applied to each them separately , as shown in fig4 b . the voltage source 76 and voltage controller 79 to apply a first voltage across the electrical interfaces 74 of the first piezoelectric layers , and a second voltage across the electrical interfaces 74 of the second piezoelectric layers . thus , the layers are wired and controlled such that when one layer lengthens , the other shortens . that is , as a voltage is applied to the first piezoelectric layer 70 to cause it to lengthen , a separate voltage is applied to the second piezoelectric layer 72 to cause it to shorten , in a manner well known to those skilled in the art . since the two layers are connected together to form a single beam , the lengthening of one side and the shortening of the other causes the laminate beam to deform in a cantilever mode . the resulting deformation of the actuator beam is towards the shortened piezoelectric layer . in place of a two layer bimorph actuator , a ‘ s - shaped ’ bimorph can be used in another embodiment of the invention . as shown in fig6 the s - shaped bimorph 90 is a layered piezoelectric element that deforms into a s - shaped beam in either of two directions . the s - shaped bimorph 90 has a two layer inboard section 92 and a two layer outboard section 94 . each of these sections has two piezoelectric layers mounted longitudinally adjacent each other and polarized opposite to each other . the inboard and outboard sections are aligned and positioned such that the arrangement of the piezoelectric layers of the inboard section 92 are the opposite of that of the outboard portion 94 . each actuator 90 has electrical interfaces 96 positioned to allow voltages to be applied to them . the actuators 90 are therefore configured such that when a voltage is applied to each , the actuators 90 deflect into s - shaped beams . in this configuration the s - shaped bimorph deforms the inboard section 92 in a curve opposite of the deformation curve of the outboard section 94 . with such s - shaped bimorph actuators , both ends of the actuators 90 are mounted in a fixed manner to prevent their rotation . with two s - shaped bimorphs 90 placed between the inboard section 34 ′ and the outboard section 36 ′ of actuator arm 30 ′, in a substantially parallel configuration , the outboard portion can be translated along at least a nearly straight line as is achieved with using the cantilever deforming bimorph actuators 50 and 60 . as shown in fig7 in another embodiment of the invention , each secondary actuator can be a monomorph actuator 100 . the monomorph is a single layer of piezoelectric material 102 mounted along a support member of a bendable length of non - piezoelectric material 104 . in this embodiment , the shortening or lengthening of the piezoelectric member 102 relative to the connected constant length bendable member 104 causes the combination to bend in one direction or the other . for example , as the piezoelectric member 102 is shortened , the bendable member will be bent in the direction of the piezoelectric member 102 and if the piezoelectric member 102 is lengthened , the bendable member 104 will be bent in the direction away from the piezoelectric . this deformable material can be metal . as shown in fig7 the deformable material can also be part of the structure of the actuator arm 30 ″, such that the deformable member 104 functions both to support the actuator arm 30 ″ and as a portion of the actuator 100 , deflecting the outboard portion 36 ″ of the actuator arm relative to the inboard portion 34 ″. in such an embodiment the inboard portion 34 ″ and the outboard portion 36 ″ are connected by the two bendable members 104 . the piezoelectric members 102 could be placed on either side of the bendable members 104 . with both the piezoelectric members 102 placed on the same side of the bendable members 104 , then the piezoelectric members 102 are both deflected in the same direction ( e . g . both lengthen ) and by the same amount to get the actuators 100 to both deflect in the same direction . with the piezoelectric members 102 on opposite sides of the bendable members 104 , as shown in fig7 then the piezoelectric members 102 are deflected the opposition to each other ( e . g . one lengthened and one shortened ) to cause the monomorph actuators 100 to deflect in the same direction . of course , the monomorph actuator could also be used in place of the cantilever bimorphs described herein . while the invention has been described in detail by specific reference to preferred embodiments , it is understood that the above description is not limiting of the disclosed invention and variations and modifications thereof may be made without departing from the true spirit and scope of the invention . | 6 |
fig1 discloses a system 1 configured to measure soot and or ash loading within a filter 16 of an engine exhaust system . system 1 comprises a filter housing 10 having an inlet end section 12 and outlet end section 14 , both of which are adapted to be connected to engine exhaust pipes in a manner well known in the art . housing 10 comprises a chamber 15 configured to receive a filter element 16 of suitable construction . a transmitting antenna 20 transmits a rf signal and a receiving antenna 22 receives a rf signal . in this embodiment , both antennas 20 and 22 are disposed within housing 10 and both antennas 20 and 22 are embedded within filter element 16 . although fig1 illustrates antennas 20 and 22 as being embedded in filter element 16 , the reader should appreciate that either or both antennas 20 and 22 may be positioned outside filter element 16 and , in some cases , outside housing 10 . additionally , the term antenna is generically used to describe any radio frequency transmitting and / or receiving device . furthermore , one skilled in the art would understand that any antenna , including an insertable resonator , could be used for antennae 20 and 22 . housing 10 may be comprised of a material to insulate transmitting antenna 20 and or receiving antenna 22 from rf noise , which may interfere with system 1 operation . in at least one embodiment , transmitting antenna 20 and receiving antennae 22 are inserted parallel to the central axis of a cylindrical metal filter housing 10 and are inductively coupled in a direction radial to antennae 20 and 22 and filter 16 axis . these antennae 20 and 22 may be inserted in either end of filter 16 or both in the same end of filter 16 . it can be readily demonstrated that the measurement volume is axially confined to the area of overlap of antennae 20 and 22 and in the radial direction by the metal walls of filter 16 housing 10 . furthermore , each antenna 20 and 22 may consist of one or more metallic elements . the addition of more than one element to an antenna 20 and 22 may be desirable in some applications in order to improve the broadband frequency transmission and reception characteristics of the system 1 . system 1 design geometry is closely coupled to the geometry of filter 16 . that is , the antenna geometry is adjusted to optimize transmission and reception of a selected frequency range within a specific filter 16 system 1 geometry . a wide - band frequency source 26 generates source signal 52 and applies source signal 52 to a splitter 28 . splitter 28 applies source signal 52 to both circulator 35 and first detector 30 . first detector 30 produces a reference output signal 48 that is representative of the power of source signal 52 prior to transmission . as mentioned , wide - band frequency source 26 supplies source signal 52 to splitter 28 , which sends a reference sample signal 48 of source signal 52 to first detector 30 . the remainder of source signal 52 is passed through circulator 35 to transmitting antenna 20 , which , in this exemplary embodiment , is inserted into ceramic filter 16 . depending on antenna design , the frequency of source signal 52 , and the combined dielectric properties of the filter and soot , some of the rf power of signal 52 is reflected back to circulator 35 . in this embodiment , circulator 35 is a directional coupler and the reflected power signal 46 is directed to a second detector 36 . reflected power signal 46 to detector 36 is then sent to first comparator 34 . first comparator 34 compares reflected power 46 to reference source power signal 48 , which was sent to comparator 34 from detector 30 . the ratio of reflected power signal 46 to reference source signal 48 provides a relative measurement of the power reflected 42 by the combined dielectric characteristics ( i . e ., the effective dielectric constant ) of filter 16 and the soot collected therein . similarly , the rf power from source signal 52 that is transmitted by antenna 20 and through filter 16 and the soot collected therein is measured by receiving antenna 22 and signal detector 32 . this signal 44 is sent to second comparator 37 , which compares the transmitted rf power signal 44 to reference power signal 48 from first detector 30 . the relative transmitted power signal thus measured is a unique function of the frequency of the transmitted power , antennae 20 and 22 design , and the dielectric properties of filter 16 and the soot collected therein . the strength of this latter signal at any frequency is equal to the relative strength of the source rf signal 52 minus the sum of the reflected rf power signal 46 ( a function of the effective dielectric constant ) and the amount of adsorbed rf power ( a function of the effective dielectric loss factor ). accordingly , first comparator 37 output signal 40 is representative of the transmission loss through filter medium 16 , which , in turn , is representative of the change in the effective dielectric constant and loss factor caused by accumulation of soot within filter 16 . it will be seen therefore that when there is little or no accumulation in filter 16 , there will be only a small transmission loss in source signal 52 strength . as the soot accumulation increases within filter 16 , the difference in signal strength between source signal 52 and transmitted signal 44 changes , resulting in output signal 40 from second comparator 37 . second comparator 37 can be designed to drive a variable output display or an indication when a predetermined level is reached , or both . the power source is arranged to emit rf energy over a range of frequencies . it can be shown that the complex permittivity of some materials is a function of frequency ; hence this latter information can be used in correlations to differentiate the relative quantity of various materials collected within the filter . other advantages may include the ability to average over a frequency range to reduce the impact of any frequency shift in the source signal . in at least one embodiment , an appropriate frequency band is 200 – 400 mhz . soot from engines , such as an internal combustion diesel engine , is generally composed of a mixture of carbon particles and condensed organic material . the condensed organic material may come from unburned fuel and or lube oil , for example . of the mixture , carbon has a relatively high dielectric loss factor . as a result of carbon &# 39 ; s relatively high dielectric loss factor , carbon particulate matter is generally a very good absorber of rf energy . the condensed organic material , on the other hand , is generally not a good absorber of rf energy . like the condensed organic material , ceramic filters — which are commonly used as particulate filters in engine exhaust systems — are also poor absorbers of rf energy . fig2 and 3 depict reflected signals 46 and transmitted signals 44 of fig1 over a range of frequencies . in at least one embodiment , this range of frequencies is from about 200 – 400 mhz . if filter 16 is free from carbon particles and condensed organic material , a transmitted signal 60 and reflected signal 62 are generated . these signals 60 and 62 are depicted to illustrate the relative attenuation and phase shifting that occurs when filter 16 is loaded with soot or other material . depending on the amount of soot present and the relative amount of carbon particles and condensed organic material , a unique shift in frequency to the relative transmitted signal 44 and reflected signal 46 occurs . as depicted in fig2 , if materials collected in filter 16 have low loss factors , then the increase in the effective dielectric constant of the loaded filter 16 would cause a phase shift in frequency . as shown in fig2 , a transmitted signal 63 and reflected signal 65 are generated in the soot - loaded filter 16 . as can be seen , both signals 63 and 65 are shifted to a lower frequency range , as compared to signals 60 and 62 , respectively . in addition to undergoing a phase shift , transmitted signal 60 may also undergo attenuation , thus resulting in a weakened signal strength . as depicted in fig3 , if a material with a high rf absorption capability is collected in filter 16 , such as carbon particles , then the transmitted signal 44 is also attenuated . the phase - shifted and attenuated transmitted signal 64 and phase - shifted reflected signal 66 can be compared with non - attenuated and non - phase - shifter signal 60 and on - phase - shifted reflected signal 62 , both of which would be measured in a soot - free filter 16 . there is , therefore , a combination of both phase shift and signal attenuation as soot with carbon particulates is collected . these changes in the rf reflected and transmitted relative power spectra can be correlated with calibration data to determine both the amount of soot and the ratio of carbon particulates to condensed organic material present in filter 16 . knowing the amount of soot present as well as the ratio of carbon particulates to condensed organic material may then be used to develop filter 16 regeneration control strategy . measurements of the complex permittivity of ash as a function of temperature and frequency have shown that generally under conditions where both soot and ash are being filtered from an engine exhaust , the amount of ash accumulated is largely undetectable by rf measurements due to the presence of soot , which has high dielectric properties relative to ash . however , at the end of the filter regeneration cycle when the soot has been oxidized and the clean filter remains hot , the higher temperatures increase the ash loss factor and the ability to detect the amount of ash present is greatly enhanced . a combination of phase shift and signal attenuation can , therefore , be used to differentiate between a hot , clean ceramic filter and a hot ceramic filter containing accumulated ash . together with calibration data correlations can , therefore , be developed to assess the quantity of ash present in the filter . | 6 |
the invention comprises a device attached to the rear of any relatively blunt based vehicle including , but not limited to tractor trailer combinations , delivery vehicles , recreational vehicles and buses , vans or any vehicle that has any vehicle that has an inherently blunt or flat aft face . the aft of the vehicle is unmodified except to act an attachment point for the device . the device when deployed forms one or more sealed aft cavities that extend from the body of the vehicle rearward while maintaining legal length limits . when the rear doors of the vehicle are opened the device stows in such a way to have no impact on the normal operation of the vehicle . with the rear doors closed the device can be deployed or remain in a collapsed condition to facilitate parking and maneuvering . when the doors are open the device and the doors lie in a generally flat position on the respective sides of the vehicle . the device itself consists of either rigid fins constructed of traditional rigid materials , including composite materials , or of a flexible materials inflated via the trucks air system , any of which , when deployed , acts to form a sealed open cavity on the aft face and open to the all direction . utilizing an inflatable system eliminates majority of the work required to stow the device for loading and unloading of the trailer . a key aspect of the design is the framework of the device which attaches to and is hinged to the edge of each door near the centerline of the trailer . this allows the device to be stowed along side the trailer when the doors are in the open position and does not require any additional clearance between the doors of the trailer and the side of the trailer to stow the device for loading and unloading . it is also possible to eliminate the need for the framework by designing a replacement door that integrally incorporates the device . the use of a flexible inflatable material may also preclude the need for a framework . fig1 illustrates a rear view of a trailer or truck 10 without a drag reduction device having doors 12 and 14 of rectangular shape in a closed position . the doors are respectfully mounted by means of hinges 16 on one side and 24 on the other side so as to move from their shown closed position to a fully retracted position where they are disposed parallel and adjacent to the opposite sides 20 and 22 of the vehicle . the present invention is concerned with providing , at the rear of vehicle , an air drag reducing device 24 which includes a pair of cavities 26 and 28 . as illustrated in fig2 , a first cavity 26 , a left hand cavity , has a generally elongated rectangular shape with an outside edge 30 and an inside edge 32 ( defining the long sides of the rectangle ) and a pair of opposite sides 34 ( at the top of the vehicle ) and 48 ( at the floor level of the vehicle ) ( defining the short sides of the rectangle ). the first cavity has an open area 38 and a base panel 40 . each of these items , except the open area 38 ( 30 , 32 , 34 and 36 ) are defined as panels . the first cavity 26 has a frustum shape ( a bath tub like structure ), four sides , a base and an open face . the base of the cavity is fastened to a supporting member 15 at the intersection of the base panel 40 and the inside panel 32 . similarly , the other cavity 28 , a right cavity , as illustrated in fig2 has a generally elongated rectangular shape with an outside edge 42 and an inside edge 44 ( defining the long sides of the rectangle ) and a pair of opposite sides 46 ( at the top of the vehicle ) and 48 ( at the floor level of the vehicle ) ( defining the short sides of the rectangle ). the right cavity has an open area 50 and a base panel 52 . each of these items , except the open area 50 ( 42 , 44 , 46 and 48 ) are defined as panels . the right cavity 28 has a frustum shape ( a bath tub like structure ), four sides , a base and an open face . the base of the cavity is fastened to a supporting member 15 at the intersection of the base panel 52 and the inside panel 56 . these cavities are preferably made of a light rigid material , such as a fiber composite material or a rigid plastic . the us government &# 39 ; s federal highway administration waives certain length requirements on trucks , trailers and other vehicles , if aerodynamic devices , such as the cavities do not extend more than 5 feet beyond the vehicle and provided they do not have the strength , rigidity , or mass to damage a vehicle or injure a vehicle or in a vehicle that strikes a trailer so equipped from the rear . additionally , such devices may not obscure tail lamps , turn signals , marker lamps , identification lamps , or any other required safety devices such as hazardous safety placards or conspicuity markings . the panels of are made of a light rigid material such as : a composite fiber , a rigid plastic material ; carbon fiber , aluminum ; or wood . the performance of the cavities as a drag reduction system is very dependent upon the sealing of all panel edges in cavities 26 and 28 . in particular , panels joining the base panel 40 to the side panels 30 , 32 , 34 , and 36 for the left handed cavity as well as the base panel 52 to the side panels 42 , 44 , 46 , and 48 for the right hand cavity : this sealing can be done by using ordinary bulb type seals , locking seals or a variety of sealing clamp strategies . the sealing needs to breakable when the cavities are moved to their storage positions , as discussed below . the detail in fig8 a and 8 b illustrate the nature of the sealing of the right aft cavity . panel 42 is sealed to panel 46 with seal 54 . panel 44 is sealed to panel 46 with seal 56 . similar sealing takes place the interfaces between panel 46 and base panel 28 ; the bottom panel 48 ; and the bottom panel 48 and panels 42 and 54 . similar sealing is done between the same panels in the left cavity . examples of possible sealing arrangement include a seal of the form of a bulb seal 58 or inside edge seal 60 or a similar seal that prevents any air from leaking from the cavity formed by the aft extending panels to the surrounding outer surface except out the aft open end of the cavity fig3 illustrates an isometric view of the drag reducing device 10 . there are two independent cavities 26 and 28 , one on each door ( not seen ). inside side panel 32 of left cavity 26 and inside side panel 44 of right cavity 28 are normal to the back of the vehicle and are in contact with each other . as discussed the base panel 40 and 52 of each cavity is fastened to a supporting member 15 . the outside side panels 30 and 42 of each cavity 26 and 28 and the short side panels 34 , 36 , 46 , and 48 may be angled inwardly in the range of 0 to 35 degrees , depending on the preferred geometry . an exemplary value for the outside panels 30 and 42 and the upper short side panels 34 and 46 is an angle of about 15 degrees . an exemplary value for the short side panels 36 and 48 is an angle of about 7 degrees . it is not required that all panels be angled the same amount . for optimum performance , cavities 26 and 28 need to have an open area facing rearward and have the sealed panel junctions as discussed above . each cavity has the base panel hinged to the inside panel , outside panel and the other two panels . the inside panel and the outside panel of each cavity is fastened to the two other panels . fig4 depicts the device in the fully retracted state . cavity 26 with its panels fold flat along the left side of the vehicle and in front of rear door 12 . cavity 28 with its panels fold flat along the left side of the vehicle and in front of rear door 14 . when access to the load in the vehicle is needed the device will be stowed as shown in fig4 and fig7 . for a rigid sided device a first example of the procedure of stowing would be : a . fasteners are released and seals broken allowing the cavity to be folded together ; b . sides and top and base of each cavity are folded together against the respective back doors ; c . cavity units are released from door and swing out on hinge lines near the centerline of the vehicle ; e . entire assembly swings out of the way on the door hinge line whilst the cavity highline continues to move and then flat against the vehicle side . for a rigid sided device a second example of the procedure would be : a . cavity units are released from door and swing out on hinge lines near the centerline of the vehicle ; c . entire assembly swings out of the way on the door hinge line whilst the cavity highline continues to move and then against the vehicle side ; d . fasteners are released and seals broken allowing the cavity to be folded together ; e . sides and top and base of each cavity are folded together against the respective side of the vehicle . c . cavity units are released from door and swing out if necessary or simply remain attached to the door and reside against the door ; e . entire assembly swings out of the way and then flat against the vehicle side . this motion is illustrated in fig5 to fig7 and contrasts with previous designs which tend to have hinge lines at or near the door hinge line . access to the vehicle is now possible and unchanged from the original vehicle configuration . after load access is complete the rear doors are closed , the devices is placed into its original position and the panels are deployed . additionally , there may be instances when it would be desirable to have the vehicle &# 39 ; s doors closed , but have the drag reducing apparatus in a stowed position . such instances include being in a crowded business district where multiple deliveries are being made and at the lower speed of travel with the inconvenience of moving the apparatus for each delivery outweighs any marginal fuel efficiency gain by use of the device . the user would use steps a . and b . of the first above described procedures . it is estimated that it takes 5 minutes to move the cavities from the deployed state and the retracted state . the illustrative embodiments and modifications thereto described hereinabove are merely exemplary . it is understood that other modifications to the illustrative embodiments will readily occur to persons of ordinary skill in the art . all such modifications and variations are deemed to be within the scope and spirit of the present invention as will be defined by the accompanying claims . | 1 |
referring now to the drawings in general and more particularly to fig1 and 2 , shown therein is a hoist 100 constructed in accordance with the present invention . the hoist 100 has a fixed - length stanchion 102 that is removably supportable at an upper end thereof by a first support member 104 and at a lower end thereof by a second support member 106 . as used herein , the term “ fixed - length ” means that the stanchion 102 is unitarily constructed of a single component , and for purposes of this description and the claims , the term “ fixed - length ” does not include a stanchion of multi - component assembly construction such as a telescoping construction . for use in lifting a disabled person , it has been determined that sufficient strength can be obtained by using two - inch square stainless steel tubing to construct the stanchion 102 . in the illustrative embodiments of fig1 the support members 104 , 106 are first fixed to wall 108 and floor 110 portions of the facility structural framework . advantageously , the stanchion 102 can be easily attached to and removed from the support members 104 , 106 without removing either of the support members 104 , 106 from the structural framework . this construction permits erecting the hoist 100 as needed for use , and then further permits quick and easy removal of the hoist 100 for storage or use in another location . where the hoist 100 is used in multiple locations on a recurring basis , a set of the support members 104 , 106 are preferably installed in each of the desired locations in which the hoist 100 is used . the embodiments of the present invention are not limited to the illustrative embodiment of fig1 having the support member 104 fixed to the wall 108 and the support member 106 fixed to the floor 110 . generally , the support members are preferably attached to the appropriate structural framework members that are strong enough to lend the necessary structural integrity to the hoist 100 . in alternative embodiments , for example , the support member 104 can be fixed to a ceiling or roof member , and the support member 106 can be fixed to the wall 108 as well . the support member 104 is a clamp which defines a cavity 112 that is receivingly engageable with the cross section of the stanchion 102 . in fig1 the upper end of the stanchion 102 is shown disposed in the cavity 112 and thereby supported by the wall 108 . preferably , the stanchion 102 is slidingly engageable in the cavity 112 in a close mating relationship with the support member 104 . for example , the support member 104 of fig1 defines a three - sided cavity that cooperates with the wall 108 to define an enclosure closely conforming to the shape and size of the stanchion 102 . the support member 106 has a base 114 fixed to the floor 110 . the support member 106 furthermore has a moveable bearing surface 116 for selectively providing a desired longitudinal distance between the bearing surface 116 and the cavity 112 of the support member 104 . accordingly , embodiments of the present invention provide a support member 114 that is positionable between a disengaged mode and an engaged mode . fig3 illustrates the disengaged mode in that the distance 118 between the bearing surface 116 and the adjacent end of the cavity 112 is greater than the longitudinal length of the stanchion 102 . this permits the insertion of the stanchion 102 in longitudinal alignment between the support members 104 , 106 . fig4 contrarily illustrates the engaged mode in that the distance 120 between the bearing surface 116 and the adjacent end of the cavity 112 is less than the longitudinal length of the stanchion 102 . in the engaged mode the bearing surface 116 pressingly engages against one end of the stanchion 102 and thereby translates the other end of the stanchion 102 into receiving engagement with the cavity 112 . this provides a two - point supporting engagement by the structural framework of the opposing ends of the stanchion 102 . in some embodiments the bearing surface 116 is made moveable by threadingly engaging it with a threaded post 122 that extends from the base 114 . a clearance opening is provided in the plate defining the bearing surface 116 and a threaded member 124 , such as a nut , is attached to the plate , such as by welding . in alternative equivalent embodiments the bearing surface 116 can be made moveable in other manners , such as but not limited to pinning , blocking , or camming the plate defining the bearing surface 116 with respect to the base 114 . the support member 104 shown in fig1 can be attached to the wall 108 by attaching one or more fasteners 126 to a structural supporting member , such as a header or a ceiling plate ( not shown ). alternatively , the pair of fasteners 126 can straddle an upright stud ( not shown ) and connect to a shoring plate either inside or on the opposing side of the wall 108 . in any event , such an arrangement is well suited for attaching the hoist 100 against the wall 108 . in this arrangement it will be noted that the surface defining the cavity 112 is operably disposed substantially parallel with the longitudinal direction of the stanchion 102 . as mentioned above , it may be advantageous to attach the support member 106 to the wall also . fig5 illustrates an alternative support member 128 for doing so . the support member 128 has an angular base 114 a with one side 130 supporting the moveable bearing surface 116 , as above , but with the other side 132 attachable to the wall 108 such as with a fastener 134 . it may also be advantageous to use the hoist 100 at a location away from a wall 108 , such as in the middle of a room adjacent to an entry location of a tub . fig6 illustrates an alternative support member 140 for attaching the upper end of the stanchion 102 to a structural support member in the ceiling 142 . it will be noted that in this arrangement the support member 140 has a surface 144 defining a cavity 112 a that is operably disposed substantially orthogonal to the longitudinal direction of the stanchion 102 . returning now to fig1 and 2 , the hoist 100 further comprises an articulating arm assembly 150 depending from the stanchion 102 . preferably , the articulating arm assembly 150 can be quickly and easily attached to and removed from the stanchion 102 without the use of tools . this makes attaching the stanchion 102 to the support members 104 , 106 easier by removing the weight and torsion of the articulating arm assembly 150 . in the present embodiments , openings 152 are provided in opposing sides of the stanchion 102 . a mount 154 portion of the articulating arm assembly 150 defines a cavity that is receivingly engageable with a portion of the stanchion 102 cross section , and has openings 156 that are alignable with the openings 152 . a fastener 158 , such as a pin , can be inserted through the aligned openings 152 , 156 of the stanchion 102 and mount 154 , respectively , to secure the mount 154 . a threaded member 160 can be advanced to pressingly engage a distal end thereof against the stanchion 102 in order to achieve a desired angle of the mount 154 relative to the longitudinal direction of the stanchion . the articulating arm assembly 150 has an arm 162 journalled at a proximal end thereof to the mount 154 providing pivotal movement of the arm 162 in a plane substantially orthogonal to the longitudinal direction of the stanchion 102 . the mount 154 provides supporting flanges 164 for a spindle 166 . the spindle 166 provides a journal around which the hub 170 is rotatable upon a pair of bearings 168 . the articulating arm assembly 150 further has an arm 172 journalled at a proximal end thereof to the distal end of the arm 162 for pivotal movement of the second arm 172 in relation to the arm 162 in a substantially parallel plane . the arm 172 has a spindle 174 at a proximal end thereof that is receivingly engageable within a hub 176 formed at a distal end of the arm 162 . the spindle 174 provides a journal around which the hub 176 is rotatable upon a pair of bearings 168 . a winch 178 , such as an electric , pneumatic or hydraulic type , is supported by the distal end of the arm 172 . fig7 is a flowchart illustrating steps of removably erecting the hoist in accordance with embodiments of the present invention . the method 180 begins in block 182 by fixing the support members 104 , 106 to the facility structural framework , such as the wall , floor , and / or ceiling structure of the facility . in block 184 the stanchion 102 is inserted in longitudinal alignment between the support members 104 , 106 . in block 186 the support member 106 is moved to the engaged position , thereby translating the opposing end of the stanchion into supporting engagement with the support member 104 . normal use of the hoist 100 begins in block 188 . in decision block 190 it is determined whether the hoist 100 is to be removed . if no , then normal use continues in block 188 ; if yes , then control passes to block 192 where the support member 106 is returned to the disengaged position . the stanchion 102 is then removed from the support members 104 , 106 without removing any of the support members 104 , 106 from the facility structural framework . the method can further comprise fixing third and fourth support members at a different location of the facility structural framework , and repeating the steps of fig7 in relation to the third and fourth support members . it is to be understood that even though numerous characteristics and advantages of various embodiments of the present invention have been set forth in the foregoing description , together with details of the structure and function of various embodiments of the invention , this detailed description is illustrative only , and changes may be made in detail , especially in matters of structure and arrangements of parts within the principles of the present invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed . for example , the particular elements may vary depending on the particular manner of moving a support member to the engaged position without departing from the spirit and scope of the present invention . in addition , although the embodiments described herein are directed to a hoist for moving a disabled person , it will be appreciated by those skilled in the art that the claimed subject matter is not so limited and can be employed as various other lifting systems without departing from the spirit and scope of the claimed invention . | 0 |
fig1 shows an enlarged side view of a guidewire made according to the invention . the guidewire ( 100 ) is made up of the wire core formed of a flexible torqueable wire filament material and has a total length typically between about 50 and 300 centimeters . the proximal section ( 102 ) preferably has a uniform diameter ( along its length ) of about 0 . 010 to 0 . 025 inches , preferably 0 . 010 to 0 . 018 inches . the relatively more flexible distal section ( 104 ) extends for 3 to 30 centimeters or more of the distal end of the guidewire ( 100 ). there may be a middle section ( 106 ) having a diameter intermediate between the diameter of the two portions of the wire adjoining the middle section . the middle section ( 106 ) may be continuously tapered , may have a number of tapered sections or sections of differing diameters , or may be of a uniform diameter along its length . if middle section ( 106 ) is of a generally uniform diameter , the guidewire core will neck down as is seen at ( 108 ). the distal section ( 104 ) of the guidewire ( 100 ) typically has an end cap ( 110 ), a fine wire coil ( 112 ), and a solder joint ( 114 ). the fine wire coil ( 112 ) may be radiopaque and made from materials including but not limited to platinum and its alloys . the end cap ( 110 ) may be radiopaque to allow knowledge of the position of the coil ( 112 ) during the process of inserting the catheter and traversal of the guidewire through the vasculature . at least some portion of the guidewire core has included thereon a braid placed generally on the outside surface of the core and often extends to the distal tip of the core . this braid is not seen in fig1 but will be discussed in more detail below . the braid is constructed of a number of ribbons and , in general , is typically metallic . preferred as ribbon materials are stainless steels and superelastic alloys , but high performance polymers such as polyaramids are useful in some situations . all or part of the guidewire proximal section ( 102 ) and middle section ( 106 ) and distal section ( 104 ) may be coated with a thin layer ( 116 ) of polymeric material to improve its lubricity without adversely affecting the flexibility or shapeability of the guidewire . this invention includes portions or sections of the guidewire described above having the noted polymeric tie layer described below and a slippery , e . g ., a hydrophilic polymeric coating thereon . fig2 shows a partial cutaway of the inventive guidewire ( 100 ) showing the core wire ( 130 ), the supporting ribbon braid ( 132 ), and the polymeric covering ( 134 ). not shown in fig2 because it is only a very thin layer , is the applied polymeric ( often hydrophilic polymeric ) coating exterior to the polymeric covering ( 134 ). as is noted elsewhere , this structure may be placed in any portion of the final guidewire assembly . the inventive guidewire assembly is typically used in a catheter which is made up of an elongate tubular member having proximal and distal ends . the catheter is about 50 to 300 centimeters in length , typically between about 100 and 200 centimeters in length . often , the catheter tubular member has a relatively stiff proximal section which extends along a major portion of the catheter length and one or more relatively flexible distal sections which provide greater ability of the catheter to track the guidewire through sharp bends and turns encountered as the catheter is advanced through the tortuous paths found in the vasculature . the construction of a suitable catheter assembly having differential flexibility along its length is described in u . s . pat . no . 4 , 739 , 768 . super - elastic alloys , particularly ni — ti alloys , retain their super - elastic properties during traversal through the vasculature and yet are sufficiently pliable that they provide the physician using the guidewire with enhanced “ feel ” or feedback and yet do not “ whip ” during use . that is to say , as a guidewire is turned it stores energy during as a twist and releases it precipitously as it “ whips ” to quickly recover the stored stress . the preferred alloys do not incur significant unrecovered strain during use . we have also found that if the eccentricity of the wire , i . e ., the deviation of the cross - section of the guidewire from “ roundness ” ( particularly in the middle section ) is maintained at a very low value , the guidewire is much easier to steer or direct through the vasculature . the materials used in the guidewires of this invention are of shape memory alloys which exhibit super - elastic / pseudo - elastic shape recovery characteristics . these alloys are known . see , for instance , u . s . pat . nos . 3 , 174 , 851 and 3 , 351 , 463 as well as 3 , 753 , 700 ; the &# 39 ; 700 patent describes a material because of the higher modulus of the material due to an increased iron content . these metals are characterized by their ability to be transformed from an austenitic crystal structure to a stress - induced martensitic ( sim ) structure at certain temperatures , and return elastically to the austenitic structure when the stress is removed . these alternating crystalline structures provide the alloy with its super - elastic properties . one such well - known alloy , nitinol , is a nickel - titanium alloy . it is readily commercially available and undergoes the austenite - sim - austenite transformation at a variety of temperature ranges between − 20 ° c . and 30 ° c . these alloys are especially suitable because of their capacity to elastically recover almost completely to the initial configuration once the stress is removed . typically there is little plastic deformation , even at relatively high strains . this allows the guidewire to undertake substantial bends as it passes through the body &# 39 ; s vasculature , and yet return to its original shape once the bend has been traversed without retaining any hint of a kink or a bend . nevertheless , compared to similar stainless steel guidewires , less force need be exerted against the interior walls of the vessels to deform the guidewire of the invention along the desired path through the blood vessel thereby decreasing trauma to the interior of the blood vessel and reducing friction against the coaxial catheter . a guidewire , during its passage through the vasculature to its target site , may undertake numerous bends and loops . the desirability of enhancing the ease with which a guidewire may be twisted to allow the bent distal tip to enter a desired branch of the vasculature cannot be overstated . we have found that one factor in enhancing such ease of use , that is , in enhancing the controllability of the guidewires is by controlling the eccentricity of the cross - section of the middle portion of the guidewire . we have found that by maintaining the middle portion of the guidewire ( 106 in fig1 ) to an eccentricity ratio of 1 ± 10 − 4 , the guidewire is significantly more controllable than those which fall outside this ratio . by “ eccentricity ”, we mean that at any point along the guidewire the ratio of the largest diameter at that cross - section to the smallest diameter of the wire at that cross - section . to achieve these results of high strength and enhanced control even while allowing feedback to the attending physician during use , we have found that the following physical parameters of the alloy are suitable . in a stress - strain test as shown on a stress - strain diagram such as that found in fig3 the stress found at the midpoint of the upper plateau ( up ) ( measured , e . g ., at about 3 % strain when the test end point is about 6 % strain ) should be in the range of 75 ksi ( thousand pounds per square inch )± 10 ksi and , preferably , in the range of 75 ksi ± 5 ksi . additionally , this material should exhibit a lower plateau ( lp ) of 25 ± 7 . 5 ksi , preferably 20 ± 2 . 5 ksi , measured at the midpoint of the lower plateau . the material preferably has no more than about 0 . 25 % residual strain ( rs ) ( when stressed to 6 % strain and allowed to return ) and preferably no more than about 0 . 15 % residual strain . the preferred material is nominally 50 . 6 %± 0 . 2 % ni and the remainder ti . the alloy should contain no more than about 500 parts per million of any of o , c , or n . these alloys often contain up to about 7 % of one or more members of the iron group of metals , e . g ., fe , cr , co , etc . typically such commercially available materials will be sequentially mixed , cast , formed , and separately co - worked to 30 - 40 %, annealed and stretched . by way of further explanation , fig3 shows a stylized stress - strain diagram showing the various parameters noted above and their measurement on that diagram . as stress is initially applied to a sample of the material , the strain is at first proportional ( a ) until the phase change from austenite to martensite begins at ( b ). at the upper plateau ( up ), the energy introduced with the applied stress is stored during the formation of the quasi - stable martensite phase or stress - induced - martensite ( sim ). upon substantial completion of the phase change , the stress - strain relationship again approaches a proportional relationship at ( c ). the stress is no longer applied when the strain reaches 6 %. the measured value ( up ) is found at the midpoint between zero and 6 % strain , i . e ., at 3 % strain . if another terminal condition of strain is chosen , e . g ., 7 %, the measured value of ( up ) and ( lp ) would be found at 3 . 5 %. materials having high up values produce guidewires which are quite strong and allow exceptional torque transmission but cause a compromise in the resulting “ straightness ” of the guidewire . we have found that guidewires having high up values in conjunction with high lp values are not straight . these guidewires are difficult to use because of their tendency to “ whip ” as they are turned . again , that is to say , as a guidewire is turned it stores energy during as a twist and releases it quickly . the difficulty of using such a whipping guidewire should be apparent . materials having up values as noted above are suitable as guidewires . furthermore , materials having values of lp which are high , again , are not straight . lowering the value of lp compromises the ability of the guidewire to transmit torque but improves the ease with which a straight guidewire may be produced . lowering the lp value too far , however , results in a guidewire which , although round , has poor tactile response . it feels somewhat “ vague ” and “ soupy ” during its use . the lp values provided for above allow excellent torque transmission , straightness , and the valuable tactile response . the values of residual strain discussed above define materials which do not kink or otherwise retain a “ set ” or configuration after stress during use as a guidewire . in addition to the core wires made of super - elastic alloys , this invention also covers guidewire cores comprising various stainless steels . suitable stainless steels include those typically used in medical devices , e . g ., 304ss , 306ss , 312ss , and 316ss . most preferred are 304ss and 316ss . in comparison to the guidewire cores made of superelastic alloys , comparable stainless steel cores are more able to transmit torque and are typically stiffer . the trade - off is that stainless steels are much more likely to lack the elasticity of the superelastic alloys . the core may be an assembly of components such as is shown in fig4 and 5 . these figures depict only a few of the various arrangements contemplated under this invention . fig4 shows a guidewire assembly having a composite core made up of a superelastic alloy portion ( 142 ) and a stainless steel distal section ( 144 ). the braid ( 146 ) in this instance might be a superelastic alloy . a radio - opaque coil ( 148 ) is also seen in the drawing . a polymeric covering ( 150 ) is also visible in the drawing . this combination of metallic components has the following benefits : the small stainless steel distal section ( 144 ) is readily shapeable by a physician using the device ; the superelastic braid ( 146 ) inhibits the guidewire section containing the small stainless steel distal section ( 144 ) from kinking ; the more proximal superelastic section does not kink during the manipulation necessary to introduce the guidewire to the target site . another desirable variation of a composite core wire ( 152 ) is seen in fig5 . in this variation , the more proximal section ( 154 ) is stainless steel to provide proximal stiffness . a tubing member is depicted but a solid core member may be used with some provision for a joint to the adjoining superelastic alloy section ( 156 ). an exterior braiding ( 158 ) is also shown . that braiding may be a stainless steel for stiffness , a superelastic alloy for kink resistance ( particularly within the joint region ( 160 )), or even a radio - opaque metal or alloy to allow observance of the guidewire during passage within the body . this invention involves , in large part , the melding of the optimum qualities of the various physical parameters of the respective alloys to result in a guidewire assembly with greater overall effectiveness . fig6 a and 6b together depict a preferred embodiment of the invention . it is a guidewire including a composite core having sections of various alloys and specifically has a stainless steel distal tip section ( 172 ) to allow that tip to be easily shaped by the user . the middle portion ( 174 ) of the guidewire comprises a super - elastic alloy . the mid - section ( 174 ) passes through a significant length of the most tortuous vasculature during a procedure and hence is the most significant candidate for that alloy . the most proximal section ( 176 ) is used primarily for pushing and for transmitting twisting (“ torquing ”) motions between the proximal end and the distal end . consequently , the choice for materials in the more - proximal end ( 176 ) is often stainless steel . if a more flexible path is to be accessed in the vasculature , the choice of materials for the more - proximal end ( 176 ) may be a super - elastic alloy . also depicted in the preferred embodiment in fig6 a and 6b is a ribbon braid member ( 178 ) placed concentrically about the core wire . the braid ( 178 ) need not be the complete length of the core ; it need be only over the portion requiring the enhanced physical characteristic . for instance , in procedures through vasculature having great tortuosity near a major vessel , e . g ., liver vasculature , the proximal section need not be reinforced with a braid . the braid may variously be a super - elastic alloy such as nitinol , a stainless steel , a polymeric material such as is noted elsewhere here , carbon fiber , etc . preferred are superelastic alloys and stainless depending upon the usage . the core assembly depicted in fig6 a and 6b is typical of guidewires used to access targets in the vasculature of the brain . it , however , is only “ typical ” and forms no critical portion of the invention . the core assembly has two tapering regions ( 180 , 182 ) to help with the transition between various regions of the core . as can be seen in the figures , the tubular braid follows the core wire such that the maximum radial gap between the tubular braid and the core wire is less than the wall thickness of the tubular braid . the core wire may taper for significant regions or over short distances . such decisions are within the purview of the guidewire designer . similarly , selection of a polymeric coating ( 184 ) is a matter of choice for the designer . the distal tip ( 186 ) and radio - opaque coil ( 188 ) are relatively common features on contemporary guidewires . the braids used in this invention are exterior to the surface of the guidewire core and are used to provide specific physical strengths of various types , e . g ., torsional rigidity , stiffness , kink resistance , composite elasticity , etc . the braid may be placed directly upon the wire core or may be used with a thin layer of a polymer between the braid and core wire to provide a level of adhesion between the two . other methods of bonding the braid to the core may be used , e . g ., gluing , soldering , welding , etc ., and the bonding may be continuous or at intervals along the core body . although the braid ( 132 ) most desired is shown in fig2 and has a single size of ribbon , the braid need not be so limited ; multiple sizes of ribbon may be used as desired . the major limitations are simply the size , e . g ., diameter , of the overall braid as finally constructed and the desired added stiffness to be added to the guidewire . the braids typically useful in this invention comprise an even number of ribbons : one half of the ribbons wound one way , i . e ., clockwise , and the remainder are wound the other way . a typical braid will be of eight to 16 ribbons . the braid may have a single pitch , an angle of a constituent ribbon measured against the axis of the braid , or it may have a pitch which varies along the axis of the braid . preferred super - elastic alloys include the class of titanium / nickel materials known as nitinol — alloys discovered by the u . s . navy ordnance laboratory . these materials are discussed at length in u . s . pat . nos . 3 , 174 , 851 to buehler et al ., 3 , 351 , 463 to rozner et al ., and 3 , 753 , 700 to harrison et al . commercial alloys containing up to about 5 % of one or more other members of the iron group , e . g ., fe , cr , co , are considered to be encompassed within the class of superelastic ni / ti alloys suitable for this service . when using a superelastic alloy , an additional step may be desirable to preserve the shape of the stiffening braid . for instance , with a cr - containing ni / ti superelastic alloy which has been rolled into a 1 × 4 mil ribbon and formed into a 16 - member braid , some heat treatment is desirable . the braid is placed onto a mandrel , usually metallic , of an appropriate size . the braid is then heated to a temperature of 650 °- 750 ° f . for a few minutes , possibly ( but not necessarily ) annealing the constituent ribbon . after heat treatment , the braid retains its shape and the alloy retains its superelastic properties . the braid may also be wound directly onto the core if so desired . metallic ribbons that are suitable for use in this invention are desirably between 0 . 25 mil and 3 . 5 mil in thickness and 2 . 5 mil and 12 . 0 mil in width . by the term “ ribbon ”, we intend to include elongated shapes , the cross - section of which are not square or round and may typically be rectangular , oval or semi - oval . they should have an aspect ratio of at least 0 . 5 ( thickness / width ). in any event , for superelastic alloys , particularly nitinol , the thickness and width may be somewhat finer , e . g ., down to 0 . 25 mil and 1 . 0 mil , respectively . currently available ribbons include sizes of 1 mil × 3 mil , 1 mil × 4 mil , 2 mil × 6 mil , and 2 mil × 8 mil . the ribbons making up the braid ( 206 ) shown in fig2 may also contain a minor amount of non - superelastic materials . although metallic ribbons are preferred as the ancillary materials because of their strength - to - weight ratios , fibrous materials ( both synthetic and natural ) may also be used . preferred , because of cost , strength , and ready availability , are stainless steels ( ss304 , ss306 , ss316 , etc .) and tungsten alloys . in certain applications , particularly smaller diameter catheter sections , more malleable metals and alloys , e . g ., gold , platinum , palladium , rhodium , etc ., may be used . a platinum alloy with a few percent of tungsten is preferred partially because of its radiopacity . suitable non - metallic ribbons include high performance materials such as those made of polyaramids ( e . g ., kevlar ) and carbon fibers . the braids utilized in this invention may be made using commercially available tubular braiders . whenever the term “ braid ” is used herein , we mean tubular constructions in which the ribbons making up the construction are woven in an in - and - out fashion as they cross to form a tubular member defining a single lumen . the braids may be made up of a suitable number of ribbons , typically six or more . ease of production on a commercial braider typically results in braids having eight or sixteen ribbons . the braid shown in fig2 has a nominal pitch angle of 45 °. clearly the invention is not so limited . other braid angles from 20 ° to 60 ° are also suitable . an important variation of this invention is the ability to vary the pitch angle of the braid either at the time the braid is woven or at the time the braid is included in the guidewire section or sections . the braid ( 132 ) may be rough to the touch if not covered or further processed . procedures such as rolling , sanding , or grinding may be used to smooth the surface of the braid if so desired . removal of any produced particulates is , of course , necessary . whether the outer surface of the braid ( 132 ) is smoothed or not , it is quite desirable to place an outer layer of a lubricious polymer on the exterior of the braiding . the variation show in fig2 utilizes the tie layer ( 134 ) discussed elsewhere herein and has a thin layer of a hydrophilic polymeric layer placed on the exterior of the tie layer ( 134 ). the hydrophilic polymeric layer is not depicted on the drawing because the layer is typically too thin to see . the tie layer ( 134 ) and its associated hydrophilic polymeric layer may be ( but need not be ) of the same composition throughout the resulting guidewire assembly . all or part of the guidewire core and braid may be covered or coated with one or more layers of a polymeric material . the coating is applied typically to enhance the lubricity of the guidewire assembly during its traversal of the catheter lumen or the vascular walls . as noted above , at least a portion of the guidewire core and braid may simply be coated by dipping or spraying or by similar process with such materials as polysulfones , polyfluorocarbons ( such as teflon ), polyolefins such as polyethylene , polypropylene , polyesters ( including polyamides such as the nylon &# 39 ; s ), and polyurethanes ; their blends and copolymers such as polyether block amides ( e . g ., pebax ). it is often desirable to utilize a coating such as discussed just above on the proximal portion of the guidewire and a coating such as discussed below on the more distal sections . any mixture of coatings placed variously on the guidewire is acceptable as chosen for the task at hand . the guidewire core and braid may also be at least partially covered with other hydrophilic polymers including those made from monomers such as ethylene oxide and its higher homologs ; 2 - vinyl pyridine ; n - vinylpyrrolidone ; polyethylene glycol acrylates such as mono - alkoxy polyethylene glycol mono ( meth ) acrylates , including mono - methoxy triethylene glycol mono ( meth ) acrylate , mono - methoxy tetraethylene glycol mono ( meth ) acrylate , polyethylene glycol mono ( meth ) acrylate ; other hydrophilic acrylates such as 2 - hydroxyethylmethacrylate , glycerylmethacrylate ; acrylic acid and its salts ; acrylamide and acrylonitrile ; acrylamidomethylpropane sulfonic acid and its salts cellulose , cellulose derivatives such as methyl cellulose ethyl cellulose , carboxymethyl cellulose , cyanoethyl cellulose , cellulose acetate , polysaccharides such as amylose , pectin , amylopectin , alginic acid , and cross - linked heparin ; maleic anhydride ; aldehydes . these monomers may be formed into homopolymers or block or random copolymers . the use of oligomers of these monomers in coating the guidewire for further polymerization is also an alternative . preferred precursors include ethylene oxide ; 2 - vinyl pyridine ; n - vinylpyrrolidone and acrylic acid and its salts ; acrylamide and acrylonitrile polymerized ( with or without substantial crosslinking ) into homopolymers , or into random or block copolymers . additionally , hydrophobic monomers may be included in the coating polymeric material in an amount up to about 30 % by weight of the resulting copolymer so long as the hydrophilic nature of the resulting copolymer is not substantially compromised . suitable monomers include ethylene , propylene , styrene , styrene derivatives , alkylmethacrylates , vinylchloride , vinylidenechloride , methacrylonitrile , and vinyl acetate . preferred are ethylene , propylene , styrene , and styrene derivatives . the polymeric coating may be cross - linked using various techniques , e . g ., by light such as ultraviolet light , heat , or ionizing radiation , or by peroxides or azo compounds such as acetyl peroxide , cumyl peroxide , propionyl peroxide , benzoyl peroxide , or the like . a polyfunctional monomer such as divinylbenzene , ethylene glycol dimethacrylate , trimethylolpropane , pentaerythritol di - ( or tri - or tetra -) methacrylate , diethylene glycol , or polyethylene glycol dimethacrylate , and similar multifunctional monomers capable of linking the monomers and polymers discussed above . polymers or oligomers applied using the procedure described below are activated or functionalized with photoactive or radiation - active groups to permit reaction of the polymers or oligomers with the underlying polymeric surface . suitable activation groups include benzophenone , thioxanthone , and the like ; acetophenone and its derivatives specified as : where r 1 is h , r 2 is oh , r 3 is ph ; or r 1 is h , r 2 is an alkoxy group including — och 3 , — oc 2 h 3 , r 3 is ph ; or r 1 = r 2 = an alkoxy group , r is ph ; or r 1 = r 2 = an alkoxy group , r 3 is h ; or r 1 = r 2 = cl , r 3 is h or cl . the polymeric coating may then be linked with the substrate using known and appropriate techniques selected on the basis of the chosen activators , e . g ., by ultraviolet light , heat , or ionizing radiation . crosslinking with the listed polymers or oligomers may be accomplished by use of peroxides or azo compounds such as acetyl peroxide , cumyl peroxide , propionyl peroxide , benzoyl peroxide , or the like . a polyfunctional monomer such as divinylbenzene , ethylene glycol dimethacrylate , trimethylolpropane , pentaerythritol di - ( or tri - or terra -) methacrylate , diethylene glycol , or polyethylene glycol dimethacrylate , and similar multifunctional monomers capable of linking the polymers and oligomers discussed above is also appropriate for this invention . the polymeric coating may be applied to the guidewire by any of a variety of methods , e . g ., by spraying a solution or suspension of the polymers or of oligomers of the monomers onto the guidewire core or by dipping it into the solution or suspension . initiators may be included in the solution or applied in a separate step . the guidewire may be sequentially or simultaneously dried to remove solvent after application of the polymer or oligomer to the guidewire and crosslinked . the solution or suspension should be very dilute since only a very thin layer of polymer is to be applied . we have found that an amount of oligomer or polymer in a solvent of between 0 . 25 % and 5 . 0 % ( wt ), preferred is 0 . 5 to 2 . 0 % ( wt ), is excellent for thin and complete coverage of the resulting polymer . preferred solvents for this procedure when using the preferred polymers and procedure are water , low molecular weight alcohols , and ethers , especially methanol , propanol , isopropanol , ethanol , and their mixtures . other water miscible solvents , e . g ., tetrahydrofuran , methylene dichloride , methylethylketone , dimethylacetate , ethyl acetate , etc ., are suitable for the listed polymers and must be chosen according to the characteristics of the polymer ; they should be polar because of the hydrophilic nature of the polymers and oligomers but , because of the reactivity of the terminal groups of those materials , known quenching effects caused by oxygen , hydroxyl groups and the like must be recognized by the user of this process when choosing polymers and solvent systems . particularly preferred as a coating for the guidewire cores discussed herein are physical mixtures of homo - oligomers of at least one of polyethylene oxide ; poly 2 - vinyl pyridine ; polyvinylpyrrolidone , polyacrylic acid , polyacrylamide , and polyacrylonitrile . the catheter bodies or substrates are preferably sprayed or dipped , dried , and irradiated to produce a polymerized and crosslinked polymeric skin of the noted oligomers . the lubricious hydrophilic coating is preferably produced using generally simultaneous solvent removal and crosslinking operations . the coating is applied at a rate allowing “ sheeting ” of the solution , e . g ., formation of a visibly smooth layer without “ runs ”. in a dipping operation for use with most polymeric substrates including those noted below , the optimum coating rates are found at a linear removal rate between 0 . 25 and 2 . 0 inches / sec , preferably 0 . 5 and 1 . 0 inches / sec . the solvent evaporation operations may be conducted using a heating chamber suitable for maintaining the surface at a temperature between 250 ° c . and the glass transition temperature ( t g ) of the underlying substrate . preferred temperatures are 500 ° c . to 1250 ° c . most preferred for the noted and preferred solvent systems is the range of 750 ° to 1100 ° c . ultraviolet light sources may be used to crosslink the polymer precursors onto the substrate . movement through an irradiation chamber having an ultraviolet light source at 90 - 375 nm ( preferably 300 - 350 nm ) having an irradiation density of 50 - 300 mw / cm 2 ( preferably 150 - 250 mw / cm 2 ) for a period of three to seven seconds is desired . passage of a guidewire core through the chamber at a rate of 0 . 25 to 2 . 0 inches / second ( 0 . 5 to 1 . 0 inches / second ) in a chamber having three to nine inches length is suitable . when using ionizing radiation , a radiation density of 1 to 100 krads / cm 2 ( preferably 20 to 50 krads / cm 2 ) may be applied to the solution or suspension on the polymeric substrate . exceptional durability of the resulting coating is produced by repetition of the dipping / solvent removal / irradiation steps up to five times . preferred are two to four repetitions . we have found that it is often desirable to incorporate a “ tie ” layer as a coating between the outer polymeric surface and the braid to enhance the overall adhesion of the outer polymeric surface to the guidewire assembly . of course , these materials must be able to tolerate the various other solvents , cleaners , sterilization procedures , etc ., to which the guidewire and its components are placed during other production steps . fig2 shows a typical guide wire core section ( 100 ) made according to the invention having a metallic core ( 130 ), a braid ( 132 ), a polymeric tie layer ( 134 ), upon which a lubricious coating is placed . choice of materials for such tie layers is determined through their functionality . specifically , the materials are chosen for their affinity or tenacity to the outer polymeric lubricious or hydrophilic coating . clearly , the tie layer material must be flexible and strong . the tie layers may be placed onto the guidewire center in a variety of ways . the polymeric material may be extrudable and made into shrinkable tubing for mounting onto the guidewire through heating . it may be placed onto the guidewire core by dipping , spraying , shrink wrapping of polymeric tubing or other procedure . one quite desirable procedure involves the placement of a polymeric tubing of a fusible polymer , e . g ., polyurethane , on the guidewire core which , in turn , is covered with a heat shrink tubing such as polyethylene . the outer tubing is shrunk down and the inner tubing is fused onto the guidewire core to form a tie layer . the tie layer is preferably 0 . 0004 ″ to 0 . 003 ″ in thickness . the melt temperature of the tie layer polymer desirably is appropriately chosen to fuse at the heat shrink temperature of the outer tubing . the outer shrink tubing is then simply peeled off , leaving the tie layer exposed for treatment with the lubricious coating . we have found that various nylon &# 39 ; s , polyethylene , polystyrene , polyurethane , and polyethylene terephthalate ( pet ) make excellent tie layers . preferred are polyurethane ( shore 80a - 55d ) and pet . most preferred is polyurethane . it is additionally desirable to use a number of sections of polyurethane having differing hardnesses . for instance , the distal section may have a tie layer of shore 80a polyurethane ; the proximal shaft might be shore d55 polyurethane . these materials may be formulated or blended to include radio opaque materials such as barium sulfate , bismuth trioxide , bismuth carbonate , tungsten , tantalum or the like . as noted above , another manner of applying a tie layer is by heat - shrinking the tubing onto the braid . the guidewire core and the exterior braid is simply inserted into a tubing of suitable size — often with a small amount of a “ caulking ” at either end to seal the tubing . the tubing is cut to length and heated until it is sufficiently small in size . the resulting tubing tie layer desirably is between about 0 . 0005 and 0 . 015 inches in thickness . the thinner layers are typically produced from polyurethane or pet . the layer of lubricious polymer is then placed on the outer surface of the shrunk tubing . another procedure for preparing or pretreating guidewires prior to receiving a subsequent coating of a polymer , preferably a polymer which is lubricious , biocompatible , and hydrophilic , is via the use of a plasma stream to deposit a hydrocarbon or fluorocarbon residue . the procedure is described as follows : the guidewire core and braid is placed in a plasma chamber and cleaned with an oxygen plasma etch . it is then exposed to a hydrocarbon plasma to deposit a plasma - polymerized tie layer on the guidewire core to complete the pretreatment . the hydrocarbon plasma may comprise a lower molecular weight ( or gaseous ) alkanes such as methane , ethane , propane , isobutane , butane or the like ; lower molecular weight alkenes such as ethene , propene , isobutene , butene or the like or ; gaseous fluorocarbons such as tetrafluoromethane , trichlorofluoromethane , dichlorodifluoromethane , trifluoro - chloromethane , tetrafluoroethylene , trichlorofluoroethylene , dichlorodifluoroethylene , trifluorochloroethylene and other such materials . mixtures of these materials are also acceptable . the tie layer apparently provides c — c bonds for subsequent covalent bonding to the outer hydrophilic polymer coating . preferred flow rates for the hydrocarbon into the plasma chamber are in the range of 500 c . c ./ min . to 2000 c . c ./ min . and the residence time of the guidewire in the chamber is in the range of 1 - 20 minutes , depending on the chosen hydrocarbon and the plasma chamber operating parameters . power settings for the plasma chamber are preferably in the range of 200 w to 1500 w . a tie layer of plasma - produced hydrocarbon residue having a thickness on the order of 10μ thick is disposed between braid and coating . this process typically produces layers of hydrocarbon residue less than about 1000μ in thickness , and more typically less than about 1000μ . the tie layer effectively bonds the outer layer to the guidewire core while adding very little additional bulk to the guidewire . guidewires made according to this invention therefore avoid the size and maneuverability problems of prior art guidewires . the pretreated guidewire may be coated with a polymer using a procedure such as described above . for example , the pretreated guidewire may be dipped in a solution of a photoactive hydrophilic polymer system , i . e ., a latently photoreactive binder group covalently bonded to a hydrophilic polymer . after drying , the coated guidewire is cured by exposing it to uv light . the uv light activates the latently reactive group in the photoactive polymer system to form covalent bonds with crosslinked c — c bonds in the hydrocarbon residue tie layer . the dipping and curing steps are preferably repeated often enough , typically twice , to achieve the appropriate thickness of the hydrophilic coating layer . one highly preferred variation of the invention involves a guidewire with metal core , preferably 0 . 010 ″ to 0 . 025 ″ diameter stainless steel or high elasticity alloy ( such as nitinol ) and a braid of stainless steel or a high elasticity alloy . the exterior surface of the guidewire is a biocompatible coating of a polyacrylamide / polyvinyl - pyrrolidone mixture bonded to a photoactive binding agent . a preferred photoactive hydrophilic polymer system is a mixture of a polyacrylamide and polyvinylpyrrolidone . the polyacrylamide system provides lubricity , and the polyvinylpyrrolidone system provides both lubricity and binding for durability . as an alternative , however , the hydrophilic biocompatible coating may be polyacrylamide alone , polyvinylpyrrolidone alone , polyethylene oxide , or any suitable coating known in the art . in addition , a coating of heparin , albumin or other proteins may deposited over the hydrophilic coating in a manner known in the art to provide additional biocompatibility features . the guidewire may be cleaned by using an argon plasma etch in place of the oxygen plasma etch . the thickness of the plasma - polymerized tie layer may also vary without departing from the scope of this invention . although preferred embodiments of the present invention have been described , it should be understood that various changes , adaptations , and modifications may be made therein without departing from the spirit of the invention and the scope of the claims which follow . | 0 |
referring now to the drawings , and first to fig1 , shown generally at 10 is an improved cable assembly for electrically coupling a hand - held device 12 to a mounting member or puck 14 . one end 16 of the cable assembly 10 is shown connected to the puck 14 . the other end 18 of the cable assembly 10 has a connector fitting that is plugged into a female jack fitting on the hand - held 12 . the shape of the connector fitting 18 may be unique to the hand - held manufacturer . in accordance with the design disclosed here , one or the other connector fittings 16 , 18 are adapted to carry a chip , the operational characteristics of which are further described below . however , and as just mentioned , connector fitting 18 can be unique to the female jack provided by the hand - held manufacturer . therefore , it is anticipated that the chip may best be housed in the other fitting 16 ( i . e ., connected to the puck 14 ). referring now to fig3 , reference numeral 16 illustrates in greater detail , how connector fitting 16 can be modified to carry a programmable chip . as in fig1 - 2 , the cable assembly is generally indicated at 10 in fig3 and 4 . on the end of the cable 10 is a strain - relief fitting , generally indicated at 20 . the fitting 20 provides a means for relieving stresses that are put on the connector 16 when a consumer examines the hand - held 12 . as discussed above , consumer examination of the hand - held 12 often involves lifting the hand - held from the display position . this action stresses connection points on cabling . a fitting housing , generally indicated at 22 , is located on the end of the cable assembly 10 . fig5 and 6 show upper and lower halves 24 , 26 of the fitting housing 22 . projecting from the fitting housing 22 is a molex - type connector 28 that has connector elements ( indicated generally by 30 in fig7 ). wiring from the cable 10 goes to the connector 28 in conventional fashion . the housing 22 and connector 28 also captures a chip , indicated generally at 32 in fig8 , which is electrically coupled to puck 14 via connector 28 . the connector 28 plugs into the puck 14 which has a corresponding female jack . the chip 32 is of a type that is capable of adjusting incoming power ( delivered first to the puck 14 and then output to the adaptor cable 10 ) to the requirements needed by the hand - held 12 , in lieu of the resistor method described above . returning again to fig1 , this fig . shows the puck 14 exploded from the hand - held 12 . fig2 shows the same embodiment , but with the puck 14 mounted to the hand - held 12 . power to the puck 14 may be supplied in different ways . in the embodiment shown in fig1 - 2 , power may be supplied via a separate power cable 34 that delivers input power at a certain voltage and amperage level to the puck 14 . while not shown here , the puck 14 may contain an internal electronics control board (“ ecb ”) that provides retail security or other functions . some power from cable 34 may be used to power such functions . other power is to be passed through to drive a hand - held 12 and / or charge the hand - held &# 39 ; s battery . in preferred form , incoming power to the puck 14 , could be in the range of 3 to 28v , with 3 amps continuous , up to 4 amps of peak power . within this input range , a means must be provided to adjust these voltage and amperage levels to the requirements that are unique or specific to the hand - held 12 , as provided by the adaptor cable 10 . the chip 32 in the fitting 16 is a programmable device that can receive elevated voltage and amperage and adjust incoming values to device voltage and current required as per device specifications . moreover , the chip 32 can be easily reprogrammed so that the same cable assembly 10 can be used to power a different hand - held having different voltage and amperage input requirements . chips of this type can also adapt to variations in power input ( i . e ., power supplied to the puck 14 or otherwise provided at the jack connection point ( for connector 16 , in this example ). in the near - term implementation , the chip 32 is programmed at the factory for setting the output voltage and current to the level needed to match the intended device &# 39 ; s requirements . however , it could be reprogrammed on - site , to match a different device . electronically programmable chips of the type described here are well - known and could be easily adapted to the above functionality . as indicated , the above design allows the same cable assembly to be used or reused multiple times as devices change , rather than undergo the expense of purchasing new adaptor cables . moreover , by providing the retailer with a simple add - on at the store , in the form of a stand - alone programming device or a downloadable app for an existing device to do the programming , the retailer can easily undertake reprogramming at the store . concerning the above , it is possible to develop a small , hand - held programming tool or device that enables programming individual cables , either at the factories or for store technicians to use . the programming device will include an led display for data and / or a simple button keypad for inputting make and model of the hand - held , as well as the applicable power numbers . the programming device will be capable of reading existing cable settings and displaying them . other programming information may be displayed such as , for example , device type , brand , model number , operating voltage , etc . at the customer ( retailer ) level , the programming device will be simplified for customer use ( i . e ., a store employee ). as one possible embodiment , it is conceivable that the customer &# 39 ; s device will support a mobile app that can be loaded into the operating system of a smart phone , as an example . in other words , it may be possible to develop an app that a store employee can download to his or her local phone from the factory website for the purpose of reprogramming adaptor cables . other features may be included such as bluetooth compatibility . the app interface would include simple , drop - down menus that allow the store user to easily set - up a programming profile for the adaptor cable . in this way , unprogrammed adaptor cables could be plugged into a local programming module ( e . g ., local smart phone or other programming device ) that encode the applicable programming instructions to the chip inside the cable assembly . as indicated above , this would allow the store to program and reprogram cable assemblies , thus saving substantial costs relating to the purchase of new cable assemblies as devices change , with one key limitation being the use of proprietary input jacks . the implementation of a chip in the adaptor cable provides advantages that relate to monitoring of the device &# 39 ; s operation , so that power can be used more efficiently ( energy savings ). the chip offers a “ smart ” platform for performing other functions such as transmitting to outside peripherals data concerning the specific kind of device that is merchandised at specific display post positions . it is conceivable the chip could be made to communicate with the device or puck to handle other power supply and / or diagnostic functions . the above description is not intended to be limiting . the spirit and scope of patent protection is to be limited only by the patent claim or claims that follow , the interpretation of which is to be made in accordance with the established doctrine of patent claim interpretation . | 7 |
