text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
while this invention is susceptible of an embodiment in many different forms , there are shown in the drawings and will be described herein in detail specific embodiments thereof with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention . it is not intended to limit the invention to the specific illustrated embodiments . embodiments of the present invention include a tank head that can be associated with a fluid treatment tank . the tank head can incorporate multiple ports , and , in preferred embodiments , the tank head can include a quick connection fitting to associate the head with a fluid treatment tank . a tank head in accordance with the present invention can be machined or injection molded . in preferred embodiments , the tank head can be formed from a material that is inert and non - reactive to the fluid being treated in connection with the head . such material can include , but is not limited to , plastic , chrome , stainless steel , and brass or a combination thereof . in embodiments of the present invention , a tank head can incorporate multiple inlet and outlet ports . the ports can be configured in various ways with ports from other tank heads to create various flow patterns between and among the tanks . for example , a plurality of fluid treatment tanks can be connected in series , parallel , or a combination of series and parallel flows . in a preferred embodiment of the present invention , up flow and down flow patterns , which are preferable in flow - specific filter media , can be achieved in a system of fluid treatment tanks . the multiple ports associated with a tank head allow for quick and easy modifications to the flow scheme between and among tanks . additionally , unused ports can be blocked off with plugs , which can be held in place with retaining clips . embodiments of the present invention include a location within the tank head for gauge - type connections . gauge - type connections are useful to determine when the tank media requires service . additionally , a gauge - type connection can incorporate an electronic interface and initiate a flushing or back wash function . referring now to fig1 a , a top view of a tank head with an input port and an output port is shown . traditionally , a tank head 10 includes only two ports : an input port 12 and an output port 14 . as can be seen in fig1 a , during operation , fluid enters the tank head 10 via the input port 12 and exits the tank head 10 via the output port 14 . the tank head 10 can be affixed to a fluid treatment tank as would be understood by one of ordinary skill in the art . similarly , a side view of a tank head with an input port and an output port is shown in fig1 b . during operation , fluid enters the tank head 10 via the input port 12 and exits the tank head 10 via the output port 14 . fig2 is a side view of a tank head incorporating two port connections . when a tank head incorporates more than one inlet port or more than one outlet port , the inlet ports or outlet ports , respectively , can be connected with one another inside the tank head . the connections between the various ports provide for ease of installation . in embodiments of the claimed invention , the connections between the ports can be straight pipes , elbows , tees , barbs , reducers , or any other type of connection as would be understood by those of ordinary skill in the art . in the exemplary embodiment of fig2 , the tank head 20 incorporates ports 22 and 26 , which are connected via tank connection 24 . referring now to fig3 , a top perspective view of a multi - port tank head in accordance with the present invention is shown . the tank head 30 can incorporate a plurality of ports 32 , 34 , 36 , 38 , 40 , and 42 . it is to be understood that the number of ports incorporated into the tank head is not a limitation of the present invention . rather , the number of ports incorporated into a tank head could be more or less than the number shown in fig3 . fig4 is a bottom perspective view of the multi - port tank head shown in fig3 . as seen in fig4 , the tank head 30 can include a connection fitting 44 to connect the tank head 30 to a fluid treatment tank ( not shown ). the connection fitting 44 can be screwed on , snapped on , or connected to the treatment tank in any other way as would be known by those of ordinary skill in the art . in embodiments of the present invention , the connection fitting 44 allows for the quick connection of the tank head 30 to a fluid treatment tank . fig5 is a first side view of a tank head in accordance with the present invention , and fig6 is a cross - sectional top view of the first side view shown in fig5 . the ports 32 , 34 , 36 , 38 , 40 , 42 of a tank head 30 can be in fluid communication with one another . as seen in the exemplary embodiments of fig5 and 6 , ports 32 , 34 , and 36 are in direct communication with one another , while ports 38 , 40 , and 42 are in direct communication with one another . that is , one side of the tank head 30 includes a plurality of inlet ports 32 , 34 , 36 , and one side of the tank head includes a plurality of outlet ports 38 , 40 , 42 . when fluid enters the inlet ports 32 , 34 , 36 of the tank head 30 , the fluid is directed into an associated fluid treatment tank in accordance with the configured flow pattern of the tank head 30 . when fluid exits the fluid treatment tank , it is directed towards the outlet ports 38 , 40 , 42 in accordance with the configured flow pattern of the tank head 30 . referring now to fig7 , an end view of a tank head in accordance with the present invention is shown , and a cross - sectional view of the end view is shown in fig8 . as seen in fig7 and 8 , input port 32 and output port 36 can be incorporated into a singular tank head 30 and be in fluid communication with one another via an associated fluid treatment tank . fig9 is a top view of a system of tank heads incorporating multiple ports and connections therebetween in accordance with the present invention . in a system of tank heads in accordance with the present invention , various ports incorporated within a tank head can be connected to one another and to fluid supply lines via connection adapters . a connection adapter in accordance with the present invention can include two ends : a first end and a second end . a first end of the connection adapter can include an o - ring - type seal , which allows the connection adapter to be connected to a port of the tank head . a retaining clip can hold the connection adapter in communication with the port of the tank head , and the o - ring - type seal can provide for a sealing means between the connection adapter and a port of the tank head . a connection adapter can have more than one o - ring - type seal for positive sealing of the fluid . a second end of the connection adapter can have a thread or barb . the thread or barb allows for easy connection to fluid supply lines or to a connection adapter in communication with a port of another tank head . as seen in fig9 , a system of tank heads can include tank heads 50 , 60 , 70 , 80 and 90 . it is to be understood that the number of tank heads included in the system is not a limitation of the present invention . rather , the number of tank heads could be more or less than the number shown in fig1 . in the exemplary embodiment illustrated in fig9 , tank head 50 incorporates ports 51 , 52 , 53 , 54 , 55 , and 56 . tank head 60 incorporates ports 61 , 62 , 63 , 64 , 65 , and 66 . tank head 70 incorporates ports 71 , 72 , 73 , 74 , 75 , and 76 . tank head 80 incorporates ports 81 , 82 , 83 , 84 , 85 , and 86 . tank head 90 incorporates ports 91 , 92 , 93 , 94 , 95 , and 96 . as can be seen in fig9 , port 91 of tank head 90 is connected to a fluid supply line 190 . port 95 of tank head 90 is connected to a fluid supply line 192 . port 96 of tank head 90 is connected to port 52 of tank head 50 via a fluid supply line 194 . port 53 of tank head 50 is connected to a fluid delivery line 196 . port 55 of tank head 50 is connected to port 65 of tank head 60 via a fluid supply line 198 . port 61 of tank head 60 is connected to port 75 of tank head 70 via a fluid supply line 100 . port 72 of tank head 70 is connected to a fluid delivery line 102 . port 76 of tank head 70 is connected to port 84 of tank 80 via a fluid delivery line 104 . port 82 of tank head 80 is connected to a fluid supply line 106 . the various fluid supply lines and fluid delivery lines can be connected to their respective ports via the connection adapters as explained above . it is to be understood that the connections between the various ports of the tank heads shown in fig9 are not limitations of the present invention . rather , they are only exemplary . the configuration of the connections between the various ports of tanks heads within a system and connections to fluid supply lines allow for variation in the flow pattern of the fluid . referring now to fig1 , a top view of a tank head incorporating multiple ports and plugs in accordance with the present invention is shown . as can be seen in fig1 , a tank head 110 can include ports 111 , 112 , 113 , 114 , 115 , and 116 . if a port is unused , it can be blocked off by a plug . as seen in fig1 , ports 113 , 114 , 115 , and 116 are blocked with plugs 120 , 121 , 122 , and 123 , respectively . therefore , in the exemplary embodiment of fig1 , fluid only flows into and out of ports 111 and 112 , respectively . plugs can be used in connection with a system of tank heads to control the flow of fluid therethrough . fig1 is a side view of a tank head in accordance with the present invention in association with a protective cover and a lower strainer basket . the protective cover 242 of the tank head 200 can be placed over the various ports associated with the tank head 200 . further , a lower strainer basket 266 can be situated below the connection fitting 244 of the tank head 200 . from the foregoing , it will be observed that numerous variations and modifications may be effected without departing from the spirit and scope of the invention . it is to be understood that no limitation with respect to the specific apparatus or method illustrated herein is intended or should be inferred . it is , of course , intended to cover by the appended claims all such modifications as fall within the scope of the claims . | 5 |
fig1 shows a temperature sensor 20 positioned at the interface of a substrate 22 having known thermophysical properties and a surrounding 24 whose thermophysical properties are unknown . suitable means are provided for causing a thermal perturbation of the sensor 20 . for example a heater 21 can be provided for this purpose . if the heater 21 is of the electrical type , it can be provided with electrical leads 26 for applying heat energy to the sensor . however , the invention is not limited in this regard and any suitable heating element can be used which is capable of causing a thermal perturbation , provided that the heating element 21 is preferably located beneath the sensor so that the surface of the sensor remains exposed to the surroundings 24 . alternatively , depending on the type of sensor , a thermal perturbation can be achieved without the need for a separate heater element 21 . for example , if the sensor is comprised of a thermocouple or a resistive temperature device ( rtd ), then an electrical current of known value and duration can be applied directly to the leads 28 of the sensor element so as to cause a pre - determined thermal perturbation of the sensor element 20 . in any case , the known thermal perturbation created by temporarily heating the sensor 20 results in a temporary increase in the measured temperature output for the sensor 20 and then a gradual decay as the temperature returns to ambient conditions . an example of this transient response resulting from the thermal perturbation is shown in fig2 . the transient response of sensor 20 to the thermal perturbation will depend upon a variety of factors but most significantly upon the effective thermal diffusivity of the surroundings 24 and the substrate 22 . significantly , however , if the substrate is known , then any significant variations in the transient response can be attributed to the surroundings . this concept is illustrated in fig2 by two distinct response curves 30 and 32 . as shown in fig2 the thermal decay time τ , will vary depending on the effective thermal diffusivity of the surroundings 24 . for example , the rate of temperature decay in sensor 20 surrounded by ice will be substantially more rapid as compared to a sensor surrounded by air . likewise , the decay time with ice is also more rapid as compared to chilled water because the thermal diffusivity of ice is about seven times larger than that of chilled water . the rapid decay when the sensor is surrounded by ice can be attributed largely to the shift in the heat transfer mechanism from convection to air to conduction in ice which occurs in the presence of ice . the different transient response and / or decay times associated with various surroundings as described herein can be used as a signature to identify the presence or absence of a frozen deposition such as ice . in particular , reference or baseline transient responses can be obtained under known operating conditions with the sensor 20 mounted to a known substrate material 22 which has the same thermal diffusion characteristics as the substrate on which the sensor is intended to be used in practice . subsequently , such reference or baseline response “ signatures ” can be related to identify unknown surroundings under operational conditions . thus , if reference data is obtained for the transient / decay response in the presence and in the absence of ice ( or any other frozen deposition ) and with the sensor mounted to the substrate for which it is intended to be used in practice , then this reference data can subsequently be associated to transient / decay responses where the presence or absence of frost is to be determined . the foregoing process is illustrated by steps 400 through 414 in flow chart form in fig4 . any suitable temperature sensor can be used for carrying out the method as described herein . in a preferred embodiment , however , the temperature sensor is a thermocouple . in the embodiment without the heating element 21 , an electrical current is applied for a short period of time to the thermocouple itself so that it causes resistive heating of the device . once the electric current is removed , the thermocouple begins to return to its ambient temperature and the desired transient response is obtained . other devices which may be used to similar effect are resistive temperature devices (“ rtd &# 39 ; s ”) which are conventionally used as temperature sensors . fig5 is a block diagram showing the basic operation of a frozen deposition detection system according to a preferred embodiment of the invention . as shown in fig5 the system according to the invention is preferably controlled by microprocessor 42 and includes a control unit 50 . control unit 50 preferably incorporates an analog to digital (“ a / d ”) converter 54 for converting the analog voltage output of sensor 20 to a digitized representation which may be used as an input to the microprocessor . a current source 56 is preferably provided as part of the control unit 50 . upon command from the microprocessor , the current controller 56 causes an electric current to flow so as to apply a thermal perturbation . if a thermocouple or rtd unit is used for the sensor 20 , the electric current can be applied directly to the sensor leads for a heating effect and no separate heater element 21 is required . alternatively , if other another type of sensor not capable of direct heating is used then the current is preferably applied to the heater unit 21 . in any case , the application of the predetermined quantity of heat results in a transient response as discussed relative to fig2 . the current is then removed and the sensor output is measured via a / d converter 54 to obtain the transient / decay response . this response is compared by the microprocessor 42 to the reference transient previously recorded for the particular type sensor under controlled conditions with the same substrate 22 . the microprocessor uses this information to evaluate whether the measured response matches the response expected for the presence of ice or the absence of ice . the comparison can be made on a data - point by data - point basis to evaluate how closely the curves match , can involve a comparison of the measured decay time to a reference value , or any other suitable means for matching the characteristics of the measured transient response to the reference transient response . in any case , the results can then be communicated to a user by suitable means such as by displaying a message on display unit 44 . if the transient or decay response matches the reference response for ice present , then the display will indicate the presence of ice . it will be readily appreciated by those skilled in the art that numerous alternative embodiments of the invention are also possible . for example , the microprocessor 42 and control unit could be replaced by conventional analog circuitry capable of comparing a measured transient response to a reference . however , it will likewise be appreciated that the programmable microprocessor arrangement shown in fig5 allows for greater flexibility when using different types of sensors on various different substrates . according to an alternative embodiment of the invention , it is also possible to detect the presence of a frozen deposition such as ice by taking advantage of the required latent heat which is needed to affect a phase change . the process by which this result may be achieved is illustrated in fig6 steps 600 - 614 . latent heat is the quantity of heat absorbed or released by a substance undergoing a change of state or phase . for example , such a state or phase change occurs when ice transitions to water , or water transitions to steam . in this method , it is necessary first to establish the maximum quantity of applied heat that is required to raise the temperature of the sensor 20 above the temperature at which the deposition solidifies or freezes . in the case of water , this would be thirty - two degrees fahrenheit . for convenience this temperature shall hereinafter generically be referred to as the freezing temperature , it being understood however , that the freezing temperature could differ in the case of different materials . in any case , this so called maximum quantity of applied heat will take into account the coldest anticipated operating temperature which the sensor is likely to encounter , the thermal diffusivity of the substrate material on which the sensor is mounted , and any other heat loss mechanisms such as anticipated airflow velocity over the sensor in the absence of the ice or other frozen deposition . this maximum value of applied heat can be determined either experimentally or by calculation so that when such quantity of heat is delivered to the sensor 20 , it will have the effect of raising the temperature of the sensor above freezing for all operating conditions where no ice or other frozen deposition is surrounding the sensor . for many applications it will be sufficient to simply define the maximum quantity of applied heat based on the coldest temperature likely to be encountered by the sensor . those skilled in the art will recognize that for certain applications , it may be appropriate to account for other heat loss mechanisms such as wind velocity for the purpose of establishing a set of maximum quantity of applied heat values . thus , in fig6 optional step 602 includes reading of ambient environmental conditions such as ambient temperature , humidity and wind velocity , and at step 604 selecting a maximum heat quantity based on the given ambient environmental conditions . the sensor 20 will typically be incapable of sensing anything other than temperature . however , in many applications , the ambient conditions can be obtained from other sensors associated with the equipment . for example , in the case of aircraft wings , ambient temperature , wind velocity and humidity conditions can be obtained from other sensors on board an aircraft . most applications will not require these additional ambient conditions to be addressed so that only a single maximum heat quantity need be determined and applied . once the maximum applied heat requirement is determined , the application of that quantity of heat to the sensor will result in a response that will always raise the sensor temperature above the freezing temperature , at least momentarily , when no frozen deposition or ice is present . significantly , however , for the case where ice or some other frozen deposition surrounds the sensor , the application of the predetermined maximum quantity of heat would result in a response that will not cause the sensor temperature to surpass the freezing temperature . this failure to raise the temperature above the freezing temperature is due to the additional energy that is always required in order to effect a state change for a frozen deposition such as ice . fig3 illustrates graphically the temperature response of a sensor 20 versus time when the maximum quantity of heat is applied as described above . as shown in curve 34 of fig3 the application of such heat where no ice is present raises the sensor temperature above the freezing temperature . however , the application of the same amount of heat fails to raise the temperature above freezing as shown by curves 35 and 36 when ice is present . this is due to the fact that the amount of energy input to the sensor 20 is not sufficient to affect a phase change . accordingly , the additional energy applied to the sensor 20 in the form of heat is absorbed by the surrounding ice or frost without any corresponding rise in temperature above freezing temperature . the foregoing method is advantageous as it does not require any transient signature analysis . instead , it is merely necessary to detect a measured temperature response below or at freezing temperature to indicate the presence of ice on the sensor . in order to implement the foregoing system , an arrangement similar to that shown in fig5 can be used . it will be recognized by those skilled in the art that the method according to fig6 avoids the need for complex transient signature analysis . thus , the control circuitry and programming for this alterative method can potentially be simplified to some extent as compared to fig5 . the delivery of the maximum required heat to the sensor can be accomplished by various means depending upon the type of sensor which is used . once again , the use of a thermocouple as a sensor element is preferred due to the fact that the thermocouple can serve as both a heating and sensing element . in the case of the thermocouple sensor or rtd sensor , the heat can be applied directly by connecting an electric current of predetermined amperage and duration , alternatively , an auxiliary heating device 21 may be used as previously described relative to fig1 . while the foregoing specification illustrates and describes the preferred embodiments of this invention , it is to be understood that the invention is not limited to the precise construction herein disclosed . the invention can be embodied in other specific forms without departing from the spirit or essential attributes . accordingly , reference should be made to the following claims , rather than to the foregoing specification , as indicating the scope of the invention . | 4 |
the principles of the present invention are incorporated in a display and dispensing apparatus generally indicated by numeral 10 in the drawings . as fig1 - 3 illustrate , the apparatus 10 is composed of a head portion 12 and an arm member 14 . the apparatus 10 is illustrated throughout the drawings in conjunction with a couple 20 which affixes the apparatus 10 to a flat surface 22 such as a pegboard , for example . in the preferred embodiment , head portion 12 is formed from a single piece of hardened steel rod which is bent to the desired configuration . it is to be noted , however , that head portion 12 may be constructed from a variety of materials and may have a variety of shapes , all of which will accomplish the same function . as fig2 illustrates , the head portion 12 is composed of two side members 24 and 26 , a cross member 28 and a bottom spacing member 30 . the bottom spacing member 30 as well as top spacing members 32 and 34 of respective side members 24 and 26 are slightly bent away from the rear of the head portion 12 . this rearward bend permits the head portion 12 to stand away from the pegboard 22 in use , thereby providing a space for couple 20 . additionally , an overall support of the apparatus 10 is provided by top spacing members 32 and 34 , and the entire length of bottom spacing member 30 which contact the pegboard 22 and provide stability . the cross member 28 provides horizontal stability between the side members 24 and 26 as well as a support for arm member 14 . as illustrated in fig4 arm member 14 has a distal end 36 and a proximal end 38 which , in the preferred embodiment , is welded to the center of cross member 28 . furthermore , the proximal end 38 of first arm member 14 extends beyond cross member 28 and is bent downward with respect to the head portion 12 to form an engagement leg member 40 . this engagement leg member 40 interfaces directly with the couple 20 and lies in the standoff space created by the bottom spacing member 30 and the top spacing members 32 and 34 of side members 24 and 26 respectively . the arm member 14 is affixed to the head portion 12 and may be arranged at a slight angle toward the bottom spacing member 30 of head portion 12 in the preferred embodiment . this slight angle provides a gravity feed for the paint brushes or similar articles which are suspended from the arm member 14 . as the drawings illustrate , gravity forces the articles downward and away from head portion 12 and toward the customer when in use . this design thereby aligns the articles one behind the other while advancing the next brush to the front of the apparatus 10 so that the display always has a full appearance thereby reducing the amount of in - store housekeeping . to prevent the articles carried on the arm 14 from falling off the distal end 36 , a first detent 42 is formed in the arm near the distal end and a second detent 44 is formed in the arm spaced away from the first detent , toward the proximal end 38 . still farther toward the proximal end 38 is a bend 46 in the arm which changes the downward slope of the arm 14 to a lesser slope . the second detent preferably is formed by a first bend 48 causing the arm to slope downwardly to a greater extent and a second bend 50 causing the arm to then slope upwardly . the first detent is preferably formed by a first bend 52 causing the arm to slope downwardly and a second bend 54 causing the distal end of the arm to slope upwardly . other detent arrangements may be used as will be evident to those skilled in the art . when a full load of articles such as paint brushes , is applied onto the arm 14 by a person restocking the display , and the arm is held in the couple 20 against the vertical surface 22 , the articles will slide under the influence of gravity toward the distal end 36 . a first , most distal article 56 will be captured by the second detent 44 , a second article 58 will reside on the portion of the arm between the bend 46 and the second detent 44 , which has a minimal downward slope , thereby preventing this article from pressing against the first article to such an extent so as to push the first article more toward the distal end . subsequent articles 60 will line up behind the second article 58 . thus , the length of the arm between the bend 46 and the second detent 44 , which comprises the lesser sloped portion , has a length at least as great as a thickness of the articles being carried on the arm . similarly , the first and second detents 42 , 44 are spaced apart by at least approximately the thickness of the articles being displayed . the first article 56 may be manually moved to the first detent 42 , and upon such movement , the second article 58 will be free to move into the second detent 44 , and will be caused to move in such direction because of the slope of the arm between the first bend 46 and the second detent 44 as well as due to forward pressure by the third and subsequent articles 60 . the first article 56 is then in a position for easy removal by a customer by merely sliding the article up the final upwardly sloped portion of the arm 14 at the distal end 36 . if the customer subsequently decides not to purchase the article , the article may be easily replaced on the arm since the first detent area 42 will remain open . the article captured by the second detent 44 will not move into the area of the first detent on its own , but requires a manual force to move it to the first detent area . in this manner , an article can be easily removed from the arm , even if it is held in a second detent area by manually causing the article to slide over bend 52 into the first detent area and then slipping the article upwardly off the distal end of the arm . the first detent area then remains clear for replacement of the article if it is determined to be unwanted by the customer . the customer need not press the remaining balance of articles back upwardly along the arm just to replace an unwanted article since the first detent remains clear . as illustrated in fig2 and 4 , couple 20 is comprised of two upstanding hook members 66 and 68 which are inserted into the holes of the pegboard for suspending the apparatus 10 . additionally , couple 20 has a central aperture 70 which extends through the couple 20 . this aperture 70 is slightly beveled and has a channel 72 formed in its top surface . the aperture 70 and the channel 72 accept the engagement leg member 40 of first arm member 14 to affix the apparatus 10 to the pegboard 22 . the channel 72 also prevents rotation of the engagement leg member 40 within the couple 20 and provides a set angle for the apparatus 10 with respect to the pegboard 22 . in operation , couple 20 is affixed to pegboard 22 by inserting hook members 66 and 68 into the desired holes of the pegboard 22 . next , the engagement leg member 40 of the arm member 14 is inserted within the aperture 70 of couple 20 until the proximal end 38 of the arm member 14 is seated within the channel 72 . in this position , the top spacing members 32 and 34 of sides 24 and 26 respectively as well as the bottom spacing member 30 of head portion 12 should contact pegboard 22 to further prevent rotation of the apparatus 10 around the engagement leg member 40 of the arm member 14 and to provide additional vertical support to the apparatus 10 upon its engagement with pegboard 22 . as illustrated in fig1 several articles to be displayed , such as paint brushes , are loaded onto the distal end 36 of arm member 24 , are advanced past the first detent 42 and second detent 44 until the apparatus 10 is completely loaded or until a desired number of articles are placed on the arm member 14 . with this arrangement , when not in use , the most forward article is suspended from the arm member 14 at the second detent 44 with the remaining articles stacked neatly behind it . to remove an article from the apparatus 10 , the leading article is moved out of the second detent into the first detent , unless it is already held at the first detent , and then it is slid upwardly and forwardly off the distal end 36 of the arm 14 . when the leading article is removed in this manner , it can readily be understood that gravity forces the remaining articles downward along first arm member 14 until a new first article is held by the second detent to once again maintain the desired stacked arrangement . for replacement , normally by the consumer , the article is merely placed back onto the distal end 36 of first arm member 14 where it will then slide by gravity along the distal end portion and into the first detent 42 . this is advantageous since the consumer does not have to perform any further steps to reload the article back onto the apparatus 10 which would normally involve pushing the remaining articles back up the arm member 14 . as is apparent from the foregoing specification , the invention is susceptible of being embodied with various alterations and modifications which may differ particularly from those that have been described in the preceeding specification and description . it should be understood that i wish to embody within the scope of the patent warranted hereon all such modifications as reasonably and properly come within the scope of my contribution to the art . | 0 |
with reference now to the drawings , and in particular to fig1 thereof , the preferred embodiment of the new and improved seat mounted workout station system embodying the principles and concepts of the present invention and generally designated by the reference numeral 10 will be described . the present invention , the seat mounted workout station system 10 is comprised of a plurality of components . such components are individually configured and correlated with respect to each other so as to attain the desired objective . more specifically , the new and improved seat mounted workout station system for exercising from a sitting position through various motions includes a seating assembly 14 which has a generally vertically extending back portion 16 . a seat portion 18 is coupled to the back portion adjacent a lower extent thereof and a head portion 20 is coupled to the back portion at the top thereof . the seat portion preferably has a rectangular support assembly 19 mounted thereunder . the back portion preferably has a rectangular frame 21 mounted thereon which resides in a slightly angled plane . the frame has a width equal to that of the back portion and further extends from a point spaced from the head portion to a point below the seat portion . also provided are a plurality of cables , springs and pulleys positioned within the back portion . such cables , springs and pulleys include two interior cables 24 , pulleys 26 and springs 28 which are coupled internally to a lower base 30 of the frame of the back portion and primary hand grips 32 adjacent to the chest of a user . the primary hand grips preferably rest on a pair of primary hand grip arms 31 which are mounted to sides of the back portion adjacent to the head portion . the arms 31 preferably extend forward along an axis which is normal to a plane in which the back portion resides . the interior cables are preferably routed through the frame and to the arms via pulleys . the back portion also includes two outer cables 34 , pulleys 36 and springs 38 which are coupled interially to an upper base , 40 of the frame of the back portion . secondary hand grips 42 are positioned at outboard ends of the support assembly 19 of the seat portion adjacent to the legs of the user . the two outer cables each preferably include a spring mounted to the upper base which is coupled to a cable that is routed through a pulley mounted on the lower base . thereafter , the cable is routed through a pulley coupled to another spring depending from the upper base . the cable is then are routed through the support assembly of the seat portion for coupling with the secondary hand grips . two intermediate cables 44 , pulleys 46 and springs 48 are coupled interially to an intermediate base 50 of the back portion . tertiary hand grips 52 are coupled adjacent to the head of a user . it should be noted that each of the hand grips have a cylindrical configuration . at rest , the tertiary hand grips preferably rest on tertiary hand grip arms 53 coupled to ends of the upper base and extending vertically therefrom . the two intermediate cables each preferably include a spring mounted to the intermediate base which is coupled to a cable that is routed through a pulley mounted on the upper base . thereafter , the cable is routed through a pulley coupled to another spring connected to the lower base . the cable is then are routed through the frame and tertiary hand grip arms for coupling with the tertiary hand grips . lastly provided is at least one padded strap 54 which has free ends couplable to the primary hand grips for being moved in response to the forward motion of a chest of a user . to accomplish this , the strap has a pair of ends with holes therein for receiving the secondary hand grips . as described hereinabove , the system of the present invention is a multi - purpose exercise gym that can be mounted behind the driver &# 39 ; s seat in a tractor trailer truck . the system consists of a 30 inch high by 21 inch high by 23 inch wide frame that is produced from 1 inch square tubular steel . the frame bolts to the seat in a tractor trailer truck or similar vehicle and has three hand grips on each side for a user to hold while exercising . a first set of handles are located midway up the back of the frame so that they are approximately even with the driver &# 39 ; s shoulders . a second set of hand grips is located on horizontal frame members of the support assembly that position the handles at the front corners of the seat . the third set of handles are located at the top of the frame so that they are positioned over the driver &# 39 ; s head . each handle is produced from steel tubing or molded from plastic . the handles are connected to lengths of stainless steel cable that runs through a series of pulleys and connect to springs or hydraulic cylinders mounted on the back of the frame so that the springs or cylinders stretch as the driver pulls on the handles . a set of padded springs slip over the handles and fasten around a driver &# 39 ; s arms are also included . the appealing features of the present system are its ability to help an individual tone and strengthen his or her muscles and fight fatigue . the present system is designed to provide a multi - purpose exercise machine that is attached to the driver &# 39 ; s seat in the cab or a truck or a motor home . this allows a driver to receive a workout before he starts his day , when he is finished driving for the day , or while his is driving . the driver simply sits in the seat , holds a hand grip in one hand and pulls on the hand grip . as the driver pulls on a hand grip , a cable connected to the hand grip stretches a spring . overcoming the resistance provided by the spring tones and strengthens the muscles being used , and the driver can perform six different exercises with each arm to provide a complete upper body workout . regular workouts could also increase a driver &# 39 ; s safety by helping to prevent him or her from falling asleep while driving . the present system is easy to install and does not get in the way when not in use . the frame fits flat against the back of a seat and is easily attached to virtually any seat . the handles are positioned within easy reach so that a driver does not take his eyes off the road , and the driver can vary the number of repetitions he performs to fit his strength or fitness level . the system also works the arms independently so that a driver could keep one hand on the steering wheel while he exercises . as to the manner of usage and operation of the present invention , the same should be apparent from the above description . accordingly , no further discussion relating to the manner of usage and operation will be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention . | 0 |
fig1 illustrates a time of flight mass spectrometer 10 in accordance with the invention . for purposes of example , spectrometer 10 receives pre - existing ions , such as is the case for space applications . however , the invention is also applicable to time of flight mass spectrometers that use an ionizer . in general , spectrometer 10 is just one example of instrumentation that counts particles , and is thus one example of instrumentation to which the invention described herein may be applied . spectrometer 10 is a “ single coincidence ” spectrometer , meaning that a single start and a single stop per particle define an event . primary ions enter the spectrometer 10 and pass through an ultra - thin foil 11 , such as a carbon foil . the interaction of the ions and the foil 11 produces secondary electrons , which are emitted from the exit locations of the ions . the foil may be more generally referred to as a type of “ secondary electron emission surface .” these secondary electrons are electrically directed to a start detector 13 to provide a start signal . an example of a suitable start detector 13 is a microchannel plate . a suppression grid 12 is placed in front of the start detector 13 . as explained below , grid 12 permits only a fraction of the electrons to pass through and impinge on detector 13 . although typically , each primary particle that enters the spectrometer 10 provides only at most a few electrons , the number of primary particles may be quite high . the suppression of electrons by grid 12 prevents spectrometer 10 from being saturated in the case of high primary particle rates . grid 12 is made from a highly transmissive conductive material , examples being nickel or gold . the ions pass through the foil 11 , traverse a drift space and impinge upon a stop detector 14 . a microchannel plate may also be used for detector 14 . although some ions may become neutralized at foil 11 , because the drift space has a small electric field , the times of flight are not much different for the ions and the neutrals . the time lapse between the “ start ” pulse from the electron detector and the “ stop ” pulses from the stop detector 14 represents the time - of - flight of the respective ion . this time - of - flight is proportional to the square root of the ratio of the ion &# 39 ; s mass over its charge . if desired , the biasing of foil 11 may be used to reduce false start electrons . as shown in fig1 foil 11 is held at a voltage , v foil , which is more negative than any part of spectrometer 10 other than suppression grid 12 . with sufficient biasing , the result is suppression of electrons arriving from anywhere other than from foil 11 . electron suppression at grid 12 is achieved by applying a voltage , v cutoff , to grid 12 , where v cutoff is more negative than v foil . electron suppression by grid 12 is based on the fact that the electrons are emitted from foil 11 with a very low but highly repeatable energy distribution . as explained below , v cutoff may be adjusted so that only a known fraction of the secondary electrons that would otherwise reach detector 13 are transmitted through grid 12 . a control unit 15 may be used to provide appropriate voltage for v cutoff as well as v foil , with appropriate control electronics for grid 12 and foil 11 . processing unit 16 receives the output of detectors 13 and 14 and may be programmed to analyze the output data and to implement various calibration techniques discussed below . fig2 illustrates the energy distribution of the electrons emitted by foil 11 . as illustrated , this energy peaks at only a few electron volts ( ev ). this secondary electron spectrum is independent of the energy of the primary ions . fig3 illustrates how grid 12 is used to suppress the count rate of start electrons that reach detector 13 . a voltage , v cutoff , is applied to grid 12 , such that only the fraction of electrons that have sufficiently high energy , e & gt ; v cutoff , pass through grid 12 . fig4 illustrates how v cutoff may be varied to control the fraction of start electrons that pass through grid 12 . the number of electrons with sufficiently high energy to pass through grid 12 is the area of the curve to the right of v cutoff . as v cutoff is increased , the fraction of start electrons that reach detector 13 is reduced . in effect , grid 12 acts as a variable “ electrostatic choke ” on the count rate of start electrons . fig5 illustrates the resulting efficiency of this throttling as a function of v cutoff . as can be seen , grid 12 provides a controllable variable count efficiency . like the curve of fig4 the curve of fig5 is predictable and particle independent . the secondary electron suppression provided by grid 12 can be introduced anywhere along the electron flight path . grid 12 may be placed immediately after foil 11 or just in front of detector 13 . also , additional grids could be used for additional throttling . an alternative embodiment of spectroscope 10 could be equipped with a stop foil and stop detector for electrons produced on stop foil ( not shown ). this would permit secondary electrons to be produced and collected , to produce stop electrons and a stop signal , in a manner similar to the production of start electrons . this alternative embodiment could be further equipped with a suppression grid associated with the stop detector , which could be used to throttle the stop electrons in a manner similar to the above - described throttling of start electrons . using the above - described electron suppression method , it is expected that , if desired , more than 99 % of the secondary electrons from foil 11 may be suppressed . because of the nature of the electron emission curve of fig5 it can be determined with accuracy , what percent of electrons are being detected at detector 13 . specifically , a particular value of v cutoff can be expected to suppress a known percent of electrons at grid 12 . the above - described method of electron suppression may also be used for purposes of calibrating the spectrometer 10 . the same ions being analyzed may be used as the calibration source . measurements that vary from the curves illustrated in fig4 and 5 indicate that the applied voltage , v cutoff , may require calibration . one approach to calibration is to scan the suppression voltage , v cutoff , while ions are received at various constant fluxes . the secondary electron counting rates may be measured as a function of the suppression voltage . calibration may be also performed as a function of energy , to remove energy dependent effects . or , calibration may be performed as a function of ion species , to remove species dependent effects . for ions of mixed species , calibration using the actual ions to be detected guarantees that the calibration is appropriate for the particular mixture of ions observed . because of the ease of calibration , routine calibrations may be incorporated into the normal data collection cycle of spectrometer 10 . at any point in time , or at periodic intervals , the curves of fig4 or 5 may be run to determine what counts were detected for the v cutoff that was set . measuring calibration factors as a function of energy may be used to increase the accuracy of the absolute count rate measurement . this is because the secondary electron emission curve , illustrated in fig2 is extremely reproducible . this means that a fit to a known curve shape is used rather than simple count ratios . reproducible discrepancies from this curve can provide an onboard internal measure of problems with the measurements , internal to spectrometer 10 , such as errors in the applied voltage , or with the detector or counter . calibration is especially effective when combined with the use of separate stop and start channels . this approach is useful for space - based spectrometers , which often use a single stop channel in association with multiple start channels . the different start channels are used for effecting different viewing directions simultaneously . comparison of start and stop rates provides improved knowledge of absolute calibration because the different channels provide independent measurements of the same incident ions . as stated above , the particle suppression concepts described herein may be applied to any particle counting instrumentation . in fact , detector 13 and suppression grid 12 could be manufactured as a unit to be installed in such instruments . appropriate voltage controls could be implemented . two such units could be used in a time of flight spectrometer for counting both start and stop electrons . although the present invention has been described in detail , it should be understood that various changes , substitutions , and alterations can be made hereto without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
the inventory management engine , also referred to as lean inventory management engine ( lime ), works as a service and can be used as a stand - alone component or an add - on component in an existing scm system . the inventory management engine does not contain any user interfaces . therefore , all dialog functions related to the physical stock quantities and stock movements are contained in separate , external components , as will be described below . the primary purpose of the inventory management engine is to keep and move the physical stock and answer queries from other applications about stock quantities and stock movements . [ 0031 ] fig1 a is a simplified block diagram of one implementation of an inventory management system ( 100 ), for example , for a company having one inventory to manage . the company can be a manufacturer that receives supplies from n suppliers and operates the inventory management system ( 100 ) in a manner that permits the suppliers to input data regarding the particular stock items they supply to the manufacturer . for example , the manufacturer can have an agreement with the suppliers that all finished products in the suppliers &# 39 ; warehouses that will be available to the manufacturer are to be input into the inventory management system ( 100 ) such that the manufacturer will be able to anticipate shortages of supplies . individual suppliers can also be authorized to view data in the inventory management system ( 100 ) that pertains to levels of the particular stock item the individual suppliers supply . for example , the suppliers may have an arrangement with the manufacturer to maintain an inventory range of a particular part at the manufacturer &# 39 ; s facility . thus , viewing the inventory data will enable the suppliers to supply stock items as necessary to ensure that the number of stock items at the manufacturer &# 39 ; s facility is within the specified range . the suppliers also will be able to determine whether they must increase or reduce their production . the management system ( 100 ) includes a web application server ( 105 ) that runs an inventory management engine ( 110 ) and that communicates over a network ( 115 ) with the suppliers ( 120 ). the web application server ( 105 ) communicates with a database ( 125 ) that includes inventory related data . the company operating the web application server ( 105 ) can be , for example , a manufacturer of simple and / or complex items . a manufacturer of a complex item may receive supplies from many suppliers , whereas the manufacturer of a simple item may receive supplies from much fewer suppliers . nevertheless , in either situation the inventory management system operates scalably to handle the transactions required of the system ( 100 ). one example of an inventory management engine ( 110 ) is sap &# 39 ; s lime . an example of a network ( 115 ) includes a wired network , such as the internet , or a wireless network . the inventory management engine ( 110 ) includes a set of interface layers ( 112 ) so that the inventory management engine ( 110 ) can communicate with a large variety of external systems . [ 0035 ] fig1 b is a simplified block diagram of an implementation of a second inventory management system ( 130 ) to , for example , a company that receives stock items from n suppliers ( 120 ) and also manufactures and supplies stock items to n customers ( 135 ). for example , the customers ( 135 ) may be manufacturers of other items . in this implementation , the inventory management system must be able to store the data and handle the queries and transactions of both the suppliers and the customers . the company operating the web application server ( 105 ) and inventory management engine ( 110 ) of fig1 b may be , for example , one of the suppliers of fig1 a . as may be evident from fig1 a and 1b , each supplier , manufacturer , and customer in a supply chain may have the need to operate an inventory management system ( 100 , 130 ). moreover , there may be sharing of some of the data stored in the individual databases ( 125 ) between multiple inventory management engines ( 110 ) such that the members of the supply chain have as much information as possible to ensure that their inventory management is optimized . [ 0036 ] fig1 c is a simplified block diagram of an implementation of a third inventory management system ( 140 ). the inventory management system ( 140 ) includes a company that acts as a service broker of the web application server ( 105 ) and the inventory management engine ( 110 ) for entities , such as suppliers ( 120 ), customers ( 135 ), manufacturers ( 145 ), warehouse operators ( 150 ), and shippers ( 155 ). in this implementation , the inventory management system stores the data and handles the queries and transactions of all of the entities that are provided this service by the service broker . each entity accessing the inventory management engine would be provided an authorization code to access only certain data and only the supply chains in which that entity is involved . in this implementation , the entities advantageously avoid the initial capital costs of setting up an inventory management system as well as the ongoing costs of maintaining the software and hardware associated with such a system . however , the entities are required to pay fees to the service broker for the use of the inventory management system ( 140 ). as was described above , the lime engine can communicate with a variety of external systems , such as a sap r / 3 system , a non - sap system ( for example , a legacy system in a conventional inventory system ), and a valuation system ( 150 ). the valuation system can be an accounting or finance system that performs functions related to the valuation of the stock quantity data , such as reporting or analyzing the value of the stock stored in one or more locations . the sap system can be based on an sap r / 3 computing environment that includes a classical inventory management system ( mm - im ), a warehouse management system ( le - wm ), and a handling unit ( hu ) management system , or other computer systems . the external systems can be client computers , such as desktops or laptop personal computers ( pcs ), having the necessary software for communicating with the web application server over the network . depending on what type of external system is used , different interfaces are selected from the interface repository ( 112 ). some external systems can use xml ( extensive markup language ) to communicate with lime via application integration . other applications , such as the sap system , can use xml via application integration , a cif ( common interchange format ) interface , function modules , bapi ( business application programming interface ) and badis ( business add - inns ). in some cases , the inventory management engine may also communicate with other function modules or engines in the same system through function modules and abap ( advanced business application programming ) oo ( object oriented ) methods . the inventory management engine provides the stock quantity data in response to transaction requests from the external systems . for example , a valuation system may send a transaction request requesting to monitor specific stock quantity data so that the valuation system can further process the data such as analyzing the data and producing a report based on the analyzed data . in the retail industry , such a process may include producing a report of the quantity and value of the merchandise in one or more locations . an exemplary implementation of the inventory management engine will now be described in further detail , in particular with regards to table structures , rules , and how to add or delete entries from a table . an inventory management engine in accordance with one implementation of the invention will now be described by way of example . as can be seen in fig2 the database model of a lime kernel includes a hierarchical tree ( 200 ) that contains a set of guids ( global unique identifiers ) representing locations ( l 1 through l 3 ), one or more handling units ( h 1 ), stock units ( s 1 through s 3 ) and serial numbers ( serial 1 through serial 3 ). a location identifies the physical location of a stock unit and can , for example , be a warehouse , a warehouse gate , a delivery point , a shelf , a storage bin , and so on . a handling unit is an aggregation of stock quantities bundled together for distribution and logistics purposes . examples of handling units include an individual item in a carton , combined items on pallets and skids , or items transferred in independently identified containers , such as ocean containers , rail cars or trucking trailers . a handling unit usually has a worldwide unique identifier sscc ( serial shipping container code ). the quantity for a handling unit is always one . a stock unit is the smallest entity or item that can be handled and can be physically identified in a logistics process . a stock unit cannot be divided into components for logistic purposes . single instances of a stock unit are not distinguished , but own the identical attributes and identifier . the stock unit is the carrier of the stock quantity . examples of stock units include : material , trade item , sku ( t - shirt size l , style country , color green ), batch ( different production lots for paints , dyes , wallpapers , pharmaceutical products ), quantity with a certain shelf - life expiration , serial number , split valuation new / used , manufacturer part number ( separate stock units for different manufacturers ), value only article is a stock unit using the currency unit as quantity unit , and so on . every node in the hierarchical tree ( 200 ) has a unique identifier marked with “ x ” and a number . the hierarchical tree ( 200 ) is represented as a table identified by “/ lime / tree ” ( not shown ) in the inventory management engine &# 39 ; s database . the “/ lime / tree ” table is one of the main components of the inventory management engine , and will be discussed in further detail below . first , however , the other tables in the inventory management engine will be described . these other tables include index tables ( 205 - 215 ), a stock table ( 220 ) identified by “/ lime / stock ,” and a serial number table ( 225 ) identified by “/ lime / serial .” there are three types of index tables in the inventory management engine ; index tables for location ( 205 ), index tables for handling units ( 210 ), and index tables for stock units ( 215 ). the index tables ( 205 - 215 ) are used to map real world numbers ( that is , business keys ) to guids that are to be used in the / lime / tree , / lime / stock , and / lime / serial tables . as can be seen in fig2 there are two index tables for locations ( 205 ), which are marked loc_i 001 and loc_i 002 . it should be noted that none of the tables in fig2 are complete , but are only used to illustrate the principle of the lime database model . the location index table loc_i 001 has a first column lgnum representing a warehouse number and a second column lgtyp representing a storage type . the location index table loc_i 002 additionally contains a third column lgpla representing a bin location . as can be seen from the tables loc_i 001 and loc_i 002 , there is a unique guid l 1 for the warehouse number and storage type , and unique guids l 2 and l 3 for each of the bin locations . similarly the handling unit index table ( 210 ) identified by hu_i 001 represents the sscc with a unique guid h 1 . the upper one of the stock unit index tables ( 215 ) identified by stock_i 002 has a guid s 1 representing the material yogurt , batch c 1 , produced by nestle . the lower one of the stock unit index tables ( 215 ) identified by stock_i 001 in which guid s 3 represents a gold ore owned by smith , and a guid s 2 represents a cellular telephone owned by nokia . all of the guids presented above are of a type referred to as index guids . index guids refer to the index tables for location , handling unit , or stock item . another type of guids that is used in the inventory management engine is of a type referred to as node guids . node guids are used to identify nodes in the hierarchy tree ( 200 ). if the same stock item ( for example , s 1 for material yogurt batch c 1 ) has stock quantities at two different places ( for example , handling unit h 1 and location l 3 ), each stock quantity s 1 will have a different node guid ( x 8 and x 6 ). a stock quantity can be found in the table / lime / stock ( 220 ) with the node guid as a unique key . a serial number is linked to a stock quantity via the node guid and stored in the table / lime / serial ( 225 ). a stock quantity that is represented in several units , also referred to as a multiple transaction quantity ( mtq ), has the same node guid . this can , for example , be seen in node x 4 of the hierarchy tree ( 200 ), where the gold ore ( identified by guid s 3 ) is represented as 1 to and 1 . 