fig1 a through 1c illustrate the structure and operation of a tip assembly 100 for a data storage device including the data storage medium according to the embodiments of the present invention . in fig1 a , probe tip assembly 100 includes a u - shaped cantilever 105 having flexible members 105 a and 105 b connected to a support structure 110 . flexing of members 105 a and 105 b provides for substantial pivotal motion of cantilever 105 about a pivot axis 115 . cantilever 105 includes an indenter tip 120 fixed to a heater 125 connected between flexing members 105 a and 105 b . flexing members 105 a and 105 b and heater 125 are electrically conductive and connected to wires ( not shown ) in support structure 110 . in one example , flexing members 105 a and 105 b and indenter tip 120 are formed of highly - doped silicon and have a low electrical resistance , and heater 125 is formed of lightly doped silicon having a high electrical resistance sufficient to heat indenter tip 120 , in one example , to between about 100 ° c . and about 500 ° c . when current is passed through heater 125 . the electrical resistance of heater 125 is a function of temperature . also illustrated in fig1 a is a storage medium ( or a recording medium ) 130 comprising a substrate 130 a , and a cured polyaryletherketone resin layer 130 b . in one example , substrate 130 a comprises silicon . in one example , curing is performed at a temperature between about 300 ° c . and about 400 ° c . cured polyaryletherketone resin layer 130 b may be formed by solution coating , spin coating , dip coating or meniscus coating polyaryletherketone copolymer and reactive diluent formulations and performing a curing operation on the resultant coating . in one example , cured polyaryletherketone resin layer 130 b has a thickness between about 10 nm and about 500 nm . the composition of cured polyaryletherketone resin layer 130 b is described infra . an optional penetration stop layer 130 c is shown between cured polyaryletherketone resin layer 130 b and substrate 130 a . penetration stop layer 130 c limits the depth of penetration of indenter tip 120 into cured polyaryletherketone resin layer 130 b . turning to the operation of tip assembly 100 , in fig1 a , an indentation 135 is formed in cured polyaryletherketone resin layer 130 b by heating indenter tip 120 to a writing temperature t w by passing a current through cantilever 105 and pressing indenter tip 120 into cured polyaryletherketone resin layer 130 b . heating indenter tip 120 allows the tip to penetrate the cured polyaryletherketone resin layer 130 b forming indentation 135 , which remains after the tip is removed . in a first example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being not greater than about 500 ° c ., to form indentation 135 . in a second example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being not greater than about 400 ° c ., to form indentation 135 . in a third example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being between about 200 ° c . and about 500 ° c ., to form indentation 135 . in a fourth example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being between about 100 ° c . and about 400 ° c ., to form indentation 135 . as indentations 135 are formed , a ring 135 a of cured polyaryletherketone resin is formed around the indentation . indentation 135 represents a data bit value of “ 1 ”, a data bit value of “ 0 ” being represented by an absence of an indentation . indentations 135 are nano - scale indentations ( several to several hundred nanometers in width ). fig1 b and 1c illustrate reading the bit value . in fig1 b and 1c , tip assembly 100 is scanned across a portion of cured polyaryletherketone resin layer 130 b . when indenter tip 120 is over a region of cured polyaryletherketone resin layer 130 b not containing an indentation , heater 125 is a distance d 1 from the surface of the cured polyaryletherketone resin layer ( see fig1 b ). when indenter tip 120 is over a region of cured polyaryletherketone resin layer 130 b containing an indentation , heater 125 is a distance d 2 from the surface of the cured polyaryletherketone resin layer ( see fig1 c ) because the tip “ falls ” into the indentation . d 1 is greater than d 2 . if heater 125 is at a temperature t r ( read temperature ), which is lower than t w ( write temperature ), there is more heat loss to substrate 130 a when indenter tip 120 is in an indentation than when the tip is not . this can be measured as a change in resistance of the heater at constant current , thus “ reading ” the data bit value . it is advantageous to use a separate heater for reading , which is mechanically coupled to the tip but thermally isolated from the tip . a typical embodiment is disclosed in patent application ep 05405018 . 2 , 13 jan . 2005 . “ erasing ” ( not shown ) is accomplished by positioning indenter tip 120 in close proximity to indentation 135 , heating the tip to a temperature t e ( erase temperature ), and applying a loading force similar to writing , which causes the previously written indent to relax to a flat state whereas a new indent is written slightly displaced with respect to the erased indent . the cycle is repeated as needed for erasing a stream of bits whereby an indent always remains at the end of the erase track . t e is typically greater than t w . the erase pitch is typically on the order of the rim radius . in a first example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is not greater than about 500 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . in a second example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is not greater than about 400 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . in a third example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is between about 200 ° c . and about 400 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . in a fourth example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is between about 200 ° c . and about 500 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . fig2 is an isometric view of a local probe storage array 140 including the data storage medium according to the embodiments of the present invention . in fig2 , local probe storage array 140 includes substrate 145 having a cured polyaryletherketone resin layer 150 ( similar to cured polyaryletherketone resin layer 130 b of fig1 a , 1 b and 1 c ), which acts as the data - recording layer . an optional tip penetration stop layer may be formed between cured polyaryletherketone resin layer 150 and substrate 145 . in one example , substrate 145 comprises silicon . cured polyaryletherketone resin layer 150 may be formed by solution coating , spin coating , dip coating or meniscus coating uncured polyaryletherketone resin formulations and performing a curing operation on the resultant coating . in one example , cured polyaryletherketone resin layer 150 has a thickness between about 10 nm and about 500 nm and a root mean square surface roughness across a writeable region of cured polyaryletherketone resin layer 150 of less than about 1 . 0 nm across the cured polyaryletherketone resin layer . the composition of cured polyaryletherketone resin layer 150 is described infra . positioned over cured polyaryletherketone resin layer 150 is a probe assembly 155 including an array of probe tip assemblies 100 ( described supra ). probe assembly 155 may be moved in the x , y and z directions relative to substrate 145 and cured polyaryletherketone resin layer 150 by any number of devices as is known in the art . switching arrays 160 a and 160 b are connected to respective rows ( x - direction ) and columns ( y - direction ) of probe tip assemblies 100 in order to allow addressing of individual probe tip assemblies . switching arrays 160 a and 160 b are connected to a controller 165 which includes a write control circuit for independently writing data bits with each probe tip assembly 100 , a read control circuit for independently reading data bits with each probe tip assembly 100 , an erase control circuit for independently erasing data bits with each probe tip assembly 100 , a heat control circuit for independently controlling each heater of each of the probe tip assembles 100 , and x , y and z control circuits for controlling the x , y and z movement of probe assembly 155 . the z control circuit controls a contact mechanism ( not shown ) for contacting the cured polyaryletherketone resin layer 150 with the tips of the array of probe tip assemblies 100 . during a write operation , probe assembly 155 is brought into proximity to cured polyaryletherketone resin layer 150 and probe tip assemblies 100 are scanned relative to the cured polyaryletherketone resin layer . local indentations 135 are formed as described supra . each of the probe tip assemblies 100 writes only in a corresponding region 170 of cured polyaryletherketone resin layer 150 . this reduces the amount of travel and thus time required for writing data . during a read operation , probe assembly 155 is brought into proximity to cured polyaryletherketone resin layer 150 and probe tip assemblies 100 are scanned relative to the cured polyaryletherketone resin layer . local indentations 135 are detected as described supra . each of the probe tip assemblies 100 reads only in a corresponding region 170 of cured polyaryletherketone resin layer 150 . this reduces the amount of travel and thus the time required for reading data . during an erase operation , probe assembly 155 is brought into proximity to cured polyaryletherketone resin layer 150 , and probe tip assemblies 100 are scanned relative to the cured polyaryletherketone resin layer . local indentations 135 are erased as described supra . each of the probe tip assemblies 100 erases only in a corresponding region 170 of cured polyaryletherketone resin layer 150 . this reduces the amount of travel and thus time required for erasing data . additional details relating to data storage devices described supra may be found in the articles “ the millipede — more than one thousand tips for future afm data storage ,” p . vettiger et al ., ibm journal of research and development . vol . 44 no . 3 , may 2000 and “ the millipede — nanotechnology entering data storage ,” p . vettiger et al ., ieee transaction on nanotechnology , vol . 1 , no , 1 , march 2002 . see also united states patent publication 2005 / 0047307 , published mar . 3 , 2005 to frommer et al . and united states patent publication 2005 / 0050258 , published mar . 3 , 2005 to frommer et al ., both of which are hereby included by reference in their entireties . turning to the composition of cured polyaryletherketone resin layer 130 b of fig1 a through 1c . it should be understood that for the purposes of the present invention curing a polymer implies cross - linking the polymer to form a cross - linked polymer or resin . the polyaryletherketone resin medium or imaging layer of the embodiments of the present invention advantageously meets certain criteria . these criteria include high thermal stability to withstand millions of write and erase events , low wear properties ( little or no pickup of material by tips ), low abrasion ( tips do not easily wear out ), low viscosity for writing , glassy character with no secondary relaxations for long data bit lifetime , and shape memory for erasability . cured polyaryletherketone resins according to embodiments of the present invention have high temperature stability while maintaining a low glass transition temperature ( tg ). in a first example , cured polyaryletherketone resins according to embodiments of the present invention have a tg of less than about 180 ° c . in a second example , cured polyaryletherketone resins according to embodiments of the present invention have a tg of between about 100 ° c . and about 180 ° c . the glass transition temperature should be adjusted for good write performance . to optimize the efficiency of the write process there should be a sharp transition from the glassy state to the rubbery state . a sharp transition allows the cured resin to flow easily when a hot tip is brought into contact and quickly return to the glassy state once the hot tip is removed . however , too high a t g leads to high write currents and damage to the probe tip assemblies described supra . a formulation of polyaryletherketone copolymer according to embodiments of the present invention comprises one or more polyaryletherketone copolymers , each polyaryletherketone copolymer of the one or more polyaryletherketone copolymers having the structure : ( i ) m repeat units represented by the structure — r 1 — o — r 2 — o — interspersed with n repeat units represented by the structure — r 1 — o — r 3 — o —, and terminated by a first terminal group represented by the structure r 4 — o — and a second terminal group represented by the structure — r 1 — o — r 4 , or ( ii ) m repeat units represented by the structure — r 1 — o — r 2 — o — interspersed with n repeat units represented by the structure — r 1 — o — r 5 — o —, and terminated by a first terminal group represented by the structure r 4 — o — and a second terminal group represented by the structure — r 1 — o — r 4 , or ( iii ) m repeat units represented by the structure — r 1 — o — r 2 — o — interspersed with n repeat units represented by the structure — r 1 — o — r 3 — o —, terminated by a first terminal group represented by the structure r 6 — o — and a second terminal group represented by the structure — r 1 — o — r 6 , or ( iv ) m repeat units represented by the structure — r 1 — o — r 2 — o — interspersed with n repeat units represented by the structure — r 1 — o — r 5 — o —, a first terminal group represented by the structure r 6 — o — and a second terminal group represented by the structure — r 1 — o — r 6 ; wherein o = oxygen , and occurs as a link between all r groups ; wherein r 1 is selected from the group consisting of : wherein r 2 is selected from the group consisting of : wherein r 3 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein r 4 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein r 5 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein r 6 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein m is an integer of 2 or more , n is an integer of 1 or more , m is greater than n and m + n is from about 5 to about 50 . the molar ratio of a first repeat unit ( containing r 1 and r 2 groups ) to a second repeat unit ( containing either r 1 and r 5 groups or r 3 and r 2 groups ) in structures ( i ), ( ii ), ( iii ) and ( iv ) is kept greater than 1 , therefore the ratio m / n is greater than 1 . the acetylene moieties in the r 3 , r 4 , r 5 , and r 6 groups , whichever are present , react during thermal curing with each other to cross - link the polyaryletherketone copolymers into a polyaryletherketone resin by cyclo - addition . in a first example , polyaryletherketone copolymers according to embodiments of the present invention advantageously have a molecular weight between about 3 , 000 daltons and about 10 , 000 daltons . in a second example , polyaryletherketone copolymers according to embodiments of the present invention advantageously have a molecular weight between about 4 , 000 daltons and about 5 , 000 daltons . all materials were purchased from aldrich and used without further purification unless otherwise noted . 3 - iodophenol ( 5 . 00 gram , 22 . 7 mmol ), bis ( triphenylphospine ) palladium ( ii ) dichloride ( pdcl 2 ( pph 3 ) 2 ) ( 160 mg ), triphenylphospine ( pph 3 ) ( 420 mg ), and cui ( 220 mg ) were suspended in triethylamine ( net 3 ) ( 150 ml ) under an n 2 atmosphere . phenylacetylene ( 3 . 1 ml , 2 . 9 gram , 28 . 4 mmol , 1 . 25 eq ) was added by syringe . the reaction mixture was then stirred and heated to 70 ° c . using an oil bath for 38 hours . excess net 3 was removed under reduced pressure . the remaining solids were extracted with 3 × 50 ml diethyl ether , which was then filtered and evaporated . the crude product was purified by column chromatography ( silica , 3 : 1 hexanes - ethyl acetate ) to give 4 . 1 gram of an orange solid . further purification was accomplished by sublimation ( 100 ° c ., 28 mtorr ) to give 3 -( phenylethynyl ) phenol as a white solid ( 3 . 3 g , 75 % yield ). to a suspension of 3 - iodophenol ( 3 . 73 gram , 17 mmol ), pdcl 2 ( pph 3 ) 2 ( 120 mg ), cui ( 161 mg ), and pph 3 ( 333 mg ) in net 3 ( 100 ml ) under n 2 was added a solution of 3 - hydroxyphenylacetylene ( 2 . 00 gram , 17 mmol ) in net 3 ( 10 ml ). the mixture was stirred and heated to 70 ° c . using an oil bath for 18 h . excess net 3 was removed under reduced pressure , and the remaining solids were extracted with 4 × 50 ml diethyl ether which was then filtered and evaporated . the crude product was purified by suspending in 80 ml ch 2 cl 2 , stirring for 1 hour , and filtering to give the final product as a yellow powder ( 2 . 96 g , 83 % yield ). in a multi - necked flask equipped with a mechanical stiffing apparatus and a dean - stark trap , 4 , 4 ′- difluorobenzophenone ( 1 . 4187 gram , 6 . 502 mmol ), resorcinol ( 0 . 5326 g , 4 . 838 mmol ), 3 , 3 ′- dihydroxydiphenylacetylene ( 0 . 2540 g , 1 . 209 mmol ), 3 - hydroxydiphenylacetylene ( 0 . 1753 g , 0 . 9037 mmol ), and potassium carbonate ( 3 g , 22 mmol ) were suspended in a mixture of dimethylformamide ( dmf ) ( 10 ml ) and toluene ( 20 ml ). the reaction mixture was vigorously stirred and heated to 130 ° c . for 16 hours under a slow flow of dry nitrogen , and toluene was removed periodically via the dean - stark trap . at the end of the 16 h period , the temperature was increased to 150 ° c . for another 8 hours . the reaction was then cooled and the polymer was isolated by multiple precipitations using thf and methanol . molecular weights were adjusted by using different proportions of ( r 1 + r 2 ) to ( r 3 ) and several different molecular weight polymers were prepared . thus , the embodiments of the present invention provide for compositions of matter for the storage media that operate in the nanometer regime . the description of the embodiments of the present invention is given above for the understanding of the present invention . it will be understood that the invention is not limited to the particular embodiments described herein , but is capable of various modifications , rearrangements and substitutions as will now become apparent to those skilled in the art without departing from the scope of the invention . therefore , it is intended that the following claims cover all such modifications and changes as fall within the true spirit and scope of the invention . | 6 |
fig1 shows the overall frame and base of an embodiment of the carrying device , or bag . here it is shown in its open , or unfolded position the frame is constructed with first frame member 5 a and second frame member 5 b . these frame members are quadrilaterally shaped . the frame members shown in the fig1 are substantially rectangular in shape , however other quadrilateral shapes such as trapezoidal may be used , in which the upper and lower horizontal frame sections may be parallel . other four sided shapes using different proportions and angles may be used as well . each frame member includes vertical sections and horizontal sections . here , left vertical sections are 10 b , right vertical sections are 10 a , right horizontal sections are 15 a , left horizontal sections are 15 b . frame members 5 a and 5 b are pivotably joined together by pivots 20 , with one pivot joining the right and left vertical sections as shown . the pivoting mechanism is a single axis mechanism such as a rivet , bolt , etc . pivots 20 are located at approximately a midpoint of each vertical section , where the midpoint is considered to be in the middle one - third of the total length of 5 a or 5 b fig1 also shows two - piece base 50 , which is made from right base 55 a and left base 55 b . further detail of the bases pieces is shown as part of fig1 , described below . other views of the same embodiment of the bag &# 39 ; s frame as in fig1 are shown in fig2 through 6 . fig7 shows a flexible shell 70 installed that surround a frame assembly . the shell may surround the frame and the base , or the frame only . in the first case , the shell covers the frame and the bottom of the base piece ( not shown ), while in the latter case , the shell has four sides and terminates at the edge of the base pieces . in the preferred embodiment , the shell may be fabric , constructed from flexible , natural , man - made or synthetic materials such as nylon , tyvek , canvas , and other materials known by those skilled in the art . the shell may be made from a single piece of material or multiple pieces joined together . alternatively , the shell may be made from a hard material such as metal , wood , plastic , carbon , or other suitable materials known by those skilled in the art . an optional top cover , not shown , may be part of the shell . the cover provides additional security for the contents of the bag , and folds backward to create a top opening to allow full access to the interior cavity of the bag . shell 70 is preferably removable from the frame members , with means such as hook - and - pile strips that fold over the top horizontal frame members , snaps , and other means known in the art . fig1 through 14 show further detail of the device . fig1 and 14 show cross section 4 , where the shell material includes a pleat along each of the device &# 39 ; s shorter bottom edges . fig1 shows a cross section of the shell material when the bag is in its expanded position . when the overall device is folded , the material of the pleat becomes repositioned , with a majority of the pleat unfolding , thereby creating enough slack material to allow the shell to fold with the frame . preferably , the frame assembly is positioned inside of the shell . however , alternate versions ( not shown ) may also be used in which the frame is positioned outside of the shell , or a hybrid in which some portions of the frame are exterior of the shell , and some are interior of the shell . additionally , an inside liner ( not shown ) may be used with the shell . the top access opening created by the combination of fabric and frame members creates a rigid opening to the device &# 39 ; s interior cavity , and thus easy access to the interior of the bag . a conventional grocery or tote bag has a floppy opening , as there &# 39 ; s no rigid structure to support the opening . similarly , a conventional bag lacks any structure to make the bag stand upright on its own . thus two hands are required to access the interior of a conventional bag : one hand to hold the bag upright and expose the opening into the interior cavity , and another hand to reach into the bag &# 39 ; s interior to place or retrieve items . in the present invention , the frame - supported opening does not require one hand to brace the material around opening , or to hold the bag upright . shell 70 may optionally include additional features , such as pockets both inside and / or outside for enhanced organization . there may be a multitude of compartments or dividers within the unit providing options for organization . there also may be options such as an insulated fabric shell to help keep the bag contents cool or warm . other features such as carrying handles 90 are included on the preferred embodiment . here , the handles are formed as cut - outs in shell 70 , forming handles underneath with a top edge spanned by right horizontal sections 15 a and left horizontal section 15 b . of course , other strap configurations may be used as well . hooks or straps that allow the bag to be hung easily can also be included . in addition , there can be d rings , elastic cording and the like attached to the shell for expanded functions and attachments . in the preferred embodiment , the bag is carried by hand . optionally , the bag may be carried as a backpack . for use as a backpack , there is at least one strap , and preferably two , anchored to the frame members or to the shell . optionally , the bag may have a single longer shoulder strap . these strap configurations are further detailed in fig1 . fig8 shows the frame in its folded , or closed position , which is substantially flat . while shell 70 remains in place and folded with the frame in use , the shell is not shown here in order to better show details of the folded frame . when in the closed position , as shown , first and second frame members move around pivots 20 , and the vertical sections of the frame members become positioned substantially parallel to one another , creating a overall device that is substantially flat . fig8 also shows the right base 55 a and left base 55 b folded around hinge 110 ( seen in fig1 ), allowing the base piece to fold upwards in half and become coplanar with the first and second frame members . the frame assembly may be made from materials such as steel , aluminum , fiberglass , carbon , wood , and various other metals and plastics and composites known by those skilled in the art . similarly , a variety of frame material cross - sections may be used , such as circular , oval , square , rectangular , or various i - beam types ; any of these cross sections may be hollow / tubular , or solid . the frame material may be flattened - out in the area of the pivots , in order to facilitate the rivet or similar fastener that is used to pivotably join the first and second frame members together . optionally , a different style pivot joint may be used , with the first frame member may be fabricated to allow the second frame member to pass through the first member at the pivot the outside of the bottom of the unit may include features such as bumpers , to protect the shell or frame from wear , though these bumpers are not shown in the figs . the bumpers may be made from natural or synthetic materials . fig9 shows base piece 50 , which is made from right base 55 a and left base 55 b . interlocking ridges 100 are seen in this view . fig1 also shows base piece 50 , including interlocking ridges 100 engage right and left base pieces together , along with base hinges 110 . ridges 110 form an interlocking system of small plates , or tabs , in which a tab from one side slides underneath the edge of the opposing base piece . this configuration allows the base pieces to lock together , providing a rigid planar structure when contents are loaded into the bag , while also allowing the right and left plate to pivot using hinges 110 . as shown , hinge 110 is a finger - joint , or piano , type , with a cylindrical hinge pin used as a hinge axis . alternate embodiments of the base use a finger joint hinge along the entire edge length of the right and left base pieces , and omit ridges 110 . another embodiment uses conventional hinges that are mounted to the base plate with fasteners , or through molding or bonding . however , the interlocking ridges offer advantages in manufacturing and assembly , and , depending on material selection , may provide additional strength and stiffness . in addition , structural ribs 130 are shown in fig1 , which add stiffness and strength the base pieces . note that in fig1 - 8 , the interlocking ridges are not shown as part of the base plate . fig1 also shows engagement points 120 , which connect the right and left base pieces to the first frame member 5 a and second frame member 5 b . as shown , the engagement points are formed as partial circles that snap around the first and second frame members , and allow the base pieces to rotated around the frame members . alternately ( not shown ), the base pieces may include holes to lighten the pieces and reduce material cost — such a structure being analogous that of a plastic milk crate . fig . tk shows an alternate one - piece base , which is pivotably joined on one edge to a lower horizontal section of said first frame member , with an opposing edge that engages a lower horizontal edge of said second frame member . the engagement may include a fastener that removably snaps around the frame member , or the one - piece may simply rest on the base member , or other suitable engagement means may be used . the one - piece base may further include a live hinge spanning the midsection of said one - piece - base , allowing said one - piece base to fold lengthwise . fig1 is a compilation of multiple illustrations showing an embodiment of the invention that includes one or more carrying straps . the straps may be configured in numerous ways , including as a backpack , tote - style strap , or a single shoulder strap for over - the - shoulder use . included on the shell 70 are first and second loops , each loop located at a bottom corner of shell 70 , and a plurality of guides located inside shell 70 . the loops may be in the form of a fabric , webbing , d - rings , or other suitable types . the strap with a first attachment mechanism on one strap end and a second attachment mechanism on the strap &# 39 ; s opposing end , so that the ends may be fastened together . the attachment mechanism may be a releasable latch , or other suitable type . to form two backpack straps , a strap 200 , as shown in the left column of fig1 , may be foldably fastened to handle 90 , by first folding strap 200 in half , feeding through the handle 90 of the bag , and attacting each end to loops 130 ( which are also shown in fig7 ). here , the attachment mechanism shown is a snap hook type , also known as bolt snap hook , as commonly used on dog leashes . of course , other types of attachment mechanisms may be used , such as squeeze - and - release , or fastex , buckles , and many other types . sliding - type buckles on the strap allow the user to adjust the straps to desired length . in this configuration , the single strap quickly and easily becomes a backpack strap . the right column of fig1 shows another configuration allows strap 200 to form a tote - style carrying strap . here , as shown , one end of the strap is threaded through the four guides 210 between the frame and shell 70 . the ends of the strap 200 are then connected together , using the buckles as described above . this creates a strap arrangement from four points of the bag . alternately , the strap may be slid to create a single shoulder strap for over - the - shoulder use as shown . although the description includes one or more embodiments , it will be understood that other versions may be made without departing from the spirit and scope of the present embodiments . hence , the invention is deemed limited only by the claims and the reasonable interpretation thereof . | 1 |
in the following description , for purposes of explanation rather than limitation , specific details are set forth such as the particular architecture , interfaces , techniques , etc ., in order to provide a thorough understanding of the present invention . however , it will be apparent to those skilled in the art that the present invention may be practiced in other embodiments , which depart from these specific details . for the purpose of simplicity and clarity , detailed descriptions of well - known devices and methods are omitted to avoid obscuring the description of the present invention with unnecessary detail . referring now to fig6 a structure of an antenna apparatus 460 will be described according to a preferred embodiment of the present invention . fig6 illustrates a front view of a mobile communication terminal 400 , e . g . a pda , provided with the antenna apparatus 460 according to the present invention . the antenna apparatus 460 is disposed in the vicinity of the keypad 405 , underlying the same , as viewed from the front of the mobile terminal 400 . the mobile terminal 400 is provided on its front with a display unit 401 , beneath which a keypad assembly 405 is arranged and above which a speaker 409 is disposed . on an upper end of the mobile terminal 400 is disposed a camera module 411 , of which a photographing angle is adjustable by an adjusting knob 413 , disposed on one side of the upper end of the mobile terminal 400 . the display unit 401 may be configured in such a way that it has the largest possible display area within the entire top surface of a main body of the mobile terminal 400 , so as to enable viewing a motion picture or using video phone thereon with more ease . therefore , the keypad assembly 405 is preferably provided with only those essentially required basic key buttons 451 a ( fig7 ) such as “ menu ” key , “ power ” on / off key and so on , and the display unit 401 may be formed of a touch screen , which enables use as an input device for entering a variety of data into the mobile terminal . referring to fig7 to 9 , a detailed description to the keypad 405 and the antenna apparatus 460 is provided . fig7 illustrates an exploded perspective view of the keypad assembly 405 and the antenna apparatus 460 of the mobile communication terminal 400 shown in fig6 and fig8 illustrates an example of an antenna pattern 465 formed by the antenna apparatus 460 of the mobile communication terminal shown in fig7 . further , fig9 illustrates a partial sectional view of the keypad assembly 405 and the antenna apparatus 460 of the mobile communication terminal shown in fig7 . as shown in these figures , on a main board 457 accommodated within the mobile terminal 400 is a cover 455 . the keypad assembly 405 and the antenna apparatus 460 are configured in such a way that a silicon keypad 451 , a first antenna sheet 460 a , a flexible printed circuit board 453 for the keypad and a second antenna sheet 460 b are sequentially stacked on the cover 455 . the silicon keypad 451 is positioned as the topmost surface of a main body of the mobile terminal 400 over the antenna apparatus 460 , with its key tops protruded . the flexible printed circuit board 453 is provided with a plurality of contacts 453 a so as to generate an electrical signal s supplied to the main board 457 depending upon the operation of respective key buttons 451 a arranged on the keypad 451 . the electrical signal s produced from the contacts 453 a of the flexible printed circuit board 453 is supplied to the main board 457 through a data cable 453 b . the first antenna sheet 460 a is inserted between the silicon keypad 451 and the flexible printed circuit board 453 , while the second antenna sheet 460 b is inserted between the cover 455 and the flexible printed circuit board 453 . here , there will be no need to put together both of the first antenna sheet 460 a and the second antenna sheet 460 b , but instead of both , only one of the two antenna sheets may be selectively employed depending upon the characteristic of the mobile terminal in use . the first and second antenna sheets 460 a and 460 b are , in themselves , capable of performing the function of an antenna , and on these first and second antenna sheets 460 a and 460 b may be formed the antenna pattern 465 having a topology such as shown in fig8 . using the antenna pattern 465 , a planar inverted f - type antenna , a meander antenna formed of curvatures and the like may be constructed . further , it should be appreciated that , besides the above antenna pattern , other types of antenna may be implemented using a suitable wire or the like . the first and second antenna sheets 460 a and 460 b are provided with ground lines 463 a and 463 b connected to a ground of the mobile terminal 400 and the antenna pattern 465 , and power supply lines 461 a and 461 b for supplying electrical power f . the mobile terminal 400 carries out data transmitting / receiving operations with a base station through the antenna apparatus 460 which may be provided with both of the first antenna sheet 460 a and the second antenna sheet 460 b , or either one of the two antenna sheets according to the characteristic of the mobile terminal in use . in addition , using the antenna apparatus 460 equipped within the mobile terminal 400 , a diversity antenna of the mobile terminal can be configured according to the present invention . referring now to fig1 and 11 , a front view of a mobile communication terminal having the antenna apparatus according to other preferred embodiments of the present invention are shown . as shown in fig1 , the mobile terminal 500 with a diversity antenna , having on its front a display unit 501 , beneath which a keypad assembly 505 is positioned and above which a speaker 509 is disposed . the mobile terminal 500 further includes a first antenna 507 disposed in upper end and a second antenna 560 disposed underlying the keypad 505 on a lower end that is opposite to the first antenna 507 . also in the upper end of the mobile terminal 500 is disposed a camera module 511 , with a photographing angle adjustable by an adjusting knob 513 disposed on one side of the upper end of the mobile terminal 500 . here , the display unit 401 may be configured in such a way that it has the largest possible area within the entire top surface of a main body of the mobile terminal 500 so as to enable viewing a motion picture or using a video phone thereon with more ease . the first antenna 507 serves as a main antenna of the mobile terminal 500 , for carrying out the transmitting / receiving of radio waves , while the second antenna 560 serves as a sub antenna of the mobile terminal , for carrying out the diversity receiving function , being configured in such a way that the silicon keypad 451 , the first antenna sheet 460 a , the flexible printed circuit board 453 for keypad and a second antenna sheet 460 b are sequentially stacked on the cover 455 , as in fig7 and 9 . here , it will be also appreciated by one of ordinary skill in the art that , contrary to the above construction , the second antenna 560 may be configured to serve as a main antenna of the mobile terminal 500 , for carrying out the transmitting / receiving of radio waves , while the first antenna 507 serves as a sub antenna of the mobile terminal , for carrying out the diversity receiving function . referring then to fig1 , the mobile terminal 600 with the diversity antenna is provided in its front with a display unit 601 , beneath which display unit a keypad assembly 605 is positioned and above which a speaker 609 is disposed . the mobile terminal 600 further includes a first antenna 607 disposed in its upper end underlying the speaker 609 , and a second antenna 660 underlying the keypad 605 and disposed in the lower end , opposite to the first antenna 607 . on the upper end of the mobile terminal 600 is further disposed a camera module 611 , with a photographing angle adjustable by an adjusting knob 613 disposed on one side of the mobile terminal 600 . the first antenna 607 accommodated within the upper end of the mobile terminal 600 may be configured with the first or second antenna sheet 460 a or 460 b , having topology as shown in fig8 using either one of a planar inverted f - type antenna , a meander antenna with plural curvatures , a loop antenna , a chip - type antenna , etc ., which best meets the requirements for a particular preferred embodiment . the first antenna 607 serves as a main antenna of the mobile terminal 600 , for carrying out the transmitting / receiving of radio waves , while the second antenna 660 serves as a sub antenna of the mobile terminal , for carrying out the diversity receiving function , the second antenna being configured in such a way that the silicon keypad 451 , the first antenna sheet 460 a , the flexible printed circuit board 453 for keypad and the second antenna sheet 460 b are sequentially stacked on the cover 455 , as seen in fig7 and 8 . further , apart from the antenna apparatus having the antenna pattern formed on the first or second antenna sheet 460 a and 460 b , this antenna apparatus may be implemented using a preferred one of various kinds of antennas such as a planar inverted f - type antenna , a curved antenna with plural curvatures , a loop antenna , or a chip type antenna , etc . depending upon the requirements or characteristic of the mobile terminals in use . the second antenna serves as a sub antenna of the mobile terminal for achieving the diversity receiving function . in the meantime , it will be appreciated by one of ordinary skill in the art that contrary to the above configuration of the first and second antennas , the second antenna 660 may be configured to serve as a main antenna of the mobile terminal 600 , for carrying out the transmitting / receiving of radio waves , while the first antenna 607 serves as a sub antenna of the mobile terminal , for carrying out the diversity receiving function . as apparent from the foregoing description , it will be understood that the mobile communication terminal according to the present invention is configured in such a way that the antenna apparatus is accommodated underlying the keypad assembly or together with the same within the mobile communication terminal such as , e . g ., mobile phone or pda , thereby achieving more easy built - in design and preventing damage to the antenna due to any external impact . moreover , where the aforementioned pattern antenna is combined with an external type of antenna , it will be considerably easier for its designers to meet the design rule to ensure enough isolating distance in between the aforementioned antenna and the external antenna . furthermore , introduction of such a diversity receiving function to either one of the two antennas according to the present invention will cause to achieve significant improvement of the quality of signal and speed of data transfer in the mobile communication terminals . while the preferred embodiments of the present invention have been illustrated and described , it will be understood by those skilled in the art that various changes and modifications may be made , and equivalents may be substituted for elements thereof without departing from the true scope of the present invention . therefore , it is intended that the present invention not be limited to the particular embodiments disclosed , instead , it is intended that the present invention include all embodiments falling within the scope of the appended claims . | 7 |
the present invention is directed to a system and methods for tracking and billing alarms which allows users to collect , track , store , process , analyze and bill alarm call information and data . the present invention will allow users to identify the location of false alarms , notify responsible parties , generate appropriate information for proper billing and documentation , analyze patterns , and make informed policy decisions for responding to alarms . the system of the present invention also receives and stores alarm call data and analyzes and processes the data to provide users with a sophisticated system for interacting with alarm data and alarm system users . alarm calls can be automatically entered from any computer aided dispatch ( cad ) system capable of generating a simple ascii file . in addition , alarms can be reviewed through geographic information system (“ gis ”) technology such as the one produced by environmental systems research institute (“ esri ”). the system allows an unlimited number of alarmed locations , both business and residential , can be entered into the system . multiple persons can be stored for each location registered , allowing for the tracking of owners , responsible persons , responding persons , and other information in addition , information can be stored on the alarm companies that sell , service or monitor the alarm systems . multiple responsible persons can be entered for each alarm company . the present invention allows payment information to be entered and tracked by registration number , name , alarm company , location , invoice and other data . related invoices can be reviewed status ; outstanding , paid , all invoices , or by specific invoice number . full account history can be reviewed at any time . data from the alarms can not only be used to identify problems in alarm systems , such as excessive false alarms , but can also be used to populate notices , warnings , invoices , and account histories . the present invention provides the user with a system which can collect , analyze , and process alarm data to provide an accurate tool for minimizing false alarms as well as increase the efficiency of jurisdictions or customers and time spent dealing with alarms . the system may include special maintenance screens which allow for important customization . the system may include special user interfaces which allow the users various options such as an option as to whether false alarms should be billed with an “ automatic charge / no - charge ” and an option which also allows for comments . in addition , the system allows the user to define parameters and definitions for when options are applied as well as rules regarding those options such as defining specific fines for each alarm count . the user can also create and save multiple file input formats . another feature of the present invention is the graphical mapping tool , which can be incorporated to allow users to view alarms through mapping tools , allowing for the visual interpretation of alarm patterns . the present invention also enables statistical and graphical alarm information to be viewed , printed directly , or copied into a word processor . additional features of the present invention include easy user - customization , windows - based technology , the ability to map alarm call and registration information , gis oriented systems , and the ability to process multiple alarm input file formats . the present invention can also analyze data and produce various reports associated with the analysis including : aging report , invalid geo - code report , activities by date range , alarms by date range , alarm statistics by date range , dispatch statistics by date range , registration by date range , registration statistics by date range , top offenders report , count registrations by alarm company , list registrations by alarm company , false alarm statistics by alarm company , registration history report , review appeal hearings by registration , print mailing labels . the tracking and processing of alarm data includes entry of licensed alarm holders , tracking of each alarm that occurs by location , accessing dispatch and the records management systems (“ rms ”), reviewing alarm locations through geospatial data , inputting an unlimited number of alarmed locations , and multiple persons to be stored for each location . the alarms can be viewed via mapping tools , allowing for the visual interpretation of alarm patterns in addition to statistical and graphical alarm information . the alarm tracking system of the present invention , as seen in fig1 , provides a way for tracking and billing alarm data for residences , businesses , or any facility or building with an installed alarm system . the residences or businesses 101 , 103 , 105 , each contain an alarm system 102 , 104 , 106 . as indicated in fig1 , the residences or business 101 , 103 , 105 can be located in separate jurisdictions . the alarm systems 102 , 104 , 106 are each connected or communicating with an alarm company 111 , 113 . most alarm systems are wired into the phone line or system of the given residence or business 101 , 103 , 105 . the alarm companies 111 , 113 receive the alarm signal 107 , 108 , 109 from the alarm systems 102 , 104 , 106 and electronically communicate with the appropriate dispatch 121 , 151 for the corresponding jurisdiction 120 , 150 in which the residence or business 101 , 103 , 105 is located . the alarm companies 111 , 113 typically telephonically call , as indicated by signals 112 , 114 , 115 , the appropriate dispatch 121 , 151 for the appropriate jurisdiction 120 , 150 . however , the communication signals 107 , 108 , 109 from the alarms systems 102 , 104 , 106 to the alarm companies 111 , 113 and the communication signals 112 , 114 , 115 from the alarm companies 111 , 113 to the appropriate dispatch 121 , 151 may be by any form of electronic communication including internet , voice , e - mail , or any other communication technology appropriate for the urgency of the alarm . the dispatch 121 , 151 in most instances is the emergency call center which receives all police and emergency calls , such as those placed to 911 , for a given jurisdiction 120 , 150 . as alarm signals 107 , 108 , 109 from the residences or business 101 , 103 , 105 have been processed and relayed from the alarm companies 111 , 113 to the appropriate dispatch 121 , 151 the alarm data is entered into the dispatch computer 125 , 155 . information about the alarm is relayed to police officers for appropriate response and the data from the alarm is stored or saved in a data file 129 , 159 . as indicated in the configuration depicted in jurisdiction a 120 , the dispatch 121 may be the dispatch for both police , fire , and ambulatory rescue operations . the police agency 130 of jurisdiction a 120 may utilize the system of the present invention in their off - site facility using a separate computer 135 . the agency 130 computer 135 has a connected database 139 and the relevant software or computer code 137 resident on the computer 135 which enables the alarm tracking system of the present invention . the agency 130 will retrieve or be sent a data file from the dispatch computer 125 which contains all of the alarm records for a given time period , typically daily , and process the data , as will be described in more detail below . another configuration of the present invention , as seen in relation to jurisdiction b 150 would have the relevant software or computer code 157 resident on the computer 155 of the dispatch 151 . once again the computer 155 would have a connected database 159 for storing system data such as alarm records , registrant information and other data . in the jurisdiction b 150 configuration the data file resident on database 159 containing all of the alarm records for a given time period is then processed by computer 155 , as will be described in more detail below . another still further option or configuration of the system would include an outsourcing agency or facility 140 . in the outsourcing configuration , the outsource agency 140 would have a computer 147 which has a connected database 149 and the relevant software or computer code 147 resident on the computer 145 which enables the alarm tracking system of the present invention . the outsourcing agency 140 will retrieve or be sent a data file from the dispatch 151 computer 155 which contains all of the alarm records for a given time period , typically daily . the outsourcing agency 140 will then process the alarm data , as will be described in more detail below . although the configurations described above describe a system in which alarm data is stored for a given time period and then processed by the software application of the present invention the system can also receive or retrieve alarm data as it is entered into the system at the dispatch and process the alarm data immediately . the method and system of the present invention and how it processes the alarm data will be described in conjunction with fig2 . the process is started in step 201 where the user initiates the computer program or software application resident or running on a computer processing device in a given location such as a law enforcement agency . after starting the process , the user establishes some predefined criteria in step 203 . the establishment of predefined criteria will be described in more detail below but would generally consist of defining the number of false alarms allowed , the amount of fines and penalties , and whether the data file will be processed manually or automatically . the alarm data information for a given time period , such as a day , is stored in a data file which may be located at the dispatch 121 , 151 . the agency 130 or outsourcing agency 140 retrieves or receives the alarm data file from the dispatch 121 , 151 as seen in step 205 . the alarm data file is mined and processed in step 207 where the type of alarm , location , classification , comments and any other information related to each alarm record is compared to stored data on registered alarm locations . in step 209 the system determines if the user has selected the data to be processed automatically or manually . if the user has selected manual review the alarm record is displayed in step 240 . in step 241 the user or system may determine if the alarm data record is for a new location or registrant . if the alarm is for a new location or registrant the new information is entered in step 242 . if the alarm data is not for a new location of registrant or once the new information has been entered ( see step 242 ) the user manually reviews the alarm record in step 243 . the user may save identified alarm records which need additional processing in step 244 . by saving or flagging identified alarm records the user can review all of the records in a timely fashion and place the alarm records into an appropriate category , file , or folder which allows the user to create invoices or correspondence to a selected group of alarm record responsible parties . after the user has reviewed the alarm record and determined if the record needs to be saved or flagged the user can move to the next record . the system determines if there are additional records in step 246 . provided there are additional alarm records the system retrieves the data for the next record in step 248 . the new record is now displayed in step 240 and the process is repeated until all of the alarm records for a given data file have been processed . when the system determines that there are no additional records to process , in step 246 , the user can process the saved records in step 280 . this processing , as described above and as will be described in more detail below , provides the user the ability to invoice , send correspondence , add , delete , or edit information in the system as well as a whole host of other capabilities . once the user has completed the data processing the session is terminated in step 290 . if the user has selected to have the data file processed automatically , see step 209 , the data for a given alarm record is analyzed against the stored data in the system . the stored data in the system contains data from previous alarms as well as information entered by the user or loaded from other sources including information on alarm companies , alarm registrants , mapping information , as well as a host of information related to the jurisdiction . in step 220 , the alarm record is analyzed against the stored data within the system . the system can determine if the data for the alarm record represents a new registrant not previously entered into the system as seen in step 225 . if the alarm record is for a new location or registrant the information is entered as a new data record in the system in step 227 and the record is flagged , placed in a folder , or stored in a file for later review and input by the user . the system then combines the alarm record with any existing data , if any , for the registrant or location in step 230 . if the system determines , in step 225 , that the alarm record is not for a new location or registrant the data from the alarm record is added to the existing data stored in the system , as seen in step 230 . in step 233 , the combined data is processed against the predefined criteria established in step 203 . the system , in step 235 , determines if the registrant or location has exceeded any of the predefined limits . if so , the system flags the record , places it in a folder , or saves it in a file for later processing by the user or the system , as seen in step 237 , can automatically create invoices and correspondence , print copies of such invoices and correspondence , or electronically transmit the invoice and correspondence to the registrant . after the system has either entered new registrant or location information in step 227 , determined that the registrant has not exceed the predefined limits in step 235 , or has created an invoice in step 237 the system determines if there are additional alarm records to review , as seen in step 250 . if there are additional alarm records to review the system retrieves the next record , as seen in step 260 , and analyzes the alarm record against the stored data of the system , as seen in step 220 . when the system determines that there are no additional records to process , see step 250 , the user can review and process any saved records in step 280 . the user has the ability to invoice , send correspondence , add , delete , or edit information in the system as well as other capabilities as will be described in more detail below . once the user has completed the data processing the session is terminated in step 290 . the preferred embodiment of the present invention will be described in more detail in conjunction with fig3 - 16 . the preferred embodiment provides an alarm tracking system which includes an automated user friendly computer system specifically designed to track alarm calls within a particular jurisdiction . this system gives the users the capability of processing alarms , both true and false . the system stores and tracks alarms by alarm locations . the preferred embodiment of the system allows users to register or enter information on alarm companies , alarm vacations as well as a responsible party or a registrant . as seen in fig3 - 16 , the preferred embodiment incorporates a software application or computer program which provides user friendly menus and screens for entering , displaying , or controlling the data related to the alarm . fig3 represents the alarm company registration screen of the preferred embodiment . the system allows for the input of the alarm registration because although alarms are primarily tracked by the address where the alarm is generated it is often important to track the alarm company that installed and monitors the alarm . the user is able to store useful information and data related to the alarm companies and is able to customize the menu by adding or deleting various fields for the alarm company . fig4 represents a screen for entering business or residence registration information . the screen allows the user to input all relevant contact information and location of the business or residence including the personal information , alarm information , special conditions or custom data , and any additional information or notes . this list of alarm companies can always be added to or edited and the system can be used to create and establish the letters , invoices or other correspondence needed to use in conjunction with the billing and notification functions . the system also allows the user to establish all sorts of letters , customize the letterhead , invoices , and reports . another aspect of the system is the ability to store and track alarms by alarmed locations or facilities , and therefore each alarmed location should be registered . as seen in fig4 , the preferred embodiment includes a user friendly screen which allows the user to input and save data on registered alarm locations . information already in the system can be used to populate known data . the alarm license or business / registration screen may include the occupant &# 39 ; s name , address , email address , and phone numbers , as well as registration type , fees paid ( if any ), status date , date paid , expiration date and check number if applicable . related personal information on the resident or responsible party can be entered . the system will check every time the user enters a new address to see if that address already exists in the program . if the address is found , the user is shown a list of matches for review . the user may link the alarm licensee or registrant to the alarm company and set information on the type of alarm , as well as special fee and fee waiver information . the registration screen allows the user to enter such information as whether the alarm is audible , the date installed and / or inspected and the alarm company monitoring the alarm . the user may also enter miscellaneous information , special conditions , additional information and administrative notes . another feature of the preferred embodiment enables the registration fee to be based upon the location type . the user can choose a status for each type of location and set a related fine / charge . for example , the user may set a charge of $ 100 . 00 for a status of not registered . but if the user chooses this status for a new registration , the fee shown and recorded will only be the registration fee related to the location type , such as residential or business . this allows the user to customize and specify any registration fees , fines and any other costs or rules based upon a user defined criteria such as residence or business , which jurisdiction , escalating fines for repeat false alarms and so forth . the preferred embodiment has the ability to process alarm files and is capable of reading a fixed length or tab delimited text file generated by the user &# 39 ; s dispatch system , matching it against those locations currently registered , determining the alarm count , and the appropriate charge . the system or user can determine the time frame for alarm charges . depending upon the jurisdiction , alarm charges can be based on a floating number of months ( i . e ., base charges for all alarms that occurred in the past 12 months from the date of this alarm ) or based on a given date each year ( base charges on all alarms that have occurred since june , 1 ) or any set of defined parameters . as seen in fig5 and 6 , the user may use the alarm entry screen to define the alarm file format . after the user defines the file format , processing alarms is simple . false alarm entry options are selected by clicking the options button on the lower left of the screen . there are several options for processing false alarms . as seen in fig6 the two buttons at the top right hand side allow the user to use the auto process or manual process . the system may also utilize an interactive mode of processing the alarm files where if a decision needs to be made the program stops and the user will be given options , such as charge or ignore . the manual mode presents one alarm at a time on the screen . the user can make the decision for each alarm , charge , ignore , or the user might even be asked to verify the address or name for a particular location . all three options are valid depending upon the needs for the user &# 39 ; s jurisdiction . in the preferred embodiment the user locates and selects the file or files the user wish to process . these files may be produced by the user &# 39 ; s 911 computer aided dispatch (“ cad ”) programs . they are generally batch processed once a day at an off - peak time . a small message should appear advising that there are a certain number of alarms for processing in this file . the user will notice that the system has confirmed the license # for a given location and determine if this is the first alarm for this address during this time period . in the manual mode , the user may press either the charge or ignore button depending on how the user wishes to process this alarm . since nothing indicates this is a false alarm , the user would probably press ignore . the screen automatically moves to the next record and all the user needs to do is look at the information presented on the screen for each record , and press the charge or ignore buttons . the user can continue to process the files manually in this fashion , or the user can use the automatic processing feature to speed things up . most cad systems will track officer comments , dispatch type , and clearance for all calls for service . the system also allows the user to predefine actions ( charge , ignore ) based on clearance types and officer comments . once these options are set , each file can be processed based on those parameters . to test out the semi - automated system , click on the options button and select the auto - process button . alarm files can be processed in either manual or auto process mode . in both processing modes , the alarm records are loaded automatically onto the screen . the difference is that in the automatic mode the program can be set to determine whether to charge or ignore an alarm based on officer clearance or comment information . there may be cases where even in automatic mode , the user would like a chance to review a specific record . one option in the maintenance program is an auto - stop feature for any officer clearance or comments . when the program processes a record which is marked as auto - stop , a special screen loads with pertinent information displayed on the screen . the user is given the opportunity to review the information to determine whether to process the case normally , mark it as ignored , or skip the record completely . when the user press the next button , each record will be automatically charged or ignored , based on pre - established criteria , and the system will move to the next record . the processing will continue uninterrupted until it hits duplicate or unknown addresses . after the last record is processed , the user will see a notice that all records have been processed at this time . if the user had skipped any records for whatever reason , the user will also be presented with a message box advising that records had been skipped and asking the user if the user would like to save these specific records to a new file . the user can then review these records in a word processor such as word or wordperfect . the system is particularly useful for jurisdictions with established legislation for false alarms with developed charging structures based on the number of alarms received . therefore , many of the system - generated correspondence involves billing alarm licensees for false alarms . the payment entry screen , as seen in fig7 and 8 allows the user to record the payments made by each licensee . the user can record a payment of a single invoice or multiple invoices at one time . multiple actions can be placed against a single invoice bill , such as a payment , returned check , incorrect payment entry or the like . in addition , almost every action performed in the system can result in some form of letter being generated for sending to the registrant or alarm company involved . a copy of this correspondence is automatically stored for later retrieval . in the processing of false alarm calls , the normal procedure is to process each day of alarms and then to mail the cover letter and any associated invoice ( bill ) to the registrant . however , the user &# 39 ; s jurisdiction may prefer to send out monthly , or some other periodic time interval , statements for false alarm charges . larger jurisdictions may prefer this approach to reduce overall mailing costs . the preferred embodiment has been designed to allow the user to choose either approach , a periodic invoice or separate invoices for each alarm or can use both approaches . for example , the user may wish to send a letter to the registrant for the first alarm call that explains the problem , but starting from the second alarm send a monthly invoice only . as seen in fig9 , the preferred embodiment includes a fines and status menu where the user can enter the range of alarm counts and choose the letter the user wishes to send to each count or range of counts . creating and transmitting correspondence to the registrant , location or alarm company is another feature of the alarm tracking system . as seen in fig1 , the preferred embodiment provides a list of form letters , a way to create new letters and documents , and a way to track letters that have not been generated ensuring that critical correspondence is never overlooked . when the user select a letter ( s ) to be previewed to the screen , the invoice number is tracked internally . if the letter is acceptable to the user , and the user send the letter ( s ) to the printer , a message box will pop up on the screen providing the user the opportunity to mark the letter as completed . the user has the option of saving every letter in a , as a word , ascii , or pdf file format , all of which can be electronically transmitted to the registrant of alarm company . the system is also able to track expiring and expired registrations , generate and send out bulk letters , and create mailing labels . the preferred embodiment also includes a report generator application using a selected data query as seen in fig1 . the user selects records and fields and the format of the report . the user can select a query from the list , either as a starting point or as the final query , or click the open query button to view previously saved queries . the user can also edit or create new queries . the preferred embodiment is capable of generating various charts and graphs based on alarm information , as seen in fig1 . the user can graph such things as alarm calls and letters sent . the graphing can be grouped many different ways including : by minute , minute intervals , hours , day , quarter , week of year , month of year , or day of week . graphs can be limited by a date range and can also be limited by any location type used during registration ( i . e . only chart businesses , or only chart residences ). the preferred embodiment also provides the ability to geographically view alarm information as seen in fig1 , 14 , and 15 . the preferred embodiment may use map objects , such as esri map objects , to incorporate the mapping functionality . mapping is developed by creating unique layers of geographic information based on the user &# 39 ; s requests . each layer is placed on top of the default base layer of streets for the user &# 39 ; s jurisdiction . each layer is listed in a legend shown to the left of the map . only one layer is considered active at a time . to make any layer active just click once on the layer name in the legend . the name of this layer will appear in the lower right - hand comer of the screen . the user can edit , modify , and control the features they want to view , select the shape and color of the markers and name the layers . the user can choose to map all locations , or limit the map to specific location types such as only mapping residential or government locations . most maps create a single layer showing all the alarms for a selected date range matching the criteria . another feature includes the ability to automatically group matching records into separate layers , such as for each day of the week . as seen in fig1 and 15 , the user can zoom in or zoom out within the map . the user can also move the map around . the user can view information on a particular location by showing the address information for the point selected . the preferred embodiment also has a general information section , as seen in fig1 and 17 , which processes basic information required for the system . the general information feature allows for automatic numbering , default state to use for registrations , payment due date allowance , default hearing charge , check boxes for escrow accounts , shading capability on reports , saving letters in pdf format , setting alarm fines , several default values and charging options . the general information feature includes a registration information portion , which allows the user to customize or add sub - categories of registrations and attach fees according to these categories . the system starts with two types , residential and business . but registration types are not limited to just residential and business . the user can customize the types of registrations allowed with each registration having its own fee . during the processing of alarms , the user has the option of automatically loading new alarm registrations into the database . the user can also associate a default alarm company for every new registration . under the registration information portion , the user may define an additional penalty fee to be applied when false alarms occur at unregistered locations . the preferred embodiment also may include a strong security module where a system administrator has the ability to assign very specific rights to each user . for example , the system administrator may allow a person to enter registration information but not process alarm files . or the system administrator may restrict who can generate reports or allow a person to generate reports , but not to print them . while the invention has been described in detail and with reference to specific embodiments thereof , it will be apparent to those skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof . thus , it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . | 6 |
as described herein , the preferred embodiments of the current invention provide a method and apparatus related to automatically storing and delivering medications within an institutional facility . the method and apparatus maintains the security of the medication and ensures patient compliance with the medicine protocol . referring to the drawings and specifically to fig1 - 14 , the automated medication delivery system is illustrated and generally designated by the numeral 10 . fig1 represents a front perspective view of automated medication delivery system 10 . referring to fig1 - 5 , automated medication delivery system 10 includes a storage facility 12 . storage facility 12 is a secure area having a single access door 14 . access door 14 is positioned within inner side wall 16 of storage facility 12 providing access to storage bins 24 . preferably , a plurality of storage bins 24 are positioned along inner side wall 16 and outer side wall 26 , aligned in at least two rows . each of storage bins 24 are sized to accept med card 28 , shown in fig1 and described herein . preferably , storage bins 24 are vertically and laterally aligned to form a plurality of storage bins 24 . as shown in fig5 , access panel tray 30 is positioned next to bin end 32 of storage bins 24 . automated medication delivery system 10 also includes a barcode scanner 34 . barcode scanner 34 is positioned near access panel tray 30 or near bin end 33 . preferably , barcode scanner 34 is positioned to provide a sufficient field of view to read barcode 36 of med card 28 . it may be desirable to have at least two barcode scanners 34 , with one positioned in each location . controller 38 is positioned within storage facility 12 as shown in fig5 . controller 38 may be positioned in any location as long as it is electronically connectable to numerous components of automated medication delivery system 10 as identified herein . controller 38 is in electronic communication with a computer 40 . controller 38 provides functional control for all of automated medication delivery system 10 . for example , controller 38 receives input , provides output and real - time feedback to all systems . some of the major systems include barcode scanner 34 , retrieval device 42 , dispensing device 44 , first input station 46 , positive control feedback device 48 , and cart 50 . computer 40 is preferably incorporated into controller 38 . however , for security reasons computer 40 may be separated from controller 38 . with reference to fig1 and 5 , first input station 46 includes input port 52 , at least one positive identification device 54 , and display device 56 . in the preferred embodiment , input port 52 is a keyboard , as shown in fig1 ; however , input port 52 maybe any device suitable for entering personal identification data into controller 38 . positive identification device 54 is preferably a biometric device such as finger print reader , retinal scanner , or voice identification device . display device 56 is a visual display interacting with the requestor . preferably , display device 56 is a touchscreen device . in one alternative , when display device 56 is a touch screen display device , input port 52 is integrated with display device 56 . first input station 46 elements , input port 52 , positive identification device 54 , and display device 56 , are in electronic communication with controller 38 . additionally , first input station 46 , input port 52 and display device 56 may be used to submit live queries or respond to medical / pharmacy personnel or security personnel . retrieval device 42 is preferably positioned between storage bins 24 and in electronic communication with controller 38 . as shown in fig3 - 9 , retrieval device 42 includes track 58 , elevation rod 60 , picker arm 62 , and retriever 64 . track 58 permits lateral movement of elevation rod 60 between storage bins 24 . track 58 supports elevation rod 60 between upper component 66 and lower component 68 elevation rod 60 carries a rotatable collar 70 supporting picker arm 62 . elevation rod 60 provides vertical movement of between storage bins 24 for picker arm 62 , while rotatable collar 70 allows picker arm 62 to rotate 360 degrees about elevation rod 60 . picker arm 62 is able to laterally move within rotatable collar 70 . each picker arm end 72 and 74 carries a retriever 64 . in one preferred embodiment depicted in fig6 - 8 , retriever 64 carries clamping device 76 . in an alternative embodiment depicted in fig9 retriever 64 carries spatula shaped device 78 . dispensing device 44 is shown in fig3 - 5 and 11 . dispensing device 44 includes punchout system 80 , cup 82 , first conveyor 84 , second conveyor 86 , anti - contamination film 88 , pill crusher 90 , cup sweeper 92 , med card sweeper 94 , first cup dispensing slot 96 , second cup dispensing slot 98 , first med card dispensing slot 100 , second med card dispensing slot 102 , a distribution conveyor 104 , and water dispenser 106 . punchout system 80 includes punch 108 and tray 110 , and is adapted to extract medication from med card 28 . a plurality of holes 112 are disposed through tray 110 and positioned above catch 114 . catch 114 has catch opening 116 . with reference to fig1 , med card 28 has blisters 118 containing pills 120 . positioning of med card 28 in tray 110 aligns blisters 118 with holes 112 . extraction of pills 120 is provided by positioning of punch 108 over any one of blisters 118 . with reference to fig3 and 4 , cup feeder 122 is positioned at first conveyor first end 124 . cup feeder 122 provides a continuous supply of individual cups 82 to conveyor 84 . first conveyor 84 is adapted to convey cup 82 to first cup dispensing slot 96 positioned through outer side wall 26 or second cup dispensing slot 98 positioned through first end wall 126 at first conveyor second end 128 . anti - contamination film 88 is positioned between and crusher head 134 of pill crusher 90 and an interior of cup 82 . anti - contamination film 88 is carried by first spool 130 and second spool 132 . first spool 130 and second spool 132 are adapted to release a portion of anti - contamination film 88 when crusher head 134 is positioned within the interior of cup 82 , and to retract anti - contamination film 88 when crusher head 134 is not in use . first spool 130 and second spool 132 are adapted to move anti - contamination film 88 after every crushing event . preferably , pill crusher 90 moves in an upward and downward direction for crushing pill 120 . pill crusher 90 , first spool 130 , and second spool 132 are in electronic communication with controller 38 . second conveyor 86 , shown in fig3 - 5 , receives a complete med card 28 . second conveyor 86 has a second conveyor first end 138 adapted to receive med card 28 from retrieval device 42 . second conveyor 86 is adapted to convey med card 28 to first med card dispensing slot 100 , or second med card dispensing slot 102 . first med card dispensing slot 100 is positioned through outer side wall 26 . second med card dispensing slot 102 is shown positioned through first end wall 126 at second conveyor second end 140 . sweep structure 142 supports cup sweeper 92 and med card sweeper 94 . cup sweeper 92 is positioned to move cup 82 from first conveyor 84 to first cup dispensing slot 96 . med card sweeper 94 is positioned to move med card 28 from second conveyor 86 to first med card dispensing slot 100 . when requested , first conveyor 84 conveys a plurality of cups 82 through second cup dispensing slot 98 to distribution conveyor 104 . distribution conveyor 104 is shown wrapping around first end wall 126 and onto inner side wall 16 . distribution conveyor 104 is positioned within a secure portion of storage facility 12 . positive consumption feedback device 48 is shown in fig1 . positive consumption feedback device 48 ensures compliance with medical protocols by providing a video camera 144 , microphone 146 , recorder 148 and audio / video communications link 150 to permit monitoring of patients using automated medication delivery system 10 . additionally , window 152 permits direct human oversight by facility staff standing in or outside of window 152 . although video camera 144 , microphone 146 , recorder 148 and audio / video communications link 150 can be positioned almost anywhere . in one embodiment , window 152 has video camera 144 and microphone 146 positioned above it . audio / video communications link 150 provides a signal to recorder 148 co - located with controller 38 . dispensing device 44 optionally includes a water dispenser 106 . water dispenser 106 is adapted to provide water to cup 82 while upon first conveyor 84 , as seen in fig1 . in the preferred embodiment , a printer 158 prepares a receipt for the medication . in one embodiment , printer 158 prepares a receipt near input port 52 . the receipt optionally includes additional information regarding the medication dispensed . another embodiment has an additional printer near first cup dispensing slot 96 for dispensing a receipt with cup 82 . preferably , another printer 158 is positioned to deposit a receipt with cup 82 exiting second cup dispensing slot 98 . additionally , a portable printer ( not shown ) may be near window 152 for a staff member to manually present to the patient . as depicted in fig1 , med card 28 carries a barcode 36 . additional information is also preferably printed on med card 28 . the preferred information includes identification of the medication , date of issue , number of refills , prescribing medical professional , dosage , administration protocol , warnings , and housing unit , or room of the patient . other information can be added as desired . preferably , database 160 stores all information for access by computer 40 through controller 38 . servicing of retrieval device 42 , dispensing device 44 , barcode scanner 34 , controller 38 , first input station 46 , or any other equipment with medication room 196 is done by qualified personnel . this includes refilling cup feeder 122 , picking up dropped med cards 28 , or cleaning spills . in the preferred embodiment , cart 50 is a mobile extension of automated medication delivery system 10 . fig1 and 14 show cart 50 carried by wheels 162 . however , cart 50 may use any convenient type of conveyance suitable for movement through the intended environment . additionally , cart 50 may have powered wheels 162 for autonomous operations or robotic operations . cart 50 preferably uses a rechargeable battery as a power source ( not shown ) and includes a suitable charger ( not shown ) connectable to a standard wall outlet . cart 50 has a plurality of internal storage bins 24 sized to store med card 28 . in the preferred embodiment , security is provided by access panels 164 that are only openable by the facility staff members with the proper access clearance . cart 50 further includes a wireless communication system suitable for communicating with controller 38 . when operating in an autonomous mode or robotic mode , cart 50 is entirely controlled by controller 38 . in this situation , controller 38 is a remote central control facility . a typical wireless communication system will include an antenna 166 and communications device 168 positioned within or on cart 50 . additionally , cart 50 has an on - board computer 170 for local control functions . in the preferred embodiment , cart 50 has a remote input station 172 , a remote retrieval device 174 , a remote punchout 176 , a cup 178 , a remote cup dispensing slot 180 , and a remote med card slot 182 . each of these is similar to the ones found in storage facility 12 . additionally , remote input station 172 includes the same elements as found in input station 46 . remote input station 172 has input port 52 , positive identification device 54 , and display device 56 . on remote input station 172 , input port 52 is shown as a keyboard in fig1 . as before , input port 52 is suitable for entering personal identification data into cart 50 and controller 38 . display device 56 is a visual display interacting with the requestor . preferably , display device 56 is a touchscreen device . in one alternative , when display device 56 is a touch screen display device , input port 52 is integrated with display device 56 . remote input station 172 is in electronic communication with on - board computer 170 and in wireless electronic communication with controller 38 . remote retrieval device 174 also includes the same elements found in retrieval device 42 . remote retrieval device 174 is shown in fig1 and 14 as being positioned near and providing access to storage bin 24 . remote retrieval device 174 is in electronic communication with on - board computer 170 and in wireless electronic communication with controller 38 . fig1 and 14 show remote retrieval device 174 with track 58 , elevation rod 60 , picker arm 62 , and retriever 64 . elevation rod 60 is movably positioned on track 58 . within cart 50 , track 58 is shown with an upper component 66 and a lower component 68 . track 58 is designed to move elevation rod 60 laterally between storage bins 24 . cart 50 uses picker arm 62 , which is shown positioned on elevation rod 60 . elevation rod 60 is designed to move picker arm 62 vertically between storage bins 24 . picker arm 62 is mounted on rotatable collar 70 . rotatable collar 70 allows picker arm 62 to rotate 360 degrees about elevation rod 60 . picker arm 62 is able to laterally move within rotatable collar 70 . picker arm 62 in cart 50 also employs either clamping device 76 or spatula shaped device 78 as retriever 64 . within cart 50 , retriever 64 is attached to at least end 72 . preferably , retriever 64 is attached to both ends 72 and 74 of picker arm 62 . cart 50 employs a variation of dispensing device 44 . as shown in fig1 , cart 50 uses punchout system 80 , which includes punch 108 ( not shown in fig1 ) and tray 110 . tray 110 has a plurality of holes 110 disposed through it with catch 114 positioned below tray holes 112 of tray 110 . catch 114 has catch opening 116 . cart conveyor 184 is adapted to convey a pill 120 extracted by punchout system 80 to remote cup dispensing slot 180 . remote cup dispensing slot 180 is shown positioned through outer side wall 26 . remote cup dispensing slot 180 is sufficiently large enough to allow access to pill 120 on cart conveyor 184 . although not shown in fig1 , cart 50 , an alternative embodiment includes a pill crusher 90 . in this alternative embodiment , pill crusher 90 , first spool 130 , second spool 132 , crusher head and anti - contamination film 88 are similarly configured as in storage facility 12 . in cart 50 , pill crusher 90 , first spool 130 , second spool 132 , crusher head and anti - contamination film 88 are positioned between tray 110 and cart cup dispensing slot 180 . pill crusher 90 , first spool 130 and second spool 132 are in electronic communication with on - board computer and in wireless electronic communication with controller 38 . in the alternative embodiment using pill crusher 90 , cup feeder 122 is also used . in this alternative embodiment , cart conveyor 184 receives cups from cup feeder 122 which is positioned at cart conveyor first end 186 . cup feeder 122 provides a continuous supply of individual cups 82 to cart conveyor 184 . cart conveyor 84 conveys pill 120 positioned within cup 82 to remote cup dispensing slot 180 . remote cup dispensing slot 180 is also sufficiently large enough to allow access to cup 82 on cart conveyor 184 . as shown in fig1 , cart 50 uses cart shelf 188 to receive a complete med card 28 . cart shelf 188 is positioned adjacent to remote med card slot 182 . remote retrieval device 174 positions med card 28 sufficiently within remote med card slot 182 for a requestor to extract med card 28 . an alternative positive consumption feedback device 48 including video camera 144 , microphone 146 , recorder 148 and audio / video communications link 150 is optionally integrated with cart 50 . video camera 144 , microphone 146 , recorder 148 and audio / video communications link 150 are positioned near remote input station 172 for ease of use . audio / video communications link 150 provides a signal to on - board computer 170 and wirelessly communicates with recorder 148 via controller 38 . in one alternative embodiment , cart 50 includes printer 158 . typically , printer 158 will be located near remote input station 172 for ease of use . having described the preferred embodiments of the apparatus of the current invention , the following discussion will focus on the preferred methods for automatically delivering medication using the automated medication delivery system 10 . the following detailed discussion will break the method into six sub - methods , as shown in fig1 - 18 . the first sub - method begins with the actual prescription process . the method includes the following steps , which are shown in fig1 : a . a physician writes a prescription for medication ( s ) for a patient ; b . the prescription is transmitted to a pharmacy via computer or facsimile ; c . the pharmacy fills the prescription into med cards 28 having blisters 118 ; d . the pharmacy records patient information and medicine information into database 160 , and associates that information with barcode 36 that is printed on med card 28 ; e . the patient information and prescription information are printed onto med card 28 ; f . the pharmacy ships med cards 28 to facility via approved , overnight shipping agent ; and g . the staff receives , inspects , records anomalies and loads medicine cards loaded into automated medication delivery system 10 . the second sub - method highlights the loading process and is shown in fig1 . in this sub - method , the medical staff preferably inputs med card 28 into storage facility 12 . the group of med cards 28 is received from the pharmacy . each med card 28 has all of the pertinent patient information already printed upon it , along with barcode 36 that associates the patient information and medication . the staff member , or members , enters medication room 196 through access door 14 with med cards 28 received from the pharmacy . each med card 28 is inspected by at least one staff member for completeness , accuracy and any missing medications . all missing medications on med card 28 are identified by individual blisters 118 . the information is entered into terminal 194 , which is in electronic communication with controller 38 and database 160 . the staff member places the inspected med card 28 onto access panel tray 30 . in one embodiment , controller 38 engages barcode scanner 34 to record barcode 36 while med card 28 is upon access panel tray 30 . in another embodiment , controller engages barcode scanner 34 after removing med card 28 from access panel tray 30 . in an alternative embodiment , the staff member directly places med card 28 into storage bin 24 and engages controller 38 , automatically or through terminal 194 , to use retrieval device 42 to remove , scan and store it . controller 38 next engages retrieval device 42 using retriever 64 to pick up the scanned med card 28 . controller 38 assigns med card 28 to an empty storage bin 24 and moves retrieval device 42 to insert med card 28 therein . the third sub - method highlights the patient request process . this process is similar to the fourth sub - method shown in fig1 a and 16b . the third sub - method is demonstrated through an example operation of storage facility 12 . in the example , the facility is a prison or large institutional hospital . a patient approaches the first input station 46 . using input port 52 and display device 56 , the patient proceeds to login by entering a unique number assigned to them , along with a personal identification number . positive identification device 54 in this instance is a finger print biometric device . the patient places their finger on positive identification device 54 for verification of their identity . a receipt is printed and dispensed to the patient using printer 158 . once the patient &# 39 ; s identity is verified , a menu of at least one medication associated with that patient is shown on display device 56 . the menu indicates all medication available for dispensing at that time . using first input station 46 , the patient makes a request for the medication by selecting the medication desired . if several medications are available , the menu allows the patient to select all dispensable medications . upon receipt of the request , controller 38 identifies the specific storage bin 24 containing the patient &# 39 ; s med card 28 . controller 38 also identifies that the medication is not a “ keep on person ” medication and that the medication must be crushed . as known to those skilled in the art , institutions identify certain medications as “ keep on person ” medications when those medications must remain with the patient . for example , a patient with severe asthma may need to carry their medication with them at all times in the event of an asthma attack . controller 38 moves picker arm 62 vertically and laterally to position retriever 64 immediately adjacent to the specific storage bin 24 containing the patient &# 39 ; s med card 28 . controller 38 extends picker arm 62 through rotatable collar 70 until retriever 64 clamps med card 28 . controller 38 next retracts picker arm 62 to a neutral position . controller 38 moves picker arm 62 vertically and laterally to position retriever 64 adjacent to barcode scanner 34 . controller 38 again extends picker arm 62 through rotatable collar 70 to scan barcode 36 on med card 28 . picker arm 62 is again retracted to a neutral position . depending upon the particular location of storage bin 24 , rotatable collar 70 may have rotated picker arm 62 one or more times to scan barcode 36 . controller 38 moves picker arm 62 vertically and laterally until med card 28 is aligned with tray 110 . once aligned , controller 38 extends picker arm 62 through rotatable collar 70 to place med card 28 onto tray 110 . since tray 110 is sized to accept med card 110 , blisters 118 are aligned with holes 112 . depending upon the particular location of storage bin 24 , rotatable collar 70 may have rotated picker arm 62 one or more times to align med card 28 with tray 110 . picker arm 62 may optionally release med card 28 . in the preferred embodiment , picker arm 62 retains med card 28 until after punchout system 80 is through with the extraction process of pill 120 . controller 38 operates punchout system 80 once med card 28 is positioned on tray 110 . controller 38 memory contains the location of all remaining pills 120 in med card 28 . preferably , controller 38 moves punch 108 to a position over blister 118 containing pill 120 . alternatively , picker arm 62 and retriever 64 release med card 28 , allowing tray 110 to move and position blister 118 under punch 108 . controller 38 moves punch 108 in a downward direction to push pill 120 through blister 118 . pill 120 falls through hole 112 into catch 114 and out catch opening 116 . since catch 114 is funnel shaped , it does not matter which pill 120 is extracted . controller 38 has previously released cup 82 from cup feeder 122 at first conveyor first end 124 . controller 38 positions cup 82 under catch opening 116 by moving cup 82 on first conveyor 84 . once pill 120 is extracted , controller moves picker arm 62 back to a neutral position on rotatable collar 70 . this movement removes med card 28 from tray 110 . preferably , controller 38 moves picker arm 62 to replace med card 28 in the same storage bin 24 . once pill 120 is in cup 82 , controller 38 moves first conveyor 84 to position it under pill crusher 90 . controller 38 moves crusher head 134 in a downward motion until it enters interior 136 of cup 82 and engages pill 120 . pill 120 is crushed by crusher head 134 . anti - contamination film 88 protects crusher head 134 . crusher head is moved upward to a neutral position . once in the neutral position , controller 38 causes first spool 130 and second spool 132 to rotate and remove the contaminated portion of anti - contamination film 88 from near crusher head 134 . controller 38 engages first conveyor 84 to move cup 82 to a position in front of first cup dispensing slot 96 . once positioned , controller moves cup sweeper 92 to push cup 82 into first cup dispensing slot 96 . printer 158 produces a receipt and deposits the receipt in or near cup 82 while cup 82 is in first cup dispensing slot 96 . the patient is now able to access their medication . controller 38 updates database 160 with the details of the transaction to include the specific pill extracted from med card 28 . if the patient is to receive “ keep on person ” medication , controller 38 directs delivery of med card 28 to second conveyor first end 138 . once med card 28 is on second conveyor 86 , controller 38 moves second conveyor 86 until med card 28 is positioned in front of first med card dispensing slot 100 . once there , controller 38 engages med card sweeper 92 to push med card 28 into first med card dispensing slot 100 . printer 158 produces a receipt and deposits the receipt with med card 28 while med card 28 is in first med card dispensing slot 100 . the receipt may contain additional information about the medication to include drug interaction warnings and side effects . the patient is now able to access their medication . the fourth sub - method is for a staff member to request medication for a group of patients , an entire housing unit or an entire wing . the fourth sub - method is shown in fig1 a and 16b . in some situations , patients are unable to come to a central medication distribution site . thus , facility staff member may need to retrieve all of the medication for a particular room , housing unit , or wing . in that situation , the staff member approaches a second input station ( not shown ) and logins using a second input port ( not shown ), a second display device ( not shown ), and a second positive identification device ( not shown ). second input station is preferably positioned in near inner side wall 16 or first end wall 126 . second input station is also in electronic communication with controller 38 . after the staff member enters their unique identifying number and personal identification number , they may be required to further provide positive identification by a finger print scanner , retinal scanner , or voice identification device . once the staff member &# 39 ; s identity is verified by controller 38 , they will have a different set of menu options presented to them . preferably , the staff member is able to select an individual patient , a group of patients , an entire housing unit or wing , and / or a combination thereof . from that grouping , the staff member selects the medication to be dispensed at that time . controller 38 has the medical records of the patients on file and is able to determine which medication must be dispensed . controller 38 repeats most of the process used for the individual patient identified in the third sub - method , but it does not use cup sweeper 92 or med card sweeper 94 . instead , controller 38 uses first conveyor 84 to deliver all of the medication in cups 82 through second cup dispensing slot 98 . printer 158 prints the patient information for each cup 82 . at that point , controller 38 moves cups 82 on distribution conveyor 104 . the staff member removes cups 82 from distribution conveyor 104 . a safety check device 190 provides feedback to controller 38 to prevent cups 82 from falling off of distribution conveyor 104 . additionally , controller 38 uses second conveyor 86 to deliver all med cards 28 that are “ keep on person ” medications to second med card dispensing slot 102 . the med cards 28 are delivered to catch basket 192 . the staff member removes all med cards 28 from catch basket 192 . the fourth sub - method highlights the staff request process . the method includes the following steps shown in fig1 a and 16b : a . the staff member logs into the second input port with appropriate identifier ; b . the staff member selects the option to retrieve all medication for a particular patient , group of patients , housing unit or wing ; c . controller 38 identifies if any of the medication is “ keep on person ” ( kop ) medication d . if any of the medication is a kop medication , controller 38 directs retrieval device 42 to use picker arm 62 and retriever 64 to retrieve med card 28 : i . barcode 36 on med card 28 is scanned and verified that medication is correct for patient ; ii . the entire med card 28 is passed through second med card dispensing slot 102 to catch basket 192 ; iii . database 160 is electronically updated ; e . if none of medication is a kop , controller 38 directs retrieval device 42 using picker arm 62 and retriever 64 to retrieve med card 28 : i . retrieval device 42 using picker arm 62 moves med card 28 to punchout system 80 ; ii . barcode 36 on med card 28 is scanned to verify the correct medication is being dispensed for the correct patient ; iii . med card 28 is positioned to allow the next individual pill 120 to be punched out , extracted , from blister 118 on med card 28 ; iv . individual pill 120 is punched out and falls into cup 82 ; v . database 160 , medication administration records , are electronically updated ; vi . database 160 information on med card 28 is updated to determine where next punchout should occur on med card 28 ; vii . controller 38 directs retrieval device 42 using picker arm 62 to return med card 28 to its storage bin 24 ; viii . cup 82 is moved on first conveyor to pill crusher 90 station ; ix . controller 38 identifies if pill 120 is to be crushed ; if so , pill ( s ) 120 are crushed using crusher head 134 ; otherwise cup 82 is further conveyed to second cup dispersing slot 98 ; and x . printer 158 prints a receipt showing the medication retrieved ; the receipt is placed on or in cup 82 . the fifth sub - method relates to a patient &# 39 ; s refill request of medication or a staff member &# 39 ; s request for a refill of a medication for a patient . this sub - method is shown in fig1 . controller 38 will display all medications needing refills as part of the original display . if the patient or staff member is only requesting a refill , they may go through the same login process and select that particular option . the fifth sub - method is further outlined in the following steps : a . the patient or staff member logs into first input station using their unique identifying number , personal identification number , and presenting a positive identification ; b . the positive identification is made through fingerprint scan , retinal scan , or voice identification ; c . the medication ( s ) the patient is authorized to refill is shown on display device 56 ; d . the patient or staff member identifies any or all medications to be refilled ; e . if the medication is selected for refill , the refill order is automatically sent to the pharmacy and the medical staff is notified that a refill order was transmitted ; and f . if the refill order was rejected by the patient or staff member , the medical staff notified that refill order was rejected . the sixth sub - method relates to the mobility of automated medication delivery system 10 . as shown below , cart 50 is used to deliver medication within a facility . cart 50 may be pushed by a staff member . alternatively , cart 50 may be semi - autonomous and move through the facility with a staff member . in still another alternative , cart 50 operates autonomously without a staff member . in all situations , cart 50 is in wireless electronic communication with controller 38 and facility staff . cart 50 is loaded with med cards 28 by an authorized staff member . in a secure environment , a staff member opens secure access panels 164 to have access to storage bins 24 . the staff member uses a remote barcode scanner ( not shown ) to scan barcode 36 and record the information in on - board computer 170 and controller 38 . the remote barcode scanner is mounted within cart 50 , and is in electronic communication with on - board computer 170 and controller 38 . the staff member places med card 28 inside of cart 50 under remote barcode scanner . remote barcode scanner triggers remote retrieval device 174 to collect med card 28 . remote retrieval device 174 selects an empty storage bin 24 and moves med card 28 to that storage bin 24 . on - board computer 170 is performing local control of remote barcode scanner and remote retrieval device 174 . the particular med card 28 information and storage bin 24 information are locally stored and transmitted to controller 38 . the med card 28 information is compared with database 160 by controller 38 . any anomalies are identified to the on - board computer 170 , which has remote retrieval device 174 remove med card 28 . once all anomalies are resolved , the med card 28 having trouble is reloaded . after all med cards 28 are loaded , secure access panels 164 are secured . once cart 50 is loaded , on - board computer 170 directs it to deliver the medication . preferably , cart 50 delivers medication to a single room or patient . however , cart 50 can be programmed to deliver medication to a location with several patients . when the patient accesses cart 50 , they use remote input station 172 to login . using input port 52 and display device 56 , the patient proceeds to login by entering a unique number assigned to them , along with a personal identification number . preferably , the patient further verifies their identity using positive identification device 54 . positive identification device 54 is preferably a biometric device , as described above . since , the need for cart 50 implies a higher security area to be serviced , on - board computer 170 records the entire transaction using video camera 144 mounted near remote input station 172 . additionally , the date , time and all other pertinent information is recorded . the recording is wirelessly transmitted to controller 38 . once the patient &# 39 ; s identity is verified , a menu of at least one medication associated with that patient is shown on display device 56 . the menu indicates all medication available for dispensing at that time . using remote input station 172 , the patient makes a request for the medication by selecting the medication desired . if several medications are available , the menu allows the patient to select all dispensable medications . upon receipt of the request , on - board computer 170 identifies the specific storage bin 24 containing the patient &# 39 ; s med card 28 . on - board computer 170 also identifies if the medication is a “ keep on person ” medication , an individual dosage , and if that individual dosage should be crushed . within cart 50 , on - board computer 170 engages remote retrieval device 174 . picker arm 62 is moved vertically and laterally to position retriever 64 immediately adjacent to the specific storage bin 24 containing the patient &# 39 ; s med card 28 . on - board computer 170 extends picker arm 62 through rotatable collar 70 until retriever 64 retrieves med card 28 . on - board computer 170 next retracts picker arm 62 to a neutral position . on - board computer 170 next moves picker arm 62 vertically and laterally to position retriever 64 adjacent to barcode scanner 34 . on - board computer 170 again extends picker arm 62 through rotatable collar 70 to scan barcode 36 on med card 28 . picker arm 62 is again retracted to a neutral position . depending upon the particular location of storage bin 24 , rotatable collar 70 may have rotated picker arm 62 one or more times to scan barcode 36 . once med card 28 is scanned , on - board computer 170 moves picker arm 62 vertically and laterally until med card 28 is aligned with tray 110 . once aligned , on - board computer 170 extends picker arm 62 through rotatable collar 70 to place med card 28 onto tray 110 . since tray 110 is sized to accept med card 110 , blisters 118 are aligned with holes 112 . depending upon the particular location of storage bin 24 , rotatable collar 70 may have rotated picker arm 62 one or more times to align med card 28 with tray 110 . picker arm 62 may optionally release med card 28 . in the preferred embodiment , picker arm 62 retains med card 28 until after punchout system 80 is through with the extraction process of pill 120 . on - board computer 170 operates punchout system 80 once med card 28 is positioned on tray 110 . on - board computer 170 memory contains the location of all remaining pills 120 in med card 28 . preferably , on - board computer 170 moves punch 108 to a position over blister 118 containing pill 120 , alternatively , picker arm 62 and retriever 64 release med card 28 , allowing tray 110 to move and position blister 118 under punch 108 . on - board computer 170 moves punch 108 in a downward direction to push pill 120 through blister 118 . pill 120 falls through hole 112 into catch 114 and out catch opening 116 . since catch 114 is funnel shaped , it does not matter which pill 120 is extracted , if an alternative embodiment utilizing pill crusher 90 is used , cup 82 is internally positioned . in this alternative embodiment , on - board computer 170 has previously released cup 82 from cup feeder 122 at cart conveyor first end 186 . on - board computer 170 positions cup 82 under catch opening 116 by moving cup 82 on cart conveyor 184 . once pill 120 is extracted , controller moves picker arm 62 back to a neutral position on rotatable collar 70 . this movement removes med card 28 from tray 110 . preferably , on - board computer 170 moves picker arm 62 to replace med card 28 in the same storage bin 24 . once pill 120 is in cup 82 , on - board computer 170 moves first conveyor 84 to position it under pill crusher 90 . if pill 120 is to be crushed , on - board computer 170 moves crusher head 134 in a downward motion until it enters interior 136 of cup 82 and engages pill 120 . pill 120 is crushed by crusher head 134 . anti - contamination film 88 protects crusher head 134 . crusher head is moved upward to a neutral position . once in the neutral position , on - board computer 170 causes first spool 130 and second spool 132 to rotate and remove the contaminated portion of anti - contamination film 88 from near crusher head 134 . if pill 120 is not be crushed , or after being crushed , on - board computer 170 engages first conveyor 84 to move cup 82 to a position in front of remote cup dispensing slot 180 . once positioned , printer 158 produces a receipt and deposits the receipt in or near cup 82 while cup 82 is in remote cup dispensing slot 180 . the patient is now able to access their medication . if the alternative embodiment is not used having pill crusher 90 receiving cup 82 from cup feeder 122 , cart conveyor 184 receives pill 120 and positions it in front of remote cup dispensing slot 180 . in yet another embodiment , using pill crusher 90 and not cup feeder 122 , the patient selects cup 82 from external cup feeder 198 , removes pill 120 from cart conveyor 184 , inserts pill 120 into cup 82 and places cup 82 under pill crusher 90 . on - board computer 170 knows to detect if cup 82 is positioned under crusher 90 through a detector ( not shown ). once cup 82 is in position , pill crusher 90 engages and crushes pill 120 . after the crushing event , the patient removes cup 82 with pill 120 in it . on - board computer 170 updates database 160 via controller 38 with the details of the transaction to include the specific pill extracted from med card 28 . if the patient was to receive “ keep on person ” medication , controller would have delivered med card 28 to cart shelf 188 . remote retrieval device 174 pushes med card 28 out remote med card dispensing slot 182 a sufficient distance so that the patient may grab med card 28 . printer 158 produces a receipt for the patient . the receipt may contain additional information about the medication to include drug interaction warnings and side effects . the patient is now able to access their medication . an automated update of the entire transaction is recorded by on - board computer 170 and transmitted to database 160 via controller 38 . therefore , it will be seen that the apparatus and method of the present invention are well adapted to carry out the ends and advantages mentioned , as well as those inherent therein . while a presently preferred embodiment of the apparatus and method have been described for the purposes of this disclosure , numerous changes in the arrangement and construction of parts in the apparatus , and steps in the method , may be made and executed by those skilled in the art . all such changes are encompassed within the scope and spirit of the appended claims . | 6 |
referring now to the drawing in detail , the control circuit of the present invention is used to operate a momentary impulse air pilot valve 12 which admits air to a cylinder 14 to retract or extend a piston 16 to engage or release a clutch ( not shown ). when engaged , the clutch connects a drive mechanism to a press for cycling the press . the control circuit also checks the operation before and during the cycle of the press . should the press malfunction at any point before or during the cycle , the pilot valve 12 is shifted to the right as shown in the figure to connect fluid lines 18 and 20 in a chamber 22 between cylinder 14 and a source of air 24 , whose pressure is regulated by a regulator device 26 , so that air from source 24 extends piston 16 to release the clutch of the press drive , thereby serving as a brake on the operation of the press . with the lines 28 and 30 in chamber 32 of pilot valve 12 in the position illustrated , source 24 will admit air under pressure through line 28 into cylinder 14 , which will exhaust through line 30 , to retract piston 16 to engage the clutch and begin cycling the press . in order to cycle the press , three conditions must be met . a signal in the form of an air pulse must be generated by an impulse generator circuit 34 ; a second air signal must be present from an &# 34 ; on - off &# 34 ; circuit 36 ; and an operation control circuit 38 must generate a third pulse to indicate that the ram of the press is in its uppermost position ready to begin a new cycle . the pulses generated by circuits 34 and 36 are passed through an and gate 40 to a second and gate 42 via the output line 44 of and gate 40 . the operation control circuit 38 must also send an air pulse through line 46 to and gate 42 for an output pulse to appear in output line 48 of and gate 42 to operate the air pilot valve 12 to shift it to the position illustrated . in the position illustrated , piston 16 is retracted to engage the clutch . the operator must hold his button down until circuit 38 can respond . the response time is set by 114 &# 34 ; no - no timer &# 34 ;. this requirement to hold the buttons down for several seconds is a safety feature because it prevents accidentally &# 34 ; tripping &# 34 ; the press by accidentally hitting or falling against the palm or foot buttons . this circuit feature requires the palm and foot buttons to be depressed and held momentarily to engage the clutch . this safety feature is highly desirable in preventing accidents to the operators . the &# 34 ; no - no timer &# 34 ; also adjusts the duration of a &# 34 ; jog &# 34 ; cycle . impulse generator circuit 34 can generate the required pulse to and gate 40 in a variety of ways , depending upon the mode of operation chosen for the press . if the press is to be operated by a sole operator , a palm switch 50 is depressed to admit air from a source 52 through a line 54 . a manual air switch 56 operated by a rotatable selection knob 58 can be positioned so as to conduct fluid to a line 60 from line 54 . line 60 constitutes one input to an or gate 62 . fluid in line 60 is passed through or gate 62 to an output line 64 , feeding one chamber of a second manual air switch 66 whose output is fed via line 68 to a second or gate 70 to supply air to the output line 72 . the air in line 72 will activate an impulse generator 74 , which will transmit an output pulse of a specified duration , depending upon the characteristics of the generator 74 , via line 76 to the input to and gate 40 . alternatively , selection knob 58 can be positioned to open the first switch element and close a second switch element in switch 56 which will pass air transmitted from a source 78 through a second palm switch 80 via line 82 to an and gate 84 . in order for an output pulse to appear in the output line 86 of and gate 84 , the first palm switch 50 must also be depressed at the same time as the second palm switch 80 , so that the pulse generated from source 52 will pass to and gate 84 , and gate 84 prevents either signal in 54 or 82 , from passing unless both signals are present together and at the same time . the signal from 84 passes through line 86 , through &# 34 ; or &# 34 ; 62 and switch 67 . the operation of pulse generator 74 is then identical to that described above . by rotating knob 58 to select a circuit operable only when both palm switches 50 and 80 are depressed , the press can only be activated when two operators are ready to cycle the press . for example , one operator may be at a remote location from the other and when one is ready , the other must also be , in order for the press to commence its cycle . yet another alternative available to generate a pulse through line 76 to and gate 40 is for an operator to depress a foot switch 88 rather than one or both palm switches 50 and 80 . air is admitted through the switch 88 from a source 90 . the output line 92 of the foot switch 88 is connected to a second chamber in switch 66 by a manually rotatable knob 67 on the switch 66 . the output from switch 66 is fed via a line 69 through or gate 70 to impulse generator 74 , which generates the requisite signal in line 76 . the second condition of the circuit check is met by turning &# 34 ; on &# 34 ; an &# 34 ; on - off &# 34 ; switch 92 to the press drive to activate a motor controller 93 . upon closing of switch 92 , an air pulse will be transmitted from a source 94 through line 96 to and gate 40 . when both input lines 96 and 76 to and gate 40 are operational , an output pulse will be transmitted via line 44 to and gate 42 . in order to obtain an output signal in the output line 48 from and gate 42 to supply a momentary pulse to shift air pilot valve 12 to a position enabling air from source 24 to retract piston 16 , an air pulse must be supplied to and gate 42 through line 46 . this will be accomplished if the third condition of the circuit check is met , which requires the ram of the press to be in its uppermost position ready to cycle . when the ram of the press is up , a limit switch 100 in the operational control circuit 38 will be closed or depressed enabling air from a source 102 to be transmitted through a line 106 to an or gate 104 . or gate 104 will transmit the requisite pulse over output line 46 to and gate 42 satisfying all conditions necessary to shift the pilot valve 12 . if for any reason the ram does not move , for example , if motor 93 is not plugged in or is burnt out , or if the ram is jammed , the clutch will be immediately released by reshifting of air pilot valve 12 to the right . when impulse generator 74 is activated , the pulse from or gate 70 is tapped from line 72 to a nono timer 114 . nono timer 114 is a normally open negative output logic element whereupon sensing an input pulse , it will immediately conduct and close after an adjustable , predetermined time interval and not conduct . accordingly , when impulse generator 74 receives a pulse from or gate 70 , nono timer 114 will conduct for the predetermined interval and then close . the output of the nono timer 114 via a line 112 is connected to the input of a not element 110 . the output from or gate 104 is also connected via line 108 to not element 110 . not element 110 will supply an output pulse in a line 128 when nono timer 114 is not conducting and an input signal or pulse is received in line 108 . accordingly , should the ram not move after passing the circuit check , switch 100 will still be depressed to send air from source 102 through or gate 104 through line 108 to not element 110 . normally , limit switch 100 would be opened as the ram moves before nono timer 114 finishes its conducting cycle , preventing a pulse from being transmitted to output line 128 . however , should the ram still depress limit switch 100 after nono timer 114 shuts down , not element 110 will pass air to line 128 which is connected to an or gate 126 whose output line 130 will transmit a pulse wherein pilot valve 12 is shifted to the right so as to extend piston 16 to release the clutch and break the drive to the press . should the press be functioning correctly , when the ram returns at the end of its cycle to close limit switch 100 again , nono timer 114 will not be conducting until another pulse is tapped from line 72 . therefore , a signal will be transmitted from source 102 via line 106 through or gate 104 , via line 108 , through the not element 110 , which will conduct because nono timer 114 is not conducting , line 128 , or gate 126 , and output line 130 , to shift the pilot valve 12 and shut down operation of the press . if the ram of the press should stop for any reason after it has begun its travel and is below limit switch 100 , the ram may be returned to the top of its cycle by closing a jog switch 118 . this feature is highly desirable as a safety precaution because it requires the operators to turn &# 34 ; on &# 34 ; the jog switch in order to get the ram back up to its operating position . in so doing , the operator must stop and think about why the ram stopped . if it is a malfunction jogging through the rest of the cycle will give the operator time to see the malfunction , hopefully . with jog switch 118 on , air will be transmitted from source 120 through a line 132 to or gate 104 . or gate 104 will supply the necessary pulse through line 46 to and gate 42 to cause piston 16 to retract as long as switch 92 is &# 34 ; on &# 34 ; and the palm switch 50 , or foot switch 88 , or the two palm switches 50 and 80 are depressed , as the case may be . the requisite pulse will be supplied through line 48 to shift air pilot valve 12 . nono timer 114 will also be activated when the palm switch 50 , or any of the combinations described are depressed , to enable the not element 110 to act as an inhibitor preventing the pulse from or gate 104 from entering line 128 and line 130 to shift the valve 12 to release the piston 16 . the jog pulse will be active as long as nono timer 114 is on . accordingly , the press ram will jog until timer 114 shuts down in which event not element 110 will become active to supply a pulse to line 130 through or gate 126 to release the clutch . when this occurs , the palm switches or foot switch in impulse generator circuit 34 must again be activated to jog the press . this can be continued until the ram has returned to the top of the cycle . the controls are set up so there is normally a signal present to stop the press at all times . the presence of this stopping signal is a highly desirable safety feature being sought industry - wide to help prevent accidents to press operators and to the machinery . current regulations suggest that this type of circuitry is desirable but has heretofore not been generally available to the industry . the presence of the stopping signal prevents an operator from casually operating the press in an unsafe manner ; that is , it is hard to bypass the control circuits . in the event of an emergency during the operation of the press which is viewed by the operator , an emergency palm switch 122 can be closed to supply air from source 124 through or gate 126 directly to line 130 to shift air pilot valve 12 to the right to extend piston 16 , thereby releasing the clutch to the drive . it will also be apparent from the foregoing that the jog duration is adjustable , that is , by adjusting the length of time in which nono timer 114 conducts , the amount each jog pulse moves the ram can be varied . further , the regulator 26 supplying air to clutch cylinder 14 can make the piston 16 press on the clutch either hard or softly . with soft pressure , the clutch slips some , moving the ram at a creep speed . pressing hard fully engages the clutch for maximum speed . there are many safety features built into the circuit . the press itself , requires strong clutch pressure to start it moving . if this pressure is removed , the press stops . accordingly , it takes a definitive coercive force to get the press through one cycle and to begin to move . if air pressure fails , the press will stop . if the air lines leak , the press will stop and as pointed out above , there is normally a signal to stop the press at all times . this signal must be interrupted by the proper combination of &# 34 ; on &# 34 ; signals . these &# 34 ; on &# 34 ; signals are not allowed to activate the press unless the limit switch indicates that the ram is up and ready to go . if the limit switch is jammed , the press will at best only jog . if the line to the limit switch 100 is cut , the press will not even start . there is also a guard against accidental triggering . if the palm or foot switches are not held down long enough for the ram to clear the limit switch 100 , the press will stop once the nono timer 114 closes . while a specific embodiment of a press control circuit has been disclosed in the foregoing description , it will be understood that various modifications within the spirit of the invention may occur to those skilled in the art . for example , while the circuit has been disclosed using air logic elements , it should be apparent that an electronic or hydraulic logic system which functions in the identical manner could be used . further , each of the air sources disclosed could emanate from a single source rather than individual sources . therefore , it is intended that no limitations be placed on the invention except as defined by the scope of the appended claims . | 5 |
as will be described in more detail below , embodiments of the present invention reduce the parasitic capacitance between a conductive trace and a substrate in an integrated circuit device ( e . g , a cmos device ), without changing the process material or flow . terminology used to describe embodiments of the present invention is discussed below . the term “ nwell ” means a region of a substrate ( e . g ., a silicon wafer ) that has a relatively high concentration of n - type dopants , so that negatively charged electrons are available for electrical conduction . example n - type dopants can include , but are not limited to , antimony trioxide , arsenic trioxide , arsine , phosphorus oxychloride , phosphorus pentoxide , phosphine or other n - type dopants as would be apparent to one skilled in the relevant art ( s ). the term “ pwell ” means a region of a substrate ( e . g ., a silicon wafer ) that has a relatively high concentration of p - type dopants , so that positive “ holes ” ( or the absence of electrons ) are available for electrical conduction . example p - type dopants can include , but are not limited to , boron tribromide , boron trioxide , diborane , boron trichloride , boron nitride or other p - type dopants as would be apparent to one skilled in the relevant art ( s ). as a person skilled in the relevant art ( s ) will appreciated , the combination of an nwell and a pwell are typically used in cmos structures to form both n - channel and p - channel transistors . cmos circuits are typically smaller and consume less power than comparable circuits . the terms “ signal line ” and “ conductive trace ” are used interchangeably to mean an electrically conductive material that is separated from a substrate by an insulator layer , sometimes called a field oxide . typically , a field oxide is a dielectric , like silicon dioxide ( sio 2 ), but other materials can be used as a field oxide , as is know by persons skilled in the relevant art ( s ). as mentioned above , examples of signal lines can include , but are not limited to , metal lines and / or polycrystaline silicon ( poly ) resistors . in vlsi applications , a parasitic capacitance arises from an electrical coupling between a conductive trace and a substrate that are separated by an insulator layer or field oxide . fig1 is a cross sectional view of a conventional arrangement of a conductive trace 102 mounted on a substrate 106 ( e . g , a silicon wafer ). an insulator layer 104 is disposed between the conductive trace 102 and the substrate 106 . insulator layer 104 produces a separation 108 between the conductive trace 102 and the substrate 106 . insulator layer 104 can be composed of silicon dioxide or silicon nitride , or some other dielectric material as would be apparent to one skilled in the semiconductor art . the arrangement in fig1 results in a parasitic capacitance ( cd ) between the conductive trace 102 and the substrate 106 . this parasitic capacitance reduces the signal bandwidth and signal speed due to the filtering effect , as described above in connection with eq . 1 . according to an embodiment of the present invention , the parasitic capacitance between the conductive traces and the substrate is reduced by disposing an element between the conductive trace and the substrate . fig2 is an embodiment of the invention in which an element 212 is disposed between the conductive trace 202 and the substrate 206 . the element 212 produces an additional capacitance , in series with the parasitic capacitance , between the conductive trace 202 and the substrate 206 . the series combination of the parasitic capacitance and the additional capacitance results in a reduced effective capacitance between the conductive trace 202 and the substrate 206 , which is given by the following equation : c eff = c x c d c x + c d , eq . 2 where c eff is the effective capacitance , c x is the additional capacitance , and c d is the capacitance across the insulator layer . from eq . 2 it is seen that c eff is always less than c d , which means the effective parasitic capacitance between the conductive trace 202 and the substrate 206 is less than the original parasitic capacitance . it will be apparent to a person skilled in the relevant art that the element inserted between the conductive trace and substrate can be any device that contributes an impedance , including capacitance and resistance , between the conductive trace and the substrate to result in an additional capacitance that is in series with the original capacitance between the conductive trace and the substrate . fig3 and 4 illustrate two example elements or combinations of elements that can be disposed between the signal lines and the substrate to reduce the parasitic capacitance . fig3 is an example in which the element that provides a capacitance in series with the parasitic capacitance is an nwell 312 . in this example , the substrate comprises a pwell 306 , i . e ., a region of silicon wafer substrate containing p - type dopants . in order to form a capacitance ( c x ) between the nwell 312 and the pwell 306 , the nwell 312 must be electrically ac floating . in an embodiment , the nwell 312 can be made electrically ac floating by coupling it to a diode 314 , which is coupled to a high voltage source ( not shown ), so that the nwell 312 is biased at a higher voltage than the pwell ( substrate ) 306 . in other words , nwell 312 is in direct electrical contact with the p - type portion 316 of the pn junction of diode 314 . the high voltage source coupled to diode 314 can be , for example , a supply voltage of the ic device of which the structure depicted in fig3 is a part . other techniques to bias nwell 312 will become apparent to a person having ordinary skill in the pertinent art . in standard cmos technologies , the capacitance ( c x ) between the pwell 306 and the nwell 312 is about the same as the original parasitic capacitance ( c d ) between the conductive trace 302 and the pwell 306 . therefore , according to eq . 2 , the effective parasitic capacitance ( c eff ) is about half of the original parasitic capacitance ( c d ) between the conductive trace 302 and the pwell 306 . this means that the parasitic capacitance between the conductive trace 302 and the pwell 306 is reduced by 50 %. for the example of fig3 , if the conductive trace 302 is disposed on a polycrystaline layer and has a width of approximately 8 μm and a length of approximately 26 μm , then c d ( the capacitance between conductive trace 302 and nwell 312 ) is approximately 50 ff ( 50 × 10 − 15 farads ) and c x ( the capacitance between nwell 312 and pwell 306 ) is approximately 47 ff . therefore , according to eq . 2 , c eff ( the effective capacitance between conductive trace 302 and pwell 306 ) is approximately 24 ff , which represents a reduction in the typical capacitance between conductive trace 302 and pwell 306 of approximately 51 % or 26 ff . ( note : in the example quoted above , three series of diodes were used to avoid forward biasing if the signal swing is too large .) to further reduce the parasitic capacitance between the conductive traces and the substrate , a second element can be disposed between the conductive traces and the substrate , thereby forming an additional capacitance in series with the parasitic capacitance . for instance , fig4 is an example in which the element between the conductive trace 402 and the substrate 406 comprises a pwell 412 and a deep nwell 416 . again , the pwell 412 and the deep nwell 416 are kept electrically ac floating and dc reversed biased by coupling the deep nwell 416 to a voltage source ( not shown ) through a reverse - biased diode 414 , in like manner to that described above with reference to fig3 . this arrangement results in a floating capacitance , c x , between the pwell 412 and the deep nwell 416 , and a floating capacitance , c y , between the deep nwell 416 and the substrate 406 . therefore , the effective parasitic capacitance between the conductive trace 402 and the substrate 406 is reduced according to the following equation : c eff = c x c y c d c x c y + c y c d + c d c x . eq . 3 as a person skilled in the relevant art ( s ) will appreciate , the structures in fig3 and 4 can be fabricated according to several different processing steps . an example fabrication process for the structure illustrated in fig3 is described below with reference to fig5 a - 5e . it is to be appreciated that the fabrication process is presented by way of example only , and not limitation . other fabrication processes can be employed to fabricate either of the structures illustrated in fig3 or 4 without deviating from the scope and spirit of the present invention . step 1 : layering operation . the example fabrication process begins with a portion of a substrate that is doped with p - type dopants to form a pwell 501 , as shown in fig5 a . the doping can be achieved through thermal diffusion , ion implantation , or some other doping technique as would become apparent to those skilled in the relevant art ( s ). pwell 501 is then layer with a field oxide layer 503 ( e . g ., silicon dioxide ), as shown in fig5 b . example layering techniques can include physical vapor deposition ( pvd ), chemical vapor deposition ( cvd ), evaporation , sputtering , or some other technique as would be apparent to one skilled in the relevant art ( s ). step 2 : patterning operation . the patterning operation leaves an opening 505 in field oxide layer 503 exposing substrate 501 , as shown in fig5 c . substrate 501 is then doped with an n - type dopant to produce an nwell 507 . lithography and deposition are well known techniques for these steps , as would be apparent to a person skilled in the relevant art . step 3 : layering operation . field oxide layer 503 is then removed by known techniques and a new field oxide layer 509 is disposed on substrate 501 , as indicated in fig5 d . step 4 : etching operation . a hole is etched in field oxide layer 509 using known techniques to expose nwell 507 . step 5 : layering / patterning operation . a diode 511 is patterned and formed using well - known techniques having its pn junction reversed biased , as shown in fig5 e . step 6 : layering / patterning operation . a conductive trace 513 is created using known layering / patterning techniques , as would be apparent to one skilled in the relevant art ( s ), as shown in fig5 e . in addition to the steps outlined above , various heat treatments may be employed to cure , alloy , and / or repair ( i . e ., anneal ) the structure , as would be apparent to one skilled in the relevant art ( s ). as is well - known in the relevant art ( s ), heat treatments are operations in which a substrate ( e . g ., wafer ) is heated and cooled to achieve specific results . for example , ion implantation disrupts the crystal structure of a wafer ; a heat treatment can be used to repair ( or anneal ) the crystal structure of the wafer after ion implantation . an arrangement for reducing the parasitic capacitance between a conductive trace and a substrate has been disclosed . while various embodiments of the present invention have been described above , it should be understood that they have been presented by way of example only , and not limitation . it will be apparent to persons skilled in the relevant art that various changes in form and detail can be made therein without departing from the spirit and scope of the invention . thus , the breadth and scope of the present invention should not be limited by any of the hereinabove described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents . | 7 |
fig1 shows a backer board , 10 , holding 4 rows of media carriers , 12 a - 12 p , which are arranged in adjacency . it should be understood that the number of rows of media carriers could be greater or lesser in number . the same is true for the number of media carriers present in each row . the number of media carriers shown in fig1 is for illustrative purposes and does not constitute a limitation of the present disclosure . it will be observed that separation lines , 14 - 18 , are present on backer board 10 between each of the rows of media carriers to enable each row of media carriers to be separated and retained on sections of media carrier 22 . the top row of media carriers 12 a - 12 d and shown separated from the other media carriers in fig2 . additionally , media carrier 12 a is shown in an exploded view to show the various components of media carrier 12 a and the other media carriers in fig1 . an adhesive strip , 20 , on backer board 10 holds a media carrier sheet , 22 , in place . adhesive strip 20 could be adhesive material laid down on backer board 10 or it could be a piece of double - sided tape . another adhesive strip , 24 , holds a media , 26 , in place and affixed to media carrier sheet 22 . again , adhesive strip 24 could be adhesive material laid down on media carrier sheet 22 or a strip of double - sided tape . desirably , adhesive strip 20 is located directly below media 26 . adjacent to media 26 is yet a third strip of adhesive , 28 , located on media carrier sheet 22 and covered by a release strip , 30 . finally , a reinforcing tab , 32 , is located adjacent to media carrier sheet 22 . it will be observed that backer board 10 has a notch , 34 , for release strip 30 to extend into for facilitating its removal . each section of backer board 10 supporting a media carrier has a similar notch for the same purpose , as will be more fully explained below . backer board 10 could be made of , for example , polyester ( e . g ., polyester terephthalate or pet ), polycarbonate , and like materials . in fig3 , the printed instructions and ruled measurements are present . they were omitted in the earlier figures for description and understanding purposes . however , media carrier 22 and release strip 30 in fig3 are seen to have instructions for use . in particular , step 1 is printed on release strip 30 and is “ removal ”. release strip 30 extends into notch 34 for a person to easily grasp it for its removal . step 2 is seen on the right side of media carrier 22 and is “ fold ”. step 3 also is located on release strip 30 and is “ press ” to remind the user to press the right side of media carrier 22 onto adhesive strip 28 when media carrier 22 is folded for trapping the tissue specimen in place . located opposite step 2 is step 4 , which is “ cut ”, and indicates where media carrier 12 a is to be cut in half . suitable adhesives could be solvent based or water based ( hydrophilic ). they could be ultraviolet radiation ( uv ) cured . they could be , for example , a rubber or resin , an acrylic , a silicone , or like adhesive composition . various of the adhesive layers could discontinuous , strips on either side , and could contain gaps , holes , perforations , or other design to permit pass through of fluids . additionally , the adhesive could be biocompatible . it should be noted that media carrier 22 is transparent and may be made from filtration grade spun bonded polyester of about 0 . 0122 ″ ( about 0 . 03099 mm ) in thickness with a weight of about 2 . 1 oz / yd 2 ( about 71 . 2021 g / m 2 ). by being transparent , the user can read the instructions and measurement indicators even when it is folded in half . it will be observed further that tab 32 contains a sample number for unique identification of the tissue biopsy sample . measurement or geometric indicators indicate distal and proximal orientation of the tissue sample between each half and within each half of media carrier 22 . media 26 could be made from two different colored materials to distinguish between the distal half and the proximal half of the tissue biopsy half and such color may be transferred to the sample . such color could be premarked with tissue dye that is actuated by the processing using , for example , encapsulated colorant in the media . two different color dyes maybe used placed at the proximal end , distal end , and / or and at the middle of the media . media 26 can be sliced on a microtome without fragmentation and is easily sliced . media 26 retains the biopsy sample throughout fixation , tissue processing , embedding , slicing , staining , and cover slipping . moreover , it does not chemically harm the sample , does not interfere with viewing the tissue on a slide , and is permeable . media 26 could be made from needle - punched polyester about 0 . 050 inches ( about 1 . 27 millimeters ) in thickness and of about 3 . 5 oz / yd 2 ( about 118 . 67 g / m 2 ) in weight . media 26 also could be made from polypropylene , borosilicate , glass - based media , or other woven or non - woven polymers . its thickness could range from about 0 . 030 inches to about 0 . 160 inches ( from about 0 . 762 millimeters to about 4 . 064 millimeters ) with a weight range of from about 3 . 0 oz / yd 2 to about 12 . 0 oz / yd 2 ( from about 101 . 717 g / m 2 to about 406 . 869 g / m 2 ). media 26 also could be tinted , calendared or grooved to hold a biopsy sample . additionally , media 26 could be chemically modified , such as by oxidation or hydroxylation to improve biopsy sample retention . media carrier 22 also could be made from polyester , polypropylene , borosilicate , glass bead , and woven and non - woven polymers . it should be resistant to chemicals and can range in thickness from about 0 . 0045 inches to about 0 . 0209 inches ( from about 0 . 1143 millimeters to about 0 . 53086 millimeters ) and have a weigh range from about 0 . 4 oz / yd 2 to about 4 . 0 oz / yd 2 ( from about 13 . 5623 g / m 2 to about 135 . 623 g / m 2 ). media carrier 22 further could be chemically treated via oxidation with , for example , hydrogen peroxide , and subsequently washed to improve hydrophilic character . the medium additionally could be scored , ultrasonically or mechanically , to form a channel or ridge to assist the transfer and maintenance of the specimen geometry on the media . the medium could be formed of other polymers , as recited above , which other polymers have the characteristics of the cited polymers in regard to their mechanical and optical properties . the media could be pretreated with saline solution to assist in preserving specimen geometry after transfer . the carrier additionally could be printed with a numeric or alphanumeric code or multiple such codes . such codes could be human readable , machine readable , or both . one of such multiple codes could be removable and used to document the link between the carrier and the location from the biopsy specimen was taken . an rfid ( radio frequency identification ) tag could be placed on the carrier backer board . such tag could be embedded with additional information regarding the carrier and its use . returning to the drawings , in fig5 a biopsy sample , 36 , is placed onto media 26 for its retention . in fig6 , release strip 30 is pulled away . it will be observed that notch 34 enables the user to easily grasp release strip 30 . in fig7 , backer board 10 is folded in half to trap sample 36 . force arrows , 38 a - 38 c , show where the user should press to ensure that the top folded media carrier 22 is securely held to adhesive strip 28 . in fig9 , the user &# 39 ; s hand , 40 , grasps tab 32 so that media carrier 22 can be pulled away from backer board 10 . media carrier , then , is placed into a vial , 41 , of fixative solution ( e . g ., formalin ). in all steps , folded media carrier 22 securely holds the biopsy sample with no handling thereof . fig1 illustrates folded media carrier 22 with all of the lettering present . again the lettering was absent in the preceding figures so as to not distract from the steps being illustrated . in fig1 , user &# 39 ; s hands 40 and 42 hold folded media carrier 22 steady for cutting it in half along the “ cut ” line with a scalpel , 44 , or other cutting instrument . in fig1 , one of the cut media carrier halves , 22 a , is picked up with a pair of tweezers , 46 , or similar device for its placement into a cassette , 48 . the other media carrier half , 22 , similarly can be placed into a separate cassette . the media could be modified using various techniques to assist in the transfer of the biopsy specimen from the biopsy needle to the media by physically cutting or slicing of the media , forming a shape using ultrasonic , heat , or a laser . such shape could be a channel , l - shaped or l - stepped , grooved , offset groove , or other alteration . different media materials could be used in order to create a physical feature , such as , for example , a step , l - shape , or channel in the transfer of the biopsy specimen from the biopsy needle to the media . the unit of measure for the media is denier ( d ) and the media could range from about 1d to about 20d . the following materials have been effective in testing : superior felt style # 106100 pet 6 oz , 100 thick , 100 % 3d ; fig1 - 21 illustrate these features . in fig1 , a media , 50 , made of , for example , superior felt , supports a biopsy sample , 52 , atop thereof . in fig1 , a media , 54 , made of , for example , superior felt , has a square shape on one side into which a biopsy sample , 56 , is placed . in fig1 , a media , 58 , made of , for example , superior felt , has its right side lower than the left creating a land upon which a biopsy sample , 58 , rests . in fig1 , a media , 60 , made of , for example , superior felt , has a v - shaped groove on one side and into which a biopsy specimen , 62 , is placed . in fig1 , a media , 64 , made of , for example , superior felt , has an upstanding media , 66 , of greater height and made from the same or different material , with media 64 supporting a biopsy sample , 70 , adjacent to the higher media 68 . in fig1 , a media , 72 , made of , for example , superior felt , has a semi - circular depression on one side and into which is placed a biopsy specimen , 74 . in fig2 , a media , 76 , made of , for example , superior felt , has a deeper semi - circular depression ( different sloped sides ) on one side and into which is placed a biopsy specimen , 78 . in fig2 , a media , 80 , made of , for example , superior felt , has two uneven top - sloped top surfaces with a circular depression on the higher sloped top surfaced for supporting a biopsy sample , 82 . the skilled artisan will appreciate that additional designs and combinations of media materials could be used in additional to those illustrative designs in the drawings . the backer board additionally could contain a needle guide . a portion or section of the backer board could be die cut and formed at the proximal position of the carrier . the form could be shaped in various ways to guide the trajectory of the needle / cannula and specimen onto the media . shapes include , for example , linear , l - shaped , t - shaped , or radial . a current design is simply a slit in the backer board at the centerline of the media from the proximal edge of the backer board to the proximal edge of the media . a crease or score would be added laterally in the backer board at the proximal edge of the carrier . the user could select to manually fold up one side or the other creating a linear guide at the centerline of the media , depending on user preference . a fixture could be used to register the backer board and , as part of the fixture , provide fixed position needle guides at each position centered on the media at the proximal edge of the carrier . the needle guide could be made with various shapes . for a single position fixture needle guide , a fixture could be used to register the backer board and , as part of the fixture , provide fixed position needle guide . the backer board could be indexed so that the needle guide would be centered on the media at the proximal edge of the carrier . the needle guide could be made with various shapes . fig2 and 23 illustrate such fixture guides that could be used to locate the biopsy specimen . in particular in fig2 , a backer board , 84 , carries a media carrier , 86 , upon which a media , 88 rests . an alignment fixture , 90 , attached to backer board 84 has a trapezoidal cutout into which a biopsy needle can be placed to deposit a biopsy specimen , 92 , onto media 88 . the cutout shape could be square , rectangular , curvilinear , or the like . alignment fixture 90 could be affixed to backer board 84 with an adhesive , two - sided tape , or the like . the user inserts the biopsy needle through alignment fixture 90 and pushes the plunger while pulling the biopsy needle outwardly to deposit biopsy specimen 92 onto media 88 at a location determined by the placement of alignment fixture 90 . in fig2 , an alignment fixture , 96 , carries upstanding alignment segments , 98 a - 98 d . alignment fixture 96 has side arms with slots designed to receive backer board 84 . backer board 84 carries 4 media carries , only one of which is labeled for ease of illustration . each of the alignment segments mates with one of the media carriers . placement of a biopsy specimen proceeds as described in relation to fig2 . when all 4 of the media carriers have a biopsy specimen , the backer board is withdrawn so that another backer board can be inserted into alignment fixture 96 . it will be appreciated that the end row of media carriers on backer board 10 ( see fig1 ) could be inserted into a similar alignment fixture . the full row of media carriers can be broken off so that the next adjacent row can be fitted into the alignment fixture . in fig2 and 25 , a media carrier , 100 , supports a media , 102 , which in turn supports a sample , 104 . in this alternative embodiment , however , a removable strip , 106 , is made from a thick closed cell foam or similar material and acts as a guide to aid the user in placing specimen 104 onto media 102 . any adhesive layer disclosed herein could be perforated , as shown in fig2 for an adhesive layer , 108 . the perforations could be the same size , different sizes , and / or patterned . additionally , any adhesive layer disclosed herein could be discontinuous , as shown in fig2 for adhesive layers , 110 and 112 . such discontinuous adhesive layers could be provided in a variety of patterns also . referring now to the further embodiment in fig2 , the components are numbered according to fig5 . the difference here is that an adhesive layer , 114 , is used to atop media 26 to secure specimen 36 . in fig3 , media 26 has been eliminated so that specimen 36 is directed held by adhesive layer 114 onto media support 22 . additionally , a compliant open cell or non - fluid restricting material located between the adhesive and the backer board . compliance would ensure that the specimen would remain under a light compressive force once the media is folded over and secured . while the apparatus , system , and method have been described with reference to various embodiments , those skilled in the art will understand that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope and essence of the disclosure . in addition , many modifications may be made to adapt a particular situation or material in accordance with the teachings of the disclosure without departing from the essential scope thereof . therefore , it is intended that the disclosure not be limited to the particular embodiments disclosed , but that the disclosure will include all embodiments falling within the scope of the appended claims . in this application all units are in the metric system and all amounts and percentages are by weight , unless otherwise expressly indicated . also , all citations referred herein are expressly incorporated herein by reference . | 6 |