15635 oz , respectively . the / lime / stock table ( 220 ) also reflects this by having two entries for the gold ore . as can be seen from the / lime / stock table ( 220 ), the yogurt ( identified by guid s 1 ) is represented in two units . however , this should not be confused with the mtq , because in the case of the yogurt , it is only represented in one unit per location ( ka at location x 8 and pc at location x 6 ). consequently , when changes occur to the gold ore , both quantity entries for the gold ore in the stock table ( 220 ) need to be updated , but when changes occur to the yogurt in one of the locations , only the single quantity entry corresponding to that particular location needs to be updated . the described representation allows any one stock item to be represented in as many units as necessary , and it also allows any participant in the supply chain to access the stock item in any measurement unit , as long as the unit has been specified and added to the stock table / lime / stock ( 220 ). the table / lime / stock ( 220 ) is the only table containing stock quantities . a stock quantity refers to a specific node in the hierarchy tree ( 200 ). the exemplary / lime / stock table ( 200 ) in fig2 contains an index guid column with the guids obtained from the stock index tables ( 215 ), a parent column that identifies the parent node of the stock item , a vsi ( virtual stock indicator ) column that indicates whether the stock item relates to a physical or virtual stock item , a unit column that indicates the unit of measure for the stock item , a quantity column that indicates the quantity of the stock item , and a node column that is a unique key for a stock quantity . the unit of measure is a key field , which allows stock items represented in multiple units of measure to have different entries in the / lime / stock table ( 220 ). the vsi is included in the / lime / stock table ( 220 ) since there can be a requirement to store the same physical stock quantity twice within lime . for example , when a lime is used in a warehouse , the vsi can be used to mark stock quantities as ‘ transport pending ’ in addition to the real physical quantities . another requirement known from the oil and gas industry is to separate the so called “ physical stock levels ,” which are derived from absolute measurements of a stock item quantity , from the “ book stock levels ,” which are calculated by the system adding or subtracting delta quantities to the stock item quantity table . with the vsi indicator , this separation can be achieved . queries can then use the vsi indicator to retrieve stock item quantities for a defined vsi only . in one implementation , a stock quantity node without a vsi is the real quantity and a stock quantity node with a vsi is a virtual quantity needed for special purposes only . the vsi ensure that the same physical quantity is not counted twice when calculating the total physical stock . the individual serial numbers are stored in a table ( 225 )/ lime / serial and can be linked to any type of stock item through the node guids without having to add the serial number field to the corresponding index table . the number of serial number entries is linked to the stock quantity in a specific unit of measure , for example , three serial numbers are linked to the node x 7 which has a quantity of 3 in the stock index table ( 220 ) in fig2 . in an alternative implementation , serial numbers can be stored as stock quantity entries in table ( 220 ), but that might lead to a very large number of entries in the stock index table ( 220 ) and might be performance - critical for queries . table 1 above contains the relationship between a hierarchy node and its parents as well as all ancestors ( grand - parents and higher ). a node at the highest hierarchy level has a default parent root . the node guid is the exact identifier of a node and can be used to retrieve the complete path from a node to all the ancestors of the node . the column headings idx and type above refer to index table number and index table type , respectively . in this exemplary implementation of the lime engine , the structure and the entries of the / lime / tree table have two primary goals . first , writing to the / lime / tree table should be fast . therefore , there is only a small number of fields and all entries ( relationship node to parent and node to ancestors ) can be inserted in a single database statement . second , queries , in particular bottom - up queries , such as “ where can i find a stock quantity ( node ) within a location ( ancestor )?” need to be efficient . this is particularly important for warehouse management applications , where it should be possible to obtain information with a minimum of db accesses . with the / lime / tree table it is possible , for example , to read the stock quantity node guids directly of any location ( ancestor ) in the hierarchy tree , read the stock quantity of any node in table / lime / stock ( 220 ) via the node guid , and read the intermediate nodes ( e . g . hu , sub - location ) in / lime / tree via the node guid if the hierarchy information is requested by the query . furthermore , no additional entries are requested in the table / lime / tree for mtq ( multiple transaction quantities ) of the same stock item . all quantities have the same guids ( stock index guid , parent index guid , node guid ) because they represent the same physical stock . the mtq quantities are kept in table / lime / stock ( 220 ) only ( where the unit of measure is a key field ). the table structures described above allow the users to build virtually any kind of hierarchy , but the logical consistency needs to be checked against two kinds of rules , namely hierarchy rules ( for example , a stock guid cannot have any children ; a hu cannot be parent to a location , the highest node should always be a location , and so on ) and business logic rules ( for example , a bin location cannot be parent to a plant / storage location , and so on ). a user can define specific business rules in customizing / system tables . in one implementation of the inventory management engine , the hierarchy rules are as follows : 1 . stock quantities can only be found at stock item level . there can be no stock quantities at the handling unit , location , or serial number levels . 2 . a serial number is always linked to a stock item . the serial number cannot be linked directly to a handling unit or to a location . 3 . a multi - level hierarchy of locations ( nested locations ) and handling units ( nested handling units ) is possible . 4 . a multi - level hierarchy of stock items ( containing the stock quantities ) is not allowed ( no nested stock items ). 5 . a stock item must have either a handling unit or a location as parent . 6 . a stock item can be appended to each node of the hierarchy . it is thus possible to represent a location containing materials on handling units and materials without handling units . 7 . a location can exist without a handling unit or without a stock item ( empty location ). 8 . a handling unit can exist without a stock item ( empty handling unit ). 9 . a stock item or a handling unit cannot exist without a location . 10 . a location can only have another location as parent ( no handling unit or stock item ). 11 . a node in the hierarchy tree can only have one parent . 12 . a specific location or a specific handling unit can only exist once in the hierarchy tree . consequently , it is not possible to have a recursive hierarchy . a user may define additional hierarchical rules and business rules to further constrain the functionality of the inventory management engine to specific situations , if necessary . the database model and index tables described above are also shown in fig3 in the form of a conventional entity relationship diagram for stock quantities . to add new locations , handling units , or stock items , entries need to be created in the corresponding index table and in the hierarchy tree . in one implementation , stock items can be created “ on the fly ” with a goods movement , while handling units need to be created through calling a particular maintenance module . when creating a location , a handling unit , or a stock item the lime ensures that the hierarchy rules described above are not violated . in one implementation this means that a parent node always needs to be specified for locations or handling units . for locations ( but not for handling units or stock items ), the parent node can be the root node . whenever entries in the index tables are updated , the lime updates the tree table / lime / tree and performs the necessary checks . entries in the stock index tables can be created without specifying a parent node . the new stock table entries are integrated into the table representing the hierarchy tree when a goods movement process occurs . the integration takes place by calling a badi that enables the caller to decide if the stock should be created , or if the goods movement should be canceled with an error . materials with batches or goods movements with new stock categories are examples of were it could be suitable to create stock entries “ on the fly .” [ 0072 ] fig5 shows how the index tables and their entries are changed when creating the location l 2 and the handling unit h 1 . in addition to creating the location l 2 and the handling unit h 1 , two batches of the material ‘ butter ’ are also created in a goods movement operation . originally , only the rightmost hierarchy tree ( 500 ) exists and the corresponding entries in tables 510 , 520 , 525 and 530 , that is , entries with guids l 3 and s 1 . when a user wishes to create a new location , the location index table ( 510 ) is updated with the new location information and a new guid l 2 is assigned . the hierarchy tree table ( 525 ) is also updated with a new entry that corresponds to l 2 and only has root as a parent , and a new node guid x 2 is assigned to the new location l 2 . next , a handling unit is created in location l 2 by creating an entry in a handling unit index table ( 515 ) and updating the hierarchy tree table ( 525 ) with the corresponding handling unit entry , as well as adding a new node guid x 5 to the handling unit . finally a set of two stock items “ butter ” are added to the handling unit by updating the stock index table ( 520 ) with two new entries . the new guids s 2 and s 3 are generated for the two new “ butter ” items , and the corresponding entries are created in the stock item table ( 530 ) and in the hierarchy tree ( 525 ) table . the resulting hierarchy tree ( 505 ) is shown in the left hand side of fig5 . how the actual writing to the various tables is carried out will be discussed in further detail below . in this exemplary implementation of the invention , it is only possible to delete locations or handling units if the locations or handling units are on a leaf level of the hierarchy tree , that is , if the location or handling unit does not have any children . entries from the stock index tables can be deleted only if the corresponding entries to be deleted from the table / lime / stock has a quantity of zero . the data table model used in lime has been designed to allow fast queries for complex supply chain networks and fast writing of data when stock movement documents are posted . entries of the table / lime / stock can be identified using either the guid and parent guid combination , or using the node guid . for goods movements , the guid and parent guid combination is used to avoid an additional select operation on the / lime / tree table . queries use the node guid when the stock item , but not the direct parent , is specified . movements of products for owners and total stock levels result in updates of only one table ( the / lime / stock table ). as long as the hierarchy is not changed , table / lime / tree does not change and does not need to be updated . movement of the handling unit to a different location , on the other hand , results in a change in table / lime / tree but table / lime / stock remains unchanged . similarly , a stock change can be posted to the handling unit , which in return leads to an update of the relevant entry in table / lime / stock only . [ 0078 ] fig6 shows how a goods movement is reflected in lime . in the example it is assumed that stock s 1 ( yogurt ), in location l 3 ( warehouse number 0001 and storage location 0002 ) is increased by 10 liters and 11 kilograms , respectively ( in the scenario , it is assumed that yogurt is measured both in the units liters and kilograms ). first , the location guid ( l 3 ) is selected in the location index table / lime / loc_i 001 . second the stock guid ( s 1 ) for yogurt is selected in the stock index table / lime / stock_i 001 . finally the stock corresponding to guids s 1 and l 3 is updated in the stock table / lime / stock . with the hierarchy tree table concept , most queries can be carried out using a single select statement ( joined with the relevant index table ) on the table / lime / tree . a distinction can be made between two general types of queries : top - down queries , where the basic query is “ show me what i contain ,” and bottom - up queries , where the basic query is “ show me where i am in the world .” depending on the business scenario and setup of the supply chain , optimized queries can be developed using this basic conceptual approach . [ 0080 ] fig7 shows how lime selects the stock of s 1 in location l 1 . first , the location guid ( l 1 ) is selected in the location index table / lime / loc_i 001 . second the stock guid ( s 1 ) for yogurt is selected in the stock index table / lime / stock_i 001 . third , the nodes in the hierarchy table / lime / tree are identified using the guids s 1 and l 1 . since the table / lime / tree holds all parents of a stock item , it is possible to find all occurrences of a stock item with only one select operation on the table / lime / tree . it is not necessary to do one select operation for each level against the tree table . from the hierarchy table / lime / tree , it can be seen that the nodes are x 5 and x 7 . finally , the stock quantities corresponding to nodes x 5 and x 7 are retrieved from the “ quantities ” column in the stock table / lime / stock . a more detailed process for inventory management in accordance with one implementation of the invention will now be described with reference to the schematic block diagram ( 400 ) in fig4 . in fig4 all the blocks outside the dashed lines ( that is , blocks 402 - 412 , 418 , 438 , and 444 - 450 ) represent external components , while all the blocks inside the dashed lines ( that is , blocks 414 - 416 , 420 - 436 , and 440 - 442 ) represent the inventory management engine . lime receives a message from a calling application ( 402 , 404 ) containing stock movement data or physical inventory data . the message can be an xml document that is forwarded to lime via an application integration server ( 412 ) or it can be a function module call from a mysap application ( 404 ). the incoming document is kept by lime during the whole process . lime then generates ( 414 ) an update log ( prima nota ) ( 416 ) if necessary . the prima nota holds all input data that is required for recovery in the event of a system failure or auditing . after generating the prima nota ( 416 ), lime extracts ( 420 ) its own data from the incoming document , such as location , handling unit , stock quantities , and so on and maps it to the lime internal structures described above according to a set of mapping rules ( 422 ). an external data check or data enrichment ( 418 ) is also carried out , if necessary , and a stock quantity controller ( 424 ) updates a stock quantity database ( 426 ). external applications ( 406 - 410 ) can submit stock inquiries to lime through the stock quantity controller ( 424 ). each application that is interested in stock movement or physical inventory documents subscribes to lime , and defines the dispatching rules for the documents . users of the lime application can include rules based on various conditions , such as which criteria are relevant for the subscribing application ( for example , finance applications need to be informed of changes in stock ownership ), how often the subscribing application will receive documents from lime ( for example , once per day ), and whether the documents will be cumulated by lime before dispatching and what the aggregation rules are . an event controller ( 430 ) then checks the subscriber rules ( 436 ) for the various applications and forwards the document ( maybe in cumulated form ) to the interested applications using a dispatcher ( 432 ). the forwarding may include adding cumulated data ( 428 ) and obtaining other external data ( 438 ) for enrichment ( 440 ) with the lime data before the lime data is passed on to the receiving applications . the receiving applications may include an mm - im system ( 444 ), a r / 3 accounting interface ( 446 ), and an application integration server ( 448 ). the application integration server ( 448 ) may call various subsequent applications ( 450 ), such as finance applications , legacy applications , and so on . these applications can in turn customize ( 442 ) the subscriber rules ( 436 ) used by the event controller to dynamically change the behavior of the event controller ( 430 ) and dispatcher ( 432 ) before the next event takes place . [ 0088 ] fig8 shows an example of an oil terminal tank containing diesel from two different owners ( exxon and shell ). the diesel stock is kept in several units of measure ( liter , denoted by l , and liter at 12 ° c ., denoted by l 12 ). the hierarchy tree ( 800 ) in the left hand side of fig8 shows the real - world view , and the hierarchy tree ( 805 ) in the right hand side of fig8 shows the internal representation in lime . the oil terminal tank is represented by location guid l 1 , as shown in the location index table loc_i 005 . the owner is a key field of index table stock_i 003 , therefore the same material has a different guid for each owner , that is , s 1 ( for exxon ) and s 2 ( for shell ). in the stock table / lime / stock , each owner &# 39 ; s oil is represented by two entries , one for each unit of measure and each having an associated quantity . the unit of measure is a key field in the stock table / lime / stock , so that all mtq quantities can be managed with the same guid and parent guid combination . physically the mtq quantities belong to the same stock item . [ 0090 ] fig9 shows an example , similar to the one shown above in fig8 of an oil terminal tank containing diesel from two different owners ( exxon and shell ). also here , the diesel stock is kept in liters and liters at 12 ° c ., respectively . the hierarchy tree ( 900 ) in the left hand side of fig9 shows the real - world view , and the hierarchy tree ( 905 ) in the right hand side of fig9 shows the internal representation in the lime . the example in fig9 is different from example in fig8 because of the addition of node x 4 to the hierarchy tree ( 905 ) in the lime . the addition of node x 4 allows inventory difference handling in tank management , as will now be explained . whenever a goods movement occurs for a specific owner , one or both of nodes x 2 ( diesel exxon ) and x 3 ( diesel shell ) is / are updated , depending on for which owner the goods movement took place . the total tank stock is regularly measured and an inventory report ( in absolute quantities ) is posted to node x 4 ( that is , the total amount of diesel in the tank , which is a non owner - specific measurement ). the virtual stock indicator ( vsi ) indicates that the same physical quantity is stored twice in lime . stock item quantities with a vsi value should not be considered when calculating the total physical stock represented in lime . differences between the owner - specific stock ( x 2 and x 3 ) and the total stock can now be analyzed by comparing the goods movement postings to x 2 - x 3 and the inventory reports to x 4 . a number of embodiments of the invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . for example , the stock quantity data in the database can be distributed among one or more databases . accordingly , other embodiments are within the scope of the following claims . | 6 |
fig1 to 3 show the principle of focus detection utilizing phase differences . fig1 shows the in - focus state , fig2 shows the near - in - focus state and fig3 shows the far - in - focus state . as seen in fig1 a to 3a , optical images of light beams passing through two different regions of a photo - taking lens 1 are detected by two sensor arrays 3a and 3b through secondary image forming lenses 2a and 2b . the sensor arrays 3a and 3b produce output signals sa and sb , as shown in fig1 b to 3b . in the in - focus state shown in fig1 two images are formed at substantially corresponding positons on the sensor arrays 3a and 3b and the two output signals sa and sb have a substantially zero phase difference d . however , in the near - in - focus state and the far - in - focus state in fig2 and 3 , the two images are shifted in position and the output signals sa and sb respectively have phase differences d = c1 and d = c2 , as shown in fig2 b and 3b . therefore , when the phase difference d of the two output signals sa and sb is detected , the focusing state of the photographic lens 1 can be detected . the phase difference d can be calculated by , for example , the following algorithm . assume that the two photoelectric conversion outputs sa and sb are n image signals of imgae a {( a ( 1 ), a ( 2 ), . . . , a ( n )} and image b { b ( 1 ), b ( 2 ), . . . , b ( n ) }, and a correlation pk between the two images a and b is given by : ## equ1 ## according to equations ( 1 ) and ( 1 )&# 39 ; above , the correlation pk is calculated by checking the coincidence between the images a and b while changing the phase difference . the value of k whick provides a minimum value of the correlation pk corresponds to the phase difference d . therefore , when the phase difference d is calculated in accordance with the equations ( 1 ) and ( 1 )&# 39 ;, the focus state of the photographic lens 1 can be determined . fig4 a to 4d show the images a and b and the corresponding correlations pk . fig4 c shows an image signal in the in - focus state , and the correlation pk in this state is represented by curve α in fig4 a . the correlation pk in the out - of - focus state in fig4 b is represented by curve β in fig4 a . the correlation pk in the out - of - focus state in fig4 d is represented by curve γ in fig4 a . according to the focus detection method utilizing phase differences , the phase difference between the two images formed by light beams emerging from two different regions of the photographic lens 1 is determinable . fig5 shows images a ( a , a &# 39 ;) which are shifted over time . when there is no shake , substantially the same output signals are obtained as shown in fig5 a . however , when shake is present , the object pattern formed on the sensor changes due to such shake , and the output waveforms from the sensor arrays become different from each other as shown in fig5 b and 5c . fig6 shows a single - lens - reflex camera in which the apparatus shown in fig1 to 3 is assembled . in fig6 the photographic lens 1 , the lenses 2a and 2b , and the sensor arrays 3a and 3b are the same as those shown in fig1 to 3 . referring to fig6 the camera further has a quick return mirror 4 having a submirror 5 , a photographic film 6 , a shutter 7 , a program shutter control unit 8 , a shutter release switch 8 &# 39 ;, a beam splitter 9 , an exposure meter 10 , an automatic focus motor 14 to be described later , and a handshaking warning led 21 to be described later . ip is the primary imaging plane . the present invention will be described in more detail with reference to the block diagram shown in fig7 . referring to fig7 the image signal processor 11 is a 1 - chip microprocessor which has a cpu ( central processing unit ), a memory circuit , i / o ports and the like . the processor 11 receives signals from a sensor device 12 consisting of sensor arrays 12a and 12b and ccds ( charge - coupled devices ) through an a / d converter 13 . a control output from the processor 11 controls the motor 14 . the sensor device 12 is driven by a ccd driver 15 . the ccd driver 15 and the processor 11 receive clock pulse signals from a clock generator 16 . two images are formed on the sensor arrays 12a and 12b by light beams which have passed through two different regions of the photographic lens . accumulation and transfer of optical images is performed by control signals φc , sh and icg from the ccd driver 15 . when the processor 11 supplies a start signal st to the driver 15 , the driver 15 sends an accumulation start signal icg to the sensor device 12 together with the clock φc generated in response to a signal clk from the clock generator 16 . in response to the signal icg , the sensor device 12 starts accumulating the two images . when the photocharges of these images reach a predetermined accumulation level , the sensor device 12 sends an accumulation end signal eoi to the driver 15 . the driver 15 then sends a photoelectric conversion output transfer signal sh to the sensor device 12 . the charges accumulated in the sensor device 12 are transferred to the ccds and an end signal end is supplied to the processor 11 . in synchronism with the clock φc from the driver 15 , the sensor device 12 time - serially supplies analog photoelectric conversion signals os of the two images to the a / d converter 13 . the a / d converter 13 performs 8 - bit a / d conversion in synchronism with a conversion command signal adc from the driver 15 and supplies digital time - serial signals d0 to d7 to the processor 11 . the processor 11 stores the input two image signals a { a ( 1 ), a ( 2 ), . . . , a ( n )} and bb ( 1 ), b ( 2 ), . . . , b ( n ) } and detects the phase difference d between the two images a and b for automatic focus in accordance with the following procedures . ## equ2 ## note that ( iii ) above means that &# 34 ; the value of k which provides a minimum value of pk is defined as d &# 34 ;. the phase difference d is compared with a predetermined automatic focus allowable value e1 ( positive value ). if | d |≦ e1 , it is determined that an in - focus state is obtained . then , a signal of high level ( to be referred to as h hereinafter ) is supplied to a display terminal jf , and a signal of low level ( to be referred to as l hereinafter ) is supplied to display terminals nf and ff . an led 17 connected to the terminal jf is thus turned on . however , if d & lt ;- e1 , it is determined that the lens is in the near - in - focus state . a signal h is supplied to only the terminal nf if d & gt ; e1 , it is determined that the lens is in the far - in - focus state , and a signal h is supplied to only the terminal ff . when shake detection is performed , in a processing sequence beginning with the sensor image accumulation , the phase difference d between the images a and b is calculated using the signal a &# 39 ; of the image a in the immediately preceding sequence as the signal of the image b . with this method , the phase difference between the same images which are shifted only over time can be detected . if handshaking has occurred , the phase difference d has a value substantially corresponding to the amount of handshaking although the same image is involved . in this manner , the phase difference d is compared with a predetermined handshaking allowable value e2 ( positive value ). if | d |≦ e2 , it is determined that no handshaking has occurred . this operation sequence can be written as : note that a &# 39 ;( i ) is the a image signal of the immediately preceding sequence , and ( ii ) and ( iii ) are the same as in the focus processing . output terminals rn and fm of the processor 11 are for driving the motor 14 mounted on the photographic lens . when both the terminals rn and fm are h , transistors 19a and 19c are off and transistors 19b and 19d are on through gates 18a and 18b . thus , the transistors 19b and 19d and diodes 20a and 20b apply an electrical brake on the motor 14 . when the terminal rm is h and the terminal fm is l , the transistors 19a and 19d are off while the transistors 19b and 19c are on . the motor 14 is biased in the direction from right to left in the figure . when the terminal rm is l and the terminal fm is h , the transistors 19b and 19c are off and the transistors 19a and 19d are on . the motor 14 is biased in the direction from left to right and driven in the direction opposite to that when the terminal rm is h and the terminal fm is l . when both the terminals rm and fm are l , all the transistors 19a through 19d are off and the motor 14 is electrically released . when shake is detected , a terminal err of the processor 11 goes h and turns on the led 21 . a switch 22 is an af lock switch . if the switch 22 is on when the operator wishes to stop the automatic focus function , the processor 11 sets the terminals rm and fm to h and stops the motor 14 . the mode of operation of the circuit configuration described above will be explained with reference to the flow chart shown in fig8 . the processor 11 has a program of the flow chart algorithm shown in fig8 . parentheses () indicate steps of the sequence . ( 1 ) the processor 11 generates a start signal st , the ccd driver 15 supplies a signal icg to the sensor device 12 , and accumulation of light images is started . ( 2 ) when the driver 15 receives an accumulation end signal eoi from the sensor device 12 after the photocharges reach a predetermined accumulation level , it drives the a / d converter 13 . the a / d converter 13 converts photoelectric conversion signals os of the light images formed on the sensor arrays 12a and 12b and supplies digital signals a ( i ) and b ( i ) ( where i = 1 , 2 , . . . , n ) of the two images a and b . these signals are sequentially stored in the memory . ( 4 ) if the af lock switch 22 is off , in order to perform automatic focus , image signals a ( i ), b ( i ) ( where i = 1 , 2 , . . . , n ) for automatic focus are generated in accordance with the procedures ( i ) above . ( 5 ) the phase difference d is calculated in accordance with the procedures ( ii ) and ( iii ). ( 6 ) the phase difference d is compared with the focus allowable value e1 . ( 7 ) if | d |≦ e1 , it is determined that an in - focus state is obtained the terminal jf is set h to turn on the led 17 connected thereto . at the same time , the terminals rm and fm are set h to brake the motor 14 . ( 8 ) if d & lt ;- e1 , it is determined that the lens is in a near - in - focus state . the terminal nf is set h , the terminal rm is set h , and the terminal fm is set l so as to drive the motor 14 . ( 9 ) if d & gt ; e1 , it is determined that the lens is in a far - in - focus state . the terminal ff is set h , the terminal rm is set l , and the terminal fm is set h . the motor 14 is driven in the direction opposite to that in the case of step ( 8 ). ( 10 ) when the af lock switch 22 is on , the terminals jf and nf for locking the automatic focus are set l so as to turn off the leds 17 and the terminals rm and fm are set h to brake the motor 14 . ( 11 ) the shake detection image signals a ( i ) and b ( i ) ( i = 1 , 2 , . . . , n ) are generated in accordance with the procedures ( i &# 39 ;) for shake detection . ( 12 ) the phase difference d is calculated in accordance with the procedures ( ii ) and ( iii ) as in step ( 5 ). ( 13 ) the phase difference d is compared with the handshaking allowable value e2 . ( 14 ) if | d |≦ e2 , it is determined that no shake has occurred . the terminal err is set l to turn off the led 21 . ( 15 ) if | d |& gt ; e2 , it is determined that shake has occurred . the terminal err is set h to turn on the led 21 to warn the operator of this condition . in this manner , in this embodiment , it is difficult to perform shake detection during automatic focus due to movement of an object . therefore , shake detection is performed by turning on the af lock switch 22 after automatic focusing . after this series of operations is performed , the flow returns to step ( 1 ) for sensor accumulation . at this time , the image signals a ( i ) and b ( i ) ( i = 1 , 2 , . . . , n ) are held in the memory until the flow advances to step ( 4 ) or step ( 11 ). in the above description , shake detection is performed after the af lock switch is turned on . however , focus detection and shake detection can be alternately performed after an in - focus state is confirmed . before shake detection is performed , when an operation c ( i )= a ( i ) is performed in procedures ( i ), a processing sequence beginning with sensor image accumulation is started . in this sequence , the a image signals a &# 39 ; of the immediately preceding sequence are stored as signals c in a separate memory area . when shake detection is performed , these signals are used as the b image signals to calculate the phase difference d between the two images a and b . then , the phase difference of images of a single image which are shifted over time is detected . if shake has actually occurred , the phase difference d has a value corresponding to such shake even if a single image is involved . when the phase difference d calculated in this manner is compared with the predetermined allowable value e2 ( positive value ) and found to be | d |≦ e2 , it is determined that no shake has occurred . these procedures can be represented by : note that c ( i ) are a image signals which are stored in a separate memory region in the immediately preceding sequence in the procedures ( i ). the procedures ( i ), ( ii ) and ( iii ) are the same as those in focus control , and the procedures ( i &# 39 ;) are added next to ( i ). the mode of operation in this case will be described with reference to the flow chart shown in fig9 . the processor 11 prestores a program of an algorithm of the flow chart shown in fig9 . the algorithm steps indicated in parentheses . ( 1 ) the processor 11 generates a start signal st , and the ccd driver 15 supplies a signal icg to the sensor device 12 causing it to start accumulating light images . ( 2 ) when the photocharges reach a predetermined accumulation level , the sensor device 12 supplies an accumulation end signal eoi to the driver 15 to energize the a / d converter 13 . the a / d converter 13 converts the photoelectric conversion signals os of the light images formed on the sensor arrays 12a and 12b . the digital images a ( i ) and b ( i ) ( i = 1 , 2 , . . . , n ) of the two images a and b are sequentially stored in the memory . ( 3 ) in order to perform automatic focusing , the image signals a ( i ) and b ( i ) ( i = 1 , 2 , . . . . n ) are generated in accordance with the procedures ( i ). in order to allow shake detection to be performed if an in - focus state is established , the signals a ( i ) of the immediately preceding sequence are stored in a separate memory area as signals c ( i ). ( 4 ) the phase difference d is calculated in accordance with the procedures ( ii ) and ( iii ). ( 5 ) the phase difference d is compared with the focus allowable value e1 . ( 6 ) if | d |≦ e1 , it is determined that an in - focus state is obtained . the terminal jf is set h to turn on the led 17 . at the same time , the terminals rm and fm are set h to brake the motor 14 . ( 7 ) in the in - focus state , the a image signals c ( i ) of the immediately preceding sequence stored in step ( 3 ) are generated as signals b ( i ). ( 8 ) the phase difference d is calculated in accordance with the procedures ( ii ) and ( iii ) as in step ( 4 ). ( 9 ) the phase difference d is compared with the allowable value e2 . ( 10 ) if | d |≦ e2 , it is determined that no shake has occurred . the terminal err is set l to turn off the led 21 . ( 11 ) if | d |& gt ; e2 , it is determined that shake has occurred . the terminal err is set h to turn on the led 21 , thereby signalling the operator of this condition . ( 12 ) if it is determined in step ( 5 ) that d & lt ;- e1 , it is determined that the lens is in a near - infocus state . the terminal nf is set h , the terminal rm is set h and the terminal fm is set l so as to drive the motor 14 . ( 13 ) if d & gt ; e1 , it is determined that the lens in a far - in - focus state . the terminal ff is set h , the terminal rm is set l and the terminal fm is set h so as to drive the motor 14 in the direction opposite to that in step ( 12 ). in this sequence , shake detection is performed only when the in - focus state is determined . after a series of operations is performed , the flow returns to the sensor accumulation processing in step ( 1 ). thus , focus detection and shake detection are alternately performed . in the above description , focus detection and shake detection are performed independently of each other . however , in the case of a detection system of the present invention for calculating an out - of - focus state from a phase difference of two images , focus detection and shake detection can be performed in parallel if signal processors are arranged in parallel with each other . fig1 and 11 show the case wherein the degree of shake of a shake detection signal exceeds a predetermined value , and the program diagram of an automatic exposure system is shifted to a high speed shutter in order to prevent a blurred print . fig1 shows an exposure control circuit which has a known program function described in , for example , japanese patent disclosure no . 54 - 151445 ( u . s . pat . no . 4 , 358 , 188 ). a circuit 30 produces a voltage representing the negative value of ev which is determined by the brightness of an object and film speed . the circuit 30 consists of a photometer ( not shown ), a film speed setting section and the like . a circuit 31 provides a full - aperture diaphragm value av0 . devices 32 and 33 control the diaphragm value and the shutter speed in accordance with values of av and tv , respectively . a description will first be made with reference to the case of program operation when no shake is detected . in this case , the output at an output end and a of the terminal err of the processor 11 is l . therefore , a transistor 35 connected to the end a through a resistor 34 is off . meanwhile , a transistor 36 connected to the end a through a resistor 37 and an inverter 38 is on . when resistors 39 , 40 , and 41 , an operational amplifier 42 , constant voltages kvc and vc , and a resistor 43 connected to the collector of the transistor 36 which in on are properly set , an operation result of av &# 39 ;=( 1 / 2 ) ev - 1 is produced at the output end of the operational amplifier 42 . the output from the operational amplifier 42 is supplied to one terminal of an analog switch 44 . a terminal of an analog switch 45 paired with this switch 44 receives the full - aperture diaphragm value av0 from the circuit 31 . two input terminals of a comparator 46 receive an output av &# 39 ; from the operational amplifier 42 and the value av0 from the circuit 31 . when av &# 39 ;≧ av0 , an output l is produced . when av &# 39 ;& lt ; av0 , an output h is produced . the output terminal of the comparator 46 is connected to a control terminal of the pair of the analog switches 44 and 45 . when the output from the comparator 46 is l , the switch 44 is on and the switch 45 is off . when the output from the comparator 46 is h , the switch 44 is off and the switch 45 is on . the output terminals of the switches 44 and 45 are commonly connected , and the node produces a larger value of the value av &# 39 ; and av0 as av . when the result av &# 39 ; is smaller than av0 , the operation is performed such that av = av0 . the diaphragm value control device 32 properly controls the diaphragm value in accordance with this value av . the value av is connected to the inverting input terminal of an operational amplifier 48 through a resistor 47 . tv = ev - av is produced at the output terminal of the operational amplifier 48 by properly setting the operational amplifier 48 , resistors 47 , 49 , and 50 , a signal - ev and a constant voltage vc . the shutter speed control device 33 controls the rear curtain drive of the shutter in accordance with the value tv . the above series of operations represents the operation of the program diagram of p , indicated by the solid line in fig1 . when shake is detected , the above - mentioned shake detection means sets the terminal a connected to the terminal err of the processor 11 at h level . then , unlike in the case when no shake is detected , the transistor 35 is on and the transistor 36 is off . a resistor 51 connected to the collector of the transistor 35 is rendered conductive . the operation result of av &# 39 ;=( 1 / 2 ) ev - 3 is produced by the resistance of the resistor 51 , and the subsequent operation is the same . however , in this case , the operation of the program diagram as indicated by q and , shown by the broken line in fig1 , is performed . in this manner , when shake is detected , the program diagram is shifted from p to q . then , with the same ev value , a higher shutter speed is selected , so that the adverse influence of handshaking is eliminated . | 6 |
the same reference numbers are used in fig1 to 5 for identical or comparable components . a vehicle seat 10 having a backrest 20 and a head restraint 30 can be seen in fig1 . the vehicle seat may be , for example , an individual seat or a seat of a seat bench . a safety device 40 is fitted at the side of the vehicle seat 10 — on that side of the vehicle seat which faces the vehicle interior . the safety device 40 has an airbag 50 which , in the event of a vehicle accident or a hazardous situation ( for example “ pre - crash situation ”), is inflated by a gas generator and deployed . in this case , the airbag 50 is positioned laterally next to the vehicle occupant on the inside of the vehicle . the airbag 50 has a covering section 60 with which the airbag 50 is fastened in the region of the vehicle seat . the covering section 60 may therefore be referred to as the “ fastening section ”. a front edge 70 of the airbag 50 faces away from the covering section 60 , which front edge , when the airbag is deployed , is arranged laterally next to the vehicle seat 10 and projects forwards in the direction of travel in relation to the backrest 20 ( in the event of a vehicle seat oriented in the direction of travel ). three tensioning straps 80 , 90 and 100 are fitted to the front edge 70 of the airbag 50 and are connected to the vehicle seat 10 . the tensioning straps 80 , 90 and 100 laterally hold the airbag 50 , which is deployed in the event of an accident , so that a vehicle occupant plunging into the airbag 50 cannot cause the airbag 50 to buckle or give way . as can be seen in fig1 , the airbag 50 has a head section 105 which is positioned at head height in order to protect the head of the vehicle occupant to be protected . fig2 shows an exemplary embodiment for a safety device 40 having an airbag 50 without a head section ; otherwise the airbag 50 according to fig2 corresponds to the airbag 50 according to fig1 . it can be seen in fig2 how the tensioning straps 80 , 90 and 100 fix the position of the airbag 50 . fig3 and 4 illustrate a plan view of the vehicle seat 10 having the safety device 40 according to fig1 or fig2 . the three tensioning straps 80 , 90 and 100 can be seen , which tensioning straps are connected in each case at their one tensioning - strap end 110 to the airbag 50 and at their other tensioning - strap end 120 to the vehicle seat 10 , for example to the seat itself or the seat structure of the vehicle seat . the position of the three tensioning straps 80 , 90 and 100 when a vehicle occupant 130 is on a seat surface 140 of the vehicle seat 10 can be seen in fig4 . it can be seen that the vehicle occupant 130 presses on the tensioning straps 80 , 90 and 100 as soon as he moves in the direction of the airbag 50 . owing to the pressing away of the tensioning straps 80 , 90 and 100 , the tensioning force of the tensioning straps is increased even more , so that the supporting effect of the tensioning straps on the airbag 50 is likewise increased even further . the airbag 50 according to fig1 to 4 may be inflated at an internal pressure of the airbag of at least 100 kpa , preferably of at least 150 kpa , in order to ensure that the airbag is sufficiently stable and fixed and a yielding of the airbag or a buckling away of the airbag is prevented . fig5 discloses another embodiment of a safety device 40 . the supporting effect of the airbag 50 is achieved by a supporting element 200 which is arranged in the interior of the airbag 50 . the supporting element 200 is designed in such a manner that , in the activated state , it can absorb lateral forces and , in the event of a side impact , can limit a movement of the airbag 50 in the impact direction . the supporting element 200 is preferably connected to the airbag layer 300 of the airbag 50 that faces away from the occupant , so that a protective air cushion can be formed in the airbag 50 between the supporting element 200 and the vehicle occupant 130 . the supporting element 200 can be pivoted into its “ protective position ” shown in fig5 by folding , rotating , pivoting , extension of a telescopic system or by a roller blind technique . for the sake of clarity , fig5 only shows a single supporting element 200 . however , the safety device may additionally have further supporting elements in order to increase the supporting effect on the airbag 50 . according to other embodiments , the tensioning straps 80 , 90 and 100 explained in conjunction with fig1 and 4 may also be used in combination with the supporting element 200 explained in conjunction with fig5 . a common feature of the three exemplary embodiments explained in conjunction with fig1 to 5 is that the vehicle occupant 130 is fixed in his seat region by the airbag 50 . as a result , the occupant cannot come into contact with intruding vehicle parts , with the interior of the vehicle or with other vehicle occupants . in addition , abdomen injuries due to the seat belt ( not illustrated in fig1 to 5 for the sake of clarity ) cutting into “ soft parts ” of the vehicle occupant are prevented if the latter is moved in the event of an accident in the direction of the belt buckle of the seat belt . the mounting ( shown in the figures ) of the safety device 40 in a manner fixed on the seat ensures that the said safety device moves at the same time over the entire seat - adjusting region and the entire backrest - setting region ; the effect achieved by this is that the airbag 50 always takes up the optimum position relative to the vehicle occupant . the airbag size and therefore the covering region of the airbag can therefore be selected to be very small . the priority application , german patent application no . 10 2004 020643 . 0 filed on apr . 22 , 2004 is incorporated by reference herein in its entirety . | 1 |
fig1 and 2 show structural details of the neck of a particular shadow - mask - type color television picture tube . the structure of this crt , which is a rectangular 25 v - size tube with a 110 ° deflection , is conventional except for the electron - gun mount assembly . the structural details thereof are similar to those described in u . s . pat . no . 4 , 288 , 719 issued sept . 8 , 1981 to k . g . hernqvist . the crt includes an evacuated glass envelope 11 comprising a rectangular faceplate panel ( not shown ) sealed to a funnel having a neck 13 integrally attached thereto . a glass stem 15 having a plurality of leads or pins 17 therethrough is sealed to and closes the neck 13 at the end thereof . a base may be attached to the pins 17 outside the envelope 11 . the panel includes a viewing window which carries on its inner surface a luminescent viewing screen comprising phosphor lines extending in the direction of the minor axis thereof , which is the vertical direction under normal viewing conditions . an in - line beaded bipotential electron - gun mount assembly 21 , centrally mounted within the neck 13 , is designed to generate and project three electron beams along coplanar convergent paths to the viewing screen . the mount assembly 21 comprises two support rods in the form of glass beads 23a and 23b from which the various electrodes are supported to form a coherent unit in a manner commonly used in the art . these electrodes include three substantially equally transversely spaced coplanar cathodes 25 ( one for producing each beam ), a control - grid electrode ( also referred to as g1 ) 27 , a screen - grid electrode ( also referred to as g2 ) 29 , an accelerating - and - focus electrode ( also referred to as g3 ) 31 , an end electrode ( also referred to as g4 ) 33 , and a shield cup 35 longitudinally spaced in that order by the beads 23a and 23b . the electrodes are held in predetermined positions by means of claws which are integral with the electrodes and which are embedded in the beads . the g3 claws 32a and 32b for the g3 are of particular interest in this embodiment . the various electrodes of the mount assembly 21 are electrically connected to the pins 17 either directly or through metal ribbons 37 . the mount assembly 21 is held in a predetermined position in the neck 13 on the pins 17 and with snubbers 39 which press on and make contact with the electrically - conducting internal coating 41 on the inside surface 45 of the neck 13 . the internal coating 41 extends over the inside surface of the funnel and connects to the anode button ( not shown ). each of the beads 23a and 23b is about 10 mm ( millimeters ) wide by about 50 mm long and carries an electrically - conductive coating or patch 43a and 43b respectively on the portion of its surface facing and spaced from the inside surface of the neck 13 . each bead is metallized ; that is , it receives its conductive coating or patch 43a and 43b before the bead is incorporated into the mount assembly . in this embodiment , each bead was coated in the desired area with hanovia liquid bright platinum no . 5 , which is a metal resinate marketed by englehard industries , inc ., east newark , n . j . a resinate coating may be produced by any of the known processes , such as painting , screening , spraying , or by print transfer . the resinate - coated bead is then heated to about 500 ° c . in air to volatilize organic matter and to cure the coating and then is cooled to room temperature . in this embodiment , the product is a coating comprised of an alloy of platinum and gold that is tightly bonded to the surface of the bead . the metallized beads may then be used in any of the known beading processes for assembling a beaded mount assembly . each coating or patch 43a and 43b , as shown in fig2 is substantially rectangular with rounded corners and is about 15 mm long by about 9 mm wide , which is almost the full width of the bead . each coating or patch is about 1 , 000 angstroms thick except at the edges where it is tapered to a thickness of about 500 angstroms . each area is floating electrically and has a resistivity of about 50 ohms per square as measured with silver paste contacts applied along the upper and lower edges of the patch and spaced about 12 mm apart . the tube may be operated in its normal way by applying operating voltages to the pins 17 and to the internal coating 41 through the anode button ; which , for example , are typically less than 100 volts on g1 , about 600 volts on g2 , about 8 , 000 volts on g3 and about 30 , 000 volts on g4 . because of the beaded structure described , the regions between the beads and the neck , which can be called the bead channels 47 , behave differently from the regions between the neck and the other parts of the mount assembly , which can be called the gun channels . arcing ( flashover ), when it occurs , occurs in the bead channels 47a and 47b when the tube is operating and the patches 43a and 43b are absent . however , when the patches are present as shown in fig1 and 2 , arcing in these channels is almost completely suppressed . the g3 or focus electrode comprises a larger tub - shaped cup 51 towards the g4 and a smaller tub - shaped cup 52 towards the g2 , which cups are joined together at their open ends by means of integral peripheral flanges 53 . the claws 32a and 32b are integral with the flanges 53 . the closed end of the upper cup 51 is spaced from the g4 by a g3 - g4 gap 54 having a gap width g of about 1 . 25 ± 0 . 20 mm ( 50 ± 8 mils ). the first embodiment shown in fig1 is distinguished from the embodiment in the hernqvist patent , op . cit ., in that the nearest edges of the patches 43a and 43b are a distance d that is more than four times the gap width g away from the g3 - g4 gap 54 . in the first embodiment , the distance d is about 6 . 4 mm ( 250 mils ). furthermore , the claws 32a and 32b and the flanges 53 are each more than half the length of the g3 away from the g3 - g4 gap . the u - shaped braces 56a and 56b have substantially no effect on arcing or electrode treatment in this embodiment . by relocating the patches 43a and 43b , the claws 32a and 32b and the flanges 53 with respect to the g3 - g4 gap and with respect to one another , substantially no particles are produced during the usual electrical processing of the electrodes , due to erosion of the patches 43a and 43b . any electrical processing , such as spot knocking with or without radio - frequency pulses applied , may be used ; for example , the processes disclosed in u . s . pat . nos . 3 , 966 , 287 to p . r . liller , 4 , 125 , 306 to j . t . coble and 4 , 214 , 798 to l . f . hopen . another benefit from the relocations mentioned above is that the extinction voltage for the electron - gun mount assembly is raised by about 4 kilovolts ( from about 24 kv to about 28 kv in the first embodiment ). extinction voltage is the highest voltage applied to the g4 ( with g3 grounded ) at which the g3 does not emit electrons . thus , with the crt installed in a television receiver , when the receiver is turned off after operating , the novel crt is less likely to exhibit afterglow as a result of such electron emission . fig3 and 4 show a second embodiment comprising six electrodes instead of four electrodes as in the first embodiment . the construction and advantages of the second embodiment are the same or similar to those of the first embodiment except as will be developed below . the second embodiment includes an evacuated glass envelope 61 comprising a rectangular faceplate panel ( not shown ) sealed to a funnel having a neck 63 integrally attached thereto . a glass stem 65 having a plurality of leads or pins 67 therethrough is sealed to and closes the neck 63 at the end thereof . a base may be attached to the pins 67 outside the envelope 61 . the panel ( not shown ) includes a viewing window which carries on its inner surface a luminescent viewing screen comprising phosphor lines extending in the direction of the minor axis thereof . an in - line , beaded , bipotential electron - gun mount assembly 71 centrally mounted within the neck 63 is designed to generate and project three electron beams along coplanar convergent paths to the viewing screen . the mount assembly comprises two glass support rods or beads 73a and 73b from which the various electrodes are supported in predetermined positions to from a coherent unit in a manner commonly used in the art . these electrodes include three substantially equally transversely spaced coplanar cathodes 75 ( one for producing each beam ), a control - grid electrode ( also referred to as g1 ) 77 , a screen - grid electrode ( also referred to as g2 ) 79 , a first accelerating - and - focus electrode ( also referred to as g3 ) 81 , a second accelerating - and - focus electrode ( also referred to as g4 ) 83 , a third accelerating - and - focus electrode ( also referred to as g5 ) 85 , an end electrode ( also referred to as g6 ) 87 , and a shield cup 89 longitudinally spaced in that order by the beads 73a and 73b by means of claws which are embedded in the beads . the g3 claws 82a and 82b , the g4 claws 84a and 84b and the g5 claws 86a and 86b are of special interest in this embodiment . the g3 and g5 are electrically connected together by the rod 90 . the g4 and g6 are electrically connected together by the rod 92 . the various electrodes of the mount assembly 71 are electrically connected to the pins 67 either directly or through other metal ribbons 94 . the mount assembly is held in a predtermined position in the neck 63 on the pins 67 and with the snubbers 91 which press on and make contact with an electrically - conducting internal coating 95 on the inside surface 97 of the neck 63 . the internal coating 95 extends over the inside surface of the funnel and connects to the anode button ( not shown ). each of the beads 73a and 73b is about 10 mm wide by about 50 mm long and carries an electrically - conductive coating or patch 93a and 93b respectively on a portion of its surface facing and spaced from the inside surface 97 of the neck 63 . the patches are similar in size and composition as was described above with respect to the first embodiment , as shown in fig4 . the g5 or third focusing electrode 85 comprises a smaller tub - shaped cup 101 towards the g6 and and a larger tub - shaped cup 102 towards the g4 , which cups are joined together at their open ends by means of integral peripheral g5 flanges 103 , which have g5 claws 86a and 86b integral with the g5 flanges 103 . the closed end of the upper cup 101 is spaced from the g6 by a g5 - g6 gap 105 having a gap width g of about 1 . 25 ± 0 . 20 mm ( 50 ± 8 mils ). the nearest edges of the patches 93a and 93b are a distance d that is more than four times the gap width g away from positions on the bead surface that are opposite the g5 - g6 gap 105 . in this embodiment , the distance d is about 6 . 4 mm ( 250 mils ). the g5 claws 86a and 86b and the flanges 103 are each less than half the length of the g5 away from the g5 - g6 gap ( unlike the first embodiment ) and are opposite positions on the beads 73a and 73b that are not opposite the patches . the u - shaped braces 106a and 106b have substantially no effect on arcing or electrode treatment in this embodiment . by relocating the patches 93a and 93b , the g5 claws 86a and 86b and the g5 flanges 103 as compared with the prior structure disclosed in the hernqvist patent , op . cit ., substantially no particles are produced due to the erosion of the patches by any of the possible electrode treatments , as mentioned above . another unexpected benefit of the relocations is that the extinction voltage for the electron - gun mount assembly is raised by about 4 kilovolts as in the first embodiment . the tube 61 may be operated in its normal way by applying operating voltage to the pins 67 and to the internal coating 95 through the anode button ; which for example , are typically less than 100 volts on g1 , about 600 volts on g2 , about 8 , 000 volts on g3 and g5 and about 30 , 000 volts on g4 and g6 . because of the beaded structure described , the regions between the beads and the neck , which can be called the bead channels 99 , behave differently from the regions between the neck and the other parts of the mount assembly . arcing ( flashover ), when it occurs , occurs in the bead channels 99a and 99b when the tube is operating and the conducting areas 93a and 93b are absent . however , with the conducting areas or patches present as shown in fig3 arcing in these channels is substantially entirely suppressed . with some designs , the patches 93a and 93b of the second embodiment may be eroded during some electrode treatments . this erosion has been traced to the presence of g4 claw 84a of the g4 electrode , which carries the same voltage as the g6 electrode , opposite the patch 93a . erosion of the patch can be minimized by employing the patch structure shown in fig5 in place of the structure shown in fig4 . in fig5 two smaller patches 96a and 98a are located on a bead 74a in spaced positions . the one patch 96a toward the g6 is located between positions opposite the g5 claw 86a of the g5 and the g4 claw 84a of the g4 , and the other patch 98a away from the g6 is located over positions opposite the g3 claw 82a and between positions opposite the g2 claw 80a and the g4 claw 84a . | 7 |