a communications cable 10 , according to the present invention is illustrated in fig1 . the cable 10 shown therein includes one or more optical fibers 12 which are designed for transmitting optical energy in the form of optically encoded information or signals therethrough . these optical fibers 12 are typical of those which are presently commercially available from a variety of sources . during the fiber manufacturing process such fibers 12are typically coated with a low modulus elastomer 14 such as rtv silicone , or the like , such that the low modulus elastomer 14 surrounds and is in substantially continuous contact with the exterior of the fiber 12 . this low modulus elastomer 14 is sufficiently pliable to protect the fiber 12 from the introduction of stree due to contact by the fiber 12 with any surface imperfections within the fiber processing equipment or as a result of invading dust particles or other contaminants present within the manufacturing process . the low modulus elastomer 14 can be applied to the optical fiber 12 by a variety of means , such as pulling the fiber 12 through a pool of liquid rtv . the elastomer 14 is then typically cured by heating it with an in - line furnace . a thin protective layer 16 is then extruded around the fiber 12 and the low modulus elastomer 14 , such that the protective layer 16 is in substantially continuous contact with the low modulus elastomer 14 . this protective layer 16 provides longitudinal stiffness to the fiber 12 , thereby tending to protect the fiber 12 from any bending stress which results from the remainder of the manufacturing process . the protective layer 16 is formed from a higher modulus material such as nylon , teflon , hytrel , or the like . the layer 16 and the low modulus material 14 are chosen to be chemically compatible , such that no interbonding or chemical degradation occurs as a result of their interaction . the fiber 12 with the low modulus material 14 and the protective layer 16 thereon is generally referred to as a buffered fiber 17 . an example of such a buffered fiber 17 is as follows : an rtv silicone such as dow corning sylgard 184 is applied to a fiber 12 having a typical outside diameter of 125 microns . the coated silicone fiber has a typical outer diameter of 250 microns . the rtv coated fiber is then further coated with a teflon pfa , such as that available from dupont . the teflon coated fiber has a typical outer diameter of 500 microns . fig1 shows three of these buffered fibers 17 oriented in a centrally located geometric configuration within the cable 10 . the number of fibers 17 utilized is dependent upon the amount of information which needs to be transmitted through the cable 10 and in no way should the number of fibers shown in the figures or described herein be considered a limitation on the present invention . the cable 10 illustrated in fig1 also includes a protective jacket 18 which is extruded around the geometric configuration formed by the buffered fibers 17 . this protective jacket 18 substantially occupies all the interstitial space between and around the individual buffered fibers 17 . the material forming the protective jacket 18 is chosen to have a high flexural modulus of elasticity typically greater than 1 × 10 5 psi at 72 ° f . this value of modulus provides a stiffness to the cable 10 that further minimizes the stress applied to the buffered fibers 17 as a result of bending . in the preferred embodiment the protective jacket 18 is formed from a flurocarbon , known as tefzel etfe , which is commercially available from dupont . the material forming the jacket 18 is chosen to have a melt temperature which does not damage or cause bonding with the outer buffer 16 of the fiber 12 during the extrusion process . standard extruding techniques are used to incorporate the fibers 12 within the protective jacket 18 . care , however , is taken during the extrusion process to minimize the lay angle of the fibers 12 with respect to the longitudinal axis of the cable 10 in order to avoid transmission losses due to macrobending . this lay angle is less than 30 ° and preferably very close to 0 °. care is also taken to ensure that the fibers 17 as encapsulated within the protective jacket 18 are in a balanced geometric configuration with respect to the axis of the cable 10 . the buffered fibers 17 are also as close to the axis as is possible while still maintaining a separation between the buffered fibers 17 within the protective jacket 18 . the cable 10 as thus far described offers substantial protection to the fibers 12 for a large percentage of the applications in which the cable 10 can be applied . it is however often desirable to add further protection to the cable 10 to allow the cables to operate under conditions of ever higher pressure and temperature . for example , cushioning means 20 can be added around the protective jacket 18 . the material forming the cushion means 20 ( see fig2 ) is chosen to be readily extrudable with standard extrusion techniques , and such that it is soft enough when cured to protect the buffered fiber 17 from laterally applied stress . as a typical example , the cushioning means can be formulated from neoprene . neoprene also has the advantage that it can be formulated to be slightly semi - conductive . this is particularly important when the presence of electrical conductors 22 is desired within the cable in addition to the fiber optic means 17 . such conductors 22 are illustrated in fig2 . in the preferred embodiment the conductors 22 are made of copper wire having a sufficient diameter for the current carrying capacity required by the particular application . the conductors 22 are typically insulated from the semi - conductive neoprene cushioning means 20 by a teflon outer insulation 23 . in order to avoid a breaking or kinking of the conductors 22 as a result of varying tensile stress on the cable 10 , the conductors are typically helically wound around the protective jecket 18 . this wrapping of the conductors 22 is done with cable - making techniques such as are described in u . s . pat . no . 3 , 106 , 815 , which description is incorporated herein by reference . typically a first layer 20a of neoprene is extruded over the protective jacket 18 prior to wrapping the conductors 22 around the jacket 18 . this layer 20a of neoprene protects the buffered fibers 17 from the application of lateral stress during the wrapping of the conductors 22 . the neoprene layer 20a also partially extrudes between the various wraps of the conductors 22 as these conductors 22 are being wrapped around and forced into the neoprene layer 20a . since neoprene can be made semi - conductive as has already been discussed , it provides electrical shielding between the conductors 22 and thus reduces the effect of conductor cross - talk . a second layer 20b of neoprene is then extruded over the conductors 22 , and the cable 10 is then heat cured such that this outer layer 20b of neoprene reaches a hardness in the range of from 73 to 77 shore a . the typical outer diameter of the outer neoprene layer 20b is approximately 0 . 75 cm . with this hardness and thickness and neoprene provides a further cushion for the fiber 12 from the application of lateral stress . finally it is often desirable to armor the cable 10 . the armoring 24 not only adds to the breaking strength of the cable 10 but it provides further protection for the fiber 12 against lateral stress . the armoring 24 has an annular configuration in cross - section and typically comprises one or more strands 26a , b , c , etc . of a material having a breaking strain of less than 3 %, which strands are formed into an annular helix ( i . e ., contrahelical armors or braids ) surrounding the buffered fibers 17 , protective material 18 , and the cushioning means 20 . the technique of forming these strands into a helix is similar to that set forth in u . s . pat . no . 3 , 106 , 815 , the content of which has already been incorporated herein by reference . this configuration for the armoring 24 has the effect of translating any tensile stress applied on the cable 10 into radial compression of the annulus . this compression as well as the compression due to any other unbalanced radial forces is transferred to the high modulus protective jacket 18 . since the optical fibers 12 are centrally located proximate to the longitudinal axis of the cable 10 and in a geometrically balanced configuration within the high modulus protective jacket 18 , the effect of these unbalanced radial forces is minimized . since the protective jacket 18 also fills the voids and interstitial spaces within the cable 10 , the cable 10 is made more incompressible thus further limiting the strain which is applied on the fibers 12 or the buffered fibers 17 . in the embodiment shown the armoring 24 includes two layers of strands . this is to provide some torque balance and to ensure that the armoring 24 substantially resists compression and thus further protects against any transmission losses due to macrobending or microbending . typically the inner layer of such a dual layer armoring 24 is formed with an armor wire that has a slightly smaller diameter than the outer armor wire . this construction is again discussed in u . s . pat . no . 3 , 106 , 815 . having thus described the present invention , it will be understood that changes may be made in the size , shape or configuration of some of the parts described herein without departing from the present invention as recited in the appended claims . | 6 |
having reference to fig1 and 8 a , the present invention comprises a personal steam cabinet 10 , its method of manufacture and a portable steam generator 11 for use therewith . the cabinet 10 comprises three parts : a base tub 12 , a liner tub 13 , and a lid 14 . the concave liner tub 13 forms a steam enclosure 15 . the topside of the liner tub comprises a generally w - shaped lounger portion 16 , which is body - contour formed and slightly reclining to comfortably support a person or user sitting therein . accordingly , the lounger has a foot 17 , a seat 18 , a back 19 and side walls 20 . referring to fig3 a and 3 b , the concave base tub 12 has a substantially rectangular footprint and forms a cavity into which auxiliary equipment is fitted and into which the liner tub 13 is installed for forming a base assembly 21 . the lid 14 has a foot 22 and a head 29 and is pivotally connected or hinged at its foot to the base assembly . a cutout 38 is provided at the head 29 of the lid for passing the user &# 39 ; s neck and head . the assembled base assembly has a lip or periphery 23 rising diagonally from a foot to a head . the cabinet 10 is provided with a steam inlet 30 and an electrical supply 31 . referring to fig4 the cabinet &# 39 ; s multi - piece construction permits the installation of various steam - sensitive enhancements within the protected portions , yet still maintain and low maintenance surfaces . the lid 14 is designed with a foot hinge system and thus offset weight bearing and its associated structural problems are eliminated . the hinge 24 ( not detailed ) is secured to the foot 17 of the base assembly 21 and to the foot 22 of the lid 14 . the lid 14 has a periphery 23 b and is formed with an overlapping lip 25 , which forces the lid to self - center in relation to the periphery 23 of the base assembly . gravity helps the lid &# 39 ; s periphery 23 b seal on the entire periphery 23 . the lid 14 is formed of abs ( acrylonitrile butadiene styrene ) and thereby avoids the urea emission problems . a v - shaped groove 26 is formed in the lid 14 to provide additional structural integrity to the otherwise unreinforced lid . the lid 14 remains as unreinforced abs so that it is easily cleaned . turning to fig5 a and 5 b , an internal drip lip 27 is attached to the inside of the lid 14 and offset inwards from most of its periphery 23 b . the drip lip 27 forces condensation to be directed internally to the base assembly &# 39 ; s periphery 23 and to collect in the bottom or foot 17 of the cabinet 10 allowing for easy clean up rather than drip outside on the floor or carpet . the drip lip 27 also minimizes opportunity for direct steam escape as it serves to direct most of the steam past the seal and back into the environment . small hydraulic rams 28 control opening and closing of the lid 14 , restricting the maximal range of opening to a vertical position and also to prevent lid - slamming incidents . the base assembly 21 further solves several of the problems associated with the prior art cabinets . referring to fig6 and 7 , the liner tub 13 is also formed primarily of abs and thereby avoids the urea emission problems . however , in achieving a balance between strength and weight , the typically 6 mm inch thick abs itself is generally not strong enough to rigidly support a person under operating conditions . accordingly , the lounger portion 13 of the liner tub 13 requires reinforcement 33 , such reinforcement being applied to the underside of the abs lounger portion 16 . a suitable reinforcing material can be fiberglass , as its position on the underside of the abs is protected from the hot steam environment . the reinforcement 33 is applied to the underside of the lounger portion to : the small of the back area 19 , the seat area 18 and under the raised foot portion 17 . typically , about 6 mm of fiberglass is added as reinforcement . the inside of the abs base tub 12 is similarly reinforced with fiberglass , providing a strong structure and yet a durable abs finish on the outside ( not detailed .) the topside of the lounger portion 16 is an ergonomically designed seat allowing for the most relaxed sitting position . while prior art cabinets have the user sitting bolt upright on bench - style chair , the lounger portion 18 seat area is designed to allow maximum relation for stress relief . if the user falls asleep , his or her head lies gently against the back 19 of the lounger portion rather than snapping forward . armrests 34 are formed into the side walls 20 so that user with back or hip problems can support and align themselves . a raised foot grid 35 of ribs at the foot 17 of the lounger portion 16 lifts the user &# 39 ; s feet off of base assembly 21 where condensation collects and allows a warm circulating environment under the feet ( see fig8 b ). once the reinforcement to the lounger portion 16 and base tub 12 are applied , the liner tub 13 could be inserted into the base tub 12 , however , there are additional enhancements associated with the liner tub 13 before it is so assembled . in the prior art cabinets , generated steam rises from a pan boiler or is blown out a nozzle with no care for uniformity in cabinet temperature . as the steam heat rises it is common in prior art cabinets for head and chest temperature to be up to 20 degrees f . hotter than the foot temperature . to ensure proper circulation of the steam provides uniform temperature throughout the cabinet , recirculation fans are provided . one or more u - conduits 40 are installed to the lounger portion 16 for drawing in steam environment from the steam enclosure 15 at one location 40 a along the lounger portion 16 and ejecting it at another location 40 b . to provide steam movement in the cabinet 10 is usually sufficient , however , an up to down recirculation is preferred . two low voltage fans 41 are placed in - line in the u - conduits 40 for circulating steam and evening - out the temperature in the steam enclosure 15 . through active recirculation of the steam , the user is able to withstand more intense steam , will not get cold feet and the potential for hotspots is reduced . referring to fig6 , 7 , 8 a and 8 b , hot steam is conducted from the steam inlet 30 located anywhere in the base tub 12 and is directed through a steam connection or external steam conduit 42 b to the foot 17 of the base tub 12 . an internal steam conduit 42 a within the base tub conducts steam to a steam conducting hollow structure or horn 44 . the horn 44 projects upwardly and is located between the user &# 39 ; s feet . the horn 44 is fitted with a plurality of steam outlets 45 for directing the steam forwards , away from the user &# 39 ; s feet and towards the foot 22 of the lid 14 . the steam is deflected back from the lid 14 into the enclosure 15 and can move laterally and upwardly from the lid and thus be diluted in the steam environment , lessening any hot spots before contacting the user . a temperature probe 46 is provided further in the enclosure , which is tied into a safety interlock with the steam supply . once each of the steam conduit 42 to the horn 44 , the u - conduit 40 and fans 41 , and the temperature probe 46 are installed into the liner 13 and base tubs 12 they are assembled together to form the base assembly 21 . the liner tub 13 has a peripheral edge 23 a that is matched to the peripheral edge 23 c of the base tub 12 . the liner tub &# 39 ; s 13 peripheral edge 23 a overlaps the base tub &# 39 ; s peripheral edge 23 c . once assembled the liner 13 and base tubs 12 are foamed together with foamed - in - place insulation through a suitable access port formed through the base tub . the foam insulates , covers and fixes the steam conduit 42 and fan 41 , temperature probe 46 and control wiring in place . a bead of sealant , such as silicone , is run about the interface of the two peripheral edges 23 a , 23 c . once assembled , a stainless steel hinge 24 is riveted to the lid 14 and to the foot 17 of the base assembly 21 . a common problem with all portable steam generating systems is that in order to achieve a desirable 30 - minute steam experience , it generally takes 7 - 12 minutes for pre - heating . this preheat time is a function of the large water volume that must be raised from room temperature to steam - generating temperature through the use of electrical heating elements . in addition to the perceived deterrent to use because of the extra inconvenience the preheat causes , this delay also causes significant downtime when used in a commercial application . faster heat time of this large volume of water is not achievable within the constraints put on heater size by a standard 110v , 15a electrical circuit . accordingly , and having reference to fig8 a , 9 and 10 , a new portable steam generator 11 is provided utilizing a new boiler 50 which reduces pre - heat time to approximately 3 minutes in two ways . first , the design of the v - shaped boiler 50 design minimizes the amount of water required to submerge heating element 51 positioned in the narrow bottom or apex 52 . a minimum level 53 of water is maintained in the boiler 50 which just covers the heating element 51 . accordingly , the volume of water required to cover the element 51 is significantly reduced over the prior art boilers holding an entire water supply . a further 22 % reduction in volume is achieved using the v - shape compared to a rectangular design prior art boiler . secondly , a water reservoir 55 operates as part of a vacuum trickle drip system which feeds water slowly to the heater 50 only as it evaporates . this means that the maximum water level is also close to the minimum water level 53 throughout the steam cycle . prior art portable , non - plumbed steamers utilize a one - time fill , which has the water level starting out much higher than at the end of the reservoir capacity . the trickle drip system allows a user to fill or provide a commercial bottled water feed reservoir 55 suitable for multiple steam applications , allows the user to visibly see when refill is required , makes the refill process easy , and keeps the water level as an optimal minimum level 53 at all times . further , by keeping the water level at the minimum level 53 it helps minimize preheat time . additionally , the trickle system keeps the water level in the boiler constant , which in turn keeps the steam temperature constant . as shown in fig8 a , the cabinet 10 is connected to the portable steam generator 11 . a steam conduit 42 b extends from the steam generator 11 to the cabinet &# 39 ; s steam inlet 30 . further , a low - voltage control line 39 extending from the steam generator 11 and cabinet 10 conducts power to the recirculation fan 40 , or fans , and the signal back from the temperature probe 46 to the steam generator 11 . the water bottle reservoir 55 is shown in place over the steam generator 11 . referring again to fig9 the trickle system comprises the v - shaped boiler 50 , the water reservoir 55 and a dish 56 forming a water pool 57 . the boiler &# 39 ; s v - shaped apex 52 , or constricted volume of the boiler 50 , minimizes the volume and mass of water which must be heated to form steam . the electric immersion heater 51 is positioned low the apex 52 . the water reservoir 55 has a neck portion 58 is shown projecting into the pool 57 . water is gravity fed from the water reservoir 55 into the pool 57 . water replenishes the pool 57 as soon as the water level 53 drops sufficiently to break the vacuum in the reservoir 55 and allow air back in . in this way the level 53 in the pool 57 is closely controlled , regardless of the water level 59 in the reservoir 55 . the water pool 57 is conducted through a conduit 60 to the boiler 50 . the water level in the pool 57 is maintained at the minimum water level 53 in the boiler 50 . turning to fig1 , a 110 v , 15a line 70 is fed to power distribution and control module ( dsta ) 71 . an over temperature power cutout 72 ( 190 - 200 ° f .) interrupts the power to the dsta 71 in over - temp situations . the dsta 71 monitors the temperature probe 46 from the cabinets , accepts programming control ( such as time and temperature set points ) from a control panel 73 and outputs various characteristics , including temperature to a control panel display . the dsta 71 controls the boiler &# 39 ; s heater 51 powered by a 5500 w electric element . the boiler 50 further comprises a boiler fan 74 , which draws fresh air through an air intake conduit 75 , and forces generated steam in the freeboard area 78 through at outlet conduit 76 and steam connection 42 b to the cabinet 10 . a 110v ac to 4 . 5v dc ( or 12v — depending on the fans ) power supply 77 is provided which operates the boiler fan 74 and also powers the steam recirculation fans 40 through the cabinet control line 39 . | 0 |
referring now to the drawings , particularly to fig1 and 2 , the preferred embodiment of a semiconductor wafers transferring device 30 according to the present invention generally comprises a pair of holder walls 1 r and 1 l having mutually opposing faces . the holder walls 1 r and 1 l are vertically suspended from a wafer transferring machine ( not shown ) by means of supporting strips 2 . the holder walls 1 r and 1 l are identical but arranged in mirror symmetry with respect to each other . the holder walls 1 r and 1 l have lower sections 4 of greater thickness than the upper section at which they are attached to the supporting strips 2 . the lower sections 4 respectively include mutually opposing , inwardly curving surfaces 5 merging toward each other at the lowermost portion of the device 30 . the surfaces 5 of the lower sections 4 have a slightly smaller radius of curvature than the disc - shaped semiconductor wafers 6 . a plurality of parallel retention grooves 7a and 7b are formed along each of the surfaces 5 . these retention grooves are designed to receive and hold the peripheral edges of the semiconductor wafers 6 . the floors 8a and 8b of the retention grooves 7a and 7b have essentially the same curvature as the semiconductor wafers . the floors 8a and 8b of the retention grooves 7a and 7b are staggered across the surfaces 5 at different depths , as shown in fig4 . for instance , in the shown embodiment , 25 grooves are formed on each surface 5 and the odd - numbered grooves 7a are all shallower than the even - numbered grooves 7b . with this construction , the semiconductor wafers in the odd - numbered grooves 7a ride higher than those in the even - numbered grooves 7b . the supporting strips 2 are movable toward and away from each other in the direction of the arrows a so as to shift the holder walls 1 r and 1 l between a wafer retention position , in which the distance between the holder walls 1 l and 1 r is minimized , and a release position , in which the distance between the holder walls 1 l and 1 r is expanded , so that the semiconductor wafers held between the holder walls 1 l and 1 r while the holder walls are in the wafer retention position can be released . this semiconductor wafer transferring device 30 is used to transfer a plurality of semiconductor wafers between a wafer cassette 10 and a wafer boat 20 , shown in fig3 construction of which is known per se and not essential to the present invention . therefore , the structures of the wafer cassette 10 and the wafer boat 20 will be described below only with regard to the operation of the preferred embodiment of the semiconductor wafer transferring device according to the present invention , with reference to fig1 - 3 . as set forth , the semiconductor wafers 6 are held in the wafer cassette 10 before diffusion treatment , cvd treatment and so forth . in this case , the peripheral edges of the semiconductor wafers 6 engage the retention grooves 12 in the opposing faces of vertical holder walls 14 of the wafer cassette 10 . when the semiconductor wafers 6 are to be removed from the wafer cassette 10 , a pusher plate 16 moves upwards in the direction of the arrow b to push the semiconductor wafers upward . during this upward movement of the semiconductor wafers 6 along the retention grooves 12 , the support strips 2 of the semiconductor wafers transferring device hold the holder walls 1 r and 1 l at their spaced or release positions . the semiconductor wafers 6 are pushed upwards until most of their surface projects above the upper face of the wafer cassette 10 . thereafter , during further movement of the pusher plate 16 , the supporting strips 2 move to the wafer retention position to grip the semiconductor wafers while keeping the holder walls 1 r and 1 l in alignment with the retention grooves 12 and the edge of the corresponding semiconductor wafers 6 . the holder walls 1 r and 1 l , now gripping the semiconductor wafers 6 in the wafer retention position , shift to a position above the wafer boat 20 . at this position , the supporting strips 2 gradually separate by movement apart in the direction of the arrows a . the gradual expansion of the distance between the holder walls 1 r and 1 l gently releases the semiconductor wafers 6 from the wafer transferring device 30 to the wafer boat 20 . at this time , first , the semiconductor wafers 6 in the retention grooves 7a are first released from the holder walls 1 r and 1 l and drop onto the wafer boat 20 . thereafter , the semiconductor wafers in the deeper grooves 7b are released from the holder walls . the semiconductor wafers 6 dropped onto the wafer boat 20 respectively slip into associated retention grooves 22 in the holder bars 24 of the wafer boat 20 . as will be appreciated herefrom , the semiconductor wafers to be transferred are separated into two groups or sets which drop onto the wafer boat at two different times . this reduces the impact sustained when the semiconductor wafers are dropped onto the wafer boat by approximately one - half of that due to conventional devices . this significantly reduces the possibility of chipping of the wafer boat 20 and / or the edges of the semiconductor wafers 6 . on the other hand , when the semiconductor wafers 6 held in the wafer boat 20 are to be transferred to the wafer cassette 10 , first the holder walls 1 r and 1 l are moved to the spaced or release position in the direction of the arrows a . once the retention grooves 7a and 7b are in alignment with the semiconductor wafers 6 , the holder walls 1 r and 1 l are shifted toward each other to the retention position . during this movement , first , the edges of the semiconductor wafers 6 come into contact with the floors of the shallower grooves 7a and thus are released from the wafer boat 20 . shortly thereafter , the edges of the semiconductor wafers 6 corresponding to the deeper retention grooves 7b come into contact with the floors of those deeper retention grooves . thus , after a slight time lag , the semiconductor wafers to be held by the retention grooves 7b are released from the retention grooves 22 . this makes it easier to pick up the semiconductor wafers 6 from the cassette boat 20 and reduces the possibility of lifting the wafer boat 20 along with the wafers 6 . although a specific structure of the preferred embodiment of the semiconductor wafer transferring device has been disclosed above , the present invention is not necessarily limited to the shown embodiment . for example , in order to diversify the pick - up timing and drop timing , it is necessary to have retention grooves 7a and 7b of different depths on both of the holder walls 1 r and 1 l . in an alternative embodiment , the retention grooves 7c of one of the holder walls 1 r and l l can all have the same depth 8c as shown in fig5 . in this case , the other holder wall 1 r or 1 l will have two sets of retention grooves 7a and 7b of different depths as set out above . with this arrangement , the semiconductor wafer pick - up timing and drop timing can be staggered in substantially the same manner as in the preferred embodiment . if necessary , the pick - up timing and drop timing of a plurality of semiconductor wafers can be staggered into three groups or more . if it is desired to pick - up and drop semiconductor wafers at three different timings , at least one of the holder walls should be provided with three groups of retention grooves of three different depths . while the present invention has been disclosed in terms of the preferred embodiment in order to facilitate a better understanding of the invention , it should be appreciated that the invention can be embodied in various ways without departing from the principle of the invention . therefore , the invention should be understood to include all possible embodiments and modifications to the shown embodiments which can be embodied without departing from the principles of the invention set out in the appended claims . | 8 |
the following description is merely exemplary in nature and is not intended to limit the present disclosure , application , or uses . it should be understood that throughout the drawings , corresponding reference numerals indicate like or corresponding parts and features . as used herein , the term module refers to an application specific integrated circuit ( asic ), an electronic circuit , a processor ( shared , dedicated , or group ) and memory that executes one or more software or firmware programs , a combinational logic circuit , and / or other suitable components that provide the described functionality . referring to fig1 , a vehicle 10 includes an engine 12 that drives a transmission 14 . air flows into the engine 12 through a throttle 16 . fuel is combined with the air to be combusted within cylinders 18 . the combustion process reciprocally drives pistons ( not shown ) within the cylinders 18 . the pistons rotatably drive a crankshaft 22 to produce drive torque . the engine 12 includes n cylinders 18 . although fig1 depicts four cylinders ( n = 4 ), it is appreciated that the engine 12 may include additional or fewer cylinders 18 . for example , engines having 4 , 5 , 6 , 8 , 10 , 12 and 16 cylinders are contemplated . torque from the engine 12 is supplied to the transmission 14 through a torque converter ( tc ) 24 . the torque converter 24 may be any known lockup converter including a turbine , a stator , and a torque converter clutch ( tcc ). the transmission 14 multiplies the drive torque generated by the engine 12 through one of a plurality of gear ratios to drive a vehicle driveline 26 . the transmission 14 includes a hydraulic pump 28 that regulates pressurized fluid within the transmission 14 and controls fluid flow to and from the tc 24 via at least one solenoid - operated valve 30 . an engine speed sensor 38 generates an engine speed signal based on a rotational speed of the crankshaft 22 . a turbine speed sensor 40 generates a turbine speed signal based on a rotational speed of the turbine within the torque converter 24 . the control module receives the signals and commands a current and / or pulse width modulated signal to the solenoid 30 in order to vary the supply of pressurized fluid to the torque converter 24 . the control module 32 controls a slip rate of the tc 24 by varying the pressurized fluid . a vehicle operator manipulates an accelerator pedal 34 to regulate the throttle 16 . a pedal position sensor 36 senses the position of the accelerator pedal 34 and generates a pedal position signal that is communicated to the control module 32 . the control module 32 generates a throttle control signal based on the pedal position signal . a throttle actuator ( not shown ) adjusts the throttle 16 based on the throttle control signal to regulate air flow into the engine 12 . such method of controlling the throttle 16 is referred to as electronic throttle control ( etc ). the control module 32 adjusts fuel quantity and generates a fuel signal to the engine 12 based on the air flow . when the pedal position signal indicates that the pedal 34 has been released and the vehicle is operating in a coast mode , the control module 32 communicates with the engine 12 and various sensors and actuators to control the activation of a deceleration fuel cutoff ( dfco ) mode . in order to smooth the transition into the dfco mode , the control module 32 controls the throttle 16 based on engine speed , turbine speed , and a turbine offset matching method and system according to the present disclosure . more particularly , the control module 32 determines when the dfco mode is desired and controls the throttle 16 and fuel such that the engine speed is equal to the turbine speed plus a predetermined offset . controlling the engine speed to be within a predetermined range of the turbine speed allows for the torque converter clutch to be applied . once the torque converter clutch is applied , the dfco mode is enabled thereby disabling fuel to the engine 12 . thereafter , the transmission 14 backdrives the unfueled engine 12 through the torque converter 24 to maintain a default engine speed . referring to fig2 , a dataflow diagram illustrates various embodiments of a turbine offset matching system that may be embedded within the control module 32 . various embodiments of turbine offset matching systems according to the present disclosure may include any number of sub - modules embedded within the control module 32 . the sub - modules shown may be combined and / or further partitioned to similarly control the engine during activation of the dfco mode . inputs to the system may be sensed from the vehicle 10 , received from other control modules ( not shown ) within the vehicle 10 , and / or determined from other sub - modules within the control module 32 . in various embodiments , the control module 32 of fig2 includes a dfco enable module 50 and an engine speed control module 52 . the dfco enable module 50 receives as input the accelerator pedal position 54 . based on the accelerator pedal position 54 , the dfco enable module 50 selectively sets a dfco enable flag 56 . the dfco enable flag 56 is set to true when the accelerator pedal position 54 indicates that an accelerator pedal tip - out has occurred ( e . g ., the operator has released the pedal 34 ( fig1 )). otherwise the dfco enable flag 56 remains set to false . the engine speed control module 52 receives as input the dfco enable flag 56 , engine speed 58 , turbine speed 60 , and gear 62 . when the dfco enable flag 56 is true , the engine speed control module 52 controls a desired engine speed to be nearly the same as the turbine speed . in various embodiments the desired engine speed is controlled to be near the turbine speed plus a predetermined offset . more particularly , the engine control module 52 controls the throttle 16 ( fig1 ) via a throttle control signal 64 as a function of gear 62 and engine speed 58 such that the desired engine speed is achieved . the throttle 16 is controlled for a predetermine time period . once the time period expires , the desired engine speed is gradually adjusted back to a default value and the throttle is controlled via the throttle control signal 64 accordingly . referring now to fig3 , a method of turbine offset matching for deceleration fuel cutoff is shown . the method can be run continually during engine operation . dfco enable conditions are evaluated at 100 . if the dfco mode is desired at 100 , control evaluates a timer at 102 . if a time since accelerator pedal tip - out has not expired at 102 , engine speed is controlled via the etc at 104 . more particularly , the throttle is controlled based on gear and current engine speed such that the ultimate engine speed is near the turbine speed plus a predetermined offset ( e . g ., 100 rpm ). control continues to control the engine speed via the throttle at 104 until the timer expires at 102 . when the timer expires at 102 , the throttle is controlled back to a default value at 106 . those skilled in the art can now appreciate from the foregoing description that the broad teachings of the present disclosure can be implemented in a variety of forms . therefore , while this disclosure has been described in connection with particular examples thereof , the true scope of the disclosure should not be so limited since other modifications will become apparent to the skilled practitioner upon a study of the drawings , specification , and the following claims . | 5 |
this invention is described in a preferred embodiment in the following description with reference to the drawings . while this invention is described in terms of the best mode for achieving this invention &# 39 ; s objectives , it will be appreciated by those skilled in the art that variations may be accomplished in view of these teachings without deviating from the spirit or scope of the invention . this description is made for the purpose of illustrating the general principles of the invention and should not be taken in a limiting sense . the scope of the invention is best determined by reference to the appended claims . an opto - mechanical micromachined switch is described in u . s . patent application ser . no . 09 / 366 , 428 filed aug . 2 , 1999 , assigned to integrated micromachines , inc ., the assignee of the present invention . that application is fully incorporated by reference herein . an opto - mechanical micro - switch , according to one embodiment of the present invention , comprises a micromachined structure that is formed from a monocrystalline silicon substrate . referring now to fig1 there is shown a perspective view of the overall assembly of such micromachined structure 100 , which is formed from a monocrystalline silicon substrate 110 having an upper surface 112 that lies in the { 100 } plane of monocrystalline silicon substrate 110 . the single crystal structure of monocrystalline silicon substrate 110 is recommended because it provides mechanical advantages , such as superior stiffness , durability , fatigue and deformation characteristics . in addition , monocrystalline silicon substrates are relatively inexpensive and readily available . further , batch fabrication techniques using monocrystalline silicon are well established . monocrystalline silicon substrate 110 can be economically micromachined to form relatively defect - free micromachined structure 100 . in other embodiments , substrate 110 may be formed using other materials . micromachined structure 100 includes an outer frame 120 and an inner frame 130 . inner frame 130 is pivotally connected to outer frame 120 by beams 40 . a controller 99 is configured to apply an external force to rotate the inner frame 130 about beams 40 . inner frame 130 has outward - facing flat surface 138 . as described below , outward - facing flat surface 138 is utilized as a light reflecting / blocking surface that either reflects an incident light beam ( i . e ., when a light reflecting ( mirror ) material is deposited on the surface 138 ), or blocks the incident light beam ( e . g ., when the surface 138 is partially or fully opaque ). fig2 is a plan view showing an opto - mechanical micro - switch 300 incorporating the micromachined structure 100 ( shown in fig1 ) and the relationship to light source and sensors in accordance with one embodiment of the present invention . in fig2 the opto - mechanical micro - switch 300 includes a light source 14 , a first light receiver 15 , a second light receiver 16 , and micromachined structure 100 , which is located adjacent to light source 14 and light receivers 15 and 16 . as indicated above , micromachined structure 100 includes an outer frame 120 and an inner frame 130 that is surrounded by and pivotally connected to the outer frame 120 . inner frame 130 includes an outward - facing flat surface 138 that is used to selectively reflect a light beam 18 from light source 14 to first light receiver 15 . in the embodiment shown , the planar size of the inner frame 130 is on the order of 2 mm × 2 mm . although a single opto - mechanical micro - switch 300 is shown in fig2 the methods and structure of the present invention may be utilized to produce a multi - switch device including an array of multiple micromachined structures 100 formed on a single substrate . because micromachined structure 100 is formed using a batch process , multiple interacting micro - switches may be formed during the same fabrication process , thereby providing alignment of multiple mirror surfaces to produce a multi - switch arrangement . in addition , to manufacture the micromachined structure 100 and the micro - switch 300 , etch - stop diffusion , silicon nitride deposition , permalloy formation , anisotropic etching , frame separation , metallization can be performed using the manufacturing techniques disclosed in u . s . patent application ser . no . 09 / 366 , 428 filed aug . 2 , 1999 , assigned to integrated micromachines , inc ., the assignee of the present invention . one aspect of the present invention is shown in fig3 - 5 . fig3 is a sectional view , taken along line 3 — 3 in fig2 and 4 , of opto - mechanical micro - switch incorporating an embodiment of the present invention . in fig3 the micro - switch is in its “ switch off ” position . the { 100 } plane of monocrystalline silicon substrate 110 defines upper surface 112 . the { 111 } plane of monocrystalline silicon substrate 110 defines the outward - facing flat surface 138 of the inner frame 130 . as is characteristic of a single silicon crystal , the { 100 } plane ( indicated as horizontal plane p 100 ) intersects the { 111 } plane ( indicated as plane p 111 ) at an angle α equal to 54 . 7 °. the monocrystalline silicon substrate is formed such that the upper and lower surfaces lie in { 100 } planes of the substrate . the anisotropic etchant stops at the { 111 } plane of the monocrystalline silicon substrate , thereby producing the flat wall at a known angle relative to the upper and lower surfaces of the substrate . in the koh etching process , a notch 23 is formed by etching along the { 111 } crystal plane of the silicon substrate layer 24 so that it can be aligned with the etched { 111 } plane of the substrate 110 above it . the notch 23 is a recess that allows the layer of substrate 110 to align accurately onto the layer of substrate 24 . the angle of the koh etched plane is about 54 . 7 ° to the { 100 } plane of the substrate 24 . when the inner frame 130 is rotated a predetermined amount relative to the outer frame 120 , the outward - facing flat surface 138 is rotated into a raised position to selectively obstruct or reflect light passing from the light source 14 to the light receiver 15 / 16 of the opto - mechanical micro - switch 300 . this is known as the “ switch - on ” position and is shown in fig8 . in accordance with one embodiment of the present invention , the method of operating the micro - switch is provided below . actuation of micromachined structure 100 in the opto - mechanical micro - switch 300 arrangement requires the application of a force ( e . g ., electromagnetic ) to inner frame 130 that causes pivoting or rotation of inner frame 130 relative to outer frame 120 around beam 40 ( see fig4 and 5 ) about the axis of rotation 42 . inner frame 130 is selectively pivoted into a position in which the plane of the light reflecting / blocking , outward facing flat surface 138 is perpendicular to upper surface 112 as shown in fig8 . in this manner , the opto - mechanical micro - switch 300 operates by pivoting from a first position shown in fig3 in which end y is located at or below plane p 100 defined by upper surface 112 ( i . e ., the “ switch - off ” position ), to the upright ( second ) position shown in fig8 in which the plane p 111 defining surface 138 intersects the plane p 100 of substrate 110 at an angle of approximately 90 ° ( i . e ., the “ switch - on ” position ). as indicated in fig3 when inner frame 130 is in the “ switch - off ” position , light beam 18 is transmitted across micromachined structure 100 from light source 14 to light receiver 16 , thereby indicating a first switch state . however , as shown in fig2 when the inner frame rotates upward , light beam 18 is reflected by outward - facing flat surface 138 back to the light receiver 15 or blocked altogether ( not shown in figures ), thereby indicating an alternate switch state . it is noted that the terms “ switch - on ” and “ switch - off ” are referenced arbitrarily relative to two states of the switch . the “ on ” and “ off ” states of the switch may be interchanged between fig3 and fig8 without departing from the scope and spirit of the invention . in one embodiment , a magnetic material such as a ni — fe material commercially available under the trademark permalloy is provided on the inner frame 130 , so that the inner frame can be latched onto the outer frame 120 , without continuous application of electric current through coils attached to the inner frame 130 . the electromagnetic force can be applied through an external structure , mounted in close proximity to micromachined structure 100 on a hybrid substrate , or integrated onto micromachined structure 100 . as indicated in fig3 a permalloy piece 30 on the inner frame and a permanent magnet layer 26 in the outer frame are arranged to maintain latching after pivoting / rotation . the permalloy piece 30 is attached to the downward movable portion 32 at end x of inner frame 130 . the magnet 26 lies between the silicon substrate layer 24 and the nickel / iron layer 28 . fig1 shows the cross - sectional view of the inner frame 130 along line 19 — 19 in fig5 with reference to the outer frame . as seen in these two figures , the inner frame 130 has permalloys 30 b and 30 c that do not contact the substrate 24 . the width of the substrate 24 in fig1 does not extend to contact the permalloys 30 b and 30 c that are suspended in the air without supports below them . the substrate 24 has minimal contact area with the inner frame 130 to reduce stiction . this configuration can also be applied to the permalloy configuration shown in fig1 . as indicated above , fig3 shows the initial position , or the first switch state or the “ switch off ” state . at this “ switch - off ” state , end y remains at or below plane p 100 with upward movable portion 34 resting upon silicon substrate 24 at upper silicon surface 54 . the coils 20 , which lie on upper surface 112 of inner frame 130 , are fabricated in accordance with techniques known to those skilled in the art . coils 20 include a plurality of electrically conductive windings , which are electrically isolated from adjacent windings by an insulating material . as current flows through coils 20 , an electromagnetic force is generated . as the inner frame 130 begins to pivot from the “ switch - off ” state in fig3 to the “ switch - on ” state as shown in fig8 the inner frame 130 begins to pivot in an anti - clockwise direction under the interaction of the current and the magnetic field caused by the permanent magnet layer in the outer frame . as the inner frame begins to pivot ( see fig6 ), a reactive torque , τ beam , is generated from the torsion of the beams 40 and it gradually increases . on the other hand , the torque generated by the electromagnetic force caused by a constant current in the coils , τ coil , generally decreases with rotation of the inner frame 130 in the anti - clockwise direction ( the τ coil is not constant because of the change in relative position between the coils 20 and the permanent magnet 26 and the change in the direction of the component of the magnetic force attributing to torque on the inner frame ). at the same time , the torque caused by the attractive force between the permalloy piece 30 and the magnet 26 , τ permalloy , continues to increase . in order for the inner frame 130 to be able to rotate , the following relationship must be met : | τ permalloy + τ coil |& gt ;| τ beam |. when the angle of inclination ( or rotation ) of the inner frame reaches a critical angle ( θ critical ), which is measured about the axis of rotation 42 , τ permalloy is sufficient to counteract τ beam even in the absence of the current induced τ coil . beyond θ critical , as long as τ permalloy & gt ; τ beam , the inner frame will continue to rotate to an upper silicon surface 54 as shown in fig8 and remain in this position ( i . e ., latched on ) in the absence of any coil current . the magnetic force from the permanent magnet layer 26 holds the permalloy piece 30 down , against the bias of τ beam , thus maintaining the inner frame 130 in the latched position . τ latching is the value of τ permalloy at the latched position . fig7 shows that after θ critical , τ permalloy is greater than τ beam , thus ensuring the switching on state . fig1 further shows that the current i coil required to ensure rotation of the inner frame lies within a range of possibilities . one can control the applied coil current to provide a changing τ coil that just exceeds τ beam − τ permalloy ( or δτ ) along the rotation of the inner frame from θ = 0 to θ = θ critical . this requires more complex control , but would minimize the applied current . τ critical is the greatest value of τ beam − τ permalloy during rotation to θ critical . as long as the entire i coil curve lies on or above the δτ curve , any of the i coil curves will allow the necessary current for the desired rotation of the inner frame for latching . as shown in fig1 , in yet another embodiment of the present invention , once the threshold θ critical is passed , a reverse current of an appropriate amount may be applied through the coils in order to generate a torque (& lt ;| τ permalloy − τ beam |) in a clockwise direction to counter the τ permalloy that is in excess of τ beam and a torque attributed to the rotational momentum of the inner frame . the purpose of this reverse torque is to soften the impact when the permalloy piece attached to the inner frame hits the outer frame . as indicated in fig8 and 9 , in one embodiment of the present invention , when the angle of inclination , θ , reaches 35 . 24 °, the inner frame 130 is latched onto the outer frame 120 at silicon substrate 24 . the value , 35 . 24 °, is the difference of 90 ° and 54 . 76 °, which is the angle of intersection of p 111 of the inner frame and the upper surface 112 of the outer frame 120 when the inner frame is in its “ switch off ” position . at this angle of inclination , the flat surface of p 111 of the inner frame 130 will form a 90 ° angle with the upper surface 112 of the outer frame 120 . as mentioned before , even though the power is released , the magnetic force between the magnet 26 and permalloy piece 30 maintains the latching position . as shown in fig8 in this latched on position , all light from the light source 14 is reflected to receiver 15 ( see fig2 ; receiver 15 is obscured from view by light source 14 in fig8 ) or blocked from receiver 16 . fig1 and 11 demonstrate the process in which the latched - on switch returns to its “ off ” position . when the switch is to be unlatched , power is applied so that a reverse current runs through the coils 20 . as shown in fig8 the latching torque in the anti - clockwise direction is the torque generated by the magnetic force between the permalloy piece and the permanent magnet , i . e ., τ latching . to unlatch the inner frame , two opposing torques to the latching torque come into play , the torque of the beam , τ beam , and the torque generated by the interaction of the reverse current through the coils 20 and the magnetic field from the permanent magnet 26 , τ coil . as shown in fig1 , at the point of unlatching , | τ latching |=| τ coil + τ beam | must be greater than | τ permalloy | to initiate rotation of the inner frame from its latched position . τ coil must be maintained such that it is greater than | τ permalloy − τ beam | at all times to maintain rotation of the inner frame , until the inner frame reaches θ critical . if a constant reverse current is applied , τ coil should be the maximum value of | τ permalloy − τ beam | ( i . e ., at the latched position τ latching − τ beam in fig1 ) to ensure sufficient τ coil . if a variable current is applied , τ coil may be decreased as the inner frame rotates from the latch position . ( it is noted that θ critical for clockwise rotation ( unlatching ) may be slightly different from θ critical for anti - clockwise rotation ( latching ) because of rotational momentum of the inner frame , a dynamic component that causes hysteresis in θ critical and other parameters between rotations in the two directions . the reverse current may be released once the critical angle , θ critical , is passed . as indicated before and as shown in fig1 , after this point , τ beam is greater than τ permalloy , and thus the inner frame will continue to tilt in the anti - clockwise direction until its end y rests on the silicon substrate 24 . in yet another embodiment of the present invention , once the critical point is passed , a current of an appropriate amount is applied through the coils to generate a torque ( less than | τ beam − τ permalloy |) in the anti - clockwise direction to counter the excessive torque of the beams and the rotational momentum of the inner frame . the purpose is to soften the impact of end y of the inner frame when it returns to its original “ off ” position and rests on the silicon substrate 24 in the outer frame . fig1 further illustrates the behavior ( current as a function of time ) of the opto - mechanical micro - switch 300 from the “ switch off ” to “ switch on ” and then back to “ switch off ” states under control of the controller 99 , according to one embodiment of the present invention . at time 0 , the micro - switch is at the “ switch off ” state as illustrated in fig3 . a current , i critical , is applied through the coils attached to the inner frame between t = 0 and t 1 , to rotate the inner frame from θ = 0 to θ critical . the value of i critical is chosen so that the inner frame will pivot through the critical angle of inclination , θ critical , beyond which , as indicated above , the torque generated by the magnetic force between the permalloy piece and the permanent magnet will overcome the reactive torque of the beam , thus allowing latching to occur with the current removed . beyond t 1 and θ critical , a reverse current is applied through the coils to reduce the impact of the permalloy piece onto the outer frame due to the excessive torque caused by the magnetic attraction between the permalloy piece and the permanent magnet over the reactive torque of the beam . at time t 2 , the inner frame reaches its “ latched - on ” position . at this point , no current needs to be applied through the coils . the excessive magnetic torque , τ permalloy , over the beam torque , τ beam , will keep the inner frame in place . when unlatching , a reverse current is applied , so that the sum of the unlatching torque and the beam torque must be higher than the latching magnetic torque , thereby causing the inner frame to tilt back to its original starting position . the time t 4 is a time where the inner frame has tilted back , slightly beyond the critical angle . since after t 4 , the torque of the beam is higher than the magnetic torque , the inner frame will continue to tilt toward its starting position , even without any continuous current . however , again in order to reduce the impact when the inner frame hits the upper surface 54 of the silicon substrate of the outer frame , a positive current is applied to counter the excessive torque of the beam over the magnetic torque . impact reducing is necessary during latching to prevent the end x of the inner frame 130 from making contact with the outer frame 120 that may cause structural damage ; impact reducing is also necessary during “ switching off ” to prevent the end y of the inner frame 130 from hitting the upper silicon surface 54 with excess force . fig1 shows yet another embodiment of the present invention . an additional permalloy piece 60 is added to the permanent magnet 26 to focus the magnetic field against the permalloy piece 30 . in fig1 , the permalloy piece 60 is incorporated within the silicon substrate 24 and placed directly on top of , or in close proximity to , the permanent magnet layer 26 to allow magnetization of the permalloy piece 60 . this arrangement increases the magnetic force on the permalloy piece 30 by focusing the magnetic flux of layer 26 on the permalloy piece 30 , which attracts the permalloy piece 30 towards lower stationary portion 64 and holds it in the latched on position . fig1 shows yet another embodiment of the present invention . as shown in fig1 , a permalloy piece 62 is added to the silicon substrate layer 24 . further , the permalloy piece 62 is placed directly on top of , or in close proximity to , the permanent magnet layer 26 , in order to allow magnetization of the permalloy piece 62 . an additional permalloy piece 30 b / 30 c / 30 d is added to the lower portion of end y of the inner frame 130 . the magnetized permalloy piece 62 keeps the end y of inner frame 130 attached to the upper stationary portion 66 . this embodiment serves to securely hold the inner frame 130 in place in the non - biased state ( switch - off ) against external perturbations , and to reduce the force required to unlatch from the switch - on state . fig4 and 5 show two plan bottom views of inner frame 130 with different permalloy deposit embodiments . fig4 shows permalloy 30 a with a stop edge 44 , which allows for silicon - to - silicon contact when the switch is on and the inner frame is latched onto the outer frame . the stop edge 44 avoids the permalloy - to - silicon contact . the silicon - to - silicon contact prevents the constant impact of the permalloy piece during the operations of the micro - switch . not only does it prevent damage deformation but it also avoids stiction ; a tremendous force is required for separation once there is contact . fig1 , a perspective bottom view of fig4 shows one embodiment of the present invention with the permalloy 30 a on one side of the inner frame 130 . another embodiment of the present invention in fig5 shows permalloy 30 a and stop edge 44 with the addition of permalloys 30 b and 30 c at the lower corners of the inner frame 130 . fig1 , a perspective bottom view of fig5 also shows stop edge 45 in between permalloy 30 b and 30 c . in yet another embodiment of the present invention , fig1 shows an additional permalloy 30 d with stop edges 45 a and 45 b . these additional permalloys allow for increased latching strength in another embodiment as shown in fig1 . to manufacture a micromachined structure , reference is made to u . s . patent application ser . no . 09 / 366 , 428 filed aug . 2 , 1999 , assigned to integrated micromachines , inc ., the assignee of the present invention , which is fully incorporated by reference herein . such patent application discloses a process that provides one skilled in the art with the steps to manufacture the following : an outer frame and an inner frame , pivotally coupled to the outer frame , which is rotatable about an axis of rotation from a first position to a second position relative to the outer frame when an external force is applied , and wherein the inner frame is biased to return to the first position in the absence of the external force , and providing a permanent magnet on the outer frame . in the present invention , the method of manufacturing a micromachined structure further includes the step of forming the permalloy , or a magnetic material , on the inner frame . while the present invention has been particularly shown and described with reference to the preferred embodiments , it will be understood by those skilled in the art that various changes in form and detail may be made without departing from the spirit , scope , and teaching of the invention . accordingly , the disclosed invention is to be considered merely as illustrative and limited in scope only as specified in the appended claims . | 6 |
a medical needle removal and disposal device 10 , comprising an exemplary preferred embodiment of the present invention , is illustrated in fig1 . removal and disposal device 10 comprises a base assembly 13 , head structure 20 and sealable container 50 . head assembly 20 includes power switch 21 and conical guide member 60 . as may be seen in fig2 in the exemplary preferred embodiment , conical guide me 60 converges to an aperture 61 . guide member 60 may be formed of any suitably hard material , preferably of stainless steel or other metal to resist the damage by sharp needle points . a rotatable member 80 is located beneath the aperture 61 and has an exterior surface 81 encircling an axis of rotation 82 which is parallel to and spaced apart from the axis about which the interior surface of conical guide member 60 converges . the exterior surface 81 of rotatable member 80 of the preferred embodiment is of frusto conical shape , but a cylindrical external surface , or a surface which is rounded in cross - section , may also be utilized . the rotatable member 80 is connected to a drive mechanism including an electric motor or other suitable power device by drive shaft 84 . the drive motor may be energized to rotate rotatable member 80 in a counterclockwise direction as viewed in plan from above the pressing power switch 21 . the relationship between a diameter of rotatable member 80 and the spacing between the axis of rotation 82 and the axis of convergence 82 is chosen such that , when the needle assembly 72 attached to the medical device 171 of medical unit 170 in fig2 is inserted into guide member 60 and through the orifice 61 , an exterior surface of the hub 73 of the needle assembly 72 is urged into contact with exterior surface 81 of rotatable member 80 . power switch 21 may then be pressed to cause rotation of rotatable member 80 and , as rotatable member 80 and hub 73 are coupled by their surface contact , in turn cause rotation of hub 73 in the opposite direction until hub 73 becomes detached from medical device 171 . the removal and disposal device of the present invention is suitable not only for use with hubs and medical devices incorporating helical threads but also for loosening the friction lock of friction retention hubs to effect their removal . in the exemplary preferred embodiment , a vertical passageway 22 is provided beneath orifice 61 which ends in an opening 23 at the bottom of head structure 20 . container 50 is sized to be insertable between base 11 and head structure 20 , and is provided with a primary aperture 51 through its loop panel 52 . as may best be seen in fig3 base panel 53 of container 50 of the exemplary appliance 10 is provided with a groove 63 to cooperate with tongue 14 of top surface 19 of base 11 and top panel 52 is provided with a groove 54 to cooperate with a releasable latching device 15 , such as is well known in the art , and which may be released by pressing latch button 16 . when container 50 is inserted between base 11 and head structure 20 , it is held in its receptacle position by cooperation of tongue 14 on top surface 18 of base 11 with the groove of base panel 53 , abutment with locating surface 17 pillar structure 12 , and the bottom of head structure 20 and cooperation of latch device 15 with groove 54 . primary aperture 51 is so positioned in top panel 52 that , when container 50 is in the receptacle position , aperture 51 is in alignment with hole 23 . thus , with container 50 in the receptacle position , when needle assembly 73 becomes detached from medical device 171 it will pass through passage 22 , hole 23 and aperture 51 and become enclosed in container 50 . once container 50 has been filled to its capacity with needle assemblies , container 50 maybe removed from removal and disposal device 10 by passing release button 16 and withdrawing container 50 from between base 11 and head structure 20 . three common configurations for needle assembly hubs are illustrated in fig4 . the most common hub , shown as part of a phlebotomy needle assembly attached to a vacuum via guide device in fig4 a in section and b in plan , has four bracing ribs 75 defining a generally cylindrical shape extending away from the attached medical device 71 of the medical unit 70 along needle 74 . the hub may also have a fuller shape with longitudinal surface ribs 278 as in the case of hub 273 in fig4 c , or a smooth rounded surface as in the case of hub 173 of fig4 d . hubs of needles assemblies presently available generally have a collar 76 which seats against an extension 77 of the medical device . rotatable member 80 of the exemplary removal and disposal device 10 has raised ribs 86 an outer surface 81 to engage bracing ribs 75 of hub 73 or longitudinal ribs of hub 273 . further , passageway 22 is of sufficient diameter to allow collar 76 to pass between the outer surface 81 of rotatable member 80 and the inside wall of passage 22 . top panel 52 of container 50 has a recessed portion with a floor 55 and a recess perimeter 56 , and a lid 57 with a lid perimeter 58 . lid 57 is hinged to top panel 52 along a rear edge portion of the panel by hinge 59 . lid 57 has an edge wall 40 about its perimeter 58 which extends from an inner lid surface 41 to outer lid surface 42 . as may best be seen in fig5 in the preferred embodiment of the exemplary removal and disposal device 10 , inner surface 41 of lid 57 is similarly shaped but larger than outer lid surface 42 such that the edge wall 40 of lid 57 forms an acute angle with inner surface 41 and an obtuse angle with outer lid surface 42 . a perimeter wall 43 at the perimeter of the recess area as sloped inwardly in an outward direction from floor 55 , to form an acute angle with recess floor 55 generally equal to the acute angle formed between edge wall 40 and inner surface 41 of lid 57 . lid 57 and top panel 52 of the exemplary embodiment are fabricated of a material of sufficient softness and elasticity that lid 57 may be rotated about hinge 59 until inner surface 44 of lid 57 abuts floor 55 of the recessed area and the edge wall of lid 57 may be pressed down to seat beneath perimeter wall 43 of the recessed area thereby fixing the perimeter of lid 57 in a closed position sealing aperture 51 . the head structure 20 of the preferred embodiment of needle assembly removal and disposal device 10 may include a downwardly protruding portion 24 in its bottom surface 18 to cooperate with perimeter wall 43 of panel 52 in the manner of a tongue and groove to assist in maintaining aperture 51 of container 50 in alignment with passageway opening 23 when container 50 is in the receptacle position between base 11 and head structure 20 . a relieved area 25 may also be provided in surface 17 of pillar structure 12 to cooperate with lid 57 when lid 57 is rotated to a fully open position about hinge 59 and container 50 is in the receptacle position between base 11 and head structure 20 in abutting relation with pillar structure 12 to assist in maintaining container 50 is proper position via hinge 59 . power switch 21 of the preferred embodiment of removal and disposal device 10 is preferably located in a position to be conveniently depressed with the side of the hand or one of the two outside fingers of the hand while holding a medical unit 70 , such as the syringe of fig1 in position with hub 73 of needle assembly 72 in position for needle assembly 72 to be removed by coupling with rotating member 80 . while a push switch 21 is used in the preferred embodiment of removal and disposal device 10 , a pressure sensitive switch associated with guide member 60 , a photosensor positioned at aperture 61 , or other control means such as are well known in the art may also be utilized to energize the drive device and rotate member 80 when hub 73 of needle assembly 72 is in position for needle assembly removal . head assembly 20 of the exemplary preferred embodiment of removal and disposal appliance 10 is also provided with an additional aperture 26 and a passage way 27 leading to an opening 28 which , when container 50 is in the receptacle position between base 11 and head structure 20 , aligns with a second openings 49 of recess area 55 of top panel 52 to provide for the disposal of medical sharps and other small contaminated medical items into container 50 . passage 27 is of sufficiently small diameter and of sufficient length to reduce the likelihood of access by a finger to a contaminated needle which may be in the container 50 . aperture 26 may be provided with converging cutting blades 29 for cutting butterfly tubing and the like . an alternative embodiment of the removal and disposal appliance 10 is illustrated in fig6 . in the embodiment of fig6 rotatable member 480 has a generally annular shape with a central aperture 487 through which passes an axis of rotation 482 . rotatable member 480 is mounted on an annular bearing 488 and provided with external gear teeth 484 for engagement with driver gear 489 which annular rotatable member 480 of the embodiment of fig6 includes support ears 485 . jaws 490 are supported by ears 485 at hinge points 486 . jaws 490 comprise mass concentration 491 such that , when rotatable member 480 is in response , the center of gravity of jaws 490 is located radially outwardly and below hinge point 86 . thus when the motor of the drive mechanism is activated to rotate member 480 about axis of rotation 482 jaws 490 rotate about hinge points 486 , due to centrifugal force , and coupling portions 481 of jaws 490 are moved inward toward the axis of rotation 482 . conical guide member 460 and guide aperture 461 are located above central aperture 487 of rotatable member 480 with axis of convergence 483 coinciding with axis of rotation 482 . aperture 461 is located at such a height above rotatable member 480 that coupling portions 481 will close upon hub 473 when rotatable member 480 is rotated to couple hub 473 to rotatable member 480 and cause hub 473 to rotate and detach from medical device 471 . once hub 473 has become detached from medical device 471 , rotation of rotatable member 480 may be ceased by releasing power switch 21 to return jaw member 490 to its position of repose clear of collar 476 to release the needle assembly 472 and allow it to fall through passage 422 and opening 423 and on into container 50 below . while , in the preferred embodiment of fig4 a plurality of coupling portions move relative to axis of rotation 482 , some of the coupling portions may be fixed in relation to annular rotatable member 480 . further , while coupling portions 481 of the preferred embodiment of fig4 move in response to centrifugal forces , other chuck jaw mechanisms may be used which are well known in the art , such as those which work on a principal of annular momentum or are activated by electrical or mechanical drives . a second alternative embodiment of a removal and disposal device 510 is illustrated in fig7 . the embodiment of fig7 is intended for use with a needle assembly such as 672 illustrated in fig8 . the needle assembly 672 of syringe 670 comprises a threaded hub 673 and a needle 674 . the threaded hub 673 has lugs in the form of wings 699 which extend outwardly from a longitudinal hub axis beyond the outer extremities of collar 676 to end in free ends 698 . rotatable member 580 is of an annular shape with an internal surface defining a central aperture 592 and is mounted on an annular bearing 588 to rotate about an axis of rotation 582 passing through the center of aperture 592 . conical guide member 560 and guide aperture 561 are located above the central aperture 592 with the axis of guide member 560 and aperture 561 coinciding with the axis of rotation 582 . aperture 561 is at such a height above rotating member 580 that when the needle assembly 672 of medical unit 670 is inserted into concical guide member 560 and guide aperture 561 , hub 673 is suspended within the aperture 592 of rotatable member 580 . coupling extensions 597 extend inwardly toward the axis of rotation from the interior surface of aperture 592 of rotating member 580 a sufficient distance for coupling portion 596 to act against distal ends 698 of wings 699 when rotatable member 580 is rotated and to rotate hub 673 to disengage needle assembly 672 from medical device 670 . coupling extension 597 extends inwardly of aperture 592 only to a point where the inner distance between the inner most portions of opposing coupling surfaces 596 is greater than the diameter of collar 576 . this allows needle assembly 572 to fall through aperture 592 , passage way 522 and opening 523 once it becomes detached from medical device 670 . while an exemplary removal and disposal device embodying the present invention has been shown , it will be understood , of course , that the present invention is not limited to that embodiment . modification may be made by those knowledgeable of the art , particularly in light of the foregoing teachings . for example , coupling surfaces to act upon the distal end portions of the hub wings of the hub of the needle assembly of fig6 might be provided by the coupling portions of centrifugal jaws . it is , therefore , contemplated by the appended claims to cover any such modification which incorporates the central features of this invention or encompasses the true spirit and scope of the invention . | 0 |
fig1 shows a schematic top view of a binding - in and pressing machine 1 with pressing stations 60 that are arranged in a straight row and equidistantly spaced apart from one another . the pressing stations respectively contain a pair of oppositely arranged press plates 61 a , b that serve for exerting pressure upon the sides of a book 2 and can be adjusted with respect to their mutual distance . heated joint forming rails 49 a , b assigned to the pressing stations 60 are respectively arranged opposite of one another pair - by - pair and adjustable with respect to their mutual distance . the joint forming rails form the book case joints 2 a . the joint forming rails 49 a , b are situated on a carriage 50 and simultaneously serve as a transport means for advancing the books 2 from station to station in a cyclic fashion with a transport stroke ht . the joint forming rails then return into their starting position in order to receive and transport another book 2 . according to the preferred embodiment of the invention , an alignment station 20 and a pre - forming station 40 are arranged upstream of the pressing stations 60 . the infeed of the alignment station 20 is formed by a feed conveyor 50 with several adjacently arranged conveyor belts 5 a , on which the books 2 are flatly transported to a transfer position with their spine pointing forward . this transfer position is defined by the contact of the book spine with the contact tines 7 a of a contact gate 7 that are supported in a pivoted fashion on supporting tines 6 a of a feeding gate 6 . in the horizontal position of the feeding gate 6 shown in fig2 , the tines 6 a and 7 a engage into the intermediate spaces between the conveyor belts 5 a . the supporting tines 6 a are accommodated on a common shaft and pivoted back and forward about the respective shaft axis via a lever 8 and a coupler 9 with the aid of a cam lever 10 with a cam roller 10 a that is controlled by its movement along a cam plate 11 , between a horizontal position in which the book 2 is received from the transfer position and a vertical position in which the spine of the vertically arranged book 2 stands on an alignment table 21 of the alignment station 20 . the book 2 is not subjected to any sliding or gliding movements in this case , i . e ., the books 2 are vertically positioned in a particularly careful fashion . the feeding gate 6 is illustrated in its vertical position in fig3 . the book 2 stands on the alignment table 21 and is vertically guided by the supporting tines 7 a on one side and a guide plate 28 on the other side . the contact tines 7 a are pivoted into their retracted position by lever links 12 . their movements are controlled by a coupler 13 with the aid of a cam lever 14 , the cam roller 14 a of which is controlled by a cam plate 15 in such a way that the contact tines 7 a are oriented perpendicular to the supporting tines 6 a during the vertical positioning movement and the contact tines continue their pivoting movement into the retracted position through recesses in the alignment table 21 when the book is vertical positioned thereon . as the feeding gate 6 is pivoted back , the contact tines 7 a initially remain in the retracted position and are subsequently returned into the position in which they are oriented perpendicular to the supporting tines 6 a during the course of the pivoting movement . the vertically positioned book 2 on the alignment table 21 is now aligned such that its book case joints 2 a are arranged at the desired height . the outer edges of the book spine are supported by prismatic rails 22 , 23 of the alignment table 21 that respectively contain an inwardly sloped , plane supporting surface , wherein the weight of the book 2 acts upon these prismatic rails . in order to increase the aligning forces in the alignment station 20 , holding - down means 62 may optionally act upon the front edges of the book cases and / or upon the front edge cut of the book block . the left rail 22 is realized adjustably in order to take into account different book thicknesses . this is symbolized in fig2 and 3 by the double arrow va drawn with broken lines . the alignment table 21 itself is guided on guide shafts 25 by a guide block 24 and can be adjusted between a raised position in which it aligns the books 2 and a lowered position in which it releases the book spine , by a pneumatic cylinder 27 mounted on a plate 26 . the height of the plate 26 can be adjusted as symbolized by v f in order to adjust the alignment table 21 to a certain height for the alignment process . the aligned book 2 is laterally clamped in lateral regions near the joints by the clamping jaws 31 a , b of a clamping conveyor 30 and transferred from the alignment station 20 into the pre - forming station 40 with a transport stroke h k . during this process , the lateral regions of the book case near the joints are firmly glued to the end sheets to such a degree that the formation of creases is prevented when the book is subsequently pressed into the book case joints for the first time . the alignment table 21 is situated in a lowered position during this process , and the feeding gate 6 is pivoted back into the horizontal position in order to receive an ensuing book 2 . in its vertical position , the feeding gate 6 with the retracted contact tines 7 has such a geometry that a free space for the right clamping jaw 31 b is created . the clamping conveyor 30 with its clamping jaws 31 a , b is situated on a carriage 35 that is linearly guided on guide shafts 36 such that it can be displaced between the alignment station 20 and the pre - forming station 40 with the aid of not - shown driving means . in this case , the transport stroke h k is variable in accordance with the format to be processed , i . e ., the book 2 that is fed to the alignment station 20 with a constant lateral edge always reaches the center of the pre - forming station 40 . guide shafts 34 are arranged on the carriage 35 transverse to the transport direction . holders 32 , 33 are guided on the guide shafts , and the clamping jaws 31 a and 31 b are mounted on the respective ends of the holders and can be adjusted into a clamping position for receiving the books 2 from the alignment station 20 with the aid of pneumatic cylinders 37 , 38 . the left pneumatic cylinder 37 has a stroke that not only takes into account the required clamping stroke of the clamping jaw 31 a , but also changes in the thickness of the books 2 . in order to limit the operational stroke to the value required for the clamping process , a cam roller 39 is provided on the holder 32 and supported on the guide rail 47 that is adjustable with respect to the thickness of the book when the clamping jaw 31 opens . the pre - forming station 40 is essentially composed of a forming rail 51 that acts upon the front edge cut of the book block , clamping plates 41 a , b that laterally limit the book case and the joint rails 48 a , b that engage into the book case joints 2 a . when the aligned book 2 is transferred into the pre - forming station 40 , the clamping plates 41 a , b and the forming rail 51 are respectively situated in the retracted position as indicated with broken lines in fig2 . after the transfer , the book 2 initially is laterally clamped in position by the clamping plates 41 a , b . the clamping jaws 31 a , b are then opened and the clamping conveyor 30 returns into the alignment station 20 in order to receive another aligned book 2 . immediately after the book 2 is clamped in position in the pre - forming station 40 , the forming rail 51 is softly lowered onto the front edge cut of the book block . as soon as the joint rails 48 a , b are adjusted into the book case joints 2 a such that they exert a slight pressure , the pressure of the forming rail 51 is increased and the clamping force of the clamping plates 41 a , b is diminished immediately thereafter . the book block is now pressed into the book case spine that is supported on the clamped book case joints 2 a via the center strip and the end sheet . different joint shapes can be realized in this case depending on the position and the clamping force of the joint rails 48 a , b . the clamping force of the clamping plates 41 a , b is particularly important in this respect , because the clamping force can be diminished , according to a first operating mode , to such a degree that the book 2 to be post - formed is merely guided in a loose fashion between the clamping plates 41 a , b . during the post - forming , the book 2 is displaced downward until the edges of the book case come in contact with the joint rails 48 a , b . during this process , the cloth is pressed against the case edges in order to produce a sharp book case joint . in another operating mode , the clamping plates 41 a , b act upon the book case with a high clamping force during the pre - forming . the joint rails 48 a , b are simultaneously pressed against the book case joints with a high clamping force such that the book case cannot move downward when the forming rail 51 acts thereupon . this makes it possible to maintain a predetermined position of the respective joint rails 48 a , b in the book case joint . a direct contact between the book cases and the joint rails 48 a , b is prevented such that a book case joint of reduced sharpness is produced . the described second operating mode can also be used for books with thin book cases , for example , flexible book cases that are so thin that they do not provide a sufficient support edge for being placed on the joint rails 48 a , b analogous to the first operating mode . the joint rails 48 a , b are situated on the carriage 50 for the joint forming rails 49 a , b and moved into the pre - forming station 40 during the return stroke of the carriage . after the pre - forming process is completed , the clamping force of the joint rails 48 a , b is increased while the forming rail 51 and the clamping plates 41 a , b are adjusted into their retracted position . the book 2 is now transferred into the first of the ensuing pressing stations 60 by means of the joint rails 48 a , b that solidly engage into the book case joints 2 a . the book is received in this first pressing station while being positively clamped in position with the aid of press plates 61 a , b and then transported from pressing station to pressing station in a cyclic fashion by the heated joint forming rails 49 a , b . the joint rails 48 a , b are also heatable such that the plastic deformation of the book case joints 2 a can already begin in the pre - forming station 40 when certain cloth materials are used . the forming rail 51 is realized in the form of an interchangeable part and held on a bolt 52 received in a block 53 that is guided on guide shafts 54 . the guide shafts 53 are mounted on a holder 55 of adjustable height . a pneumatic cylinder 56 for realizing the lifting movement of the forming rail 51 is also mounted on this height - adjustable holder . the clamping plates 41 a , b are controlled by pneumatic cylinders 42 , and guide shafts 43 mounted on the clamping plates 41 a , b are linearly guided in bearing blocks 44 . on the right side , the bearing block 44 is mounted on a plate 46 that is rigidly connected to the machine frame while the bearing block 44 on the left side is mounted on a plate 45 that can be adjusted with respect to the book thickness and on which the aforementioned guide rail 47 is also arranged . the adjusting device is not illustrated in detail but rather symbolized by a double arrow v d drawn with broken lines . | 1 |
[ 0014 ] fig1 is a circuit diagram explaining an example of semiconductor device to which the present invention is applied . an interposer 1 made of silicon shown in the figure has an ic chip ( 1 ) 2 and ic chip ( 2 ) 3 connected to the ic chip ( 1 ) 2 by internal wiring inside the interposer 1 . a pin 11 , pin 12 , pin 13 , . . . , pin 1 n are formed as input terminals of the interposer 1 and a pin 21 , pin 22 , pin 23 , . . . , pin 2 m are formed as output terminals of the same . mos transistors of depletion mode fet ( m 1 , m 2 , . . . , m 1 ) are inserted in series into each wiring connecting the ic chip ( 1 ) to the ic chip ( 2 ) inside the interposer . gate electrodes of each mos transistor are coupled and connected to an external terminal in and to an on - state resistance automatic compensation circuit 4 . the mos transistor serves as a switching element by controlling a voltage level of the external terminal in . further , the mos transistor also plays a role as a damping resistor during the normal operation by adjusting a resistance value of each mos transistor at on state . the external terminal in is connected to ground through a resistor rg and configured to keep a ground level when there is no input from the external terminal in . each wiring connecting the ic chip ( 1 ) and the ic chip ( 2 ) inside the interposer is also connected to external terminals ( 01 , 02 , . . . , 01 ) through resistors ( r 1 , r 2 , . . . , r 1 ). further , termination resistances ( q 1 , q 2 , . . . , q 1 ) are formed between ground and each wiring that connects the ic chip ( 1 ) and the ic chip ( 2 ) inside the interposer . the mos transistor used for this case is sufficient if it serves as a switching element by controlling a voltage level of the external terminal in at the time of operation checking for the ic chip , so that it is not necessarily always to be a mos transistor of depletion mode fet . however , as apparent from a v g - i d characteristic showing a relationship between a gate potential v g and a drain current i d in fig2 a mos transistor of depletion mode fet indicated as a symbol “ a ” in the figure maintains on state when a gate voltage is v g = 0v while a mos transistor of an enhance mode fet indicated as a symbol “ b ” in the figure becomes off state when a gate voltage is v g = 0v . accordingly , from the viewpoint of reducing power consumption , the mos transistor of depletion mode fet is preferable . it is preferable to use the mos transistor of depletion mode fet since it maintains on state when a gate voltage is v g = 0v , an on - state resistance is low and a size of a transistor may be reduced . mean while , since the mos transistor of enhance mode fet requires to have both mos and nmos , a transistor size becomes larger and a transistor occupancy area becomes wider and also parasitic capacitance is increased . on the contrary , the mos transistor of depletion mode fet basically accepts either one of pmos or nmos , so that it is also favorable when reduction of the cost for manufacturing the interposer is considered . the mos transistor used for this case is sufficient if it serves as a switching element when the operation checking for ic chip is carried out by controlling a voltage level of the external terminal in . accordingly , the mos transistor is not necessarily always to play a role as a damping resistor during the normal operation . however , in order to improve signal quality between the ic chip ( 1 ) and the ic chip ( 2 ) during the normal operation , it is preferable if the mos transistor serves as the damping resistor . from a viewpoint of carrying out the test for ic chip ( 1 ) and the ic chip ( 2 ) which are mounted on the interposer , the on - state resistance automatic compensation circuit is not always necessarily to be formed , however , since a resistance value of the mos transistor at on state is fluctuated depending on manufacture variation , power supply voltage fluctuations and temperature changes , it is preferable to form the on - state resistance automatic compensation circuit for suppressing these fluctuations as small as possible to keep the on - state resistance constant . from a viewpoint of carrying out the test for ic chip ( 1 ) and the ic chip ( 2 ) which are mounted on the interposer , it is not necessarily always to form the termination resistance between ground and the wiring connecting the ic chip ( 1 ) and the ic chip ( 2 ) inside the interposer . however , similar to having the damping resistor described above , in order to improve the signal quality between the ic chip ( 1 ) and the ic chip ( 2 ) during the normal operation , it is preferable to form the termination resistance between ground and the wiring connecting the ic chip ( 1 ) and the ic chip ( 2 ) inside the interposer . although it is not illustrated in the circuit diagram shown in fig1 a similar technique as the on - state resistance automatic compensation circuit described above is also effective for the termination resistance . in the described example of the semiconductor device to which the present invention is applied , although the explanation is made referring to the interposer having two ic chips , the number of ic chip to be mounted on the interposer is not limited to be two , but may be three or more . in the described example of the semiconductor device to which the present invention is applied , although the explanation is made referring to the interposer made of silicon on which the mos transistor is formed as the switching element , any kind of material may be used for the substrate as long as it is capable of forming the switching element . for example , a thin film transistor element may be formed as a switching element on a substrate made of glass . in the above described example of the semiconductor device to which the present invention is applied , the test for the ic chips ( 1 ) is carried out in that a switch of the mos transistor is made to be on state , signals are inputted from the input terminals pin 11 , pin 12 , pin 13 , . . . , pin 1 n of the interposer to the ic chip ( 1 ), and the signals outputted from the ic chip ( 1 ) are taken out from the external terminals ( 01 , 02 , . . . , 01 ); and the test for the ic chip ( 2 ) is carried out in that a switch of the mos transistor is made to be off state , signals are inputted from the external terminals ( 01 , 02 , . . . , 01 ) to the ic chip ( 2 ), and the signals outputted from the ic chip ( 2 ) are taken out from the output terminals pin 21 , pin 22 , pin 23 , . . . , pin 2 m of the interposer . therefore , it is possible to check whether the required condition is satisfied , not only for the entire interposer but also for the ic chip ( 1 ) and ic chip ( 2 ) which are mounted on the interposer . further , because a damping resistor and a termination resistance are formed on the interposer as chip components , deterioration of the signal caused by radiation effect such as reflection due to a faster internal signal line of a recent interposer may also be controlled . finally , the embodiments and examples described above are only examples of the present invention . it should be noted that the present invention is not restricted only to such embodiments and examples , and various modifications , combinations and sub - combinations in accordance with its design or the like may be made without departing from the scope of the present invention . | 6 |
a multi - pole circuit breaker , one pole of which is shown in fig1 is contained and mounted in an insulating housing 2 having conventional external snap - in mounting elements 4 and 6 . the breaker includes a magnetic tripping solenoid 10 for tripping a trip link latch and multi - pole link mechanism 11 which incorporates a novel trip link element 12 . the trip link 12 is tripped to open a contact set 13 upon sensing a relatively high overload current carried from the line terminal connection 15 through a bi - metal strip or element 14 , the contact set 13 , and the coil 16 of the solenoid 10 , to a load terminal connection 17 . the same contact set is opened as a result of movement of the bi - metal strip 14 if the breaker has been carrying a small overload current for a relatively long period of time . upon counterclockwise pivoting of the trip link 12 , the other parts of the mechanism 11 release the latch for a movable contact arm 18 which pivots counterclockwise to open the contact set 13 . the current flow which is to be interrupted will , immediately after contact opening , flow across the gap between the contacts of the set . magnetic forces cause the arc to be moved toward an arc chute 19 . as soon as the arc has been spread and moved ( downwards as viewed in fig7 ) one end of the arc transfers to the arc runner and booster loop 20 , current traveling from line terminal connection 15 flows down a booster loop portion 21 and back up the arc runner portion 22 to the spot to which the arc has transferred . magnetic forces cause the arc to be stretched and move toward the arc chute 19 , the arc being so stretched when it enters the chute that it is extinguished . other elements shown in fig1 are generally typical of those known in the art . the bi - metal strip 14 has its cold position adjusted by a screw 24 which permits calibration of the long - term current trip setting . current flowing through the bi - metal strip is carried by a multi - strand flexible wire strap 26 to the fixed contact 27 . current from a movable contact 28 on the contact arm 18 is carried over multi - strand flexible strap 29 to one end 31 of the solenoid coil 16 . the other end of the solenoid coil 16 is connected by a relatively rigid conductor 33 to the load terminal connection 17 . a handle 34 connected to a handle link 35 is used to open , close , and reset the movable contact 18 via the mechanism 11 . the mechanism 11 and its parts are shown in fig2 - 6 . the movable contact arm 18 is pivotably mounted on a latch and contact pivot pin 36 which is fixed in a crank 38 which , in turn , is pivotable mounted on a mechanism pivot pin 40 fixed to the frame 2 of the breaker . the pivot pin 36 also supports a pivotable latch 42 to which the handle link 35 is connected . the functional interconnection of the crank , latch and contact arm will be described below with respect to fig2 - 5 which show stages in tripping of the breaker . the trip link 12 , shown in detail in fig6 is the major interconnecting element between the momentary overload magnetic trip solenoid 10 , the long - term overload bi - metal strip 14 , and latching parts of each of the poles of the breaker . before describing its structure in detail , we will summarize its functions so that the structural relationships will be more meaningful . the following description treats the link 12 shown as though it is part of the middle pole mechanism of a 3 - pole breaker , the three poles and their mechanisms being substantially identical . the trip link may be operated to unlatch the parts for the movable contact arm 18 of this pole in any of three ways : striking of a finger 52 by an actuating disc 54 of the solenoid 10 of this pole ; pushing of a finger 56 by the end of the bi - metal strip 14 of this pole ; or contact of one of the inter - pole actuating surfaces 58 and 60 by a trip link of an adjacent pole of the same breaker ( see fig6 a ). if , this trip link is pivoted as a result of any of those occurrences , after unlatching the movable contact 18 of this pole it will operate either or both of the adjacent poles , in sequence , such that all poles are tripped , via contact of the surface 62 ( shown in fig1 ) or the surface 64 ( obscured in fig6 ) which faces surface 60 with respective corresponding surfaces 58 or 60 of the adjoining pole units . the trip link 12 is preferably molded as one piece of a reinforced synthetic resin material having excellent insulating properties , such as 15 % polyester glass having short fibers . this is the only part extending between adjacent poles , so that such construction increases the high voltage isolation between the breaker pole assemblies . the link 12 has a center hub 65 surrounding a pivot mounting hole 66 which defines a pivot axis 67 , for mounting over the mechanism pivot pin 40 . a relatively long sensing arm 68 extends generally radially from the hub 65 , and terminates in the fingers 52 and 56 . these fingers are preferably offset from each other both angularly and axially , so that the actuating disc 54 and the bi - metal element 14 may be arranged to have non - overlapping paths of movement . an adjoining - pole operating projection 69 , on which the surfaces 58 and 62 are formed , extends axially in one direction from an operating arm 50 extending generally axially from the hub 65 , at an average radius distance from the axis 67 much less than the length of the sensing arm 68 ; and at the opposite end of the operating arm 50 two operating projections 70 and 71 extend axially , separated by a space substantially wider angularly than the angular width of the projection 69 , the facing surfaces 60 and 64 being formed on the respective projections 70 and 71 . a latching surface 73 is formed near the root of the sensing arm 68 , the surface 73 being generally circularly cylindrical about the axis 67 . for the advantages to be described later with respect to detailed operation , the trip link 12 is proportioned such that its center of gravity 74 falls near the axis 67 , generally in line axially with the fingers 52 and 56 . as shown in fig2 - 5 , the crank 38 and trip link 12 are pivoted , axially adjoining each other , on the mechanism pivot pin 40 . a latch and contact pivot pin 36 interconnects the contact arm 18 , crank 38 and latch 42 , the pin 36 being fixed optionally to one of these elements , and pivotally journalled in the other two . the latch 42 has a latching projection 76 extending radially with respect to the pivot 36 , which in the closed contact position shown in fig2 presses against the latching surface 73 of the trip link 12 to form a secondary latch . preferably , the latch 42 and the crank 38 are u - shaped metal stampings as viewed from their respective pivots , with the open end of each &# 34 ; u &# 34 ; facing away from the handle 34 . the sensing arm 68 of the trip link 12 is aligned so it can pass between the legs of the latch 42 , and the contact arm 18 is arranged between the legs of the crank 38 . a mechanism spring 78 is stretched between a pin 79 fixed to the housing 2 and an opening 80 in the crank 38 ( shown in fig5 ) to pull the crank in a direction toward the solenoid 10 . as shown in fig2 in the contact closed position an end 85 of a contact pressure spring 82 , extending from the mechanism pivot pin 40 , bears against a side edge 83 of the contact arm 18 , urging the contact arm in a clockwise direction about the pivot pin 36 to provide proper pressure between the movable contact 28 and the fixed contact 27 . as will be explained below , in the initially tripped position shown in fig5 the spring 82 bears against an end edge 84 of the contact arm 18 , tending to urge the arm 18 counterclockwise so as to hold the contacts open . a trip link spring ( not shown ) urges the trip link 12 in a clockwise direction about the pin 40 at all times . as shown in fig7 the solenoid 10 is a subassembly having five principal parts : a coil 16 , an insulating bobbin 90 , a soft magnetic steel frame 91 , an armature 92 , and a spring 93 . the bobbin is hollow , to provide room for the armature 92 and spring 93 , and has two coaxial end extensions 94 and 95 . the front extension 94 fits within an opening 96 in the frame 91 . this opening concentrates the magnetic field in the region within and adjacent to the opening , while the plastic material of the bobbin extension forms a bearing journal for the largest diameter part 97 of the main portion of the armature 92 which extends through the opening 96 . the coil 16 and armature 92 can therefore be completely insulated from each other and the solenoid frame 2 . an armature extension 98 extends axially away from the large diameter part 97 to the actuating disc 54 . at the other end of the armature main portion a stop rod 99 passes through the extension 95 , preferably with a loose fit . an end portion 100 of the stop rod is bent sharply at least obliquely , and preferably about 90 ° away from the armature and bobbin axis , to bear against the outer end 101 of the extension 95 . the compression spring 93 is captured between the largest diameter part 97 of the armature and the rear end of the bobbin adjacent the extension 95 . at least the stop rod portion of the armature is made from a plastically deformable material , so that the bend between the end portion 100 can be formed at a location along the stop rod selected to control the static position of the large diameter portions of the armature with respect to the opening 96 in the frame 2 . the length of the stop rod between the bend and the armature main portion therefore determines the magnitude of current required to overcome the force of the spring 93 , so that the momentary current trip level can be adjusted accurately after the solenoid has been assembled , without need for selecting and trimming springs . it is convenient to bend a corner 104 of the solenoid frame 2 outward to form a stop for the movable contact arm 18 . the configuration and current flow patterns of the arc blow - out parts of the breaker are shown in fig8 while the rigid conducting element forming the booster loop and arc runner 20 is shown magnified in fig9 . the rigid booster loop and arc runner 20 is stamped and bent from one piece of hard copper , folded over so that one end 124 fits between the arc chute 19 and the rear wall of the breaker housing 2 , the end 124 being adjacent the rear ( in the direction of arc blow - out ) end of the chute 19 . the other end 126 of the booster loop portion 21 is bent for convenience to attach directly to the line terminal connection 15 . except for the bent end 126 , the booster loop 21 , including the region of it adjacent the end 124 , is parallel to the arc runner 22 . this not only permits a very compact construction but , as described below , provides a performance advantage because the arc is accelerated faster into the arc chute . the other end 128 of the arc runner 22 is fixed adjacent , but insulated from , the fixed contact 27 . as shown in fig8 the contacts , solenoid and arc runner are arranged such that , immediately after the contacts are separated , the fixed - contact end of the arc between the contacts transfers to the arc runner and , as will be described below , moves down the runner until the arc is extinguished . tripping operation initiated by this pole is as follows : starting , from the position shown in fig2 either finger 52 or 56 is contacted by the relevant trip unit , pivoting the trip link 12 counterclockwise as seen in fig1 - 5 . when the latching surface 73 has slipped past the latching projection 76 of the latch 42 , the latch begins to pivot counterclockwise about the handle link 35 as the crank is accelerated counterclockwise about the mechanism pivot pin 40 as a result of the force applied by the mechanism spring 78 to the crank 38 . if tripping was caused by movement of the bi - metal strip 14 , or rotation of the trip link by an adjoining pole , the contacts are opened rapidly due to the rotation of the crank 38 from the position shown in fig3 to the position shown in fig5 . as the crank pin 38 pivots , a nose 140 opposite the side edge 83 of the movable contact arm 18 abuts the inner surface 142 of the base of the &# 34 ; u &# 34 ; of the crank 38 , forcing the contact arm then to pivot counterclockwise with the crank , and opening the contact set . at the same time , movement of the end of the contact arm near the mechanism pivot pin 40 causes the end 85 of the contact pressure spring 82 to slide along the side edge 83 to its end , and then to bear against the end edge 84 of the contact arm . this causes the pivoting torque due to the contact pressure spring to reverse , so that this also urges the contacts open . the release of the latching force on the latch 42 removes the reaction force on the handle link 35 . this allows the relatively weak handle spring ( not shown ) to rotate the handle counterclockwise past dead center of the link - to - handle - pivot line , so that the handle pivots to the open position . this provides a visual indication of the state of the breaker , and also pulls the latch 42 clockwise to the position for resetting . in that position , the end edge 84 of the contact arm 18 has moved so far that the contact pressure spring end 85 slides back from the end edge 84 to the side edge 83 . as soon as the tripping force applied to the trip link has been removed , a weak trip link spring ( not shown ) pivots the trip link back to its normal position , with the latching surface 73 opposite the latching projection 76 . as described above , the operating projections 70 and 71 of the trip link 12 are separated angularly by a space substantially wider than the angular width of the adjoining - pole operating projection 69 . in a multi - pole breaker , as shown diagrammatically in fig6 a , adjoining poles have similar trip links 112 and 212 , the projection 69 projecting into the space between projections 170 and 171 , and a projection 269 projecting into the space between projections 70 and 71 . while the trip link 12 is pivoting counterclockwise to unlatch the latch 42 there is no load on this trip link due to the interconnection to the adjoining pole trip links 112 and 212 . after the latch 42 has unlatched , one or both of the surfaces 62 and 64 will engage the opposed surfaces on the projections 170 and 269 of the adjoining poles , if they are not already tripping due to the event which is tripping this pole . thus inter - pole tripping is achieved without slowing the tripping of this pole or need for another part . if the current through the solenoid 10 suddenly rises to a very high value , for example as a result of a short circuit , the solenoid force produced will be above that which is just sufficient to overcome the solenoid spring 93 ; and in preferred configurations and ratings of the breaker , far above the minimum for magnetic tripping . this causes the armature 92 of the solenoid to develop a very high saturation force , and to accelerate to speeds exceeding those equivalent to the crank and contact speeds occurring as described above . under these circumstances , after the actuating disc 54 has struck and pivoted the trip link sufficiently to unlatch the latch 42 , the disc will engage the contact arm 18 between the contact arm pivot pin 36 and the movable contact 28 , and will overcome the torque applied by the contact pressure spring 82 and directly pivot the contact arm 18 counterclockwise , opening the contact set 13 . this occurs before the crank has accelerated and moved very far under the influence of the mechanism spring 78 . a special advantage of the contact arm , crank and pressure spring arrangement disclosed is that , under fast tripping , the rotation of the contact arm 18 causes the spring end 85 to slip onto the end edge 84 of the arm , reversing the torque so that the movable contact 28 is held away from the fixed contact 27 until the crank 38 and the rest of the operating mechanism have time to reach the final open position , ready for resetting . manual operation of the handle 34 , moving the handle to the left as seen in fig1 removes the reaction force holding the crank 38 in the closed position . under the force of the mechanism spring 78 , the crank pivots counterclockwise until the nose 140 of the contact arm 18 strikes the inside surface 142 of the crank , and further crank movement opens the contact set 13 . the latch 42 will pivot counterclockwise about the point of contact between the latching projection 76 and the latching surface 73 of the trip link 12 , leaving the mechanism in condition for closing . regardless of the type of tripping or opening cycle , the final position leaves the handle in the open position , fully counterclockwise ; the remote end of the contact arm 18 pressing against the corner 104 of the solenoid frame , with the nose 140 at the other end of the arm 18 pressing against the surface 142 , and the latching projection 76 adjacent the latching surface 73 . closing movement of the handle 34 causes the handle link 35 to push the latching projection 76 up against the latching surface 73 , and then to pivot the latch 42 clockwise about the point of latching engagement , thereby pivoting the latch and contact pivot pin 36 , and with it , the crank 38 , clockwise about the mechanism pivot pin 40 . as the crank pivots , the nose 140 of the contact arm 18 is released from engagement with the inside surface 142 when the movable contact 28 engages the fixed contact 27 , and normal contact pressure due to the contact pressure spring 82 is applied . the solenoid embodiment disclosed herein is just one of many which can utilize this invention aspect . the solenoid 10 is a subassembly of a type suitable for use in other mechanisms besides circuit breakers . the magnetic trip level or current sensitivity ( for non - breaker applications ) can be easily and accurately set after the device is assembled . one technique which may be used is to apply a current to the coil 16 equal to the desired trip level prior to bending the stop rod 99 . through capturing the actuating disc 54 in a jig , the position of the armature can be controlled to move it to the position where the magnetic pull just equally the force of the spring 93 . while holding the armature 92 in that position , the end 100 of the stop rod is bent over in contact with the end 101 of the bobbin extension 95 , establishing the setting through plastic deformation of the stop rod . fig8 shows three stages of current flow through the breaker : contact set 13 closed , contacts opened but arc not yet accelerated toward the arc chute 19 , and arc transferred from the fixed contact 27 to the arc runner 22 and partially blown toward the arc chute . current flow prior to contact opening is conventional : from the line terminal connection 15 , through the bi - metal strip 14 and strap 26 to the fixed contact 27 , and from the movable contact 28 through the contact arm 18 and strap 29 to the solenoid coil 16 , through the coil to the load terminal connection 17 . when the contacts have first opened the only change in path is that , if the current is high enough to sustain a short arc , an arc 150 is established between the contacts 27 and 28 . this causes current to flow around three sides of a region 152 . according to well - known principles of electromagnetism , the magnetic field generated around and in the region 152 causes a force urging the arc outward -- that is , toward the space 154 . as a result , the arc stretches downward as viewed in fig8 and transfers from the fixed contact 27 to the arc runner 22 . this causes the current to follow a new path : from the line terminal connection 15 directly to the booster loop end 126 , along the booster loop 21 portion to the end 124 adjacent the rear of the arc chute 19 , and then back up , in the opposite direction , along the arc runner 22 to the location of instantaneous termination of the arc path 156 ; and across the space between the runner and the movable contact arm 18 . the curved end of the movable contact arm 18 is selected to cause the arc hot spot to travel from the point of normal conductive contact with the fixed contact 27 , moving continuously toward the extreme end until the arc breaks spontaneously ( relatively low currents ) or is blown into the arc chute 19 and interrupted . the connections and configuration of the arc runner and booster loop element 20 provide significant performance advantages over prior known circuit breakers : first , as the arc termination travels along the runner , the impedance drops . as a result the force accelerating the arc toward the arc chute increases , and the arc is extinguished faster than with prior art breakers . second , the overcurrent is quickly diverted from the path through the bi - metal strip 14 , so that the calibration of this strip is more consistent . it will be clear to those of ordinary skill in the art , that the adjustment feature of the solenoid mechanism disclosed herein could also be utilized in a magnetic device such as a relay , having a clapper rather than a central core armature . use of the adjustable central stop rod allows adjustment without exchanging springs and without having unbalanced lateral forces which cause irregular friction , and thus inconsistent calibration . the various elements of the latch and trip mechanism can be utilized independent of each other . for example , the trip link can be used in a single pole breaker , with the axial projections operating a different function . the crank and contact pressure spring arrangement provide important performance advantages independent of the trip link , because the contact pressure spring also aids in opening the contacts and holding them open during fast magnetic tripping . thus the scope of the invention includes any embodiments falling within the appended claims . | 7 |
fig1 is an exploded view of a first preferred embodiment of a manual controller 10 that is detachably connected by a cable 12 to a computing device ( not shown ) for manipulating images or symbols on a display associated with the computing device . although this embodiment is equipped with cable 12 , manual controller 10 may also operate with a computing device through a wireless communication link . manual controller 10 includes an internal electronics assembly 14 housed within an interior region 16 of an exoskeleton 18 formed of foam rubber . the foam rubber material is preferably medium - to - high density polyurethane exhibiting flexibility properties , such as those of the foam rubber used in nerf toy products . in the first preferred embodiment , manual controller 10 is assembled by placing internal electronics assembly 14 between an upper exoskeleton section 22 and a lower exoskeleton section 24 . upper and lower exoskeleton sections 22 and 24 are bonded together to form a waterproof , unitary foam rubber casing for internal electronics assembly 14 . as shown in fig1 , exoskeleton 18 has a left - hand grip 30 and a right - hand grip 32 for two - handed gripping by a user . a left - side control pad 34 including four pressable control members 36 , left - side analog stick control 38 , and front left - side control button 60 are positioned for access by digits of the user &# 39 ; s left hand ; and a right - side control pad 44 including four control buttons 46 , right - side analog stick control 48 , and front right - side control button 50 are positioned for access by digits of the user &# 39 ; s right hand . a mode selection switch 60 , mode indicator 62 , selection button 64 , and start button 66 are positioned between hand grips 30 and 32 . skilled persons will appreciate that the above - described number of control actuators , control actuator layout pattern , and hand grip arrangement represent only one of numerous possible control actuator and hand grip configurations . in this embodiment , the total surface area of exoskeleton 18 is covered in foam rubber . the surface areas of these control actuators are perforce covered in foam , thereby rendering them surface control actuators . the control actuator surfaces are preferably made of relatively thin foam rubber , with the button and analog stick control components held in place by a plastic plate 70 ( fig4 and 5 ) and projecting into recesses in corresponding locations of the control actuator surfaces . internal electronics assembly 14 includes the actual electronic circuits , controls , and corresponding switch elements , including switch elements 72 and 74 for the respective control pads 34 and 44 . thus , the analog stick controls and buttons are actuated by user manipulation of the foam rubber controls on the surface of exoskeleton 18 . fig2 and 3 are respective second and third preferred embodiments of manual controller 10 , in which foam rubber exoskeleton 18 is formed in one piece . internal electronics assembly 14 is inserted through an opening 76 in the front side of exoskeleton 18 and force fit into interior region 16 , enabled by the elastic properties of the foam rubber material defining its boundaries . internal electronics assembly 14 is glued in place on its side and bottom surfaces , and a foam rubber plate 78 through which cable 12 passes is glued to cover opening 76 . the second and third preferred embodiments exhibit waterproof properties and no seams . the second preferred embodiment shown in fig2 has tall analog stick controls 38 and 48 preinstalled with foam rubber formed to internal electronics assembly 14 . the third preferred embodiment shown in fig3 has a separate , shaped foam rubber piece 84 that fits over analog sticks 86 and 88 of the respective analog stick controls 38 and 48 for installation just before assembly of the manual controller . fig4 a shows a control button 90 that is suitable for use as any one of the control buttons described above with reference to fig1 . control button 90 includes a button top portion 92 from which a pin 94 downwardly depends through an aperture 96 in plate 70 to contact a switch contact pad 98 of internal electronics assembly 14 . a coil spring 100 positioned between and resting against a bottom surface 102 of button top portion 92 and top surface 104 of plate 70 functions as a biasing mechanism to keep control button 90 elevated at a nominal distance from plate 70 in the absence of user applied contact force . coil spring 100 causes control button 90 to apply pressure to the region of exoskeleton 18 above it , thereby making control button 90 feel firm to the user . fig4 b shows a modification of fig4 a in that the region of foam rubber exoskeleton 18 covering control button 90 is removed to expose button top portion 92 . removal of this region of foam rubber can be desirable for certain buttons to increase button reaction time for applications , such as games , requiring buttons exhibiting fast repeat action . certain buttons for which reaction time is not important , such as a start button , may be covered by foam rubber . moreover , button top portion 92 may be made of hard plastic or impact resistant material . fig5 shows an analog stick control 110 that is suitable for use as one of analog stick controls 38 and 48 . a vertical analog stick or pin 112 matably connects with a relatively short analog stick stub 114 projecting upwardly from a raised portion 116 of internal electronics assembly 14 . the matable connection can be of conventional plug and socket design secured in place by bonding material , such as glue . the surface profile of upper exoskeleton section 22 can be envisioned by inverting it and placing all control actuators including control buttons 90 and analog stick controls 110 into recesses that form exoskeleton actuator cavities . coil springs 100 are positioned at the appropriate places for control buttons 90 . a single plate 70 having apertures 96 appropriately located to provide passage of push pins 94 and analog sticks 86 and 88 to corresponding switch elements of internal electronics assembly 14 maintains the placement of the control actuators . skilled persons will appreciate that the control actuators can be housed in internal electronics assembly 14 , instead of secured in place inside exoskeleton 18 . control actuators not covered by foam rubber would be exposed through corresponding holes in exoskeleton 18 . fig6 is a fragmentary cross - sectional view of foam rubber exoskeleton 18 in an alternative form as a multi - layered structure 120 , in which an inside core layer 122 separates an upper external layer 124 and a lower external layer 126 . internal electronics assembly 14 fits inside core layer 122 . all layers of multi - layered structure 120 are preferably made of foam rubber , with external layers 124 and 126 exhibiting lower density properties than the density property of inside core layer 122 to provide differences in stability and tactility . alternatively , core layer 122 may be made of material other than foam rubber , such as a very high density polyurethane material . internal electronics assembly 14 itself is preferably encased in a hard plastic housing and includes a rigid printed circuit board 130 , which is shown in fig7 a . fig7 b - 1 and 7 b - 2 show flexible printed circuit board 132 supported on a substrate 134 to provide a substitute implementation of internal electronics assembly 14 having sufficient rigidity that enables actuation of the control actuators when manipulated by a user . fig7 b - 1 and 7 b - 2 show printed circuit board 132 and substrate 134 in respective unflexed and flexed states . the electronic circuit components , controls , and switch elements included in internal electronics assembly 14 are mounted on a surface of printed circuit board 132 . fig7 c shows that rigid printed circuit board 130 can be divided into separate component parts 136 and 138 that are interconnected by wiring or other communication cabling 140 . skilled persons will appreciate that flexible printed circuit board 132 supported on substrate 134 may also be subdivided into component parts and interconnected by cabling . it will be obvious to those having skill in the art that many changes may be made to the details of the above - described embodiments without departing from the underlying principles of the invention . for example , exoskeleton 18 can be provided with openings to house or display light - emitting diodes , electroluminescent devices , or other forms of internal lighting . the scope of the present invention should , therefore , be determined only by the following claims . | 6 |
referring now to fig1 a light shutter array 10 for a line printer is formed of signal electrodes s 1 , s 2 , s 3 , ----, si , ----, s 1050 , common signal electrodes c 1 , c 2 and a ferroelectric liquid crystal layer ( not shown ) sandwiched between the signal electrodes and the common signal electrodes . the signal electrodes s 1 , s 2 , s 3 , ----, si , ----, s 1050 are arranged in zigzag . pixels a 1 , a 2 , a 3 , ----, ai , ----, a 1050 are formed between the signal electrodes s 1 , s 2 , s 3 , ----, si , ----, s 1050 and the common signal electrode c 1 , and pixels b 1 , b 2 , b 3 , ----, bi , ----, b 1050 are formed between the signal electrodes s 1 , s 2 , s 3 , ----, si , ----, s 1050 and the common signal electrodes c 2 . the pixels a 1 , b 1 , a 2 , b 2 , a 3 , b 3 , ----, ai , bi , ----, a . sub . 1050 , b 1050 cover information of one line for the line printer . a first polarizer ( not shown ) is disposed on the one side of the light shutter array 10 and a second polarizer ( not shown ) is disposed on the other side of the array . the polarization axis of the first polarizer is arranged orthogonal to the polarization axis of the second polarizer so that the light shutter array operates in briefringence mode . output terminals of cmos - ic drivers ds 1 , ds 2 , ds 3 , ----, dsi , ----, ds 1050 are connected to the signal electrodes s 1 , s 2 , s 3 , ----, si , ----, s 1050 to drive the same . the cmos - ic drivers ds 1 , ds 2 , ds 3 , ----, dsi , ----, ds 1050 apply signal voltages to the respective signal electrodes in response to data signals applied to respective input terminals d 1 , d 2 , d 3 , ----, di , ----, d 1050 of the cmos - ic drivers ds 1 , ds 2 , ds 3 , ----, dsi , ----, ds 1050 . output terminals of common signal electrode drivers dc 1 and dc 2 are connected respectively to the common signal electrodes c 1 and c 2 and also connected to the ground through resistors 49 and 59 . a synchronous signal generating circuit 20 and a dividing signal generating circuit 30 are connected to the common signal electrode drivers dc 1 and dc 2 to control the alternate operation thereof . operation of the multiplexed driving circuit for the light shutter array for the line printer is explained with reference to fig2 which exemplifies a sequence of information writing and holding of four times on the pixels ai and bi covered by the signal electrode si and a initialization of pixels ai and bi . actually signal voltages are applied at once to all the signal electrodes s 1 , s 2 , s 3 , ----, si , ----, s 1050 . at first the light shutter array 10 is initialized during initializing period t s , in that , all of the pixels are rendered to an off state through an application of - 5 v dc voltage pulse with a duration of t s thereon by applying - 5 v dc signal pulse with a duration of t s , on all of the signal electrodes and applying zero signal voltage to the common signal electrodes c 1 and c 2 . during the first information writing period for the pixel ai , t wa , a npn bipolar transistor 46 generates the bipolar signal pulse with 5 v ( v o ) amplitude illustrated by the wave form of common electrode c 1 voltage v c1 through an operation of an and gate 45 and an and gate 48 with a not gate 47 , both are connected respectively to the synchronous signal generating circuit 20 and the dividing signal generating circuit 30 . the generated bipolar signal pulse is applied to the common signal electrode c 1 . during the same period , in that the first information writing period t wa , a npn bipolar transistor 53 generates the ac signal voltage of 20 v ( v h ) and 10 khz schematically illustrated by the wave form of common electrode c 2 voltage v c2 through an operation of an oscillator element 51 and a not gate 52 disposed between the npn bipolar transistor 53 and the dividing signal generating circuit 30 . the generated ac signal voltage is applied to the common signal electrode c 2 . further during the same period , in that the first information writing period t wa , since the data signal applied to the input terminal di of the cmos - ic driver dsi is low , the output signal of the cmos - ic driver dsi is an unipolar pulse with an amplitude of 5 v ( vo ) as illustrated in the waveforms of data signal di and signal voltage si . as a result , a voltage pulse of 10 v ( 2 vo ) with half duration of t wa is applied on the pixel ai to turn on the same through reorientation of the ferroelectric liquid crystal molecules in the pixel ai as illustrated by the waveform of pixel ai voltage v ai and an ac voltage biased by the dc 5 v signal voltage is applied on the pixel bi to hold the previous status , in that off state , as illustrated by the waveform of pixel bi voltage v bi . although the polarity of the dc bias on the pixel bi is changed from that previously applied for initialization , the superposed ac voltage prevents reorientation of the ferroelectric liquid crystal molecules in the pixel bi . secondly , during the first information writing period for pixel bi , t wb , in other words the first status holding period for pixel ai , a npn bipolar transistor 56 generates the bipolar signal pulse with 5 v ( vo ) amplitude illustrated by the waveform of common electrode c 2 voltage v c2 through an operation of an and gate 55 with a not gate 54 and an and gate 58 with a not gate 57 , both are connected respectively to the synchronous signal generating circuit 20 and the dividing signal generating circuit 30 . during the same period , in that the first information writing period t wb , a npn bipolar transistor 43 generates the ac signal voltage of 20 v ( vh ) and 10 khz schematically illustrated by the waveform of common electrode c 1 voltage v c1 through an operation of an oscillator element 41 and not gates 40 and 42 disposed between the npn bipolar transistor 43 and the dividing signal generating circuit 30 . further during the same period , in that the first information writing period t wb , since the data signal applied to the input terminal di of the cmos - ic driver dsi is low , the output signal of the cmos - ic driver dsi is an unipolar pulse with an amplitude of 5 v ( vo ) as illustrated in the waveforms of data signal di and signal voltage si like in the period t wa . as a result , a voltage pulse of 10 v ( 2 vo ) with half duration of t wb is applied on the pixel bi to turn on the same through reorientation of the ferroelectric liquid crystal molecules in the pixel bi as illustrated by the waveform of pixel bi voltage v bi and an ac voltage biased by the dc 5 v signal voltage is applied on the pixel ai to hold the previous status , in that on state , as illustrated by the waveform of pixel ai voltage v ai . t l is t wa + t wb , which is a period necessary to complete writing pixels for one line of a photosensitive drum for the line printer . although zero v period is included in the information writing period on pixels ai and bi as will be seen from the waveforms of pixel ai voltage v ai and pixel bi voltage v bi , no substantial status change of refractive indexes ( change in transmitted light amount ) of pixels ai and bi were not observed . moreover although the polarity of bias voltage on pixel ai during the second and fourth status holding periods for pixel ai is inverted from that of the previous information writing voltage applied on the pixel ai , no substantial status change of refractive index of the pixel ai was observed , because the amplitude of the bias voltage is limited as well as the application of the ac voltage superposed on the bias voltage . referring now to fig3 which rearranges two kinds of signal voltage waveforms applied to the signal electrodes , two kinds of common signal voltage waveforms applied to the common signal electrodes and resultant voltage waveforms obtained and applied on selected and non - selected pixels . these voltage waveforms also appear in fig2 . either a light transmitting signal voltage pulse 60 with an amplitude + vo and a duration t w or a light cutoff signal voltage pulse 61 with an amplitude - vo and a duration t w is applied to the signal electrodes . a bipolar signal pulse 62 with an amplitude ± vo and a total duration of t w is applied to one of the common signal electrodes which covers selected pixels on which information is desired to be written . an ac signal voltage 63 with an amplitude ± v h , preferably 20 - 30 v , a frequency of 5 - 30 khz and a duration t h is applied to the other common signal electrodes which cover non - selected pixels to hold the status written previously thereon . the duration t w is same as the duration t h , because the information writing period for the selected pixels covered by the one of the common signal electrodes is the status holding period for the non - selected pixels covered by the other common signal electrodes . either a dc voltage pulse 64 with an amplitude + 2 vo and a duration of t w / 2 or a dc voltage pulse 65 with an amplitude - 2 vo and a duration of t w / 2 is obtained depending on the combination of the signal voltage pulses 60 and 61 and the bipolar signal pulse 62 . the dc voltage pulses 64 or 65 is applied on the selected pixels to determine the status thereof . either an ac voltage 66 biased by the signal voltage pulse 60 or an ac voltage 67 biased by the signal voltage pulse 61 is obtained depending on the combination of the signal voltage pulses 60 and 61 and the ac signal voltage 63 . the ac voltage 66 or 67 is applied on the non - selected pixels to hold the status thereof . fig4 illustrates another example of a set of signal voltages applied to the signal electrodes , a set of common signal voltages applied to the common signal electrodes and the resultant voltages obtained and applied on selected and non - selected pixels . the voltage waveforms of a light transmitting signal voltage pulse 70 and a light cutoff signal voltage pulse 71 are same as those of the light transmitting signal voltage pulse 60 and the light cutoff signal voltage pulse 61 as illustrated in fig3 . the common writing signal voltage , which is applied to one of the common signal electrodes covering the selected pixels , is a bipolar signal pulse 72 with an amplitude ± 2 vo and a total duration of t w . the common status holding signal voltage , which is applied to the other of the common signal electrodes covering the non - selected pixels , is an ac signal voltage 73 same as the the ac signal voltage 63 illustrated in fig3 . the resultant voltages obtained and applied on the selected pixels are a bipolar pulse 74 with an amplitude of - vo and + 3 vo and a total duration of t w and a bipolar pulse 75 with an amplitude of - 3 vo and + vo and a total duration of t w . the + vo dc pulse included in the bipolar pulse 75 was observed not to cause any substantial change on the status of the pixel which was determined by the - 3 vo dc pulse included in the same bipolar pulse 75 . the voltage waveforms of ac voltages 76 and 77 obtained and applied on the non - selected pixels are same as those of the ac voltages 66 and 67 as illustrated in fig3 . fig5 illustrates still another example of a set of signal voltages applied to the signal electrodes , a set of common signal voltages applied to the common signal electrodes and the resultant voltages obtained and applied on selected and non - selected pixels . the signal voltages applied to the signal electrodes are a four polar signal pulse 80 with an amplitude ± vo and a total duration t w and another four polar signal pulse 81 with an amplitude ± vo and a total duration t w , another sense of polarity with the four polar signal pulse 80 , in other words alternate signal voltage pulses . the common writing signal voltage is a three polar signal pulse 82 with an amplitude ± 2 vo and a total duration of t w . the common status holding signal voltage is an ac signal voltage 83 same as the ac signal voltage 63 illustrated in fig3 . the resultant voltages obtained and applied on the selected pixels are one sense of four polar pulse 84 with an amplitude of ± vo and ± 3 vo and a total duration of t w and another sense of four polar pulse 85 with an amplitude of ± vo and ± 3 vo and a total duration of t w . the + vo dc pulse included in the four polar pulse 85 was observed not to cause any substantial change on the status of the pixel which was determined by the - 3 vo dc pulse included in the same four polar pulse 85 . the resultant status holding voltages obtained and applied on the non - selected pixels are a first ac biased ac voltage 86 by the four polar signal pulse 80 and a second ac biased ac voltage 87 by the four polar signal pulse 81 . since the first and second ac voltages 86 and 87 are ac biased , the status holding effect is enhanced , in other words , the response of the spontaneous polarization of the ferroelectric liquid crystal molecules to an applied electric field is alternated so as not to change substantially the status of the non - selected pixels , so that the amplitude of the common status holding ac signal voltage 83 is reduced . the 3 vo dc pulse width or duration included in the four polar pulse 84 and the - 3 vo dc pulse width or duration included in the four polar pulse 85 , which determined the status of the selected pixel , are selected to be sufficiently large enough to cause reorientation of the ferroelectric liquid crystal molecules in the selected pixels . | 8 |
with reference to fig4 - 0 , one embodiment of the invention provides an electronically implemented targeted communications method carried out by a host computer 62278 . the host computer 62278 can be viewed as having a function side 62278 - demand for processing communications from a potential buyer of a product and a function side 62278 - supply for processing communications from the seller of the product . with reference to fig1 - 2 , the host computer 62278 - demand receives a plurality of first electronic communications 10 from buyer - side users . each of the plurality of first electronic communications containing at least return address information for a potential buyer , store id information and product id information . with reference to fig1 - 5 , database records are formed in the host computer comprising the return address information for a plurality of addresses , store id information for a plurality of stores and product id information for a plurality of products . with reference to fig1 - 6 , the host computer transmits aggregate non - address information in communication 15 to the store recorded with the product in the database . with reference to fig1 - 7 , the process of unsatisfied demand information can be summarized from a buyer to the seller in accordance with an embodiment of the invention . with reference to fig2 - 2 , the host computer 62278 - supply then receives a plurality of second electronic communications containing at least store id information for the seller , product id information and new promotion information . a database is then formed in the host computer comprising the store id information for a plurality of stores , product id information for a plurality of products and new promotion information for a plurality of promotions . with reference to fig2 - 3 , the host computer associates ( a ) database records of first electronic communications 10 and ( b ) database records of second electronic communications 20 containing the same store id information and product id information and ( c ) forwards new promotion information in communication 25 to the return address of buyer - side users recorded with the same store and product in the database . with reference to fig2 - 6 , the process of modified supply information can be summarized from a seller to the buyer in accordance with an embodiment of the invention . with reference to fig3 - 1 , fig3 - 2 and fig3 - 3 , the host computer 62278 - demand receives a plurality of third electronic communications containing at least return address information for a potential buyer , store id information and product id information along with demographic information or perceived value information or product resolution information . with reference to fig3 - 4 , the host computer merges third electronic communications 30 into database records of first electronic communications 10 containing the same return address information , store id information and product id information . with reference to fig3 - 5 , the host computer transmits aggregate non - address information in communication 35 to the store recorded with the same product in the database . with reference to fig3 - 6 , the process of product r & amp ; d information can be summarized from a buyer to the seller in accordance with an embodiment of the invention . in this method , there is communication concerning an exchange opportunity between two parties . supply does sellers no good unless it can be matched with some corresponding demand . unsatisfied consumer demand information is observable and communicated to the proper supplier . new promotion information is properly targeted back to the potential buyer , who in effect is requesting to be notified of modified supply or new promotion information for the product under consideration . with reference to fig1 - 2 , because text messaging is becoming increasingly popular , it is contemplated that the plurality of first electronic communications 10 concerning unsatisfied product demand is transmitted in ( a ) mms protocol or ( b ) sms protocol . with reference to fig2 - 5a , new promotion information concerning modified product supply in communication 25 is transmitted to the return address recorded with the same store and product in the database in sms protocol . as technology progresses and becomes widely available , it is contemplated communications 10 and communications 25 will be transmitted with a proprietary image in mms , ems and other messaging protocols . with reference to fig1 - 5 , the plurality of first electronic communications 10 from a potential buyer preferably contains at least return address information representative of where the potential buyer would like to receive responsive communications concerning the product , store site information ( store id - site ) concerning the specific location the product was observed , product id information ( generally will comprise a product code selected from the group sku , upc , ean , gtin , vin , mls # and inventory numbers ) and date queued information concerning the date and time the first electronic communication 10 was transmitted to the host computer 62278 - demand . the host computer forms a database comprised of this information and with reference to fig1 - 6 , generates database reports of aggregate non - address information and transmits the reports to the associated seller in communication 15 and / or permits the seller to access the database for non - address information for analysis of aggregate product demand . with reference to fig2 - 2 , the plurality of second electronic communications 20 from the seller preferably contains at least store site information ( store id - site ) concerning the specific location the product is available , product id information ( generally will comprise a product code selected from the group sku , upc , ean , gtin , vin , mls # and inventory numbers ), new promotion information concerning the product , price schedule information including all past and present stages of product pricing , store name information corresponding to the store id information and product name information corresponding to the product id information . the host computer forms a database comprised of this information and with reference to fig2 - 3 , relates date queued information to price schedule information , store id information to store name information and product id information to product name information . with reference to fig2 - 4 , the host computer populates the consumer alert template with new promotion information , related price information , store name information and product name information . with reference to fig2 - 5 , the host computer transmits the consumer alert in communication 25 to the return address recorded with the same store and product in the database . with reference to fig3 - 4 , the plurality of third electronic communications 30 from a potential buyer preferably contains at least return address information , store id information and product id information along with residence information concerning the place the potential buyer resides , demographic information concerning the age , race and gender of the potential buyer , perceived value information concerning the potential buyer &# 39 ; s assessment of the product in demand and product resolution information concerning the outcome of the buyer - side / seller - side communication for the product . the host computer merges the plurality of third electronic communications into database records of first electronic communications containing the same return address information , store id information and product id information and with reference to fig3 - 5 , generates database reports of aggregate non - address information and transmits the reports to the associated seller in communication 35 and / or permits the seller to access the database for non - address information for analysis of aggregate product r & amp ; d . with reference to prior art in fig4 - 1 , concerning the circular flow of output and income . this model implies a complex interrelated web of decision making and economic activity . the preferences of buyers and sellers are registered on the demand and supply side of various product markets . consumers , unrestrained by government and with incomes from the sale of resources spend their dollars on those goods they are most willing and able to buy . these expenditures are “ dollar votes ” by which consumers communicate their wants through the demand side of the product market . the dollar votes of consumers play a key role in determining what products a profit seeking business will supply and at what cost . the problem which exist in this state of technology is the “ wall of uncertainty ”. this uncertainty results from a lack of buyer demand information communicated to the seller absent from purchase in the product market ( unsatisfied demand ). with reference to fig4 - 2 , it should be noted , however , the method would be operable from the consumers point of view without knowledge of aggregate demand information being communicated to the sellers . additionally , the seller could communicate information of modified product supply to prospective buyers only indirectly by means of the host computer . this method is preferred , however , since it will protect the buyer - side users from unsolicited seller - side spam . with reference to fig4 - 3 , we examine a hypothetical model making explicit use of the demand and supply components of microeconomics . a hypothetical illustration which explicitly embodies the formal components of economical analysis . the model explored emphasizes the interrelatedness of the many decision makers who comprise the purely competitive economy . it is an object of this invention to provide an alternative method of economic communication absent from purchase by means of a text message . in another embodiment of the invention , the method can be implemented by means of a communication system for a potential buyer of a product and a seller of the product . with reference to fig4 - 4 , the system comprises a buyer - side user input / output device , a host computer system provided with machine readable instructions for operability and a seller - side user input / output device . a buyer - side user input / output device is for transmitting at least return address information for responsive communications , store id information concerning the store of product observation and product id information concerning the particular product in demand to a host computer system . a host computer system is for receiving at least the return address information , store id information and product id information from a buyer - side user input / output device and electronically storing such information in a database record of unsatisfied demand . the host computer system is provided with operably associated computer instructions for generating database reports of aggregate product demand information sorted by store id and product id and optionally other key or key combination and transmitting the reports to a seller - side user input / output device and / or providing a seller - side user input / output device remote retrieval of information other than the address from database records of unsatisfied demand for seller analysis of aggregate product demand . a seller - side user input / output device is for receiving database reports of aggregate product demand information from a host computer system and / or requesting and retrieving information other than the address from a host computer system database for seller analysis of aggregate product demand and for transmitting at least store id information concerning the store of product availability , product id information concerning a product in supply and new promotion information concerning a new promotion extended to the potential buyer back to a host computer system . a host computer system is for further receiving at least the store id information , product id information and new promotion information from a seller - side user input / output device and further electronically storing such information in a database record of modified supply . the host computer system is further provided with operably associated computer instructions for associating store id and product id of a database record of unsatisfied demand with store id and product id of a database record of modified supply and forward at least new promotion information to the associated return address of a buyer - side user input / output device as a responsive communication . a buyer - side user input / output device is for receiving at least new promotion information from the host computer system and further transmitting at least return address information for responsive communications , store id information concerning the store of product observation and product id information concerning the product in demand along with demographic information concerning the potential buyer demographic or perceived value information concerning the potential buyer &# 39 ; s assessment of the product in demand or product resolution information concerning the outcome of the buyer - side / seller - side communication for the product to a host computer system . the host computer system is further provided with operably associated computer instructions for receiving from the buyer - side user input / output device , return address information , store id information and product id information along with demographic information or perceived value information or product resolution information and electronically merging such information in a database record of product r & amp ; d . the host computer system is further provided with operably associated computer instructions for generating database reports of aggregate product r & amp ; d information sorted by store id and product id or other key or key combination and transmitting the reports to a seller - side user input / output device and / or providing a seller - side user input / output device remote retrieval of information other than the address from database records of product r & amp ; d for seller analysis of aggregate product r & amp ; d . the seller - side user input / output device is for further receiving database reports of aggregate product r & amp ; d information from the host computer system and / or requesting and retrieving information other than the address from database records of product r & amp ; d for seller analysis of aggregate product r & amp ; d . the communications preferably contain additional data items as indicated elsewhere herein . the system makes the true state of unsatisfied demand and modified supply more readily known to market participants . communication is highly targeted , has at least implied consent to responsive communications and provides aggregate buyer - segmented demand information that can be used by seller - side users for a variety of analysis and planning purposes . a particular allocation of resources which is now most efficient is subject to change . as consumer preferences and technology change it is best to monitor the changing trends . by providing the seller access to reliable strategic information concerning the characteristics and / or thought process of the consumer whom they target , costs of decision making is reduced for a superior allocative solution . the system also communicates modified seller supply information to properly targeted buyer - side users and provides protection to consumers against unsolicited seller - side spam . it is an object of this invention to enhance economic communication of unsatisfied demand and modified supply by providing such a system . with reference to fig4 - 3 , the use of a communication system for unsatisfied demand and modified supply information requiring examination and systematic arrangement by a proprietary nabst ( notification and bookmark sales tool ) will streamline the process of economic exchange . generally any given product will be distributed to consumers on the basis of their ability and willingness to pay the existing market price for it . those buyers who are able and willing to pay that price will get a unit of the product ; those who are not , will not . when reluctant consumers normally disengage with passing desire , the nabst market mechanism engages them to remain active with their unsatisfied demand . where economic communication heretofore has typically been implied , economic communication hereafter involves meaningful messages between economic participants . for example , with reference to fig1 - 1 , a buyer - side user upon seeing an item of interest would follow posted instructions to provide in the outgoing message a proprietary code containing store and product information concerning an opportunity for exchange that exist . the potential buyer is requesting and consenting to future communications relating to that store and product . the nabst identifies the message or data export received from either participant to be a notification of unsatisfied demand or modified supply and is recorded for reference , creating the functional sales tool . with reference to fig2 - 0 , a buyer - side user of the nabst would effectively communicate their personal element of unsatisfied demand for a particular product to targeted seller - side users of the system , generally selected from dealers , retail stores and agents representing property . with reference to fig2 - 5 , a seller - side user of the nabst would effectively communicate modified supply or new promotional messages for a desired product to targeted buyer - side users of the system . the nabst provides consumer protection from unsolicited seller spam in this transaction . for obtaining the best results , the improved communication system comprises a multiplicity of buyer - side user input / output devices and a multiplicity of seller - side user input / output devices . for example , at least 1 , 000 buyer - side user input / output devices and at least 4 seller - side user input / output devices . a system this small would be beneficial in the automobile industry , for example . with reference to fig1 - 2 , for efficiency , it is contemplated the system utilizes handheld devices , pdas and cellular phones with imaging and / or messaging capabilities as the buyer - side user input / output device and the return address will comprise the phone number . the buyer - side user preferably transmits their phone number and a proprietary code known as the “ nab - it id ” to a host computer system by means of a message service protocol . with reference to fig1 - 0 , for efficiency and elimination of keystroke errors , it is contemplated that the nab - it id may comprise a proprietary image incorporating ocr ( optical character recognition ) labeling of proprietary fields . by utilizing the imaging device and cropping the image to effectively capture the information , the buyer - side user is eliminating the manual reproduction of the text based nab - it id . no additional software is required on the buyer - side user input / output device for interpretation or translation of the information . the image is delivered to the nabst by means of mms protocol or data export . the computer instructions associated with the host computer system are further capable of deriving store id - code information , store id - site information and product id information using ocr capabilities . geometric symbols frame the extremities of the image to help identify and correct distorted captures . unusable images are promptly identified by the nabst and a message is delivered to the buyer - side user input / output device requesting another submission of the nab - it id to the system . with reference to fig2 - 5 , in time , the host computer preferably transmits new promotion information to the buyer - side user input / output device by means of a text message . as technology progresses and becomes