for clarity and simplicity , the present specification shall refer to structural and / or functional elements , entities and / or facilities , relevant communication standards , protocols and / or services , and other components and features that are commonly known in the telecommunications art without further detailed explanation as to their configuration or operation except to the extent they have been modified or altered in accordance with and / or to accommodate the embodiment ( s ) presented herein . with reference to fig1 , a telecommunications network a includes a public switched telephone network 10 operatively connected to and / or in communication with a msc 20 in the usual manner . the msc 20 is operatively connected to and / or in communication with a plurality of base stations 30 in the usual manner . as is understood in the art , each bs 30 provides an over - the - air radio frequency interface for its respective geographic area or cell 32 . selectively , a ms ( such as the exemplary ms 40 illustrated ) is provided telecommunication services and / or otherwise accesses the network a via the interface and / or bs 30 serving the cell 32 in which the ms 40 is located . in the usual manner two communication channels are selectively employed between the bs 30 and ms 40 , namely , a paging channel and an access channel . the paging channel is used to verify and / or establish the location of the ms 40 within the network a and to deliver incoming calls to the ms 40 . the access channel is used by the ms 40 for registration purposes , i . e ., to report power - up of the ms 40 , to report changes in the location of the ms 40 , etc . while only one msc is illustrated in fig1 for purposes of simplification and clarity , it is to be appreciated that the network a may in fact include any number of one or more mscs that are similarly situated and / or arranged . additionally , while three bs 30 and three corresponding cells 32 are illustrated in fig1 , it is to be appreciated that more or less than three base stations and / or cells may be similarly situated with respect to any of the one or more mscs in the network a . that is to say , each msc in the network a may optionally serve any number of one or more base stations and / or corresponding cells . additionally , while only one exemplary ms is illustrated in fig1 , the network a optionally serves any number of one or more mobile stations similarly situated and / or arranged in any of the one or more cells 32 . with reference to fig2 , the cells 32 and / or geographic area served by the msc 20 are zoned or partitioned in two different ways , i . e ., into paging las 50 and registration las 60 . in the usual manner , each paging la 50 includes a plurality of cells 32 . the registration las 60 , however , are generally larger than the paging las 50 . suitably , each registration la 60 includes a plurality of paging las 50 . as can be appreciated , unlike the traditional partitioning of an msc having one set of las ( i . e ., the same set of las used for both paging and registration ), the partitioning illustrated in fig2 has two sets of different las , namely , the set of relatively larger registration las 60 used for registration , and the set of relatively smaller paging las 50 used for paging . accordingly , the larger registration las 60 result in relatively less frequent registration of traveling mobile stations and hence a reduced load on the access channel , while the smaller paging las 50 result in relatively fewer cells 32 being paged for a given instance and hence a reduced load on the paging channel . for example , as the ms 40 travels , it registers its current location with the msc 20 each time it enters a new registration la 60 , i . e ., each time it crosses from one registration la 60 into the next or each time it crosses a registration la boundary . for example , the ms 40 registers with the msc 20 serving its location by sending a registration signal to the msc 20 using the access channel . in this manner , the msc 20 is able to remember the most recent registration la 60 from which the ms 40 registered . for example , the msc 20 may store the last known registration information ( including , e . g ., the identity of the registration la 60 from which the ms 40 last registered ) in a location register or database 24 ( see fig1 ). a time and / or date stamp for each of these registrations is also optionally maintained in the database 24 . in this manner , it can be determined how old the last registration is for the particular ms 40 . suitably , registration does not take place when the ms 40 crosses from one paging la 50 to the next within the same registration la 60 . in addition to the last or most recent registration la 60 from which ms 40 registered , the last or most recent cell 32 accessed by the ms 40 is also monitored by the network a , and mapped to the paging la 50 containing that cell 32 . the identity of this last known paging la 50 is optionally stored or maintained along with and / or as part of the information in the database 24 . cell access events include those events where the ms 40 accesses a cell 32 , i . e ., the ms 40 sends , receives or otherwise exchanges a transmission to , from or with a bs 30 . for example , a cell access event may include , registration of the ms 40 , the ms 40 receiving an incoming call , the ms 40 placing an outgoing call , the transmission of packet data to or from the ms 40 , short - message - service ( sms ) receipt or transmittal , etc . for each of these activities , the network a is able to determine which bs 30 and / or cell 32 the ms 40 is using . suitably , this cell location and / or identity is mapped to its corresponding paging la 50 that is in turn captured and / or updated at each cell access event , e . g ., by the msc 20 . a time and / or date stamp for each of these captures and / or updates is also optionally maintained in the database 24 . in this manner , it can be determined how old the identity of the last known paging la 50 is for the particular ms 40 . suitably , when the ms 40 is being sought by the network a ( e . g ., when an incoming call arrives at the msc 20 for the ms 40 ), an appropriate page is sent out for the ms 40 over the paging channel using a paging protocol that depends upon the information stored in the location register or database 24 . depending upon if and / or when the page is answered , multiple pages may be attempted . for example , in a first paging attempt , if the last registration stored in the database 24 is more recent than a defined threshold , then the ms 40 is more likely to be in or near the paging la 50 it entered when it entered the current registration la 60 , otherwise if the last registration stored in the database 24 is older than the defined threshold , then the ms 40 is less likely to be in or near the paging la 50 it entered when it entered the current registration la 60 . that is to say , if the ms 40 had recently registered ( i . e ., crossed a registration boundary ), then there is a certain level of confidence that the ms 40 is still in or near the cell 32 it used to register ( i . e ., within that corresponding paging la 50 ). conversely , if the ms 40 had not recently registered , then that level of confidence is somewhat lower . the paging protocol is therefore tailored accordingly . for example , if the ms 40 is deemed to have registered relatively recently ( i . e ., within the threshold ), then the first paging attempt is merely sent out to the last known paging la 50 stored in the database 24 , and optionally , if the ms 40 is deemed to have registered relatively long ago ( i . e ., outside the threshold ), then the first paging attempt may be sent out to some larger area , e . g ., the entire last known registration la 60 stored in the database 24 . in this way , a wider area can be automatically paged for a more mobile ms 40 , while conserving both paging and access channel resources . of course , if the ms 40 does not respond to the first paging attempt , a second attempted may be made , suitably scaled - up as appropriate , e . g ., using a corresponding la cluster ( lac ) which includes the target la plus all its neighboring las . for example , in the case of a recently registered ms 40 , the second page may go out to the last known paging la 50 plus all its neighboring paging las 50 , while in the case of a relatively older registered ms 40 , the second page may go out to the last known registration la 60 plus all its neighboring registration las 60 . it is to be appreciated that in connection with the particular exemplary embodiments presented herein certain structural and / or function features are described as being incorporated in defined elements and / or components . however , it is contemplated that these features may , to the same or similar benefit , also likewise be incorporated in other elements and / or components where appropriate . it is also to be appreciated that different aspects of the exemplary embodiments may be selectively employed as appropriate to achieve other alternate embodiments suited for desired applications , the other alternate embodiments thereby realizing the respective advantages of the aspects incorporated therein . it is also to be appreciated that particular elements or components described herein may have their functionality suitably implemented via hardware , software , firmware or a combination thereof . additionally , it is to be appreciated that certain elements described herein as incorporated together may under suitable circumstances be stand - alone elements or otherwise divided . similarly , a plurality of particular functions described as being carried out by one particular element may be carried out by a plurality of distinct elements acting independently to carry out individual functions , or certain individual functions may be split - up and carried out by a plurality of distinct elements acting in concert . alternately , some elements or components otherwise described and / or shown herein as distinct from one another may be physically or functionally combined where appropriate . in short , the present specification has been set forth with reference to preferred embodiments . obviously , modifications and alterations will occur to others upon reading and understanding the present specification . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof . | 7 |
fig1 shows a functional block diagram of a device 102 having a power control system 104 , in accordance with an embodiment of the invention . a rechargeable battery pack 106 includes battery element 108 and a low voltage protection circuit 110 . battery pack 106 may be implemented with a conventional battery pack , such as a lithium ion battery pack . low voltage protection circuit 110 shuts off power when an output voltage produced by battery element 108 drops below a battery pack shutoff voltage level . power control system 104 may be configured to sense the voltage level generated by battery pack 106 and initiate a shutdown routine when the sensed voltage reaches a device shutoff voltage level . the device shutoff voltage level exceeds the battery pack shutoff voltage level . as is described below , the shutoff routine may include saving data stored in volatile memory and shutting down electronic circuits 112 in a predetermined order . in some embodiments of the invention , power control system 104 enables the resumption of power to electronic circuits 112 when the output voltage of battery pack 106 increases to a turn - on voltage that exceeds the device shutoff voltage level . fig2 shows a functional block diagram of a handheld printer implementation that includes a power control module in accordance with an embodiment of the invention . a battery pack 202 provides power to a power control module 204 and a power module 206 . power control module 204 may include a sensing module 208 , a bypass module 210 and a shutdown module 212 . sensing module 208 detects an output voltage level generated by battery pack 202 and may compare the detected voltage level to a predetermined device shutoff off voltage level . shutdown module 212 may initiate a shutdown routine when the detected voltage level falls below the device shutoff voltage level . in one embodiment of the invention , shutdown module 212 receives a signal from sensing module 208 when the detected voltage level falls below the device shutoff voltage level and the received signal causes shutdown module 212 to initiate the shutdown routine . in various embodiments of the invention the shutdown routine may be performed by shutdown module 212 , power module 206 or a central processing unit ( cpu ) 216 . the shutdown routine may be as simple as removing power from all components or may include additional steps such as saving data stored in volatile memory , removing power from components in a predetermined sequence , etc . bypass module 210 may be coupled to sensing module 208 and / or shutdown module 212 to prevent the initiation of the shutdown routine during operations that are known to cause high battery current spikes , such as during printing operations . high battery current spikes result in reduced battery output voltage levels . power module 206 receives power from battery pack 202 and may regulate , filter or otherwise process the power delivered by battery pack 202 before delivering the power to printer components . a backup battery pack 214 may be included to provide power when battery pack 202 fails or produces an output voltage that falls below the device shutoff voltage level . power module 206 may provide power to cpu 216 , a volatile random access memory ( ram ) 218 , a print head 220 and a motor 222 . cpu 216 may retrieve computer executable instructions from ram 218 or a read only memory ( rom ) 224 and process those instructions in a conventional manner . ram 218 may include label data and / or other volatile data . rom 224 may include firmware , the shutdown routine and / or other nonvolatile data . print head 220 may be implemented with a thermal print head , inkjet print head or another type of print head for printing on a web or label . print head 220 may receive print commands from a print module 226 . print module 226 may also provide a signal to bypass module 210 to indicate that the printer is performing a print operation . various embodiments of the invention may also include conventional handheld printer components , such as those shown in fig3 . fig3 shows a handheld printer 300 described in u . s . pat . no . 5 , 486 , 259 , the entire disclosure of which is hereby incorporated by reference . printer 300 that has a movable housing section or cover 302 which carries a scanner 304 and a lens 306 mounted at the front end of the scanner 304 . cover 302 is movable between a closed position shown in fig3 and an open position by pivoting the cover 302 about a pivot 308 . a movable housing section 310 mounts a keyboard 312 and a display 314 about pivot 308 so that housing section 310 can be moved between its closed position and an open position for servicing the electronic components ( not shown ) housed in a chamber 316 defined in part by a wall 318 . printer 300 mounts a roll r of a composite web c of record members illustrated to be a series of labels l releasably adhered to a carrier web w . roll r is mounted within the housing 320 and the composite web c passes from the roll r into guided relationship with a guide roll 322 and from there to between a print head 324 and a platen 326 . platen 326 is shown to include a platen roll 328 . adjacent print head 324 is a delaminator 340 about which the carrier web w passes . a label l is delaminated from the carrier web w as the web w is advanced . the label l is advanced following printing into label applying relationship to and under an applicator 330 which is shown to comprise a roll 332 . carrier web w passes from delaminator 340 into contact with platen roll 328 , about a guide roller 342 into the nip of a feed roll 344 and a back - up roll 334 and through a chute generally indicated at 336 from which the carrier web w exits housing 320 . a motor 338 may be included for advancing composite web c through printer 300 . fig4 is a circuit diagram that illustrates an analog embodiment of the invention . a sensing circuit 402 detects an output voltage level of a battery pack . in one embodiment of the invention , an averaging capacitor 404 is included to generate an average voltage level that represents a voltage level between a current output voltage level and an output voltage level that existed at a previous time . with this embodiment , high battery current spikes initially do not result shutdown , but will result in shutdown if they exist for a long enough time period . sensing circuit 402 may also include a solid state comparator circuit 406 to detect voltage levels . a shutoff circuit 408 may be used to shutdown one or more power supplies included within a device , such as a printer . an external shutdown circuit 410 may be used by an operator to shutoff the device during routine or regular shutoffs . a bypass circuit 412 may be used to bypass sensing circuit 402 during operations that are known to cause high battery current spikes . in the embodiment shown , bypass circuit 412 applies a bypass signal to a field effect transistor 414 during bypass operations . bypass circuit 412 may alternatively bypass shutoff circuit 408 during operations that are known to cause high battery current spikes . as shown in fig4 , sensing circuit 402 , shutoff circuit 408 , external shutoff circuit 410 and bypass circuit 412 may include solid state amplifier and switching elements , such as operational amplifiers . bypass circuit 412 receives a bypass input 416 , which may be from a microprocessor , and disables sensing circuit 402 which , in turn disables shutoff circuit 408 during known high current spikes . fig5 is a circuit diagram that illustrates a digital embodiment of the invention . a battery pack 502 is shown coupled to a device 504 . device 504 may be a portable handheld printer device , a motor or some other device that causes high battery current spikes . a sensing circuit 506 may be used to sense the output voltage level from battery pack 502 . sensing circuit 506 may be implemented with a conventional analog voltage sensing circuit . in one embodiment of the invention , sensing circuit 506 may include an averaging capacitor , such as averaging capacitor 404 ( shown in fig4 ) or another element that performs a function similar to that of averaging capacitor 404 . sensing circuit 506 may also provide a shutdown signal to power supply module 518 when it is desired to remove power , such as when battery pack 502 operates continuously for a predetermined time or just prior to reaching a shutoff limit of battery pack 502 . the output of sensing circuit 506 may be in the form of an analog voltage signal that is transmitted to an analog - to - digital converter 508 . analog - to - digital converter 508 converts the analog voltage signal into a digital signal that is then provided to a central processing unit ( cpu ) 510 . in some embodiments of the invention , the output of battery pack 502 may be provided directly to analog - to - digital converter 508 . cpu 510 may access shutdown parameters 512 stored in a memory 514 and determine when to shutoff operational circuits 516 . operational circuits 516 represent the circuits used to perform the operations of device 504 and may include a motor , a print head , a scanner or other elements . shutdown parameters may include a minimum voltage level , time period at a minimum voltage level , minimum current amount , a voltage spread between a peak voltage and a current voltage or any other parameters that may be used to determine when to shutoff prior to battery pack 502 shutting off . memory 514 may be implemented with a nonvolatile memory , such as a read only memory . cpu 510 may also receive data from operational circuits 516 to determine when to bypass a shutdown routine . for example , a signal that indicates that a print head is operating may be used by cpu 510 to bypass a shutoff routine that would otherwise take place . when a shutoff routine is executed , cpu 510 may shutoff certain components in a predetermined order , save data to a nonvolatile memory and / or shutoff a power supply module 518 . fig6 illustrates a method of controlling power delivered to a device in accordance with an embodiment of the invention . first , in step 602 the output voltage of a battery pack is detected . then it is determined whether the output voltage level is less than a device shutoff voltage level in step 604 . as described above , the device shutoff voltage level is selected to be higher than a battery pack shutoff voltage level . when the output voltage level is not less than a device shutoff voltage level , the process returns to step 602 . of course a delay period may be included before performing step 602 again . when the output voltage is less than a device shutoff voltage level it is next determined whether the device is performing one or more operations that are known to cause high battery current spikes in step 606 . when the device is performing one or more operations that are known to cause high battery current spikes the shutoff routine is bypassed by returning to step 602 . again , a delay period may be included before performing step 602 again . when the device is not performing one or more operations that are known to cause high battery current spikes , in step 608 a shutoff routine is initiated . after the device has been shut down , in step 610 the output voltage of a battery pack is detected . then it is determined whether the output voltage is greater than a device turn - on voltage level in step 612 . the device turn - on voltage level may be greater than the device shutoff voltage level . when the output voltage is not greater than a device turn - on voltage level the process returns to step 610 after an optional delay . when the output voltage is greater than a device turn - on voltage level a turn - on routine is initiated in step 614 . the turn - on routine may include providing power to components in a predetermined order , loading data into a volatile memory or performing other steps that precede operating the device . it should be noted that the term module used herein refers to functionality of physical structure . thus , various physical components , such as analog and / or digital circuits , may be combined as desired and appropriate to form the various modules . in addition , the same hardware may be used to provide the functionality of one or more modules . a module may also be broken up or combined and does not have to be a discrete unit . for example , two or more of the circuits shown in fig4 may be modified to have some common circuit elements and each circuit may still be an example of a module . the present invention has been described in terms of preferred and exemplary embodiments thereof . numerous other embodiments , modifications and variations within the scope and spirit of the appended claims will occur to persons of ordinary skill in the art from a review of this disclosure . | 7 |
this invention is directed to a common aperture for three sensors of millimeter wave ( mmw ), infrared ( ir ) and semi - active laser ( sal ) energy which are aligned on a common boresight or central longitudinal axis ( cl ) of seeker apparatus used , for example , in an airborne platform such as a missile and which allows all three modes to simultaneously use the full transmitting / receiving aperture . referring now to the drawings wherein like reference numerals refer to like components throughout , reference is first made to fig1 - 9 which disclose the details of a first embodiment of the invention . reference numeral 10 denotes the radome of a tri - mode seeker assembly including an annular base member 14 to which is secured a housing 12 for supporting a gimbal assembly 16 as well as attachment of the radome 10 . a primary mirror assembly 18 including a parabolic reflecting surface 20 is mounted on the gimbal assembly 16 so that it can be controlled to move independently in two orthogonal directions . the primary mirror assembly 18 includes a central opening through which is located an infrared sensor assembly including an ( ir ) relay optics cell 22 and an axially coupled detector / dewar assembly 24 which are located in a central longitudinal axis shown in fig2 as cl . the signal output of the ir assembly 24 is fed to an ir imaging circuit board assembly 25 . located in front of the ir relay optics cell 22 is apparatus which adjacently locates a laser sensor assembly for sal signal collection and an rf sensor assembly including a waveguide feed member while separating the rf and laser energy beams for separate detection . the ir and rf functions of the seeker remain substantially the same as if the laser sensor assembly is not present . this is achieved by locating a dielectric mirror 26 of a secondary mirror assembly and having a dielectric coating 28 which is designed to reflect ir energy while transmitting millimeter wave ( mmw ) rf energy and semi - active laser ( sal ) energy therethrough in a joint or common signal path as shown in fig9 , for example , by reference numeral 30 . the secondary mirror 26 is mounted on a support member 31 which is secured to the primary mirror assembly 18 . directly in front of the secondary mirror 26 is a diffractive element 32 in the form of a diffractive lens which acts to focus the laser energy on a laser energy sensor assembly 34 , while not affecting the rf signal . the diffractive lens 32 is similar to a fresnel lens in that there are small surface variations in the element which acts as a lens , yet the overall surface profile tends to be flat . the surface variations in the diffractive lens 32 are held to “ microscopic levels ” compared to rf wavelengths so that the rf will not react to these dimensions while the much shorter optical wavelengths will react to them . by inserting a diffractive lens 32 adjacent the dielectric secondary mirror 26 , the optical signal can be focused significantly short from a focus of the rf energy as shown in fig4 to a surface 36 of a bifurcated rf waveguide member 38 as shown in fig5 which is adapted to couple rf energy to a transceiver circuit board 40 located behind the primary mirror assembly 18 . the small focus difference between the sal energy and the rf energy is attributed to chromatic aberration in the optical materials of the secondary mirror 26 and the coating 28 , as well as the radome 10 . the laser sensor requires that the image be at or near a good focus of the sensor . by the insertion of the diffractive lens 32 behind the secondary mirror 26 , the optical signal ( sal ) can be focused significantly short from the rf focus . if an optical detector were to be placed at the optical focus of the sal energy , it would block and therefore interfere with the rf signal . accordingly , the first embodiment of the invention shown in fig1 and 2 is to employ a light pipe assembly 42 shown in fig6 - 8 which acts to divert and channel the optical signal ( sal ) to the side where optical detectors are located without rf or mechanical interference being an issue . as shown , four light pipe members 44 1 , 44 2 , 44 3 and 44 4 are orthogonally supported by four pie - shaped elements 46 1 , 46 2 , 46 3 and 46 4 . the light pipe members 44 1 . . . 44 4 include surfaces 45 1 , 45 2 , 45 3 and 45 4 angulated at 45 ° which capture the sal energy at its focus and propagate it to a peripheral region for coupling to four laser detectors 48 1 , 48 2 , 48 3 and 48 4 . four prism shaped filler elements 50 1 , 50 2 , 50 3 and 50 4 are located at the center of the assembly for spacing and support . also shown , located between the light pipes 44 1 . . . 44 4 and the respective detectors 48 1 . . . 48 4 are respective screen members 52 1 52 4 for providing electromagnetic energy interference ( emi ) shielding . it should be noted that the rf views the light pipes 44 1 . . . 44 4 as well as the filler elements 50 1 . . . 50 4 as simply a dielectric plate , i . e . a window , so as to pass through it unobstructed as shown in fig9 . the light pipes usually depend on total internal reflection for trapping signals and directing them to the exit surface . if needed , dielectric mirror coatings can also be employed . as shown in fig3 and 5 , the diffractive lens 32 is shown bent into a meniscus shape so the local zones of the surface will be at near normal to the incident rays of sal . thus , the rf signal and the sal signal reflected from the primary mirror 20 as shown in fig9 , share a common signal path through the secondary mirror 26 and the diffractive lens 32 , with the sal energy being extracted by the light pipe assembly 42 , while the rf energy propagates substantially unobstructed to the surface 36 of the waveguide element 38 , shown in fig2 . the outputs of the laser energy detectors 48 1 . . . 48 4 are coupled by means of cabling , not shown , to a post amplifier buffer board assembly 54 located at the rear of the mirror assembly 18 . although not shown , digital signal processing circuitry including rf , sal and ir signal processors connected to the circuit boards 25 , 40 and 54 , is located behind the flat rear wall 56 of the housing 12 . referring now to the second embodiment of the subject invention , reference is now made to fig1 - 15 . this embodiment is structurally the same as the first embodiment shown in fig1 and 2 , with the exception of the manner in which the laser energy ( sal ) is extracted from the common signal path 30 ( fig9 ) including the rf . the second embodiment locates the laser energy sensor assembly and the rf sensor assembly at a common focal point which is at the mid - point 58 of the rf feed waveguide member 38 shown in fig1 and 11 and where rf and laser energy beams split for separate detection . also , the laser energy detectors are mounted directly on the waveguide 38 as shown in fig1 . there reference numeral 60 denotes an assembly for the laser energy detectors attached to a common rf feed sal collector section 62 of the waveguide member 38 as shown in fig1 . in this embodiment , the diffractive lens 32 ( fig2 ) of the first embodiment is eliminated and both the rf and laser ( sal ) energy now pass through the secondary mirror 26 to four rectangular openings 64 1 , 64 2 , 64 3 and 64 4 in the bottom face 65 of the waveguide section 62 which provides a shared image plane . four beam splitting prisms 74 1 , 74 2 , 74 3 and 74 4 are located internally of the waveguide section 62 adjacent the rectangular openings 64 1 , 64 2 , 64 3 and 64 4 to reflect the sal energy at an angle of 90 ° so as to direct the laser energy out of the side surfaces 68 and 70 via four rectangular openings 72 1 . . . 72 4 , two of which are shown by reference numerals 72 1 and 72 2 in fig1 and 13 . when desirable , the rectangular openings 72 1 . . . 72 4 could be configured as an array of small holes , not shown . a dielectric mirror coating consisting of a non - metallic coating , so as not to disrupt rf transmission , is further included on the prism surfaces 67 1 . . . 67 4 to achieve the internal reflection needed to make the 90 ° reflection of the laser energy out of the side openings 72 1 . . . 72 4 in the side walls 68 and 70 of the waveguide collector section 62 . filler prisms 66 1 . . . 66 4 with similar dielectric characteristics are added to make the assemblies appear as a single uniform block to the rf energy passing therethrough . the length of this block is furthermore optimized so as to reduce the rf attenuation in / or reflection by extending the length further up into the waveguide section 62 if need be . a pair of screen members 76 1 and 76 2 are shown in fig1 and 15 for providing emi shielding of the laser light energy exiting the openings 72 1 , 72 2 . . . 72 4 out of the side walls 68 and 70 . four sal energy detectors of the laser energy detector assembly 60 shown in fig1 , two of which are shown by reference numerals 60 1 and 60 2 in fig1 , are attached to the side walls 68 and 70 of the waveguide section 62 . although not shown , the 90 ° bend in the sal light path can be achieved by using optical fiber fused into a block . before the blocks of fiber are fused , the fiber is positioned so that a point of light input and output of the fiber is normal to the faces of the blocks that will be cut and polished . filler material would also be required , but this would be fused to the fiber as well . the length of the block is also customized in order to limit the impact of the rf energy impinging thereon . a slightly defocused laser image may be desired for tracking purposes . this can be accommodated by extending the prisms or fused fiber blocks that pass the openings 64 1 . . . 64 4 in the face 65 of the waveguide section 62 shown in fig1 and 13 . in the event that an optical bandpass filter is required to pass the laser energy but allowing minimal solar irradiation to reach the laser detectors , such a filter could be applied to the surface of the secondary mirror 26 , while still allowing full aperture collection and proper optical band filtering . while the concepts presented heretofore have been presented in the context of a tri - mode seeker , it should be noted that it is not necessarily limited to tri - mode co - boresighted missile seekers . it can also be employed in connection with any application in which laser light or other optical energy and rf energy are collected , utilizing the same aperture . the foregoing detailed description merely illustrates the principles of the invention . it will thus be appreciated that those skilled in the art will be able to devise the various arrangements , which , although not explicitly described or shown herein , embody the principles of the invention and are thus within its spirit and scope . | 5 |
the following describes in detail an embodiment of the oil filter assembly in the present invention with reference to the drawings . fig3 is a vertical section view of the oil filter assembly in the present invention , fig4 is an oblique bottom view of the cap of the oil filter assembly in the present invention , and fig5 is an oblique bottom view of the combined drain pin and filter . the oil filter assembly in the present invention is a device which filters engine oil supplied to a vehicle engine and then supplies the filtered oil to the engine again . the oil filter assembly comprises the following structures : a casing ( 100 ) with an open end ( lower end in fig1 ), a filter ( 200 ) inserted into said casing ( 100 ), a cap ( 300 ) which is combined with said casing ( 100 ) in screwed connection mode and can cover the open end of said casing ( 100 ), with the drain nipple ( 310 ) having a drain hole ( 312 ) protruding downward from the position corresponding to the bottom support plate ( 240 ), and a drain pin ( 400 ) which is detachably combined with said drain nipple ( 310 ) to open / close the drain hole ( 312 ) in said drain nipple ( 310 ). said drain hole ( 312 ) is formed at the bottom surface of the cap ( 300 ). if the casing ( 100 ) and the cap ( 300 ) are filled with engine oil , the engine oil contained by said casing ( 100 ) and cap ( 300 ) will be discharged out through said drain hole ( 312 ) when the drain pin ( 400 ) is removed and the drain hole ( 312 ) is opened . on the contrary , as shown in fig3 , after the drain pin ( 400 ) is inserted into the drain nipple ( 310 ), engine oil flowing into the casing ( 100 ) and the cap ( 300 ) will not leak out if the drain hole ( 312 ) is closed , and engine oil filtered by the filter ( 200 ) is re - supplied to the engine . when engine oil flowing into the casing ( 100 ) and the cap ( 300 ) passes the filter ( 200 ) and is re - supplied to the engine , the flow path of engine oil is the same as that in the existing oil filter assembly . therefore , a detailed description of the filtering principle and flow path of engine oil is omitted here . in this case , if the part where the drain hole ( 312 ) is formed is manufactured thin , the following problem exists : after the drain pin ( 400 ) is inserted and the drain hole ( 312 ) is blocked , said drain pin ( 400 ) may incline to one side and easily fall into the drain hole . therefore , as shown in the embodiment , the part where the drain hole ( 312 ) is formed on the bottom surface of said cap ( 300 ) is preferably manufactured into a downward - extended pipe shape so as to increase the area of contact with the drain pin ( 400 ). to prevent the drain pin 400 from unwished falling out of the drain hole 312 , a safety pin 700 can be provided , like shown in the fig3 and 11 to 13 . the safety pin 700 is made of plastic , especially as a one piece molded plastic element , and is inserted in a through - hole 600 , going through the drain nipple 310 and the safety pin 700 . the safety pin 700 also prohibits twisting of the drain pin 400 , so that the slide block 420 is fixed in the rotation groove 240 . the through - hole 600 crosses the safety pin 700 below the sealing element 412 , so that the sealing effect of the sealing element 412 is not affected . as it can be seen in fig1 , the safety element 700 has elastic elements 800 , which grab behind an edge of the through - hole 600 , when the safety pin 700 is fully inserted in the through - hole 600 , and thus provide a barrier for extract the safety pin 700 out of the through - hole 600 . to clamp the safety pin 700 , it has a handle 900 . the through - hole 600 is going through the safety pin 700 as well as through the walls of the drain nipple 310 . the safety pin 700 also prevents an erroneous assembly , because it only can be inserted into the through - hole 600 , if the safety pin 700 and the whole oil filter 200 is assembled in a correct manner . further , compared with the drain bolt ( 50 ) combined with the cap ( 30 ) in screwed connection mode in the existing oil filter assembly shown in fig1 and fig2 , the drain pin ( 400 ) which opens / closes said drain hole ( 312 ) is combined with the drain nipple ( 310 ) in fit mode in the oil filter assembly in the present invention and thus the tightness of the drain hole ( 312 ) may decrease . therefore , the external circumferential surface of said drain pin ( 400 ) is preferably equipped with an o - ring sealing element ( 412 ). in this case , if the part where the drain hole ( 312 ) is formed is thin , the sealing element ( 412 ) may fall off the internal circumferential surface of the drain hole ( 312 ), depending on the insertion distance of the drain pin ( 400 ), and thus , the drain hole ( 312 ) may be opened , which is not desired by the operator . however , as shown in the embodiment of the present invention , when the drain hole ( 312 ) is formed in the drain nipple ( 310 ), the contact distance between the drain pin ( 400 ) and the drain nipple ( 310 ) is extended . thus , even if the insertion distance of said drain pin ( 400 ) is slightly changed , said sealing element ( 412 ) will still stay on the internal circumferential surface of the drain hole ( 312 ) to increase the reliability of the tightness of the drain hole ( 312 ). further , in the oil filter assembly in the present invention , said drain pin ( 400 ) is inserted into the drain nipple ( 310 ) in fit mode , instead of screwed connection mode , and therefore the time necessary for opening / closing the drain hole ( 312 ) can be reduced significantly . further , it is necessary to rotate the existing drain bolt ( 50 ) for several turns before removing the existing drain bolt ( 50 ), and therefore , engine oil will flow out and contaminate said drain bolt ( 50 ), the working tool , or the hands of the operator when said drain bolt ( 50 ) is removed . in the present invention , however , when the drain pin ( 400 ) is pulled downward , it can be separated from the drain nipple ( 310 ) instantaneously , and therefore , engine oil will not flow out of the drain hole ( 312 ) and contaminate the drain pin ( 400 ) or hands of the operator . further , said filter ( 200 ) comprises a pipe support ( 210 ) having a plurality of openings in the side wall , filter paper ( 220 ) surrounding the external circumferential surface of said support ( 210 ), a top support plate ( 230 ) which is combined with said support ( 210 ) and can cover the top of said filter paper ( 220 ), and a bottom support plate ( 240 ) which is combined with said support ( 210 ) and can cover the bottom of said filter paper ( 220 ). further , a bypass valve ( 500 ) is equipped at the bottom of the internal flow path of the support ( 210 ), that is to say , when the service life of said filter paper ( 220 ) ends and cannot filter engine oil normally , engine oil supplied to the inside of said casing ( 100 ) moves to the outside of said casing ( 100 ) in a roundabout way through the internal flow path in the support ( 210 ). in this case , said casing ( 100 ), support ( 210 ), and filter paper ( 220 ), top support plate ( 230 ), and bypass valve ( 500 ) are essentially the same as those in the existing oil filter assembly . a detailed description of these structures is omitted here . fig6 is an oblique view of the drain pin ( 400 ), fig7 is an oblique view of the drain pin ( 400 ) sliding along the rotation groove ( 242 ) when the cap ( 300 ) is combined with the casing ( 100 ) in screwed connection mode , and fig8 is a horizontal section view of the slide block ( 420 ) installed in the rotation groove ( 242 ). after the drain pin ( 400 ) is inserted into the drain nipple ( 310 ), said drain pin ( 400 ) can be lifted so that the top of the drain pin ( 400 ) touches closely against the bottom surface of the bottom support plate ( 240 ). when a vehicle is running , to keep the drain pin ( 400 ) from separating from the drain nipple ( 310 ), namely , to prevent the drain pin ( 400 ) from falling off , it is structurally optimal that the top of the drain nipple ( 310 ) is snapped into the bottom support plate ( 240 ). that is to say , when said drain pin ( 400 ) is inserted into said drain nipple ( 310 ), the top of the drain nipple is hung on or released from the bottom support plate ( 240 ), depending on the rotation degree . to achieve the above - mentioned combination , an annular rotation groove ( 242 ) is formed on the bottom surface of said bottom support plate ( 240 ), with the rotation axis of the casing ( 100 ) being the central axis , and the entrance is narrower than the bottom surface when said rotation groove ( 242 ) is manufactured . in this case , a through - hole ( 244 ) can be formed in the external wall of said rotation groove ( 242 ) to let engine oil run smoothly . further , said drain pin ( 400 ) comprises the following structures : a body ( 410 ) inserted into said drain hole ( 312 ) in fit mode , a slide block ( 420 ) which is located at one lengthwise end ( top end in the embodiment ) of said body ( 410 ) and placed on the bottom surface of said rotation groove ( 242 ) and can slide along said rotation groove ( 242 ) as said cap ( 300 ) rotates in the screwed connection direction , and a handle ( 430 ) which is located at the other lengthwise end ( bottom end in the embodiment ) of said body ( 410 ) and is exposed to the outside of said drain nipple ( 310 ) when said body ( 410 ) is inserted into the drain nipple ( 310 ). in this case , the lateral length of said slide block ( 420 ) is greater than the entrance width of said rotation groove ( 242 ), and the longitudinal length of said slide block ( 420 ) is smaller than the entrance width of said rotation groove ( 242 ). therefore , when said slide block ( 420 ) is laterally aligned to the radial direction ( see fig9 ) of said rotation groove ( 242 ), the slide block ( 420 ) will not be separated from the rotation groove ( 242 ) and will remain inserted in said rotation groove ( 242 ); when said slide block ( 420 ) is laterally aligned to the tangential direction ( see fig1 ) of said rotation groove ( 242 ), the slide block ( 420 ) can be inserted into or removed from the rotation groove ( 242 ). in addition , when the slide block ( 420 ) of the drain pin ( 400 ) is inserted into the rotation groove ( 242 ) on the bottom support plate ( 240 ) and is supplied to an assembly factory , an assembler needs to turn the cap ( 300 ) and combine the cap with the casing ( 100 ) in screwed connection mode , with the lower end of the body ( 410 ) inserted into the drain hole ( 312 ). however , if said rotation groove ( 242 ) is manufactured into a single dented groove , it is impossible to rotate the drain pin ( 400 ) and the cap ( 300 ) together . of course , when the drain pin ( 400 ) is installed on the rotation axis of the cap ( 300 ), the cap ( 300 ) can also be rotated , even if the rotation groove ( 242 ) is manufactured into a single dented groove . in this case , the drain pin ( 400 ) and the bypass valve ( 500 ) interfere with each other , however , and thus said cap ( 300 ) needs to be manufactured in an elongate manner in the upward and downward directions . in the oil filter assembly in the present invention , even if the drain pin ( 400 ) is set a certain distance away from the rotation axis of the cap ( 300 ), said rotation groove ( 242 ) is preferably manufactured into an annular groove with the central axis being the rotation axis of the cap ( 300 ) so as to keep said drain pin ( 400 ) rotating together with said cap ( 300 ) during the rotation of the cap ( 300 ). as described above , when said rotation groove ( 242 ) is manufactured into an annular groove , said slide block ( 420 ) will laterally be aligned to the radial direction of the rotation groove ( 242 ), that is to say said slide block ( 420 ) remains hung in the entrance of the rotation groove ( 242 ), and therefore said slide block ( 420 ) can rotate with the rotation axis of the cap ( 300 ) being the central axis and the cap ( 300 ) can rotate free of interference from the drain pin ( 400 ). in addition , when said slide block ( 420 ) slides along the rotation groove ( 242 ), the slide block is preferably manufactured into a structure with polygonal edges to keep the slide block ( 420 ) always laterally aligned to the radial direction of the rotation groove ( 242 ) and one lateral end ( 422 ) of said slide block ( 420 ) touching the internal side wall of said rotation groove ( 242 ). as shown in fig8 , when one lateral end ( 422 ) of said slide block ( 420 ) touches the internal side wall of said rotation groove ( 242 ), even if an external force is applied to said slide block ( 420 ) in the direction indicated by the arrows , said slide block ( 420 ) will not rotate so that said slide block ( 420 ) remains laterally aligned to the radial direction of the rotation groove ( 242 ) and revolves around the rotation axis of the cap ( 300 ). further , to keep one lateral end ( 422 ) of the slide block ( 420 ) wholly touching the internal side wall of the rotation groove ( 242 ), the lateral end ( 422 ) of said slide block ( 420 ) can be manufactured into a curved shape and the curvature is the same as that of the internal side wall of the rotation groove ( 212 ). as described above , when the lateral end ( 422 ) of the slide block ( 420 ) is manufactured into a curved shape , said slide block ( 420 ) will not rotate at all in the direction indicated by arrows in fig8 and thus the reliability of the combination between the slide block ( 420 ) and the rotation groove ( 242 ) can further be improved . when you remove said drain pin ( 400 ), you need to rotate said drain pin ( 400 ). in this case , if said slide block ( 420 ) is made of a material with almost no elasticity , such as a metal , you cannot rotate said drain pin ( 400 ) since the edges of said slide block ( 420 ) are snapped into the internal side wall of the rotation groove ( 242 ). therefore , said slide block ( 420 ) should be made of a material with elasticity above the standard value , such as synthetic resin , so that the edges of the slide block can cross the internal side wall of the rotation groove ( 242 ) when you apply a force , but said slide block will not rotate under the action of vibrations of the engine . fig9 and fig1 show the service state of the oil filter assembly in the present invention . to prevent the slide block ( 420 ) of the drain pin ( 400 ) from being separated from the rotation groove ( 242 ), you should align the lateral direction ( the direction with a larger length ) of the slide block ( 420 ) to the radial direction of the rotation groove ( 242 ), as shown in fig9 . on the contrary , to separate the slide block ( 420 ) of the drain pin ( 400 ) from the rotation groove ( 242 ), you should rotate the slide block ( 420 ) and align the lateral direction ( the direction with a larger length ) to the tangential direction of the rotation groove ( 242 ), as shown in fig1 . however , it may be difficult for the operator to rotate the drain pin ( 400 ) by a correct angle since said slide block ( 420 ) is blocked by the cap ( 300 ) and the alignment cannot be confirmed visually . to this end , marking grooves ( 314 ) are formed in the radial direction of the drain nipple ( 310 ) on the protruding end of the drain nipple ( 310 ) and said handle ( 430 ) is manufactured into a downward extended plate . when you rotate the drain pin ( 400 ) to keep the lateral direction of the slide block ( 420 ) aligned to the radial direction of the rotation groove ( 242 ), you can set the two ends in the amplitude direction of the handle ( 430 ) aligned to said marking grooves ( 314 ), as shown in fig9 . on the contrary , when you rotate the drain pin ( 400 ) to keep the lateral direction of the slide block ( 420 ) aligned to the tangential direction of said rotation groove ( 242 ), you can set the two ends in the amplitude direction of the handle ( 430 ) to be located between a pair of marking grooves ( 314 ), as shown in fig1 . as described above , when marking grooves ( 314 ) are formed on the drain nipple ( 310 ), the operator can rotate the drain pin ( 400 ) by a correct angle by confirming the direction of the handle ( 430 ) and the positions of marking grooves ( 314 ), and then can easily separate the drain pin ( 400 ) to discharge engine oil . the present invention is described in detail above with reference to the preferred embodiment of the present invention . the scope of the present invention is not limited to a specific embodiment , but should be explained according to the attached claims . further , those skilled in the art should understand that modifications and variations can be made without departing from the scope of the present invention . | 1 |