more widely available , for efficiency , it is contemplated the system will utilize handheld devices , pdas and cellular phones with additional rfid ( radio frequency id ) capabilities on the buyer - side user input / output device . additional software is required on the device to derive store id - code information , store id - site information and product id information required to compose the text based nab - it id . the information is delivered to the nabst by means of sms protocol or data export . with reference to fig2 - 1 , the seller - side user must identify the products to be monitored by the nabst and export initial supply information to the host computer system comprising at least store name information corresponding to the store id , product name information corresponding to the product id and price schedule information . because the absence of reliable information in the system tends to prevent the attainment of a superior allocative solution , the nabst verifies unsatisfied buyer - side demand for data integrity . with reference to fig1 - 3 , the host computer system ( a ) decodes the nab - it id information and ( b ) translates this information to a corresponding store name and product name for ( c ) buyer - side confirmation of unsatisfied demand . with reference to fig3 - 0 , upon a buyer - side users initial participation from a particular number , a security layer is observed for registration of web services . a temporary password is transmitted to the return address of the buyer - side user input / output device in sms protocol . with reference to fig1 - 4 , once registered with web services the store / product relationship is verified using buyer - side input in ( a ) sms protocol or ( b ) on a web - enabled device . confirmed unsatisfied demand information is then electronically recorded as an element of the buyer - side user personal product index . the product is then monitored by the individual and / or host , along with the rest of the products in their index , for modified supply coming into the nabst from seller - side users . for example ; reduced msrp , sale price , rebates , discontinuation , financing and other incentives . the host computer system utilizes this information to transmit new promotions by text message or electronic mail ( e - mail ) to the buyer - side user input / output device as a responsive communication , encouraging them to reevaluate their potential consumption of the desired product . with reference to fig1 - 5 , the communication system preferably comprises means for transmitting additional demand information from the buyer - side user input / output device , for example , date queued information concerning the date and time the product was queued for monitoring . with reference to fig2 - 2 , the communication transmitted from the seller - side user input / output device preferably also contains additional supply information , for example , price schedule information including date and time information for all past and present stages of product pricing , store name information concerning the store outlet name and product name information concerning the product label . the computer instructions operably associated with the host computer system are capable of relating date queued information to price schedule information to establish a queued price reference relative to the new promotion . additionally , product demand is more elastic the longer the time period under consideration . date and time information in the database could be used by sellers to weed out stale leads . it is well known to those familiar with economics , that geographic location may be important directly as a cost driver . the location of the buyer &# 39 ; s primary dwelling emerges as the most important geographic segmentation variable even though the buyer may use the product somewhere else . with reference to fig3 - 1 , the communication system preferably comprises means for transmitting the buyer - side user zip code to the nabst during a user profile procedure . where reports are to be generated , the computer instructions associated with the host computer system are preferably capable of sorting unsatisfied demand information based on buyer - side user zip code and transmit the report to the seller - side user having the location , or marketing power in the location . buyer demographic can be a proxy for the desired product attributes , price sensitivity and other signaling criteria . additionally , the communication system preferably comprises means for transmitting the buyer - side user demographic information to the nabst during the user profile procedure . for example , some key factors may include : age group , race , gender , household size , decision maker and occupation of the potential buyer . where reports are to be generated , the computer instructions associated with the host computer system are preferably further capable of reporting demographic breakdown of unsatisfied product demand . potential buyers of a product not currently purchasing may also constitute a buyer segment . it is well known to those familiar with economics , that a firm or household does not purchase a product ; individual decision makers do . both actual value and signals of value are assessed and interpreted by these decision makers . purchase criteria is in meeting perceived value for the buyer . with reference to fig3 - 2 , the communication system preferably comprises means for transmitting buyer - side perceived value information from the buyer - side user input / output device . or alternatively , perceived value information could be transmitted to the nabst during an sms alert preference procedure . where reports are to be generated , the computer instructions associated with the host computer system are preferably capable of charting aggregate perceived value information and transmitting the report to the seller - side user whose potential buyers are reflected in the report . the competitive firm does not have a price policy ; that is , the ability to freely adjust price . rather , the firm can merely adjust to the socially optimal price . the competitive seller is a price taker rather than a price maker . evidence concerning the economic effects of modified prices is mixed because studies are plagued by data problems and difficulties in determining cause and effect . with reference to fig3 - 3 , the communication system preferably comprises means for transmitting if a particular product was purchased and from which seller . the buyer - side user product resolution information could be transmitted to the nabst during a seller / product closure survey procedure . with reference to fig3 - 4 , the computer instructions associated with the host computer system are preferably capable of merging the communications for a particular buyer / seller product relationship into records of buyer - segmented product r & amp ; d for seller - side analysis . with reference to fig3 - 5 , simultaneous benefits include lower cost of marketing research and lower marketing overhead for acquiring equivalent information . if society registers votes for consumer goods , individual producers and resource suppliers can only adjust to the wishes of buyers as tabulated and communicated by the market system . in communicating between entities with messaging enabled devices , the computer networks have as their job to enable the information space and perform administration . it makes more sense to also bring computers more into the action , to put their analytical power to work in translation , making sense of the vast content . the nabst connects massive data sets allowing statistical algorithms to find economic patterns with unprecedented fidelity . incoming communications from buyer - side users are preferably analyzed using seller provided criteria , either by seller - side users after retrieval of the necessary unsatisfied demand data from the nabst or in the host computer system with reports generated and transmitted to the seller - side user input / output device associated with such demand . for example , the analysis can summarize unsatisfied product demand with preferential emphasis in various areas such as : ( 1 ) identification of product demand by geographic region or store site , ( 2 ) identification of product demand by buyer demographic , ( 3 ) resolution of buyer / seller communication regarding a product in demand , ( 4 ) identification of a potential buyer &# 39 ; s perceived value for a product in demand , ( 5 ) with reference to fig4 - 5 , the direct relationship of product demand to guide equilibrium supply and equilibrium pricing , ( 6 ) identification of potential supply chain management issues concerning future consumption of a particular product . analysis of unsatisfied demand and modified supply information can be used to trace interactions between various product markets . with reference to fig2 - 1 , where opportunity to stimulate consumption is identified , new promotion information is exported from the seller - side user input / output device to the host computer to implement the new promotion . it is contemplated that in time , with significant accumulation of statistical data concerning buyer - segmented cause and effect in a particular product market . the host will provide services which factor in numbered units of available seller supply in addition to all r & amp ; d variables present in the current environment of demand to guide in the rationing function of equilibrium product supply and pricing . it is well known to those familiar with commerce that satisfying buyer needs is at the core of success in any business endeavor . a firm can differentiate itself by satisfying buyer needs better than its competitors . information may be a mechanism through which a firm can increase its share of the market and strengthen consumer loyalty to its particular product . the improved communication system can be implemented for various business industries . in addition to retail , some sectors that are to be targeted include motor vehicle sales and real estate . the process would be used in the same way with the exception of the actual format of the product id information comprising the nab - it id . along with using sku , upc , ean and gtin codes , the product id for the new sectors could be comprised of , but not limited to , vin , mls # and inventory numbers . a decision maker will generally adopt a new way of doing something when the cost - benefit ratio is favorable over alternative methods for completing the equivalent task . economic efficiency results when maximum benefits are received at minimum cost from resources available . simultaneous benefits can be realized while reducing cost for both sellers and buyers . in reducing seller cost , the system utilizes the most efficient communication technology available to effectively fill a perceived seller need better , longer and at a lower cost . targeted seller needs include but are not limited to : ( 1 ) reliable information concerning the state of unsatisfied demand for the consumer they target , ( 2 ) ability to engage consumer desire at the point of observation , ( 3 ) a new sales tool improving access to targeted buyers for responsive stimulation , ( 4 ) reliable information for a greater allocative solution , ( 5 ) strategic information concerning buyer - segmented product r & amp ; d , ( 6 ) improved consumer confidence and loyalty . the competitive market contains the incentive for technological advance . benefits of new cost - cutting techniques give the innovating firm at least a temporary advantage over its rivals . lower costs mean economic profits for the pioneering firm . by passing part of this cost reduction to the consumer through lower product price , the firm can increase sales and obtain economic profits at the expense of rival firms . the inexpensive means of acquiring and providing useful information to consumers lowers search costs . the lower product price which the technological advance permits will cause the innovating firm to expand . in reducing buyer cost , the system utilizes the most efficient communication technology available to effectively fill a perceived buyer need better , longer and at a lower cost . targeted buyer needs include but are not limited to : ( 1 ) a new buying approach improving access to reliable seller information concerning a product , ( 2 ) ability to monitor exclusive products free from unsolicited seller spam , ( 3 ) a new consumer tool reducing time and exertion using forward integration to take over routine buyer function , ( 4 ) new promotions encouraging product consumption , ( 5 ) perceive seller interest in consumer well - being . benefits of the new cost - cutting techniques enhance buyer convenience . timely information regarding prices assist rational and efficient decisions regarding consumption . ultimately consumers realize the “ income effect ”, the impact of a change in price on a consumers real income and purchasing power . while certain preferred embodiments of the invention have been described herein , the invention is not to be construed as being so limited , except to the extent that such limitations are found in the claims . | 6 |
the following description is merely exemplary in nature of the subject matter , manufacture , and use of one or more inventions , and is not intended to limit the scope , application , or uses of any specific invention claimed in this application or in such other applications as may be filed claiming priority to this application , or patents issuing therefrom . the present disclosure relates to methods involving egfr signal transduction as it relates to photoaging . uv - based inhibition of receptor type protein - tyrosine phosphatase kappa ( rptp - κ ) activity can increase egfr activity . preventing the oxidation of rptp - κ can attenuate the egfr signal cascade . the biological effects of uv irradiation occur as a consequence of absorption of electromagnetic energy by certain molecules within all cells . excess energy is dissipated either by chemical modification of the absorbing molecule and / or transfer of some portion energy to an acceptor molecule . molecular oxygen , which is present in high concentrations in eukaryotic cells , can readily accept energy from uv - irradiation absorbing molecules . this photochemical activation of molecular oxygen generates reactive oxygen species ( ros ), which can oxidize cellular constituents including proteins , lipids , and nucleic acids . members of the protein - tyrosine phosphatase ( ptp ) family contain an active site cysteine residue that is required for phosphohydrolase activity . this active site cysteine is highly susceptible to oxidation , particularly by hydrogen peroxide ( h 2 o 2 ). the pka of the cysteine within the active site is relatively low ( 5 . 5 ) at physiological ph , which promotes formation of the reactive thiolate form . the thiolate reacts readily with h 2 o 2 to form a stable sulfenic acid , or sulfenyl - amide species , which renders the phosphatase catalytically inactive . the reversible oxidative inactivation of ptp activity can occur as a consequence of ros generated in response to growth factor and cytokine receptor activation , and regulates tyrosine phosphorylation - dependent signal transduction pathways . oxidative inhibition of ptp activity by ros may be a mechanism for activation of egfr by uv irradiation . investigation of this mechanism is hindered by lack of knowledge regarding phosphatases that directly regulate egfr at the cell surface . receptor - type protein - tyrosine phosphatase kappa ( rptp - κ ) as a regulator of egfr tyrosine phosphorylation , in human keratinocytes . rptp - κ directly dephosphorylates egfr in vitro , and functions in cells to maintain low levels of egfr tyrosine phosphorylation in the absence of ligand . rptp - κ counteracts egfr intrinsic tyrosine kinase activity by preferentially dephosphorylating egfr tyrosine residues # 1068 and # 1173 . the present disclosure demonstrates that activation of egfr by uv irradiation is mediated by oxidative inhibition of rptp - κ activity . to illustrate the role of rptp - κ in uv irradiation regulation of egfr tyrosine phosphorylation , effects of reactive oxygen species ( ros ) on purified rptp - κ activity and egfr tyrosine phosphorylation in vitro are examined . with reference to fig1 , oxidative inhibition of rptp - κ activity is shown to enhance egfr tyrosine phosphorylation in vitro . shown in panel a , purified rptp - κ glutathione s - transferase fusion protein was incubated with the indicated concentrations of h 2 o 2 at room temperature for 30 min . rptp - κ activity was measured using phospho - egfr peptide as substrate . *, p & lt ; 0 . 05 versus control . shown in panel b , purified egfr , supplemented with egf and atp / mg 2 + , was incubated with the indicated concentrations of h 2 o 2 at room temperature for 30 min . samples were subjected to western analysis for egfr tyrosine phosphorylation . levels of phosphorylated egfr were quantified by chemifluorescent detection . shown in panel c , purified egfr , supplemented with egf and atp / mg 2 + , and purified rptp - κ glutathione s - transferase fusion protein were incubated together in the presence or absence h 2 o 2 ( 100 μm ), at room temperature for 30 min . tyrosine phosphorylation of egfr was quantified by chemifluorescence , as described for panel b . results are mean ± s . e . for three independent experiments . *, p & lt ; 0 . 05 versus h 2 o 2 - treated . addition of hydrogen peroxide ( h 2 o 2 ) caused dose - dependent inhibition of rptp - κ activity , with 80 % loss of activity observed at 100 μm ( fig1 a ). in the presence of atp / mg 2 + , purified egfr was phosphorylated by its intrinsic tyrosine kinase activity . in contrast to rptp - κ , h 2 o 2 had no direct effect on tyrosine phosphorylation of purified egfr , in vitro ( fig1 b ). incubation of purified rptp - κ and egfr together resulted in a low level of steady state egfr tyrosine phosphorylation , representing the balance between the rates of tyrosine kinase and tyrosine phosphatase activities . in the presence of h 2 o 2 , which inhibits rptp - κ , egfr tyrosine phosphorylation increased to the level observed in the absence of rptp - κ ( fig1 c ). these data provide proof of concept for rptp - κ dependent regulation of egfr tyrosine phosphorylation by ros , in a cell - free system . as used herein , “ inhibit ” generally means a statistically significant reduction from normal levels as opposed to complete elimination . to further illustrate effects of uv irradiation on the regulation of egfr tyrosine phosphorylation by rptp - κ , a model mammalian cell system is used . chinese hamster ovary ( cho ) cells do not express either egfr or rptp - κ . with reference to fig2 , rptp - κ is shown to reduce constitutive egfr tyrosine phosphorylation and confer uv induction of egfr tyrosine phosphorylation in cho cells . cho cells were transfected with prk5 egfr expression vector and empty or rptp - κ vector . one day after transfection , cells were mock ( no uv ) or uv irradiated ( 50 mj / cm 2 ). whole cell lysates were prepared 10 min post - treatment and subjected to western analysis for total egfr and tyrosine - phosphorylated egfr . levels of immunoreactive egfr were quantified by chemifluorescent detection . results are mean ± s . e . of three independent experiments ; *, p & lt ; 0 . 05 . inset shows a representative image of chemifluorescent immunoreactive bands . transient transfection of cho cells with egfr expression vector resulted in high level of constitutive ( i . e ., in the absence of ligand ) egfr tyrosine phosphorylation ( fig2 ). this constitutive egfr tyrosine phosphorylation was abolished by specific egfr tyrosine kinase inhibitor pd169540 , indicating tyrosine phosphorylation was due to intrinsic tyrosine kinase activity ( data not shown ). also shown in fig2 , exposure of egfr - expressing cho cells to uv irradiation did not further increase egfr tyrosine phosphorylation . however , co - expression of egfr with rptp - κ substantially reduced egfr tyrosine phosphorylation . uv irradiation of cho cells expressing both egfr and rptp - κ increased the level of egfr tyrosine phosphorylation to the level observed in the absence of rptp - κ ( fig2 ). these data demonstrate that rptp - κ is required for uv irradiation induction of egfr tyrosine phosphorylation , in the cho cell model system . rptp - κ has a role in uv irradiation regulation of egfr tyrosine phosphorylation in human keratinocytes . in addition to expressing both egfr and rptp - κ , keratinocytes express several egfr ligands , including transforming growth factor - alpha ( tgf - α ), amphiregulin , hb - egf , betacellulin , and epiregulin . to examine potential involvement of ligand - binding in uv irradiation induction of egfr tyrosine phosphorylation , a neutralizing monoclonal antibody that blocks ligand binding to egfr was used . with reference to fig3 , uv - induced egfr tyrosine phosphorylation is shown to be ligand - independent and mediated by oxidative inhibition of rptp - κ in primary human keratinocytes . shown in panel a , primary human keratinocytes were treated with control igg 1 or egfr antibody la1 ( 1 μg / ml ), which blocks ligand binding , as indicated . cells were then treated with vehicle ( ctrl ), or egf ( 10 ng / ml ) for 10 min , or uv irradiated ( 50 mj / cm 2 ) and harvested 15 min post irradiation . whole cell lysates were subjected to western analysis for total egfr and tyrosine - phosphorylated egfr . levels of immunoreactive egfr were quantified by chemifluorescent detection . results are mean ± s . e . of three independent experiments ; *, p & lt ; 0 . 05 . inset shows a representative image of chemifluorescent immunoreactive total and phospho - egfr proteins . shown in panel b , human keratinocytes were uv - irradiated ( 50 mj / cm 2 ), and whole cell lysates were prepared at the indicated times . rptp - κ and β - actin ( internal control ) were detected by western blot , and quantified by chemifluorescent detection . results are mean ± s . e . of three independent experiments ; *, p & lt ; 0 . 05 . inset shows a representative image of chemifluorescent immunoreactive rptp - κ and β - actin proteins . shown in panel c , primary human keratinocytes were mock ( no uv ) or uv irradiated ( 50 mj / cm 2 ), and whole cell lysates were prepared 5 min post - uv irradiation . rptp - κ was immunoprecipitated , and phosphatase activity was determined using a tyrosine - phosphorylated egfr peptide as substrate . phosphatase activity was normalized to rptp - κ protein content in the immunoprecipitates , which was quantified by western analysis using chemifluorescent detection . results are mean ± s . e . of three independent experiments ; *, p & lt ; 0 . 05 . shown in panel d , primary human keratinocytes were mock or uv - irradiated ( 50 mj / cm 2 ), and whole cell lysates were prepared in buffer containing iodoacetic acid ( iaa , 10 mm ) to irreversibly inhibit non - oxidized protein - tyrosine phosphatase activity , 5 min post - uv irradiation . endogenous rptp - κ was immunoprecipitated , and assayed for activity in buffer containing dithiothreitol to reduce oxidized rptp - κ to restore enzymatic activity , using a tyrosine - phosphorylated egfr peptide as substrate . results are mean ± s . e . of three independent experiments ; *, p & lt ; 0 . 05 . shown in panel e , rptp - κ was immunoprecipitated from mock or uv - irradiated human keratinocytes , and the immunoprecipitates were treated with dtt to reduce oxidized rptp - κ , as described above for panel c . reduced rptp - κ was irreversibly oxidized by pervanadate , and oxidized ( ox - ptp ) and total rptp - κ were detected by western blot , using specific antibodies . results are mean ± s . e . of three independent experiments ; *, p & lt ; 0 . 05 . inset shows a representative image of chemifluorescent immunoreactive total and oxidized rptp - κ protein . while the egfr antibody la1 reduced egf - induced egfr tyrosine phosphorylation to near basal levels , it had no significant effect on uv irradiation induction of egfr tyrosine phosphorylation ( fig3 a ). this result indicates that ligand - binding has little , if any , role in activation of egfr by uv irradiation . this conclusion is consistent with the model that the egfr ligand - binding domain is not required for uv irradiation induction of egfr tyrosine phosphorylation . the experiments also determined whether uv irradiation altered rptp - κ expression in human keratinocytes . no changes in rptp - κ protein levels following uv irradiation were found ( fig3 b ). accordingly , further examination was made into the effect of uv irradiation on rptp - κ activity in human keratinocytes . for these studies , keratinocytes were mock - exposed or exposed to uv irradiation ( 50 mj / cm 2 ) and harvested in lysis buffer five minutes post uv irradiation . rptp - κ was immunoprecipitated , and its activity measured by dephosphorylation of a phosphotyrosine - containing synthetic peptide substrate , derived from the amino acid sequence of the egfr ( amino acids 1164 - 1176 ). uv irradiation reduced rptp - κ activity in human keratinocytes more than 60 %, compared to mock - irradiated cells ( fig3 c ). although uv irradiation has been reported to reduce protein levels of ptp 1b and lar in certain cell types though activation of proteolytic cleavage , no reduction of rptp - κ protein level in human keratinocytes was found within 90 minutes following uv irradiation ( data not shown ). these data therefore indicate that uv irradiation inhibits rptp - κ activity in human keratinocytes . to determine whether inhibition results from oxidation , iodoacetic acid was included in the lysis buffer that was used to harvest cells following mock or uv irradiation . iodoacetate forms a stable adduct with non - oxidized , but not with oxidized , cysteine thiols . therefore nonoxidized rptp - κ is irreversibly inhibited by iodoacetate , whereas oxidized rptp - κ is not . the activity of oxidized , but not acetylated , rptp - κ can be restored by reduction with dtt . immunoprecipitates from mock - irradiated keratinocytes , prepared in the presence of iodoacetate , and treated with dtt , contained four times less rptp - κ activity , compared with immunoprecipitates from uv - irradiated cells ( fig3 d ). these data indicate that uv irradiation caused oxidation of rptp - κ , which protected it against acetylation , in human keratinocytes . to confirm that uv irradiation leads to oxidation of rptp - κ in human keratinocytes , an antibody that specifically recognizes the oxidized active site of protein - tyrosine phosphatases was utilized . rptp - κ was immunoprecipitated from keratinocytes following mock exposure or exposure to uv irradiation . immunoprecipitated rptp - κ was analyzed for active site oxidation by western analysis . the level of oxidized rptp - κ was increased 3 - fold in uv - irradiated , compared with non - irradiated keratinocytes ( fig3 e ). expression of exogenous rptp - κ confers uv irradiation induction of egfr tyrosine phosphorylation , in cho cells ( fig2 ). keratinocytes , however , express endogenous rptp - κ . therefore , sirna - mediated knockdown was utilized to examine the role of rptp - κ in uv irradiation regulation of egfr tyrosine phosphorylation . with reference to fig4 , knockdown of rptp - κ is shown to increase egfr tyrosine phosphorylation in primary human keratinocytes . shown in panel a , human keratinocytes were transfected with scrambled control ( ctrl ) or rptp - κ sirna . two days post - transfection , whole cell lysates were prepared and analyzed for rptp - κ and β - actin ( internal control ) proteins by western blot . results are mean ± s . e . of three independent experiments ; *, p & lt ; 0 . 05 . inset shows a representative image of chemifluorescent immunoreactive rptp - κ and β - actin proteins . shown in panel b , two days after transfection with control ( ctrl ) or rptp - κ sirna , keratinocytes were uv irradiated ( 50 mj / cm 2 ). whole cell lysates were prepared 15 min post - uv irradiation and analyzed for total egfr and tyrosine - phosphorylated egfr western blot . results are mean ± s . e . of three independent experiments ; *, p & lt ; 0 . 05 . inset shows a representative image of chemifluorescent immunoreactive total and phospho - egfr ( py - egfr ) proteins . shown in panel c , keratinocytes were transfected with control ( ctrl ) or rptp - κ sirna and treated with control igg or neutralizing anti - egfr antibody . two days post - transfection , whole cell lysates were prepared and total and tyrosine - phosphorylated egfr were quantified by elisa . results are mean ± s . e . of three independent experiments ; *, p & lt ; 0 . 05 . transient transfection of rptp - κ sirna caused 80 % and 70 % reduction of rptp - κ mrna and protein ( fig4 a ), respectively . knockdown of rptp - κ had no effect on gene expression levels of other related rptps expressed in keratinocytes ( rptp - μ , - β , - δ , or - ζ ). uv irradiation induced egfr tyrosine phosphorylation nearly 5 - fold in keratinocytes transfected with scrambled control sirna ( fig4 b ), similar to that observed in nontransfected keratinocytes ( fig3 ). knockdown of rptp - κ increased egfr tyrosine phosphorylation in non - irradiated keratinocytes nearly 4 - fold . exposure to uv irradiation further increased egfr tyrosine phosphorylation only 20 % ( fig4 b ). addition of egfr antibody that blocks ligand binding had no effect on increased egfr tyrosine phosphorylation induced by rptp - κ knockdown ( fig4 c ). these data indicate that normal levels of rptp - κ function to maintain low basal egfr tyrosine phosphorylation . in the presence of reduced levels of rptp - κ , basal egfr tyrosine phosphorylation is increased , and therefore can only be marginally further increased by uv irradiation . in the presence of normal levels of rptp - κ , basal egfr tyrosine phosphorylation is low , and oxidative inhibition of rptp - κ by uv irradiation alters the egfr tyrosine kinase / phosphatase balance to elevate egfr tyrosine phosphorylation . uv irradiation can damage skin cells , and with sufficient damage , induce apoptosis . in human keratinocytes , egfr protects against uv - induced apoptosis , primarily through activation of the phosphatidylinositol 3 - kinase / atk pathway . therefore , whether overexpression of rptp - κ could modulate uv irradiation - induced dna fragmentation ( a marker of apoptosis ) in human keratinocytes was examined . with reference to fig5 , rptp - κ is shown to enhance uv irradiation - induced dna fragmentation . human primary keratinocytes were infected with either empty or rptp - κ adenovirus . cells were mock or uv irradiated 2 days post - infection . six hours post - uv irradiation , cells were lysed , and dna fragmentation was measured by elisa . results are mean ± s . e . of three independent experiments ; *, p & lt ; 0 . 05 rptp - κ versus empty vector . at a dose of 50 mj / cm 2 , uv irradiation did not cause significant dna fragmentation , compared with mock irradiation , in keratinocytes infected with control vector ( fig5 ). in contrast , this dose of uv irradiation causes a significant increase of dna fragmentation in keratinocytes overexpressing rptp - κ ( fig5 ). higher doses of uv irradiation ( 70 - 90 j / cm 2 ) caused increased dna fragmentation in both control and rptp - κ overexpressing cells . however , increased expression of rptp - κ caused increased levels of dna fragmentation , at all doses of uv irradiation . rptp - κ expression and regulation by uv irradiation in human skin in vivo is illustrated as follows . epidermis primarily consists of stratified layers of keratinocytes . the lowest layer of keratinocytes ( basal keratinocytes ) undergoes cell division . daughter cells ( suprabasal keratinocytes ) migrate upward towards the surface , and , as they migrate , undergo a coordinated complex program of maturation . suprabasal keratinocytes normally do not proliferate . with reference to fig6 , localization of rptp - κ and inhibition of rptp - κ activity by uv irradiation of human skin in vivo is illustrated . shown in panel a , is rptp - κ mrna expression in human epidermis , detected by in situ antisense probe hybridization . sense probe served as control for specificity of hybridization . shown in panel b , rptp - κ protein expression in human epidermis , detected by immunohistochemistry . preimmune serum and neutralization of rptp - κ antibody ( ab ) with immunogenic peptide were used as controls for specificity of staining . shown in panel c , co - localization of egfr ( green ) and rptp - κ ( red ) proteins in human epidermis , detected by double immunofluorescence staining . shown in panel d , sun - protected buttocks skin of human subjects was exposed to twice the minimal erythema dose of uv irradiation . samples from non - irradiated and uv - irradiated skin were obtained 30 min post - irradiation . rptp - κ was immunoprecipitated and analyzed by western blot , using chemifluorescent detection . results are mean ± s . e . of five independent experiments . shown in panel e , rptp - κ in immunoprecipitates obtained from non - irradiated and uv - irradiated human skin , as described for panel d , were assayed for activity , using a tyrosine - phosphorylated egfr peptide as substrate . results are mean ± s . e . of three independent experiments ; *, p & lt ; 0 . 05 . color versions of panels a , b , and c are found in xu et al ., j . of biol . chem , vol . 281 , no . 37 , pp . 27389 - 27397 , sep . 15 , 2006 . it was discovered that rptp - κ mrna is expressed predominantly in suprabasal keratinocytes ( fig6 a ). a similar pattern of expression for rptp - κ protein is observed ( fig6 b ). egfr protein , the substrate for rptp - κ , was expressed throughout the epidermis in both basal and suprasbasal keratinocytes ( fig6 c ). erk map kinase is a major egfr effector in many cells , including human keratinocytes . uv irradiation activates erk1 / 2 in human keratinocytes in skin in vivo , and this activation is dependent on egfr . in view of the experiments described herein , the observation that the localization of activated erk closely coincides with that of rptp - κ in uv irradiated human skin can now be explained by uv irradiation oxidative inhibition of rptp - κ leading to egfr - dependent erk activation of suprabasal keratinocytes in human skin in vivo . egfr is a major activator of the mitogenic pathway in basal keratinocytes . accordingly , predominant expression of the inhibitor rptp - κ in non - proliferating suprabasal keratinocytes is consistent with its role in limiting egfr tyrosine phosphorylation . the observation by xu , y et al . ( 2005 ) j . biol . chem . 280 , 42694 - 42700 that overexpression of rptp - κ in cultured basal keratinocytes completely inhibits proliferation provides additional support for this notion . exposure of human skin in vivo to uv irradiation increases egfr tyrosine phosphorylation , as described by fisher , g ., et al . ( 1998 ) j clin invest 101 , 1432 - 1440 ). increased tyrosine phosphorylation was maximal ( 5 - fold ) 30 minutes after exposure ( ibid .). to determine the effect of uv irradiation on rptp - κ , sun - protected buttock skin of human adult subjects was exposed to uv irradiation , and skin samples were obtained 30 minutes post exposure . uv irradiation had no effect on rptp - κ protein level in human skin in vivo ( fig6 d ), consistent with the effects observed in cultured keratinocytes ( fig3 b ). in contrast , uv irradiation inhibited rptp - κ activity more than 60 % ( fig6 e ). these results are similar to those obtained in cultured keratinocytes , and provide support for rptp - κ as a critical regulator of egfr tyrosine phosphorylation in uv - irradiated human skin in vivo . activation of signal transduction cascades and concomitant alterations in genes that occur in skin cells in response to exposure to uv irradiation are largely dependent on increased egfr tyrosine phosphorylation . in human skin , egfr - dependent responses are critical elements in the pathophysiology of uv irradiation induced cancer and aging . currently , with the exception of sunscreens , there are no effective measures for preventing these serious solar uv irradiation - induced skin conditions . the present data demonstrate that oxidative inhibition of rptp - κ is a central mechanism by which uv irradiation activates egfr in human skin . anti - oxidants , as topical preparations or dietary supplements , have gained popular attention with claims for a multiplicity of health benefits . however , these claims have been difficult to substantiate . one reason for this difficulty is lack of specific molecular targets for assessment of anti - oxidant effect . the present disclosure identifies rptp - κ as a key molecular target for anti - oxidant action for prevention of the primary manifestations of solar uv irradiation induced skin damage . as such , the present disclosure provides in vitro and in vivo methods for selection and application of treatments and compounds that are operable to protect rptp - κ activity from oxidation mediated by uv irradiation or any other insult . protection of rptp - κ activity may prevent or reduce the effects of photoaging and uv irradiation damage to cells . regardless the insult , measurement of rptp - κ levels and activities before and after challenge by the insult can be used to ascertain whether the insult is actually detrimental to the natural , endogenous egfr signaling that is attenuated by rptp - κ activity . if the insult is detrimental , measurement of the same with and without a candidate treatment or composition can screen for therapeutically useful treatments and / or compositions . an “ insult ” is something that causes or has potential to cause injury to body tissues and as used herein means any phenomenon or compound that generates reactive oxygen species , such as peroxides , or otherwise inhibits rptp - κ , directly or indirectly . uv irradiation and various compounds ( e . g ., h 2 o 2 ) can cause the formation of reactive oxygen species . this includes endogenous compounds such as nadph oxidase , which is normally latent in neutrophils and is used by those cells to generate superoxide in phagosomes to degrade ingested bacteria and fungi . compounds such as paraquat ( n , n ′- dimethyl - 4 , 4 ′- bipyridinium dichloride ) and similar quaternary ammonium herbicides are easily reduced to a radical that generates superoxide . additionally , treatment of most cell types with growth factor or cytokine not only increases growth factor receptor activity , but also nadph oxidase activity . the present disclosure thus enables determining whether a variety of insults inhibits the activity of rptp - κ and the ability of rptp - κ to dephosphorylate egfr . the present disclosure therefore provides methods for determining whether an insult affects rptp - κ activity . these include providing cells expressing rptp - κ and measuring initial rptp - κ activity . the cells are then exposed to the insult and rptp - κ activity again measured . the insult is identified as affecting rptp - κ activity if the rptp - κ activity measured after exposure to the insult is different than the rptp - κ activity prior to the insult . the method may further employ cells that also express egfr . in this case , initial egfr phosphorylation is measured and egfr phosphorylation is again measured after exposure to the insult . the insult is then identified as inhibiting rptp - κ activity if rptp - κ activity measured after exposure to the insult is decreased relative to initial rptp - κ activity prior to the insult and egfr phosphorylation is increased relative to initial egfr phosphorylation . the insult may be uv irradiation and the cells may be cultured cells . measuring rptp - κ activity may include at least one of measuring the oxidative state of rptp - κ and measuring phosphatase activity of rptp - κ . another method for the identification of an insult includes the following . with respect to the procedures described herein , egfr tyrosine phosphorylation , rptp - κ levels , and / or rptp - κ activity of transfected cho cells are measured before and after exposure of the cells to an insult ( e . g ., uv irradiation , reactive oxygen species , etc .). a statistically significant increase in egfr phosphorylation or decrease in rptp - κ levels or activity indicates that the insult is detrimental to rptp - κ and / or an egfr activator . having identified an insult , the present disclosure provides methods for determining whether a treatment and / or composition protect rptp - κ activity from the insult . a cell having a known rptp - κ activity is provided and the composition is administered to the cell . the cell is exposed to the insult and activity of the rptp - κ in the cell after exposure to the insult is measured . the composition is identified as protecting rptp - κ activity if the measured activity of the rptp - κ in the cell after exposure to the insult is about the same as the known rptp - κ activity or rptp - κ activity before the insult . the rptp - κ protein level in the cell may be measured after exposure to the insult . another method for evaluating a treatment and / or composition includes the following . having followed the present methods and procedures , or otherwise identifying an insult that inhibits rptp - κ activity , and having a candidate treatment or composition , the experimental procedures as described with respect to fig3 may be used ( analogous to the use of dtt ) where rptp - κ activity is measured with and without the candidate compound , optionally at varying doses , after exposure to uv . a cell free assay may be used to determine if rptp - κ is inhibited , and whether a candidate compound protects rptp - κ from oxidate inactivation . high throughput screening ( hts ), a well - known automated screening method , can be used with cells or in a cell free manner to screen for compounds that inhibit rptp - κ and for compounds that protect rptp - κ activity . after the candidate compound is confirmed as protecting rptp - κ in the presence of the insult , it can be formulated into a form suitable for a desired route of administration . as another example , the present methods demonstrate that laminaria japonica extract inhibits uv irradiation - induced egfr activation in human primary keratinocytes . several candidate treatments and compounds are examined for their affect on rptp - κ activity and / or egfr phosphorylation . the present methods have been applied to laminaria japonica extract ( lje ), porphyra haitanensis ( phe ) extract , or resveratrol ( rv ). the lje and phe are prepared by grinding each seaweed into a particulate form and performing liquid phase extractions . various organic and aqueous solvents can be used to prepare extracted material , for example , alcohol such as methanol , organic solvent such as hexane , and water were used to prepare extracts from laminaria japonica and porphyra haitanensis . in the case of laminaria japonica , extraction with methanol was found to contain activity that inhibits uv irradiation - induced egfr activation . preparations of aqueous lje and hexane lje did not contain the same extent of activity . none of the methanol , aqueous , and hexane extracts of porphyra haitanensis contained such activity . likewise , resveratrol did not exhibit activity that inhibits uv irradiation - induced egfr activation . the various extracts may be used as is or may be concentrated , for example , by filtration or evaporation of liquid . the various extracts may be dried under vacuum ( e . g ., freeze dried or lyophilized ) and the residue may be resuspended in or mixed with a different vehicle or solvent . for example , the methanol extract can be lyophilized and resuspended in an aqueous buffer . alternatively , the dried or partially dried extract may be resuspended in a vehicle for topical application to skin , such as a lotion , cream , or ointment . these vehicles may be further formulated with other ingredients into sunscreens , for example . sunscreens that contain laminaria japonica extract may include ingredients listed in the fda monograph , listed in table 1 . with reference to fig7 , primary adult human keratinocytes were treated with laminaria japonica extract ( lje ) or porphyra haitanensis extract ( phe ) for 16 hours prior to exposure to ultraviolet ( uv ) irradiation ( 50 mj / cm2 ). cells were analyzed for phosphorylated epidermal growth factor receptor ( egfr ) and total egfr by western analyses 30 minutes post irradiation . with reference to fig8 , primary adult human keratinocytes were treated with laminaria japonica extract ( lje ), porphyra haitanensis ( phe ) extract , or resveratrol ( rv ) for 16 hours prior to exposure to ultraviolet ( uv ) irradiation ( 100 mj / cm 2 ). cells were analyzed for oxidized receptor protein tyrosine phosphatase - kappa ( rptp - κ ) and total rptp - κ by western analyses 10 minutes post irradiation . with reference to fig9 , primary adult human keratinocytes were treated with laminaria japonica extract ( lje ) for 16 hours prior to exposure to ultraviolet ( uv ) irradiation ( 50 mj / cm 2 ). cells were analyzed for erk phosphorylation and total erk by western analyses 15 minutes post irradiation . in addition , the present methods have been applied to demonstrate that certain antioxidants have no effect on uv - induced egfr activation . antioxidants which have no effect on uv - induced egfr activation include : cape ( caffeic acid phenethyl ester ), mci - 186 ( 3 - methyl - 1 - phenyl - 2 - pyrazolin - 5 - one ), resveratrol , tocopherylquinone , d - alpha , mito q10 , bamboo water extract , porphyra haitanensis extract , sargassum fusiforme extract ( 3 ), green tea extract ( egcg ), and n - acetyl cysteine ( nac ) ( data not shown ). the following description further illustrates materials and methods employed in the present disclosure . materials — adult human primary keratinocytes were purchased from cascade biologics inc . ( portland , oreg .). chinese hamster ovary ( cho ) cells were obtained from atcc . egfr and phospho - egfr ( py1068 ) antibodies used for western analysis were purchased from santa cruz biotechnology ( santa cruz , calif .) and cell signaling technology ( beverly , mass . ), respectively . egfr antibody for immunofluorescence was from neomarkers ( fremont , calif .). neutralizing egfr antibody la1 which blocks ligand - binding , was obtained from upstate biotechnologies ( waltham , mass .). rptp - κ antibody was generated and affinity purified from rabbits immunized with a peptide derived from the intracellular domain of human rptp - κ ( as described by xu , y et al . ( 2005 ) j . biol . chem . 280 , 42594 - 42700 ). phospho - tyrosine peptide derived from egfr ( biotin - kgstaenae ( py ) lrv - amide ) was synthesized by new england peptide . inc . ( gardner , mass .). pd169540 is a generous gift from dr . david fry ( pfizer inc .) oligonucleotide probes used for in situ hybridization were synthesized by genedetect . com ( bradenton , fla .). purified , full length active human egfr was obtained from biomol ( plymouth meeting , pa .). intracellular region of rptp - κ was cloned into pgex - 6 - p , and expressed as a his - tagged gst fusion protein in bl21 . expressed rptp - κ was purified by nickel chelate and glutathione affinity chromatography to a purity of greater than 90 %, as judged by sds page . cell culture — subcultures of adult human primary keratinocytes were expanded in modified mcdb153 media ( epilife , cascade biologics , inc .) at 37 ° c . under 5 % co 2 , cho cells were cultured in ham &# 39 ; s f12 medium with 1 . 5 g / ml sodium bicarbonate , supplemented with 10 % fbs under 5 % co 2 , at 37 ° c . uv source and irradiation — subconfluent cells in a thin layer of tris - buffered saline were irradiated using a daaviin lamp apparatus containing six fs24t12 uvb - ho bulbs . a kodacel ta401 / 407 filter was used to eliminate wavelengths below 290 nm ( uvc ) resulting in a uv spectrum consisting of 48 % uvb , 31 % uva2 and 21 % uva1 . the irradiation intensity was monitored with an il1400a phototherapy radiometer and a sed240 / uvb / w photodetector ( international light , newbury , mass .). human subjects were phototested to determine the dose of uv irradiation that caused the skin to become slightly pink ( med = minimal erythema dose ). subjects were exposed to twice this dose for studies . all procedures involving human subjects were approved by the university of michigan institutional review board and all subjects provided written informed consent . transient transfection of cho cells — mammalian expression vectors harboring egfr ( prk5 egf ) or rptp - κ pshuttle rptp - κ ) coding sequences were transiently transfected by lipofectamine 2000 method into cho cells according to manufacturer &# 39 ; s protocol ( invitrogen corporation , carisbad , calif .). sirna silencing of endoqenous rptp - k in primary human keratinocytes — a 21mer rna sequence ( 5 ′ mg gtt tgc cgc ttc ctt cag 3 ′) derived from rptp - κ coding sequence was designed using oligoengine &# 39 ; s software ( seattle , wash .). homology search was performed on this rna sequence using blast ( http :// www . ncbi . nlm . nih . gov / blast /) to ensure it was not presented in any other known sequence in the database . double - stranded sirna was synthesized by qiagen - xeragon inc . ( valencia , calif .). the synthetic sirna was transfected into primary human keratinocytes using human keratinocytes nucleofector kit and device from amaxa biosystems ( cologne , germany ) according to manufacturer &# 39 ; s protocol . rptp - κ immunoprecipitation , protein tyrosine phosphatase assay , and egfr tyrosine phosphorylation elisa — keratinocytes whole cell lysates were made in tgh buffer ( 50 mm hepes , ph 7 . 2 . 20 mm nacl , 10 % glycerol and 1 % triton x - 100 ), supplemented with 10 μg / ml aprotinin , 10 μg / ml leupeptin . 10 μg / ml pepstatin a and 1 mm pmsf , and were pre - cleared with normal rabbit igg before incubation with rptp - k antibody for three hours at 4 ° c . for some assays 10 mm iodoacetic acid was added to tgh buffer to irreversibly inhibit non - oxidized protein tyrosine phosphatase activity ( see bae , y ., et al . ( 1997 ) j biol chem 272 , 217 - 221 ). protein a - conjugated agarose beads were then added , and further incubated at 4 ° c . for two hours , followed by extensive washing . washed immunoprecipitates were analyzed by western blot , or assayed for protein tyrosine phosphatase activity . for some assays 10 mm dtt was added to the assay buffer to reduce oxidized rptp - κ ( see bae et al .). for measurement of protein phosphatase activity , tyrosine - phosphoryiated peptide derived from egfr was added to a final concentration of 0 . 5 mm in 50 ml ptp assay buffer ( 50 μm tris , ph 7 . 6 , 100 μm nacl , 100 μg / ml bsa ). reactions were terminated by addition of 100 μl of biomol green reagent ( biomol , plymouth meeting , pa .) and absorbance measured at 620 nm . human total egfr and tyrosine 1068 phospho - egfr were quantified by elisa ( biosource international , camarillo , calif .). western blot analysis of uv irradiation - induced oxidation of rptp - κ in human primary keratinocytes — human primary keratinocytes were mock irradiated or uv irradiated ( 90 mj / cm 2 ). five minutes post uv irradiation , cells were lysed in the presence of 100 mm iodacetic acid , and rptp - κ was immunoprecipiated as described above . the immunoprecipitate was reduced by addition of 10 mm dithiothreitol in tgh buffer , containing protease inhibitors , for 30 minutes at 4 ° c . the immunoprecipitate was washed three times , and then irreversibly oxidized by incubation with 2 mm pervanadate at 4 ° c . for one hour . oxidized rptp - κ was analyzed by western blot probed with oxptp antibody ( a gift from dr . arne ostman , cancer center karolinska . stockholm , sweden ; as described by persson , c . et al . ( 2005 ) methods 35 , 37 - 43 ). western analysis detection and quantitation — western blots were developed and quantified using a chemifluorescent substrate ( ecf western blot reagents , amersham biosciences , arlington heights , ill .). detection of chemifluorescense was performed using a storm phosphorlmager ( molecular dynamics , sunnyvale , calif .). sample loads , antibody concentration , and incubator times were adjusted to yield fluorescent signals within the linear range of detection . fluorescent intensity of protein bands were quantified by imagequant software , which is an integral application of the storm . detection of uv irradiation - induced dna fragmentation in human primary keratinocytes — human primary keratinocytes were infected with either empty or rptp - κ adenovirus . cells were mock or uv - irradiated two days post infection . six hours post uv irradiation , cells were lysed , and dna fragmentation was measured by cell death detection elisa according to manufacturer &# 39 ; s instructions ( roche applied science , penzberg , germany ) in situ hybridization — hybridization buffer ( 4 × ssc , 20 % dextran sulfate , 50 % formamide , 0 . 25 mg / ml salmon sperm dna , 0 . 25 mg / ml yeast trna , 0 . 1m dtt , 0 . 5 × denhardt &# 39 ; s solution ) with three fluorescine - conjugated sense or antisense dna oligonucleotide probes , corresponding to nucleotides 1549 - 1596 , 3440 - 3487 , and 4290 - 4337 in the human rptp - κ mrna sequence ( genebank accession number nm — 002844 ), at 37 ° c . overnight . sections were washed in 2 × pbs with 0 . 01 % tween 20 , then 1 × pbs . 0 . 01 % tween 20 . washed slides were incubated with protein block ( biogenex , san ramon , calif . ), biotin - labeled anti - fluorescence antibody , followed by horse radish peroxidase - strepaviden . hybridized probes were visualized by addition of aec as substrate . immunohistology and immuno - fluorescence — human full thickness skin samples were embedded in oct and frozen in liquid nitrogen . frozen sections ( 7 μm ) were cut with a cryostat ( leica cm3050 ). sections were air dried for 10 minutes , fixed with 2 % paraformaldehyde for 20 minutes at room temperature , and washed for 20 minutes . slides were loaded on an automated immunostainer ( biogenex i6000 ). for immunoperoxidase staining , slides were incubated with peroxide block ( 10 minutes ), protein block ( 20 minutes ), rabbit affinity - purified anti - rptp - κ ( 30 minutes ), multilink - biotin conjugate ( 10 minutes ), streptaviden - conjugated horse radish peroxidase ( 10 minutes ), aec substrate ( 3 minutes ), and hemotoxylin ( 20 seconds ). for double immunofluorescence , peroxide block was omitted , and following incubation with rptp - κ antibody , biotin - conjugated anti - rabbit antibody ( vector laboratories , burlingame , calif . ), and streptavidin - conjugated alexafluor 594 ( invitrogen - molecular probes , san diego , calif .) were each added for 10 minutes . slides were washed with distilled water , egfr antibody ( ab - 10 ) was added overnight at 4 ° c ., and anti - mouse igg ,- conjugated fitc ( caltag , burlingame , calif .) was added for 10 minutes . stained slides were washed with distilled water , and covered with supermount . for negative control , staining was performed using rptp - κ antibody plus peptide used to raise the antibody , or pre - immune serum , instead of primary antibody . staining was observed under a zeiss microscope ( axioskop 2 ) and images were obtained with digital camera ( spot2 , diagnostic instruments , inc ., sterling heights , mich .). all reagents , except as noted , were from biogenex . all referenced literature and patents are incorporated herein by reference . the examples and other embodiments described herein are exemplary and not intended to be limiting in describing the full scope of compositions and methods of the technology . equivalent changes , modifications and variations of specific embodiments , materials , compositions , and methods may be made within the scope of the present technology , with substantially similar results . | 6 |
for a general understanding of the environment for the method and printer disclosed herein as well as the details for the method and printer , reference is made to the drawings . in the drawings , like reference numerals designate like elements . fig1 shows a three - dimensional object printer 100 configured for automated part removal . the printer 100 includes a platen 104 , an ejector head 108 , an actuator 116 , an inductive heater 124 , a sensor 122 , a controller 120 , a wiper 130 , and an actuator 134 . the ejector head 108 has a plurality of ejectors configured to eject material onto a surface 112 of the platen 104 . the printer 100 also includes an actuator 116 , which is operatively connected to the platen 104 to rotate the platen from the horizontally level position shown in fig1 to the position shown in fig2 . the printer 100 further includes a controller 120 operatively connected to the ejector head 108 , the actuator 116 , the inductive heater 124 , and the sensor 128 . the controller 120 is configured to operate the ejectors in the ejector head 108 with reference to digital image data of a three - dimensional object to form layers of material and produce a three - dimensional object 138 on the platen 104 . the controller is also configured to operate the actuator 116 to rotate the platen to the second position where gravity urges the object towards the edge at which the sensor 122 is positioned and to operate the inductive heater 124 to melt support material adhering to the platen so the object slides towards the edge of the platen . while the heater 124 is shown connected to the platen , it need only be positioned sufficiently close to the platen to heat the platen to the appropriate temperature to release the object and need not be connected to the platen . once the controller 120 receives a signal from the sensor that indicates the object has been removed from the platen , the controller operates the actuator 116 to return the platen to the horizontal level position for the production of the next object . as used in this document , “ horizontally ” means a direction that is parallel to the surface 112 of the platen 104 in fig1 and parallel to a face of the ejector head 108 . the position of the platen 104 is depicted as being at a forty - five degree angle to the horizontally level position of fig1 . in one embodiment , this angle is the minimum angle at which gravity sufficiently induces the object 138 to move once the inductive heater has melted the material adhering to the platen ; however , the angle at which gravity begins to urge movement of an object can be more or less depending upon the platen surface treatment and object support material . the angle of rotation can be up to one hundred and eighty degrees , if the object is to be dropped onto another surface , such as a conveyor as explained below . in embodiments in which the object is to slide onto another surface the orientation can be limited to some angle that is less than one hundred and eighty degrees , depending again on the platen surface treatment and object support material . the platen 104 needs to be made of a ferromagnetic material to ensure that the inductive heater 124 produces heat in the platen 104 . because the fluctuating fields generated by the inductive heater do not interact with the object 138 , the temperature of the object does not change so the integrity of the object remains intact . the controller 120 is configured to operate the inductive heater for a period of time that ensures the platen reaches a temperature of at least sixty degrees celsius , which is the melting temperature for the most commonly used support material , namely , paraffin wax . the printer shown in fig1 and fig2 also includes a wiper 130 that is operatively connected to an actuator 134 . the controller 120 is also connected to the actuator 134 to enable the controller to operate the actuator and move the wiper 130 across the surface 112 of the platen 104 when the platen is in the position shown in fig2 . the controller 120 operates the actuator 134 to move the wiper in response to the sensor 122 generating a signal indicative of the object sliding off the platen and past the sensor 122 . the sensor 122 can be , for example , an optical sensor that generates a light beam at the edge of the platen 104 and detects the absence of the beam at a receiver as the object moves between the light generator and the receiver . other sensors can be used , such as , a mechanical sensor that generates a signal to the controller in response to the object moving a mechanical arm . an alternative embodiment of a three - dimensional object printer that rotates the platen through the movement of the platen along a track is shown in fig5 . in this figure , like reference numbers refer to like components in the embodiment of fig1 . the platen 104 is configured to move along a track 110 . the platen 104 moves underneath the ejector head 108 to enable the formation of one or more layers of an object . the platen can move along the track 110 to enable the top layer of the object to be planerized , uv material cured , or the object to be imaged and the image data analyzed to verify proper formation of the object . a switch in the track is configured to enable the track 110 either to return the platen to the ejector 108 for the formation of additional layers or it can divert the platen to the object discharge area 150 . in discharge area 150 , the configuration of the track 110 changes to tilt the platen 104 as shown in fig6 . as shown in that figure , rails 156 and 158 are configured with a u - shape to hold the wheels 160 of the platen 104 . rail 156 changes elevation while rail 158 turns to enable the platen to rotate at an angle to the horizontal position of the platen . in this position , the part 138 is urged by gravity toward the edge of the platen closest to rail 156 . alternatively , as shown in fig7 , both rails can change elevation in opposite directions to turn the platen over and drop the object . with continued reference to fig5 , as the platen travels through the discharge area 150 , the track enables the platen 104 to rotate and the controller 120 operates the inductive heaters 124 to heat the platen and raise its temperature to a level that enables the part 138 to be released from the platen . the sensor 122 , which is positioned at the edge from which the part falls away , generates a signal that enables the departure of the part 138 from the platen 104 to be detected . the platen 104 continues to move along the track 110 past the wiper 130 that extends across the path of the track 110 . as the platen passes the wiper 130 , the wiper removes residual material from the platen surface . a receptacle can be positioned beneath the wiper 130 to receive the falling debris cleared from the platen 104 by the wiper 130 . the platen 104 continues on the track 110 and returns to the ejector head 108 for production of another part . in the embodiment shown in fig7 , three platens 104 are shown moving along the track 110 . again the platens 104 are configured with wheels 160 for movement along the track . the middle platen has entered an area where the rails 156 , 158 of the track 110 are configured to rotate the platen ninety degrees as shown in the figure . the rails 156 , 158 to right of that position are configured to further rotate the platen 104 another ninety degrees to invert the platen when it reaches the position of the rightmost platen as shown in the figure . once the platen is inverted , the controller 120 operates the heaters 124 to heat the platen 104 to a temperature that releases the part 138 from the platen 104 so it falls under the effect of gravity onto a conveyor 170 . the conveyor 170 can carry the part to another processing area or it can drop the parts into a receptacle located at the end of the conveyor . a wiper 130 is positioned to remove residual material from the platen as the inverted platen passes the wiper . the platen 104 then passes through another section of the track 110 that returns the platen to the un - inverted position and the platen can be routed to the ejector head for production of another part . a method 300 for operating the printer 100 to automatically remove printed parts from the platen 104 is shown in fig3 . in the description of the method , statements that the method is performing some task or function refers to a controller or general purpose processor executing programmed instructions stored in non - transitory computer readable storage media operatively connected to the controller or processor to manipulate data or to operate one or more components in the printer to perform the task or function . the controller 120 noted above can be such a controller or processor . alternatively , the controller can be implemented with more than one processor and associated circuitry and components , each of which is configured to form one or more tasks or functions described herein . when the method 300 is performed , it begins with the controller 120 operating ejectors in the ejector head 108 to eject drops of material and form layers of material with reference to digital image data of a three - dimensional object to produce the object on the platen ( block 304 ). in one embodiment , the controller 120 operates a first plurality of ejectors of the ejector head 108 to eject material onto the surface 112 of the platen 104 to form one or more parts on the platen . in another embodiment , the controller 120 first operates a second plurality of ejectors of the ejector head 108 to eject wax onto the surface 112 of the platen 104 to form a wax base 304 , as shown in fig4 . after forming the wax base 304 , the controller 120 operates the first plurality of ejectors of the ejector head 108 to eject material onto the wax base 304 to form the object 138 . once the part has been produced , the cart is tilted to rotate the platen to the second position where gravity urges the object towards the edge at which the sensor 128 is positioned ( block 308 ). as the platen rotates , the controller connects the inductive heater 124 to an electrical power source to operate the heater and melt support material adhering to the platen so the object slides towards the edge of the platen or drops from the platen ( block 312 ). once the controller 120 receives a signal from the sensor that indicates the object has been removed from the platen , the cart rotates to return the platen to the horizontal level position for the production of the next object ( block 316 ). it will be appreciated that variants of the above - disclosed and other features and functions , or alternatives thereof , may be desirably combined into many other different systems , applications or methods . various presently unforeseen or unanticipated alternatives , modifications , variations , or improvements therein may be subsequently made by those skilled in the art , which are also intended to be encompassed by the following claims . | 1 |
the heart of this invention lies in the recognition that especially designed tabs , loops or other gripping mechanisms incorporated in the wrist portion of a glove are not sufficient to prevent contact of the glove &# 39 ; s exterior with a user &# 39 ; s skin . an additional layer of protection is required , so that the gripping mechanism itself is prevented from contacting contaminated portions of the glove and its cleanliness is maintained for later safe contact with the bare hands of a user . referring to the drawings , wherein like parts are designated throughout with like numerals and symbols , fig1 illustrates in perspective view the preferred embodiment of a glove 10 that incorporates protected gripping means according to the present invention . while the glove 10 is illustrated and described with reference to a surgical glove , it is understood that any protective glove can be manufactured to comprise the features of the present invention , which is therefore not to be limited in scope to surgical applications . the glove 10 is made with elastomeric impermeable material , such as latex , to prevent fluid penetration from the exterior and avoid contamination of the skin of a wearer . as all conventional gloves , the glove 10 comprises a wrist portion 12 with an edge 14 adapted for wrapping tightly around the wrist of the wearer , so that penetration of contaminants between the glove and the wrist is prevented , and a hand portion 16 with . individual fingers 18 . the preferred gripping means consists of a glove tab 20 fixedly attached to the wrist portion and adapted for gripping by the fingers of the opposite hand of a user and for pulling toward the distal end of the gloved hand to remove the glove . the tab 20 is thus attached to the glove at one end , such as the proximal end 22 ( proximal with respect to the gloved hand ), and is free at the other end 24 , so that it may be gripped and pulled to remove the glove 10 , as illustrated in fig2 . critical to this invention is a protective cover 30 , which is adapted for covering the glove tab 20 and hermetically sealing it from outside contamination . this is achieved by providing a layer of bonding adhesive 26 in the area of the wrist portion 12 overlapped by the cover 30 . the adhesive 26 is of a kind that permits permits a user to remove the protective cover 30 simply by pulling the cover off the glove and without damaging the wrist portion of the glove . a cover tab 32 may be provided to facilitate the removal operation . preferably , the adhesive 26 is placed over the entire underside 34 of the cover 30 and over the corresponding overlapped area of the wrist portion of the glove , so that the glove tab 20 is fully sealed off and protected during use of the glove . even more preferably , the outer portion of the tab 20 is also bonded to the cover 30 while the inner portion is free of adhesive , so that the motion of pulling out the protective cover 30 also results in raising the free end 24 of the glove tab 20 , such that it is easier to grip and pull . finally , the protective cover 30 may be permanently attached at one end to the wrist portion 12 of the glove , as illustrated in fig1 - 3 , and remain dangling as a free flap after detachment , or it may constitute a separate detachable component , as shown in fig4 and 5 . the latter embodiment is preferred because it allows the complete separation and disposal of the protective cover 30 , which may be contaminated and could provide a source of infection if left dangling on the glove while the opposite ungloved hand is pulling on the glove tag 20 ( as seen in fig2 ). thus , in operation , the invention requires each glove to have a glove tab 20 and at least one of a pair of gloves to also comprise a protective cover 30 . where , for example , only the right glove is equipped with a protective cover 30 , it is first removed by pulling the cover tab 32 with the gloved left hand . the glove tab 20 of the left glove is then gripped by the fingers of the gloved right hand and pulled to peel off and remove the left glove . finally , the newly - exposed glove tab 20 of the right glove is gripped by the bare fingers of the ungloved left hand and pulled to peel it off and remove it . obviously , if both gloves are equipped with a protective cover 30 , each gloved hand is first used to remove the protective cover from the other hand by pulling the cover tab 32 . the rest of the procedure remains the same . it is readily apparent that the glove of this invention provides a self - contained means for safely removing contaminated gloves after use by following the outlined procedure . one critical aspect of the invention is the impermeable feature of the bond between the protective cover and the glove in order to seal the gripping means 20 and prevent penetration of liquid contaminants . accordingly , adhesives that require intimate contact between the glove and cover surfaces are acceptable , but fasteners that create a porous layer therebetween , such as velcro ® strips , would be unsafe and therefore are not adequate to practice the invention . the specific structure of the protective cover 30 and of the gripping means 20 may vary with different embodiments of the invention , so long as the functional characteristics are retained as described . for example , as illustrated in fig6 the gripping means 20 may consist of a loop 40 ( instead of a tab ) attached to the glove and covered by the protective cover 30 by means of a bonding medium 26 , as in the case of the preferred embodiment discussed above . another gripping means may be simply a string 42 with an end attached to the wrist portion of the glove and similarly protected by the cover 30 , as shown in the partial view of fig7 . yet another gripping means may consist of a finger pocket 60 covered by the same gripping means 30 , as illustrated in fig8 . the pocket 60 is uncovered and the glove is removed by inserting a finger in the pocket and pulling the glove distally . it is understood that these methods of implementing gripping means are for enablement purposes only and not intended to constitute a limitation on the scope of the invention . any equivalent structure adapted for gripping by a user &# 39 ; s hand and capable of being completely isolated by a protective cover would be suitable for praticing the invention . similarly , the protective cover 30 of the invention may be implemented in different equivalent ways . for example , it may be integral with the wrist portion 12 of the glove of the invention , such as by constituting a cuff 44 folded outwardly from the edge 14 to overlap gripping means 46 ( which could be any one of the disclosed means 20 , 40 , 42 and 60 , or yet another equivalent means ) sandwiched between the cuff and the glove , as illustrated in fig9 . a bonded area 50 would ensure intimate contact betwen the cuff and the glove to protect the gripping means 46 from contamination . a cover tab 32 could also be attached to the edge 52 of the cuff in alignment with the location of the gripping means to facilitate the lifting of the cuff to expose the gripping means at the time of removal of the glove . various changes in thee details , steps and materials that have been described may be made by those skilled in the art within the principles and scope of the invention herein illustrated and defined in the appended claims . therefore , while the present invention has been shown and described herein in what is believed to be the most practical and preferred embodiment , it is recognized that departures can be made therefrom within the scope of the invention , which is therefore not to be limited to the details disclosed herein but is to be accorded the full scope of the claims so as to embrace any and all equivalent apparatus and methods . | 0 |
the improved thermite compositions of this invention comprise consolidated thermite compositions of water insoluble metal fuels and metal oxide oxidizers , an acceptable binder and a supplemental oxidizing agent . the improved thermite compositions of this invention employ finely divided metal fuels and metal oxide oxidizing agents . the desired exothermic reaction is produced upon ignition of the composition by oxygen breaking away from the metal oxide and reoxidizing with the metal fuel . any suitable finely divided metal fuel know for use in thermite compositions may be used in the improved compositions of this invention . as examples of suitable finely divided metal fuels there may be mentioned , aluminum , titanium , titanium hydride , vanadium , boron and the like , preferably aluminum powder . as examples of suitable metal oxide oxidizers there may be mentioned , ferric oxide ( fe 2 o 3 ), titanium oxide ( tio ), cupric oxide ( cuo ), cobaltic oxide ( co 2 o 3 ), cobaltous ferrite ( cofe 2 o 4 ), manganese dioxide ( mno 2 ) and the like . the finely divided metal fuels and metal oxide oxidizers will generally have a particle size of from about 0 . 01 to about 300 microns and preferably from about 0 . 1 to about 100 microns . most preferably , the particle size of the metal fuel will be about 5 to about 30 microns and the particle size of the metal oxide oxidizer about 0 . 1 to 3 microns . the supplemental oxidizing agent can be any acceptable oxidizing agent but is preferably ammonium perchlorate ( nh 4 clo 4 ), potassium perchlorate ( kclo 4 ) or potassium chlorate ( kclo 3 ) in order to improve the ignitability of the improved consolidated thermite compositions . as a binder suitable to enable the thermite compositions to be consolidated in an acceptable manner yet producing essentially no unacceptable hot particulate materials upon ignition thereof , there may be mentioned hydrated calcium sulfate ( caso 4 . 2h 2 o ). in the improved thermite compositions of this invention the finely divided metal fuel is generally present in an amount of from about 20 to about 30 % by weight , the metal oxide oxidizer in an amount of from about 40 to about 70 % by weight , the binder in an amount of from about 5 to about 25 % by weight , preferably about 5 to 10 % by weight , and the supplemental oxidizing agent in an amount of from about 2 to about 10 % by weight . generally the binder will be employed at the lowest level at which acceptable consolidation can be achieved in order not to unduly decrease the flame temperature of the igniting composition which would undesirably reduce the ability of the igniting thermite composition to heat the stored pressurized gas . in general , therefore , it has been found that a level of binder of about 10 % by weight is preferred . similarly , it is generally desirable to use the least amount of additional or supplemental oxidizing agent necessary to provide for easy ignition of the improved thermite compositions since higher levels can produce safety concerns . for example , the amount of additional oxidizing agent , such as potassium perchlorate , is generally about 2 . 0 % by weight since higher levels of about 5 to 10 % by weight can produce compositions that are very sensitive to electrostatic discharge . as examples of formulations that can be utilized to produce the improved consolidated thermite products of the invention , there may be mentioned the following representation formulations . ______________________________________ formulation number 1 2 3component component weight % ______________________________________aluminum metal powder 26 . 94 27 . 35 28 . 03 ( 5 - 30 microns ) ferric oxide 61 . 06 57 . 64 51 . 97 ( 0 . 1 - 3 microns ) potassium perchlorate 2 . 00 2 . 00 2 . 00hydrated calcium sulfate 10 . 00 10 . 00 10 . 00______________________________________ an improved thermite formulation of this invention is consolidated into suitable pellets , grains or wafers in the following manner , utilizing formulation no . 1 , as described above . the ingredients of the formulation are processed into pellets by slurry mixing the ingredients in water ( about 46 % by weight ) into an intimate mixture of components and then extruding the slurry mixture and chopping or cutting the extruded material to form pellets of approximately 0 . 25 inches ( 6 . 35 mm ) in diameter and 0 . 25 inches ( 6 . 35 mm ) in length . after forming the cylindrical shaped pellets from the extruded slurry mixture , the pellets material is dried to a hard consolidated shape in any suitable drying oven by driving off the water slurry medium . an improved consolidated thermite composition , such as the pellets formed in the preceding paragraph , can be employed as the heat - producing , non gas - producing materials in hybrid inflators , especially of the co - flow type described in the aforementioned co - pending application ser . no . 08 / 423 , 261 . such improved consolidated thermite compositions are capable of producing large quantities of intense heat without producing any significant amount of gas or hot particulate material . moreover , the improved consolidated thermite compositions ignite at an acceptable low ignition temperature , generally within the range of about 1500 ° to 2200 ° c ., and generally below about 2000 ° c . with the foregoing description of the invention , those skilled in the art will appreciate that modifications may be made to the invention without departing from the spirit thereof . therefore , it is not intended that the scope of the invention be limited to the specific embodiments illustrated and described . | 2 |