it is to be understood by one of ordinary skill in the art that the present discussion is a description of exemplary embodiments only , and is not intended as limiting the broader aspects of the present invention . the present invention is generally directed to a novel spintronic sensor technology which can be employed as a chemical sensor for chemical detection , a magnetic field sensor for magnetic data storage applications ( e . g . mass storage or magnetoresistive random access memory ), and as a spin transistor . this invention uses a chemically - controlled magnetic material as a component of a multilayer device together with standard ferromagnetic layers to offer chemical sensitivity , as well as enhanced magnetic sensitivity compared with traditional magnetoresistive sensors . in one particular embodiment , the bi - layer sensor includes an organically - capped metal ( e . g ., gold ) film which displays permanent magnetism as a system . for example , sulfur atom linkages ( i . e ., thiol linkages ) can be used to bond the organic molecule to the metal film creating a multilayer film ( e . g ., a bilayer , trilayer , etc . ), such as in a thiol self - assembled monolayer or thiol sam , or polyalinine . however , many other organic structures that exhibit permanent magnetism can also be used to cap the films . moreover , while gold ( au ) is a preferred metal , other metals , such as silver ( ag ), aluminum ( al ), copper ( cu ), platinum ( pt ), palladium ( pd ), etc ., can exhibit similar properties as au when used in devices of the present invention . in particular , ag , al , and cu all have an odd number of electrons , as does au . it is proposed by the present invention that these metallic - organic ( e . g . au - thiol ) layers be used in conjunction with ferromagnetic thin films as the basis of a novel class of magnetoresistive ( spintronic ) devices . in one embodiment of the present invention , an organically capped bilayer film ( e . g ., au - thiol ) in a spintronic device is used as a spintronic chemical sensor . it has been reported that the magnetic moment in a au - polyalinine bilayer ( with a sulfur , i . e . thiol , linker atom to the au ) decreases with time after being exposed to air . thus , the present inventors have discovered that the magnetic resistance of the au - polyalinine bilayer can be used in a chemical sensor to detect the presence of an analyte in the atmosphere . specifically , any analyte that can attach ( e . g ., bond ) to the organic cap can create a change in the magnetic resistance of the bilayer . for example , fig1 shows an exemplary schematic of one embodiment of the proposed sensor 1 . a thin bar or film 10 of metal ( e . g ., au ) is patterned on top of ferromagnetic injector film 12 and ferromagnetic detector film 14 . these structures are arranged in a geometry which is commonly used to measure spin diffusion . for example , the metal film 10 capped with organic tails 11 attached to the metal 10 through sulfur linkages 13 is positioned over a biasing magnet 15 and between the ferromagnetic injector film 12 and ferromagnetic detector film 14 . the metal film 10 capped with organic tails 11 can be referred to as a bilayer film . a charge current enters the ferromagnet injector 12 and passes to ground through the organically capped metal film 10 through an ohmic or tunnel contact . the spins of the electrons entering the organically capped film 10 are polarized by passing through the ferromagnetic injector 12 . therefore , while the charge current is returned to ground , there is a characteristic length over which the spins diffuse into the metal film 10 , called the spin diffusion length ( sdl ) shown as l sdl in fig1 . in au , different measurements of the sdl suggest that the sdl ranges from 50 - 250 nm . this length l sdl sets the active area of the device . if the au film is shorter than the sdl , then the spins are detected as a spin current in the ferromagnetic detector . fig2 a - 2 c show three different types of devices . the first device 2 , shown in fig2 a , has a metal film 10 ′ without any organic layer ( thiol , polyalinine , etc .). the spin current is constant with time for a given charge current . however , if instead of the bare metal film 10 ′, an organically capped metal bilayer 10 ( e . g ., au - thiol with polyalinine ) is employed , such as in fig2 b , and if the system 3 is kept in an inert atmosphere , no spin current will be detected , because the finite magnetization of the organically capped metal bilayer 10 randomizes the spin before it has a chance to diffuse across the region . once this device is exposed to the atmosphere ( as shown in fig2 c ), an analyte 15 can be attached to the organic tail 11 of the bilayer 10 , and the magnetism decreases with time . thus , the spin diffusion current can be detected again . these three embodiments are shown in the schematic graphs on the right side of the page , where the hypothetical spin current of the three cases is graphed as a function of time . over time , in the atmospheric embodiment 4 , the signal changes as the magnetism is reduced . by modifying the organic tail 11 of the bilayer 10 , different sensitivities to different atmospheric chemicals ( e . g ., analytes 15 ) can be engineered , which is within the capabilities of one of ordinary skill in the art . as a result , an array of these spintronic devices could be used to sense a multitude of atmospheric chemicals . for example , a device can be engineered having a specific organic tail 11 that has a strong affinity for a particular analyte 15 . after the device has been constructed , it can be exposed to the particular analyte 15 to determine the affect such an exposure has on the device . then , when in use , the sensor can be used to detect the presence of that targeted analyte 15 by monitoring for that particular response predetermined by the control device . fig3 shows how the resistance of the devices in fig1 - 2 changes with an applied magnetic field . the graph on the left shows a hysteretic change in resistance as the spin current is overcome by the applied magnetic field . the graph on the right , where the au - thiol layer is magnetic , shows no change in resistance . the intermediate states between these two graphs are what this sensor would detect as the au - thiol magnetism changes . fig4 shows an alternative embodiment of a spintronic chemical sensor . this device geometry is similar to a current - in - plane ( cip ) giant magnetoresistance multilayer or spin valve . here the multilayer structure 5 has an antiferromagnetic layer 16 ( e . g . ptmn or irmn ) to pin the magnetization of a ferromagnetic layer 18 ( e . g ., cofe or nife alloy ). a spacer layer 20 ( e . g ., cu ) is deposited , and followed finally by the organically capped metal bilayer structure 10 . permanent magnets 22 can be deposited on the sides of the structure 5 to bias the layers into a non - aligned state , and leads 24 a , 24 b are deposited on the sides such that an electric current flows sideways through the multilayer . the active area ( i . e ., the organic tails 11 ) of the device is exposed to the atmosphere , and the magnitude of the observed magnetoresistance will depend on the degree to which the organically capped metal bilayer 10 is magnetic . as the magnetization decreases due to adsorption of atmospheric chemicals ( i . e ., analytes 15 ), the magnetoresistance will correspondingly decrease , enabling one to monitor the atmosphere for particular chemical species . fig5 shows another embodiment of the present invention , this time the sensor device 6 has a magnetic tunnel junction ( mtj ) device geometry . such structures have been demonstrated to have magnetoresistance when used with ferromagnetic electrodes . here the current flows perpendicular to the plane ( cpp ). a metal - thiol - metal trilayer ( e . g ., au - thiol - au trilayer ), where the sulfurs 13 are located on top 32 of the structure as well as the bottom 34 , with the organic tails 11 being the insulating tunnel barrier . the top lead film 36 is extremely thin so as to change its magnetism when atmospheric chemicals adsorb onto the lead . additionally , a ferromagnetic layer 38 and an antiferromagnetic layer 40 are present . a top lead 42 and a bottom lead 44 supply a current through the system . fig6 shows another embodiment of a mtj device 6 ′, wherein instead of using the thiol sam as the tunnel barrier , a conventional aluminum - oxide ( al 2 o 3 ) or mgo or other tunnel barrier 50 is used , only in this case , the top lead is made of an organically capped metal film 10 , i . e . the top electrode is treated with a layer of thiols to facilitate its ability to sense atmospheric chemicals . in this embodiment , it is the current through the top lead whose degree of spin alignment with the pinned ferromagnet determines the resistance of the structure and changes under atmospheric conditions . finally , fig7 shows a magnetic tunnel junction sensor 6 ″ employing an organically capped metal bilayer 10 ( e . g ., au - thiol ) as a spin dependent tunnel barrier . in fig7 , two ferromagnetic layers 38 a , 38 b are present as well as the organically capped metal layer 10 . to the extent that having spin dependent transport through the organically capped metal layer 10 enhances the magnetoresistance , this device could be used as an improved magnetic field sensor , for example , in next generation magnetic random access memory devices or hard disc drives for sensing bit directions via magnetic fields , or in any other magnetoresistive sensor technology . fig7 could be modified to have a single ferromagnet together with the organically capped metal layer 10 instead of two ferromagnetic layers . one skilled in the art would realize that there are numerous other combinations of conventional magnetoresistive device geometries wherein organically capped metal layer 10 magnetic layers could be employed . the present invention proposes candidate sensor designs for chemical and magnetic field sensing , employing a metallic - organic ( eg . au - thiol ) spintronic bilayer as a spin - active electron transport element , which is sensitive to atmospheric conditions and can be chemically adjusted to have different sensitivities to different chemical species . an array of these devices could be fabricated similarly to an mram device , but where individual sets of devices would sense a different chemical species . such a device would be a low power , portable alternative to other proposed atmospheric chemical sensor technologies . these and other modifications and variations to the present invention may be practiced by those of ordinary skill in the art , without departing from the spirit and scope of the present invention , which is more particularly set forth in the appended claims . in addition , it should be understood the aspects of the various embodiments may be interchanged both in whole or in part . furthermore , those of ordinary skill in the art will appreciate that the foregoing description is by way of example only , and is not intended to limit the invention so further described in the appended claims . plot 1 shows preliminary magnetometry data we have taken for a 24 hr au / dodecanethiol ( 1 mm in ethanol ) film , a au film control , a sample mount control , and the difference between the au - thiol and au control loops . the samples are 1 × 1 mm 2 photolithographically patterned au squares grown on si wafers . the observed magnetization is ˜ 7 . 5 × 10 − 4 emu / cm 2 at 1 t , 2 . 7 × lower than the 2 × 10 − 3 emu / cm 2 observed by hernando et al . for lewis conjugate on glass , but 8 × larger than the 9 . 33 × 10 − 5 emu / cm 2 found by for polyalanine on glass . taken together , these results display three different magnetizations for three different au — s chemistries . however , achieving reproducibility has been challenging . we have fabricated samples which , while showing weaker moments , display increasing moment with immersion time . other samples display para - and diamagnetic moments near the sensitivity limit of magnetization values highlights the need for meticulous control during sample fabrication , with a focus on which process variables directly influence the au - thiol moment . for example , au hydrophilicity and cleanliness , as well as the au crystalline texture and roughness may strongly affect the magnetization . plot 1 — the upper graph shows hysteresis loops for au , au capped with dodecane thiol ( 1 mm for 24 hours ), and the sample mount ( top ). the lower graph is the difference between the au and au - thiol loops . an example of mr detection of au - thiol magnetism is shown in plots 2 a - b , where the resistance of two different co / au ( red ) and co / au / thiol ( blue ) thin films is plotted as of our vibrating sample magnetometer ( vsm ), i . e . much weaker magnetization . the wide range a function of perpendicular field . in both cases the two curves have different transition fields for the in - plane mr component ( features between +/− 1000 oe ), and a 30 minute immersion in 1 mm dodecane thiol modifies the field necessary to observe the in - plane transitions in the co films by 500 and 200 oe for plots 2 a and 2 b respectively . repeated experiments show similar shifts of varying sizes , and an immersion in pure ethanol shows no shift within experimental error . we have observed subtractive and additive field shifts , as well as an asymmetry in the field shift rate as a function of sample angle relative to the applied field . au - thiol magnetism appears to modify the magnetotransport in co films by producing a bias field which either opposes or assists the applied field . this shift changes with time after immersion , suggesting that the thiol sam evolves with time . plot 2 a and 2 b — resistance as a function of field for two different co ( 20 nm )- au ( 5 nm ) and co ( 20 )- au ( 5 )- thiol ( 1 mm dodecane for ½ hour ) films . the peaks are the in - plane amr response for out - of - plane fields which are not perfectly normal to the film plane . the adsorption of thiol shifts these peaks to lower fields in these cases , along with other changes . those of ordinary skill in the art will understand that the devices disclosed and described herein are meant only as examples and are not intended to limit the scope of the invention . | 6 |
hereinafter , the orally administrable sebum secretion inhibiting composition comprising a collagen hydrolysate of the present invention and the food or drink product containing the composition are described . collagen is a main protein component constituting connective tissue in animals and is characterized by having a collagen triple helical structure . a total of not less than 30 types of collagen have been reported which are respectively termed type i , type ii , and so on . type i collagen is the primary component of the derma , ligaments , tendons , bones and the like ; and type ii collagen is the primary component of articular cartilage . further , type iv collagen is mainly contained in a basal membrane , which is the undercoat of all epithelial tissues . type i collagen is the most abundant collagen in the body . in the sebum secretion inhibiting composition of the present invention , the collagen origin is not limited , and usable are those derived from mammals such as cow , pig , etc ., birds such as chicken , ostrich , etc ., fishes such as sharks , etc . those derived from livestock such as cow , pig , chicken , etc ., are easily obtainable in a large amount , hence particularly preferable . further , the type of collagen is not limited and any type can be used , or a plurality of collagen types may be used in mixture . in the present invention , the collagen hydrolysate ( hereinafter sometimes referred to as collagen peptide ) refers to a low molecular collagen obtained by hydrolyzing collagen with an acid , alkali or enzyme . for example , a collagen hydrolysate can be obtained by immersing skins and joints of animals such as pig , cow and chicken or scales and skins of fish in an acid or alkali solution to extract gelatin and treating the extracted gelatin with an enzyme or acid . the gelatin refers to the collagen pre - treated with an acid or alkali and then solubilized by heat hydrolysis . the sebum secretion inhibiting composition of the present invention is for oral administration , but the dosage form is not limited and can be administered in the form of , for example , tablets , capsules , drinks , etc . further , the sebum secretion inhibiting composition of the present invention may be administered by being contained in a food or drink product , and , in that case , the food or drink product in which the composition is contained are not limited , and examples include carbonated drinks , nutritional drinks , liquors , sweets , nutritional food products , frozen sweets , dairy products , meats , etc ., and food products as a raw material to be used for these products . the sebum secretion inhibiting composition of the present invention refers to a composition which inhibits sebum secreted from skin and the skin may be derived from any site of the body , but face , head , chest , back , armpits , genital area , etc ., known as the areas where sebaceous glands are dense have abundant sebum secretion , hence are included as target sites . hereinafter , the present invention will be described in detail with reference to examples . however , the present invention is not limited to the following examples . for the collagen hydrolysate , a commercial “ collagen peptide ” ( pig ) having a molecular weight of 20000 or less was used . the collagen peptide used was obtained by immersing the pig skin in an acid or alkali solution to extract gelatin and further enzymolyzing the extracted gelatin . the collagen peptide is mainly derived from pig type i collagen . for the test meal containing the collagen peptide , a powder test meal comprising the composition shown in table 1 was prepared . the powder test meal contains 10000 mg of collagen peptide and 100 mg of vitamin c per meal . vitamin c is added because it is required to synthesize collagen in vivo . sixteen men in their twenties and thirties as the subjects orally ingested the powder test meal . the subjects took one meal of the powder test meal added to milk , juice , miso soup or the like at any convenient time once a day for 12 consecutive days . the sebum amount of the subjects was measured before , during and after the ingestion of the powder test meal . on the measurement day , the subjects washed their faces with warm water and a facial soap at 1 p . m ., and 2 hours later , i . e ., around 3 p . m ., the measurement was carried out . the measurement was carried out , using an optical sebum measurement apparatus , triplesense ( moritex precision corporation ), by pressing the sensor part of the measurement apparatus against a spot about 3 cm below the eye on the face of the subject . the value ( arbitrary unit a . u .) indicated as an oil content measurement value by the measurement apparatus was referred to as the sebum value . before ingesting the powder test meal , 10 of the subjects had a sebum amount of 40 a . u . or more , whereas 6 subjects had a sebum amount of below 40 a . u . these groups were termed as the preingestion sebum amount ≧ the 40 - group and the preingestion sebum amount & lt ; the 40 - group , respectively . table 2 shows the average value of the sebum amount of all subjects , the average value of the sebum amount of the preingestion sebum amount ≧ the 40 - group and the average value of the sebum amount of the preingestion sebum amount & lt ; the 40 - group before ingesting the powder test meal , 1 week and 2 weeks after the start of ingestion and 1 week after the completion of ingestion . similarly , the results in the form of graph are shown in fig1 . in fig1 , δ represents the average value for all subjects , ∘ represents the average value of the sebum amount of the preingestion sebum amount ≧ the 40 - group , and □ represents the average value of the sebum amount of the preingestion sebum amount & lt ; the 40 - group . after ingesting the powder test meal , all groups had reduced sebum amounts in comparison with before ingestion which revealed that the sebum secretion was inhibited owing to the ingestion of the powder test meal . in particular , the sebum secretion inhibitory effect was significant in the preingestion sebum amount ≧ the 40 - group which leads to the presumption that people with oily skin inherently are most likely to benefit the effect . the effect already started showing within 1 week after the ingestion and the sebum amount increased again 1 week later from the ingestion which leads to the presumption that the effect can be attained in a comparatively short period of time . the same test was also carried out for the group which did not ingest the powder test meal but the sebum inhibitory effect was not observed . examples of application of the deodorized collagen peptide obtained based on the above test results to drink or food products or compositions , are shown below . using the present product ( collagen peptide ) prepared by the methods described in example 1 , a drink , a powder , a tablet , a chewing gum , a candy , a tablet candy , a gummy jelly , a chocolate and a sorbet were produced with the following formula . collagen peptide 5 . 0 parts by weight high fructose corn syrup 8 . 0 parts by weight sugar 4 . 0 parts by weight flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . collagen peptide 5 . 0 parts by weight sucralose 0 . 005 parts by weight stevioside 0 . 008 parts by weight rebaudioside 0 . 008 parts by weight acesulfame potassium 0 . 01 parts by weight peach flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . collagen peptide 5 . 0 parts by weight acidic lactic beverage 5 . 0 parts by weight high fructose corn syrup 10 . 0 parts by weight flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . collagen peptide 5 . 0 parts by weight high fructose corn syrup 10 . 0 parts by weight honey 5 . 0 parts by weight flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . collagen peptide 5 . 0 parts by weight sucralose 0 . 005 parts by weight stevioside 0 . 008 parts by weight rebaudioside 0 . 008 parts by weight acesulfame potassium 0 . 01 parts by weight peach flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight gelation stabilizer 0 . 5 parts by weight after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . collagen peptide 5 . 0 parts by weight high fructose corn syrup 8 . 0 parts by weight sugar 4 . 0 parts by weight flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight gelation stabilizer 0 . 5 parts by weight after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . collagen peptide 5 . 0 parts by weight coffee extract 5 . 0 parts by weight sugar 4 . 0 parts by weight flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight after adjusting ph to 6 . 5 using sodium bicarbonate , the drink was prepared to be 100 parts by volume with purified water . collagen peptide 5 . 0 parts by weight green tea extract 10 . 0 parts by weight flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight after adjusting ph to 6 . 5 using sodium bicarbonate , the drink was prepared to be 100 parts by volume with purified water . hereinabove , the present invention has been described with reference to examples but can be carried out without being limited to these embodiments of the present invention . this application claims the priority to the japanese patent application no . 2009 - 297848 , filed on dec . 28 , 2009 , and the contents of which is hereby incorporated by reference as a part of the present application . | 0 |
fig1 of the drawings illustrates the structure of a packet which employs a tunneling protocol ( specifically , l2tp ) and which is to be sent over a transport protocol in a virtual private network . such a packet is in this example intended for sending over a public network , i . e . the internet and therefore the packet commences with an ip header 11 and an ipsec header 12 . the virtual private network employs udp as a transport protocol and l2tp ( layer 2 transmission protocol ) as a tunneling protocol . this usage accounts for the udp header 13 and the l2tp header 14 . the udp header comprises a udp source port number 131 , a udp destination port number 132 , a length field 133 and a checksum 134 . the datagram represented by the udp header , the l2tp header and a payload 15 is encapsulated by means of an ipsec protocol and in this particular example by means of the encapsulation security payload ( esp ) protocol . this protocol provides authentication , data integrity and confidentiality , specifically by enciphering between an esp header and an ipsec authentication trailer . currently ipsec authentication , for both the esp protocol in the example and the ah ( authentication header ) protocol , uses an hmac ( hashed message authentication code ) which relies on a shared secret key rather than public keys ; however , the type of key is not relevant to the present invention . the transmission protocol header , in this example the ip header 11 , includes an identification of the transport protocol which the packet employs . this is done for an ipv4 packet by setting the ‘ higher - level protocol ’ field ( the 10 th byte of the ip header ) to a number which conventionally identifies the transport protocol , i . e . ‘ 50 ’ to denote the esp protocol . for an ipv6 packet , the same value ( 50 ) would be set into the ‘ next header ’ field ( the seventh byte ) to denote the esp protocol . the ipsec esp header 12 conventionally consists of a 32 - bit field called the spi ( security parameter index ) field and a 32 - bit sequence number field . the spi field in combination with the network destination address and the security protocol uniquely identifies a security association ( sa ) for the datagram . the sequence number is initially set to zero at the establishment of a security association and is employed to inhibit intrusion ( for example by ‘ man - in - the - middle ’ attacks ). the esp trailer field 16 includes the protocol number that identifies the transport protocol ( in this case udp ) of the encapsulated datagram . the udp header , the tunneling protocol header , the payload and the encapsulation protocol trailer ( in this case the esp trailer ) are enciphered . the enciphering includes the protocol number so that an intruder should not be able to determine that udp is the transport protocol . the authentication trailer 17 terminating the packet is a variable - length field containing a signed message digest , computed for example by some suitable algorithm , such as md5 ( message digest 5 ) or sha ( secure hash algorithm ). when a packet of the kind shown in fig1 reaches its destination in the virtual private network , i . e . it reaches the end of the l2tp / ipsec tunnel , the receiver has to decode the packet , using whatever decryption key has been agreed for the vpn over the ipsec protocol , and to verify the udp checksum . unlike some other protocols , udp requires that the whole datagram ( rather than just the header ) be processed for the checksum to be verified . checksum verification of a udp datagram at a receiver customarily requires the following steps : ( a ) add a pseudo - header to the udp user datagram . this pseudo - header is defined by the udp protocol and conventionally includes the ip source address , the ip destination address and transport protocol from the ip header and the length field from the udp header ; ( b ) add padding if needed to make data 16 - bit aligned ( c ) divide the total bits into 16 - bit sections ( d ) add all 16 - bit sections using one &# 39 ; s complement arithmetic ( e ) complement the result ( f ) if the result matches the checksum in the udp header , the checksum is verified . if so , the pseudo - header and any added padding are discarded and the packet is accepted , for example for further forwarding or other processing . if not , the packet should be discarded . as has been previously explained it is possible to employ separate memories for decoding and the examination of the udp checksum . a packet is received at an input ( for example a port of a network unit ) and passed to a cipher memory coupled to a cipher block . the deciphered packet is loaded into the checksum memory while a checksum block determines the checksum ; the packet ; the packet , on the assumption that the checksum is correct , is passed on for processing and / or forwarding by the unit . an initial time interval is occupied by the deciphering of the whole packet by the cipher block . only when the deciphering is complete is packet transferred to the checksum memory and processing is complete at the end of a second interval . the next packet can be deciphered in the cipher memory block during the second interval but the process inevitably introduces latency and requires double the memory space . it is also possible to employ a shared memory . it is acted on in consecutive intervals first by a cipher block and then by a checksum block . although this scheme uses half the memory space as the previous scheme , it is obviously much slower because the memory cannot be used for the next packet until the processing of the current packet has been completed . furthermore , the technique is unnecessarily time consuming , because it is necessary first to decode the full packet for ipsec and then to run through the packet again after the decode to verify the checksum . the technique limits the number of tunnels a system can terminate per second . fig2 illustrates generally one embodiment of the invention . fig3 illustrates a checksum verifier block that forms part of the embodiment more generally shown in fig2 . fig4 illustrates a pseudo - header employed in the technique to be described and fig5 is a flow diagram . as is shown in fig2 , a packet is received by way of a fifo 21 and written into a memory block 22 ( stage 51 , fig5 ). coupled to the memory is a decipher block 23 , which progressively deciphers the packet and returns the deciphered packet back to the memory 22 . in parallel with the return path from the decipher block 23 to the memory 22 is a checksum block 24 . a controller 25 controls the reading of data to and from the memory and also provides an enable signal to the decipher block at a particular stage in a received packet . the checksum verifier , as shown in fig3 , receives data at an input 30 and couples the data to a checksum logic circuit 31 ( coupler to registers 32 ) and to a ones - complement adder 33 . the adder 33 is coupled to a checksum register 34 which can signal a pass / fail register 35 . the system allows , as will now be described , deciphering and checksum verification to proceed in parallel . before the technique is described , it is relevant to mention that algorithms , such as des - cbc ( data encryption standard — cipher block chaining ) used for enciphering in the present context are block ciphers which operate on a segment of data at a time . typically the segment size is 64 , 128 or 256 bits . this allows progressive deciphering a block at a time . further , it will be understood that it is desirable to provide pre - filtering to ensure that only ipsec packets are sent to the deciphering logic . this is readily achievable because the enciphered part of the packet occurs after the ipsec header and the ipsec header will indicate the type of the ipsec packet . the packet is passed from the memory into the ipsec logic ( the decipher block 23 ) in segments one at a time ( the size depending on the cipher used ). since the first part of the packet ( the ip header and the ipsec esp header are not encrypted , the controller 25 will inhibit the decipher block 23 from deciphering until the correct point in the packet is reached . from the ipsec header the type of ipsec packet can be determined and accordingly how many bytes into the packet the ciphered section starts . the checksum logic 31 creates the pseudo udp header needed for checksum verification using some of the fields in the outer ip header that would be at the top of the packet . to do this it will latch into registers 32 the ipsa , ipda and ip protocol fields obtained form the ip header ( stage 53 , fig5 ) and wait for the deciphered udp length field . the ‘ reserved ’ field is set to zero . the pseudo udp header can be added at any time , conveniently at the end of the packet , to the packet data to complete the computation of the checksum . the first part of the packet to be decoded by the decipher block 23 in this mode will always be the udp header . as the decoded data comes out , the checksum logic 31 will complete the pseudo - header ( stages 55 and 57 , fig5 ), create the checksum field and latch it into a checksum register 34 . this field is zeroed in the packet ( so that the checksum is set to 16 × 0 ) and then the data is passed through the checksum verifier . as the rest of the packet is deciphered ( stage 56 , fig5 ) the checksum verifier will process the data simultaneously . when it comes to the esp trailer which can include some of the data as well as padding , a pad length and next header fields , the checksum logic will have to work out if , and so , what part of it is actual packet data . this may be done by subtracting from the length field in the ip header the length of the ipsec header ; the result is the length of the packet . a simple computation then gives the number of bytes required to align the packet to 16 bits . the checksum logic should now have a complete checksum in the checksum register 34 . this is then compared to the checksum that was previously latched and a pass / fail registered in register 35 . the pass / fail value is provided when the decipher is complete to allow forwarding or to cause discard of the packet accordingly . if the udp checksum passes , all the tunnel / ipsec headers and trailers are stripped off the packet and the raw packet is forwarded . the advantages of this proposal are that as fast as the packet is decoded , the checksum is also being verified , thus overcoming the throughput and / or latency problems with the prior art and avoiding extra memory . for example the main performance indicator for vpns is the number of tunnels that can be terminated per second . latency is becoming increasingly important too with the use of vpns for voice and delay sensitive traffic . this proposal is mainly applicable to l2tp / ipsec a widely used tunneling protocol but can also be used in any tunneling protocol which uses udp and security e . g . enciphered ip over udp used to traverse nat . | 7 |
the invention relates to nucleic acids and viral vectors containing an enhancer with a mutated nf - e2 / ap1 site ( e . g ., the mths - 40 enhancer ), and their use in expressing rna in an animal . nucleic acids including the mtnf - e2 / ap1 site can be used to form transgenic animals of the invention which express an antisense transcript or a mrna encoding the protein to be expressed in the transgenic animal . the expression of the transgene is not affected by its position in the genome , nor is the expression inhibited at high transgene copy numbers ( e . g ., above 5 , 7 , 9 , 14 , or 19 copies ). instead , the expression level is directly correlated with transgene copy number , thereby allowing high levels of expression at high transgene copy numbers . introduction of a transgene into the fertilized egg of an animal ( e . g ., a mammal ) is accomplished by any number of standard techniques in transgenic technology . see , e . g ., hogan et al ., manipulating the mouse embryo : a laboratory manual , cold spring harbor laboratory press , cold spring harbor , n . y ., 1986 . most commonly , the transgene is introduced into the embryo by way of microinjection . once the transgene is introduced into the egg , the egg is incubated for a short period of time and is then transferred into a pseudopregnant animal of the same species from which the egg was obtained ( hogan et al ., supra ). in the case of mammals , typically 125 eggs are injected per experiment , approximately two - thirds of which will survive the procedure . twenty viable eggs are transferred into pseudopregnant mammal , four to ten of which will develop into live pups . typically , 10 - 30 % of the pups ( in the case of mice ) carry the transgene . to identify the transgenic animals of the invention , progeny are examined for the presence of the transgene using standard procedures such as southern blot hybridization or pcr . expression of the transgene can also be assessed using northern blots , western blots , and immunological assays . without further elaboration , it is believed that one skilled in the art can , based on the above disclosure and the description below , utilize the present invention to its fullest extent . the following example is to be construed as merely illustrative of how one skilled in the art can practice the invention and are not limitative of the remainder of the disclosure in any way . any publications cited in this disclosure are hereby incorporated by reference . transgenic mice were produced by microinjection of dna fragments into the pronuclei of fertilized mouse eggs as described in brinster et al ., cell 27 : 223 - 231 , 1981 and costantini et al ., nature 294 : 92 - 94 , 1981 . plasmids phs40 - ζ597 - gh and phs40 ( r - mt 1 )- ζ597 - gh are described in zhang et al ., mol cell biol 13 : 2298 - 2308 , 1993 . digestion of these plasmids with ecori , ndei , and scai yielded 3 . 12 kb dna fragments containing the hs - 40 enhancer , the ζ - globin promoter , and the growth hormone ( gh ) open reading frame . the 3 . 12 kb dna fragments were eluted from soft agarose gels , purified , and used for microinjection . transgenic founders were identified and their transgene copy number determined by southern blot analysis of tail dna . the founders were then bred with nontransgenic c57 / b6 mice to establish lines . the morning on which the copulatory pluf was observed was designated 0 . 5 day postcoital . for analysis of fetal ( 14 . 5 days postcoital ) and embryonic ( 9 . 5 days postcoital ) mice , transgenic males were mated to nontransgenic c57 / b6 females . transgenic pups were identified by pcr analysis of fetal mice tails or of embryo dna . for each identification , duplicate pcr reactions were carried out using one 5 ′ primer from the ζ - globin promoter region , and two different 3 ′ primers from the gh region ( see below ). a total of 9 founders with wild type hs40 - ζgh ( wt ) and 10 founders with the mutant hs40 - ζgh ( mt ) have been obtained . the copy numbers of integrated fragments in wths - 40 - containing mice vary from 1 to more than 100 , as shown in table 1 . in table 1 , the founders for which lines have been established are indicated by an asterisk . mice with the wths - 40 transgene were assayed at the age of 5 months except founder 1b , which was evaluated at 9 months old . mice with the mths - 40 transgene were assayed at the age of 4 months except founder 15 , which was evaluated at 2 months old . the ζ - globin promoter activities in the founder mice were first measured with a blood gh assay as described in zhang et al ., supra . the levels of human gh in the blood were quantitated with the allegro hgh radioimmunoassay kit from nichols institute . when the concentration of gh in the blood exceeded 50 ng / ml , the samples were first diluted with horse serum in order perform the assay in a linear range . it was known that the amount of secreted enzyme molecules are good representations of the quantities of mrnas inside the expressing cells ( zhang et al ., supra ; palmiter et al ., nature 300 : 611 - 615 , 1982 ; palmiter et al ., science 222 : 809 - 814 , 1983 ; hammer et al ., nature 315 : 680 - 683 , 1985 ; and selden et al ., mol cell biol 6 : 3137 - 3179 , 1986 ). the level of gh in wths - 40 transgenic mice were all low and comparable to non - transgenic controls . this was consistent with observations that the human ζ - globin promoter activity is essentially shut off in adult transgenic mice , even when it is linked in cis with the wths - 40 enhancer or with the β - globin locus control region ( pondel et al ., nucl acids res 20 : 5655 - 5660 , 1992 ; robertson et al ., proc natl acad sci usa 92 : 5371 - 5375 , 1995 ; albitar et al ., mol cell biol 11 : 3786 - 3794 , 1991 ; and spanger et al ., nucl acids res 18 : 7093 - 7097 , 1990 ). in contrast , the blood gh levels of the ten founder mice having the mths - 40 enhancer exhibited a roughly linear , positive relationship relative to transgene copy number . further , the expression of the mths - 40 transgene was integration site - independent ( i . e ., position - independent ) because the integration sites here were believed to be random and mice having similar transgene copy numbers exhibit similar level of expression . the blood gh levels these founders at other ages , as well as these founders &# 39 ; progeny , were similar to the levels of expression in mths - 40 - containing mice , as shown in table 1 . to analyze the gh rna levels in transgenic fetuses and embryos , liquid n 2 - frozen embryos , fetuses , or fetal livers were manually homogenized , and the rna isolated by standard acid guandinium isothiocyanate - phenol - chloroform extraction ( sambrook et al ., molecular cloning : a laboratory manual , cold spring harbor laboratory press , plainview , n . y ., 2nd ed ., 1989 ). for adult samples , the mice were rendered anemic by three injections of phenylhydrazine ( 40 μg / g of body weight ) so that erythroblasts would enter the adult blood and be collected for analysis . the second injection was 8 hours after the first injection , and the third injection was 24 hours after the first . six days after the first injection , the mice were sacrificed , and the rna was isolated from different tissues . in all cases , the total rna was used for the following assay without further purification . rt - pcr was carried out as described in chelly et al ., nature 333 : 858 - 860 , 1988 and foley et al ., trends genet 9 : 380 - 385 , 1993 . each reverse transcription reaction mixture contained 1 μg of rna , 200 units of superscript ii ™ reverse transcriptase ( gibco brl ), and 20 mm oligo d ( t ) 15 . one - twentieth of the cdna was then amplified by pcr using taq polymerase ( gibco brl ) and primers specific for human gh , mouse β major , mouse ζ - globin promoter , or mouse g3pdh . amplifications were carried out in a hybrid omnigene system with the following temperature profiles : an initial denaturation at 95 ° c . for 3 min , 53 ° c . for 1 min , and 72 ° c . for 1 min ; followed by repeating cycles of 95 ° c . for 1 min , 53 ° c . for 1 min , and 72 ° c . for 1 min ; and finally an elongation step at 72 ° c . for 5 min . each pcr analysis was done in duplicate . the sequences of pcr primers used are as follows . for mg3pdh , tgaaggtcggtgtgaacggatttggc ( seq id no : 4 ) was used as the 5 ′ primer , and catgtaggccatgaggtccaccac ( seq id no : 5 ) was used at the 3 ′ primer . for the human gh gene , gtccctgctcctggcttt ( seq id no : 6 ) was used as the 5 ′ primer , and atgcggagcagctccaggtt ( seq id no : 7 ) was used as the 3 ′ primer . another 3 ′ primer used for the human gh gene was catcagcgtttggatgcctt ( seq id no : 8 ). for the mouse β major sequence , tgggcaggctgctggtta ( seq id no : 9 ) was used at the 5 ′ primer , and ttagtggtacttgtgagccaa ( seq id no : 10 ) was used as the 3 ′ primer . for the mouse ζ - globin promoter sequence , ctgatgaagaatgagagagc ( seq id no : 11 ) was used as the 5 ′ primer , and tagaggtacttctcatcagtcag ( seq id no : 12 ) was used as the 3 ′ primer . the pcr product lengths were 980 bp for mouse g3pdh , 335 bp for mouse β major , and 290 bp or 450 bp for ζ - gh . one - fifth of each pcr reaction was resolved on a 1 . 5 % agarose - ethidium bromide gel , which was then documented using a is1000 digital imaging system and saved as a tif computer file . the band intensities were quantitated by the phosphorimage system . for semi - quantitative purposes , mouse g3pdh was used as the internal standard . the linearity of amplification of the g3pdh cdna was first defined by amplification of serial dilutions of the cdna samples . twenty five cycles were chosen for amplifying mouse g3pdh since , under the reaction conditions described above , the signals were linear over a wide range of dilutions of cdna . in the initial calibration test , g3pdh bands with similar intensities were obtained from the different tissue cdna when the same amount of rna was used for reverse transcription . the appropriate pcr cycle number used to amplify the human gh , mouse β major , and mouse ζ - globin transcripts were 28 , 25 and 28 , respectively . the amount of different cdna used for amplification were first determined by pcr using the mouse g3pdg primers , then individual pcr reactions were performed using the human gh , mouse β major , or mouse ζ - globin primers . it was known that , in the developing mouse , the first site of erythropoiesis is at the yolk sac blood island at 8 - 14 days of gestation . the major site of erythropoiesis then shifts to the fetal liver , and finally to the spleen at birth . the expression of gh transcripts from the mouse ζ - globin promoter in adult transgenic mice containing the mths - 40 enhancer was examined . in all adult mice having the mths - 40 transgene , the expression of gh rna was restricted to the erythroid tissues . expression was roughly limited to the spleen and blood , with no expression in the liver or brain . expression could not be detected in the blood of mice containing the mths - 40 transgene unless the mice were first rendered anemic , indicating that expression was erythroblasts - specific . mice having the wths - 40 transgene exhibited little , if any , expression . the expression of the transgenic mice at the fetal stage also appeared to be erythroid - specific . ζ - gh transcripts could be detected in 14 . 5 day fetuses from transgenic mice with either mths - 40 or wths - 40 sequences . no ζ - gh transcripts were detected in non - transgenic control mice . a high intensity rt - pcr band was apparent in the reaction containing fetal liver rna , consistent with the erythroid fetal liver being the major site of transcription of ζ - gh transgenes . changes in ζ - gh transgene expression were followed by rt - pcr . transgenic mice having the wths - 40 transgene exhibited the expected temporal pattern of expression during development , the level of ζ - gh transcripts was relatively high at the 9 . 5 day embryo stage but dropped significantly in the adult blood . in contrast , the transgenic mice having the mths - 40 enhancer continued to express the ζ - gh transcript into adulthood . in addition , even with only one copy of the transgene , mice having the mths - 40 expressed at a higher level than mice having the wths - 40 enhancer , regardless of the stage of development . these data indicated that the mths - 40 enhancer sequence not only relieved the repression of the ζ - globin promoter in adulthood , but enhanced expression at all stages of development , even at one transgene copy per genome . when combined with the linear relationship between transgene copy number and expression level , as described above , the results indicated that mths - 40 can be used as an enhancer of gene expression in a variety of contexts . it is to be understood that while the invention has been described in conjunction with he detailed description thereof , the foregoing description is intended to illustrate and not limit the scope of the invention , which is defined by the scope of the appended claims . other aspects , advantages , and modifications are also within the scope of this invention . for example , inconsequential deletions , additions , or substitutions of nucleotides within seq id nos : 1 , 2 , or 3 ( i . e ., do not affect the advantageous properties of the mths - 40 enhancer ) are within the scope of the claims . | 2 |
kaposi &# 39 ; s sarcoma ( ks ), a sexually dimorphic disease inflicting high mortality in aids , remains at present without effective treatment . a recent report ( lunardi - iskandar y et al ., 1995 , nature 375 : 64 - 68 ) showed that the placental glycoprotein hormone , human chorionic gonadotropin ( hcg ), and surprisingly its β subunit , inhibit tumorigenicity and metastasis of kaposi &# 39 ; s sarcoma cells in mice xenografts . the anti - ks efficacy of a commercial hcg was subsequently demonstrated in clinical trials ( gill p s et al ., 1996 , new engl j med 335 : 1261 - 1310 ; gill p s et al ., 1997 , j . natl . cancer inst . 89 : 1797 ). in addition , earlier studies by bourinbaiar ( bourinbaiar , a . s . et al ., 1992 , febs . lett . 309 : 82 - 84 ; bourinbaiar a s et al ., 1995 , immunol lett 44 : 13 - 18 ) and by gallo &# 39 ; s group ( lunardi - iskandar y et al ., 1998 , nature medicine 4 : 428 - 434 ) indicate that the β subunit of hcg ( or peptides derived thereof ) have anti - hiv effects . the applicants have been working for several years on the cellular and molecular aspects of ks regulation by hormones . recent studies in the applicants &# 39 ; laboratory confirm that commercial hcg preparations ( known to be about 25 % pure ) display significant inhibitory action in a dose - dependent manner . however , pure and biologically active hcg has no effect on kaposi &# 39 ; s sarcoma growth in culture suggesting that a contaminant ( or degradation product ) may be the active agent . the applicants have subfractionated commercial hcg preparations based on molecular size and each fraction was tested with respect to inhibition of ks cell growth , hcg radioreceptor binding and steroidogenic bioactivity . the applicants &# 39 ; results demonstrate that the anti - ks activity resides among low molecular weight components , and not in bona fide ( macromolecular ) hcg . interestingly , the applicants have identified a transcription factor which may be the target for regulation by the anti - ks components . the applicants have concluded that , as yet unidentified molecules , present in the commercial hcg preparations , are responsible for the growth inhibitory effects wrongfully attributed to hcg . surprisingly , and in accordance with the present invention , there is provided the identification of a purified hip protein having anti - ks and anti - hiv pharmaceutical activity . this protein is an hcg - like inhibitory protein and is adsorbed to polypropylene plastic supports , and has an amino acid sequence selected from the group consisting of : two commercial hcg samples were tested . the first one , under the trade name of apl , was provided by wyeth - ayerst , montreal ( lot # c84662a was generously donated and cat . # din - 02168936 was purchased ), it should be emphasized that apl was used in the earlier studies ( lunardi - iskandar y et al ., 1995 , nature 375 : 64 - 68 ; gill p s et al ., 1996 , new engl j med 335 : 1261 - 1310 ). two samples were also purchased from sigma , st - louis , mo . ( lot # 26h 1040 ). pure hcg dimer as well as α - hcg and β - hcg were obtained from niddk ( bethesda , md .). recombinant hcg was obtained from organon , oss , the netherlands . all hcg samples , previously stored lyophilised , were dissolved in pbs and frozen as aliquots . the ks - y1 ( lunardi - iskandar y et al ., 1995 , nature 375 : 64 - 68 ) was isolated from an hiv - patient while the subline designated n - 1506 ( lunardi - iskandar y et al ., 1995 , nature 375 : 64 - 68 ) of the original ks - slk cell line originated from an immunosupressed subject ( herndier b g et al ., 1994 , aids 8 : 575 - 581 ). these cell lines were provided by dr . lunardi - iskandar ( n . i . h ., bethesda ) . the ks cells were passaged and the culture medium was changed every other day in presence or in absence of any of the hcg samples mentioned above for the indicated periods ranging from 24 - 96 hrs . 3 h - thymidine incorporation was measured as described ( guo w x et al ., 1996 , am j pathol 148 : 1999 - 2008 ; guo w x et al ., 1995 , am j pathol 146 : 727 - 734 ) in most experiments , data are reported as means ± sem of quadruplet determinations . statistical analysis was determined by student t - test . three vials of apl ( 10 000 iu / vial ) were pooled for fractionation by dissolving in 1 . 5 ml of 0 . 05 m nh 4 hco 3 . the clear solution was loaded on a column of sephadex ™ g - 100 (“ sephadex ™” g - 100 ″ are beads for gel filtration preparation prepared by cross linking dextran with epichlorohydrin , available from pharmacia , baie d &# 39 ; urfé , qc ) ( 1 . 5 × 90 cm ) equilibrated in the same solvent . fractions of 1 . 7 ml were collected and pooled into seven fractions ( see fig3 ). a small portion of each was saved for estimating hcg equivalent activity and the remainder was lyophilized . a convenient test for hcg , a hormone which efficiently binds to the lh receptor , is to perform radioreceptor assays using membrane preparations of adult pig testes as described in detail ( sairam m r , 1983 , in : hormonal proteins and peptides . li c . h ., ed ., pages 1 - 79 ; manjunath p et al ., 1982 , j biol chem 257 : 7109 - 7115 ). standard ( cr - 125 hcg from nichd , bethesda ) or test samples were tested for 125 i - hcg binding as described ( sairam m r , 1983 , in : hormonal proteins and peptides . li c . h ., ed ., pages 1 - 79 ). the total binding activity in each of the seven fractions was calculated and expressed as , ug hcg equivalent per fraction . hcg is a highly potent steroidogenic hormone , therefore one reliable bioassay consists of incubating mouse leydig tumour cells ( ma - 10 , originally obtained from dr . m . ascoli , iowa ) with the test material as described ( sairam m r , 1983 , in : hormonal proteins and peptides . li c . h ., ed ., pages 1 - 79 ). progesterone in the medium was estimated by radioimmunoassay ( sairam m r , 1983 , in : hormonal proteins and peptides . li c . h ., ed ., pages 1 - 79 ). nuclear extracts were prepared from ksy - 1 cell cultures according to the original procedure of smeal ( smeal t et al ., 1989 ,. genes develop . 3 : 2091 - 2100 ). binding reactions for ap - 1 sites ( tre , tpa response element ) were carried out as described ( smeal t et al ., 1989 ,. genes develop . 3 : 2091 - 2100 , and reviewed in saatcioglu f et al ., 1994 , semin . cancer biol . 5 : 347 - 359 ). synthetic collagenase tre oligonucleotide probe of the sequence 5 ′- ggatccgatgagtcagcca - 3 ′ ( seq id no : 5 ) was end labelled with 32 p - atp and emsa performed as described ( sineal t et al ., 1989 ,. genes develop . 3 : 2091 - 2100 ). specificity was ascertained by using . 100 molar excess of unlabelled tre . the signal was quantified by phosphorimager analysis using the software by molecular dynamics ( sunnyvale , calif .). pure hcg has no inhibitory activity in ks cells ( fig1 ) initial experiments were designed to confirm the inhibitory action of hcg . the effects on the two different ks cell lines were compared . in cells pre - treated with a commercial hcg preparation ( sigma or apl ) an inhibitory effect was elicited ( p & lt ; 0 . 05 ) in all ks cell lines . in preliminary experiments a dose - dependent inhibition of cell growth was noted . the two commercial hcg products ( apl and sigma ) were tested , and near identical inhibition was obtained ( fig1 ), right - hand two bars ). however , some hcg shipments were more potent than others . samples were used at an equivalent concentration of 50 u / ml ( fig1 ). note that upon treatment with sigma - hcg ( s ) or ayerst - hcg ( apl ), ks cell growth was significantly reduced as compared with the vehicle - treated cells ( c ). in contrast , no inhibitory effect was noted using preparations of highly purified hcg . legend : 1 = dimeric hcg ; 2 = α hcg ; 3 = β hcg ; 4 = unrelated human urinary protein pool ; * p & lt ; 0 . 05 . next , the anti - ks activity of a well characterized , pure dimeric hcg , pure α or β subunits and recombinant hcg was verified . neither one of these pure hcg &# 39 ; s inhibited ks growth ( fig1 # 1 - 3 ). the biological activity of these compounds was examined by induction of steroidogenesis in cultured leydig cells . as expected , either recombinant or pure hcg elicited the classic biological responses , while neither α nor β hcg displayed any steroidogenic action . generally , the pregnancy hormone ampouled into vials for clinical use is only about 25 % pure for hcg as evaluated by biological activity and biochemical analyses ( manjunath p et al ., 1982 , j biol chem 257 : 7109 - 7115 ). the commercial hcg ( apl ) was sorted into 7 distinct fractions using sephadex ™ chromatography ( fig2 ). the contents of 3 vials of clinical grade apl ( 10 , 000 iu each ) were dissolved in 0 . 05 m nh 4 hco 3 and subjected to molecular sieving on a column of sephadex ™ g - 100 ( 1 . 5 × 90 cm ). the eluted protein / peptide fractions monitored at a230 nm ( panel e ) were separated into seven pools identified as fraction pools # 1 - 7 on the x - axis . a total of 120 tubes ( 1 . 75 ml / tube ) were collected . lyophilized material in each pool was reconstituted in ks culture medium ( without serum ), and evaluated for cell proliferation ( panel a ). hcg receptor binding in pig testicular membranes ( panel b ) and steroidogenic activity in ma - 10 cells ( panel c ) were determined . panel d : bar graphs show quantitative densitometric scanning of ap - 1 binding and insert shows the actual emsa protein - dna complexes of fractions ( fr ) 2 , 4 and 7 ; nd = not determined . ksy - 1 cells were treated with the indicated reagents at an equivalent concentration 100 u / ml for 4 days . note clear segregation of hcg hormone activity on gonadal cells ( pool 2 ) and inhibitory action on ks cells ( pool 7 ) * p & lt ; 0 . 05 . over 85 % hcg receptor binding activity ( fig2 b ) was recovered in the first two pooled fractions where high molecular weight proteins of the size of pure hcg would emerge . the ve / vo ratio of the early major fraction ( pool # 2 ) corresponded to bona fide hcg . these fractions may also contain the hormone subunits ( α / β ) or their degraded products in addition to other unidentified materials present in the crude extract . fraction # 7 consists , as shown in previous studies ( sairam m r , 1983 , in : hormonal proteins and peptides . li c . h ., ed ., pages 1 - 79 ), of relatively small peptides along with other agents present in the apl formulation . either the steroidogenic or the binding activity that is characteristic of hcg ( but not its subunits ) was highest in the 2nd fraction ( fig2 b and c ). these results are consistent with receptor binding assays in which only the dimeric ( α - β combined ) hcg but not the individual subunits or their cleaved products are biologically active ( sairam m r , 1983 , in : hormonal proteins and peptides . li c . h ., ed ., pages 1 - 79 ; manjunath p et al ., 1982 , j biol chem 257 : 7109 - 7115 ). on the contrary , only fraction # 7 contained ks inhibitory activity . down - regulation of ap - 1 binding by hcg components ( fig3 ) activating protein - 1 ( ap - 1 ) is a transcriptional activator which is induced by 12 - o - tetradecanyl phorbol - 13 - acetate ( tpa ) tumor promoter , several growth factors and various extracellular stimuli ( reviewed in saatcioglu f et al ., 1994 , semin . cancer biol . 5 : 347 - 359 ). ap - 1 consists of proteins of jun and fos families which associate to form homo -( jun / jun ) or heterodimers ( jun / fos ) and recognize a consensus sequence 5 ′- tga g / c tca - 3 ′ known as tpa response element ( tre ) present on ap - 1 regulated genes . ap - 1 complexes are considered to play important roles in several signal transduction pathways such as growth stimulation , differentiation , neuronal excitation and transformation ( saatcioglu f et al ., 1994 , semin . cancer biol . 5 : 347 - 359 ). apl - hcg and components in fraction 7 significantly inhibited ap - 1 binding to tre in ksy - 1 cells ( fig2 d ). apl - hcg inhibited ap - 1 binding by 1 . 5 , 3 and 2 fold respectively after 3 , 6 and 12 hours of treatment ( fig3 ). cells were incubated with 50 iu / ml apl - hcg (+) or with vehicle (−) for the indicated time periods ( fig3 ). nuclear extracts were prepared and emsa was performed . results shown are representative of three experiments . arrow - head points to free probe . 100ex .= 100 fold excess unlabelled probe . top shows the actual gel shifts while bottom panel provides quantitative phosphorimager measurement of the major band ( arrow ); * denotes p & lt ; 0 . 05 as compared to vehicle - treated . a dose - response was also observed with near maximal effect noted at approximately 100 iu / ml . therefore , repression of ap - 1 may be an important pathway by which inhibition of ksy - 1 cells occurs . purification of the hip using reversed phase - hplc ( fig4 ) apl was purchased from wyeth - ayerst cat . # din 02168936 and shipped in an insulated box packed with refrigierant upon receipt , apl was stored at 4 ° c . one apl vial ( which contained the dried product ) lot # ja ( l ) 3yyf - ab was reconstituted with one ( 1 ) ml of the solvent sold with the apl ampoule at room temperature and processed for hplc within one hour . the powder was readily dissolved resulting in a homogeneous “ solution ”. this “ solution ” was injected into a water ™ hplc apparatus fitted with a 7 . 8 × 300 mm c - 18 ™ columnn elution from the column was done using an increasing linear isocratic gradient of acetonitrile in water containing 0 . 1 % trifluoroacetic acid . the gradient was increased from 5 % to 75 % acetonitrile . the absorbancy was monitored at 220 wavelength during the elation and fractions were collected manually in siliconized polypropylene tubes . when regular ( i . e . non - siliconized ) tubes were used it was later found that biological activity was lost after collection , the fractions were immediately placed in a savant ™ speed - vac apparatus in order to dry the samples . the gradient is drawn on fig4 ; the right - side or y axis shows the % acetetonile (% b ; b : 80 % acetonitrile in water containing 0 . 1 % trifluoroacetic acid ) and the x axis indicates time , in minutes . the absorbency at 220 nm was recorded and recorded on the y axis . the two peaks ( d & amp ; e ) indicated by arrows were subsequently found ( see fig5 below ) to contain the ks inhibitory activity . bioassay of the collected fractions following hplc separation ( fig5 ) the fractions ( peaks ) indicated by arrows on fig4 . were lyophilized and each was reconstituted in one ( 1 ) ml of rpmi culture medium ( without serum ) and tested for biological activity using the ks - y1 cells . since the original material was supplied as 10 000 iu of hcg , by analogy , it was assumed arbitrarily that one of the fractions should contain arbitrarily 10 , 000 iu of anti - ks activity . with such an assumption , the doses were evaluated throughout the present application . the biological activity was tested in absence ( 0 ) or presence of different doses ( 10 , 100 & amp ; 200 iu / ml ) . the fraction indicated as “ mix ” represents one pool made by mixing equivalent amounts of fractions a - e . it can be seen from fig5 that fractions d , e and “ mix ” display an inhibitory activity . analysis of the active fractions ( hip ) by maldi - tof mass spectrometry ( fig6 and 7 ) briefly , an aliquot of each sample was embedded in a low molecular weight uv - absorbing matrix ( α - cyano - 4 - hydroxycinnamic acid ) to enhance sample ionization and then subjected to maldi - tof ( matrix assisted laser desorption ionization time of flight ) mass spectrometry on a voyager - delayed extraction system ( perseptive biosystem , framingham , mass .). one major peak can be observed containing moieties at approximately 13000 dalton ( fig6 ). for comparison purposes , the spectrometric analysis of fractions a - c and e are also shown ( fig7 ), note that the 13000 dalton species is found in both fractions d and e ( fig6 ). the low molecular weight fraction # 7 shown earlier to inhibit ks cell proliferation ( kachra et al ., 1997 , endocrinology , 138 : 4038 - 4041 ), was tested for its anti - hiv activity . primary cultured human lymphocytes were infected with the virus hiv - iiib as described ( tremblay et al ., 1994 , embo . j . 13 : 774 ). immediately following infection , cells were treated with the test material ( hcg fractions or recombinant hcg ) daily for 10 days at the indicated dose ranging from 1 to 250 iu equivalent . subsequently , cells were lysed and assayed for the expression of the hiv viral protein p24 as described ( tremblay et al ., 1994 , embo . j . 13 : 774 ). it can be noted that p24 expression is markedly reduced upon treatment with high doses of the fraction containing hip while recombinant hcg displays no significant affects ( fig9 ). sequencing of the proteins contained in the hip fractions ( fig1 a and 10 b ) following the hplc separation , the fractions were tested for biological activity as described above ( for fig4 and 5 ). two fractions which contains highest bioactivity were processed for protein sequencing using an automatic sequencing apparatus ( applied biosystem gas phase sequencer model 470 updated to 475 ). an internal standard was used consisting of pth - nor - leu . the initial yield efficiency was approximately 50 ± 20 pmoles . after 15 cycle runs , data generated was examined using customary protein analysis . the deduced amino acid sequences were compared with published databases of the genbank ™. it was found that the two sequences contained significant homology with the α - and β - subunits of hcg . the present results provide evidence for the existence of a potentially important compound which inhibits the growth of ks possibly through signalling by the ap - 1 pathway . although the sequencing of the purified active molecule is currently in progress , it is evident that it is neither hcg nor any of its classically unknown subunits . judging from its gel permeation chromatographic elution , its size is relatively small and probably less than 10 , 000 - 14 , 000 . to obtain further resolution , the technique of hplc was employed resulting in a separation of protein species into discrete and distinct peaks . specific individual peaks were found to contain the anti - ks activity . to obtain further data , individual peaks were analyzed by polyacrylamide gel electrophoresis followed by silver staining . in instances where proteins was visualized , a “ fuzzy ” band was observed , indicating that the proteins comprise closely related species . at this time , one can only speculate as to whether it is derived from hcg as a cleavage peptide . indeed , it is known that glycoprotein hormones are metabolized to smaller polypeptides ( sairam m r , 1983 , in : hormonal proteins and peptides . li c . h ., ed ., pages 1 - 79 ). the putative cleavage ( or related product ) could elicit its action via a modified hcg receptor . in fact , the hcg receptor gene is known to be expressed as alternatively spliced variant transcripts ( segaloff d l et al ., 1993 , endocr rev 14 : 324 - 347 ) in a developmentally regulated manner raising the possibility that the putative product could mediate different aspects of hormone action . such a hypothesis is further strengthened by parallel experiments showing that ks tissues and cell lines express significant levels of hcg receptors whose size and intracellular distribution are different from classical targets cells ( cao h ., sairam m . r . and antakly t ., abstract # 1543 , annual meeting , american association for cancer research , 1996 ). alternatively , the active substance could be a degradation product of the β - hcg subunit ( such as but not limited to p - core ) which is homologous in three - dimensional structure to several growth factors ( lapthorn a j et al ., 1994 , nature 369 : 455 - 461 ). since the initiation and proliferation of ks cells is largely growth factor - dependent , it is possible that β - core fragments act as antagonists for growth factor receptors ( reviewed in guo w x et al ., 1996 , am j pathol 148 : 1999 - 2008 ). the partial sequences obtained in accordance with the present invention support the view that hip proteins may be derived from hcg either as : 1 ) alternate expression of α - or β - subunit ; or 2 ) enzymatic processing of the hcg subunits . while the invention has been described in connection with specific embodiments thereof , it will be understood that it is capable of further modifications and this application is intended to cover any variations , uses , or adaptations of the invention following , in general , the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth , and as follows in the scope of the appended claims . ser lys glu pro leu arg pro arg cys arg pro ile asn ala thr leu ala pro asp val gln asp lys phe thr arg gln ile met ala pro asp val gln asp lys phe thr arg gln xaa met xaa xaa ser lys glu pro leu arg pro arg xaa arg pro ile asn ala thr leu | 8 |
referring to fig1 - 4 , notebook computer 10 includes a base unit 12 and a top cover 14 which are pivotably secured to each other by a pair of hinges 18 ( fig3 ) along a hinge axis x . the base unit 12 houses the keyboard ( not shown ), processor , drives etc . of the computer 10 . the top cover 14 supports the panel display 16 of computer 10 . low voltage data signals to panel display 16 for controlling panel display 16 are provided by a conventional flex circuit extending between base unit 12 and top cover 14 . high voltage power ( about 1500 volts ) from a high voltage inverter 56 ( fig2 ) within base unit 12 is provided to panel display 16 by the present invention high voltage connection which includes a flexible high voltage conductor 26 extending between inverter 56 and panel display 16 . the high voltage power is used to backlight the panel display 16 using techniques in the art . top cover 14 includes an outer cover 14 b which supports panel display 16 and an inner frame member 14 a which secures panel display 16 to outer cover 14 b ( fig3 ). inner frame member 14 a and outer cover 14 b include two respective inner 24 a and outer 24 b hinge cover halves which when joined together , form two hinge covers 24 . two hinges 18 are spaced apart from each and enclosed within the interiors 44 ( fig4 ) of respective hinge covers 24 . each hinge 18 includes a hinge body 18 b mounted to outer cover 14 b and a hinge mount 18 a which is pivotably secured to hinge body 18 b ( fig3 ). each hinge mount 18 a extends from the outer axial end of a hinge cover 24 and is secured by screws to a base mount 20 at the rear of base unit 12 , thereby pivotably securing top cover 14 to base unit 12 along hinge axis x ( fig1 ). as shown in fig2 high voltage conductor 26 includes two insulated braided wires 30 and 32 positioned side - by - side . a flexible braided sleeve 28 , preferably about 1 inch wide , is shrink fitted over wires 32 and 30 on the portion of conductor 26 near base unit 12 ( fig4 ). if desired , a longer sleeve 28 can be employed . the lower end of wires 30 / 32 are electrically connected to a lower snap fit connector 26 a which mates with inverter connector 34 ( fig2 ). the upper end of wires 30 / 32 are electrically connected to an upper snap fit connector 26 b which mates with panel display connector 38 a ( fig3 ). the snap fittings facilitate the assembly process . conductor 26 extends upwardly from inverter connector 34 through an opening 46 in base unit housing 12 a ( fig4 ). conductor 26 is then bent at about 90 ° such that conductor 26 enters the right hinge cover 24 of top cover 14 through an opening 40 and lies within the interior 44 of hinge cover 24 . the portion of conductor 26 wrapped in sleeve 28 ( about one inch ) extends from opening 46 in base unit housing 12 a into opening 40 of hinge cover 24 . the longitudinal axis of about a one inch length of conductor 26 lies approximately along the hinge axis x of notebook computer 10 . conductor 26 is then bent again at about 90 ° to exit the interior 44 of hinge cover 24 and enter an opening 42 within outer cover 14 b below display screen 16 to couple with panel display connector 38 a ( fig3 ). panel display connector 38 a is electrically connected to panel display 16 by wires 38 . top cover 14 is typically rotated about the hinge axis x approximately 135 ° when opened or closed . such a range of motion would normally fatigue and break prior art high voltage wires if such wires were extended between top cover 14 and base unit 12 in a perpendicular relation to hinge axis x . the reason for this is that the same area of the wires are repeatedly bent approximately 135 ° whenever the top cover 14 is opened and closed . bending wires at the same area exerts alternating stresses to that area which fatigues and breaks the wires . in contrast , in the present invention , by positioning a length of conductor 26 along the hinge axis x of notebook computer 10 , no active bending of conductor 26 occurs . although the portions of conductor 26 which enter and exit hinge cover 24 are initially bent at approximately right angles during assembly , no further bending occurs during use . the only cyclic or repeated movement of conductor 26 which occurs during use is that the length of conductor 26 longitudinally lying along hinge axis x twists back and forth approximately 135 ° about hinge axis x as indicated by the arrow “ a ” ( fig4 ) when top cover 14 is pivoted open or closed . the braided sleeve 28 prevents the insulation 48 ( fig5 ) of wires 30 / 32 from rubbing against hinge cover 24 and base unit housing 12 a when conductor 26 twists , so that the insulation 48 does not wear off . the twisting of conductor 26 occurs along the length of conductor 26 between about points 22 and 36 ( fig4 ). this distributes the alternating stresses on conductor 26 over about a one inch length of conductor 26 instead of at a single spot . this is a large enough area to prevent the conductor 26 from fatiguing . in fact , conductor 26 has survived tests of 20 , 000 cycles of opening and closing top cover 14 . the construction of wire 30 of conductor 26 is depicted in fig5 . wire 32 ( fig2 - 4 ) is similarly constructed . wire 30 has an inner bundle 54 of seven wire strands 50 twisted around each other . the inner bundle 54 is surrounded by an outer series or bundle 52 of 12 wire strands 50 which are in turn twisted around inner bundle 54 . an outer polymeric insulation covering 48 surrounds the outer series 52 of wire strands 50 . the diameter of wire strands 50 is about 0 . 127 mm with the diameter of the entire conductor being about 0 . 64 mm . wire strands 50 are preferably made of tinned annealed copper wire which has a temperature rating of about 105 ° c . wire 30 has a voltage rating of about 3 kvdc and a maximum resistence of about 91 . 3 ohm / km at 20 ° c . insulation 48 is preferably of double thickness and is about 0 . 48 mm thick with a diameter of about 1 . 6 mm +/− 0 . 15 mm . insulation 48 has a minimum resistance of about 1000 m ohm / km at 20 ° c . and a minimum tensile strength of about 1 . 06 kg / mm 2 . although the preferred number and diameter of wire strands 50 has been described above , the number and diameter of the wire strands can be varied slightly while still providing desirable mechanical properties . the length of conductor 26 is preferably about 5½ inches long but , alternatively , can be longer or shorter depending upon the location of inverter connector 34 or panel display connector 38 a . in addition , connectors 26 a / 26 b are preferably made of plastic but alternatively can be metallic . although wires 30 and 32 are depicted to be separate wires , alternatively , wires 30 and 32 can be molded to be side by side . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . those skilled in the art will recognize or be able to ascertain using no more than routine experimentation , many equivalents to the specific embodiments of the invention described specifically herein . such equivalents are intended to be encompassed in the scope of the claims . for example , connectors 26 a , 26 b , 34 and 38 a can be omitted . in such a case , the wires 30 / 32 would be connected directly to inverter 56 and panel display 16 . | 6 |
the priming tool of the invention is comprised of an injection molded elongated plastic body 12 having a size such that it is conveniently held in the hand of the user . the body 12 includes a central tapered cavity formed in one side of the molded body 12 and the tapered cavity being generally u - shaped when viewed in a plane transverse to the longitudinal axis of the body . the upper end of the body 12 supports a shell holder 16 embedded therein so as to be immovably restrained . the shell holder 16 may be constructed of metal and includes a lower end having a peripheral flange 18 embedded in the plastic of the upper end of the body 12 to prevent removal of the shell holder 16 . the shell holder 16 includes an upper end having a slot or chamber 20 machined therein and functional to receive the lower end of a shell case shown in phantom in fig6 . the shell is restrained therein by an inwardly extending flange 19 surrounding the chamber 20 and functional to engage the circumferential flange of the shell base if the shell is subjected to a force in the direction of its longitudinal axis . the shell holder 16 also includes a central axial bore 24 extending from the chamber 20 into the cavity 14 . the bore 24 is axially aligned with the primer bore of the shell case , and the bore 24 is intended to house the new primer before it is forced into the primer bore in a manner to be described hereinafter . a shiftable pin 26 includes an end slideably supported in the central bore 24 of the shell holder 16 and the upper end 26a of the pin 26 is movable into the chamber 24 of the shell holder 16 to force a primer into the primer bore of the shell chamber ( fig5 ). the lower end of the slideable pin 26 is supported by a ball bearing 28 in turn supported by a cam lug 30 projecting inwardly into the cavity 14 of body 12 , the cam lug 30 integrally extending from the upper end 32a of a pivotable lever 32 . the upper end 32a of a lever 32 is pivotably joined to the body 12 , adjacent to the upper end of body 12 and the shell holder 16 , by a pivot pin 34 . the pivot pin 34 extends transversely to the parallel planes of the opposed side walls 36 and 38 of the cavity 14 and is supported in aligned apertures 40 and 42 in integral projecting spaced apart lugs 44 and 46 , respectively , of the body 12 . the lever 32 is pivotable in a plane parallel and between the side walls 36 and 38 of the cavity 14 and consequently the projecting cam lug 30 projecting into the cavity 14 moves in an arcuate path parallel to the side walls 36 and 38 and generally in a vertical direction either toward or away from the shell holder 16 . more particularly , when the lower end 32b of the lever 32 moves away from the lower end of the body 12 , the cam lug 30 moves downwardly away from shell holder 16 and as a correlary , when the lower end 32b of the lever is forced toward the tool body 12 , the cam lug 30 moves upwardly causing the ball 28 to apply an upward axial force on the shiftable pin 26 for forcing a primer into the priming chamber of the shell casing . the opposed side walls 36 and 38 of the tool body 12 each include a ledge 50 which restricts the extent of motion of the pivotable lever 32 . when the lower end of pivotable lever 32 is moved away from body 12 , the lower edge 52 of the cam lug 30 is received against ledges 50 thereby limiting the movement of lever 32 . the ball bearing 28 is held between a concave seat 54 in the lower end of the shiftable pin 26 and a complementary concave seat 58 in the upper portion of the cam lug 30 . the shiftable pin 26 is biased downwardly toward the ball bearing 28 by a coil spring 60 , the spring 60 being disposed between a peripheral flange 62 surrounding the lower end of the shiftable pin 26 and the lower end of the shell holder 16 . it will be noted that the ball bearing 28 functions to impart an axial upward force on the shiftable pin 26 as the cam lug 30 moves through a generally arcuate path . in operation of the priming tool , the lower end of the lever 32 is first pivoted away from the tool body 12 to the position shown in fig3 whereupon the shiftable pin 26 is caused to retract downwardly by the coil spring 60 from the position shown in fig5 to the position shown in fig3 . a primer can then be positioned in the upper end of the bore 24 to be supported by the upper end 26a of shiftable pin 26 . the lower end of the shell casing is then slideably inserted into chamber 20 and the pivotable lever 32 is forced toward the tool body 12 thereby causing the cam lug 30 to move upwardly and the shiftable pin 26 to force the primer into the shell casing . it will be noted that one of the advantages of the invention over the prior art is that its construction facilitates a very short moment arm between the axis of rotation of the pivotable lever 32 and the ball 28 and a much longer lever which is grasped by the operator . thus the operator can generate a substantial upward force on the ball 28 with a relatively small force applied to lever 32 . the lever and ball construction of the invention also facilitates more economical manufacture then prior art priming tools since a linkage between the lever 32 and the shiftable pin is avoided . | 5 |
the first embodiment of the present invention will be hereinafter described with reference to the accompanying drawings . based on fig1 a and 2a , a projector according to the first embodiment of the present invention will be explained . rotational control for a color wheel or light control after light passes through the color wheel may be any well - known art , so that the detail explanation thereof will be omitted . according to a projector 200 as a projection image display device of a dual light - source type as shown in fig1 a , a blue illuminant 21 may be a laser light source , a light emitting diode , etc . blue light emitted from the blue illuminant 21 is introduced into an integrator rod 24 after passing through a condensing lens 23 . the integrator rod 24 may be a well - known device as long as light is allowed to be continuously reflected inside thereof . light that has been passed through the integrator rod 24 will be then introduced into a color wheel 25 . the color wheel 25 may be a circular plate where its main body is made of optically permeable materials ( optical glasses , synthetic resins , etc .). the color wheel 25 is adapted to rotate at a high speed by means of a motor ( not shown ). as shown in fig2 a , the color wheel 25 is composed of a blue - light generating portion 251 gp that transmits blue light , a green - light generating portion 252 gp that transmits green light , and a blue - and - green light generating portion 253 gp that transmits the blue light and the green light . detail of these generating portions will be hereinafter explained . for example , as shown in fig3 a ( a ), at the blue - light generating portion 251 gp through which the blue light is passed , an anti - reflection layer 250 r is formed on a color wheel main body 250 . further , as shown in fig3 a ( b ), at the green - light generating portion 252 gp through which the green light is passed , a green phosphor layer 252 is formed on the color wheel main body 250 through the anti - reflection layer 250 r , the green phosphor layer 252 emitting the green light when the blue light is irradiated thereon . the green light then exits out from the color wheel 25 through a filter 250 f that eliminates the blue light . as also shown in fig3 a ( c ), at the blue - and - green light generating portion 253 gp that transmits the blue light and the green light , as the same with the green - light generating portion 252 gp , the green phosphor layer 253 is provided on the color wheel main body 250 through the anti - reflection layer 250 r . here , by adjusting the lamination thickness of a filter 253 f as well as a laminated number of the filter 253 f , the green light is set to approximately 15 % relative to the intensity of the blue light . light that exits out from the filter 253 f will be mixed colors composed of the blue light and the green light . the filter 250 f and 253 f are each structured with a dielectric multiplayer as that light with a certain wavelength that is emitted from the phosphor layers is allowed to pass through . considering the multilayer structure , it may apply the laminated structure of titanium oxide ( tio 2 ) and silicon oxide ( sio 2 ), or tantalum pentoxide ( tao 5 ) and silicon oxide ( sio 2 ). it may modify an area at which the phosphor layer is formed according to the ratio of light passing through . further , if necessary , a diffusion plate that diffuses light may be provided on a side where light exits out . still further , a light - intensity softening phosphor layer in which to extend a blue zone ( a blue wavelength ) may be formed on the transparent portion of the color wheel 25 ( such as on the blue - light generating portion 251 gp ) on the light incident side of the color wheel 25 . see fig3 a ( d ) in the case of the blue - light generating portion 251 gp . as shown , when there is no light - intensity softening phosphor layer , the intensity of blue light is very high with a very narrowed wavelength ( forming a sharp triangular waveform ). however , when the light - intensity softening phosphor layer is provided on the blue - light generating portion 251 gp , the intensity of the blue light is reduced ( forming a rounded waveform where its wavelength is more extended and its peak is made broad than the one without the light - intensity softening phosphor layer ). it can be thus said that the light - intensity softening phosphor layer reduces the intensity of specific wavelength ( blue in this case ), so that it can make light closer to natural sunlight . when the blue light is irradiated on the green phosphor layer 252 ( see fig3 a ( b )) along with the rotation of the color wheel 25 , the green light is emitted . this green light passes through the color wheel 25 and transmits a dichroic mirror 26 . the blue light that is irradiated on the blue - light generating portion 251 gp of the color wheel 25 passes through the color wheel 25 and transmits the dichroic mirror 26 . from the blue - and - green light generating portion 253 gp , the light with mixed colors composed of the blue light and the green light will be emitted . the dichroic mirror 26 is made as that the blue light and the green light are allowed to pass through , but the red light is reflected . among the blue lights , blue light that has been reflected from the color wheel 25 ( blue light br ) is re - reflected in the integrator rod 24 and again directed toward the color wheel 25 . the same can be said to the green light reflected from the color wheel 25 . in the chromaticity diagram of fig4 , when a coordinate defined by the blue light ( blue laser ), the green phosphor , and the red light ( light emitting diode ) as shown in fig5 is determined , when the luminous ratio of all three primary colors is 1 ( see fig6 ), its luminous color will be yellow ( see a in fig4 ). further , the green phosphor layer 253 is provided at the blue - and - green light generating portion 253 gp of the color wheel 25 , as the same with fig3 a ( b ). here , by adjusting the laminated thickness of the filter 253 f and a number of the lamination of the filter 253 f , the green light is set to approximately 15 % relative to the intensity of the blue light . the red light emitted from a red illuminant 22 is reflected by a mirror 27 and the dichroic mirror 26 . relative to the intensity of the blue light , the red light is set to approximately 20 % ( see fig7 ). accordingly , in fig1 a , a light intensity detector 33 composed of either an illumination intensity sensor or a color sensor is arranged behind the mirror 27 . the intensity of the red light is thus measured , and the measured signal is then inputted into a light volume regulator 34 . further , the intensity of the blue light and the green light that has passed through the color wheel 25 and has been reflected by the dichroic mirror 26 is measured by means of a light intensity detector 32 composed of either an illumination intensity sensor or a color sensor . as the same , the measured signal is then inputted into the light volume regulator 34 . based on the signal from the light volume regulator 34 , the red illuminant 22 is performed . here , it would be possible that the signal from the light volume regulator 34 is not sent back to the red illuminant but returned to an iris 35 ( the iris 35 is replaceable by a variable nd filter ) so as to adjust the intensity of the red light . as regards the wavelength of the three primary colors in a relative relation , see fig6 . as discussed hereinabove , while decreasing the intensity of the green light and the red light relative to the blue light , white light is obtained . see “ b ” in the chromaticity diagram of fig8 . thus , light that has passed through the blue - and - green light generating portion 253 gp of the color wheel 25 transmits the dichroic mirror 26 . the light then becomes white light after mixing with the red light . the blue light , the green light , and the red light that are emitted from the color wheel 25 as well as the white light are introduced into a digital micromirror device 29 and then processed in time series . images are then projected on a screen 38 through a projection optical system 30 . according to the first embodiment of the present invention , compared to conventional devices , the green light produced by which the blue light is irradiated on the green phosphor layer passes through the color wheel so as to be able to reduce the reflection of the blue light , contributing to effective usage of the blue light . when the green light is set to approximately 15 %, and the red light is set to approximately 20 % relative to the intensity of the blue light , it would be possible to increase the brightness of the white light . next , compared to the projector 200 of the first embodiment , the second embodiment of the present invention will be hereinbelow explained with reference to fig1 b . the device of fig1 b does not include the light intensity detectors 32 , 33 , the light volume regulator 34 , and the iris 35 . the basic structure of a device shown in fig1 b is the same with the one of fig1 a . in a color wheel 25 x , as shown in fig2 b , a green - light generating portion 352 gp is formed , extended up to 240 degrees in the circumferential direction of a disc . the rest of the disc is formed with a blue - light generating portion 351 gp . a green phosphor layer 352 may be formed at the most top layer of the green - light generating portion 352 gp as shown in fig3 b ( a ). on the other hand , the blue - light generating portion 351 gp includes an anti - reflection layer 350 r ( see fig3 b ( b )). a region where the green phosphor layer 352 is formed is modifiable according to the ratio of transmitted light . in the color wheel 25 x , between the green phosphor layer 352 and a color wheel main body 350 , an anti - reflection layer 350 r is provided . further , on the most bottom side of the green - light generating portion 352 gp of the color wheel 25 x , a filter 350 f that eliminates the blue light is provided . further , if necessary , a diffusion plate that diffuses light may be provided on the bottom side of the green - light generating portion 352 gp . or , a light - intensity softening phosphor layer extending a blue zone may be formed on the blue - light generating portion 351 gp of the color wheel 25 x . see the explanation that has been discussed hereinabove in case of the blue - light generating portion 25 igp with reference to fig3 a ( d ). when the blue light is irradiated on the green phosphor layer 352 of the green - light generating portion 352 gp along with the rotation of the color wheel 25 x , the green light is emitted ( see fig3 b ( a )). this green light is adapted to pass through the color wheel 25 x and transmit the dichroic mirror 26 . the blue light that has been irradiated on the blue - light generating portion 351 gp passes through the color wheel 25 x and transmits the dichroic mirror 26 . the dichroic mirror 26 is fabricated as that blue lights and green lights are passed through , but red lights are reflected . among the blue lights , blue light br that has been reflected from the color wheel 25 x is re - reflected in the integrator rod 24 and again directed toward the color wheel 25 x . the same can be applicable to green light gr reflected from the color wheel 25 x . the red light emitted from the red illuminant 22 is reflected from the mirror 27 and the dichroic mirror 26 . the blue light and the green light that transmit the dichroic mirror 26 , and the red light that is reflected from the dichroic mirror 26 pass through the lens 28 and then introduced into the digital micromirror device 29 . the introduced light is processed in time series so that images are projected on the screen 38 through the projection optical system 30 . according to the second embodiment of the present invention , compared to conventional devices , the green light produced by which the blue light is irradiated on the green phosphor layer 352 transmits the color wheel 25 x thereby reducing the reflection of the blue light , thus contributing to the effective usage of the blue light . next , the third embodiment of a projection image display device of a single light - source type according to the present invention will be hereinbelow explained . in a projector 300 as shown in fig9 a , blue light emitted from a blue illuminant 41 passes through a lens 43 and then introduced into a color wheel 45 through an integrator rod 44 . the color wheel 45 includes a color wheel main body 340 made of an optically permeable disc ( see fig1 a ) and , as shown in fig1 a , is divided into 4 sections in a circumferential direction . the 4 divided sections are composed of a green - light generating portion 342 gp , a red - light generating portion 343 gp , a blue - light generating portion 341 gp that passes blue light , and a green - and - red light generating portion 344 gp composed of mixed green and red phosphor layers . as shown in fig1 a ( b ) and 11 a ( c ), between a green phosphor layer 342 and the color wheel main body 340 , and also between a red phosphor layer 343 and the color wheel main body 340 , an anti - reflection layer ( ar coat ) 340 r is each formed . further , at the most bottom of the green - light generating portion 342 gp and the red - light generating portion 343 gp , a filter 340 f is each formed . as regards the blue - light generating portion 3410 p , the anti - reflection layer 340 r is each formed on both sides of the color wheel main body 340 . as regards the green - and - red light generating portion 344 gp , a green and red phosphor layer 344 is formed on the most top thereof . see fig1 a ( d ). the layer thickness of the filter 340 f and a number of the layers of the filter 340 f are determined so that the intensity of the green light and the red light each becomes 10 % to 25 % relative to the intensity 1 of the blue light . when the blue light is introduced into the color wheel 45 , green lights , red lights , blue lights and white lights respectively exit out from the green - light generating portion 342 gp , the red - light generating portion 343 gp , the blue - light generating portion 341 gp and the green - and - red light generating portion 344 gp . to obtain white lights , the same method with the first embodiment is applicable . the blue lights , the green lights , the red lights and the white lights that have been emitted form the color wheel 45 pass through the lens and then introduced into the digital micromirror device 29 so as to be processed in time series . images are then projected on the screen 38 through the projection optical system 30 . in the third embodiment of the present invention , compared to conventional devices , since the light source is only the blue light source , it would be possible to effectively utilize light . in addition , since the third embodiment can eliminate optical devices such as mirrors , or dichroic mirrors , it can simplify the structure of the device . further , since the brightness of the white lights can be increased relative to three primary colors , the brightness of projected images can be expanded contributing to acquisition of clear images . next , another embodiment of the single light source type will be hereinbelow explained . the structure of the whole device in fig9 b is the same with the third embodiment ( fig9 a ). in a color wheel 45 x as shown in fig1 and fig1 b , a color wheel main body 440 is made of an optically permeable disc . the color wheel main body 440 is divided into 3 sections each extended by 120 degrees in a circumferential direction . the divided sections are composed of : a blue - light generating portion 441 gp that transmits blue lights , a green - light generating portion 442 gp and a red - light generating portion 443 gp . as shown in fig1 b ( a ) and 11 b ( b ), between a green phosphor layer 442 and the color wheel main body 440 , and also between a red phosphor layer 443 and the color wheel main body 440 , an anti - reflection layer ( ar coat ) 440 r is each formed . further , on the most bottom of the green - light generating portion 442 gp and the red - light generating portion 443 gp , a filter 440 f is each formed . as regards the blue - light generating portion 441 gp , the anti - reflection layer 440 r is each formed on both sides of the color wheel main body 440 . when the blue light is introduced into the color wheel 45 x , the green light , the red light , and the blue light respectively exit out from the green - light generating portion 442 gp , the red - light generating portion 443 gp , and the blue - light generating portion 441 gp . the blue lights , the green lights , and the red lights emitted form the color wheel 45 x are passed through the lens 46 x and then introduced into the digital micromirror device 29 so as to be processed in time series . images are then projected on the screen 38 through the projection optical system 30 . in the fourth embodiment of the present invention , compared to conventional devices , since the light source is only the blue illuminant , it would be possible to effectively utilize light . in addition , since the fourth embodiment can eliminate optical devices such as mirrors , or dichroic mirrors , it can simplify the structure of a device . the basic structure of the color wheel of the present invention is as discussed hereinabove . here , if necessary , it would be possible to provide an integrator rod between a condensing lens and a color wheel ( see , for example , fig1 a and 1b ). in addition , an anti - reflection layer may be further formed on any of phosphor layers ( see fig1 a that is discussed in case of fig3 b ( a )). still further , on the surface of the phosphor layers ( on the side into which blue light is introduced ), it would be possible to conduct roughened treatments . specifically , as shown in fig1 b , the surface of a phosphor 351 placed over an anti - reflection layer 350 r ( the surface indicated with arrow ) may be subjected to the roughened treatments . here , a layer indicated with 350 f is a filter layer . with this structure also , it would be possible to prevent light from reflection , more specifically , the reflection occurred on an interface between the phosphor layer and an air layer can be inhibited . these roughened treatment conducted on the surface of the phosphor may be completed with well - known dies or nanoimprint . phosphor materials that have been hereinabove described may be as follows . as a phosphor for a red emission , y 2 o 3 : eu , y 2 sio 5 : eu , y 3 al 5 o 12 : eu , zn 3 ( po 4 ) 2 : mn , ybo 3 : eu , ( y , gd ) bo 3 3 : eu , gdbo 3 : eu , scbo 3 : eu , lubo 3 : eu , etc . are applicable . as a phosphor for a green emission , zn 2 sio 4 : mn , baal 12 o 19 : mn , bamgal 14 o 23 : mn , sral 12 o 19 : mn , znal 12 o 19 : mn , caal 12 o 19 : mn , ybo 3 : tb , lubo 3 : tb , gdbo 3 : tb , scbo 3 : tb , sr 4 si 3 o 8 cl 4 : eu , etc . are applicable . lastly , as a phosphor for a blue emission , cawo 4 : pb , y 2 sio 5 : ce , bamgal 14 o 23 : eu , etc . are applicable . | 7 |
u . s . pat . nos . 4 , 399 , 209 and 4 , 440 , 846 and u . s . application ser . no . 339 , 917 , filed jan . 18 , 1982 , and ser . no . 620 , 994 , filed june 15 , 1984 , are incorporated herein by reference to the extent that reference thereto may be necessary to complete this disclosure . cationic dye - borate anion complexes are known in the art . their preparation and use in imaging systems is described in u . s . pat . nos . 3 , 567 , 453 ; 4 , 307 , 182 ; 4 , 343 , 891 ; 4 , 447 , 521 ; and 4 , 450 , 227 . the complexes used in the present invention can be represented by the general formula ( i ): ## str1 ## where d + is a cationic dye ; and r 1 , r 2 , r 3 , and r 4 are independently selected from the group consisting of alkyl , aryl , alkaryl , allyl , aralkyl , alkenyl , alkynyl , alicyclic and saturated or unsaturated heterocyclic groups . useful dyes from photoreducible but dark stable complexes with borate anions and can be cationic methine , polymethine , triarylmethane , indoline , thiazine , xanthene , oxazine and acridine dyes . more specifically , the dyes may be cationic cyanine , carbocyanine , hemicyanine , rhodamine and azomethine dyes . in addition to being cationic , the dyes should not contain groups which would neutralize or desensitize the complex or render the complex poorly dark stable . examples of groups which generally should not be present in the dye are acid groups such as free carboxylic or sulphonic acid groups . specific examples of useful cationic dyes are methylene blue , safranine o , malachite green , cyanine dyes of the general formula ( ii ) and rhodamine dyes of the formula ( iii ): ## str2 ## n = 0 , 1 , 2 , 3 , r = alkyl y = ch ═ ch , n -- ch 3 , c ( ch 3 ) 2 , o , s , se ## str3 ## r &# 39 ;, r = alkyl , aryl , and any combination thereof while they have not been tested , the cationic cyanine dyes disclosed in u . s . pat . no . 3 , 495 , 987 should be useful in the present invention . the borate anion is designed such that the borate radical generated upon exposure to light and after electron transfer to the dye ( eq . 1 ) readily dissociates with the formation of a radical as follows : for example particularly preferred anions are triphenylbutylborate and trianisylbutylborate anions because they readily dissociate to triphenylborane or trianisylborane and a butyl radical . on the other hand tetrabutylborate anion does not work well presumably because the tetrabutylborate radical is not stable and it readily accepts an electron back from the dye in a back electron transfer and does not dissociate efficiently . likewise , tetrapheylborate anion is very poor because the phenyl radical is not easily formed . preferably , at least one but not more than three of r 1 , r 2 , r 3 , and r 4 is an alkyl group . each of r 1 , r 2 ` l , r 3 , and r 4 can contain up to 20 carbon atoms , and they typcially contain 1 to 7 carbon atoms . more preferably r 1 - r 4 are a combination of alkyl group ( s ) and aryl group ( s ) or aralkyl group ( s ) and still more preferably a combination of three aryl groups and one alkyl group . representative examples of alkyl groups represented by r 1 - r 4 are methyl , ethyl , propyl , butyl , pentyl , hexyl , octyl , stearyl , etc . the alkyl groups may be substituted , for example , by one or more halogen , cyano , acyloxy , acyl , alkoxy or hydroxy groups . representative examples of aryl groups represented by r 1 - r 4 includes phenyl , naphthyl and substituted aryl groups such as anisyl and alkaryl such as methylphenyl , dimethylpheynl , etc . representative examples of aralkyl groups represented by r 1 - r 4 groups include benzyl . representative alicyclic groups include cyclobutyl , cyclopentyl , and cyclohexyl groups . examples of an alkynyl group are propynyl and ethynyl , and exmaples of alkenyl groups include a vinyl group . as a general rule , useful cationic dye - borate anion complexes must be identified empirically , however , potentially useful cationic dye and borate anion combinations can be identified by reference to the weller equation ( rehm , d . and weller , a ., isr . j chem . ( 1970 ), 8 , 259 - 271 ), which can be simplifed as follows . where δg is the change in the gibbs free energy , e ox is the oxidation potential of the borate anion br - 4 , e red is the reduction potential of the cationic dye , and e h ν is the energy of light used to excite the dye . useful complexes will have a negative free energy change . similarly , the difference between the reduction potential of the dye and the oxidation potential of the borate must be negative for the complex to be dark stable , i . e ., eox - ered & gt ; o . as indicated , eq . 3 is a simplification and it does not absolutely predict whether a complex will be useful in the present invention or not . there are a number of other factors which will influence this determination . one such factor is the effect of the monomer on the complex . it is also known that if the weller equation produces too negative a value , deviations from the equation are possible . furthermore , the weller equation only predicts electron transfer , it does not predict whether a particular dye complex is an efficient initiator of polymerization . the equation is a useful first approximation . specific examples of cationic dye - borate anion complexes useful in the present invention are shown in the following table with the λ max . table__________________________________________________________________________complex no . structure λmax ( tmpta ) __________________________________________________________________________ 1 . ## str4 ## 552 nm 2 . ## str5 ## 568 nm 3 . ## str6 ## 492 nm 4 . ## str7 ## 428 nm 5 . ## str8 ## 658 nm 6 . ## str9 ## 528 nm 7 . ## str10 ## 450 nm__________________________________________________________________________ no . r &# 39 ; ar__________________________________________________________________________ 7a n - butyl phenyl 7b n - hexyl phenyl 7c n - butyl anisyl__________________________________________________________________________complex no . structure λmax ( tmpta ) __________________________________________________________________________ 8 . ## str11 ## 550 nm__________________________________________________________________________ no . r r &# 39 ; ar__________________________________________________________________________ 8a methyl n - butyl phenyl 8b methyl n - hexyl phenyl 8c n - butyl n - butyl phenyl 8d n - butyl n - hexyl phenyl 8e n - heptyl n - butyl phenyl 8f n - heptyl n - hexyl phenyl 8g ethyl n - butyl phenyl__________________________________________________________________________complex no . structure λmax ( tmpta ) __________________________________________________________________________ 9 . ## str12 ## 570 system10 . ## str13 ## 590 system ## str14 ## 640 nm__________________________________________________________________________ no . r r &# 39 ; ar__________________________________________________________________________ 11a methyl n - butyl phenyl 11b methyl n - hexyl phenyl 11c n - butyl n - butyl phenyl 11d n - butyl n - hexyl phenyl 11e n - pentyl n - butyl phenyl 11f n - pentyl n - hexyl phenyl 11g n - heptyl n - butyl phenyl 11h n - heptyl n - hexyl phenyl 11i methyl n - butyl anisyl__________________________________________________________________________complex no . structure λmax ( tmpta ) __________________________________________________________________________ ## str15 ## 740 system__________________________________________________________________________ the cationic dye - borate anion complexes can be prepared by reacting a borate salt with a dye in a counterion exchange in a known manner . see hishiki , y ., repts . sci . reseach inst . ( 1953 ), 29 , pp 72 - 79 . useful borate salts are sodium salts such as sodium tetrapheylborate , sodium triphenylbutylborate , sodium trianisylbutylborate and ammonium salts such as tetraethylammonium tetraphenylborate . the most typical examples of a free radical addition polymerizable or crosslinkable compound useful in the present invention is an ethylenically unsaturated compound and , more specifically , a polyethylenically unsaturated compound . these compounds include both monomers having one or more ethylenically unsaturated groups , such as vinyl or allyl groups , and polymers having terminal or pendant ehtylenic unsaturation . such compounds are well known in the art and include arcylic and methacrylic esters of polyhydric alcohols such as trimethylolpropane , pentaerythritol , and the like ; and acrylate or methacrylate terminated epoxy resins , acrylate or methacrylate terminated polyesters , etc . representative examples include ethylene glycol diacrylate , ethylene glycol dimethacrylate , trimethylolpropane triacrylate ( tmpta ), pentaerythritol tetraacrylate , pentaerythritol tetramethacrylate , dipentaerythritol hydroxypentacrylate ( dphpa ), hexanediol - 1 , 6 - dimethacrylate , and diethyleneglycol dimethacrylate . the cationic dye - borate anion complex is usually used in an amount up to about 1 % by weight based on the weight of the photopolymerizable or crosslinkable species in the photohardenable composition . more typically , the cationic dye - borate anion complex is used in an amount of about 0 . 2 % to 0 . 5 % by weight . while the cationic dye - borate anion complex can be used alone as the initiator , film speeds tend to be quite low and oxygen inhibition is observed . it has been found that is is preferable to use the complex in combination with an autoxidizer . an autoxidizer is a compound which is capable of consuming oxygen in a free radical chain process . examples of useful autoxidizers are n , n - dialkylanilines . examples of preferred n , n - dialkylanilines are dialkylanilines substituted in one or more of the ortho -, meta -, or para - position by the following groups : methyl , ethyl , isopropyl , t - butyl , 3 , 4 - tetramethylene , phenyl , trifluoromethyl , acetyl , ethoxycarbonyl , carboxy , carboxylate , trimethylsilymethyl , trimethylsilyl , triethylsilyl , trimethylgermanyl , triethylgermanyl , trimethylstannyl , triethylstannyl , n - butyoxy , n - pentyloxy , phenoxy , hydroxy , acetyl - oxy , methylthio , ethylthio , isopropylthio , thio -( mercapto -), acetylthio , fluoro , chloro , bromo and iodo . representative examples of n , n - dialkylanilines useful in the present invention are 4 - cyano - n , n - dimethylaniline , 44 - acetyl - n , n - dimethylaniline , 4 - bromo - n , n - dimethylaniline , ethyl 4 -( n , n - dimethylamino ) benzoate , 3 - chloro - n , n - dimethylaniline , 4 - chloro - n , n - dimethylaniline , 3 - ethoxy - n , n - dimethylaniline , 4 - fluoro - n , n - dimethylaniline , 4 - methyl - n , n - dimethylaniline , 4 - ethoxy - n , n - dimethylaniline , n , n - diemthylthioanicidine , 4 - amino - n , n - dimethylaniline , 3 - hydroxy - n , n - dimethylaniline , n , n , n &# 39 ;, n &# 39 ;- tetramethyl - 1 , 4 - dianiline , 4 - acetamido - n , n - dimethylaniline , etc . preferred n , n - dialkylanilines are substituted with an alkyl group in the ortho - position and include 2 , 6 - diisopropyl - n , n - dimethylaniline , 2 , 6 - diethyl - n , n - dimethylaniline , n , n , 2 , 4 , 6 - pentamethylaniline ( pma ) and p - t - butyl - n , n - dimethylaniline . the autoxidizers are preferably used in the present invention in concentrations of about 4 - 5 % by weight . the photohardenable compositions of the present invention can be coated upon a support in a conventional manner and used as a photoresist or in photolithography to form a polymer image ; or they can be encapsulated as described in u . s . pat . nos . 4 , 399 , 209 and 4 , 440 , 846 and used to control the relase of an image - forming agent . the latter processes typically involve image - wise exposing the photosensitive material to actinic radiation and subjecting the layer of microcapsules to a uniform rupturing force such as pressure , abrasion , or ultrasonic energy . several processes can be used to form color images as explained in u . s . application ser . no . 339 , 917 . if the microcapsules are sensitive to red , green and blue light , images can be formed by direct transmission or reflection imaging or by image processing . image processing may involve forming color separations ( color - seps ) corresponding to the red , green and blue component images and sequentially exposing the photosensitive material to three distinct bands of radiation hereinafter designated λ - 1 , λ - 2 , and λ - 3 sources through each color separation . otherwise , it may involve electronic processing in which the image or subject to be recorded is viewed through a dunn or matrix camera and the output from the camera electronically drives three exposure sources corresponding to λ - 1 , λ - 2 , and λ - 3 . while the discussion herein relates to forming 3 - color full color images , 4 - color images are also possible . for example , microcapsules containing cyan , magneta , yellow , and black image - forming agents can be provided which have distinct sensitivities at four wavelengths , e . g ., λ - 1 , λ - 2 , λ - 3 , and λ - 4 . in accordance with the invention , at least one set of the microcapsules in a full color system contains a cationic dye - borate anion complex . the other sets also may contain a cationic dye - borate anion complex , or they may contain a conventional photoinitiator . in accordance with the preferred embodiments of the invention , a full color imaging system is provided in which the microcapsules are sensitive to red , green , and blue light respectively . the photosensitive composition in at least one and possibly all three microcapsules are sensitized by a cationic dye - borate anion complex . for optimum color balance , the microcapsules are sensitive ( λ max ) at about 450 nm , 550 nm , and 650 mn , respectively . such a system is useful with visible light sources in direct transmission or reflection imaing . such a material is useful in making contact prints or projected prints or color photographic slides . they are also useful in electronic imaging using lasers or pencil light sources of appropriate wvelengths . because the cationic dye - borate anion complexes absorb at wavelengths greater than 400 nm , they are colored . typically , the unexposed dye complex is present with the image - forming agent in the image areas and , thus , the color of the complex must be considered in determining the color of the image . however , the complex is used in very small amounts compared to the image - forming agent and exposure often bleaches the dye complex . the photohardenable compositions of the present invention can be encapsulated in various wall formers using techniques known in the area of carbonless paper including coacervation , interfacial polymerization , polymerization of one or more monomers in an oil , as well as various melting , dispersing , and cooling methods . to achieve maximum sensitivities , it is important that an encapsulation technique be used which provides high quality capsules which are responsive to changes in the internal phase viscosity in terms of their ability to rupture . because the borate tends to be acid sensitive , encapsulation procedures conducted at higher ph ( e . g ., greater than about 6 ) are preferred . oil soluble materials have been encapsulated in hydrophilic wall - forming materials such as gelatin - type materials ( see u . s . pat . nos . 2 , 730 , 456 and 2 , 800 , 457 to green et al ) including gum arabic , polyvinyl alcohol , carboxy - methylcellulose ; resorcinol - formaldehyde wall formers ( see u . s . pat . no . 3 , 755 , 190 to hart , et al ); isocyanate wall - formers ( see u . s . pat . no . 3 , 914 , 511 to vassiliades ); isocyante - polyol wall - formers ( see u . s . pat . no . 3 , 796 , 669 to krinitani et al ); urea - formaldehyde wall - formers , particularly urea - resorcinol - formaldehyde in which oleophilicity is enhanced by the addition of resorcinol ( see u . s . pat . nos . 4 , 001 , 104 ; 4 , 087 , 376 and 4 , 089 , 802 to foris et al ); and melamine - formaldehyde resin and hydroxypropyl cellulose ( see commonly assigned u . s . pat . no . 4 , 025 , 455 to shackle ). urea - resorcinol - formaldehyde and melamine - formaldehyde capsules with low oxygen permeability are preferred . in some cases to reduce oxygen permeability it is desirable to form a double walled capsule by conducting encapsulation in two stages . a capsule size should be selected which minimizes light attenuation . the mean diameter of the capsules used in this invention typically ranges from approximately 1 to 25 microns . as a general rule , image resolution improves as the capsule size decreases . if the capsules become too small , they may disappear in the pores or the fiber of the substrate . these very small capsules may therefore be screened from expsoure by the substrate . they may also fail to rupture when exposed to pressure or other rupturing means . in view of these problems , it has been determined that a preferred mean capsule diameter range is from approximately 3 to 10 microns . techincally , however , the capsules can range in size up to the point where they become visible to the human eye . an open phase system may also be used in accordance with the invention instead of an encapsulated one . this can be done by dispersing what would otherwise be the capsule contents throughou the coating on the substrate as discrete droplets . suitable coatings for this embodiment include polymer binders whose viscosity has been adjusted to match the dispersion required in the coating . suitable binders are gelatin , polyvinyl alcohol , polyacylamide , and acrylic lattices . whenever reference is made to &# 34 ; capsules &# 34 ; and &# 34 ; encapsulation &# 34 ; without reference to a discrete capsule wall in this specification or the appended claims , those terms are intended to include the alternative of an open phase system . the photosensitive material of the present invention can be used to control the interaction of various image - forming agents . in one embodiment of the present invention the capsules may contain a benign visible dye in the internal phase in which cas eimages are formed by contacting the exposed imaging material under pressure with a plain paper or a paper treated to enhance its affinity for the visible dye . a benign dye is a colored dye which does not interfere with the imaging photochemistry , for example , by relaxing the excited swtate of the initiator or detrimentally absorbing or attenuating the exposure radiation . in preferred embodiment of the invention , images are formed through the reaction of a pair of chromogenic materials such as a color precursor and a color developer , either of which may be encapsulated with the photohardenable composition and function as the image forming agent . in general , these materials include colorless electron donating type compounds and are well known in the art . representative examples of such color formers include substantially colorless compounds having in their partial skeleton a lactone , a lactam , a sultone , a spriopyran , an ester or an amido structure such as triarylmethane compounds , bisphenylmethane compounds , xanthane compounds , fluorane , thiazine compounds , spiropyran compounds and the like . crystal violet lactone and copikem x , iv and xi are often used . the color formers can be used alone or in combination . the developer materials conventionally employed in carbonless paper technology are also useful in the present invention . illustrative examples are clay minerals such as acid clay , active caly , attapulgite , etc . ; organic acids such as tannic acid , gallic acid , propyl gallate , etc . ; acid polymers such as phenol - formaldehyde resins , phenol acetylene condensation resins , condensates between an organic carboxylic acid having at least one hydroxy group and formaldehyde , etc . ; metal salts or aromatic carboxylic acids such as zinc salicylate , tin salicylate , zinc 2 - hydroxy napththoate , zinc 3 , 5 di - tert butyl salicylate , zinc 3 , 5 - di -( α - methylbenyl ) salicylate , oil soluble metal salts or phenol - formaldehyde novolak resins ( e . g ., see u . s . pat . nos . 3 , 672 , 935 ; 3 , 732 , 120 and 3 , 737 , 410 ) such as zinc modified oil soluble phenol - formaldehyde resin as disclosed in u . s . pat . no . 3 , 732 , 120 , zinc carbonate etc . and mixtures thereof . as indicated in u . s . pat . nos . 4 , 399 , 209 and 4 , 440 , 846 , the developer may be present on the photosensitive sheet ( providing a so - called self - contained system ) or on a separate developer sheet . in self - contained systems , the developer may be provided in a single layer underlying the microcapsules as disclosed in u . s . pat . no . 