the broad principles of acousto - fluidic noise cancellation according to the present invention are illustrated in fig1 a and 1b . specifically , a piezoelectric driver 11 is caused to vibrate by an applied audio signal from generator 12 and produces corresponding acoustic vibrations in the inlet or control part 13 of a fluidic amplifier 10 . the acoustic vibrations impinge upon a high velocity gaseous fluid jet issued from a power nozzle 14 of amplifier 10 . the power nozzle is shown supplied with pressurized gas from a compressor 16 . the impinging acoustic vibrations deflect the jet slightly , the deflection angle and frequency being substantially proportional to the amplitude and frequency , respectively , of the acoustic vibrations . downstream of the point of impingement the actual distance or amplitude of deflection of jet deflection is considerably greater , although the angle is the same so that the differential pressure sensed between the amplifier outlet passages 17 , 18 is considerably larger than the amplitude of the acoustic vibrations causing the jet to deflect . outlet passages 17 , 18 are disposed on opposite sides of a flow divider 19 to receive varying portions of the jet as it deflects , the variations in pressure in the two outlets being opposite in phase to provide a differential pressure . the amplified output differential pressure is applied from passages 17 , 18 to respective horns 21 , 22 configured to match the output impedance of the amplifier to the surrounding atmosphere , thereby resulting in little loss of power or sound level . the horns 21 , 22 emit respective amplified acoustic signals of opposite phase . if the acoustic input wave applied to control passage 13 is derived from a source of acoustic noise to be cancelled , the acoustic output signals from the horns may be directed to oppose and cancel that noise . a conceptual block diagram illustrating the principals of the present invention is presented in fig1 a to which specific reference is now made . a source 30 of unwanted acoustic energy radiates the unwanted sound forwardly where it is picked up by a sound receiver 31 . the acoustic energy arriving at receiver 31 may be directly applied as a controlled input signal to fluidic driver amplifier 10 . alternatively , receiver 31 may be a microphone which transduces the acoustic energy to an electrical audio signal , the latter being capable of transmission over a greater distance without amplification than is the case for an acoustic signal . the audio signal can be converted back to an acoustic signal at the fluidic amplifier input port by means of a suitable electronic - to - acoustic transducer , for example a piezoelectric driver , such as described above in relation to fig1 . in either case , the resulting acoustic signal , representing the noise to be cancelled , deflects a power jet in fluidic amplifier driver 10 to provide an amplifier output pressure signal at horn 21 . the horn delivers its acoustic output signal to the sound source 30 in phase opposition to the radiated sound at the delivery point , thereby cancelling the sound . referring temporarily back to fig1 it is noted that the pressure signal appearing in output passage 17 and delivered to horn 21 is of opposite phase to the deflecting input signal applied to control port 13 . accordingly , ignoring acoustic delays , it is seen that an out - of - phase signal can be delivered back to the sound source in phase cancelling relation , depending upon the point of delivery . in other words , if the output pressure signal is delivered by horn 21 rather than by horn 22 , and if horn 21 is positioned so that all of the audio and acoustic delays between receiver 31 , driver 10 and horn 21 produce a negligible phase shift ( or a phase shift that is a multiple of 360 °), then the acoustic signal delivered by the horn will cancel the undesired noise . on the other hand , any significant phase shift can be balanced out , either empirically for each installation or by pre - calculation , with an adjustable phase shifter 32 located in the output pressure signal line from driver 10 . phase shifter 32 is typically a conventional filter for fluid signals made up of a combination of flow inertance , restriction and / or volume elements , only one of which needs to be adjustable if phase adjustability is desired . alternatively , the phase shift may be effected electrically in the audio input signal if receiver 31 is a microphone . a more sophisticated embodiment of the invention is illustrated in fig1 b wherein a turbofan type engine produces unwanted acoustic noise patterns 42 to be cancelled . the noise pattern 42 is received by a microphone 43 arranged to deliver its audio output signal to a microprocessor 44 programmed to provide an output signal at suitable phase and frequency to drive the fluidic driver 10 by means of a voltage - to - pressure ( or current - to - flow ) transducer 45 . microprocessor 44 can be used to adjust for the various system delays so as to accurately present the acoustic signal from horn 21 in phase opposition to the noise pattern at the location of the output end of the horn . for even greater accuracy in cancelling the relatively complex frequency spectrum of noise produced by turbofan 40 , microprocessor 44 can be programmed to process input signals in accordance with a least - mean - square algorithm of the type described in detail in the aforementioned thomas , et at . publication . when so programmed , microprocessor 44 and the associated components serve as a feedforward control . for this mode of operation an audio reference signal at the blade passage frequency of turbofan 40 is picked up by a microphone 46 and delivered through a filter 47 to the microprocessor , serving to synchronize the microprocessor and its control signal to the dominant noise - producing frequency components . this arrangement is described below in somewhat greater detail in relation to fig5 . the present invention does not reside in the particular algorithm employed in connection with microprocessor 44 , or in any specific processing circuitry used to assure that the phase of the acoustic signal from fluidic driver 10 is properly phased to effect noise cancellation . such techniques are , to some extent , known and , in any event , are well within the skill of persons familiar with the art of noise cancellation . rather , the invention resides in the use of fluidic drivers to provide the acoustic control signal , the phase of which can be adjusted either manually or automatically in any of a multitude of ways . the fluidic driver may be a single stage or , for more effective operation , or for different applications , multiple cascaded or parallel - connected stages . in considering the engine noise cancellation embodiment of fig1 b , periodic engine noise ( whine ) is generated during passage of the turbofan rotor past the stator , and eddies shed by the rotor blades impinge on the stationary surfaces of the stators . this sound radiates both forward , out of the engine inlet , and backward , out of the engine exhaust . in general , the sound radiated through the exhaust is less coherent than that radiated forward because of turbulent mixing in the high energy exhaust stream , and it is also muffled by the higher free - stream noise . the sound radiated forward is called engine inlet noise and is characterized by a discrete tonal frequency called the blade passage frequency ( bpf ) tone . it is the level of this sound that has been reduced by one embodiment of the present invention . typically this sound level is on the order of 120db ( referenced to 20μpa ) at about two meters away from the inlet . by using an upstream sound sensing means , e . g ., a microphone or an acousto - fluidic transducer , the bpf tones to be reduced can be sensed and referred to a bpf reference sensor that detects the passage of the rotor blades . this fixes the phase relationship of the sound generated to that sensed . using this information , a microprocessor can predict the frequency and amplitude of the signal with which the acousto - fluidic driver must be actuated in order to produce a counter - sound wave that is near in amplitude and is out of phase with the radiated bpf tones . the acousto - fluidic driver produces the desired anti - sound , and the noise radiated out of the engine inlet is effectively reduced . in order that an acousto - fluidic driver be practical and viable to cancel high level engine noise , it must be capable of developing sound levels at the horn exit , ( i . e ., at the wall of the inlet of the turbofan engine ) on the order of 150 - 160db ( referenced to 20μpa .). levels that must be achieved within the acousto - fluidic amplifiers themselves must therefore reach 175 - 185db . in accordance with one aspect of the present invention , fluidic amplifiers originally designed to operate at low pressures ( i . e ., in the laminar flow regime ) are operated successfully at high pressures that develop turbulent supersonic flows , with little loss in gain but immense increase in frequency response . this results in recovery of remarkably high acoustic pressures . a standard integrated circuit fluidic amplifier operating at 30 psig has been shown to be able to develop a ± 3 psi peak - to - peak signal into a matched acoustic impedance , corresponding to 177db spl rms . in order to use an ultra - low power , headset - type speaker which generates input signals of about ± 0 . 004 psi peak - to - peak ( 113db rms ), a gain in excess of 60db is needed to achieve the desired output levels . a four - serial - stage gainblock module , consisting of a final , driving stage of sixteen parallel c / 2 - format amplifiers with 0 . 010in nozzle width and height provides a optimum power transfer match to the acoustic impedance of the standard 0 . 045 - in diameter outlet port . c - and c / 2 - format are designations for standard u . s . government integrated circuit fluidic laminations used to build amplifiers and circuits , ( joyce , j . w ., &# 34 ; a catalog of c - format laminates ,&# 34 ; harry diamond laboratories special report , hdl - sr - 83 - 2 , march 1983 ), where the c / 2 - format is half the size of c - format . the total number of parallel amplifiers is dictated by the amount of power required to be radiated , but the maximum number of amplifiers that can be placed in parallel without losing power transfer efficiency is dictated by the size of the outlet port diameter . thus , to obtain more power using standard c / 2 - format devices operating at 30psi , modules with 16 - parallel amplifiers must be placed in parallel . the preferred embodiment of the present invention utilizes a staging scheme of the general type described in the aforementioned drzewiecki et al . patent , ( u . s . pat . no . 5 , 540 , 248 incorporated herein by reference ) that keeps the interstage impedances constant in order to ensure maximum power transfer . by reducing the operating supply pressure of the driving stage relative to the output stage by four , and the number of parallel elements by two , and continuing this procedure in each stage , a low input pressure four - stage amplifier with very high dynamic range , a gain of over 60db and a frequency response essentially flat to well past 5 , 000 hz has been devised . fig2 illustrates that the frequency response for the resulting amplifier not only is relatively uniform ( i . e ., within ± 2db ), but that the bandwidth exceeds 5 , 000 hz , which is more than sufficient to handle both primary as well as harmonic blade passage frequency ( bpf ) tones in a turbofan engine . since fluidic amplifiers have two output channels , each putting out signals 180 ° out of phase with each other , the invention utilizes the technique of summing a lagged output disclosed by drzewiecki et al . &# 34 ; fluidic sound amplification system &# 34 ; and found that , in a relatively wide band (± 50 - percent of the frequency of interest ) the output power could be doubled by delaying one output signal to generate an additional 180 ° of phase shift at 2 , 500 hz and summing it in an equal area acoustic junction with the other output signal . this provides an effective twofold increase in sound pressure level , or 6db . the acousto - fluidic gainblock used in the preferred embodiment should not be construed to be the optimum design ; rather , it merely represents what can be achieved using existing technology components . by customizing the lamination topology to provide for larger exit openings , for example , more parallel amplifiers could be accommodated in a single module , thereby reducing the number of modules required to generate the desired amount of acoustic power . indeed , it is advantageous to increase the overall number of parallel stages throughout the module because that reduces the effects of mechanical imperfections which could lead to non - symmetrical output signals and possibly null oifsets that are large enough to saturate the amplifier , thereby reducing the gain to levels below which the device is effective . in the described four - stage configuration using two parallel amplifiers in the first stage , four in the second , eight in the third and sixteen in the fourth , null offset propagation is minimized by having two well - matched parallel amplifiers , with their offsets cancelling one another , in the first stage , as well as having the first stage pressure a factor of sixty - four lower than the last stage . the large number of parallel amplifiers in each succeeding stage further minimizes null offset propagation . by reducing the first stage output offset pressure to less than one - percent of the 20 mm hg first stage supply pressure ( e . g ., 0 . 2 mm hg ), even when this is amplified by the gain of 160 of the last three stages , the result is less than 32 mm hg out of a greater than 500 mm hg output span . this , then , does not materially affect the amplifier &# 39 ; s operation . fig3 illustrates the measured flow consumption of a single acousto - fluidic module , demonstrating that the flow consumption at 20 psi ( 1 , 000 torr , torr = mm hg ) is about thirty - two liters per minute . fig4 illustrates the static transfer characteristic showing the measured output pressure as a function of the applied control pressure . the slope of this curve represents the gain and is over 1000 : 1 . also , this plot shows that the signal needed to saturate the output signal is about ± 0 . 4 mm hg , corresponding to an input rms sound level for saturation of about 125db , a level that is readily developed by miniature voice coil speakers such as found in stereo headsets . it is also a level that is readily developed acousto - optically by light ( e . g ., laser ) energy impinging on a broadband absorber and amplified by one or two stages of acousto - fluidic amplifiers as shown in u . s . pat . no . 4 , 512 , 371 , the disclosure of which is incorporated herein . in such an embodiment , the sound to be cancelled is picked up by a microphone , as described above , and the resulting audio signal is used to modulate the intensity of a light beam generated , for example , by a laser . the modulated light beam is directed ( for example , by an optical fiber ) to a photo - acoustic cell of the type described in the aforementioned u . s . pat . no . 4 , 512 , 371 . that cell absorbs the light energy and converts it to heat energy , thereby creating pressure pulses in the cell that are delivered to the fluidic driver and amplified . thus , in the event that it is desired to eliminate any and all moving parts , an optical fiber could be used to transmit the command signal to the acousto - fluidic driver modules , and could be directly incorporated as part of the circuit . using the described four - stage gainblock as a building module , a modular acousto - fluidic driver , composed of eight multiple parallel integrated circuit gainblocks , each driven by a miniature voice - coil earphone , was found to be capable of delivering sufficient acoustic power to significantly reduce the bpf tones in a jt15d turbofan engine . the general characteristics of one module are : ______________________________________ • acoustic power 5 . 4 watts , summed outputs • flow consumption 37 . 7 lpm ( 1 . 7 × 10 . sup .- 3 lb / sec ) @ 1400 mmhg • weight 125 gm ( 4 . 4 oz )• size 23 × 23 × 50 mm ( 0 . 9 × 0 . 9 × 2 . 0 in )• sound pressure level 116 db @ 2 . 4 m , 8 modules w / 31 / 2 - in horn .• input radio shack monaural earphone______________________________________ in the experimental test setup shown in fig5 described in detail in the thomas et al . publication for use with compression drivers , counter - sound is injected into the engine with eight fluidic driver modules feeding a single exponential horn 60 that exits into the engine with a 2in 2 ( 31 / 8in × 3 / 4in ) opening . unfortunately , that horn was poorly matched to frequencies below 4 , 000 hz and resulted in delivered signal levels 8db less than ideal . nevertheless , on the jt15d turbofan engine , operating at idle but with the bpf tones augmented to levels equivalent to those that would be expected at full engine power by using eddy - shedding exciter rods in the proximity of the stators as described in the thomas et al publication , the bpf tones ( engine whine ) at 2 , 412 hz were reduced by more than 7db ( a factor of 2 . 2 ) at one selected position in the far field . specifically , fig6 a and 6b show the rms spectra of the engine noise before being controlled ( fig6 a ) and after being controlled ( fig6 b ), and two frequency spikes can be seen . control , for purposes of the subject test , was applied to reduce the amplitude of the 2 , 412 hz tonal only . the reduction can be seen in fig6 b in that the height of the spike is reduced , the reduction being clearly audible during the test . fig7 a is a time trace of the amplitude of the uncontrolled engine noise , basically the signal that the ear hears , and fig7 b , a time trace of the controlled engine noise amplitude , shows the level reduced by a clear factor of two ; this was readily perceived by the human ear . to extend the area or angular coverage of tonal reduction , a multiplicity ( e . g . twelve ) of drivers , disposed circumferentially around the engine inlet , would serve the purpose . with a 7db reduction in bpf tone noise with a single driver , one would then expect a reduction of over 20db ( a factor of ten ) with an array of twelve drivers , which would also extend the global control , i . e ., through a larger radiation cone . the lms algorithm illustrated in fig5 was used to generate the accurate counter - sound and is a single - channel , time - domain filtered - x lms algorithm described in detail in the thomas , et al publication . use of this algorithm successfully demonstrated operation of the system . with proper impedance matching and design of the horn , this same eight - module driver would provide 6 - 8db more of sound suppression . horns can be designed to be conformal with , cast or machined in the engine . they do not have to be very long , as the cutoff frequency needs only to be somewhat lower than the lowest frequencies of interest ( 1 , 000 hz ). these lower frequencies are expected to be generated in large ultra - high bypass engines . the exit area of the horn in the disclosed embodiment should be increased to an effective diameter of greater than 31 / 2 - in to achieve proper transfer of acoustic power at frequencies of the order of 2 , 000 hz . in order that a plurality such large openings in the side wall of the engine inlet not introduce undesirable effects , such as flow disturbances and eddy shedding ( which could alter the inlet flow distribution and counter - productively increase the engine noise ), a practical horn implementation can be terminated with an acoustically transparent covering , such as a thin membrane supported by a short honeycomb structure . this will not attenuate or affect the output sound levels , and will minimize flow disturbances by presenting a smooth flow surface . the thin membrane can be speaker cloth which permits the dc outflow of air from the fluidic amplifier outlet passages . fig1 a and 10b illustrate such an implementation , wherein the horn may be terminated by a combination of a honeycomb structure and cloth covering . the honeycomb structure is a thin wall honeycomb having its passages of hexagonal section oriented in the direction of sound and air propagation . the cloth covering covers the downstream end of the honeycomb structure and the outlet end of the horn . based on the measured flow consumption ( 0 . 0017 lb / sec ) of a single module of the described embodiment , twelve such eight - module drivers , using air that is bled from the turbofan engine compressor to provide the fluidic power , would consume 0 . 08 lb / sec of air , corresponding to less than two - thirds of one - percent of the 27 lb / sec of actual engine flow for the jt15d engine . such a low flow demand would have little or no effect on the efficiency or performance of the engine , and constitutes less than the flow normally used to purge the cabin of a commercial jet airplane . the weight of an eight - module acousto - fluidic driver configured as described is less than two pounds . this could be reduced by choice of materials ( e . g ., aluminum as opposed to steel ); however , compared with a pair of prior art 100w electromagnetic compression drivers each weighing over 10 lbs , a tenfold lighter system is provided which would not add materially to the flight weight of the engine . fig8 a and 8b illustrate one particular embodiment of the invention using twelve acousto - fluidic drivers disposed in circumferentially equally spaced relation around a cylindrical section 1 of the inlet of a jt15d turbofan engine . the miniature electronic speakers 2 , are each located in the center of eight acousto - fluidic driver amplifier modules 3 , and the computer - generated sound is distributed equally through equal length paths to one control or input port of each driver module . sound is also distributed to the opposite control ports through a longer path channel so that the signal at a desired frequency ( typically the mid - frequency of the range of interest , e . g ., 3 , 000 ± 1 , 500 hz ) arrives approximately 180 ° out of phase . in this manner the input signal is presented differentially to the amplifier , and its amplitude is approximately doubled at the center frequency but is only down a factor of two ( 6db ) at the extremes of the band of interest . this arrangement provides for isolation of the inputs from external disturbances and spurious input noise . the acousto - fluidic modules 3 amplify the sound and the two out - of - phase output signals are collected ( i . e ., summed ) with the same phase - lagging scheme described above . the summed output signals are fed into the throat 4 of a matching coiled horn 5 . the horns 5 are coiled to minimize their protrusion from the engine and to minimize the size of the outer envelope of the engine . output sound radiates from the horn mouths 6 into the inlet section 1 and cancels the unwanted bpf tones being radiated forward from the turbofan blades and stators . the horns may alternatively be conformally wrapped about the engine as illustrated in fig9 wherein six acousto - fluidic drivers are circumferentially equally spaced about a turbofan engine inlet . the present invention makes available an improved active acoustic noise cancellation method and apparatus employing acousto - fluidic amplifiers to reduce the size , cost and weight from that of conventional noise cancellation systems . the invention has particular utility in reducing jet engine noise , but should not be construed as so limited since the principles described herein apply to reducing noise in substantially any noisy environment . inasmuch as the present invention is subject to many variations , modifications and changes in detail , it is intended that all subject matter discussed above or shown in the accompanying drawings be interpreted as illustrative only and not be taken in a limiting sense . | 6 |
fig1 shows an interferometric optical switching device 10 capable of simultaneously and individually directing a plurality of externally derived substantially coherent light beams , e . g . k 1 & amp ; k 2 , to a selected plurality of output ports , e . g ., l 1 & amp ; l 2 . as illustrated in fig1 switching device 10 comprises four interferometric switching cells ( iscs ) s 1 , 1 , s 1 , 2 , . . . s 2 , 2 arranged to form a two - dimensional switching matrix having two columns c 1 - c 2 and two rows r 1 - r 2 . in general , s i , j identifies an isc located in the i th row and the j th column of a switching matrix comprising a plurality mxn of iscs arranged in m columns and n rows . each isc s i , j , as illustrated in fig2 a - 2d , typically comprises a first switch unit 130 optically coupled to a spatial light modulator ( slm ) 140 which is in turn optically coupled to a second switch unit 150 . as used herein , &# 34 ; optically coupled &# 34 ; refers to an arrangement in which one or more light beams are directed from one optical component to another in a manner which maintains the integrity of the signal carried by the light beams . first switch unit 130 comprises respective beamsplitter means , such as a cube beamsplitter 132 coupled to an associated total internal reflection ( tir ) prism 134 ; second switch unit 150 similarly comprises respective beamsplitter means , such as a cube beamsplitter 152 coupled to an associated tir prism 154 . as used herein , beamsplitter means refers to the entire beamsplitter assembly , not just the diagonal interface at which light separation or combination occurs . it should be appreciated that since first and second switch units 130 and 150 respectively use a nonpolarizing beamsplitter , i . e ., a beamsplitter which does not alter the polarization of incident light , each first and second switch units can operate equally effectively on either polarized or unpolarized light . therefore , each isc can be either polarization - dependent or independent based on the predetermined characteristics of its respective slm 140 . that is , if slm 140 has a predetermined polarization dependency so does the respective isc . alternatively , if slm 140 is polarization - independent so is the respective isc . each slm 140 typically includes a two - dimensional array of individually controllable predetermined pixels 140 1 and 140 2 respectively illuminated by light beams passing through a respective isc . each pixel comprises a material responsive to a selected electrical control signal ( not shown ) applied thereto for selectively shifting the phase of light passing therethrough . the pixel material can be selected to have a suitable optical axis orientation or nematic molecular director which allows the pixel to operate either on polarized or unpolarized light . each of the illustrated exemplary embodiments , in particular , incorporates a slm adapted to operate on unpolarized light , i . e ., light comprising both p and s linearly polarized components being respectively represented by the twin headed arrows and solid dots on exemplary light beams . for explanatory purposes , and not by way of limitation , it will be assumed that each pixel comprises a nematic liquid crystal ( lc ) material . it will be understood by those skilled in the art that other materials can be equally effective as optical phase shifters ( e . g ., materials exhibiting the property known as the faraday effect or ferroelectric smectic lcs ). the nematic lc in each pixel may operate so that when the control signal applied thereto has one predetermined voltage level the molecular orientation of the lc causes an advancement to the phase of the light beam passing through the pixel . for example , the phase of the light beam may be selected to be advanced by + 90 °, indicated by a + π / 2 designation in so selected pixels . alternatively , another predetermined voltage level of the control signal applied to a respective pixel may cause a retardation to the phase of the light beam passing through the pixel . for example , the phase of the light beam may be selected to be retarded by - 90 °, indicated by a - π / 2 designation in so selected pixels . in this mode of operation , predetermined pixels 140 . sub . 1 and 140 2 can thus cooperate to effectively impart an overall 180 ° phase differential between light beams respectively passing therethrough . alternatively , the voltage level of the control signal respectively applied to predetermined pixels may be selected such that the phase differential of light beams passing therethrough is 0 °, indicated by a 0 designation in so selected pixels . thus , predetermined pixels in the slms can be set to selectively shift the phase differential between light beams passing therethrough . this mode of operation is particularly useful to improve the switching speed of each isc . analysis by s . t . wu and c . s . wu , in &# 34 ; small angle relaxation of highly deformed nematic liquid crystal ,&# 34 ; applied physics letters , vol . 53 , no . 19 , 1988 , pp . 1794 - 1796 , indicates that the on - off response time of a nematic lc is directly proportional to the square of the refractive index change required from each pixel to provide the overall 180 ° phase differential between the light beams passing therethrough . therefore , the cooperating predetermined pixel pair has an on - off response time four times faster than it would be possible with the use of a single pixel , i . e ., the use of a single pixel to individually provide a 180 ° phase differential between passing light beams . as seen in fig1 each isc in the first column c 1 is positioned to receive a portion of the externally derived substantially coherent light beams , k 1 & amp ; k 2 . as indicated by the single headed arrows along the light beams shown in fig1 and as will be explained in greater detail , light beams applied to the first column of iscs can be selectively directed through the switching matrix in ascending column order within a row and in ascending row order within a column so that externally applied light beams reach selected output ports l 1 & amp ; l 2 associated with the last row of iscs . in a reverse mode of operation , externally derived substantially coherent light beams can be applied to each isc in the last row r 2 through ports l 1 and l 2 , here functioning as input ports . the input or output function of such ports is solely defined in terms of the direction of the light beams passing therethrough . in the reverse mode of operation , the applied beams can be selectively directed through the switching matrix in descending row order within a column and in descending column order within a row ( i . e ., in directions opposite to the single headed arrows along the light beams shown in fig1 ) so as to reach selected ports m 1 & amp ; m 2 associated with the first column of iscs . each single isc , as respectively illustrated in fig2 a - 2d , enables substantially coherent light beams received by a first or a second input face 135 and 137 , respectively , of the isc to be selectively switched along either a first or a second axis ( here the x and y axes , respectively ). by way of example and not of limitation , a representative substantially coherent beam of unpolarized light &# 34 ; b &# 34 ; is illustrated in fig2 a incident on the first input face 135 of isc si , j . beam b is split in beamsplitter 132 into a substantially identical constituent pair of beams , represented as b &# 39 ; and b &# 34 ;. beam b &# 39 ; passes through first switch unit 130 along substantially the same path as incident beam b and into a predetermined pixel 140 1 of slm 140 ; beam b &# 34 ; is deflected in beamsplitter 132 such that it is incident on tir prism 134 and then optically coupled to a different predetermined pixel 140 2 in slm 140 . in fig2 a - 2d , cube beamsplitters are shown and thus the angle of deflection is typically about 90 °; alternatively , other types of beamsplitters may be used in which the deflection angle is other than 90 °. as illustrated in fig2 a , the two predetermined pixels in slm 140 through which beams b &# 39 ; and b &# 34 ; respectively pass are respectively set such that beams b &# 39 ; and b &# 34 ; emerge from slm 140 with a phase differential of 0 ° which is carded to second switch unit 150 . beam b &# 39 ; is incident on tir prism 154 and is deflected into beamsplitter 152 ; beam b &# 34 ; passes from slm 140 directly into beamsplitter 152 . the phase differential ( here 0 °) between beams b &# 39 ; and b &# 34 ; is such that when respective components thereof are combined along predetermined coincident collinear paths , they mutually interfere constructively ( in - phase components interfere constructively , while out - of - phase components interfere destructively ) in beamsplitter 152 to form one substantially coherent light beam b that emerges from isc s i , j through a first output face 155 along the selected first axis ( here the x axis ). fig2 b illustrates an isc s i , j with predetermined pixels 140 1 and 140 2 in slm 140 respectively set to cooperatively impart an overall 180 ° phase differential between respective light beams passing therethrough . the operation is as described above with the exception that beams b &# 39 ; and b &# 34 ; undergo , respectively , + 90 ° and - 90 ° phase shift as each passes through pixels 140 1 and 140 2 , respectively . in accordance with such 180 ° phase differential between beams b &# 39 ; and b &# 34 ;, when respective components thereof are combined along such predetermined coincident collinear paths , the respective components mutually interfere constructively in beamsplitter 152 to form one substantially coherent light beam b that emerges from isc s i , j through a second output face 157 along the selected second axis ( here the y axis ). fig2 c and 2d illustrate operation of an isc s i , j with predetermined pixels of slm 140 respectively set to cooperatively impart a phase differential of 0 °, and 180 °, respectively , when optical beam b is received along the second input face 137 of isc s i , j . the operation is identical to that described above with the exception that the 0 ° phase differential setting of predetermined pixels of slm 140 results in the substantially coherent output beam emerging along the second axis ( here the y axis ) and the 180 ° phase differential setting of predetermined pixels of slm 140 results in the substantially coherent output beam emerging along the first axis ( here the x axis ). fig1 illustrates operation of switching matrix in the context of light beams k 1 and k 2 received , respectively , by iscs s 1 , 1 and s 2 , 1 , each in the first column of the switching matrix . for purposes of explanation of operation , it will be assumed that predetermined pixels 140 1 and 140 2 of slm 140 of iscs s 1 , 1 and s 2 , 2 are respectively set to cooperatively impart a 180 ° phase differential between optical beams passing therethrough , while predetermined pixels pixels 140 1 and 140 2 of slms in all remaining iscs are respectively set to impart a 0 ° phase differential between light beams passing therethrough . it should be understood that while fig1 illustrates only one light beam received by each isc for simplicity of illustration , each isc can simultaneously handle many light beams , for example , more than about 10 4 light beams per cm 2 . in accordance with the aforementioned selected settings , recombined substantially coherent light beam k 1 emerges from second switch unit 150 of isc s 1 , 1 along the y axis . isc s 1 , 2 located in a column subsequent to the first column c 1 is optically coupled to receive the light beam from isc s 1 , 1 passed along the y axis . since predetermined pixels of the slm in isc s 1 , 2 are respectively set to the 0 ° phase differential setting , the recombined beam k 1 emerges from isc s 1 , 2 along the x axis . isc s 2 , 2 located in a row subsequent to the first row is optically coupled to receive the light beam from isc s 1 , 2 passed along the x axis and since the predetermined pixels of slm 140 in isc s 2 , 2 are respectively set to cooperatively impart a 180 ° phase differential between light beams passing therethrough , recombined beam k 1 emerges from isc s 2 , 2 along the x axis so as to reach a selected output port l 2 . again referring to fig1 analysis analogous to the one described in reference to beam k 1 indicates that beam k 2 propagates through the switching matrix to a selected output port l 1 . in fig1 a phantom line between iscs indicates other possible optical paths for light beams propagating through the matrix but not specifically selected here , given the assumed selected settings . focusing of the multiple light beams passing between each pair of adjacent iscs is desirable to minimize crosstalk . an optical lens 170 , or alternatively a lens array , can be advantageously optically coupled between adjacent iscs to focus the light beams . fig3 a illustrates an interferometric switching device 10 which comprises a succession of stacked switching matrices identified by alternate odd and even numbers ( e . g ., p 1 , p 2 , p 3 . . . p q ). in general device 10 comprises a plurality of q matrices substantially similar to the one illustrated and described in the context of fig1 . each of the q matrices is positioned in parallel alignment with each other across a common axis perpendicular to their rows and columns ( e . g . the z axis extending perpendicular to the x and y axes ). as illustrated in fig3 a , respective optical components of successive iscs s i , j in each of the q switching matrices may be constructed integral to each other . thus , each slm , located in the same ith row and jth column of successive matrices ( p 1 , p 2 . . . p q ), which extends parallel to the x axis may be formed by a single elongated slm 140 additionally extending parallel to the z axis . a similar integral construction may also be provided for each of the first and second switch units of successive iscs s i , j ( i . e ., first switch unit 130 and second switch unit 150 ). this integral construction reduces manufacturing costs and also improves optical alignment between successive switching cells . fig3 a further illustrates row interferometric means 200 1 , . . . 200 q / 2 each capable of optically coupling an associated pair of consecutive switching matrices in which an odd matrix is followed by an even matrix . for example , row interferometric means 200 1 is capable of optically coupling switching matrix p 1 to matrix p 2 . as illustrated in fig3 b , each row interferometric means ( e . g ., 200 1 ) comprises a first row end beamsplitter 250 optically coupled to receive substantially coherent light beams from the last row of a predetermined odd matrix ( e . g ., matrix p 1 ). first row end beamsplitter 250 splits each received optical beam into a substantially identical constituent pair of beams b &# 39 ; and b &# 34 ;. first row end beamsplitter 250 cooperates with an associated first tir prism 252 to direct beams b &# 39 ; and b &# 34 ; along the common axis ( here the z axis ). a row end slm 260 is optically coupled to receive beams b &# 39 ; and b &# 34 ; directed along the common axis . the row end slm 260 typically includes a two - dimensional array of individually controllable pixels pixels 260 1 and 260 2 capable of selectively shifting the phase of each beam pair passing therethrough . the row interferometric means further comprises a second row end beamsplitter 270 and an associated second tir prism 272 optically coupled to combine each constituent beam pair received from row end slm 260 . in particular a beam pair having a phase differential of 180 °, as can be selectively imparted via slm 260 , has respective components thereof combined along predetermined coincident collinear paths in the second row end beamsplitter 270 to interferometrically form a substantially coherent light beam ( represented by the long dashed line ) directed to a selected output port l 1 associated with the row interferometric means , while a beam pair having a 0 ° phase differential ( as specifically exemplified in fig3 b ) has respective components thereof combined along such predetermined coincident collinear paths to interferometrically form a substantially coherent light beam directed along the z axis . a third tir prism 274 is optically coupled to receive the coherent light beam along the z axis and to deflect such received light beam to the last row of iscs of the next subsequent even matrix ( i . e ., matrix p 2 ) for further propagation within that subsequent even matrix . fig3 a also illustrates column interferometric means 300 1 . . . 300 q / 2 each capable of optically coupling an associated pair of consecutive switching matrices in which an even matrix is followed by an odd matrix . for example , column interferometric means 300 1 is capable of optically coupling switching matrix p 2 to matrix p 3 . in fig3 c , each column interferometric means is shown to comprise a first column end beamsplitter 350 optically coupled to receive substantially coherent optical beams from the first column of a predetermined even matrix ( e . g ., matrix p 2 ). first column end beamsplitter 350 splits each received optical beam b into a substantially identical constituent pair of beams b &# 39 ; and b &# 34 ;. first column end beamsplitter 350 cooperates with an associated first tir prism 352 to direct beams b &# 39 ; and b &# 34 ; along a common axis ( here the z axis ). a column end slm 360 is optically coupled to receive beams b &# 39 ; and b &# 34 ; directed along the common axis . the column end slm 360 typically includes an array of individually controllable pixels 360 1 and 360 2 capable of selectively phase - shifting each beam pair passing therethrough . the column interferometric means further comprises a second column end beamsplitter 370 and an associated second tir prism 372 optically coupled to combine each constituent beam pair received from the row end slm 360 . in particular a beam pair having a phase differential of 180 ° has respective components thereof combined along predetermined coincident collinear paths to interferometrically form a substantially coherent optical beam ( represented by the long dashed line ) directed to a selected output port n 1 associated with the column interferometric means , while a beam pair having a phase differential of 0 ° ( as specifically exemplified in fig3 c ) is combined along such predetermined coincident collinear paths to form a substantially coherent optical beam directed along the common axis ( here the z axis ). a third tir prism 374 is optically coupled to receive the optical beam along the common axis and to deflect each received optical beam to the first column of iscs of the next subsequent odd matrix ( i . e ., matrix p 3 ) for further propagation within that subsequent odd matrix . in accordance with the embodiment of fig3 a , in each isc of an odd matrix the slm and first and second switch units cooperate to propagate optical beams through the odd matrix in ascending column order within a row and in ascending row order within a column , while in each isc of an even matrix the slm and first and second switch units cooperate to propagate signal beams through the even matrix in descending row order within a column and in descending column order within a row so that redirected optical beams may be switched to selected output ports . in another aspect of the invention , the light output relationship between the first and second output axes of each isc can be characterized in terms of a sinusoidal function whose argument is the phase differential between recombined light beams . thus , in the general case , each isc is not only capable an on - off mode of operation but can also spatially multiplex an output beam along both of the first and second output axes . in accordance with this aspect of the invention , predetermined pixels in the slm of an isc may be respectively set to cooperatively phase shift the optical beams passing therethrough to impart a predetermined phase differential having an intermediate value between 0 ° and 180 °. optical beams having this predetermined intermediate phase differential recombine to selectively form two optical beams simultaneously emerging along both the first and second axes for further propagation within the switching matrix . thereby , each of the externally derived optical beams can be simultaneously directed to at least two selected output ports of the switching matrix . while only certain features of the invention have been illustrated and described herein , many modifications and changes will occur to those skilled in the art . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention . | 6 |
fig1 shows a nucleotide sequence of human cdna which encodes a c - terminal portion of a novel growth factor , referred to herein as pdgf - d ( formerly vegf - g ). pdgf - d is a new member of the vegfpdgf family . the nucleotide sequence of fig1 ( seq id no : 1 ) was derived from a human est sequence ( id . ai488780 ) in the dbest database at the ncbi in washington , d . c . the nucleotides 1 to 198 of the cdna of fig1 ( seq id no : 1 ) encodes a 66 amino acid polypeptide ( fig2 - seq id no : 2 ) which shows some sequence similarity to the known members of the vegfpdgf family . the amino acid sequence of the polypeptide encoded by the nucleotides 1 to 198 of the polynucleotide of fig1 ( seq id no : 1 ) is shown in fig2 ( seq id no : 2 ). to generate more sequence information on human pdgf - d , a human fetal lung λgt10 cdna library was screened using a 327 bp polymerase chain reaction ( pcr )- generated probe , based on the originally identified est sequence . the probe was generated from dna from a commercially available human fetal lung cdna library ( clontech ) which was amplified by pcr using two primers derived from the identified est ( ai488780 ). the primers were : the amplified 327 bp fragment was cloned into the pcr2 . 1 vector ( invitrogen ). nucleotide sequencing verified that the insert corresponded to the est . the screen identified several positive clones . the inserts from two of these clones , clones 5 and 8 were subcloned into pbluescript and subjected to nucleotide sequencing using internal or vector - specific primers . the nucleotide sequences determined were identical in both clones and are shown in fig3 ( seq id no : 3 ). the coding region of the 690 bp polynucleotide is nucleotides 1 - 600 ( seq id no : 3 ) that encodes for a large portion of hpdgf - d with the exception of the 5 ′- end . this portion of hpdgf - d includes the bioactive fragment of hpdgf - d . the deduced partial amino acid sequence of hpdgf - d ( 200 residues - seq id no : 4 ) derived from nucleotides 1 to 600 of fig3 ( seq id no : 3 ) is shown in fig4 ( seq id no : 4 ). extended nucleotide sequencing of the isolated human pdgf - d cdna clones from this human fetal lung cdna library has provided additional sequence . fig5 ( seq id no : 5 ) shows a nucleotide sequence of a partial human cdna ( 1934 bp ) that encodes hpdgf - d . the coding region of the 1934 bp polynucleotide is nucleotides 1 to 966 that encodes for hpdgf - d except for the most 5 ′- end of the polypeptide . the deduced partial amino acid sequence of hpdgf - d ( 322 residues - seq id no : 6 ) derived from nucleotides 1 to 966 of fig5 ( seq id no : 5 ) is shown in fig6 ( seq id no : 6 ). fig7 ( seq id no : 7 ) shows a polynucleotide sequence of cdna encoding a full - length hpdgf - d . the region encoding pdgf - d is 1116 bp . the deduced amino acid sequence of full - length hpdgf - d is 370 amino acid residues ( fig8 - seq id no : 8 ). the sequence for the 5 ′ end of full - length pdgf - d was obtained using rapid amplification of cdna ends ( race ) pcr , and clones containing cdna from the human heart ( marathon - ready ™ cdna , clontech , cat # 7404 - 1 ). these cdna clones have an adaptor sequence attached to the 5 ′ end of each clone , including a site for primer called adaptor primer 1 ( clontech ): were used to amplify the sequence found at the 5 ′ end of pdgf - d . in the pcr reaction a special polymerase mix was used ( advantage & lt ;& lt ;- gc cdna pcr kit , clontech , cat # k1907 - 1 ). the reaction mix included ( in microliters ): adaptor primer 1 gene specific primers 1 each template ( human heart cdna ) 5 gc - melt ( from the k1907 - 1 kit ) 5 5xgc cdna pcr reaction buffer 10 50x dntp mix 1 sterile h 2 o 27 total 50 the 5 ′ end of pdgf - d was amplified for 31 cycles , five cycles consisted of 45 seconds denaturation at 94 ° c . and four minutes extension at 72 ° c ., five cycles consisted of 45 seconds denaturation at 94 ° c . and four minutes extension at 70 ° c ., and twenty - one cycles consisted of 45 seconds denaturation at 94 ° c . and four minutes extension at 68 ° c . and an initial denaturation step at 94 ° c . for two minutes . from this pcr , an approximately 790 bp long product was obtained . this product was run on a 1 % agarose gel , purified ( qiaquick gel extraction kit , qiagen , cat # 28706 ) from the gel , cloned into a vector ( topo ta cloning kit , invitrogen ) and transformed into bacteria ( e . coli ). transformed bacteria were plated , and incubated at 37 ° c . overnight . single colonies were picked and grown in fresh media overnight . plasmids were prepared ( qiaprep spin miniprep kit , qiagen , cat # 27106 ) and sequenced with the plasmid primers , t7 and m13r . the result of this sequencing was that 312 bp of previously unknown pdgf - d sequence was obtained . the rest of the sequence ( 478 bp ) was identical with previously obtained sequence from other pdgf - d cdna clones . similar to pdgf - c , pdgf - d has a two domain structure with a n - terminal cub domain ( residues 67 - 167 , discussed below ) and a c - terminal pdgfvegf homology domain ( residues 272 - 362 , the core domain ). the overall amino acid sequence identity between pdgf - c ( seq id no : 32 ) and pdgf - d ( seq id no : 8 ) is approximately 43 % ( fig9 ). the similarities are highest in the distinct protein domains while the n - terminal region , including the hydrophobic signal sequence , and the hinge region between the two domains display lower identities . a putative signal peptidase cleavage site was identified between residues 22 - 23 . cleavage results in a protein of 348 residue with a calculated molecular mass ( m r ) of 44 , 000 . a single putative site for n - linked glycosylation was identified in the core domain of pdgf - d ( residues 276 - 278 ). fig1 shows the amino acid sequence alignment of the pdgfvegf - homology domain of pdgf - d ( found in the c - terminal region of the polypeptide ) with the pdgfvegf - homology domains of pdgfvegf family members , pdgf - c , pdgf - a , pdgf - b , vegf 165 , plgf - 2 , vegf - b 167 , vegf - c and vegf - d ( seq id nos : 10 - 18 , respectively ). gaps were introduced to optimize the alignment . this alignment was generated using the megalign alignment tool based on the method of j . hein , ( 1990 , methods enzymol . 183 : 626 - 45 ) the pam 250 residue weight table is used with a gap penalty of eleven and a gap length penalty of three and a k - tuple value of two in the pairwise alignments . the alignment is then refined manually , and the number of identities are estimated in the regions available for a comparison . the alignment shows that the core domain of pdgf - d displays about a 50 % identity to the corresponding domain in pdgf - c , and about a 20 - 23 % identity to the core domains in the classical pdgfs and vegfs . it also shows that , with two exceptions , pdgf - d has the expected pattern of invariant cysteine residues , involved in inter - and intra - disulfide bonding , a hallmark of members of this family . the first exception occurs between cysteine 3 and 4 . normally these two cysteines are spaced by 2 residues . however , similar to pdgf - c , pdgf - d has an unique insertion of three additional amino acids residues , ncg . in total , ten cysteine residues reside in the core domain , including the extreme c - terminal region , suggesting a unique arrangement of the cysteines in the disulfide - bonded pdgf - d dimer . the second exception is that the invariant fifth cysteine found in the other members of the pdgfvegf family is not conserved in pdgf - d . this feature is unique to pdgf - d . based on the amino acid sequence alignments in fig1 , a phylogenetic tree was constructed and is shown in fig1 . the data show that the pdgfvegf homology domain of pdgf - d forms a subgroup of the pdgfs together with pdgf - c . the n - terminal region of the partial pdgf - d amino acid sequence of fig1 ( residues 53 - 170 of seq id no : 8 ) has a second distinct protein domain which is referred to as a cub domain ( bork and beckmann , 1993 , j . mol . biol . 231 : 539 - 545 ). this domain of about 115 amino acids was originally identified in complement factors c1rc1s , but has recently been identified in several other extracellular proteins including signaling molecules such as bone morphogenic protein 1 ( bmp - 1 ) ( wozney et al ., 1988 , science , 242 : 1528 - 1534 ) as well as in several receptor molecules such as neuropilin - 1 ( np - 1 ) ( soker et al ., 1998 , cell 92 : 735 - 745 ). the functional roles of cub domains are not clear but they may participate in protein - protein interactions or in interactions with carbohydrates including heparin sulfate proteoglycans . these interactions may play a role in the proteolytic activation of pdgf - d . as shown in fig1 , the amino acid sequences from several cub - containing proteins were aligned . the results show that the single cub domain in human pdgf - d ( seq id no : 19 ) displays a significant identify with the most closely related cub domains . sequences from human bmp - 1 , with 3 cub domains ( cubs1 - 3 ) ( seq id nos : 20 - 22 , respectively ) and human neuropilin - 1 with 2 cub domains ( cubs1 - 2 ) ( seq id nos : 23 - 24 , respectively ) are shown . this alignment was generated as described above . the portion of the cdna encoding amino acid residues 24 - 370 of seq id no : 8 was amplified by pcr using taq dna polymerase ( biolabs ). the forward primer used was 5 ′ gata tctaga agcaaccccgcagagc 3 ′ ( seq id no : 33 ). this primer includes a xbai site ( underlined ) for in frame cloning . the reverse primer used was 5 ′ gctc gaattc taaatggtgatggtgatgatg tcgaggtggtcttga 3 ′ ( seq id no : 34 ). this primer includes an ecori site ( underlined ) and sequences coding for a c - terminal 6 × his tag preceded by an enterokinase site . the pcr product was digested with xbai and ecori and subsequently cloned into the baculovirus expression vector , pacgp67a . verification of the correct sequence of the cloned pcr product was done by nucleotide sequencing . the expression vectors were then co - transfected with baculogold linearized baculovirus dna into sf9 insect cells according to the manufacturer &# 39 ; s protocol ( pharmingen ). recombined baculovirus were amplified several times before beginning large scale protein production and protein purification according to the manual ( pharmingen ). sf9 cells , adapted to serum free medium , were infected with recombinant baculovirus at a multiplicity of infection of about seven . media containing the recombinant proteins were harvested four days after infection and were incubated with ni - nta - agarose beads ( qiagen ). the beads were collected in a column and after extensive washing with 50 mm sodium phosphate buffer ph 8 , containing 300 mm nacl ( the washing buffer ), the bound proteins were eluted with increasing concentrations of imidazole ( from 100 mm to 500 mm ) in the washing buffer . the eluted proteins were analyzed by sds - page using 12 . 5 % polyacrylamide gels under reducing and non - reducing conditions . fig1 shows the results of the sds - page analysis of human recombinant pdgf - d under reducing ( r ) and non - reducing ( nr ) conditions . pdgf - d was visualized by staining with coomassie brilliant blue . fig1 also shows that the recombinant pdgf - d migrates as a 90 kda species under non - reducing conditions and as a 55 kda species under reducing conditions . this indicates that the protein was expressed as a disulfide - linked homodimer . rabbit antisera against full - length pdgf - dd and against a synthetic peptide derived from the pdgf - d sequence ( residues 254 - 272 , amino acid sequence rkskvdldrlnddakrysc of seq id no : 36 were generated . these peptides were each conjugated to the carrier protein keyhole limpet hemocyanin ( klh , calbiochem ) using n - succinimidyl 3 -( 2 - pyridyldithio ) propionate ( spdp ) ( pharmacia inc .) according to the instructions of the supplier . 200 - 300 micrograms of the conjugates in phosphate buffered saline ( pbs ) were separately emulsified in freunds complete adjuvant and injected subcutaneously at multiple sites in rabbits . the rabbits were boostered subcutaneously at biweekly intervals with the same amount of the conjugates emulsified in freunds incomplete adjuvant . blood was drawn and collected from the rabbits . the sera were prepared using standard procedures known to those skilled in the art . the antibodies to full - length pdgf - dd were affinity - purified on a column of purified pdgf - dd coupled to cnbr - activated sepharose 4b ( pharmacia ). as seen in fig1 , the antibodies did not cross - react with pdgf - c in the immunoblot analysis . for immunoblotting analyses , the proteins were electrotransferred onto hybond filters for 45 minutes . to investigate the tissue expression of pdgf - d in several human tissues , a northern blot was done using a commercial multiple tissue northern blot ( mtn , clontech ). the blots were hybridized at according to the instructions from the supplier using expresshyb solution at 68 ° c . for one hour ( high stringency conditions ), and probed sequentially with a 32 p - labeled 327 bp pcr - generated probe from the human fetal lung cdna library ( see description above ) and full - length pdgf - b cdna . the blots were subsequently washed at 50 ° c . in 2 × ssc with 0 . 05 % sds for 30 minutes and at 50 ° c . in 0 . 1 × ssc with 0 . 1 % sds for an additional 40 minutes . the blots were then put on film and exposed at − 70 ° c . as shown in fig1 , upper panel , the highest expression of a major 4 . 4 kilobase ( kb ) transcript occurred in heart , pancreas and ovary while lower expression levels were noted in several other tissues including placenta , liver , kidney , prostate , testis , small intestine , spleen and colon . no expression was detected in brain , lung , or skeletal muscle . in comparison , the 3 . 5 kb pdgf - b transcript was abundantly expressed in heart and placenta , whereas lower levels were observed in all other tissues ( fig1 , lower panel ). prominent co - expression of pdgf - d and pdgf - b occurred in heart , pancreas and ovary . the spatial and temporal patterns of expression of the pdgf - d protein in mouse embryos were determined by immunohistochemistry using standard procedures and employing affinity - purified rabbit antibodies to full - length pdgf - dd generated in example 2 on tissue sections of embryos during mid - gestation ( embryonic day ( e ) 14 . 5 ). the embryos were fixed in 4 % paraformaldehyde overnight at 4 ° c . and processed for cryosectioning . 14 μm cryosections were used for the stainings . paraffin - embedded sections which were prepared by routine procedures were also used . after sectioning , the slides were air dried for one to three hours followed by a ten minute post fixation with 4 % paraformaldehyde . after washing 3 × 5 minutes with phosphate buffered saline ( pbs ) containing 0 . 3 % triton x - 100 ( pbs - t ), the slides were incubated in 0 . 3 % h 2 o 2 in pbs - t for 30 minutes to quench the endogenous peroxidase activity . this was followed by washing 2 × 5 minutes with pbs - t and 2 × 5 minutes in pbs . blocking of non - specific binding was done using 3 % bovine serum albumin ( bsa ) in pbs for 30 minutes . the slides were incubated with the affinity purified antibody to human pdgf - dd ( 3 - 9 mg of igml ) overnight at 4 ° c . after washing , the slides were incubated with the secondary ig ( goat anti - rabbit hrp , vector laboratories ) at a dilution of 1 : 200 for one hour . after washing , the slides were incubated with the ab complex ( vector laboratories ) for one hour and washed with tris ph 7 . 4 . either 3 , 3 ′- diaminobenzidine tetrahydrochloride ( dab from sigma ) or 3 - amino - 9 - ethyl carbazole ( aec from vector laboratories ) was used for color development . the reaction was quenched by washing in tris - hcl buffer . in control experiments the antibodies were preincubated with a 30 × molar excess of full - length pdgf - dd . this blocked the staining , while a similar preincubation with full - length pdgf - cc did not affect the staining of the tissue sections . the photomicrographs were taken using a zeiss microscope equipped with differential interference contrast optics . intense staining for pdgf - d was noted in the developing heart , lung , kidney and some muscle derivatives . fig1 - 18 show the staining of the embryonic kidney . intense staining of the highly vascularized fibrous capsule ( fc ) surrounding the kidney , the adjacent adrenal gland ( ag ), and in the most peripheral aspect of the metanephric mesenchyme ( mm ) of the cortex was observed ( fig1 and 17 ). staining was also observed in cells located in the basal aspect of the branching ureter ( fig1 ), while the developing nephron , including the ureter buds , glomeruli ( gl ) and henle &# 39 ; s loops , were negative . previous analysis have shown that pdgfr - beta is expressed by the metanephric mesenchyme and the developing vascular smooth muscle cells and mesangial cells of the developing renal cortex . in contrast , renal expression of pdgf - b is restricted to endothelial cells ( lindahl , p . et al ., 1998 , development 125 : 3313 - 3322 ). the non - overlapping patterns of expression of the two pdgfr - beta ligands suggests that pdgf - b and pdgf - d provide distinct signals to pdgfr - beta expressing perivascular cells . this differential localization indicates that pdgf - d might have a paracrine role in the proliferation andor commitment of pdgfr - beta expressing perivascular progenitor cells of the undifferentiated metanephric mesenchyme . in line with the phenotype of pdgf - b deficient mice , pdgf - b may then provide proliferative signals and spatial clues of the branching vascular tree of the kidney , thus allowing proliferation and co - recruitment of the pdgfr - beta expressing perivascular cells to form the mesangium of the glomeruli , and the smooth muscle cells of the efferent and afferent arterioles . the expression of pdgf - d partially overlaps with the expression of pdgf - c in the cortical area of the developing kidney . the different receptor specificities of pdgf - c and pdgf - d and their apparent inability to form heterodimers indicate that the two novel pdgfs may provide distinct signals for migration and proliferation for at least two different cell populations in the undifferentiated metanephric mesenchyme ; either interstitial cell progenitors expressing pdgf alpha - receptor , or the pdgfr - beta expressing perivascular progenitor cells . the phenotypic differences in the kidneys of mice lacking pdgfr - alpha and pdgf - a argue for a unique role of pdgf - c in the formation of the renal mesenchyme . interestingly , a comparison of the pdgfr - beta and pdgf - b deficient mice have not revealed a similar phenotypic discrepancy arguing for , at least partially , redundant roles of pdgf - d and pdgf - b during early stages of kidney development . to assess the interactions between pdgf - d and the vegf receptors , truncated pdgf - d was tested for its capacity to bind to soluble ig - fusion proteins containing the extracellular domains of human vegfr - 1 , vegfr - 2 and vegfr - 3 ( olofsson et al ., 1998 , proc . natl . acad . sci . usa 95 : 11709 - 11714 ). an expression vector encoding the pdgfvegf homology domain of pdgf - d was generated in the vector psectag ( invitrogen ). the primers 5 ′- cccaagcttgaagatcttgagaatat 3 ′ ( forward ) ( seq id no : 30 ) and 5 ′- tgctctagatcgaggtggtctt 3 ′ ( reverse ) ( seq id no : 31 ) were used to amplify a 429 bp fragment ( nucleotides 556 to 966 in fig5 ) ( seq id no : 5 ) encoding amino acid residues 186 to 322 of fig6 ( seq id no : 6 ). the fragment was subsequently cloned into a hindiii and xbai digested expression vector . cos cells were transfected with the expression vector encoding truncated pdgf - d or a control vector using calcium phosphate precipitation . the expressed polypeptide included a c - terminal c - myc tag and a 6 × his tag ( both derived from the psectag vector ). the ig - fusion proteins , designated vegfr - 1 - ig , vegfr - 2 - ig and vegfr - 3 - ig , were transiently expressed in human 293 ebna cells . all ig - fusion proteins were human vegfrs . cells were incubated for 24 hours after transfection , washed with dulbecco &# 39 ; s modified eagle medium ( dmem ) containing 0 . 2 % bovine serum albumin ( bsa ) and starved for 24 hours . the fusion proteins were then precipitated from the clarified conditioned medium using protein a - sepharose beads ( pharmacia ). the beads were combined with 100 microliters of 10 × binding buffer ( 5 % bsa , 0 . 2 % tween 20 and 10 μgml heparin ) and 900 microliter of conditioned medium prepared from the cos cells transfected with the expression vector for truncated pdgf - d or the control vector . the cells were then metabolically labeled with 35 s - cysteine and methionine ( promix , amersham ) for 4 to 6 hours . after 2 . 5 hours at room temperature , the sepharose beads were washed three times with binding buffer at 4 ° c ., once with phosphate buffered saline ( pbs ) and boiled in sds - page buffer . labeled proteins that were bound to the ig - fusion proteins were analyzed by sds - page under reducing conditions . radiolabeled proteins were detected using a phosphorimager analyzer andor on film . in all these analyses , radiolabeled pdgf - d failed to show any interaction with any of the vegf receptors . these results indicate that secreted truncated pdgf - d does not bind to vegf receptors r1 , r2 and r3 . to test if pdgf - d causes increased phosphorylation of the pdgfr - beta , full - length and plasmin - digested pdgf - d were tested for their capacity to bind to the pdgfr - beta and stimulate increased phosphorylation . a plasmin - digested preparation of pdgf - dd was generated and analyzed since it is known that plasmin - digestion of full - length pdgf - cc releases the core domain and thus allow the ligand to interact with the receptor . full length pdgf - dd was digested with plasmin in 20 mm tris - hcl ( ph 7 . 5 ) containing 1 mm cacl 2 , 1 mm mgcl 2 and 0 . 01 % tween 20 for 1 . 5 to 4 . 5 hours at 37 ° c . using two to three units of plasmin ( sigma ) per ml . analysis of the plasmin - digested preparation of pdgf - dd by sds - page under reducing conditions showed two prominent bands of 28 kda and 15 kda . the 15 kda band was identified as the core domain due to its immunoreactivity in immunoblotting with a peptide antiserum raised against a sequence of pdgf - d just n - terminal of the first cysteine residue in the core domain . serum - starved porcine aortic endothelial - 1 ( pae - 1 ) cells stably expressing the human pdgfr - beta ( eriksson et al ., 1992 , embo j . 11 : 543 - 550 ) were incubated on ice for 90 minutes with a solution of conditioned media mixed with an equal volume of pbs supplemented with 1 mgml bsa and 10 ngml of pdgf - bb , 300 ngml or 1200 ngml of full length human pdgf - dd homodimers or 300 ngml or 1200 ngml of digested pdgf - dd . the full length and digested pdgf - dd homodimers were produced as described above . sixty minutes after the addition of the polypeptides , the cells were lysed in lysis buffer ( 20 mm tris - hcl , ph 7 . 5 , 0 . 5 % triton x - 100 , 0 . 5 % deoxycholic acid , 10 mm edta , 1 mm orthovanadate , 1 mm pmsf 1 % trasylol ). the pdgfr - beta were immunoprecipitated from cleared lysates with rabbit antisera against the human pdgfr - beta ( eriksson et al ., 1992 , supra ). the precipitated receptors were applied to a sds - page gel . after sds gel electrophoresis , the precipitated receptors were transferred to nitrocellulose filters , and the filters were probed with anti - phosphotyrosine antibody py - 20 , ( transduction laboratories ). the filters were then incubated with horseradish peroxidase - conjugated anti - mouse antibodies . bound antibodies were detected using enhanced chemiluminescence ( ecl , amersham inc ). the filters were then stripped and reprobed with the pdgfr - beta rabbit antisera , and the amount of receptors was determined by incubation with horseradish peroxidase - conjugated anti - rabbit antibodies . bound antibodies were detected using enhanced chemiluminescence ( ecl , amersham inc ). the probing of the filters with pdgfr - beta antibodies confirmed that equal amounts of the receptor were present in all lanes . human recombinant pdgf - bb ( 100 ngml ) and untreated cells were included in the experiment as a control . fig1 shows plasmin - digested pdgf - dd efficiently induced pdgfr - beta tyrosine phosphorylation . full - length pdgf - dd failed to induce pdgfr - beta tyrosine phosphorylation . pdgf - bb was included in the experiment as a positive control . this indicates that plasmin - digested pdgf - d is a pdgfr - beta ligandagonist . next , full length and plasmin - digested pdgf - d were tested for their capacity to bind to human pdgf alpha - and beta - receptors by analyzing their abilities to compete with pdgf - bb for binding to the pdgf receptors . the binding experiments were performed on porcine aortic endothelial - 1 ( pae - 1 ) cells stably expressing the human pdgf alpha - and beta - receptors , respectively ( eriksson et al ., 1992 , supra ). binding experiments were performed essentially as in heldin et al . ( 1998 , embo j . 7 : 1387 - 1393 ). different concentrations of human full - length and plasmin - digested pdgf - dd , or human pdgf - bb were mixed with 5 ngml of 125 i - pdgf - bb in binding buffer ( pbs containing 1 mgml of bovine serum albumin ). aliquots were incubated with the receptor expressing pae - 1 cells plated in 24 - well culture dishes on ice for 90 minutes . after three washes with binding buffer , cell - bound 125 i - pdgf - bb or 125 i - pdgf - aa was extracted by lysis of cells in 20 mm tris - hcl , ph 7 . 5 , 10 % glycerol , 1 % triton x - 100 . the amount of cell bound radioactivity was determined in a gamma - counter . an increasing excess of the unlabeled protein added to the incubations competed efficiently with cell association of the radiolabeled tracer . fig2 provides a graphical representation of results which show that conditioned medium containing plasmin - digested pdgf - dd competes for binding with pdgf - bb homodimers for the pdgfrs - beta , while the full length protein did not . compared to pdgf - bb , plasmin - activated pdgf - dd appeared 10 - 12 fold less efficient as a competitor ; probably a result of suboptimal activation of the recombinant protein in vitro by the protease . control experiments showed that plasmin present in the digested pdgf - dd fraction did not affect the binding of 125 i - labelled pdgf - bb to the pdgfr - β - expressing cells . both the full length and plasmin - digested pdgf - dd proteins failed to compete for binding to the pdgfr - alpha ( fig2 ). these studies indicate that pdgf - dd is a pdgfr - beta - specific agonist and that proteolytic processing releases the core domains of pdgf - dd from the n - terminal cub domains which is necessary for unmasking the receptor - binding epitopes of the core domain similar to the situation for pdgf - cc . primers were designed for the amplification of the whole coding area of murine pdgf - d by pcr from mouse heart cdna ( clontech ). these primers were : 5 ′- caaatgcaacggctcgttt - 3 ′ ( seq id no : 41 ) and 5 ′- gatatttgcttcttcttgccatgg - 3 ′ ( seq id no : 42 ). pcr reaction conditions were as follows : pcr cycles : 94 ° c . for 2 minutes , followed by 30 cycles : 94 ° c . for 45 seconds , 62 ° c . for 45 seconds , 72 ° c . for 90 seconds , and 72 ° c . for 7 minutes . the expected product from this reaction was a 1 . 2 kb cdna fragment . however , the product was two bands , one approximately 1 . 2 kb and the other only 1 . 0 kb . these two products were checked in a 1 % agarose gel , purified from the gel ( qiaquick gel extraction kit , qiagen , cat # 28706 ), cloned into a vector ( topo ta cloning kit , invitrogen ), and transformed into e . coli bacteria . transformed bacteria were plated and incubated at 37 ° c . overnight . the next morning some single colonies were picked and grown in fresh medium overnight . plasmids were prepared ( qiaprep spin miniprep kit , qiagen , cat # 27106 ) and sequenced with plasmid primers t7 and m13r , and also with mpdgf - d specific primers . the results revealed three different types of murine pdgf - d cdnas , one being completely identical with the earlier mouse clones , depicted in seq id no : 35 . the second clone was almost identical to the earlier mouse sequence , however , it lacked six amino acid residues ( aa 42 - 47 ) from the region between the signal sequence and the cub domain . the second clone is depicted in seq id no : 37 . the third clone was comprised of part of the earlier mouse sequence , lacking amino acids 42 - 47 as in the second clone , and also lacking the pdgf - homology domain . the third clone is depicted in seq id no : 39 . the similarities and differences between regions of the three clones are depicted in fig2 . the surprising results show that at least two alternatively spliced versions of the pdgf - d gene are transcribed into polyadenylated rna . the variant transcript structures suggest an alternative splice acceptor site is used in exon two , producing a variant protein lacking six amino acid residues ( esnhlt ). in addition to lacking the above noted six amino acid residues , the third clone also lacks the pdgf - homology domain . this is because of the skipping of exon six and the resulting frameshift . this ends the open reading frame in a stop codon after four additional amino acid residues ( giev ). as shown in detail in fig2 , this splice variant only contains the amino terminal cub domain and could potentially provide an inhibitor of pdgf - d functions . the potential inhibition function is because the activation of full - length pdgf - d binding to the pdgfr - d requires proteolytic removal of the cub domain . the process as described ( bergsten et al ., 2001 , nat . cell biol . 3 : 512 - 516 ) was followed to generate recombinant human pdgf - dd core domain . human pdgf - dd was expressed as a mutant full - length form containing a factor xa protease cleavage site that allowed the generation of the active c - terminal fragment of the protein ( pdgf - homology domain ) upon cleavage with factor xa . the recombinant protein has an extreme c - terminal his 6 - tag to allow its purification on a nickel - containing resin . following purification , the protein solution was dialyzed against 0 . 1m acetic acid and lyophilized . sds - page analysis under reducing conditions on the purified protein revealed that it migrated as a homogenous 21 kda species ( fig2 ). the purified protein was lyophilized for storage . comparison of angiogenic activities of the human pdgf - dd core domain with other pdgf isoforms the mouse corneal micropocket assay was performed according to procedures described in cao et al ., 1998 , proc natl acad sci usa 95 : 14389 - 94 ; cao et al ., 1999 , nature 398 : 381 . specifically , lyophilized proteins were dissolved in phosphate buffer solutions ( pbs ) and used to make protein bound polymer beads , as described . the beads were then implanted in mouse cornea . male 5 - 6 week - old c57bi6j mice were acclimated and caged in groups of six or less . animals were anaesthetized by injection of a mixture of dormicum and hypnorm ( 1 : 1 ) before all procedures . corneal micropockets were created with a modified von graefe cataract knife in both eyes of each male 5 - 6 - week - old c57bi6j mouse . a micropellet ( 0 . 