4 , 440 , 846 . alternatively , the color former and the color developer may be individually encapsulated in photosensitive capsules and upon exposure both capsule sets image - wise rupture releasing color former and developer which mix to form the image . alternatively , the developer can be encapsulated in non - photosensitve capsules such that upon processing all developer capsules rupture and release developer but the color former contining capsules rupture in only the unexposed or under - exposed area which are the only areas where the color former and developer mix . still another alternative is to encapsulate the developer in photosensitive capsules and the color former in non - photosensitive capsules . the present invention is not necessarily limited to embodiments where the image - forming agent is present in the internal phase . rather , this agent may be present in the capsule wall of a discrete capsule or in the binder of an open phase system or in a binder or coating used in combination with discrete capsules or an open phase system designed such that the image - wise ruptured capsules release a solvent for the image - forming agent . embodiments are also envisioned in which a dye or chromogenic material is fixed in a capsule wall or binder and is released by inter - action with the internal phase upon rupturing the capsules . the most common substrate for this invention is paper . the paper may be a commercial impact raw stock , or special grade paper such as cast - coated paper of chrome - rolled paper . the latter two papers are preferred when using capsules having a diameter between approximately 1 and 5 microns , because the surface of these papers is smoother and therefore the capsules are not as easily embedded in the stock fibers . transparent substrates such as polyethylene terephthalate and translucent substrates can also be used in this invention . their advantage is that the latent image formed need not be reversed for printing . synthesis examples 1 and 2 respectively illustrate the preparation of borates and dye - borate complexes . dissolve triphenylborane in 150 ml of dry benzene ( 1m ) under nitrogen atmosphere . place flask in a cool water bath and , while stirring , add n - buli , ( 1 . 1 eg .) via syringe . a white precipitate soon formed after addition was started . stirring is continued about 45 - 60 min . dilute with 100 ml hexane and filter , washing with hexane . this resultant li salt is slightly air unstable . dissolve the white powder in about 200 ml distilled water and , with virogour stirring , add aqueous solution of tetramethyl ammonium chloride ( 1 . 2 eg . of theoretical in 200 ml ). a thick white precipitate forms . stir this aqueous mixture about 30 min . at room temperature , then filter . wash collected white solid with distilled water . as an alternative synthesis , to a 1 . 0m solution of 2 . 0 equivalents of 1 - butene in dry , oxygen - free dichloromethane , under inert atomosphere , was added slowly dropwise with stirring , 1 . 0 equivalents of a 1 . 0m solution of dibromethane - methylsulfide complex in dichloromethane . the reaction mixture stirred at reflux for 36 hours and the dichloromethane and excess 1 - butene were removed by simple distillation . vacuum distillation of the residue afforded 0 . 95 equivalents of a colorless mobile oil ( bp 66 - 7 0 . 35 mm hg , &# 34 ; bnmr ; bs ( 4 . 83ppm ). under inert atmosphere , this oil was dissolved in dry , oxygen - free tetrahydrofuran to give a 1 . 0m solution and 3 . 0 equivalents of a 2 . 0 m solution of phenylmagnesium chloride in tetranydrofuran were added dropwise with stirring . after stirring 16 hours , the resultant solution was added slowly with vigorous stirring to 2 equivalents of tetramethylammonium chloride , as a 0 . 2 m solution , in water . the resulting white flocculate solid was filtered and dried to afford a near quantitative amount of the desired product mp 250 °- 2 ° c ., &# 34 ; bnmr ; bs (- 3 . 70ppm ). sonicate a suspension of a borate salte ( 1 g / 10 ml ) in meoh , to make a very fine suspension . protect flask from light by wrapping with aluminum foil then add 1 equivalent of dye . stir this solution with low heat on a hot plate for about 30 min . let cool to room temperature then dilute with 5 - 20 volumes of ice water . filter has resultant solid and wash with water until wasings are colorless . suction filter to dryness . completely dry initiator complex by low heat ( about 50 ° c .) in a vacuum drying oven . initiator is usually formed quantitatively . analysis by h - nmr indicates 1 : 1 complex formation typically greater than 90 %. the present invention is illustrated in more detail by the following non - limiting examples . 1 . into a 600 ml stainless steel beaker , 104 g water and 24 . 8 g isobutylene maleic anhydride copolymer ( 18 %) are weighed . 2 . the beaker is clamped in place on a hot plate under an overhead mixer . a six - bladed , 45 ° pitch , turbine impeller is used on the mixer . 3 . after thoroughtly mixing , 3 . 1 g pectin ([ polygalacturonic acid methyl ester ) is slowly sifted into the beaker . this mixture is stirred for 20 minutes . 4 . the ph is adjusted to 4 . 0 using a 20 % solution of h 2 so 4 , and 0 . 1 g quadrol ( 2 - hydroxypropyl ethylenediamine with propylene oxide from basf ) is added . 5 . the mixer is turned up to 3000 rpm and the internal phase ia added over a period of 10 - 15 seconds . emulsification is continued for 10 minutes . 6 . at the start of emulsification , the hot plate is turned up so heating continues during emulsification . 7 . after 10 minutes , the mixing speed is reduced to 2000 rpm and 14 . 1 g urea solution ( 50 % w / w ), 3 . 2 g resorcinol in 5 g water , 21 . 4 formaldehyde ( 37 %), and 0 . 6 g ammonium sulfate in 10 ml water are added at two - minute intervals . 8 . the beaker is covered with foil and a heat gun is used to help bring the temperature of the preparation to 65 ° c . when 65 ° c . is reached , the hot plate is adjusted to maintain this temperature for a two to three hour cure time during which the capsule walls are formed . 9 . after curing , the heat is turned off and the ph is adjusted to 9 . 0 using a 20 % naoh solution . 10 . dry sodium bisulfite ( 2 . 8 g ) is added and the capsule preparation is cooled to room temperature . three batches of microcapsules were prepared for use in a full color imaging sheet using the three internal phase compositions set forth below . internal phase a provides a yellow image - forming agent and is sensitive at 420 nm , phase b provides a magenta image - forming agent and is sensitive at 480 nm , and phase c contains a cyan image - forming agent and a cationic dye - borate anion complex which is sensitive at 570 nm . the three batches of microcapsules were mixed , coated on a support , and dried to provide a full color imaging sheet . ______________________________________internal phase a ( 420 nm ) tmpta 35 gdphpa 15 g3 - thenoyl - 7 - diethylamino coumarin 15 g2 - mercaptobenzoxazole ( mbo ) 2 . 0 gpentamethylaniline ( pma ) 1 . 0 greakt yellow ( basf ) 5 . 0 gsf - 50 ( union carbide isocyanate ) 1 . 67 gn - 100 ( desmodur polyisocyanate resin ) 3 . 33 ginternal phase b ( 480 nm ) tmpta 35 gdphpa 15 g9 -( 4 &# 39 ;- isopropylcinnamoyl )- 0 . 15 g1 , 2 , 4 , 5 ,- tetrahydro - 3h , 6h , 10h [ 1 ]-- benzopyrano [ 9 , 9a , 1 - yl ] quinolazine - 10 - onembo 1 . 0 gpma 2 . 0 gmagenta color former 8 . 0 g ( hd - 5100 hilton davis chemical co ) sf - 50 1 . 67 gn - 100 3 . 33 ginternal phase c ( 570 nm ) tmpta 50 gcationic dye complex no . 2 0 . 15 gpma 2 . 0 gcyan color former 4 . 0 g ( s - 29663 hilton davis chemical co .) sf - 50 1 . 67 gn - 100 3 . 33 g______________________________________ 1 . into a 600 ml stainless steel beaker , 110 g water and 4 . 6 g isobutylene maleic anhydride copolymer ( dry ) are weighed . 2 . the beaker is clamped in place on a hot plate under an overhead mixer . a six - bladed , 45 ° pitch , turbine impeller is used on the mixer . 3 . after thoroughly mixing , 4 . 0 g pectin ( polygalacturonic acid methyl ester ) is slowly sifted into the beaker . this mixture is stirred for 2 hours at room temperature ( 800 - 1200 rpm ). 4 . the ph is adjusted to 7 . 0 with 205 sulfuric acid . 5 . the mixer is turned up to 3000 rpm and the internal phase ia dded over a period fo 10 - 50 seconds . emulsification is continued for 10 minutes . magenta and yellow precursor phases are emulsified at 25 °- 30 ° c . cyan phase is emulsified at 45 °- 50 ° c . ( oil ), 25 °- 30 ° c . ( water ). 6 . at the start of emulsification , the hot plate is turned up so heating continues during emulsification . 7 . after 10 minutes , the ph is adjusted to 8 . 25 with 20 % sodium carbonate , the mixing speed is reduced to 2000 rpm , and a solution of melamine - formaldehyde prepolymer is slowly added which is prepared by dispersing 3 . 9 g mealmine in 44 g water , adding 6 . 5 g formaldehyde solution ( 37 %) and heating at 60 ° c . until the solution clears plus 30 minutes . 8 . the ph is adjusted to 6 . 0 , the beaker is covered with foil and placed in a water bath to bring the temperature of the preparation to 65 ° c . when 65 ° c . is reached , the hot plate is adjusted to maintain this temperature for a two hour cure time during which the capsule walls are formed . 9 . after curing , mixing speed is reduced to 600 rpm , formaldehyude scavenger solution ( 7 . 7 g urea and 7 . 0 g water ) is added and the solution was cured another 40 minutes . 10 . the ph is adjusted to 9 . 5 using a 20 % naoh solution and stirred overnight at room temperature . three batches of microcapsules were prepared as above for use in a full color imaging sheet using the three internal phase compositions set forth below . ______________________________________yellow forming capsules ( 420 nm ) tmpta 35 gdphpa 15 g3 - thenoyl - 7 - diethylamino coumarin 15 g2 - mercaptobenzoxazole ( mbo ) 2 . 0 g2 , 6 - diisopropylaniline 1 . 0 greakt yellow ( basf ) 5 . 0 gn - 100 ( desmodur polyisocyanate resin ) 3 . 33 gmagenta forming capsules ( 550 nm ) tmpta 50 gcomplex 8a 0 . 2 g2 , 6 - diisopropylaniline 2 . 0 ghd5100 ( magenta color 12 . 0 gprecursor from hilton - davischemical co .) cyan forming capsules ( 650 nm ) tmpta 50 gcomplex 11 h 0 . 31 g2 , 6 - diisopropylaniline 2 . 0 gcyan precursor ( cp - 177 6 gof hilton - davis chemical co .) ______________________________________ the three batches of microcapsules were blended together and coated on a support to provide an imaging material in accordance with the present invention . having described the invention in detail and by reference to preferred embodiments thereof , it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims . | 8 |
reference will now be made in detail to the embodiments of the present disclosure , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to like elements throughout . as illustrated in fig1 to 4 , a damper 1 for decreasing a piping vibration includes a fixation part 10 fixed to a pipe p while directly making contact with the pipe p , a weight part 20 connected to the fixation part 10 and formed in a way that a space s is present in between the weight part 20 and the pipe p while not directly making contact with the pipe p , and a slitting part 30 formed in a slitting manner at the outer circumferential surface of the fixation part 10 and the weight part 20 in lengthways of the fixation part 10 and the weight part 20 . the damper 1 is installed at the pipe p , which is configured to the structure of the refrigerant cycle of an air conditioner or a refrigerator , and decreases the vibration of the pipe p . the damper 1 is structured to be separated into the fixation part 10 and the weight part 20 , and the fixation part 10 is fixed to the pipe p by directly making contact with the pipe p , and the weight part 20 is connected to the fixation part 10 while formed in a way that the space s is present in between the weight part 20 and the pipe p without directly making contact with the pipe p . the fixation part 10 is formed with the material in a cylindrical shape while having elasticity , and for example , the fixation part 10 may be formed with rubber . in the drawings , it is illustrated that the fixation part 10 is provided with a cylindrical shape , but the shape of the fixation part 10 may be variously formed . a coupling hole 11 having the same diameter as the diameter of the pipe p is formed at an inside of the fixation part 10 , such that the pipe p is fixed to the pipe p by directly making contact at the fixation part 10 . in order to install the damper 1 at the pipe p , after the slitting part 30 formed at the fixation part 10 and the weight part 20 is spread open , the damper 1 is inserted around the pipe p through the slitting part 30 , which is spread open , such that the damper 1 is installed at the pipe p . at this time , the fixation part 10 is fixed to the pipe p in a state that the coupling hole 11 formed at an inside the fixation part 10 is directly making contact at the outer circumferential surface of the pipe p . in order to fix the fixation part 10 to the pipe p , a spring clip 40 is coupled to the fixation part 10 . in order to couple the spring clip 40 , a coupling groove 13 is formed at the outer circumferential surface of the fixation part 10 along the circumference of the fixation part 10 , and by fastening and tightening the spring clip 40 at the coupling groove 13 , the fixation part 10 is fixed to the pipe p . the spring clip 40 configured to fix the fixation part 10 to the pipe p is formed with a steel material having elasticity , and the spring clip 40 is formed in a circular shape having one side thereof open , such that the spring clip 40 is inserted around the fixation part 10 to surround the outer circumferential surface of the fixation part 10 , and thereby the fixation part 10 is fixed to the pipe p . after having the open one side of the spring clip 40 spread open , and then having the spring clip 40 inserted around and tightened to the coupling groove 13 of the fixation part 10 , the fixation part 10 is fixed to the pipe p . the weight part 20 , as similar to the fixation part 10 , is formed with the material in a cylindrical shape while having elasticity , and for example , the weight part 20 may be formed with rubber . the weight part 20 , which takes about 80 % of the overall weight of the damper 1 , is connected to the fixation part 10 , and is formed to have a larger outside diameter than the outside diameter of the fixation part 10 . a penetrating hole 21 having a larger diameter than the diameter of the coupling hole 11 formed at the fixation portion 10 and the diameter of the pipe p is formed at an inside the weight part 20 . in order to install the damper 1 at the pipe p , after the slitting part 30 formed at the fixation part 10 and the weight part 20 is spread open , the damper 1 is inserted around the pipe p through the slitting part 30 , which is spread open , such that the damper 1 is installed at the pipe p . since the penetrating hole 21 formed at an inside the weight part 20 is formed to have a large diameter than the outside diameter of the pipe p , the penetrating hole 21 is not directly making contact with the outer circumference of the pipe p , and the space s is present in between the penetrating hole 21 and the outer circumferential surface of the pipe p . since the weight part 20 is not directly making contact with the pipe p , and is formed in a way to have the space s in between the weight part 20 and the pipe p , the weight part 20 may be able to move freely compared to the fixation part 10 that is being in contact with the pipe p . by having the weight part 20 structured to move freely , the effect in decreasing the vibration of the pipe p may be improved . referring to fig5 , a comparison will be made among the case ( a ) when the damper 1 is not installed at the pipe p ; the case ( b ) when a damper for decreasing a piping vibration 1 formed as a unitary body without being separated between the fixation portion 10 and the weight portion 20 , is configured to make contact with the pipe p as a whole ; and the case ( c ) when the damper 1 for decreasing a piping vibration formed to be separated into the fixation 10 and the weight portion 20 is configured such that the fixation portion 10 makes contact with the pipe p without allowing the weight part 20 to make contact with the pipe p . in the case ( b ) when the damper having the fixation portion 10 and the weight portion 20 formed as an unitary body without being separated between the fixation portion 10 and the weight portion 20 makes contact with the pipe p , the natural frequency at the case ( b ) is moved to a lower frequency range to the case ( a ) when the damper for decreasing a piping vibration 1 is not installed at the pipe p . accordingly , the natural frequency of the pipe p is moved to a lower frequency band to avoid the driving frequency of the compressor , and thereby the vibration of the pipe p may be improved . however , since the vibration peak shows almost no change , in a case of the pipe p connected to a constant speed compressor that is being operated at a constant speed , the vibration of the pipe p may be improved . however , in a case of the pipe p connected to an inverter compressor that is being operated in a considerably large range , only the frequency is moved without the vibration being decreased , and thus the effect in decreasing the vibration of the pipe p is not large . in the case ( c ) when the damper for decreasing a piping vibration 1 formed to be separated into the fixation portion 10 and the weight portion 20 such that the fixation portion 10 makes contact with the pipe p without allowing the weight portion 20 to make contact with the pipe p , the vibration peak at the case ( c ) is largely decreased compared to the case ( b ). thus , even in a case of the pipe p connected to the inverter compressor that is being operated in a considerably large frequency range , the effect in decreasing the vibration of the pipe p becomes large . the damper for decreasing a piping vibration 1 configured to decrease the vibration of the pipe p , to improve the effect in decreasing a vibration , is formed to have a different weight each according to the type of a compressor or the shape of the pipe p that is connected to a compressor . as illustrated on fig6 , a plurality of insertion grooves 23 may be formed at the weight portion 20 , and as a weight controlling member 27 is inserted into the insertion groove 23 , the weight of the weight part 20 is controlled . in a case when the weight of the damper for decreasing a piping vibration 1 is needed to be controlled after installing the damper for decreasing a piping vibration 1 at the pipe p , the weight controlling member 27 is inserted into the insertion groove 23 , so that the weight of the damper for decreasing a piping vibration 1 is controlled . by inserting the weight controlling member 27 into some of the insertion holes among the plurality of the insertion grooves 23 formed at the weight part 20 , the weight of the damper for decreasing a piping vibration 1 may be controlled , and by inserting the weight controlling member 27 into all of the insertion holes among the plurality of the insertion grooves 23 formed at the weight part 20 , the weight of the damper for decreasing a piping vibration 1 may be controlled . the number of the insertion grooves 23 formed in the weight portion 20 is not limited thereto , and may be provided in a predetermined number depending on the depth and the diameter of the insertion groove 23 and the material of the weight controlling member 27 . as illustrated on fig7 to 8 , the weight part 20 may be formed in a way to have various shapes other than the cylindrical shape . in a case when the weight part 20 is formed in a way to have a different shape other than the cylindrical shape , the weight part 20 includes a plurality of weight controlling portions 25 at which the insertion groove 23 is formed . the weight controlling portions 25 may be provided in a predetermined number corresponding to the number of the insertion grooves 23 formed at the weight part 20 . in the drawings , it is illustrated that three or four portions of the weight controlling portions 25 are formed at the weight part 20 , but according to the number of the insertion grooves 23 formed at the weight part 20 , the weight controlling portions 25 may be formed in a way to be provided with various number of portions thereof . the slitting part 30 is slit from one sides of the outer circumferential surface of the fixation part 10 and the weight part 20 to the coupling hole 11 and the penetrating hole 21 in lengthways of the fixation part 10 and the weight part 20 . the slitting part 30 is formed to install the damper for decreasing a piping vibration 1 at the pipe p , and after the slitting part 30 formed at the fixation part 10 and the weight part 20 is spread open , the damper for decreasing a piping vibration 1 is inserted around the pipe p through the slitting part 30 , which is spread open , such that the damper for decreasing a piping vibration 1 is installed at the pipe p . although the damper for decreasing a piping vibration according to a few embodiments of the present disclosure has been described in relation to the shape and direction , it would be appreciated by those skilled in the art that changes may be made in these embodiments without departing from the principles and spirit of the disclosure , the scope of which is defined in the claims and their equivalents . | 5 |
shown in fig1 is a schematic view of a general embodiment of the invention in which two coarse demultiplexers 10 , 12 are used in conjunction with an interleaver to demultiplex the channels of an optical system . each of the demultiplexers handles every other channel , the wavelengths handled by demultiplexer 10 being referred to as the “ even ” wavelengths , and the wavelengths handled by demultiplexer 12 being referred to as the “ odd ” wavelengths . each of the demultiplexers 10 , 12 is one of any number of different types of prior art demultiplexers , and easily discriminates between the wavelengths it handles , given the wavelength spacing between them . this is despite the fact that the actual spacing between adjacent channels of the optical system may be too narrow for good discrimination by either demultiplexer acting alone . however , because an interleaver is also used to separate out every other channel , the effective channel spacing is much wider . in order to perform the desired separation of the odd and even channels , an interleaver 14 is used in conjunction with optical circulator 16 . the circulator 16 is a known optical component , and acts as unidirectional optical coupler between different optical paths . light directed toward the circulator 16 from input port 18 is coupled to the path containing interleaver 14 , while light directed toward the circulator 16 from the interleaver 14 is coupled to the path containing demultiplexer 10 . thus , any light from input port 18 that is reflected by the interleaver 14 after exiting the circulator 16 is directed to demultiplexer 10 , while portions of the same light signal that are not reflected by interleaver 14 continue on to demultiplexer 12 . as such , the function of the interleaver in the embodiment of fig1 is to reflect every other wavelength channel . the ideal interleaver has a reflectivity profile that is a perfect square wave . in the preferred embodiments of the invention , the interleaver is a fiber grating that is arranged so that sections of maximum reflectivity correspond to the even wavelengths , while the sections of minimum reflectivity correspond to the odd wavelengths . that is , the spacing of the grating is such that the desired square wave profile is produced . for example , in a first embodiment , the grating 14 is made up of a series of gratings , each having a maximum reflectivity at one “ even wavelength ” and a width corresponding to the bandwidth of the channels of the system . for example , in a forty - channel system , the grating 14 could contain twenty separate gratings , each with a uniform pitch that corresponds to the even wavelengths . the fabrication of such a grating would use essentially the same phase mask lithographic process as would be used for a single wavelength grating , except that it would be used to define all twenty gratings simultaneously . the spacing of the gratings from one another corresponds to the discrimination bandwidth of the demultiplexers 10 , 12 . in such an arrangement , grating 14 would transmit all the odd channels and reflect all the even channels . it is preferable for the interleaver grating to be apodized , as shown in fig2 . this figure shows an example of how the refractive index patterning might change along the length of one grating section , although those skilled in the art will recognize that the profile shown is not to scale . having the reflective index gradient change in this manner along the length of each grating section reduces the side lobes of the interleaver , and therefore the cross talk between channels . for example , given a grating designed for 100 ghz channel spacings and 200 ghz demultiplexers , appropriate apodizing can reduce the side lobes down close to 30 db , while the interleaver itself remains flat to 0 . 1 db over 0 . 4 nm . the length of the grating per wavelength channel is 4 mm , and the assumed maximum index change is 0 . 001 . fig2 a shows the reflectivity profile of such a grating , shifted by 200 ghz . the apodization eliminates the sidelobes and prevents interference between the gratings . of course , those skilled in the art will recognize that varying the specific interleaver parameters can allow the performance to be customized . in another embodiment of the invention , the interleaver grating 14 of fig1 is a “ sampled grating ” that consists of a grating structure having a constant pitch , but periodic breaks in the grating structure . a portion of such a grating is shown graphically in fig3 although it will be understood that the grating will typically have many more sections 20 than shown . the grating sections 20 are each separated from adjacent sections by an equal amount of space in which there is no grating . the pitch of the grating , the length of the sections 20 and the spacing between them combine to establish the desired reflective properties of the grating . in fig3 the sections 20 are shown as having a length “ a ” and a separation of “ b ” between them . the pitch of the grating establishes the center wavelength of the grating , and the periodicity of the sections 20 establishes additional reflectivity peaks away from the center wavelength . the reflectivity peaks created by the sampled grating correspond to the desired channel wavelengths . for any selected center wavelength and grating pitch , a particular set of reflectivity peaks will be created . in a variation of this embodiment , a sampled grating may be used that has a different structure than that shown in fig3 . shown in fig4 is a sampled grating that has a chirped structure , rather than a periodic sequence of grating , sections . as shown , the pitch of the grating increases along the length of each section of the grating structure , starting with a minimum pitch 26 that increases linearly to a maximum pitch 28 . the change occurs over a superstructure 30 of predetermined length . an example of the reflectivity provided by a sampled grating like that of fig4 is shown graphically in fig5 . if constructed properly , the chirped grating should provide a larger reflectivity bandwidth and potentially a higher peak reflectivity . of course , those skilled in the art will recognize that a variety of desired reflectivity profiles may be created by varying the minimum and maximum pitch parameters 26 , 28 , and the size of the grating superstructure 30 . moreover , while the pitch of the chirped grating sections changes linearly in the embodiment shown , it is not necessary that the change be linear . it is also possible to space the sections apart from one another if desired . those skilled in the art may vary the grating structure in other ways as well , and such variations are considered to be within the scope of the invention . in addition to the fiber - based techniques described above , it is possible to create the interleaver 14 of fig1 from a planar waveguide . as in the fiber grating embodiments , it is necessary to get the appropriate changes in refractive index along the waveguide region in order provide the desired reflectivity response . in the embodiment shown in fig6 the interleaver is made up of a cladding region 40 that surrounds a core region 42 through which the optical energy is transmitted . the core region 42 generally has a higher refractive index than the cladding 40 , and thereby provides the necessary total internal reflection condition in the core for the wavelength range of interest . typically , the cladding 40 is a material such as silicon dioxide ( sio 2 ), and the core is a material , such as sio 2 that has a dopant , such as germanium , added to raise its refractive index . this provides the refractive index boundary between the core 42 and the cladding 40 . to function as an interleaver , the planar waveguide in fig6 is provided with the desired reflectivity profile by selectively spaced regions of lower refractive index along a lateral section of the core . these regions provide a structure of regular refractive index boundaries that function like a diffraction grating , and which may be configured with the same periods as the fiber gratings described above in order to provide a similar reflectivity profile . in the embodiment of fig6 the low - refractive index regions 44 along the length of the core may be fabricated in a number of different ways . in the preferred embodiment , the interleaver is fabricated by a phase mask exposure during the fabrication of the core . after deposition of a lower portion of the cladding 40 , and the deposition of the core 42 on top of the lower cladding portion , a photoresist material may be applied to the core , and then developed using a phase masking procedure to form the desired core pattern . as is known in the prior art , wet or dry etching may then be used to remove selectively the undesired portions of the core material . subsequent deposition of the remainder of the cladding layer results in the lower refractive index cladding material settling within the etched regions between portions of the core 42 . those skilled in the art will recognize that fig6 is not to scale , and that typically there would be many more low - refractive index regions 44 to achieve the desired reflectivity profile . in another planar waveguide embodiment , shown in fig7 the desired grating effect is produced by depositing a higher refractive index material at selected locations along the already - deposited core . these “ loading ” sections 46 create disruptions in the index difference between the core and the cladding , providing a grating - like effect . when placed at equal separations along a section of the core 42 , a desired reflectivity profile can be created . such loading sections can be of any of a number of different high refractive index materials , such as germanium oxide ( geo ). their arrangement would be essentially the same as the arrangement of refractive index interruptions in the core in the foregoing embodiments . however , it is not necessary to etch the core to create the desired reflectivity profile . in fig7 the cladding material surrounding the core 42 is not shown , but those skilled in the art will recognize that such a layer would be provided and would surround both the core 42 and the loading sections 46 . moreover , as in previous figures , fig7 is not to scale , and there are likely to be many more high - index sections 46 to produce the desired reflectivity profile . yet another planar waveguide embodiment of the interleaver 14 is shown in fig8 . a core section 42 is surrounded by cladding material 40 . for exemplary purposes , only the cladding material above the core 42 is shown , but it will be understood that the cladding would also be below and on the sides of the core . however , the upper layer of cladding material is etched in selective locations down to the core itself so as to produce air gaps 48 that lie adjacent to the core . these air gaps are periodically situated , and the refractive index difference between the core and the air gaps is higher than the refractive index difference between the core and the cladding material 40 . thus , as in the fig7 embodiment , a grating - like effect is produced that may be used to create a desired reflectivity profile , just as the fiber grating embodiments above . with the appropriate spacing of the air gaps , a square wave profile emerges that may be used for interleaving with the demultiplexer embodiment of fig1 . as with the fiber embodiments , an interleaver having a reflectivity profile such as that shown in fig5 may be formed in this manner . in another variation of the embodiment of fig1 the optical circulator 16 may be omitted by using a diffraction grating in a free - space region . fig9 is a schematic view of such an arrangement . although this figure uses conventional depictions of discrete optical elements to demonstrate the design , preferably , these components would be fabricated in a planar waveguide material . for example , lenses such as those shown in fig9 may be readily fabricated using regions of high index . techniques for forming the other components are known in the art . the planar waveguide portion of this embodiment is designated in the figure by broken line 62 . in fig9 an input fiber 64 carries all of the wavelengths to be demultiplexed , and is coupled to an input waveguide 66 in a known manner . the light from the waveguide 66 is coupled to a lens 68 , which collimates the beam diverging from the waveguide 66 . this collimated beam is directed to an interleaver grating having the characteristics of the gratings discussed above . however , since the grating is slightly tilted with respect to a propagation direction of the beam , the wavelengths that are reflected ( e . g ., the “ even ” wavelengths ) are redirected by the lens 68 toward a first output waveguide 72 . this waveguide is , in turn , coupled to a first external output fiber 73 . the wavelengths that are transmitted through the interleaver 70 ( i . e ., the “ odd ” wavelengths ), are focused by lens 74 into a second output waveguide 76 . this waveguide is , in turn , coupled to the external output fiber 77 . those skilled in the art will recognize that there would be many more sections of the grating 70 than are actually shown in the figure . in a variation of the fig9 embodiment , the lens 68 can be omitted if the interleaver uses a curved grating structure instead of a flat one . shown in fig9 a is a schematic view of a curved grating 78 that replaces grating 70 . the grating , like those described above , is configured to provide the desired interleaver reflectivity profile . that is , the grating has a square wave response that reflects even wavelengths but not odd wavelengths . however , the angle and curvature of the grating 78 are such that the reflected wavelengths are focused into even wavelength waveguide 72 . the odd wavelengths are not reflected by the grating 78 , and are instead transmitted to lens 74 , and thereafter to the odd wavelength waveguide 76 . the grating preferably has an overall aspheric shape , and the pitch and spacing of the grating might , for example , be the same as previous embodiments . again , as in fig9 many more sections of the grating would be present than are actually shown . while the invention has been shown and described with reference to a preferred embodiment thereof , it will be understood by those skilled in the art that various changes in form and detail may be made herein without departing from the spirit and scope of the invention as defined by the appended claims . for example , the specific structural parameters for the interleavers described herein will vary depending on the particular conditions of the system in question , such as wavelengths , materials , etc . however , given the disclosures herein , those skilled in the art will be able to produce devices having the appropriate characteristics . | 6 |
fig1 outlines the rear structure of a motorcycle . a rear fender 6 , a rear cowling 9 and a seat 5 are mounted on a pair of back stays 1 and a pair of side rails 2 which form a frame body . a rear fork 3 is pivotally supported on a supporting mechanism 4 in a conventional manner . the rear fender 6 ( of resin ) is made up of a first rear fender piece 7 and a second rear fender piece 8 . the first rear fender piece 7 has a front curved part , both sides of which have locking pieces 7a , 7b , 7c and 7d which are engaged with the inside of the pair of back stays 1 . inverted - u - shaped engaging grooves 11 , each being made up of an inner wall 12 , an outer wall 14 and a groove bottom 16 are formed at both sides of the rear curved fender part 10 . a side wall 17 extends upwardly from the upper surface of each groove bottom 16 which forms the top of the engaging groove 11 , extends backwardly from the rear part of the engaging groove 11 together with parts of the inner wall 12 and the groove bottom 16 , and merges with a rear wall 19 . the rear wall 19 merges with the two side walls 17 on both sides and the rear curved fender portion 10 at the lower end thereof . ( cf . fig2 through fig5 ) two pair of protruding guide claws or looking or engaging pieces 18a and 18b of channel - shape in section are provided on the front part of the outer wall surface of the pair of side walls 17 in a staggered manner . the channel - shaped bottom wall surfaces of the guide claws 18a and 18b form a locking guide path or restricted groove for the rear cowling 9 ( described later in detail ). the front edges of the guide claws are included in one and the same plane which is inclined at a predetermined angle forwardly from the side of the rear wall 19 with respect to the side wall 17 and which opens and is inclined at a predetermined angle downwardly from above the side wall 17 . accordingly , the front guide claws 18a project outwardly farther than the rear guide claws 18b . ( cf . fig2 and 11 ) the outer wall 14 and the inner wall 12 of each engaging groove 11 have respective locking holes 15 and 13 at predetermined positions in the corresponding locking end portion of each side wall 17 of the fender piece 7 , and these holes are used for securing the first rear fender and the second rear fender piece 7 to the side rail 2 . on the other hand , fixing brackets 20 extend upwardly from both edges of the upper part of the second rear fender piece 8 . each fixing bracket 20 is made up of a first riser part 21 and a spacer piece 22 which is partly in the form of a block 23 . the riser part has locking holes 24 and 25 which mate with the locking holes 15 and 13 , respectively , in the locking end portion of the corresponding side wall 17 of fender piece 7 , ( cf . fig6 and 10 ). the rear fender piece 7 is engaged , from inside , with the pair of back stays 1 and the side rails 2 by means of the locking pieces 7a , 7b , 7c and 7d . under the condition that the fixing brackets 20 of the second rear fender 8 piece are inserted into the engaging grooves 11 and the locking holes 15 of the outer walls 14 are aligned with the locking holes 24 while the locking holes 13 of the inner wall are aligned with the locking holes 25 , the rear fender pieces 7 and 8 are secured to the inside of the pair of side rails 2 by , for example , corresponding bolts 15a and 13a ( cf . fig1 and fig1 ). the rear cowling 9 ( fig8 and 9 ) is fundamentally u - shaped . the configuration of the rear cowling 9 is such that the part thereof at a predetermined distance from the u - shaped open ends is bent in one direction . the side view of the rear cowling 9 is in the form of a sleigh . a pair of slide pieces 28 or engaging ribs extend from the sides of the sleigh - shaped side walls 27 . fixing brackets 29 having u - shaped slots extend inwardly from the open ends . a pair of side walls 26 of the rear cowling 9 are polygonal in section as indicated at 30 . a tail light 31 is secured to the rear wall 19 of the first rear fender piece 7 with screws . the embodiment shown in fig1 through 11 is constructed as described above , and it is assembled as follows : the first rear fender piece 7 is engaged , from the inside , with the pair of back stays 1 and the side rails 2 with the aid of the locking pieces 7a , 7b , 7c and 7d . the fixing brackets 20 of the second rear fender piece 8 are inserted into the engaging grooves 11 . the locking hole 15 of the outer wall 14 is aligned with the locking hole 24 , and the locking hole 13 of the inner wall 12 is aligned with the locking hole 25 . under this condition , the first rear fender piece 7 is fixedly secured to the inside of each side rail 2 with bolts and nuts as previously described ( cf . fig1 and 10 ). the rear cowling 9 can be positively positioned according to the following method : with the closing type ( or detachable type ) seat 5 opened , the rear cowling 9 is fitted from above in such a manner that it holds the two side walls 17 of the first rear fender piece 7 . then , the slide piece 28 is engaged with the guide claws 18a and 18b which protrude in a staggered manner on the side wall 17 . the pair of fixing brackets 29 are secured with screws to brackets la which protrude from the back stays 1 at predetermined positions . thus , the rear cowling 9 is positively positioned . thereafter , the seat 5 is fixedly set on the side rails 2 , and the assembling operation is completed . in the above - described embodiment , the slide pieces 28 or engaging ribs of the rear cowling 9 are fixedly secured between the guide claws or engaging or locking pieces 18a and 18b which protrude from the two side walls 17 of the first rear fender piece 7 . therefore , the rear cowling can be readily mounted and can be positioned with high accuracy , which remarkably improves production efficiency . furthermore , in the above - described embodiment , the guide claws 18a and 18b for mounting the rear cowling are integrally molded with the first rear fender piece 7 , and therefore the number of components is reduced by as much , which results in high productivity . also , the rear wall 19 for mounting the tail light 31 is also molded integrally with the first rear fender piece 7 . therefore , the mounting accuracy of the tail light 31 is improved . the positional relation between the tail light and the rear cowling 9 or the second rear fender 8 is accurate , with the result that the external appearanoe is improved , and the weight of the vehicle body is decreased . as the tail light 31 can be secured to the rear fender 7 before the latter piece 7 is secured to the vehicle body , productivity is improved . the dead space which is formed by the two side walls 17 of the first rear fender piece 7 , the rear curved fender part 10 and the rear cowling 9 is utilized as a compartment c for accommodating articles , such as the storage of tools or the like , and is accessed by lifting the seat . in the above - described embodiment , the two side walls 17 having the guide claws or engaging pieces 18a and 18b and the rear wall 19 , for mounting the tail light , are provided on the first rear fender piece 7 ; however , substantially the same effect can be obtained by providing those components on the second rear fender piece 8 . as is apparent from the above description , in the rear fender of a motorcycle which is made up of two fender pieces , the pair of side walls and the rear wall for mounting the tail light are extended integrally from the locking end portions of one of the two fender pieces , and a storage compartment is formed by shielding the upper part with the rear cowling . accordingly , the number of components is relatively small , production efficiency is improved , the weight of the vehicle body is decreased , and the dead space is effectively utilized . according to the invention , in a motorcycle or the like , the locking or engaging pieces ( guide claw 18a and 18b ) integral with the side walls of the rear fender made of resin are engaged with the engaging ribs ( slide pieces 28 ) integral with the inner wall of the rear cowling , so that the rear cowling is fixedly secured to the vehicle body . therefore , the rear cowling can be readily mounted and positioned with high accuracy , which improves production efficiency . as the rear cowling mounting locking pieces ( namely , the guide claws in the embodiment ) and the rear fender are molded as one unit , the number of necessary components is reduced , which again contributes to an improvement in productivity . | 1 |
the invention will now be further discussed with reference to the figures . fig1 provides a flow chart which generally outlines the four basic steps in killing microorganisms on the surface of meat products . as shown in fig1 the first step involves exposing the meat product to a vacuum . the second step involves flushing the meat surface with a treatment gas . the third step involves treating the meat with the treatment gas . the fourth step involves exposing the meat again to a vacuum . in accordance with this invention , the treating substance applied is a gas , such as steam , ozone , hydrogen peroxide or propylene oxide . use of such gases avoids the difficulties concerning penetration into surface irregularities to effect microbial kill : due to their size , these gases can enter any cavity large enough to contain a bacterium . other gases displaying similar properties may be used . to this end , it is noted that salmonellae are short , straight rods , about 0 . 7 × 10 - 6 m . in thickness and 4 × 10 - 6 m long . simple gas molecules are typically 2 × 10 - 10 m . in diameter ; hence 10 , 000 times smaller than a bacterium . gas condensation velocity is reduced only in cavities of diameter shorter than the mean free path of the gas . as a preferred condition for this invention , the mean free path of the gas is 0 . 3 × 10 - 6 m . during treatment . this is about half the diameter of the smallest cavity capable of containing a salmonella . from this , it can be anticipated that the gases can quickly reach all toxic surface microorganisms . it is true that the vapor pressure within small wetted cavities is reduced by surface tension . however , in a cavity large enough for a salmonella , this effect is negligible . although ordinary steam , for example , may reach and kill each surface bacterium , it may not do so before the sub - surface of the meat has received a cooking heat dose . to accomplish surface treatment without interior involvement , the gas must reach the surface very rapidly . gas approaches a surface in one or the other of two possible modes : streaming or diffusion . of these , streaming is very rapid and is motivated by pressure gradient . the other mode , diffusion , is much slower and is motivated by the concentration gradient of the gas through other gases . during gas treatment , air , or any other non - condensible gas present , would concentrate near the treated surface as a result of being pushed up to this surface by the in rush of condensing steam , or reacting gas . this air would quickly form a layer near the surface . additional gas must then diffuse through this layer ; since it cannot stream through it . the time taken for a killing dose of gas to reach the target organisms is therefore strongly dependent on the quantity of non - condensible gases which may be between the treating gas and the target . these interfering non - condensible gases can arise from three sources : those which had been around the meat in its treatment chamber , those which had been present in the treatment gas , and those which had been desorbed from the meat or other surfaces . the present invention is directed at reducing each of these three sources of intervening non - condensibles . the air around the meat before treatment is reduced by first exposing the meat to a vacuum , preferably 0 . 5 psia , or less . see fig2 b . to achieve this practically , it is necessary to enclose the meat as tightly as possible in a chamber . this chamber is then opened to a much larger vacuum receiver which is kept at the lowest workable absolute pressure . to further reduce the air around the meat , it is necessary to flush the meat in its evacuated treatment chamber with air - free gas . for steam , this must be done at a pressure below that which could produce a cooked effect if prolonged . to do this conveniently , one form of the present invention proposes to move the treatment chamber from the vacuum receiver opening to the gas treatment opening , through an arc at the midpoint of which the chamber is slightly open to both the vacuum and gas supply simultaneously . this is shown in fig2 c . furthermore , the chamber is so shaped as to promote good circulation of the flushing gas around the meat during this stage of the operation . the meat , though closely fitting the chamber , should be loose enough therein to permit good gas flow on all sides . preferably , the chamber moves in such a way , relative to gravity , and at such an angular acceleration , that the chamber walls do not continuously obscure any one part of the meat surface from the gas . for steam treatment , entrained air is minimized by using only steam from well boiled water . such steam can be obtained from a reboiler . any process steam can be condensed within the tubes of the reboiler , the shell of which is supplied with air - free water . of course , the same result can be achieved more simply by boiling normal water for an adequate time in the reboiler , discarding the steam so generated , before directing the steam , now air - free , into the surface treatment device . similarly , for every treatment gas , specific chemical or physical methods are available to insure removal of air , water , or other impurities . in every case , the gas supply should be connected to the device with the shortest and widest possible ducting . this is particularly necessary for steam treatment in order to avoid superheat . superheated steam can condense only after it has been cooled to saturation temperature . such cooling is much slower than condensing . hence , the present invention avoids superheat . likewise , entrained liquid water , though less damaging , should be removed from the flowing steam by , for example , an impingement / centrifugal separator . to reduce gas evolution from the meat , any water wash used on the meat prior to surface pasteurization , or at least the final such wash , should be gas free water , not water containing dissolved gas , such as air or chlorine . the gases desorbed from the meat can be minimized further by exposing the meat first to vacuum , and then to a gas flush . in the case of steam , the flush slightly heats the meat surface . most of the gases desorbed from the meat leave at first heating ; hence they leave with the flush , only after the flush , should the meat be exposed to the pasteurizing treatment itself . to reduce further the gases evolved from the meat during pasteurization , heating the meat must be minimized by very short treatment duration , through the methods herein described . this is consonant with the objective of the invention to avoid a deep cooked appearance of the meat . in these ways , the interference by non - condensible gas can be very much reduced . the essence of the process is precise control of the treatment dose . therefore , after treatment , the treating agent must be removed nearly as rapidly as it had been applied . this is accomplished by exposing the chamber after treatment to the same vacuum used to evacuate the chamber prior to treatment . in the case of steam treatment , this has the effect of cooling the meat surface back down nearly to the temperature at which it began the treatment . this is an inevitable consequence of re - evaporating all the water formed on the meat surface by the condensing treatment steam . in this way , nearly the same quantity of heat is removed as has been added . furthermore , in the absence of much condensate run down , the heat is removed from precisely the same regions on the meat to which the heat had previously been added . the result is that the surface has been uniformly heated , and then the same surface has been uniformly cooled nearly to its original temperature ; all within a short time , without much heat reaching the interior of the meat . in the case of a treatment gas other than steam , the reaction at the surface can be abruptly ended by evacuation , as proposed for steam ; just as streaming has been shown essential to rapid treatment onset ; so it is almost equally important to rapid treatment termination . the reason is the same ; the departing gas molecules , like the arriving molecules , must not be forced to diffuse slowly through a stagnant gas layer . roughly the same reactions are needed to kill bacteria by heat as are needed to cook the meat . these are the inactivation of the enzyme proteins in bacteria versus the denaturation of the muscle proteins in the meat . inactivation and denaturation consist of irreversibly cross - linking the proteins &# 39 ; constituent amino acids in new and disorderly ways so that the exquisite molecular configurations necessary for functionality are lost . however , the inactivation of the most sensitive vital enzyme is enough to kill the organism , typically the heat of activation for such inactivation reaction is 2 - 12 kcal / g - mol . on the other hand , to denature the muscle protein to give a cooked appearance , much of the entire protein mass near the surface must be affected . typically , the heat of activation for such a reaction is 50 - 100 k cal / g mole . hence about twelve times as much heat must be absorbed by one mole muscle protein , compared to one mole of bacterial enzyme for killing and cooking to be equally complete . only micrograms of enzyme need be inactivated for killing , contrasted with grams of muscle which need to be denatured for cooking . so , if the heating rates of meat and microorganisms were equal , the bacteria would die earlier than the meat would cook . for a square centimeter of surface heavily contaminated with one hundred bacteria , fifteen million times as much heat is needed to cook the surface to a depth equal to the length of a bacterium ; compared to the heat needed to kill all the bacteria themselves . furthermore , the bacteria in question are exposed on the surface ; whereas much of the muscle which must be denatured for cooked appearance lies slightly below the wet meat surface . the rate of heating below the surface is proportional to the heat conductivity of the meat . the more rapid convective heat transfer cannot occur because of the cellular nature of the meat . heat conduction in the body of the meat is thus very much slower than surface heating by steam condensation . the same reasoning applies to the pasteurizing gases which rely on chemical disruption of the microbial enzyme . they too , must arrive abruptly , treat quickly , and depart rapidly , in order to prevent changes in the meat itself . using these stratagems , the present inventor has found that meat can be so rapidly exposed to a gaseous pasteurizing agent that no deep changes occur in the meat , yet the meat is adequately surface pasteurized . in fig2 clearances between stator and rotor 10 are exaggerated for clarity . with reference to fig3 , 5 and 6 , one device that may be used in accord with the present invention is comprised of a stator containing a cylindrical rotor 10 . means are provided to turn the rotor 10 very rapidly around its horizontal axis to precisely determined angular positions . in this description , the motion of rotor 10 may be spoken of as intermittent . in actual practice , the rotor 10 may turn in a steady motion . within the rotor 10 , there are one or more treatment chambers 12 , have radial sides and round bottoms . the rotor 10 may be fitted with interior channels for cooling water flow . a small duct at the bottom of the chamber ( s ) can be connected through the rotor shaft to vacuum or , alternatively , to filtered room air . this duct would open only when the chamber 12 is at the removal / insertion position . the desired volume of the chamber determines the diameter of the rotor . for a double treatment stator , for example , with a chamber volume of one gallon ( adequate for a whole broiler chicken ), the rotor must be 10 inches in diameter , 12 inches long . a single treatment stator is provided with one opening to air , two to vacuum , and one to treating gas . see fig2 a - 2e . these are arranged around the stator so that the net pressure forces acting on the rotor 10 are balanced as nearly as possible . the connections to vacuum and to gas are such that no part of the connections are of smaller cross - sectional area than that of the rotor chamber 12 , and are each as short as possible . the positions around the stator , in terms of the function of each are : removal / insertion ( open to air ), closed , vacuum , flush ( slightly open to both vacuum and gas ), gas treatment , closed , vacuum , closed , and removal / insertion again . see fig2 a - 2e . a double treatment stator consists of removal / insertion , closed , vacuum , flush , gas treatment , closed , vacuum , closed , gas treat , closed , vacuum , closed , and back to removal / insertion . in this version , the two exposures to gas should be located on opposite sides of the stator so that gravity is reversed within the rotor chamber between treatments . the rotor 10 fits inside the stator so that there is minimal leakage across the segments called closed , except as described below under the heading &# 34 ; steam flush &# 34 ;. this separation function may optionally be achieved by a separate assembly of sealing bearings attached to the stator . fig7 , 9 and 10 illustrate specific configuration and structural details of an embodiment of an apparatus designed in accordance with the present invention . besides fresh meat , various other solids may advantageously be surface treated in accordance with the present invention . separation membranes , for example , may be treated to yield good separations at high permeation rates . or temperature and moisture sensitive materials , such as wax paper , can be sterilized . in different embodiments , the word meat can be defined to include other materials needing surface treatment ; and the word steam can be defined to include other treatment gases . meat entering the pasteurizer should be free of puncture wounds . of course , the pieces should also fit the treatment chamber fairly closely . unless spacers are used , the meat must have just enough room to move slightly within the chamber as the chamber is accelerated around its orbit . this is intended to expose all surfaces of the meat during treatment . with reference to fig2 a , 5 and 6 , meat is first inserted into the chamber 12 through stator opening 44 . at the insertion rotor position , after ejection of the previously treated pieces , a piece of film , such as saran , is applied to the stator opening 44 . this film is drawn as a liner into the chamber by applying a vacuum to a bottom duct 3 . the piece of meat is then inserted into the lined chamber . the meat must be restrained within the chamber 12 so that it does not emerge from the chamber 12 or touch the stator until the rotor 10 reaches the removal position . with reference to fig2 a - 2e , 5 and 6 , the chamber 12 then rotates through an angle sufficient to end its exposure to the insertion atmosphere . as shown in fig2 b , it then rotates through an angle so that it is open to the path leading to the vacuum receiver . it remains open to vacuum long enough for the air content of the chamber 12 to be reduced nearly to the vacuum pressure . this time can be calculated by assuming the gas flows at sonic velocity through the stator opening at the vacuum pressure . since the pressure reduction will immediately start to cool the meat , the rotor 10 must stay in this position no longer than necessary . the preferred vacuum is about 0 . 5 psia which is the pressure of the saturated pure steam at 80 ° f . with reference to fig2 c , 5 and 6 , the chamber 12 then rotates through an angle such that the chamber bridges the closure between the vacuum opening and the steam opening on the stator . this position is calculated to provide open gaps to both vacuum and steam about one millimeter wide . a round bottom of the chamber 12 causes the flush to circulate completely around the meat , and back out into the vacuum . this steam flush entering the vacuum receiver could place a heavy burden on the vacuum steam . therefore a condensing subsystem may be inserted into the receiver , the subsystem may be a spray of cold water , or a coil inside of which cold water circulates . if the spray is used , the combined condensate and cooling water can either be pumped out to room pressure ; or they can flow down through a vertical atmospheric leg to a hot well . if a cooling coil is used , the condensate dripping off its surface can be pumped out of the receiver / condenser . the treatment chamber 12 does not produce more than 0 . 3 psi momentary pressure rise within the receiver , assuming that the condenser accommodates the flush . with reference to fig2 d , 5 and 6 , the chamber 12 then rotates through an angle such that it is closed to the vacuum , and open to the steam reservoir , in which very pure saturated steam is maintained . this steam is generated in the reservoir by prolonged boiling of a pool of pure water within the reservoir , by means of heat transferred to the pool from a submerged electric or steam heater controlled by pool temperature . the reservoir / reboiler steam pressure is better controlled by a valve in a line from the steam source to the vacuum condenser when the treatment temperature is below 212 ° f . with reference to fig2 e , 5 and 6 , the chamber 12 then rotates through an angle such that the opening of the steam reservoir / reboiler is closed , it then rotates through an angle such that it is open again to the vacuum receiver / condenser . this allows the steam treatment to be ended abruptly ; and for very rapid evaporative cooling to take place . for a vacuum maintained at 0 . 5 psia , the surface cooling will proceed nearly to 80 ° f ., at which point all the condensate added to the meat in the pasteurizing step has been removed . to maximize the efficacy of the treatment in certain situations , it may be preferable to repeat the steam treatment after the first cooling . the complete cycle of evacuating , flushing , pasteurizing , and cooling may repeated as often as necessary . if meat pieces are treated several times and at varying angular positions , it is more unlikely that any individual area of the meat surface will be left untreated . for example , it is noted that while bacterial contamination occurring during meat processing is nearly always limited to the meat surface . if the surface of the meat is broken or otherwise punctured during slaughter , surface - residing microorganism can be displaced internally into the meat beneath the immediate surface area . such surface breakage and punctures normally do not occur when slaughtering and processing is conducted with care . whenever such surface lesions do occur , the present invention should be carried out more slowly , carefully , and repeatedly , to insure that any displaced sub - surface microorganisms are treated and killed . at the end of the previous cycle , after final vacuum and closed steps , the chamber is rotated through an angle such that it is returned to the initial &# 34 ; insertion &# 34 ; position shown in fig2 a . over the opening is stretched another piece of sterile film , such as gamma ray sterilized saran , or the like . the air pressure pushes the film into the chamber on top of the meat piece , forming a cover wrap for the meat piece which has just been treated . air then flows through the bottom duct of the chamber , ejecting the liner and the treated and , now , fully wrapped piece . the chamber is now ready for a new cycle . thirty grams of fresh broiler chicken boneless breast meat was cut to fit the treatment chamber of fig2 this meat had a pink , partly translucent appearance , typical of raw white poultry meat . the meat sample was painted with a suspension of listeria innocua , a harmless corynebacterium resembling salmonella typhii in size , shape , and thermal resistance . the suspension was analyzed and found to contain 10 , 000 ( 10 4 ) living microorganisms per gram . the contaminated piece was inserted into the device shown in fig2 and then exposed to the process shown in fig1 . the conditions were the following : ______________________________________step duration conditions______________________________________vacuum 1 . 0 second 00 . 3 psiaflush 0 . 3 secondtreat 1 . 0 second 30 . 0 psia ( steam ) vacuum 1 . 0 second 00 . 3 psia______________________________________ the meat sample was removed after treatment and examined . it was found to be about 40 ° c . and showed no whitened flat surfaces typical of cooked meat . it did show whitened fine protrusions and sharp edges . a sterile peptone water solution was used to wash the treated sample . an untreated control was likewise washed with the same solution . the peptone - water rinse from each sample was saved , then plated onto triptose agar , and subsequently counted . the untreated control contained 10 . sup . 4 colonies , whereas the treated sample revealed only 10 . sup . 0 colonies . again , as in example 1 , thirty grams of broiler chicken meat was cut to fit the treatment chamber . again , the sample was painted with a suspension of listeria innoccuans . the operating conditions were as follows : ______________________________________step duration conditions______________________________________vacuum 1 . 0 second 00 . 3 psiaflush 0 . 2 secondtreat 0 . 3 second 40 . 0 psia ( steam ) vacuum 1 . 0 second 00 . 3 psia______________________________________ after treatment , unlike example 1 , the meat sample was found without any areas having a cooked , whitish appearance . the treated and untreated controls were washed with a sterile peptone solution and the rinses plates . again , 10 4 colonies were counted in the untreated samples , whereas 10 0 colonies were counted in the treated samples . it is to be understood that the present invention is not limited to the embodiments described above , but encompasses any and all embodiments within the scope of the following claims . | 0 |
referring now to the drawings , wherein like reference numerals refer to like parts , fig1 illustrates one embodiment of the present invention wherein users of a data network such as the internet can “ log on ” to a web site and monitor one or more remote locations in exchange for value . as shown in fig1 , a central server 200 is coupled to a plurality of remote location sensor devices 100 a - c and a plurality of user devices 300 a - c . central server 200 may be a high bandwidth web server of the type commonly operated by internet service providers . user devices 300 a - c may be personal computers and / or televisions coupled to the internet ( e . g ., webtv ). location sensor devices 100 a - c may comprise digital / analog video cameras , digital / analog audio microphones , motion detectors , pressure sensors , thermal sensors , laser and / or light sensors , radar , sonar and other sensing devices well known to those skilled in the art . it is to be understood that any number of user devices and sensor devices may be coupled to the central server 200 . in one embodiment of the present invention , the central server 200 may be operated and maintained by an internet service provider ( isp ), such as america online ™. the isp receives payment from entities ( e . g ., banks , retail stores , private home owners , etc .) desiring their locations to be monitored by one or more of the isp &# 39 ; s users . for example , fleet bank may offer to pay the isp $ 6 . 00 per hour to have a user monitor a fleet branch remotely over the internet . the isp in turn advertises this opportunity to its users at the stated rate ( i . e ., $ 6 . 00 per hour ) less a service fee ( e . g ., 25 % of the quoted rate of $ 6 . 00 per hour ). after a user has logged on and completed the remote monitoring task , the isp bills fleet bank at the stated rate and pays or credits the user for their time at the stated rate less the service fee . to monitor remote locations for value , users initially register with the central server 200 and receive a user identifier . after registering , users can simply present their user identifier to central server 200 when logging on for assignment of a remote monitoring task . remote monitoring tasks include a task identifier and a shift ( e . g ., a date and / or a time period ). central server 200 assigns the remote monitoring task taking into account predetermined rules specified by the location owner , such as a predetermined number of users required to monitor the remote location simultaneously and / or a minimum user rating . in accordance with one aspect of the present invention , users are rated based on their attentiveness during monitoring sessions , as will be discussed in detail hereinafter in connection with fig8 . in addition , a number of precautions are preferably taken by central server 200 to maintain anonymity of the location being monitored . anonymity is typically advantageous since the present invention allows individuals who are not guaranteed to be trustworthy to monitor private property over a public network . these precautions are discussed in detail hereinafter in connection with fig8 and include preventing the user from monitoring a location that is within a predetermined distance of the user &# 39 ; s home address . at a minimum , the identity of the physical location assigned for monitoring is not revealed to the user . in the prior art remote video surveillance systems discussed above , anonymity was not important , or even practical , because those systems were designed for private usage . at the start of the shift , central server 200 , enables communication between the location sensor devices 100 a - c and the user devices 300 a - c . as previously indicated , a location may be monitored by a plurality of users simultaneously . during the shift , central server 200 takes steps to measure , encourage and / or enforce user attentiveness , as will be discussed in detail hereinafter in connection with fig8 . one method of measuring user attentiveness includes transmitting test communications to the user device and receiving responses to the test communications within a predetermined period of time . if a predetermined number of responses to test communications are not received within the time specified , the user &# 39 ; s rating is lowered and communication between the location sensor device ( s ) and the user device may consequently be disabled . in addition to lowering the user &# 39 ; s rating , the user can be further penalized as discussed in detail hereinafter in connection with fig8 , including preventing future monitoring by the user . however , if communication between the user device and the remote sensor device ( s ) has not been disabled due to inattentiveness , at the end of the shift , central server 200 credits value to the user &# 39 ; s account for performing the monitoring task as will be discussed in detail hereinafter . at the time a user is assigned the remote monitoring task , he is also provided with emergency procedures to be followed in the event that the user detects an emergency at the remote location during his shift . if a signal is received by the user device from the central server 200 and the user interprets that signal to indicate an emergency at the remote location , central server 200 will determine whether the reported emergency is legitimate in the manner discussed in detail hereinafter in connection with fig8 . if legitimate , central server 200 will transmit an output request to an emergency dispatch service corresponding to the sensor location . alternatively , the emergency procedure provided to the user includes the phone number of the emergency dispatch service ( i . e ., a service geographically corresponding to the remote location ) and thus , upon detection of an emergency , the user can contact the emergency dispatch service himself . fig2 depicts a block diagram of an exemplary central server 200 maintained and operated , e . g ., by an internet service provider . the central server 200 performs all the operations of a conventional server maintained and operated by an internet service provider and performs additional operations in accordance with the present invention . the central server 200 includes a cpu 205 coupled to a rom 210 , ram 215 and system clock 207 . the cpu 205 is also coupled to the location sensor devices 100 a - c and the user devices 300 a - c via a communications port 220 . as shown in fig2 , the cpu 205 is also coupled to a data storage device 225 . of course , cpu 205 may comprise a plurality of processors working in conjunction . data storage device 225 includes a variety of databases including a user database 230 , a task database 240 , a session status database 245 , and a user performance testing rules database 250 . the user database 230 of data storage device 225 contains user information . the task database 240 contains information concerning remote monitoring tasks . the session status database 245 contains information concerning the status of remote monitoring tasks . the user performance testing rules database 250 contains testing rules for remote monitoring tasks . each of these databases will be discussed in detail hereinafter in conjunction with fig4 - 7 . storage device 225 further includes a monitoring session program 260 executed by cpu 205 to manage remote monitoring tasks in accordance with the present invention . the monitoring session program 260 will be discussed in detail hereinafter in connection with fig8 and 9 . fig3 is a block diagram illustrating an exemplary user device 300 . in one embodiment , the user device can be a personal computer , which includes a cpu 305 coupled to rom 310 , ram 315 and system clock 320 . the cpu 305 is coupled to a variety of input devices 325 and output devices 330 . the input devices 325 may include one or more of the following : a mouse , a keyboard , a monitor with “ touch screen ” capability , and a microphone . the output devices 330 may include , for example , a monitor and / or a speaker . the device 300 also includes a communications port 335 for accessing a data network 340 such as the internet . fig4 illustrates an exemplary user database 230 , which records information concerning users who have registered to log on to the central server of the present invention to monitor remote locations in exchange for value . as previously indicated , when a user first requests to monitor a remote location , a record for the user is established in the user database 230 . for each record , the user database 230 includes a user identifier field 410 , a user rating field 420 , and an account balance field 430 . the user identifier field 410 of user database 230 contains a user identifier such as a password , a pin number , a credit card number , or a telephone number provided by the user , or some other identifier assigned to the user by the central server 200 . the user rating field 420 contains a user rating generated by central server 200 based on the user &# 39 ; s past performance during remote monitoring sessions . lastly , account balance field 430 is a running account ( e . g ., a financial account ) of the value credited to the user in exchange for performing remote monitoring tasks . fig5 illustrates an exemplary task database 240 which preferably stores specific information for each remote monitoring task . when a location owner instructs the operator of server 200 ( e . g ., an isp ) to have its location monitored remotely by one of the isp &# 39 ; s users , a record for the remote monitoring task is established in the task database 240 in accordance with information provided to the isp by the location owner . for each record , the task database includes a task identifier in field 505 ( assigned by the isp ), the geographic location of the remote sensor in field 510 ( e . g ., fleet bank , hamden , conn . branch ), the electronic address of the remote sensor in field 515 ( e . g ., www . fleetbank . com / branch3 / cam1 ), and the owner of the location in field 520 ( e . g . fleet corporation , hartford , conn .). each record also includes the pay rate associated with monitoring the location in field 525 , any rules that must be satisfied prior to monitoring the location in field 530 ( e . g ., more than 3 users ), the shift ( s ) during which the location is to be remotely monitored in field 535 and the emergency procedures to be followed in the event that the user detects an emergency condition at the remote location in field 540 ( e . g ., click the emergency button on the isp frame ). lastly , each record also contains an indication in field 545 of the availability of the remote monitoring task ( i . e ., whether or not user ( s ) are still needed to perform the task ). fig6 illustrates an exemplary session status database 245 , which maintains status information for each shift of a remote monitoring task . for each task and shift identified by the task identifier in field 605 and shift in field 610 , the session status database 245 includes the user identifier ( s ) in field 615 ( as indicated above , more than one user may monitor the same location ), the status of the shift in field 620 , and the performance results of the user ( s ) in responding to test communications in field 625 . as shown in fig6 , if the shift of the remote monitoring task has not yet commenced , the entries in fields 620 (“ status ”) and 625 (“ performance results ”) will contain the indication “ not available ” (“ n / a ”). fig7 illustrates an exemplary user performance testing rules database 250 . the user performance testing rules database 250 includes a plurality of records each associated with the user testing rules for a particular task . each record includes fields for a task identifier in field 705 , a test communication in field 710 , test communication intervals in field 715 , the required response time in field 720 , and the required response in field 725 . the test communication field 710 in database 250 contains the test communication to be transmitted to the user during the remote monitoring task ( e . g ., staged emergencies , questions , etc .). field 715 contains the frequency at which the test communication is to be transmitted to the user ( e . g ., random , periodic , etc .). field 720 contains the time in which the user is required to respond to the test communication ( e . g ., 10 seconds ). lastly , field 725 contains the required user response to the test communication ( e . g ., click 911 button ). fig8 a and 8b are flow - charts illustrating an exemplary process of the monitoring session program 260 executed by central server 200 . users preferably “ register ” with the operator of the central server 200 to perform remote monitoring tasks . registration may take place on - line , by phone , by mail , or in - person . at the time of registration , central server 200 assigns the user a user identifier ( if one is not supplied by the user ) and then creates a record for the user in user database 230 ( if one has not already been created ). as shown in fig4 , the record will contain the user identifier in field 410 . however , the user rating in field 420 will contain a “ not available ” entry or the like and the account balance in field 430 will be “$ 0 . 00 ” if the user has not yet performed a remote monitoring task . if registration occurs on - line , the user may either remain on - line for assignment of a remote monitoring task , or log off and then log back on at a later time to request an assignment . turning to fig8 a , in step 800 , central server 200 receives a request from a user of the data network to monitor a remote location . the request may include the user identifier previously assigned to the user . in step 805 , the central server 200 accesses task database 240 and identifies a remote monitoring task for assignment to the user . this includes determining an appropriate task identifier ( e . g ., “ 12345 ”) and shift ( e . g ., 1 / 1 / 98 and / or 12 : 00 am - 3 : 00 am ). in an alternate embodiment , the user is not assigned a shift . rather , the user can log on for assignment of a remote monitoring task at any time and end the remote monitoring session ( i . e ., log off ) at any time . as a precondition to logging off without negatively impacting the user &# 39 ; s rating , sever 200 may require that an alternate user be available to continue monitoring the remote location . ( as discussed in detail below , the present invention can notify a back - up user to replace an original user .) the process of identifying a remote monitoring task may take into account the predetermined rules in field 530 of task database 240 specified by the location owner ( e . g ., a minimum user rating required for a user to be assigned a particular location ). the process may also take into account user - specified preferences concerning the assigned shift . in addition , the process preferably includes taking precautions to maintain anonymity of the location being monitored . without such precautions , an unscrupulous user knowing the location &# 39 ; s identity could study the location &# 39 ; s characteristics , such as its traffic patterns , to plan a crime . for example , central server 200 may prevent the user from monitoring a location that is within a predetermined distance from the user &# 39 ; s physical location ( as determined by reference to zip codes or modern navigation methods such as gps ). alternatively , central server 200 may prevent the user from monitoring the location more than a predetermined total number of times , or from monitoring the location during a predetermined time of day if the user has previously monitored the location a predetermined number of times during that time of day . in yet another embodiment , central server 200 may randomly change the user &# 39 ; s assigned location during the user &# 39 ; s shift . in summary , it is desirable that central server 200 not provide the user with the identity of the remote location to be monitored and take affirmative steps to prevent the user from ascertaining the identity of the location . once a task identifier and shift has been assigned to the user , central server 200 communicates them to the user together with the emergency procedure specified in field 540 of task database 240 for reporting emergencies at the remote location . in step 810 , the central server 200 establishes a record for the user in session status database 245 . rather than creating a new record for the user , the user identifier may be added to a previously established record . for example , a location may be monitored by a plurality of users and at least one user of the plurality of users may have already been assigned the location and thus a corresponding record may have already been established in session status database 245 . the record in session status database 245 includes the task identifier in field 605 , the shift in field 610 and the user identifier in field 615 . the status in field 620 and the performance results in field 625 may contain a “ not available ” entry or the like , until commencement of the remote monitoring session . it is to be understood that often it may be impractical for the user to remain in communication with central server 200 until the start time of the shift ( e . g ., the user may be logged on in the early morning and the assigned shift does not begin until mid - afternoon ) in such instances , the user may log off after receiving the task identifier and shift , and then log on to central server 200 at a time closer to the start of the shift . when logging back on , the user preferably provides the user identifier , task identifier and shift to assist central server 200 in identifying which remote monitoring task in session status database 245 the user is logging on to perform ( e . g ., the user may be assigned more than one remote monitoring task ). central server 200 may also transmit a reminder to the user via e - mail or telephonically ( i . e ., a voice call ) prior to the start of the shift . at a predetermined period of time prior to the start of the shift , central server 200 in step 815 determines whether the rules in field 530 of task database 240 corresponding to the task identifier and shift assigned to the user have been satisfied . for example , the rules may require a minimum number of users ( and / or users of a particular rating ) for the remote monitoring task to commence . moreover , the number of assigned users and / or the user ratings of those users may have changed since the user was initially assigned the task identifier and shift requiring a re - evaluation in light of the rules in field 530 of database 240 . if the rules in field 530 have been satisfied then in step 820 central server 200 uses the sensor address in field 515 of task database 240 to enable communication between the location sensor device ( s ) and the user device at the start of the shift . central server 200 also updates the status in field 620 of the appropriate record in session status database 245 from “ not available ” to “ in progress ”. it is to be understood that the communication between the location sensor devices and the user devices can be video - based and / or audio - based . if only audio - based , a “ speakerphone ” setting on the user device is used to monitor sounds at the remote location . as previously described , a location may be monitored in accordance with the present invention by a plurality of users simultaneously . in such instances , the present invention can deter “ bystander inaction syndrome ”. bystander inaction syndrome is a sociological behavioral pattern that emerges when several people simultaneously witness an emergency , but each person assumes that someone else will notify the authorities . the present invention prevents this behavioral pattern in several ways . in one embodiment , central server 200 simply does not inform the user that anyone else is monitoring the location . in another embodiment , central server 200 informs the user that he is the only user monitoring the remote location . in either case , the user is instilled with the belief that if he does not report the emergency , it will not be reported at all . in an alternate embodiment , central server 200 informs the user whenever an emergency is reported by another user at the location the user is monitoring . in this manner , when an emergency occurs , the user knows whether anyone else has reported it yet and can act accordingly . in some of the embodiments discussed hereinafter , central server 200 imposes penalties for false positives or inattentiveness and / or pays bonuses for the detection of legitimate emergencies . thus , in those embodiments , users are economically motivated to report legitimate emergencies . continuing with fig8 a , central server 200 in step 825 uses the task identifier to access the corresponding record in the user performance testing rules database 250 . at the test communication intervals specified in field 715 , central server 200 transmits the test communication specified in field 710 of the record to the user device to measure user attentiveness . in a first embodiment , the test communication comprises a randomly transmitted predetermined video of a fabricated emergency . in a second embodiment , the test communication comprises one or more questions communicated to the user , for example , by e - mail . in an alternate embodiment , central server 200 monitors a biometric reading from the user at the remote device to measure user attentiveness . for example , the user device may be equipped with a retinal scanner similar to those being developed for atm machines . the retinal scanner would then take random , periodic or continuous readings to determine whether the user is watching the video stream from the remote location on his screen . in yet another alternate embodiment , the user device is equipped with a video camera . other users can then log on to central server 200 and be assigned the remote monitoring task of monitoring another user monitoring a remote location . once inattention is detected , central server 200 may also enforce attention by causing an audible alarm to be transmitted to the user . the alarm may grow progressively louder until the user responds to the alarm . whereas the foregoing embodiments function to detect and deter inattention , other embodiments function to encourage attentiveness . in one embodiment , for example , central server 200 randomly transmits to the user an offer to enter the user in a sweepstakes . in another embodiment , entertainment video is transmitted to the user at random times and / or for random durations . since the user cannot predict when the next transmission of entertainment video will occur , he will be encouraged to remain attentive to await the next transmission . in step 830 of fig8 a , central server 200 determines whether a response to the test communication was received within the response time specified in field 720 . if a predetermined number of responses ( which may be recorded in ram 215 for the duration of the shift ) are not received within the time specified in field 720 , then in step 835 central server 200 penalizes the user by adjusting the user &# 39 ; s rating in user database 230 in accordance with predetermined criteria , and thereafter disables communications between the location sensor device ( s ) and the user device . in addition to adjusting the user &# 39 ; s rating , central server 200 may penalize the user by not paying him for the remote monitoring session , paying him less than the pay rate specified in field 525 of task database 240 , imposing a charge upon the user ( i . e ., deducting a predetermined amount from the account balance in field 430 of user database 230 ), and , in an extreme case , preventing the user from participating in remote monitoring tasks in the future . in one embodiment , if central server 200 determines that the user is inattentive , a back - up user can be notified to replace the original user . the back - up user can then log - on and monitor the location for the remainder of the original user &# 39 ; s shift . such an embodiment is particularly well suited to situations in which the operator of central server 200 is an isp , since the isp can actively monitor all current users that utilize the isp for internet related services . thus , the isp can recruit users to perform remote monitoring tasks for value ( e . g ., by transmitting offers to registered users of the isp ). if a response was received within the specified time , central server 200 , in step 840 of fig8 b , evaluates the response to determine whether it was the response specified in field 725 of the user performance testing rules database 250 ( e . g ., click 911 ). if the test communication transmitted to the user comprises a question , the evaluation in step 840 includes determining whether the user responded with the expected answer . in step 845 , central server 200 updates the user &# 39 ; s rating in database 230 in accordance with predetermined criteria and , if the user &# 39 ; s shift is not over ( step 850 ), the process returns to step 825 . as discussed above , the ratings can be used when determining whether to assign a user a particular remote monitoring task and it is envisioned that users with higher ratings will be assigned higher paying tasks ( e . g ., a bank may be willing to pay more than a homeowner to have a location remotely monitored ). at the end of the shift , in step 850 , the central server 200 uses the task identifier to access the corresponding record in the session status database 245 and update the entry in field 625 (“ performance results ”) to reflect the user &# 39 ; s performance in responding to test communications . alternatively , the user &# 39 ; s performance may be continuously or periodically updated during the shift . finally , in step 855 , central server 200 credits the user &# 39 ; s account balance in field 430 of user database 230 in accordance with the pay rate and shift duration specified in fields 525 and 535 respectively of task database 240 . various payment schemes are contemplated . for example , the pay rate may incorporate such criteria as the time of day ( e . g ., a user may be paid more to monitor a location between the early morning hours of 2 : 00 am and 5 : 00 am ), whether the user is monitoring two or more locations simultaneously ( e . g ., a user may be paid more to monitor two or more locations at the same time ), the criminal history of the community in which the sensor is located ( e . g ., a user may be paid more to monitor locations whose zip codes correspond to communities having statistically higher crime rates or , alternatively , more users may be assigned to higher crime areas ), and / or the number of users simultaneously monitoring the remote location ( e . g ., the user may be paid less if more than one user is monitoring the same location ). if the operator of central server 200 is an isp , the user may be provided with discounted or free internet access if the user monitors the location for a predetermined amount of time during the billing cycle . the isp may also submit sweepstakes entries or other positive rewards on the user &# 39 ; s behalf for each predetermined period of time spent monitoring a location ( e . g ., one entry for each x minutes spent monitoring ). those skilled in the art will appreciate that many types of services may be granted to the user in exchange for performing remote monitoring tasks . in addition , bonuses may be paid for each legitimate emergency detected by the user . in an alternate embodiment , the user operates a different program ( e . g ., a word processor ) in a different window on the user device 300 a - c while maintaining communication with the sensor device ( s ) 100 a - c via central server 200 using a web browser . in this embodiment , the sensor device includes a video camera and a motion detector . rather than , or in addition to , detecting motion at the remote location , the sensor device may be equipped to detect other events such as a predetermined level of light intensity ( e . g ., a bright light illuminating a dark area ) or static ( e . g ., resulting from the sensor having been disabled ). in response to a signal from the central server indicative of a predetermined event having been detected by a sensor device , the user device preempts the program being operated by the user to immediately display the video data received from the video camera . the user can then review the displayed video data to determine whether an emergency has occurred at the remote location . thus , in accordance with one aspect of the present invention , a user can receive value for passively monitoring a remote location while working on an entirely different project . in yet an alternate embodiment , rather than enabling communication between sensor devices 100 a - c and user devices 300 a - c via the internet , central server 200 causes the video / audio data stream received from sensor devices 100 a - c to be transmitted to user devices 300 a - c via a dedicated television channel of a wireless or cable television system . the user can then monitor the video / audio data on the user device , which , in this embodiment , is preferably a television set . in addition , if the user device includes a picture - in - picture feature , the user can employ this feature to monitor the video data while watching a program on another television station . in these embodiments , a user can submit a request to monitor a remote location via an interactive television set or , via his telephone by calling the operator of central server 200 , if his television does not include an interactive feature . in an alternate embodiment , in addition to a video camera , the sensor device ( s ) 100 a - c include detectors for detecting predetermined events ( e . g ., a predetermined level of motion , sound , light intensity , etc .) at the remote location . when a predetermined event is detected by the sensor device , a signal indicative of the predetermined event is transmitted from the central server to functionality in the television set via the wireless or cable television system . in response to the received signal , the functionality in the television set preempts the television program currently being watched by the user to display the video / audio data received from the video camera ( e . g ., the television will change channels to the dedicated television channel ). alternatively , the functionality in the television set may simply display a visual alert to the user to manually change channels to the dedicated television channel . in these embodiments , functionality in the television set may also cause an audible alarm to be issued to inform the user that a predetermined event has been detected at the remote sensor . thus , the user may engage in other activities , such as household chores , while monitoring a remote location in exchange for value . fig9 is a flow chart illustrating an exemplary emergency procedure executed by the central server 200 of the present invention . in step 900 , central server 200 receives a signal from the user device indicating an emergency at the remote location corresponding to the sensor address of the current monitoring session . in step 905 , central server 200 determines whether the reported emergency is in response to a test communication and , if not , whether the reported emergency is legitimate . in one embodiment , if the reported emergency is not in response to a test communication , central server 200 will immediately communicate the video feed of the remote location to other users who will verify that an emergency has occurred . in a second embodiment , central server 200 will contact an emergency dispatch service only if a threshold number or percentage of users have reported the emergency . if the emergency is not legitimate , central server 200 , in step 910 , lowers the user &# 39 ; s rating in user database 230 in accordance with predetermined criteria . if , however , the reported emergency is legitimate , central server 200 , in step 915 , transmits an output request to an emergency dispatch service corresponding to the sensor location in field 510 of task database 240 . alternatively , central server 200 communicates to the user the phone number of the emergency dispatch service corresponding to the geographic location of the sensor . upon detecting an emergency , the user contacts the emergency dispatch service himself . the many features and advantages of the present invention are apparent from the detailed specification , and thus , it is intended by the appended claims to cover all such features and advantages of the invention which fall within the true spirit and scope of the present invention . furthermore , since numerous modifications and variations will readily occur to those skilled in the art , it is not desired that the present invention be limited to the exact construction and operation illustrated and described herein , and accordingly , all suitable modifications and equivalents which may be resorted to are intended to fall within the scope of the claims . | 6 |
the subject matter of the present invention is thus a composition comprising : from 0 . 1 to 30 % by weight of copolyamide ( copa ), and from 70 to 99 . 9 % by weight of a medium acceptable in cosmetics , in perfumery and / or in pharmaceuticals . the “ copolyamides ”, abbreviated to “ copas ”, comprise at least two distinct repeat units , these distinct units being formed from at least two different monomers . the copolyamides are thus prepared from two or more comonomers chosen from an amino acid , a lactam and / or a dicarboxylic acid with a diamine . the term “ monomer ” in the present description of the copolyamides should be taken to mean “ repeat unit ”. this is because the case where a repeat unit of the pa is composed of a combination of a diacid with a diamine is particular . it is considered that it is the combination of a diamine and of a diacid , that is to say the diamine . diacid pair ( in equimolar amounts ), which corresponds to the monomer . this is explained by the fact that individually the diacid or the diamine is only a structural unit which is not sufficient in itself alone to be polymerized . the term “ copolyamide ” ( abbreviated to copa ), is understood to mean the polymerization products of at least two different monomers chosen from : monomers of amino acid or aminocarboxylic acid type and preferably α , ω - aminocarboxylic acids ; monomers of lactam type which have from 3 to 18 carbon atoms on the main ring and which can be substituted ; monomers of “ diamine . diacid ” type resulting from the reaction between an aliphatic diamine having from 4 to 36 carbon atoms and a dicarboxylic acid having from 4 to 36 carbon atoms ; and their mixtures , with monomers comprising a different carbon number in the case of mixtures between a monomer of amino acid type and a monomer of lactam type . mention may be made , as examples of α , ω - amino acids , of those having from 4 to 18 carbon atoms , such as aminocaproic , 7 - aminoheptanoic , 11 - aminoundecanoic , 11 -( n - heptylamino ) undecanoic and 12 - aminododecanoic acids . mention may be made , as examples of lactams , of those which have from 3 to 18 carbon atoms on the main ring and which can be substituted . mention may be made , for example , of β , β - dimethylpropiolactam , α , α - dimethyl - propiolactam , amylolactam , caprolactam , also known as lactam 6 , capryllactam , also known as lactam 8 , oenantholactam , 2 - pyrrolidone and lauryllactam , also known as lactam 12 . mention may be made , as examples of dicarboxylic acid , of acids having from 4 to 36 carbon atoms . mention may be made , for example , of adipic acid , sebacic acid , azelaic acid , suberic acid , isophthalic acid , butanedioic acid , 1 , 4 - cyclohexanedicarboxylic acid , terephthalic acid , the sodium or lithium salt of sulfoisophthalic acid , dimerized fatty acids ( these dimerized fatty acids have a dimer content of at least 98 % and are preferably hydrogenated ) and dodecanedioic acid hooc —( ch 2 ) 10 — cooh . mention may be made , as example of diamine , of aliphatic diamines having from 4 to 18 atoms , which can be arylic and / or saturated cyclic . mention may be made , as examples , of hexamethylenediamine , piperazine ( abbreviated to “ pip ”), tetramethylenediamine , octamethylenediamine , decamethylenediamine , dodecamethylenediamine , 1 , 5 - diaminohexane , 2 , 2 , 4 - trimethyl - 1 , 6 - diaminohexane , polyoldiamines , isophoronediamine ( ipd ), methylpentamethylenediamine ( mpdm ), bis ( aminocyclohexyl ) methane ( bacm ), bis ( 3 - methyl - 4 - aminocyclohexyl ) methane ( bmacm ), meta - xylylenediamine , bis ( p - aminocyclohexyl ) methane and trimethylhexamethylenediamine . mention may be made , as examples of monomers of “ diamine . diacid ” type , of those resulting from the condensation of hexamethylenediamine with a c 6 to c 36 diacid , in particular the monomers : 6 . 6 , 6 . 10 , 6 . 11 , 6 . 12 , 6 . 14 and 6 . 18 . mention may be made of the monomers resulting from the condensation of decanediamine with a c 6 to c 36 diacid , in particular the monomers : 10 . 10 , 10 . 12 , 10 . 14 and 10 . 18 . mention may be made , as examples of copolyamides formed from different types of monomers described above , of the copolyamides resulting from the condensation of at least two α , ω - aminocarboxylic acids or of two lactams or of one lactam and of one α , ω - aminocarboxylic acid . mention may also be made of the copolyamides resulting from the condensation of at least one α , ω - aminocarboxylic acid ( or one lactam ), at least one diamine and at least one dicarboxylic acid . mention may also be made of the copolyamides resulting from the condensation of an aliphatic diamine with an aliphatic dicarboxylic acid and of at least one other monomer chosen from aliphatic diamines other than the preceding one and aliphatic diacids other than the preceding one . mention may be made , as examples of copolyamides , of copolymers of caprolactam and lauryllactam ( pa 6 / 12 ), copolymers of caprolactam , hexamethylenediamine and adipic acid ( pa 6 / 6 . 6 ), copolymers of caprolactam , lauryllactam , hexamethylenediamine and adipic acid ( pa 6 / 12 / 6 . 6 ), copolymers of caprolactam , hexamethylenediamine and azelaic acid , 11 - amino undecanoic acid and lauryllactam ( pa 6 / 6 . 9 / 11 / 12 ), copolymers of caprolactam , adipic acid and hexamethylenediamine , 11 - aminounecanoic acid and lauryllactam ( pa 6 / 6 . 6 / 11 / 12 ), copolymers of hexamethylenediamine , azelaic acid and lauryllactam ( pa 6 . 9 / 12 ), copolymers of 2 - pyrrolidone and caprolactam ( pa 4 / 6 ), copolymers of 2 - pyrrolidone and lauryllactam ( pa 4 / 12 ), copolymers of caprolactam and 11 - aminoundecanoic acid ( pa 6 / 11 ), copolymers of lauryllactam and capryllactam ( pa 12 / 8 ), copolymers of 11 - aminoundecanoic acid and 2 - pyrrolidone ( pa 11 / 4 ), copolymers of capryllactam and caprolactam ( pa 8 / 6 ), copolymers of capryllactam and 2 - pyrrolidone ( pa 8 . 4 ), copolymers of lauryllactam and capryllactam ( pa 12 / 8 ) or copolymers of lauryllactam and 11 - aminoundecanoic acid ( pa 12 / 11 ). advantageously , the copa used in the composition according to the invention is obtained at least partially from bioresourced starting materials . the term “ starting materials of renewable origin ” or “ bioresourced starting materials ” is understood to mean materials which comprise bioresourced carbon or carbon of renewable origin . specifically , unlike the materials resulting from fossil materials , the materials composed from renewable starting materials comprise 14 c . the “ content of carbon of renewable origin ” or “ content of bioresourced carbon ” is determined by application of the standards astm d 6866 ( astm d 6866 - 06 ) and astm d 7026 ( astm d 7026 - 04 ). by way of example , the copas based on polyamide 11 originate at least in part from bioresourced starting materials and exhibit a content of bioresourced carbon of at least 1 %, which corresponds to a 12 c / 14 c isotopic ratio of at least 1 . 2 × 10 − 14 . preferably , the copas according to the invention comprise at least 50 % by weight of bioresourced carbon with regard to the total weight of carbon , which corresponds to a 12 c / 14 c isotopic ratio of at least 0 . 6 × 10 − 12 . this content is advantageously higher , in particular up to 100 %, which corresponds to a 12 c / 14 c isotopic ratio of 1 . 2 × 10 − 12 , in the case of copas resulting entirely from starting materials of renewable origin . mention may be made , as examples of amino acids of renewable origin , of : 11 - aminoundecanoic acid , for example produced from castor oil , 12 - aminododecanoic acid , for example produced from castor oil , 10 - aminodecanoic acid , for example produced from decylenic acid obtained by metathesis of oleic acid , or 9 - aminononanoic acid , for example produced from oleic acid . mention may be made , as examples of diacids of renewable origin , as a function of the number x of carbons in the molecule ( c x ), of : c 4 : succinic acid , for example from glucose ; c 6 : adipic acid , for example from glucose ; c 7 : heptanedioic acid from castor oil ; c 9 : azelaic acid , for example from oleic acid ( ozonolysis ); c 10 : sebacic acid , for example from castor oil ; c 11 : undecanedioic acid from castor oil ; c 12 : dodecanedioic acid , for example from biofermentation of dodecanoic acid = lauric acid ( rich oil : palm kernel oil and coconut oil ); c 13 : brassylic acid , for example from erucic acid ( ozonolysis ) which is found in rape ; c 14 : tetradecanedioic acid , for example by biofermentation of myristic acid ( rich oil : palm kernel oil and coconut oil ); c 16 : hexadecanedioic acid , for example by biofermentation of palmitic acid ( mainly palm oil ); c 18 : octadecanedioic acid , for example obtained by biofermentation of stearic acid ( a small amount in all vegetable oils but predominant in animal fats ); c 20 : eicosanedioic acid , for example obtained by biofermentation of arachidic acid ( predominantly in rapeseed oil ); c 22 : docosanedioic acid , for example obtained by metathesis of undecylenic acid ( castor oil ); c 36 : fatty acid dimer resulting from softwood byproducts transformed by the kraft process . mention may be made , as examples of diamines of renewable origin , as a function of the number x of carbons in the molecule ( c x ): c 4 : butanediamine obtained by amination of succinic acid ; c 5 : pentamethylenediamine ( from lysine ); and so on for the diamines obtained by amination of the diacids of renewable origin seen above . the term “ copolyamide of completely renewable origin ” is understood to mean the copolyamides resulting from the polymerization of various monomers ( renewable , non - renewable , or mixed ), such as those mentioned above . this is the case , for example , of copa 6 . 6 / 10 . 10 in which the monomer “ 6 . 6 ” is of non - renewable origin whereas the monomer “ 10 . 10 ” is of renewable origin . the term “ copolyamide of completely renewable origin participating in the composition of the invention ” is understood to mean the copolyamides resulting from the polymerization of various monomers , such as those mentioned above , such as , for example , the following copolyamides : pa 11 / 10 . 10 , pa 11 / 10 . 36 , pa 10 . 10 / 10 . 36 , the 11 - aminoundecanoic / 11 -( n - heptylamino ) undecanoic copolyamide and the like . use is made advantageously of one or more of the following copolyamides in the composition or the process of the present invention : pa 6 / 6 . 6 / 12 , the ratios by weight of corresponding monomers of which can be ( as a percentage ): 40 / 20 / 40 , 35 / 20 / 45 , 45 / 35 / 20 , 30 / 30 / 40 , 22 / 18 / 60 or 40 / 25 / 35 ; pa 6 / 6 . 6 / 12 , the ratios by weight of corresponding monomers of which can be , for example ( as a percentage ): 30 / 15 / 10 / 45 , 30 / 20 / 20 / 30 or 15 / 25 / 25 / 35 ; pa 6 / 12 with a ratio by weight of 70 / 30 ; pa 6 . 9 / 12 with a ratio by weight of 30 / 70 ; pa pip . 9 / pip . 12 / 11 with a ratio by weight of 15 / 70 / 15 ; pa 6 / ipd . 6 / 12 with a ratio by weight of 20 / 15 / 65 ; pa ipd . 9 / 12 with a ratio by weight of 20 / 80 ; pa 6 / 6 . 12 / 12 with a ratio by weight of 30 / 30 / 40 ; pa 6 / pip . 12 / 12 with a ratio by weight of 30 / 20 / 50 ; pa 6 / 6 . 12 / 11 / peg . 12 with a ratio by weight of 25 / 21 / 25 / 30 ; pa 6 / 6 . 6 / 6 / 10 / 6 . 1 with a ratio by weight of 40 / 10 / 40 / 10 ; pa 6 . 10 / pip . 10 / pip . 12 with a ratio by weight of 20 / 40 / 40 ; pa 6 / 11 / 12 with a ratio by weight of 10 / 36 / 54 ; pa pip . 12 / 12 with a ratio by weight of 35 / 65 ; pa ipd . 10 / 12 with a ratio by weight of 80 / 20 ; pa pip . 10 / 12 with a ratio by weight of 72 / 28 ; pa 6 / 11 with a ratio by weight of 50 / 50 ; pa pip . 10 / 11 / pip . 9 with a ratio by weight of 65 / 30 / 5 ; pa 6 / 6 . 6 / 6 . 10 with a ratio by weight of 35 / 30 / 35 . mention may in particular be made , as examples of copolyamides , of those sold under the “ platamid ®” and platamid rnew ® names by arkema . the term “ medium acceptable in cosmetics , perfumery or pharmaceuticals ” is understood to mean , within the meaning of the invention , any product which does not cause irritation or reaction on the skin , keratinous fibers ( eyelashes , hair ) or nails . advantageously , said medium comprises at least one component chosen from water , alcohols , alcoholic solutions , lipid compounds , glucide compounds , hydrocarbons , synthetic polymers , natural polymers and / or plant extracts . advantageously , the composition according to the invention has at least one of the following forms : dispersion , solution , emulsion , micro emulsion , nanoemulsion , dry emulsion , suspension , aerosol , gel , compact gel , gum , plastic gum , paste , foam , cream , powder , loose powder , compact powder , expanded powder , butter , film , elastic film and their mixtures . advantageously , said medium comprise an aqueous phase comprising at least 50 % water . the water can be softened water , demineralized water , and / or sterilized water , according to its degree of purification , thermal water and the like . the aqueous phase can additionally comprise alcohols , the number of carbons of the carbon chain of which does not exceed 6 and which are water - soluble , such as ethanol or isopropanol . alcoholic solutions obtained by simple mixing of these alcohols with water can also be used in the aqueous phase ; as well as glycols , such as ethylene glycol or propylene glycol ; polyols , such as glycerol or glycerine , sorbitol or sorbitol syrup . polyoxyethylene glycols ( peg ) can also be used as solvents in said aqueous phase . carboxyvinyl polymers ( carbomers or carbopol ), cyanoacrylic polymers ; glucide compounds , such as polysaccharides extracted from algae ( alginates , carrageenates ), wood ( cellulose and its derivatives ), tree sap ( gum arabic , gum tragacanth ), seeds or pips ( pectin , guar gum , locust bean gum , starch ) or leaves ( aloe gel ); glycoproteins or proteoglycans ; glucide esters and ethers can also participate in the composition of the aqueous phase , in particular as thickeners or gelling agents for the aqueous phase . preservatives , hydrophilic emulsifiers , dyes , humectants , gelling agents , hydrophilic active agents or any other hydrophilic cosmetic agents can participate in the composition of said aqueous or hydrophilic phase . advantageously , said medium comprises an oily phase comprising at least 50 % of organic solvent chosen from fatty esters , fatty alcohols , fatty acids and their mixtures . fatty alcohols within the meaning of the invention are alcohols , the carbon chain of which comprises at least carbons , preferably from 7 to 10 carbons , so that they are liquid at ambient temperature . they are insoluble in water but the presence of hydroxyl confers on them a weak affinity for water . mention may be made in particular of benzylic alcohol which acts as solvent and preservative . fatty acids within the meaning of the invention are organic acids which occur in lipids . their carbon chain is more or less lengthy ( from c 4 to c 30 ) and they can be saturated or unsaturated . saturated fatty acids are solid at ambient temperature ( 25 ° c . ), except for c 4 and c 6 acids . unsaturated fatty acids are liquid . mention may be made , by way of example , of lauric acid , stearic acid or oleic acid . fatty esters result either from the combination of a fatty acid with a short - chain alcohol ( for example isopropyl palmitate or myristate , which form liquid fatty esters ), or from the combination of a fatty acid with a fatty alcohol ( for example isostearyl isostearate ), or from the combination of a short - chain acid with a fatty alcohol having a more or less lengthy chain ( for example benzoic acid with a c 13 - c 15 fatty alcohol , forming fatty alcohol benzoates ). other lipid compounds can occur in said oily phase , such as vegetable oils , for example jojoba oil , castor oil , peanut oil , sunflower oil , borage oil or coconut oil ; animal oils ; it being possible for these oils to be or not to be chemically modified ; synthetic oils , such as synthetic mono -, di -, and triglycerides , for example caprylic / capric triglycerides ; nonsaponifiable products , in particular from avocado , soya , corn or shea ; butters , in particular shea , coconut or cocoa butter ; waxes with a melting point of greater than 50 ° c . of vegetable origin ( carnauba wax , candelilla wax ) or animal origin ( beeswax , propolis ); or phospholipids , in particular soybean lecithin . said oily phase may also include mineral hydrocarbons : mineral oils , petrolatums , paraffins or isoparaffins ; or silicones , such as silicone oils , for example dimethicone or phenyl methicone , volatile silicones , such as cyclomethicones , or emulsifying silicones . the oily phase can also comprise silicas , silicates , in particular aluminum and / or magnesium silicate , clay , kaolin , montmorillonite , bentone , bentonite or hectorite , which thicken the oily phase . antioxidants , pigments , fillers such as talc , nylon or silica , lipophilic active agents and any other lipophilic cosmetic agent can also participate in the composition of said oily phase . advantageously , said medium additionally comprises from 0 . 