35 × 0 . 35 mm ) of sucrose aluminum sulfate ( bukh meditec , copenhagen , denmark ) coated with slow - release hydron polymer type ncc ( ifn sciences , new brunswick , n . j .) containing various amounts of homodimers of truncated pdgf - dd was surgically implanted into each cornal pocket . for comparison purposes corresponding amounts of pdgf - aa , pdgf - ab , pdgf - bb , and pdgf - cc were similarly implanted into corneal pockets of test mice . in each case , the pellet was positioned 0 . 6 - 0 . 8 mm from the corneal limbus . after implantation , erythromycinophthalmic ointment was applied to each eye . on day 5 after growth factor implantation , animals were sacrificed with a lethal dose of co 2 , and corneal neovascularization was measured and photographed with a slit - lamp stereomicroscope . in fig2 a - e , arrows point to the implanted pellets . vessel length and clock hours of circumferential neovascularization were measured . quantitation of corneal neovascularization is presented as maximal vessel length ( fig2 f ), clock hours of circumferential neovascnlarization ( fig2 g ), and area of neovascularization ( fig2 h ). graphs represent mean values ( å sem ) of 11 - 16 eyes ( 6 - 8 mice ) in each group . the corneal angiogenesis model is one of the most rigorous mammalian angiogenesis models that requires a putative compound to be sufficiently potent in order to induce neovascularization in the corneal avascular tissue . potent angiogenic factors including fgf - 2 and vegf have profound effects in this system . the results are shown in fig2 . the assays were done using pdgf - aa ( fig2 a ), pdgf - ab ( fig2 b ), pdgf - bb ( fig2 c ), pdgf - cc ( fig2 d ), and pdgf - dd ( fig2 c ). fig2 f - h show the quantitative analysis of vessel length , clock hours , and vessel areas ( means ± sd , n = 4 - 6 ). the overall angiogenic response induced by pdgf - dd was similar to that induced by other pdgf isoforms . the results again clearly demonstrate that the truncated pdgf - d homodimer exhibits marked angiogenic activity in vivo . in light of the foregoing test results , which demonstrate the in vivo angiogenesis inducing activity of pdgf - dd , treatments with pdgf - dd alone , or in combination with other angiogenic factors such as vegf family members and fgfs , provide an attractive approach for therapeutic angiogenesis of ischemic heart , brain and limb disorders . the healing of wounds is a complex process involving three discreet but overlapping stages : inflammation , proliferation and repair , and remodeling . wound healing involves many growth factors , some of which exert different effects on multiple cell types . pdgf in general has been known to be active in all stages of the healing process and to promote wound healing . it is synthesized in significant quantities throughout the process by a number of different cells , including platelets , macrophages , fibroblasts and endothelial cells . despite the critical role played by other growth factors involved in wound healing ( egf , fgf , insulin - like growth factors , and the tgfs ), only pdgf has been shown to augment wound healing in vivo ( steed , 1998 , am . j . surg . 176 : 205 - 255 ). in fact , as early as 1991 , pdgf - b was used for would healing purposes . see e . g . pierce et al ., 1991 , j . biol . chem . 45 : 319 - 326 “ role of pdgf in wound - healing ” and pierce et al ., 1994 , tissue repair processes in healing chronic pressure ulcers treated with recombinant pdgf - bb , am . j . pathology 145 : 1399 - 1410 . nagai and embil ( 2002 ) expert opin . biol . ther . 2 : 211 - 218 reviewed the use of recombinantly produced pdgf - b and concluded that it is safe , effective and easy to use in the treatment for healing diabetic foot ulcers . pdgf - b and pdgf - d share the same type of receptors . the effects of pdgf - d on wound healing were investigated using transgenic mice which overexpress pdgf - d in skin keratinocytes . the human pdgf - d gene was cloned and operatively linked with the keratin 14 promoter ( k - 14 promoter ), which directs the expression of the gene to the basal epithelial cells of the skin of transgenic animals ( jeltsch et al ., 1997 , hyperplasia of lymphatic vessels in vegf - c transgenic mice , science 276 : 1423 - 1425 ; detmar et al ., 1998 , increased microvascular density and enhanced leukocyte rolling and adhesion in the skin of vegf transgenic mice , j . investigative dermatol . 111 : 1 - 6 ). a schematic diagram of the k14 - pdgf - d construct is depicted in fig2 . transgenic mice overexpressing pdgf - d in skin keratinocytes were obtained . four mice from the same transgenic litter were tested postitive for pdgf - d and four negative . fig2 shows a comparison of pdgf - d expression between k14 - pdgf - d transgenic mouse ( tg ) and wild - type mouse ( wt ). paraffin embedded mouse skin samples were stained with anti - pdgf - d . for experimental details , see uutela et al ., 2001 , chromosomal location , exon structure and vascular expression patterns of the human pdgfc and pdgfd genes , circulation 103 : 2242 - 2247 , which is incorporated herein by reference in its entirety . mice were then anesthetized ( ksylatsine + ketaminehydrochloride ) and punch biopsy wounds were made to their flank skin ( 4 wounds with a diameter of 6 mm per mouse ). an analgesic was used to inhibit pain ( buprenorfine ). one positive and one negative mouse were sacrificed two days after the wounding , and as can be seen from fig2 , the amount of granulation tissue in the wound area was considerably greater in the pdgf - d positive mouse ( tg ) when compared with transgene negative littermate ( wt ). the next mice were sacrificed after 4 days . the amount of the developing connective tissue was greater in pdgf - d expressing mouse as shown by the van gieson elastic connnective tissue stain ( fig2 ). a similar augmentation of connective tissue development was seen in the transgenic mice sacrificed 7 and 10 days after wounding ( fig3 ). because increased amount of elastic connective tissue results in a greater tensile strength of the pdgf - d treated wounds , these results indicate that pdgf - d enhances the wound repair process , and that pdgf - d can be used as a valuable enhancer of wound healing . the ability of pdgf - d to stimulate wound healing is also tested in the most clinically relevant model available , as described in schilling et al ., 1959 , surgery 46 : 702 - 710 and utilized by hunt et al ., 1967 , surgery 114 : 302 - 307 . the effects of pdgf - d overexpression in normal skin and muscle and its effects on wound healing were investigated . human pdgf - d cdna was overexpressed under the keratin 14 ( k14 ) promoter in the basal skin keratinocytes of transgenic mice . this promoter should deliver abundant pdgf - d to the wounds , because it is strongly upregulated during the wound healing process [ werner et al ., 2000 , exp cell res , 254 : 80 - 90 ]. full - length pdgf - d and the activated growth factor domain were cloned into an adeno - associated virus ( aav ) vector , and overexpressed alone or in combination with a known angiogenic factor , vegf - e , in the ear and skeletal muscle , and the results were compared with the effects seen in the skin . pdgf - d was found to induce macrophage recruitment , increased interstitial pressure and blood vessel maturation during angiogenesis . human pdgf - d cdna ( bp 176 - 1285 ; genbank seq . number : af336376 ) was inserted into the bam hi site of the k14 promoter expression vector [ vassar et al ., 1989 , proc . natl . acad . sci . usa 86 : 1563 - 1567 ]. fig3 a shows a schematic diagram of the resulting k14 - pdgf - d construct . the construct was digested with ecori and sphi and the expression cassette was purified . a 5 ngμl solution of the dna was injected into fertilized eggs of the fvb - strain of mice and the resulting transgenic mice were maintained in this strain . to analyze the transgene expression , pdgf mrna expression in the skin of transgenic and wild type littermate mice was studied . tissues were snap - frozen in liquid nitrogen and homogenized with a dismembrator . total rna was extracted with the rneasy kit ( qiagen gmbh ). 10 - 20 μg of total rna was electrophoresed in 1 % agarose and transferred to a nylon membrane ( nytran , schleicher & amp ; schuell ), which was then hybridized with a human pdgf - d probe ( bp 119 to 1268 ) and subjected to autoradiography . protein expression was verified by immunohistochemistry using anti - pdgf - d antibodies [ uutela et al ., 2001 , circulation 103 : 2242 - 2247 ]. two transgenic lines were used for the analysis . for the affymetrix ™ microarray analysis , total rna ( 5 μg ) was isolated from the skin of three transgenic and three wild type littermate mice and used for the synthesis of double - stranded ( ds ) cdna using the custom superscript ds - cdna synthesis kit ( invitrogen ). biotin - labeled crna was prepared using the enzo bioarray ™ highyield ™ rna transcript labeling kit ( affymetrix ), and the unincorporated nucleotides were removed using rneasy columns ( qiagen ). the hybridization , washing and staining of mouse genome moe430a microarrays were carried out according to the manufacturer &# 39 ; s instructions ( affymetrix , genechip ™ expression analysis technical manual ). the probe arrays were scanned at 570 nm using an agilent genearray ™ scanner , and the readings from the quantitative scanning were analyzed by the affymetrix ™ microarray suite version 5 . 0 . for the comparisons , the hybridization intensities were calculated using a global scaling intensity of 100 . full - length pdgf - d was expressed under control of the k14 promoter in the basal epidermal keratinocytes of transgenic mice . pdgf - d expression was detected in the skin of the transgenic , but not control littermate mice by northern hybridization and immunohistochemistry . fig3 b is a northern blot of skin total rna hybridized with radioactive pdgf - d probe showing the mrna product of the transgene construct . equal loading of the first two lanes was confirmed by ethidium bromide staining of rna . fig3 c through 31f show immunostaining of the skin . anti - pdgf - d stains the basal keratinocytes in k14 - pdgf - d skin ( fig3 c , arrowheads ) but not in wild type littermate skin ( fig3 d ). staining for f480 shows a very strong staining in the transgenic mouse skin ( fig3 e , arrowheads ) when compared to wild type littermate skin ( fig3 f ). no obvious differences were detected in the macroscopic inspection of the skin between the transgenic mice and their wild type littermates . epidermal thickness , dermal cellularity , and blood and lymphatic vessel numbers were similar in transgenic and wild type skin as detected by staining for dna ( nucleae ), and pecam - 1 , laminin and lyve - 1 antigens . whole mount immunohistochemistry of arteries and anti - smooth muscle actin antibodies and microlymphangiography using fluoresecent dextran did not either show differences between the transgenic and wild type mice . however , an increased number of cd45 positive hematopoietic cells was detected in the dermis of the transgenic mice and staining with the f480 antibodies indicated that most of these cells were macrophages ( fig3 e and 31f ). careful counting indicated that on an average the transgenic mice had 3 . 7 ± 0 . 4 fold more macrophages in the skin than their wildtype littermates ( see control in fig3 b ). increased macrophage numbers were found in both transgenic founder lines . in contrast , no differences were found in the numbers of granulocytes or b - and t - lymphocytes in the skin or in the different leukocyte populations in the peripheral blood . in agreement with the histology , microarray analysis made from the skin rna indicated a twofold increase of transcripts of the monocyte to macrophage differentiation - associated gene in the transgenic mice when compared to their wild type littermates . this result was verified with rt - pcr . rna extracted from the skin of three transgenic mice and their wild type littermates was reverse transcribed using oligo - dt ( boehringer - ingelheim ) and superscript ii ( invitrogen ). rt products were subjected to pcr analysis using a pair of primers specific for mouse monocyte to macrophage differentiation - associated gene [ from genebank sequence bc021914 , forward : 5 ′- ccctcctccatcggctgtct ( seq id no : 43 ) and reverse : 5 ′- ccgtggccacaaacaggtg ( seq id no : 44 )]. pcr cycles were : 94 ° c . 5 min ( 1 ×), 94 ° c . 30 sec , 58 ° c ., 72 1 min ( 30 ×). equal amounts of pcr products were analyzed on 1 % agarose gel . the human homologue of this gene is expressed only in mature macrophages , not in monocytes [ rehli et al ., 1995 , biochem biophys res commun . 217 : 661 - 667 ]. evaluation of interstitial fluid pressure in the dermis of mice which overexpress pdgf - d interstitial fluid pressure ( ifp ) affects capillary fluid filtration and the filling of lymphatic vessels and it is a useful parameter for the estimation of interstitial compliance [ wiig , 1990 , crit rev biomed eng 18 : 27 - 54 ]. many solid tumors demonstrate interstitial hypertension thus making the delivery of many anticancer drugs more difficult [ jain , 1994 , scientific amer . 271 , 58 - 65 ]. pdgf - bb has been shown to raise dermal ifp to a normal level after it has been lowered for example by anaphylaxis [ rodt et al ., 1996 , j . physiol 495 : 193 - 200 ]. furthermore , it has been shown that the inhibition of the pdgfr - β signaling lowers interstitial hypertension in tumors [ pietras et al ., 2001 , cancer res . 61 : 2929 - 2934 ] and that the lowering of ifp also increases the efficacy of chemotherapy [ salnikov et al ., 2003 , faseb j . 17 : 1756 - 1758 ]. the effect of pdgf - d overexpression on the skin interstitial fluid pressure ( ifp ) was investigated . measurement of interstitial fluid pressure from the skin of seven transgenic and seven wild type mice was carried out by using the modified wick technique as described by fadnes et al ., 1977 , interstitial fluid pressure in rats measured with a modified wick technique . microvasc res . 14 : 27 - 36 . statistical analyses were performed using the unpaired student &# 39 ; s t test , and p & lt ; 0 . 05 was considered statistically significant . the ifp measured from the dermis was between − 1 . 1 and − 2 . 1 mmhg (± 0 , 065 ) in wild type mice and between − 1 . 0 and − 1 . 5 (± 0 , 136 ) in transgenic mice . this increase in the ifp in the skin of the transgenic mice was statistically significant ( n = 7 in both groups , * p & lt ; 0 . 05 ). eight to ten week old mice were anesthetized with ketamine hcl ( 50 mgkg s . c .) and xylazine - hcl ( 10 mgkg s . c .). adequate pre - and postoperative pain medication was given ( buprenorphine 0 . 5 mgkg s . c . 3 times a day or when needed ). the backs of the mice were shaved and the skin was cleaned with ethanol . one or two circular wounds were made on both sides of the back with a 5 mm punch - biopsy tool ( fray products corp .). after wounding , the mice were given free access to food and drink . the wounds were allowed to heal for up to 10 days after which the mice were sacrificed with carbon monoxide and cervical dislocation and the wounds were collected . infected wounds were discarded . samples were fixed in 4 % paraformaldehyde , dehydrated and embedded in paraffin . some samples were snap - frozen in liquid nitrogen and embedded in tissue - tek ( sakura - finetek europe bv ). sections were deparaffinized and stained with haematoxylin and eosin . digital images were acquired with a olympus ax70 microscope and dp50 digital camera equipped with a macintosh system 9 . 1 computer and analyzed with the nih image program . the remaining wound area was quantified by measuring the distance between the edges of the migrating epidermis and dividing it with that of the original wound , measured as the distance between the edges of the panniculus carnosus muscle layer . paraffin sections were treated with xylene and dehydrated in ethanol . they were then treated with trypsin for 20 min at 37 ° c . and stained with rat anti - mouse monoclonal f480 antibodies against macrophages ( serotec ), with rat anti - mouse monoclonal antibodies against the cd45 common leukocyte antigen ( bd pharmingen ), the endothelial marker pecam - 1 ( bd pharmingen ) and anti - laminin [ iivanainen et al ., 1997 , j . biol . chem . 272 : 27862 - 27868 ], using the tsa - kit ( perkin elmer life sciences ). biotinylated anti - rat igg ( vector laboratories ) diluted 1 : 300 was used for detection . anti - pdgf - d antibodies were produced and used as described in uutela et al ., 2001 , chromosomal location , exon structure and vascular expression patterns of the human pdgf - c and pdgf - d genes . circulation 103 : 2242 - 2247 , as were antibodies against vegfr - 3 [ kubo et al ., 2000 , blood 96 : 546 - 553 ] and lyve - 1 [ laakkonen et al ., 2002 , nat med . 8 : 751 - 755 ]. frozen sections were fixed in acetone and stained with biotinylated hamster anti - mouse monoclonal cd3e antibodies ( bd pharmingen ) against t - lymphocytes and rat anti - mouse monoclonal b220 antibodies ( bd pharmingen ) against b - lymphocytes . rat anti - mouse monoclonal ly - 6g antibodies ( bd pharmingen ) against granulocytes ( both neutrophils and eosinophils ) were used with biotinylated anti - rat igg ( vector laboratories ) for detection . for evaluation of the skin and wound connective tissue , sections were also stained with van gieson &# 39 ; s stain and masson &# 39 ; s trichrome stain . cells were counted from three grids of equal size from the wounded areas and from normal skin of each section . this was done for samples from the van gieson &# 39 ; s ( total cell count ), f480 ( macrophage count ) and pecam - 1 ( endothelial cellblood vessel count ) and vegfr - 3 ( lymphatic vessel count ) stainings . whole mount staining of smooth muscle actin ( sma ) positive blood vessels was performed by first fixing the ears with 4 % paraformaldehyde , after this , tissues were blocked in 3 % milk 0 . 3 % triton - x in pbs overnight and cy 3 conjugated antibodies against sma ( sigma ) were applied overnight at + 4 ° c . and viewed in a zeiss axioplan 2 fluorescent microscope . fig3 a depicts the quantification of wound closure measurements in the transgenic mice and wild type littermates . there was no difference in the re - epithelialization of the skin punch biopsy wounds between the transgenic and wild type mice . fig3 b shows the total number of macrophages in the wound area in transgenic mice and their littermates at various days of healing (* p & lt ; 0 . 05 ; day 4 , n = 5 ; day 5 , n = 4 ; day 7 , n = 4 ; day 10 , n = 3 ). statistical analyses were performed using the unpaired student &# 39 ; s t test , and p & lt ; 0 . 05 was considered statistically significant . fig3 c and 32d show typical wounds from day 7 . the boxes are examples of the areas from which the total cell counts and macrophage counts were obtained ( 1 box = 4 × 10 4 μm 2 ). the number of cells of the granulation tisssue was counted from identical surface areas under the hyperproliferative epithelium in corresponding areas of the wounds . the cellular density was in general greater in the k14 - pdgf - d positive mice . cell influx into the wound area was greatest in the transgenic mice during the first four days after wounding , being 39 % increased in the transgenic mice but the difference did not reach statistical significance during the later stages of wound healing . the most significant difference between the wounds of the transgenic and wild type mice was the number of macrophages . during the first four days after wounding , there was no difference in macrophage influx , but between days five and seven the macrophage numbers decreased in the granulation tissue of wild type mice , while they continued to increase in the transgenic mice . the number of macrophages peaked on day seven , being about twofold greater in the transgenic mice , and this difference persisted until day ten ( fig3 b ). wound vascularity , quantified as the number of pecam - 1 positive vessels in the wound granulation tissue , was similar between the mice . there was also no difference detected in number of lymphatic vessels , identified by staining for vegfr - 3 . the k14 promoter driven transgene expression starts at e15 in mouse embryos , peaks during the first hair cycle in the skin and is maintained constitutively in adult mice [ vassar et al ., 1989 , proc . natl . acad . sci . usa 86 : 1563 - 1567 ]. in order to analyze the effects of pdgf - d expression in adult skin and muscle , aav vectors encoding the full - length pdgf - d ( dfl ) or the activated form ( δn ) lacking the cub domain were generated and tested in vitro . aav encoding hsa was used as a control . fig3 b shows an in vitro expression analysis of aav infected hela cells . the pdgfs were precipitated with pdgfr - β - ig and vegf - e with vegfr - 2 - ig . the full length vegf - e ( bp 1 - 399 , genbank seq . af106020 ), the full length pdgf - d ( pdgf - dfl ), and a short form ( pdgf - dδn , bp 917 - 1285 ) as well as human serum albumin ( hsa , bp 112 - 1866 , genbank seq . nm — 000477 ) cdnas were cloned as blunt - end fragments into the mlui site of the psub - cmv - wpre plasmid [ paterna et al ., 2000 , gene ther . 7 : 1304 - 1311 ]. fig3 a is a schematic presentation of the aav - pdgf - d constructs . the human pdgf - dfl , pdgf - dδn , vegf - e and hsa cdnas are driven by the cmv promoter and early enhancer ( cmv ), promoted by the woodchuck post - transcriptional enhancer - element ( wpre ). pa is the sv40 polyadenylation signal . the recombinant aavs were produced as described in karkkainen et al ., 2001 , a model for gene therapy of human hereditary lymphedema , proc . natl . acad . sci . usa 98 : 12677 - 12682 . 50 μl of purified aav ( 5 × 10 11 genomic particlesml ) was injected into mouse ear or gastrognemius muscle and four weeks later the mice were sacrificed and the tissues analyzed . production of vegfr - 2 - ig fusion protein and in vitro testing of the aavs to construct a vegfr - 2igg expression plasmid , the first three ig homology domains of the extracellular part of vegfr - 2 were amplified by pcr using primers 5 ′- gcggatccttgcctagtgtttctcttgatc - 3 ′ ( seq id no : 45 ) and 5 ′- ccagtcacctgctccggatcttcatggaccctgacaaatg - 3 ′ ( seq id no : 46 ) and cloned into the signal plgplus vector ( ingenius ). the resulting plasmid was cut with bamhi and kpni , treated with t4 polymerase and back - ligated . the generation of stable drosophila s2 cells and purification of the vegfr - 2 - ig fusion proteins was carried out as described by makinen et al ., 2001 , inhibition of lymphangiogenesis with resulting lymphedema in transgenic mice expressing soluble vegf receptor - 3 , nat med . 7 : 199 - 205 . hela cells were infected with 2 μl purified aav ( 5 × 10 11 genomic particlesml ) in 5 ml dmem supplemented with 2 % fetal bovine serum and glutamine overnight , after which the cells were washed and cultured for further 24 hours in dmem supplemented with 10 % fetal bovine serum and glutamine . the cells were metabolically labelled in methionine and cysteine free mem supplemented with 100 μciml [ 35 s ] methionine and [ 35 s ] cysteine ( redivue promix ; amersham pharmacia biotech ). immunoprecipitation of metabolically 35 s - labelled pdgf - d was carried out by using pdgfr - α - ig or pdgfr - β - ig ( r & amp ; d ), and vegf - e was precipitated by a vegf receptor 2 - ig . the complexes were adsorbed to protein a - sepharose ( pharmacia ), washed twice in 0 . 5 % bsa , 0 . 02 % tween 20 in pbs , and once in pbs and analyzed in a 12 . 5 % sds - page under reducing conditions . the recombinant aavs were injected into the mouse gastrognemius muscle and the muscle histology and immunohistochemistry were analyzed five weeks later . no difference in blood vessel numbers , their smooth muscle coating or the amount of connective tissue could be detected in the injected region . chimeric mice reconstituted with green fluorescent protein ( gfp )- positive bone marrow ( bm ) cells were produced to study the behavior of bm cells in vivo . briefly , bm was collected by flushing femurs of c57bl6 - tgn ( actbegfp ) 1osb mice [ okabe et al ., 1997 , febs lett . 407 : 313 - 319 ] obtained from the jackson laboratory , bar harbor , me . this is a transgenic mouse line with an enhanced gfp ( egfp ) cdna under the control of the chick beta - actin promoter and cytomegalovirus enhancer . transgenic mice were identified by fluorescence upon exposure of the tissues to a 488 nm light source . 2 × 10 6 unselected bm cells from gfp - transgenic mice were transplanted into c57bl6jo1ahsd wild type recipient mice ( harlan , horst , netherlands ) by means of tail vein injection . the recipient mice were irradiated 1 day before transplantation by a sublethal dosage of 4 . 0 gy . microscopic examination and fluorescence - assisted cell sorter ( facs ) analysis showed that bone marrow cells as well as peripheral blood cells were almost completely ( 80 - 95 %) reconstituted with gfp + cells 5 weeks after transplantation . after 5 weeks of bone marrow recovery the mice were used for aav - experiments . the transplantation efficiency was measured by the flow cytometry analysis of gfp + cells in the peripheral blood on the day the mice were killed . fig3 c - e shows staining of the macrophage antigen f480 in mice injected with aav - pdgf - dδn ( fig3 c ) and aav - pdgf - dfl ( fig3 d ) compared to pbs control ( fig3 e ). when the viruses were injected to mice transplanted with gfp - marked bone marrow cells from a donor of the same mouse strain , a strong accumulation of gfp positive cells was detected in the ear ( fig3 c and 33d ). such accumulation did not take place in ear injected with aav encoding has or with pbs only ( fig3 e ). fig3 f - h show fluorescent photomicrographs from the ears of mice transplanted with gfp - marked bone marrow cells from a donor of the same mouse strain . the ears were injected with aav - pdgf - dδn ( fig3 f ), aav - pdgf - dfl ( fig3 g ) or pbs ( fig3 h ). note the strong accumulation of gfp positive cells in the ears expressing pdgf - d . immunohistochemical analysis indicated that the recruited hematopoietic cells were mostly macrophages . the foregoing results show that the major effects of pdgf - d overexpression in the skin were macrophage recruitment and a significant rise of the ifp in the dermis . in skeletal muscle injected with aav - pdgf - d macrophage accumulation was similarly observed . the increase of the mrna for monocyte to macrophage differentiation marker in the skin of the transgenic mice confirmed that the cells were not monocytes , but instead differentiated macrophages as the gene is active only in mature macrophages , not in monocytes . these results are consistent with the studies that have shown that pdgf - bb induces macrophage migration [ siegbahn et al ., 1990 , j . clin . invest . 85 : 916 - 920 ], since pdgf - b and pdgf - d both bind and activate the pdgf - β - receptor . the application of pdgf - b into a wound increases cellular density in the wound bed from day four until day 14 of wound healing and also increases the influx of macrophages into the wound granulation tissue [ pierce et al ., 1991 , j . cell biochem . 45 : 319 - 326 ]. the foregoing results show that extra pdgf - d recruits macrophages into unperturbed skin , and that its effects are enhanced in the wound healing process . macrophages are known to play an important role in wound healing by producing a variety of growth factors and cytokines ( e . g . tgf - α , tgf - β , igf - 1 ) and by phagocytosing cellular and matrix debris [ rappolee et al ., 1988 , science 241 : 708 - 712 ]. removal of macrophages impairs the healing process significantly [ martin , 1997 , science 276 : 75 - 81 ][ leibovich et al ., 1975 , am . j . pathol . 78 : 71 - 100 ]. recent results have shown that the removal of pdgf - b of hematopoietic origin actually promotes vascularization of the granulation tissue , leading to the conclusion that pdgf - b has an inhibitory role in the vascularization of the scar tissue [ buetow et al ., 2001 , am . j . pathol . 159 : 1869 - 1876 ]. the foregoing results indicate that unlike pdgf - b , which may be anti - angiogenic during wound healing , pdgf - d does not have a significant effect on angiogenesis in the granulation tissue . the fact that pdgf - d increases interstitial fluid pressure ( ifp ) in vivo is also a novel function for this growth factor , consistent with the fact that the pdgf receptor β is essential for the maintenance of steady - state ifp [ pietras et al ., 2001 , cancer res . 61 : 2929 - 2934 ]. thus , the pdgf receptor β and its ligands have an important role in maintaining and controlling the ifp . modulation of pdgf - d activity may therefore be useful in the delivery of cancer chemotherapy , where the high tumor ifp is a problem [ salnikov et al ., 2003 , faseb j . 17 : 1756 - 1758 ]. assays are conducted to evaluate whether pdgf - d has similar activities to pdgf - a , pdgf - b , vegf , vegf - b , vegf - c andor vegf - d in relation to growth andor motility of connective tissue cells , fibroblasts , myofibroblasts and glial cells ; to endothelial cell function ; to angiogenesis ; and to wound healing . further assays may also be performed , depending on the results of receptor binding distribution studies . to test the mitogenic capacity of pdgf - d for endothelial cells , the pdgf - d polypeptide is introduced into cell culture medium containing 5 % serum and applied to bovine aortic endothelial cells ( baes ) propagated in medium containing 10 % serum . the baes are previously seeded in 24 - well dishes at a density of 10 , 000 cells per well the day before addition of the pdgf - d . three days after addition of this polypeptide the cells are dissociated with trypsin and counted . purified vegf is included in the experiment as positive control . to test the mitogenic capacity of pdgf - d for fibroblasts , different concentrations of truncated homodimers of pdgf - dd or pdgf - aa ( as control ) are added to serum starved human foreskin fibroblasts in the presence of 0 . 2 mci [ 3h ] thymidine . the fibroblasts are then incubated for 24 hours with 1 ml of serum - free medium supplemented with 1 mgml bsa . after trichloroacetic acid ( tca ) precipitation , the incorporation of [ 3h ] thymidine into dna is determined using a beta - counter . the assay is performed essentially as described in mori et al ., 1991 , j . biol . chem . 266 : 21158 - 21164 . endothelial cell growth assays are performed by methods well known in the art , e . g . those of ferrara & amp ; henzel , 1989 , nature 380 : 439 - 443 , gospodarowicz et al ., 1989 , proc . natl . acad . sci . usa 86 : 7311 - 7315 , andor claffey et al ., 1995 , biochem . biophys . acta 1246 : 1 - 9 . the effect of pdgf - d on adhesion of polymorphonuclear granulocytes to endothelial cells is tested . the standard boyden chamber chemotaxis assay is used to test the effect of pdgf - d on chemotaxis . endothelial cells are tested for the effect of pdgf - d on plasminogen activator and plasminogen activator inhibitor production , using the method of pepper et al ., 1991 , biochem . biophys . res . commun . 181 : 902 - 906 . the ability of pdgf - d to stimulate endothelial cells to migrate and form tubes is assayed as described in montesano et al ., 1986 , proc . natl . acad . sci . usa 83 : 7297 - 7301 . alternatively , the three - dimensional collagen gel assay described in joukov et al ., 1996 , embo j . 15 : 290 - 298 or a gelatinized membrane in a modified boyden chamber ( glaser et al ., 1980 , nature 288 : 483 - 484 ) may be used . the ability of pdgf - d to induce an angiogenic response in chick chorioallantoic membrane is tested as described in leung et al ., 1989 , science , 246 : 1306 - 1309 . alternatively the rat cornea assay of rastinejad et al ., 1989 , cell , 56 : 345 - 355 may be used ; this is an accepted method for assay of in vivo angiogenesis , and the results are readily transferrable to other in vivo systems . a variety of in vitro and in vivo assays using specific cell populations of the hemopoietic system are known in the art , and are outlined below . in particular a variety of in vitro murine stem cell assays using fluorescence - activated cell sorter to purified cells are particularly convenient : these are cells capable of repopulating the bone marrow of lethally irradiated mice , and have the lin − , rh h1 , ly - 6ae + , c - kit + phenotype . pdgf - d is tested on these cells either alone , or by co - incubation with other factors , followed by measurement of cellular proliferation by 3 h - thymidine incorporation . these are cells that have comparatively little bone marrow repopulating ability , but can generate d13 cfu - s . these cells have the lin − , rh h1 , ly - 6ae + , c - kit + phenotype . pdgf - d is incubated with these cells for a period of time , injected into lethally irradiated recipients , and the number of d13 spleen colonies is enumerated . these are cells that respond in vitro to single growth factors and have the lin − , rh h1 , ly - 6ae + , c - kit + phenotype . this assay will show if pdgf - d can act directly on haemopoietic progenitor cells . pdgf - d is incubated with these cells in agar cultures , and the number of colonies present after 7 - 14 days is counted . smooth muscle cells play a crucial role in the development or initiation of atherosclerosis , requiring a change of their phenotype from a contractile to a synthetic state . macrophages , endothelial cells , t lymphocytes and platelets all play a role in the development of atherosclerotic plaques by influencing the growth and phenotypic modulations of smooth muscle cell . an in vitro assay using a modified rose chamber in which different cell types are seeded on to opposite cover slips measures the proliferative rate and phenotypic modulations of smooth muscle cells in a multicellular environment , and is used to assess the effect of pdgf - d on smooth muscle cells . the ability of pdgf - d to inhibit metastasis is assayed using the lewis lung carcinoma model , for example using the method of cao et al ., 1995 , j . exp . med . 182 : 2069 - 2077 . the effects of the pdgf - d on the migration of smooth muscle cells and other cells types can be assayed using the method of koyama et al ., 1992 , j . biol . chem . 267 : 22806 - 22812 . the effects of the pdgf - d on chemotaxis of fibroblast , monocytes , granulocytes and other cells can be assayed using the method of siegbahn et al ., 1990 , j . clin . invest . 85 : 916 - 920 . the effects of pdgf - d on proliferation , differentiation and function of other cell types , such as liver cells , cardiac muscle and other cells , endocrine cells and osteoblasts can readily be assayed by methods known in the art , such as 3 h - thymidine uptake by in vitro cultures . pdgf - d is a member of the pdgf family of growth factors which exhibits a high degree of homology to the other members of the pdgf family . pdgf - d contains seven conserved cysteine residues which are characteristic of this family of growth factors . these conserved cysteine residues form intra - chain disulfide bonds which produce the cysteine knot structure , and inter - chain disulfide bonds that form the protein dimers which are characteristic of members of the pdgf family of growth factors . pdgf - d interacts with a protein tyrosine kinase growth factor receptor . in contrast to proteins where little or nothing is known about the protein structure and active sites needed for receptor binding and consequent activity , the design of active mutants of pdgf - d is greatly facilitated by the fact that a great deal is known about the active sites and important amino acids of the members of the pdgf family of growth factors . published articles elucidating the structureactivity relationships of members of the pdgf family of growth factors include for pdgf : oestman et al ., 1991 , j . biol . chem ., 266 : 10073 - 10077 ; andersson et al ., 1992 , j . biol . chem ., 267 : 11260 - 1266 ; oefner et al ., 1992 , embo j ., 11 : 3921 - 3926 ; flemming et al ., 1993 , molecular and cell biol ., 13 : 4066 - 4076 and andersson et al ., 1995 , growth factors , 12 : 159 - 164 ; and for vegf : kim et al ., 1992 , growth factors , 7 : 53 - 64 ; pötgens et al ., 1994 , j . biol . chem ., 269 : 32879 - 32885 and claffey et al ., 1995 , biochem . biophys . acta , 1246 : 1 - 9 . from these publications it is apparent that because of the eight conserved cysteine residues , the members of the pdgf family of growth factors exhibit a characteristic knotted folding structure and dimerization , which result in formation of three exposed loop regions at each end of the dimerized molecule , at which the active receptor binding sites can be expected to be located . based on this information , a person skilled in the biotechnology arts can design pdgf - d mutants with a very high probability of retaining pdgf - d activity by conserving the eight cysteine residues responsible for the knotted folding arrangement and for dimerization , and also by conserving , or making only conservative amino acid substitutions in the likely receptor sequences in the loop 1 , loop 2 and loop 3 region of the protein structure . as used herein , the term “ conservative substitution ” denotes the replacement of an amino acid residue by another , biologically similar residue . examples of conservative substitutions include the substitution of one hydrophobic residue such as isoleucine , valine , leucine , alanine , cysteine , glycine , phenylalanine , proline , tryptophan , tyrosine , norleucine or methionine for another , or the substitution of one polar residue for another , such as the substitution of arginine for lysine , glutamic acid for aspartic acid , or glutamine for asparagine , and the like . neutral hydrophilic amino acids which can be substituted for one another include asparagine , glutamine , serine and threonine . the term “ conservative substitution ” also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid . as such , it should be understood that in the context of the present invention , a conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties . exemplary conservative substitutions are set out in the following table a from wo 9709433 . table a conservative substitutions i side chain characteristic amino acid aliphatic non - polar g a p i l v polar - uncharged c s t m n q polar - charged d e k r aromatic h f w y other n q d e alternatively , conservative amino acids can be grouped as described in lehninger , biochemistry , second edition ; worth publishers , inc . ny : ny ( 1975 ), pp . 71 - 77 as set out in the following table b . table b conservative substitutions ii side chain characteristic amino acid non - polar ( hydrophobic ) a . aliphatic : a l i v p b . aromatic : f w c . sulfur - containing : m d . borderline : g uncharged - polar a . hydroxyl : s t y b . amides : n q c . sulfhydryl : c d . borderline : g positively charged ( basic ): k r h negatively charged ( acidic ): d e exemplary conservative substitutions are set out in the following table c . table c conservative substitutions iii original residue exemplary substitution ala ( a ) val , leu , ile arg ( r ) lys , gln , asn asn ( n ) gln , his , lys , arg asp ( d ) glu cys ( c ) ser gln ( q ) asn glu ( e ) asp his ( h ) asn , gln , lys , arg ile ( i ) leu , val , met , ala , phe , leu ( l ) ile , val , met , ala , phe lys ( k ) arg , gln , asn met ( m ) leu , phe , ile phe ( f ) leu , val , ile , ala pro ( p ) gly ser ( s ) thr thr ( t ) ser trp ( w ) tyr , phe tyr ( y ) trp , phe , thr , ser val ( v ) ile , leu , met , phe , ala if desired , the peptides of the invention can be modified , for instance , by glycosylation , amidation , carboxylation , or phosphorylation , or by the creation of acid addition salts , amides , esters , in particular c - terminal esters , and n - acyl derivatives of the peptides of the invention . the peptides also can be modified to create peptide derivatives by forming covalent or noncovalent complexes with other moieties . covalently - bound complexes can be prepared by linking the chemical moieties to functional groups on the side chains of amino acids comprising the peptides , or at the n - or c - terminus . in particular , it is anticipated that the aforementioned peptides can be conjugated to a reporter group , including , but not limited to a radiolabel , a fluorescent label , an enzyme ( e . g ., that catalyzes a colorimetric or fluorometric reaction ), a substrate , a solid matrix , or a carrier ( e . g ., biotin or avidin ). the formation of desired mutations at specifically targeted sites in a protein structure is considered to be a standard technique in the arsenal of the protein chemist ( kunkel et al ., 1987 , methods in enzymol . 154 : 367 - 382 ). examples of such site - directed mutagenesis with vegf can be found in pötgens et al ., 1994 , j . biol . chem . 269 : 32879 - 32885 and claffey et al ., 1995 , biochem . biophys . acta , 1246 : 1 - 9 . indeed , site - directed mutagenesis is so common that kits are commercially available to facilitate such procedures ( e . g . promega 1994 - 1995 catalog ., pages 142 - 145 ). the connective tissue cell , fibroblast , myofibroblast and glial cell growth andor motility activity , the endothelial cell proliferation activity , the angiogenesis activity andor the wound healing activity of pdgf - d mutants can be readily confirmed by well - established routine screening procedures . for example , a procedure analogous to the endothelial cell mitotic assay described by claffey et al ., 1995 , biochem . biophys . acta . 1246 : 1 - 9 ) can be used . similarly the effects of pdgf - d on proliferation of other cell types , on cellular differentiation and on human metastasis can be tested using methods which are well known in the art . the foregoing description and examples have been set forth merely to illustrate the invention and are not intended to be limiting . since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed broadly to include all variations falling within the scope of the appended claims and equivalents thereof . | 0 |
an overview of a rideshare system 100 is shown in fig1 . a rideshare is broadly defined as a transaction between a driver 102 and a passenger 104 that results in the transportation of the rideshare participants 102 , 104 to a destination 106 along a route 108 . the driver 102 provides transportation using a vehicle such as an automobile 110 . other forms of transportation may be provided , such as airplanes , trains or vans . each participant 102 , 104 has available to him or her a rideshare device 112 , 114 . the rideshare device 112 , 114 has communication capabilities and a location determining capabilities . the rideshare device 112 , 114 communicates with a location broadcast station 120 and a communication broadcast station 130 . commonly , the location broadcast station 120 is a satellite , such as a global positioning satellite provided by the united states government . examples of communication broadcast stations 130 include cellular towers , wi - max broadcasters , wifi broadcasters , walkie - talkie and other forms of radio communication . the location broadcast station 120 and the communication broadcast station 130 may be combined into any convenient form , satellite or terrestrial . the rideshare device 112 , 114 may be any type of presently known or future developed communication device . communication systems are quickly being combined such that computer devices are providing various combinations of voice , text , e - mail , instant messaging , video , pictures and other forms of communication between devices . for example , the rideshare device 112 , 114 may be a cellular telephone with gps ( global positioning satellite ) capabilities . gps capabilities enable determining the three spatial coordinates of the device and the fourth dimension of time at or near when that determination is made . the location of the device generally refers to the three spatial coordinates of the device at a particular time . to simplify the following discussion , the rideshare device 112 , 114 will generally be discussed as if it is a cell phone with gps capabilities , but limitation to this type of device is not intended . the participant device 112 , 114 includes , or has access to , a location system such as gps or other locating strategies . gps systems determine location by measuring the time differentials for location signals 126 , 128 coming from gps satellites 120 orbiting the earth . similarly , a cellular telephone , or similar device , can be located by triangulating communication signals 132 , 134 originating from the device 112 , 114 received at a plurality of broadcast stations 130 . a rideshare system 160 interfaces with the rideshare devices 112 , 114 through the communication broadcast station 130 . the rideshare system 160 arranges and administers a rideshare transaction between a driver 102 and a passenger 104 . the rideshare transaction occurs along a route 108 starting at an origin 105 and concluding at a destination 106 . as discussed below , the rideshare system 160 determines a driver location 170 using the location capabilities of the driver device 114 . the driver location 170 may be the origin 105 or any point along the route 108 as the vehicle 110 is in transit . a pickup location 172 is determined from the location capabilities of the passenger device 112 . the application 172 need not be the actual location of the passenger device 112 , for instance a safer nearby pickup location may be specified by the rideshare system 160 . safety functions provided by the rideshare system 160 include the monitoring of a trip location 174 as the passenger 104 shares the transport 110 with the driver 102 . the rideshare system 160 includes a number of subsystems shown generally in block form in fig2 . the rideshare system 160 may be used in a number of transportation contexts and locations . for example , the rideshare system 160 may support commuting in different metropolitan areas within the same or different countries . a rideshare support system 210 provides a localization module 212 that may provide directions and instructions translated for , or otherwise tailored to , a particular location . a map module 214 provides transportation maps , for example roadmaps of the transportation coverage area administered by the rideshare system 160 . navigation systems support 216 provides navigation functions such as driving directions and may be interfaced with location determining systems such as gps or the location determining functions of the participant devices 112 , 114 . a rideshare match transaction system 220 generally includes functions for matching participants 102 , 104 in a rideshare transaction . a rideshare security module 230 tracks and monitors the participants 102 , 104 during the rideshare transaction . the various components 210 , 260 of the rideshare system 160 employ a communication system 240 . for example , the rideshare match transaction system 220 may utilize the participant devices 112 , 114 to arrange a rideshare transaction and also to track and monitor participant security via the rideshare security module 230 . the communication system 240 may also interface the components 210 , 260 of the rideshare system 160 via wired or wireless communications systems , such as a wide area network , local area network , or cellular communication network . rideshare accounting system 250 provides functions for the monetary and non - monetary administration of the rideshare system , for example , tracking and accounting for : rideshare transactions ; financial negotiations for rideshare between participants 102 , 104 ; fees and commissions that may be taken by the rideshare system 160 ; revenues generated by the rideshare revenue business methods 260 ; expense allocations ; and , rideshare participation incentives . rideshare revenue business methods 260 provide profit and financing alternatives for the rideshare system 160 . turning to fig3 , the ride matching transaction system 220 includes a participant match component 330 , a ride match component 350 , a financial negotiations component 360 and a rideshare participation incentives component 370 that in various combinations match rideshare participants 102 , 104 using dimensions beyond just a shared route . the participant match component 330 matches participants 102 , 104 using either or both social and security considerations . the identification of a participant is performed by a participant identification component 332 . the identification may be confirmed by the participant component 332 , for instance , by biometric input , video input or passwords . background information associated with the identity of the participant can be referenced and utilized by a background checker component 334 . participants 102 , 104 can also be matched by a social network component 336 using social network information maintained by either the rideshare matching transaction system 220 or third party social network systems . for example , a driver 102 may wish to only be matched to passengers 104 identified as friends ( first degree relationships ) or friends of friends ( second degree relationships ). a participation - scoring component 338 may maintain information documenting the participation of the participants 102 , 104 . the participation information may include such values as the number of successful rideshare transactions that the participant has participated in , feedback scores from other participants that have participated in rideshare transactions with the subject participant or recommendations from other rideshare participants . the shared interest - scoring component 340 determines and compares either or both biographic or behavioral information . examples of biographic information might include gender , age , hobby , profession and music preferences . examples of behavioral information might include smoking or non - smoking preferences . the participant match component 330 may utilize information other than that directly associated with a participant . for example , a vehicle information component 342 may obtain and utilize information pertaining to the characteristics of the vehicle 110 , such as vehicle size , number of available seats , insurance safety ratings and the like . vehicle maintenance and safety inspections are other examples of information associated with the vehicle 110 that may inform a participant 104 directly , or the participant match component 330 automatically , to arrange a rideshare match transaction . the participant match component 330 also provides for a preferences component 344 , which may require , or give preference to , certain participants or classes of participants . for example , priority may be given to corporate sponsored users , participants with nearby home or work locations , participants with good participant ratings , or participants with certain group associations . the ride match component 350 includes systems and methods for the transportation specifics of the rideshare transaction . a route match component 352 determines a route 108 that corresponds to a location 170 , a proposed pickup location 172 and a destination 106 . to coordinate a route 108 that meets the criterion of the ride location 170 , the pickup location 172 and the destination 106 , the route match component 352 may determine a suitable route with a route - planning component 354 . a pickup and drop - off alternatives component 356 may suggest an alternative pickup or drop - off location that complies with route planning objectives , such as choosing routes with consideration for the safety of the participants , as is discussed in more detail below . the ride match component 350 may also undertake the negotiation of elements that the participants may be flexible with , for example negotiating the time of pickup using a time negotiation component 358 . the rideshare matching transaction system 220 may also include a financial negotiations component 360 , whereby the participants negotiate compensation for the rideshare transaction . for example , a ride auction component 362 may administer bidding between one or more passengers 104 for a seat in a vehicle 110 along a particular route 108 . the rideshare matching transaction system 220 may also take into account rideshare participation incentives administered by a rideshare participation incentives component 370 . a block diagram of the rideshare participation incentives component 370 is shown in fig4 . participation incentives encourage the use of the rideshare program by a diverse group of participants . these participation incentives may be monetary or non - monetary . for example , participants may be awarded prizes or recognition , as well as , cash and discounts . tie - in promotions are advantageous with the providers of insurance services , wireless communication plan providers , and navigation systems , to name only a few examples . participation incentives provided by the rideshare participation incentives component 370 include providing a free or discounted navigation system 402 for vehicle 110 and giving free or discounted insurance 404 against liability occurring while participating in the rideshare program . free or subsidized wireless communication plans 406 and free or subsidized vehicle cleaning services 408 may also be offered as incentives . a rideshare participation incentive 370 might also include inducements 418 to actively participate in the rideshare system 160 ; for instance , a driver 102 may be given graduated fee credits tied to the percentage of time a driver 102 makes his vehicle 110 available for rideshare transactions . examples of monetary participation incentives include cash payments 410 , sharing of revenue 412 collected by the rideshare program , or credit against fees 414 charged by the rideshare program . for many participants , a primary advantage of participating in a rideshare program is the benefit to the environment . recognition , in the form of carbon credits 413 , is a powerful incentive to those participants . a carbon credit is a value assigned to quantify the savings in carbon emissions caused by the participant &# 39 ; s choice to engage in the rideshare transaction . the value of a sale of carbon credits may extend beyond just recognition , as there is a market developing to trade carbon credits for monetary and other consideration , such as offsetting rights to generate carbon from other activities . referring to fig5 , the rideshare system 160 provides rideshare revenue business methods 260 . revenue may be provided to operate the rideshare system 160 may include monthly fees 510 or per transaction fees 512 . fees may be adjusted , up or down , based upon the monitoring of supply and demand 514 . for example , when there are more passengers 104 then drivers 102 seeking transportation on a given route 108 , the demand based monitoring component 514 may increase the transaction fee 512 . similarly , if there are more drivers 102 offering transportation on a route 108 then there are passengers 104 willing to participate , the demand base component 514 may lower transaction fees 512 to encourage additional passengers 104 to participate in a rideshare transaction . as discussed above , or rideshare auctions 516 may be conducted directly between rideshare participants 102 , 104 , setting the price of the rideshare transaction through bidding . the rideshare system 160 may take a percentage of these ride auctions . the rideshare revenue business methods 260 may also include revenue sources originating beyond the participants of the system . for example , advertisements 518 may be sold to third party advertisers for display on interfaces provided by the participant devices 112 , 114 . third party organizations may offer sponsorships 520 compensating the rideshare program 160 and permitting the third party organization to obtain the public relations value of supporting a worthy program . third party organization may also benefit by providing reward programs 522 subsidizing rideshare transactions . providers of products used in the navigation system 115 may also provide promotional tie - ins , such as giving memberships in the rideshare system 160 with the purchase of a navigation system 524 . insurance is a significant issue in any rideshare system and an opportunity for revenue . systems and methods for insurance integration 526 derive revenue from the integration of insurance coverage with the rideshare system 160 for example ; low cost , month - to - month insurance premiums can be collected to provide users with additional insurance coverage that protects them while participating in a rideshare transaction . supplemental insurance policies may also be offered on a per rideshare transaction basis that insure against liability incurred during the rideshare transaction . these supplemental insurance policies could be charged on a per rideshare transaction basis or on a monthly unlimited rideshare transaction basis . the rideshare system 160 could act as the insurer or share in the revenues generated from these supplemental insurance policies , for instance , by collecting something similar to an agent &# 39 ; s a fee . the rideshare security system 230 is further described with reference to fig6 . a security match module 610 provides participant matching functions 612 with a security focus . the security match module 610 may be implemented as an extension of the rideshare matching transaction system 220 . a safety testing function 614 might test for indicators that a driver 102 is intoxicated , for instance by asking the driver 102 to solve a puzzle or demonstrate response time through the driver device 114 . a visual identity 616 or biometric identifier 618 are matching functions that match identities at the time the passenger 104 is picked up by the driver . for example , either or both of the participants 102 , 104 could be sent a picture of the other participant 102 , 104 for viewing on their participant device 112 , 114 when the participants 102 , 104 meet at the pickup location 172 . the identity of either or both of the participants 102 , 104 may be confirmed at the pickup location using biometric information associated with that participant , by communicating 620 with the rideshare system using the participant device 112 , 114 . a rideshare transaction monitor module 630 sets conditions for and monitors the security of the rideshare participants 102 , 104 while the rideshare transaction is in progress . the transaction monitor module 630 works in conjunction with a rideshare security timer 650 . the rideshare security timer 650 triggers monitors 634 - 640 to assess the safety of the participants 102 , 104 at periodic intervals 652 , randomly 654 or at scheduled times 656 during the rideshare transaction . for example , the rideshare security timer 650 might periodically request from a participant to provide a security response to an active participant monitor 638 . similarly , a passive participant monitor 636 measures and reports a metric using a participant device 112 , 114 , but without the active participation of the participant 102 , 104 . some security functions are monitored in real - time 658 . real - time monitoring occurs at or near an event and is subject to communication lags and other technical limitations . for example , a location monitor 634 may monitor the location of the vehicle 110 in real - time as the vehicle traverses the route 108 . the location of the vehicle may be determined using the location capabilities of either participant device 112 , 114 or using a navigation system 115 associated with the vehicle 110 . if either of the participant devices 112 , 114 or the navigation system 115 deviates from the route 108 by more that a pre - defined threshold , the rideshare security system might take a security action . examples of the security scenarios are discussed below . the rideshare security system 230 may also respond to asynchronous notifications initiated by a participant device 112 , 114 . for example , an emergency button 642 would be communicated 620 to the rideshare security system 230 , which might initiate a security response , such as contacting a security response provider 670 . other security monitoring , whether initiated by the rideshare transaction monitor module 630 or a participant device 112 , 114 , asynchronous or synchronous , periodic , random , scheduled or monitored in real - time , are possible and contemplated by the present invention . the following examples of the rideshare security systems and methods are broadly separated into server - based and device - based strategies . a server - based security check is initiated by a server associated with the rideshare system 160 and interacts with either or both of the participant devices 112 , 114 or a navigation device 115 . a device - based security check is initiated by a participant device 112 , 114 and interacts with the server to evaluate the security alert and administer a security response , when appropriate . security checks may include either or both active participant checks , which anticipate the participation of the participant in the security check , and passive participant checks , which judge information obtained without the active participation of the participant . these categories are defined for the purposes of simplifying the following discussion and are not intended as limitations . also , while examples of security checks may be discussed individually for clarity , those taught or suggested by the examples may be used in various combinations in the embodiments of the invention . fig7 is a state diagram illustrating exemplary server - based security checks . a server 702 triggers 710 a security check 712 . the trigger 710 may be periodic , random or scheduled . the security check 712 may include an active participant check 714 , a passive participant check 716 , or both . for instance , an active participant check 714 may include sending a message to a participant device 112 , 114 and requesting a reply message . the reply message may include an indication of the participant &# 39 ; s perception of the security situation , and an identity token such as a password or biometric confirmation . if the reply is confirmed 718 , the security state is determined to be ok 720 , which is reported 722 to the security check 712 . if the active participant check 714 fails , a security alarm 730 is raised and reported 732 to the server 702 . a security check 712 may also request a passive participant check 716 that checks security information against metrics generally without the participation of the participant 102 , 104 . if the metric is confirmed 724 to be within a range determined to be safe , the security state is determined to be ok 720 and is reported to the security check 712 . when the metric is determined to be out of range 726 , a security alarm 730 is raised . the security alarm 730 notifies 732 the server 702 of the unsafe security situation . the server 702 may then take appropriate action , such as performing other security checks to verify the security situation or reporting that security situation to a security response provider 670 , such as the police . fig8 is a state diagram illustrating exemplary device - based security checks . a device based security check is generally monitored by a participant device 112 , 114 . the security check may be either automated or responsive to something that a participant 102 , 104 initiates . for example , a security parameter 802 is provided by a server 702 or directly programmed into a participant device 112 , 114 . a parameter check 804 monitors the status of information obtained from the participant device 112 , 114 and maintains a status of security ok 806 as long as the information stays within pre - defined boundaries 808 . if the information goes out of bounds , the participant device 112 , 114 may direct the process to either an active participant check 810 or a passive participant check 820 . for example , the active participant check 810 may request a reply from the participant and indicate that the security situation is ok 806 if the reply is confirmed 812 . if the participant replies that there is trouble 814 or no reply 816 is received , then the process moves to a state of security alarm 830 . a passive participant check 820 may check confirming metrics and either confirm 822 that security is ok 806 or the metric indicates a problem 824 , triggering a security alarm 830 . the security alarm 830 may then take further action by notifying a centralized server 832 or taking a direct action 834 , for instance , by notifying a security provider . an emergency button 838 may directly cause entry into the security alarm 830 . fig9 - 12 illustrate exemplary embodiments of security monitoring systems and methods , which can either be implemented as server - based or device - based . turning to fig9 , a security monitor determines the location of a participant device 112 , 114 compares that location to an expected route 108 and triggers a security alarm when an anomaly is detected . the route 108 may be agreed to by the rideshare participants 102 , 104 , assigned by the transaction monitor 630 or other supporting server . in embodiments that either allow or force the assignment of the route 108 , the transaction monitor 630 may choose a route based in part upon a safety profile of the route . the safety profile may take into account such factors as the exposure of the route to the public , the availability of communication connectivity along the route , and the anticipated law enforcement presence along the route . once the route 108 is determined , the location monitor 900 enforces the route assignment 902 by conducting a location check 904 at periodic , random or scheduled intervals . the trip location 174 is determined from either or both of the participant devices 112 , 114 or a navigation system 115 associated with the vehicle 110 . if the trip location 174 is within pre - defined boundaries associated with the route 108 , the security status is considered in - bounds 906 and the security situation is maintained as ok 908 . if the trip location 174 is not within the predefined boundaries associated with the enforced route assignment 902 , the location monitor 900 may trigger an off - route 910 active participant check 912 , or may trigger an off - route 914 passive participant check 916 . a no reply 920 or a trouble reply 922 generates in a security alarm 930 . if the reply is confirmed 913 , the process returns to a security ok state 908 . a passive participant check 916 may seek to verify the security situation , for instance by measuring other security - associated metrics , such as vehicle speed . the vehicle speed may be computed from the location information provided by either the participant devices 112 , 114 or the navigation system 115 and the timestamps associated with that location information . if the metric is confirmed acceptable 917 , the process returns to a security ok state 908 . the security alarm 930 is entered if the metric is outside acceptable parameters 919 . fig1 illustrates an exemplary monitor 1000 that tracks the participant devices 112 , 114 in near real - time and responds if the signal from either of those devices becomes unavailable . if the tracking signal is lost 1002 , a no reply condition 1004 may move directly to a security alarm state 1010 . the monitor 1000 may also seek to determine if there is a condition that explains the signal loss , such as querying 1018 a communication network 1020 for its status . if there is a problem with the network 1022 , the security state may be set to a security ok state 1024 . the security alarm 1010 is moved to if the network status is confirmed as ok 1026 . the monitor 1000 may also query active participant devices 112 , 114 to determine the status of the lost signal or to determine helpful information , for instance , a starting location for a participant search , which is forwarded to the security alarm 1010 . fig1 illustrates an exemplary monitor 1100 that tracks the participant devices 112 , 114 in near real - time and responds if the location information derived from those devices indicates that there has been an early and unexplained separation of the participants 102 , 104 . the early participant separation state 1102 notes an anomaly , it may inquire 1104 by moving to an active participant check state 1106 , which sends a message requesting a reply to either or both of the participants 102 , 104 . if the replies 1108 are deemed to be sufficient to indicate there is no security situation , the security state may be reset to ok 1110 . otherwise , if there is no reply 1112 or a reply indicating that there is a security problem 1114 , then a security alarm state 1116 is moved to . the early participant separation state 1102 may also inquire 1120 using a passive participation check 1122 , which further analyzes the security situation . security okay state 1110 indicates that a security situation does not exist 1124 . security alarm state 1116 indicates a security problem 1126 . fig1 illustrates an exemplary monitor 1200 that tracks the participant devices 112 , 114 in near real - time and responds if the location information derived from those devices indicates that there has been an early and unexplained stop of either or both participant devices 112 , 114 or the navigation system 115 . if an unexpected stop state 1202 notes an anomaly , it may wait a pre - defined amount of time for the participants 102 , 104 and the vehicle 110 to begin moving again , and to reset 1204 to security ok 1210 if the time limit is not exceeded . if the time limit is exceeded 1206 , the state is moved to an active participant check state 1220 , which sends a message requesting a reply to either or both of the participants 102 , 104 . if the replies are confirmed 1222 and deemed sufficient to indicate there is no security situation , the security state may be reset to ok 1210 . otherwise , if there is no reply 1224 or a reply indicates that there is a security problem 1226 , and then a security alarm state 1230 is moved to . the unexpected stop state 1202 may also inquire 1240 using a passive participation check 1242 , which for further analyzes the security situation and moves 1244 to a security okay state 1210 if it is satisfied that a security situation does not exist . the methods and systems of the present invention can encompass embodiments in hardware , firmware , software , or a combination thereof . hardware includes commercially available or proprietary computer systems having a processor for executing program instructions and memory for storing those instructions . while the invention has been particularly shown and described as referenced to the embodiments thereof , those skilled in the art will understand that the foregoing and other changes in form and detail may be made therein without departing from the spirit and scope of this disclosure . further , presently unforeseen or unanticipated alternatives , modifications , variations , or obvious improvements therein may be subsequently made by those skilled in the art , which are also intended to be encompassed by the following claims . | 6 |
shown in fig1 is a first embodiment of a c - arm x - ray system 10 according to the invention . the c - arm x - ray system 10 has a flat panel x - ray emitter 1 and a flat panel x - ray detector 2 which are mounted on a c - arm 5 . moreover , the c - arm x - ray system 10 has a controller 3 to control the flat panel x - ray emitter 1 and the flat panel x - ray detector 2 , and to rotate the c - arm 5 and a terminal 13 with monitor 14 , keyboard 15 , mouse 16 , and a dvd 21 . in order to generate x - ray image data of a volume segment of an examination subject , the examination subject is arranged within the c - arm 5 such that the volume segment is situated between flat panel x - ray emitter 1 and flat panel x - ray detector 2 . the x - rays ( which are radiated traveling in parallel from the x - ray microemitters of the flat panel x - ray emitter 1 ) expose the predetermined volume segment and are then detected by the x - ray pixels of the flat panel x - ray detector 2 . the x - ray image data of the predetermined volume segment are then reconstructed from the data of the flat panel x - ray detector 2 . in order to generate x - ray images from different viewing angles relative to the volume segment , the c - arm 5 is rotated orbitally , meaning that the rotation axis is situated perpendicular to the plane of the drawing . since the flat panel x - ray emitter 1 and the flat panel x - ray detector 2 are firmly attached to the c - arm 5 , the flat panel x - ray emitter 1 and the flat panel x - ray detector 2 are rotated by the same rotation angle so that x - rays generated by the flat panel x - ray emitter 1 in turn strike orthogonally on the flat panel x - ray detector 2 , independent of the rotation angle . the x - ray image data are prepared by the controller 3 and shown on the monitor 14 depending on specific instructions which are input via the keyboard 15 and the mouse 16 . schematically shown in fig2 is a flat panel x - ray emitter 1 which comprises an arrangement of multiple ( 40 in fig2 ) x - ray microemitters 4 . each x - ray microemitter 4 has dimensions of approximately 1 - 10 mm 2 which in particular correspond to dimensions of an x - ray pixel 7 ( see fig3 ). the flat panel x - ray emitter 1 generates a laminar x - ray radiation ( the x - rays of the individual x - ray microemitters travel parallel to one another ), which is contrasted with the conical radiation of an x - ray vacuum tube used presently . for clarification it is noted that a classical vacuum tube radiates isotropically in a point shape and within wide boundaries . the conical radiation arises in that only a small x - ray window is opened . the remainder is shielded . the x - ray window thereby depends on the size and distance of the detector . an additional embodiment of a c - arm x - ray system 10 according to the invention is shown in fig3 . in this embodiment the x - ray microemitters 4 of the flat panel x - ray emitter 1 are arranged across the extent of the c - arm 5 on an area which is larger than the area of the flat panel x - ray detector 2 with this x - ray system 10 , the predetermined volume segment can be exposed from various angles even without a rotation of the c - arm 5 in that a different partial area of the flat panel x - ray emitter 1 is respectively activated . the flat panel x - ray emitter 1 ( i . e . the arrangement of the x - ray microemitters ) is thereby advantageously arranged symmetrical ( in particular axially symmetrical relative to the rotation axis of the c - arm 5 ) to the flat panel x - ray detector 2 ( i . e . to the arrangement of the x - ray pixels 7 ). moreover , an orbital rotation of the c - arm 5 can be implemented in order to correspondingly increase the angle from which the predetermined volume segment is exposed . shown in fig4 is a first embodiment of an o - arm x - ray system 11 according to the invention . instead of a c - arm 5 , the o - arm x - ray system 11 has a gantry 6 in the form of a torus . in this gantry 6 the flat panel x - ray emitter 1 and the flat panel x - ray detector 2 are arranged opposite one another ( thus offset from one another by 180 °) such that they can rotate , wherein the arrangement comprising the flat panel x - ray emitter 1 and the flat panel x - ray detector 2 can be rotated arbitrarily in the gantry . the gantry 6 can be opened on one side in order to shift the gantry 6 across the patient to be examined or , respectively , the table on which the patient lies . the gantry 6 is closed again after the patient is located within said gantry 6 . in comparison to a c - arm x - ray system 10 , the o - arm x - ray system 11 has the following advantages : a rotation of the flat panel x - ray emitter 1 and the flat panel x - ray detector 2 by 360 ° is possible . it is a very stable system . no moving parts exist outside of the gantry 6 , such that fewer problems with sterility occur . with regard to the o - arm x - ray system 11 , the size and weight on the one hand and the lesser flexibility given use as a radioscopy system on the other hand are to be cited as disadvantages relative to a c - arm x - ray system 10 . a second embodiment of an o - arm x - ray system 11 according to the invention is shown in fig5 . in this embodiment , the x - ray microemitters 4 are distributed across the entire area of the gantry 6 . therefore , to create an x - ray image only the flat panel x - ray detector 2 advantageously needs to be moved corresponding to the angle at which the x - ray image is to be created . in the embodiment shown in fig5 , it is also possible that the flat panel x - ray detector 2 is not moved for the generation of multiple x - ray images with different viewing angles . to create a respective one of these x - ray images , x - ray microemitters 4 which are offset by 180 °±“ defined angle ” ( 45 °, for example ) relative to the position of the flat panel x - ray detector 2 are thereby activated and form an area which essentially corresponds to the area of the flat panel x - ray detector 2 . the embodiment of a stationary x - ray system 12 according to the invention is shown in fig6 . in a stationary x - ray system 12 , the flat panel x - ray emitter 1 and the flat panel x - ray detector 2 are arranged stationary ( i . e . immobile ). in order to create x - ray images from different viewing angles even given a stationary x - ray system 12 , the area of the flat panel x - ray emitter 1 is larger than the area of the flat panel x - ray detector 2 . if the individual x - ray microemitters of the flat panel x - ray emitter 1 are respectively aligned relative to the flat panel x - ray detector 2 , a partial area of the flat panel x - ray emitter 1 can be activated to create an x - ray image from a respective viewing angle . even given a stationary x - ray system 12 , it is thereby possible to acquire and reconstruct tomosynthesis images ( for example ) without moving components . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art . | 0 |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.