1 to 30 % by weight of surfactant with regard to the total weight of copa . the term “ surfactant ” is understood to mean , within the meaning of the invention : surfactants of synthetic origin which are themselves divided into two groups , ionic surfactants ( anionic surfactants , such as sodium lauryl sulfate or fatty acid salts , cationic surfactants , such as stearylammonium chloride , or amphoteric surfactants such as betaine derivatives ) and nonionic surfactants with an hlb within the range from 0 to 20 , for example sorbitan esters ( span , tween ) and polyoxy - ethylenated fatty alcohols ; and surfactants of natural origin , such as cholesterol , lecithin , saponin , and proteins such as casein . preferably , the surfactant according to the invention is chosen from anionic surfactants and nonionic surfactants . the surfactant is advantageously chosen from salts of alkyl ether sulfate and of polyoxyalkylene , dialkyl sulfosuccinate salts , fatty acid salts and copolyamides of ethylene oxide / propylene oxide , and their mixtures . from 0 . 1 to 30 % of copa , from 40 to 99 . 9 % of oily phase and / or of aqueous phase , from 0 to 30 % of surfactant , preferably from 0 . 1 to 20 % of surfactant , with regard to the total weight of the composition . advantageously , the composition according to the invention additionally comprises a lipophilic or hydrophilic thickener or gelling agent , such as those described above . according to a preferred embodiment of the invention , the composition forms a dispersion of copa dissolved in an oily phase dispersed in an aqueous phase in the presence of a surfactant . according to another advantageous embodiment of the invention , the composition forms a dispersion of copa dissolved in an aqueous phase dispersed in an oily phase in the presence of a surfactant . another subject matter of the present invention is a method for the incorporation of a copolyamide in a cosmetic , perfumery and / or pharmaceutical medium , said method comprising at least one stage chosen from : mixing , dispersing , homogenizing , high pressure homogenizing , dissolving , diluting , gelling , thickening , emulsifying , refining , forming a paste , heat treating , drying , lyophilizing , baking , extruding , grinding , granulating , atomizing , filtering and the successive or simultaneous mixtures of several of these stages . direct or gradual addition , preferably with stirring , within the range from 100 to 20 000 rev / min , of copolyamide ( copa ) to a medium acceptable in cosmetics , in perfumery and / or in pharmaceuticals , the copa / medium ratio by weight being within the range from 40 / 60 to 1 / 99 , the limits of the range being included ; and heating said mixture at a temperature within the range from 40 to 190 ° c ., preferably in the range from 60 to 180 ° c ., preferably from 70 to 130 ° c ., preferably under a pressure within the range from 1 to 100 bar , for a period of time within the range from 5 to 120 minutes , preferably from 5 to 60 minutes and preferably from 10 to 30 minutes ; the addition and heating stages being simultaneous or successive , taken in this order or in the reverse order . preferably , the method according to the invention comprises the addition of from 0 . 1 to 30 % of copolyamide ( copa ) to from 70 to 99 . 9 % of a medium acceptable in cosmetics and / or in perfumery , the mixture obtained representing 100 %. preferably , the copa used in the method of the invention is in the form of a powder with a d50 within the range from 1 to 150 μm , preferably within the range from 1 to 100 μm , preferably from 1 to 50 μm and preferably from 1 to 30 μm . within the meaning of the invention , d50 corresponds to the volume - average size , that is to say the value of the particle size which divides the population of particles examined exactly into two . the d50 is measured according to standard iso 9276 - parts 1 to 6 : “ representation of results of particle size analysis ”. advantageously , in the method of the invention , the medium acceptable in cosmetics , in perfumery and / or in pharmaceuticals comprises an aqueous phase ( or a polar solvent , preferably a protic polar solvent ) comprising at least 50 % of water with regard to the weight of aqueous phase and / or an oily phase comprising at least 50 % of organic solvent with regard to the weight of oily phase , said organic solvent being chosen from fatty esters , fatty alcohols , fatty acids and their mixtures . according to an advantageous embodiment , the method of the invention comprises the following stages : dissolving the copa in the oily phase ; emulsifying the copa solution obtained in the aqueous phase comprising at least one surfactant , preferably chosen from anionic surfactants and nonionic surfactants . according to a preferred embodiment , the method of the invention comprises a stage consisting in dispersing copa with a melting point m . p . in the aqueous phase comprising at least one basic compound and / or one surfactant chosen from anionic surfactants and nonionic surfactants , at a temperature of greater than or equal to m . p ., and with stirring at a shear rate sufficient for the d50 of the emulsified copa drops to be within the range from 0 . 1 to 50 μm , preferably within the range from 0 . 1 to 20 μm , within the range from 0 . 1 to 10 μm . preferably , the copa is incorporated according to the method of the invention , with stirring within the range from 100 to 15 000 revolutions per minute , preferably from 1000 rev / min to 12 000 rev / min and sometimes at more than 8000 rev / min . use is made , for the low stirring speeds , for example , of a homogenizer , such as a deflocculator , whereas , for the stirring speeds of more than 8000 rev / min , a device of ultra - turrax type is used . advantageously , the method of the invention comprises the use of a copa with predominantly acid ( that is to say to more than 50 % by weight acid ) chain ends in a medium ( preferably an aqueous medium ) comprising a basic compound which reacts with the acid chain ends to give carboxylates , the latter acting as surfactant . preferably , the ratio of the end carboxyl groups to the end amino groups of the copa used in the present invention is within the range from 60 / 40 to 95 / 5 . the term “ basic compound ” is understood to mean an alkali metal hydroxide or an amino compound . mention may be made , as examples , of sodium hydroxide or potassium hydroxide . preferably , the composition according to the invention comprises from 0 . 2 to 3 . 0 mol of basic compound per mole of end hydroxyl groups of the copa . preferably , the copa is dispersed in said medium ( preferably said aqueous medium ) at a temperature greater than or equal to the melting point m . p . of the copa , preferably at a temperature within the range from 70 to 200 ° c ., preferably from 90 to 190 ° c . the aqueous dispersions of example 1 below are in accordance with these preferred parameters . a further subject matter of the present invention is the use of a copolyamide ( copa ) in the manufacture of a cosmetic , pharmaceutical or perfumery product , said copa being incorporated in the form of a composition in accordance with the invention . a subject matter of the present invention is in particular a composition according to the invention as defined above , said composition being a colored , colorless and / or transparent product chosen from the following products : makeup products for the human face and body , such as foundation , tinted cream , loose or compact powder , eyeshadow , mascara , eyeliner , lipstick or nail varnish ; care products for the human face and body , such as cream , milk , lotion , mask , scrubber , cleansing and / or makeup - removing products , deodorants , antiperspirants , shaving products or hair - removing products ; hair products such as shampoos , products for the shaping of the hair , products for retaining the hairstyle , antidandruff products , products for combating hair loss , products for combating dryness of the hair , hair dyes or bleaching products ; perfumery products , such as fragrance , milk , cream , or loose or compact scented powder . the following examples illustrate the present invention without limiting the scope thereof . unless otherwise indicated , all of the percentages are by weight . copa 1 : copolyamide pip . 10 / 12 with a ratio of 72 / 28 ( percentage by weight ), “ pip ” being piperazine . copa 2 : copolyamide 6 / 6 . 6 / 12 with a ratio of 35 / 20 / 45 ( percentage by weight ). an aqueous dispersion of copa 1 and then of copa 2 are manufactured according to the same following method : 15 % by weight of copa are added to water ( 84 %) mixed with 1 % of naoh , with stirring ( 300 rev / min ) and at a temperature maintained above the melting point of the copa , in this instance maintained at 150 ° c ., and the combination is homogenized until an aqueous dispersion of copa particles with a d50 within the range from 0 . 5 to 5 μm is obtained ; then the dispersion is allowed to cool to ambient temperature ( 25 ° c .) an aqueous dispersion of copa 1 and an aqueous dispersion of copa 2 ( compositions according to the invention ) are respectively obtained in example 1 and can advantageously be incorporated in a cosmetic formulation as in the following examples : a and b are separately heated to a temperature of approximately 90 ° c . ; b is poured into a , with stirring ( using a deflocculator of silverson ® homogenizer type ) for at least 5 minutes and until a homogeneous emulsion is obtained ; slow stirring is continued , while gradually lowering the temperature to 30 ° c ., and the preservative is added . a protective white cream is obtained which has a “ smooth ” appearance when being taken up and applied . b is poured slowly into a , with stirring ( with a deflocculator ) for at least 5 minutes and until a homogeneous emulsion is obtained ; slow stirring is continued , while gradually lowering the temperature to 30 ° c ., and the preservative is added . a fluid makeup - removing milk is obtained which , applied to the skin , effectively absorbs the impurities ( makeup , excess sebum ) from the skin . the pigment ( black iron oxide ) is dispersed under cold conditions using an ultra - turrax in the water with the propylene glycol and the triethylamine ; the aqueous phase thus obtained is heated to 90 ° c . and the aqueous dispersion of copa 1 of example 1 is added thereto ; the aqueous phase b is poured into the oily phase a with rapid stirring ( 200 rev / min ) using a deflocculator over 5 minutes ; the emulsion obtained is cooled with moderate stirring down to a temperature of 25 - 30 ° c . and then the active agent is added . a mascara is obtained which curves the eyelashes in a “ flexible ” manner . the composition according to the invention provides a film - forming , sheathing and smooth curving effect for the eyelashes . | 0 |
the invention provides methods for the preparation of 21 - amino epothilone derivatives of general formula ( i ): in formula ( i ), r is selected from the group consisting of h , alkyl , or substituted alkyl ; x is selected from the group consisting of a carbon - carbon bond ( as in epothilones c and d ), o , s , ch 2 , or nr ′; y is 0 or nh ; r ′ is selected from the group consisting of h , alkyl , aryl , — co — r ″, — co 2 r ′″, conhr ″, conr ″ r ′″, — so 2 r ′″, so 2 nhr ″, and so 2 nr ″ r ′″. r ″ and r ′″ are independently selected from the group consisting of alkyl , aryl , aryl - alkyl , heteroaryl , and heteroaryl - alkyl , or r ″ and r ′″ taken together with the nitrogen to which they are attached may comprise a nitrogen heterocycle , and additionally r ″ may be h . where x is a carbon - carbon bond , the 12 , 13 - olefin may be of e or z stereochemistry . the preparation of the compounds of formula ( i ) may be carried out according to scheme 1 . starting from epothilones a - d , or from synthetic or semi - synthetic derivatives thereof , shown in scheme 1 as formula ( ii ), epothilone n - oxides of formula ( iii ) can be obtained as described in the references cited above then converted to 21 - oh epothilones of formula ( iv ). the epothilone starting material may optionally be purified by conventional means , for example by crystallization and / or chromatography , to minimize the proportion of impurities before being reacted to form the n - oxide . one or both the 3 - hydroxyl and 7 - hydroxyl groups of the compound of formula ( iii ) may optionally be protected , for example with trimethylsilyl groups or other trialkyl silyl groups , during formation of the n - oxide . those skilled in the art will appreciate that it may also be advantageous or necessary to protect reactive functional groups in the moiety x , as appropriate ( see , for example , wo 97 / 19086 , the entire disclosure of which is herein incorporated by reference ). any other protecting means known in the art may also be employed for this purpose . the n - oxide ( formula ii ) is reacted with an acyl anhydride , preferably trifluoroacetic anhydride , in the presence of a hindered base such as collidine or 2 , 6 - lutidine , to yield the 21 - hydroxy epothilones iv after hydrolysis . an exemplary process for preparing 21 - amino epothilones via an n - oxide obtained from epothilone b is shown in the first two reaction steps of scheme 2 . the n - oxide of epothilone b , 2 , is reacted to form epothilone f , 3 , which is the starting material converted to an azido derivative , 4 . the azido derivative is then reduced to form the 21 - amino epothilone derivative , 5 . generally , as shown in scheme 1 , the 21 - hydroxy epothilones of formula ( iv ) may be obtained by oxidizing , then further reacting an epothilone starting material , which can be selected from epothilones a - d . alternatively , the 21 - hydroxy epothilones may be obtained by biotransformation ( 21 - hydroxylation ) of epothilones , e . g . epothilones a - d , with the aid of suitable microorganisms or with enzymes . suitable microorganisms include , for example , sorangium cellulosum strains as described in pct patent application wo 98 / 22461 , and actinomycetes sp ., e . g . strain sc 15847 , as described in pct patent application wo 00 / 39276 . the entire disclosure of each of these applications is herein incorporated by reference in its entirety . protected or unprotected epothilones such as those described in pct patent application wo 97 / 19086 ) are appropriate and may be employed as the starting material in the method of the present invention . synthetic or semi - synthetic epothilone starting materials may also be used . in the presently claimed process , the conversion of a 21 - hydroxy epothilone is accomplished , for example , using a phosphoryl azide , in the presence of a suitable base under conditions conducive to formation of the 21 - azido epothilone . for examples of the use of phosphoryl azides in this manner , see : g . zuccarello et al ., j . org . chem . 1998 , 63 : 4898 ; g . gosselin et al ., nucleosides nucleotides 1998 , 17 : 1731 ; k . c . nicolaou et al ., angew . chem ., int . ed . engl . 1998 , 37 : 2708 ; t . honda et al ., heterocycles 1996 , 42 : 109 ; a . g . schultz , h . a . holoboski , m . s . smyth , j . am . chem . soc . 1996 , 118 : 6210 ; and w . h . pearson , j . v . hines , j . org . chem . 1989 , 54 : 4235 . preferred phosphoryl azides are diaryl phosphoryl azides , and most preferred is diphenylphosphoryl azide . any sufficiently polar and suitably inert organic solvent may be employed . the preferred solvent is tetrahydrofuran ( thf ). the presence of water or hydroxylic impurities in the solvent may consume a portion of the phosphoryl azide reagent ; this may be overcome by addition of a compensating additional amount of phosphoryl azide and base . most preferably the solvent is thf that is substantially free of water , for example commercial “ anhydrous ” grade thf or thf that has been dried over molecular sieves . suitable bases are strong hindered non - nucleophilic bases , such as for example 1 , 5 - diazabicyclo [ 4 . 3 . 0 ] non - 5 - ene ( dbn ), 1 , 8 - diazabicyclo [ 5 . 4 . 0 ]- undec - 7 - ene ( dbu ), 1 , 5 , 7 - triazabicyclo [ 4 . 4 . 0 ] dec - 5 - ene ( tbd ), 2 , 4 , 6 - tri - tert - butylpyrimidine ( ttbp ), and diisopropylethylamine ( dipea ). of such bases , dbu and dbn are preferred , and dbu is most preferred . in a preferred embodiment of the invention , the base is used in an excess amount relative to the molar equivalents of phosphoryl azide . the 21 - azido epothilone is then reacted with a reducing agent , followed by treatment with water , base or buffer to provide the 21 - amino derivative . it is presumed that the conversion may proceed through an intermediate . in this respect , a strong reducing agent , for example a palladium catalyst such as lindlar &# 39 ; s catalyst , or an organophosphine reagent may be used . for example , this step may be performed by contacting the 21 - azido epothilone of formula ( v ) with a trisubstituted phosphine . suitable phosphines include trialkyl phosphines such as trimethyl phosphine , triethyl phosphine and tributyl phosphine ; and triaryl phosphines such as triphenyl phosphine . trimethyl phosphine is preferred . either of the foregoing alternative reducing steps may be performed without separation of the 21 - azido compound from the reaction mixture obtained in the first step . optionally , the solvent used in the azide formation may be removed , for example by evaporation , and replaced in part or entirely by a second solvent , but preferably the phosphine is added directly to the reaction mixture obtained in the azide formation step . in an alternative embodiment of the invention , the base is added before the phosphine . this reverse addition may also be performed in situ , it should therefore be understood that within the scope of the present invention the order of addition of the phosphine reducing agent and the base may be reversed , with either variation of the process producing the desired compound of formula ( i ) in good yield . as is reflected in scheme 1 , the process is completed by hydrolysis in conjunction with the reduction step . the hydrolysis may be effected by one of several means ; for example by reaction with water , preferably in the presence of added acid or alkali , to obtain a 21 - amino substituted compound of formula ( i ). in this embodiment , the hydrolysis is carried out with added alkali , the most preferred alkali being aqueous ammonium salts . a buffer may also be used instead of or in addition to the base . in particular , it has been observed that addition of the buffer further reduces impurities in the reaction end product . suitable bases or buffers include , for example , nh 4 oh , nh 4 cl , nh 4 br , cf 3 co 2 nh 4 , nh 4 oac , and mixtures thereof , e . g . aq . nh 4 oh / nh 4 cl . the process steps of the invention may be carried out at temperatures ranging from about 0 ° c . up to the boiling point of the solvent . they are preferably carried out between about 0 ° c . and about 40 ° c ., and most preferably between about 20 ° c . and about 40 ° c . purification of the product preferably is achieved via chromatography and / or crystallization , though any suitable means of purification known in the art may also be used . preferred crystallization solvents are mixtures of a polar solvent and a hydrocarbon , most preferably a mixture of ethyl acetate and heptane . the crude product is typically suspended in the solvent and mixed , if necessary with heating , before cooling . optionally , the solution may be seeded during cooling to promote crystal formation . the synthesis of the invention may be carried out as a batch or continuous process . the following examples are provided to illustrate the present invention . however , it should be understood that the present invention is not limited to the examples herein described . epothilone b ( 1 . 98 g , 3 . 90 mmol ) was placed under argon and dissolved in 60 ml dry ch 2 cl 2 . to this solution was added mcpba ( 0 . 720 g , 4 . 17 mmol , 1 . 07 equivalents ). the mixture was stirred at 25 ° c . for 5 . 5 hours . the reaction mixture was quenched with nahco 3 ( 60 ml ), and extracted with chcl 3 ( 3 × 75 ml ). the organic phase was washed with water ( 100 ml ) followed by 5 % na 2 so 3 ( aq ., 70 ml ) and then brine ( 70 ml ). the organic phase was then dried over na 2 so 4 . the crude reaction product was chromatographed using silica gel and eluted with 2 % meoh in chcl 3 to yield the n - oxide ( 0 . 976 g , 48 % yield ) as a white solid . ( ii ) to a resealable tube under argon was added the n - oxide ( 0 . 976 g , 1 . 86 mmol ) dissolved in dry ch 2 cl 2 ( 35 ml ), 2 , 6 - lutidine ( 1 . 73 ml , 14 . 88 mmol , 8 equivalents ) and ( cf 3 co ) 2 o ( 1 . 84 ml , 13 . 02 mmol , 7 equivalents ). the tube was sealed and heated at 70 ° c . for 25 min . the mixture was allowed to cool and the solvent was removed under a stream of argon , followed by concentration to a few ml of dark yellow solution under vacuum . the reaction was diluted with meoh ( 25 ml ) and 28 % nh 4 oh ( aq ., 2 . 9 ml ) was added . the mixture was heated to 45 ° c . for 20 min , then cooled to room temperature . the crude product was concentrated on a rotary evaporator and chromatographed using silica gel , eluting with 4 % meoh in chcl 3 to afford epothilone f ( 0 . 815 g , 84 % yield ). epothilone b ( 5 . 08 g , 10 . 0 mmol ) was placed under argon and dissolved in dry ch 2 cl 2 ( 150 ml ). to this solution was added powdered nahco 3 ( 2 . 11 g , 25 . 0 mmol , 2 . 5 equivalents ) and purified mcpba ( 4 . 31 g , 25 . 0 mmol , 2 . 5 equivalents ). the mixture was stirred at 25 ° c . for 6 hours . the reaction mixture was washed with water ( 100 ml ) followed by 5 % na 2 so 3 ( aq ., 70 ml ) and then brine ( 70 ml ), and the organic phase was dried over na 2 so 4 . the crude reaction product was chromatographed on silica gel , eluting with 20 - 30 % etoac / 2 % et 3 n / ch 2 cl 2 , to afford the n - oxide ( 1 . 93 g ., 36 . 8 % yield ) as a white fluffy solid . larger - scale runs , employing 15 and 19 g of starting material , provided n - oxide epothilone b in yields of 39 and 32 %, respectively . the n - oxide ( 1 . 89 g , 3 . 60 mmol ) was dissolved in dry ch 2 cl 2 ( 100 ml ), 2 , 6 - lutidine ( 3 . 15 ml , 27 mmol , 7 . 5 equivalents ) and ( cf 3 co ) 2 o ( 1 . 78 ml , 12 . 6 mmol , 3 . 5 equivalents ). the mixture was stirred at 25 ° c . for 3 hours , then diluted with etoh ( 60 ml ), and the ch 2 cl 2 was removed under vacuum . the residue was cooled to 0 ° c ., and 28 % aqueous nh 4 oh ( 0 . 73 ml , 6 equivalents ) was added . the mixture was stirred at 0 ° c . for 2 hours , and then concentrated on a rotary evaporator and chromatographed on silica gel and eluted with 2 % meoh / 0 . 2 % et 3 n / ch 2 cl 2 to afford of epothilone f ( 0 . 95 g , 50 % yield ). larger - scale runs , employing 6 and 6 . 42 g of starting material , also provided epothilone f in yields of 50 %, with an additional 2 g of epothilone f present in mixed chromatographic fractions . to a stirred solution of epothilone f ( 957 mg , 1 . 83 mmol ) in tetrahydrofuran ( 20 ml ) at 0 ° c . under argon was added diphenylphosphoryl azide ( 0 . 47 ml , 604 mg , 2 . 19 mmol , 1 . 2 equivalents ). ( epothilone f can , for example , be obtained according to the process described in commonly assigned and co - pending u . s . patent application ser . no . 09 / 468 , 854 , the entire disclosure of which is incorporated herein by reference ). the mixture was stirred for approximately 3 min . 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 0 . 27 ml , 278 mg , 1 . 83 mmol , 1 equivalents ) was then added and the mixture was stirred at 0 ° c . after 2 hours , the mixture was warmed to 25 ° c . and stirred for 20 hours . the reaction mixture was diluted with ethyl acetate ( 150 ml ) and washed with h 2 o ( 50 ml ). the aqueous layer was extracted with ethyl acetate ( 35 ml ), and the combined organic layers were dried over na 2 so 4 and concentrated under vacuum . the crude material was chromatographed using silica gel eluted with 50 % ethyl acetate in hexanes to afford 21 - azido - epothilone b ( 913 mg , 91 % yield ) as a clear , colorless oil . ms ( esi +): 549 . 3 ( m + h )+; 1 h - nmr ( 300 mhz , cdcl 3 ); δ = 6 . 59 ( bs , 17 - h ), 7 . 04 ( s , 19 - h ), 4 . 63 ( s , 21 - h2 ); hrms ( dcl ); c 27 h 40 n 4 o 6 s : [ m +] calculated 549 . 2747 , found 549 . 2768 . to a stirred solution of epothilone f ( 5 g , 9 . 55 mmol ) in tetrahydrofuran ( 40 . 0 ml ) at room temperature was added diphenylphosphoryl azide ( 2 . 28 ml , 2 . 89 g , 10 . 5 mmol , 1 . 1 equivalents ). the mixture was stirred for approximately 5 min . 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 1 . 72 ml , 1 . 74 g , 11 . 46 mmol , 1 . 2 equivalents ) was then added . the mixture was heated to 40 ° c . and stirred for 3 hours . the reaction mixture was cooled to room temperature and diluted with ethyl acetate ( 160 ml ), followed by washing with h 2 o ( 25 ml ). the organic layer was washed with 10 % aqueous nh 4 oh ( 25 ml ), followed by 1 m nh 4 oh ( 25 ml ). the combined aqueous layers were extracted with etoac ( 20 ml ). the combined organic layers were washed with 15 % aqueous nah 2 po 4 ( 20 ml ), dried over na 2 so 4 , and concentrated under vacuum to afford 21 - azido - epothilone b ( 5 . 0 g . 95 . 4 % yield ) as a white solid . to a stirred solution of 21 - azido - epothilone b ( 1 . 0 g , 1 . 82 mmol ) in tetrahydrofuran ( 10 . 0 ml ) was added trimethylphosphine ( 1 m in thf , 1 . 91 ml , 1 . 91 mmol , 1 . 05 equivalents ) at room temperature . the mixture was stirred for 15 min . an aqueous solution of nh 4 oh ( 1 m , 1 ml ) was added at room temperature . after the mixture was stirred at room temperature for 30 min , etoac ( 50 ml ) and h 2 o ( 10 ml ) were added . the organic layer was washed with 5 % aqueous nah 2 po 4 ( 10 ml ) and h 2 o ( 10 ml ). the organic phase was then dried over mgso 4 and the solvents were removed under vacuum to yield 21 - amino epothilone b ( 0 . 81 g , 85 % yield ) as a slightly pink solid . to a stirred suspension of epothilone f ( 10 g , 19 . 1 mmol ) in tetrahydrofuran ( 200 ml ) under argon , chilled in an ice bath to 5 ° c . or below , was added diphenylphosphoryl azide ( 6 . 20 ml , 7 . 90 g , 28 . 6 mmol , 1 . 5 equivalents ). the mixture was stirred for approximately 10 min . 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 3 . 43 ml , 3 . 53 g , 22 . 8 mmol , 1 . 2 equivalents ) was then added gradually at a rate that maintained the temperature of the mixture below 8 ° c . the mixture was stirred for 30 min ., then allowed to warm to 20 ° c . and stirred for 18 hours . to the reaction mixture was added a solution of 1 . 0 m trimethylphosphine in tetrahydrofuran ( 21 ml , 18 . 3 g , 21 mmol , 1 . 1 equivalents ), which generated a mild exotherm with gas evolution . the mixture was allowed to stir at 20 ° c . for 30 minutes , and water ( 52 ml ) was added . after 30 minutes , 28 % aqueous nh 4 oh ( 26 . 5 ml ) was added . after stirring at 25 ° c . for another 30 minutes , water ( 100 ml ) was added , and the mixture was extracted with methylene chloride ( 3 × 100 ml ). the combined organic extracts were washed with 1 . 0 m aqueous ammonium hydroxide ( 2 × 100 ml ), and then with half - saturated aqueous sodium chloride ( 100 ml ). the solvents were removed on a rotary evaporator , and the residue dried in vacuo for 18 hours . the crude material from several synthetic runs ( from 36 g starting material in total ) was chromatographed on silica gel ( 810 g , density 0 . 45 g / ml ; 1800 ml ), and eluted with 0 . 2 % et 3 n , 2 . 5 % meoh in ch 2 cl 2 , to yield 21 - amino epothilone b ( 27 . 1 g ) as a white solid . ms ( esi +): 523 . 3 ( m + h ) + . an additional 2 . 37 g was obtained by re - chromatography of later mixed fractions , for a total of 29 . 5 g ( 82 . 4 % yield ). the material was dissolved in ch 2 cl 2 , ( 200 ml ) and the solution filtered through a 0 . 45 micron membrane ( durapore ™ hvhp , millipore inc ., bedford mass .) and evaporated to dryness in vacuo . crystallization was carried out by dissolving the residue in ethyl acetate ( 344 ml ) at 75 ° c ., slowly adding cyclohexane ( 688 ml ), and slowly cooling with stirring and with addition of seed crystals of 21 - amino epothilone b . the mixture was held with stirring at 40 ° c . for an hour , then allowed to cool further to room temperature and stirred for 12 hours . the mixture was then cooled to below 5 ° c . in an ice bath , stirred for 4 hours at 0 to 5 ° c ., and filtered . the solids were rinsed with ice - cold 10 % ethyl acetate in cyclohexane ( 3 × 30 ml ) and then dried in vacuo at 40 ° c . for 18 hours to provide crystalline 21 - amino epothilone b ( 27 g , 75 % overall yield ) as white plates . thf was dried over 3a molecular sieves prior to use . to a stirred suspension of epothilone f ( 10 g , 19 . 1 mmol ) in dry tetrahydrofuran ( 200 ml ) under argon , was added diphenylphosphoryl azide ( 6 . 20 ml , 7 . 90 g , 28 . 6 mmol , 1 . 5 equivalents ). the mixture was stirred for about 10 min . 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 3 . 43 ml , 3 . 53 g , 22 . 8 mmol , 1 . 2 equivalents ) was added gradually , at a rate that maintained the temperature of the mixture below 30 ° c . the mixture was stirred for 12 to 24 hours ( overnight ). to the reaction mixture was added a solution of 1 . 0 m trimethylphosphine in tetrahydrofuran ( 21 ml , 18 . 3 g , 21 . 04 mmol , 1 . 1 equivalents ), at a rate that maintained the temperature of the mixture below 27 ° c . the mixture was stirred at room temperature for 30 minutes , and water ( 52 ml ) was added . after 30 minutes , 28 % aqueous nh 4 oh ( 26 . 5 ml ) was added , and the mixture stirred for 30 minutes . water ( 100 ml ) was added , and the mixture was extracted with methylene chloride ( 3 × 100 ml ). the combined organic extracts were washed with 1 . 0m aqueous ammonium hydroxide ( 2 × 100 ml ). nmr analysis was used to determine the presence of residual diphenylphosphate in the organic phase , and an additional wash with 1 . 0 m aqueous ammonium hydroxide ( 100 ml ) was carried out . the organic phase was then washed with half - saturated aqueous sodium chloride ( 100 ml ), the solvents were removed on a rotary evaporator , and the residual solid was dried in vacuo for 18 hours . the crude product was purified within 24 hours , or stored at − 15 ° c . or below . the crude material was purified by chromatography and recrystallization as described in example 6 . to a stirred suspension of epothilone f ( 47 . 12 g , 90 . 0 mmol ) in tetrahydrofuran ( 942 ml , previously dried over 3a molecular sieves ) under argon , was added diphenylphosphoryl azide ( 29 . 2 ml , 37 . 3 g , 135 . 5 mmol , 1 . 5 equivalents ). the mixture was stirred for about 10 min . 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 24 . 5 ml , 24 . 94 g , 163 . 8 mmol , 1 . 8 equivalents ) was then added gradually , at a rate that maintained the temperature of the mixture below 30 ° c . the mixture was stirred for 22 hours . to the reaction mixture was added a solution of trimethylphosphine in tetrahydrofuran ( 1 . 0 m , 99 . 0 ml , 86 . 3 g , 99 . 0 mmol , 1 . 1 equivalents ), at a rate that maintained the temperature of the mixture below 30 ° c . the mixture was stirred at room temperature for 30 minutes , and water ( 244 ml ) was added . after 30 minutes , 28 % aqueous nh 4 oh ( 125 . 0 ml ) was added , and the mixture stirred for 30 minutes . water ( 470 ml ) was added , and the mixture was extracted with methylene chloride ( 3 × 100 ml ). the combined organic extracts were washed with aqueous ammonium hydroxide ( 1 . 0 m , 3 × 470 ml ). nmr analysis was used to determine the presence of residual diphenylphosphate in the organic phase . the organic phase was then washed with half - saturated aqueous sodium chloride ( 470 ml ), the solvents were removed on a rotary evaporator , and the residual solid was dried in vacuo for 18 hours to afford the crude product ( 56 . 72 g , 120 . 6 % yield ). the crude product was purified by column chromatography using silica gel pre - treated with 2 . 5 % methanol - 0 . 2 % triethylamine - dichloromethane . the chromatographed material was dissolved in ch 2 cl 2 , and the solution filtered through a 0 . 45 micron membrane ( durapore ™ hvhp , millipore inc ., bedford mass .) and evaporated to dryness . to the purified product ( 30 . 6 g ) was added ethyl acetate ( 370 ml ), the resulting suspension was heated at 72 - 75 ° c . to obtain a solution and n - heptane ( 370 ml ) added slowly . the mixture was treated with seeds ( 622 mg ) and then held with stirring at 72 ° c . for 1 hr . the suspension is then allowed to cool slowly and stirred at 15 - 25 ° c . for 18 hrs . after cooling at + 5 ° c ., the resulting solid was isolated by filtration , washed with 10 % ethyl acetate in heptane ( 93 ml in three portions ) followed by vacuum drying at 50 - 60 ° c . to afford the crystalline 21 - amino epothilone ( 28 . 93 g , 67 . 6 % yield corrected for input potency ). to a suspension of epothilone f ( 334 g , 637 . 8 mmol ) and diphenylphosphoryl azide ( 208 ml , 264 . 3 g , 960 mmol , 1 . 5 eq ) in tetrahydrofuran ( 6680 ml , previously dried over 3a molecular sieves ) was added gradually 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 172 ml , 175 g , 1 . 15 mol , 1 . 8 eq ) and the reaction subsequently stirred at 15 - 25 ° c . for 6 - 18 hrs . to the reaction mixture was then added a 2 . 4m solution of ammonium hydroxide ( 2600 ml , 10 eq ), followed by slow addition of a 1 . 0 m trimethylphosphine / tetrahydrofuran solution ( 700 ml , 1 . 1 eq ), and the mixture stirred for 1 hr . the reaction mixture was diluted with water ( 3340 ml ) and the aqueous phase extracted with dichloromethane ( 3 × 3340 ml ). the organic phase was then washed with diluted ammonium hydroxide ( 10 , 710 ml in five portions ) and half saturated sodium chloride solutions ( 3340 ml in two portions ); the dichloromethane solution was partially concentrated under reduced pressure to ca 1670 ml . ethyl acetate ( 3340 ml ) was then added and the mixture reconcentrated to 1670 ml . the process was repeated and to the mixture was added n - heptane ( 5010 ml ). the resulting suspension was stirred for 1 hr and the solid isolated by filtration followed by vacuum drying at 50 - 60c . to afford the crude product ( 305 . 2 g , 91 . 4 % yield ). the crude product from two reactions ( 136 . 0 and 334 . 0 g input ) was purified by column chromatography using silica gel pre - treated with 2 . 5 % methanol - 0 . 2 % triethylamine - dichloromethane , or optionally with 5 % methanol - ethyl acetate . the chromatographed material ( 340 g ) was dissolved in ch 2 cl 2 , and the solution filtered through a 0 . 45 micron membrane ( durapore ™ hvhp , millipore inc ., bedford mass .) and evaporated to dryness . to the purified product ( 339 . 10 g ) was added ethyl acetate ( 4070 ml ), the resulting suspension was heated at 72 - 75 ° c . to obtain a solution and n - heptane ( 4070 ml ) added slowly . the mixture was allowed to cool slowly in the presence of seeds and stirred at 15 - 25 ° c . after cooling at + 5 ° c ., the resulting solid was isolated by filtration , washed with of heptane ( 1020 ml in three portions ) followed by vacuum drying to afford crystalline 21 - amino epothilone ( 317 . 7 g , 73 . 4 % yield corrected for input potency ). ( optionally , the product can also be recrystallized from ethyl acetate - heptane to improve quality .) to a stirred suspension of epothilone f ( 2 . 5 g , 4 . 77 mmol , 86 . 2 % potency ) in tetrahydrofuran ( 25 ml ) was added diphenylphosphoryl azide ( 1 . 14 ml , 1 . 45 g , 5 . 25 mmol , 1 . 1 equivalents ) at room temperature . the mixture was stirred for approximately 5 min . 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 0 . 86 ml , 0 . 87 g , 5 . 73 mmol , 1 . 2 equivalents ) was then added over 10 min . the mixture was stirred for 10 min , and then allowed to warm to 40 ° c . and stirred for 3 hours . the mixture was cooled to 30 ° c ., and a mixture of aqueous solution of nh 4 cl ( 2m , 2 . 5 ml ) and nh 4 oh ( 2m , 2 . 5 ml ) was added . after the mixture was stirred for 10 min at 30 ° c ., trimethylphosphine ( 1m in tetrahydrofuran , 5 . 01 ml , 5 . 01 mmol , 1 . 05 equivalents ) was added over 10 min . the mixture was allowed to stir at 30 ° c . for 3 hours and then at room temperature for 15 hours . etoac ( 100 ml ) and aqueous nh 4 oh ( 1 m , 20 ml ) were added . the organic layer was washed with aqueous nh 4 oh ( 1 m , 20 ml ). the combined aqueous layers were extracted with etoac ( 20 ml ). the combined organic layers were washed with h 2 o ( 20 ml ) and dried over mgso 4 . the solvents were removed on a rotary evaporator , and the residue dried in vacuo to provide the crude 21 - amino epothilone b ( 2 . 45 g ) as an off - white solid . the crude 21 - amino epothilone b ( 2 . 45 g ) was crystallized from etoac / heptane to give 21 - amino epothilone b ( 1 . 86 g , 86 . 5 % yield corrected for input potency ) as a white solid . to a stirred suspension of epothilone f ( 2 . 5 g , 4 . 77 mmol , 86 . 2 % potency ) in tetrahydrofuran ( 25 ml ) was added diphenylphosphoryl azide ( 1 . 14 ml , 1 . 45 g , 5 . 25 mmol , 1 . 1 equivalents ) at room temperature . the mixture was stirred for approximately 5 min . 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 0 . 86 ml , 0 . 87 g , 5 . 73 mmol , 1 . 2 equivalents ) was then added over 10 min . the mixture was stirred for 10 min . and then allowed to warm to 35 ° c . and stirred for 6 . 5 hours . the mixture was cooled to 10 ° c ., and a mixture of aqueous solution of nh 4 br ( 2m , 5 ml ) and nh 4 oh ( 2m , 5 ml ) was added . after the mixture was stirred for 5 min , trimethylphosphine ( 1 m in tetrahydrofuran , 5 . 01 ml , 5 . 01 mmol , 1 . 05 equivalents ) was added over 10 min at 10 ° c . the mixture was allowed to stir at 35 ° c . for 4 hours and then cooled to room temperature . etoac ( 80 ml ) and aqueous nh 4 oh ( 1 m , 10 ml ) were added . the organic layer was washed with aqueous nh 4 oh ( 1 m , 20 ml ). the combined aqueous layers were extracted with etoac ( 20 ml ). the combined organic layers were washed with h 2 o ( 20 ml ) and dried over mgso 4 . the solvents were removed on a rotary evaporator , and the residue dried in vacuo to provide the crude 21 - amino epothilone b ( 2 . 5 g ) as an off - white solid . the crude 21 - amino epothilone b ( 2 . 45 g ) was crystallized from etoac / heptane to give 21 - amino epothilone b ( 1 . 95 g , 90 % yield corrected for input potency ) as a white solid . to a stirred suspension of epothilone f ( 5 . 0 g , 9 . 55 mmol , 86 . 2 % potency ) in tetrahydrofuran ( 50 ml ) was added diphenylphosphoryl azide ( 2 . 28 ml , 2 . 89 g , 10 . 5 mmol , 1 . 1 equivalents ) at room temperature . 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 1 . 73 ml , 1 . 74 g , 11 . 46 mmol , 1 . 2 equivalents ) was then added over 10 min . the mixture was stirred for 10 min . and then allowed to warm to 35 ° c . and stirred for 6 . 5 hours . the mixture was cooled to 20 ° c ., and a mixture of aqueous solution of cf 3 coonh 4 ( 4m , 10 ml ) and nh 4 oh ( 4m , 10 ml ) was added . after the mixture was stirred for 5 min , trimethylphosphine ( 1 m in tetrahydrofuran , 10 . 03 ml , 10 . 03 mmol , 1 . 05 equivalents ) was added over 10 min at 20 ° c . the mixture was allowed to stir at 35 ° c . for 2 hours and then at 5 ° c . for 14 hours . etoac ( 200 ml ) and aqueous nh 4 oh ( 1 m , 10 ml ) were added . the organic layer was washed with aqueous nh 4 oh ( 1 m , 30 ml ). the combined aqueous layers were extracted with etoac ( 2 × 30 ml ). the combined organic layers were washed with a mixture of brine ( 20 ml ) and h 2 o ( 20 ml ). the solvents were removed to yield ˜ 60 ml on a rotary evaporator , and etoac ( 60 ml ) was added . the solvent was removed again to ˜ 65 ml , and the resulting slurry was crystallized from etoac / heptane to give 21 - amino epothilone b ( 3 . 75 g , 87 % yield corrected for input potency ) as a white solid . to a suspension of epothilone f ( 5 . 0 g , 9 . 55 mmol , 86 . 2 % potency ) and diphenylphosphoryl azide ( 2 . 27 ml , 10 . 5 mmol , 1 . 1 eq ) in tetrahydrofuran ( 40 ml ) was added gradually 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 1 . 71 ml , 11 . 46 mmol , 1 . 2 eq ) and the reaction subsequently stirred at 25 - 40 ° c . for 4 - 6 hrs . to the reaction mixture was then added a 6 . 0 m solution of ammonium acetate ( 7 . 96 ml , 47 . 7 mmol , 5 eq ) followed by 1 . 0 m trimethylphosphine / tetrahydrofuran solution ( 1 . 5 eq ). the reaction mixture was diluted with water and the aqueous phase extracted with three portions of ethyl acetate ( 40 ml each ). the organic phase was then washed with three portions of diluted ammonium hydroxide ( 40 ml each ). the combined aqueous washes are then extracted with two portions of ethyl acetate ( 40 ml each ). the combined ethyl acetate phases are washed with two portions of water ( 20 ml each ) then concentrated and azeotropically dried under reduced pressure to a final volume of 60 ml . the resulting solution was heated at 65 - 75 ° c . and 70 ml n - heptane was added slowly . the mixture was allowed to cool slowly and stirred at a final temperature of 15 - 20 ° c . the resulting solid ( 3 . 34 g , 78 % corrected for input potency ) was isolated by filtration followed by vacuum drying to afford crystalline product . | 2 |
while several different embodiments of the present invention are described herein and shown in the various figures , common reference numerals in the figures denote similar or analogous elements , components or structure amongst the various embodiments . a first embodiment 1 of the present invention , in the form of discrete components enabling an existing sipo shift register to perform its own bit count , report the receipt of transmissions of some valid expected length and report the receipt of certain invalid transmissions of greater than the expected length , is shown in fig1 as comprising d - type flip - flop ff 0 2 , jk - type master - slave bad transmission flip - flop ffbt 3 , inverted active reset signal rst 4 , clock signal clk 5 , data input ( from transmitting circuitry ) data 6 , d 1 signal 7 , end signal 8 , ok control signal 9 , and gate g 1 10 , ok signal 11 , bad transmission ( bt ) signal 12 , ffbt k input 13 , tri - state driver 31 , read command 32 , and d 1 b signal 33 . flip - flop ff 0 2 is initially preset to a logic 1 value to establish the end of transmission marker ( etm ). flip - flop ffbt 3 is set whenever an invalid transmission , being too many bits in length , is received , as output and reported by bt signal 12 . in the various embodiments of the present invention , including the embodiment of fig1 , inverted logic reset signal 4 is employed to reset all circuitry , on both integrated circuits and spio shift registers , with the exception of certain components of the fifth , sixth and seventh embodiments of the present invention . clock signal clk 5 is the data transmission clock accompanying data input signal data 6 , and clocks both flip - flop dd 0 2 and flip - flop ffbt 3 . signal d 1 7 is output from flip - flop ff 0 2 , is initially set to a logic 1 value to establish the end of transmission marker ( etm ), and finally contains the last bit of the transmitted sequence . end signal 8 signifies receipt of a complete transmission , and is coupled to both the j input of both bad transmission flip - flop ffbt 3 and one input of and gate 10 . the other input of and gate g 1 10 is ok control signal 9 , output from bad transmission flip - flop ffbt 3 . ok control signal 9 selectively enables or cuts off and gate g 1 and its output , ok signal 11 , which signifies receipt of a valid overall transmission . bt signal 12 , output from bad transmission flip - flop ffbt 3 , reports the receipt of a bad serial data transmission , composed of too many bits in length . grounded k input 13 of flip - flop ffbt 3 prevents the resetting of flip - flop ffbt 3 as this flip - flop &# 39 ; s clock input is pulsed . this embodiment is equipped with a tri - state driver for use when the invention is applied to an existing sipo shift register with tri - state data outputs . in particular , inverting tri - state driver 31 , controlled by read command 32 , receives the inverted output 34 from flip - flop ff 0 2 , and provides a buffered tri - state output d 1 b 33 having the same logic state as d 1 signal 7 . referring to fig2 , a second embodiment of the invention , wherein the first embodiment of the invention is incorporated into a special purpose integrated circuit , is shown applied to an arbitrarily selected , existing sipo shift register 14 . although , in the example of fig2 , a 12 - bit sipo shift register is shown , the present invention is capable of operation in conjunction with shift registers of any arbitrary length . the connecting leads between the special purpose integrated circuit 1 and sipo shift register 14 of fig2 are as follows : rst signal 4 presets flip - flop ff 0 2 to the logic 1 state , hereby establishing the etm , and resets flip - flop ffbt 3 and all stages of sipo shift register 14 to the logic 0 state . if tri - state driver 31 is not used , its read control signal 32 is coupled to logic ground or is otherwise brought to a logic 0 state . clk signal 5 clocks incoming data into flip - flop ff 0 2 and advances the etm and data from flip - flop ff 0 2 to and through sipo shift register 14 . data signal 6 brings in data from the transmitting source . d 1 signal 7 is the q output of flip - flop ff 0 2 and the means by which the etm and input data are advanced to the sipo shift register 14 . signal d 1 7 also becomes the last bit of data transmitted for a valid transmission . end signal 8 indicates that a valid transmission of the expected number of bits has been received . end signal 8 may be connected to any desired d output along the length of sipo shift register 14 , thereby selecting for expected transmissions of a length shorter than the physical length of sipo shift register 14 . as shown in fig2 , clk signal 5 and inverted active rst signal 4 are coupled to both the circuitry 1 of the first embodiment of the invention , as well as to the clock and reset signals , respectively , of existing sipo shift register 14 . signal d 1 7 , output from flip - flop ff 0 2 , is coupled to the d 1 input of existing sipo shift register 14 . the q output of the final flip - flop ff 12 of existing sipo shift register 14 is coupled to end signal 8 of the circuitry 1 of the first embodiment of the invention . a newly designed sipo shift register 15 incorporating the novel features of the present invention is shown in fig3 . as can be seen , this particular embodiment does not include the tri - state output gate 31 . moreover , while a 12 - bit sipo shift register incorporating the present invention is shown in fig3 , shift registers of any arbitrary length may be constructed to include the features of the present invention . in this embodiment , flip - flop ff 0 2 is shown logically positioned at the beginning of the daisy - chained flip - flops ff 2 through ff 12 , and flip - flop ffbt 3 is positioned following flip - flop ff 12 16 . end signal 8 is again derived from the q output of flip - flop ff 12 . moreover , while the example of fig3 does not include a tri - state output driver , all data outputs , d 1 through d 12 may optionally be equipped with tri - state outputs . a common timing diagram illustrating the sequential operation of the circuitry of the embodiments shown in fig1 through 3 is shown in fig4 . referring to fig4 , preparation for the receipt of a transmission starts when rst signal 4 goes to the logic 0 state , presetting flip - flop ff 0 2 and its q output d 1 7 to the logic 1 state , thus establishing the etm and resetting all other flip - flops of sipo shift registers 14 and 15 , as applicable to the embodiment of the invention being considered . this resetting also resets the end 8 signal and the two - input and gate g 1 10 , and its output lead ok 11 , to the logic 0 state . transmission begins when the transmitting device has set the first data bit data 6 on - line and sends the first clock pulse clk 5 , thus validating the data . the first clk 5 pulse clocks new data 6 into flip - flop ff 0 , and advances the etm from flip - flop ff 0 2 to flip - flop ff 1 of the sipo shift register , 14 or 15 , as applicable . successive clk 5 pulses continue to advance the etm until it reaches the particular sipo shift register flip - flop that has been preselected to determine the expected length of transmission ( ff 12 of sipo shift register 14 or 15 in the embodiments illustrated by fig4 ), where it indicates the receipt of a valid transmission of the expected number of bits . moreover , in the embodiments illustrated by fig4 , the output of flip - flop ff 12 , end signal 8 , now in the logic 1 state , is the etm . at this time inverted q output signal 9 of flip - flop ffbt 3 is in the logic 1 state . the combination of end signal 8 and inverted q output signal 9 of flip - flop ffbt 3 , both in the logic 1 state , collectively drive 2 - input and gate g 1 10 and its output , ok 11 , to the logic 1 state , thereby reporting the receipt of a valid transmission . the transmitted data is available on output signals d 1 7 through d 12 . the receipt of any additional clk 5 pulses will drive flip - flop ffbt 3 and its q output , bt 12 , to the logic 1 state , indicating receipt of a bad transmission consisting of too many bits . the inverted q output signal 9 of flip - flop ffbt 3 transitions to the logic 0 state , driving two - input and gate g 110 and its output to the logic 0 state , thereby terminating ok signal 11 . flip - flop ffbt 3 , once set to the logic 1 state , cannot be reset by a successive clk 5 pulse , inasmuch as its k input 13 is connected to logic ground . a fourth embodiment of the present invention , in the form of a special purpose integrated circuit in which additional discrete logic components have been added to the logic configuration of the previously described embodiments , is shown in fig5 . in this embodiment , the circuitry again enables an existing sipo shift register to perform the functions afforded by the previously described embodiments , and , additionally , permits the sipo shift register to receive and report the validity of transmissions of differing expected lengths . referring to fig5 , this additional circuitry comprises d - type flip - flop ffsel 17 , and gate g 2 18 , or gate g 3 19 , input signal sel 20 , input signal shrt 21 , input signal ends 8 s , and input signal endd 8 d . a fifth embodiment of the present invention , in which the discrete components of the fourth embodiment are incorporated in the form of a special purpose integrated circuit 24 , is shown in fig6 . an illustration of an application of the special purpose integrated circuit 24 of the fifth embodiment of the invention , shown applied to an arbitrarily selected , existing sipo shift register 25 , is shown in fig7 . in this embodiment , clk input 5 and inverted active rst signal 7 are coupled to both integrated circuit 24 and sipo shift register 25 . moreover , in the example of fig7 , ends signal 8 s , corresponding to the anticipated short message length of 16 bits , is coupled to output d 17 of sipo shift register 25 , while endd signal 8 d , corresponding to the anticipated default transmission length of 24 bits , is coupled to the q output of the final flip - flop , ff 24 of sipo shift register 25 , and occurs automatically if the short ends signal 8 s has not been selected . when a valid word has been received in the configuration illustrated , data is available on leads d 1 through d 16 for a short transmission and leads d 1 through d 24 for a long transmission . signals 8 s and 8 d are shown as dotted lines in fig7 to illustrate that the specific d outputs of sipo sift register 25 to which they are presently shown connected are but one option , and that alternative d output connections may alternatively be employed in order to accommodate data transmissions of other expected lengths . as the ends signal 8 s and the endd signal 8 d must both be made continuously available to special purpose integrated circuit 24 , the sipo shift register 25 selected for this application cannot have tri - state outputs . a common timing diagram illustrating the sequential operation of the circuitry of the embodiments shown in fig5 through 7 is shown in fig8 . referring to fig8 , the expected length of a transmission is determined when shrt signal 21 has been placed in either the logic 1 or the logic 0 state , and flip - flop ffsel 17 has been set accordingly by a clock pulse on the sel 20 signal . flip - flop ffsel 17 is clocked to either the logic 1 state for a short length data transmission , or to the logic 0 state for a long , or default , length data transmission . preparation for the receipt of a transmission starts when inverted active rst signal 4 goes to the logic 0 state , presetting flip - flop ff 0 2 and its q output d 1 7 to the logic 1 state , thus establishing the etm , and resetting all of the internal flip - flops of both sipo shift register 25 and special purpose integrated circuit 24 , apart from flip - flop ffsel 17 . this resetting also resets the end 8 , endd 8 d and ends 8 s signals and output ok 11 of and gate g 1 10 to the logic 0 state . transmission begins when the transmitting device has set the first data bit on - line and sends the first clock pulse . the first pulse of clk signal 5 clocks the first bit of transmitted data on data signal 6 into flip - flop ff 0 2 and advances the etm initially preset into flip flop ff 0 2 to flip flop ff 1 of sipo shift register 25 . successive pulses of clk signal 5 continue to advance the etm until , in the case illustrated , it advances to flip - flop ff 16 if a short transmission is expected , or flip - flop ff 24 if a longer , default - length transmission is expected . moreover , in the case illustrated , either the output of flip - flop ff 16 , generating the ends signal 8 s for a short transmission , or the output of flip - flop ff 24 , generating the endd signal 8 d lead for a default length transmission , transitioning to the logic 1 state , indicates the end of the expected transmission . either indication , when occurring , will be passed to the end signal 8 by two - input or gate g 3 19 , indicating receipt of a transmission having an expected length . at this time , inverted q output 9 of flip - flop ffbt 3 is in the logic 1 state . at this time , the combination of end signal 8 and inverted q output 9 of flip - flop ffbt 3 , both in the logic 1 , state drives two - input and gate g 1 10 and its output , ok signal 11 , to the logic 1 state , thereby reporting the receipt of a valid transmission . at the same time , the transmitted word , having been converted to parallel form , is available on signals d 1 7 through d 16 of sipo shift register 25 for a short transmission , or signals d 1 7 through d 24 for a default length transmission . receipt of any additional clk 5 pulses following the end of a valid transmission will drive flip - flop ffbt 3 and its q output , bt signal 12 , to the logic 1 state , thereby indicating receipt of a bad transmission consisting of too many bits . at the same time , the inverted q output 9 of flip - flop ffbt 3 transitions to the logic 0 state , which drives the two - input and gate g 1 10 and its output to the logic 0 state , thereby terminating the ok signal 11 . as its k input 13 is connected to logic ground , flip - flop ffbt 3 , once set to the logic 1 state , cannot be reset by additional pulses of clk signal 5 . a sixth embodiment of the present invention , in which the circuitry of the special purpose integrated circuit of the fifth embodiment is incorporated within a newly designed sipo shift register 28 that may be applied to data transmissions having differing expected lengths through the use of variable external connections , is shown in fig9 . signals 8 s and 8 d are shown as dotted lines in fig9 to illustrate that the specific d outputs of sipo sift register 28 to which they are presently shown connected are but one option , and that alternative d output connections may alternatively be employed in order to accommodate data transmissions of other expected lengths . unlike the embodiment of fig7 , however , this external wiring of signals 8 s and 8 d is entirely coupled to a single integrated circuit 28 , as opposed to wiring between a special purpose integrated circuit and an existing sipo shift register . moreover , while short and default message transmission lengths of 16 and 24 bits , respectively , are depicted within fig9 , alternative message lengths may alternatively be wired by coupling these signals to desired d outputs of sipo shift register 28 . a seventh embodiment of the present invention , in which the circuitry of the special purpose integrated circuit of the fifth embodiment is incorporated within a newly designed sipo shift register 29 having internally wired , pre - configured short and default message length values , is shown in fig1 . moreover , while short and default message transmission lengths of 16 and 24 bits , respectively , are depicted within fig1 , alternative message lengths may alternatively be wired by internally wiring these signals to desired d outputs of sipo shift register 29 . the use of internal connections for signals 8 s and 8 d permit tri - state drivers to alternatively be included to the d outputs of sipo shift register 29 . both of the sixth and seventh embodiments perform their own received bit count , issue an ok signal 11 signal when a valid transmission is received , issue a bt signal 12 when a bad transmission consisting of too many bits is received , and can receive transmissions of two different expected lengths . additional selection components may optionally be added in order to allow receipt of transmissions of a greater number of different lengths ( i . e ., three valid transmission lengths , four valid transmission lengths , etc .). a common timing diagram illustrating the sequential operation of the circuitry of the embodiments shown in fig9 and 10 is shown in fig1 . the expected length of a transmission is determined when shrt signal 21 has been placed in either the logic 1 or the logic 0 state , and flip - flop ffsel 17 has been set accordingly by a pulse sel signal 20 . specifically , flip - flop ffsel 17 is clocked to the logic 1 state for a short anticipated data transmission length , or to the logic 0 state for a long , or default length data transmission . preparation for the receipt of a transmission starts when the inverted active rst signal 4 goes to the logic 0 state , presetting flip - flop ff 1 27 and its q output d 1 7 to the logic 1 state , thus establishing the etm and resetting all other flip - flops of the sipo shift registers 28 , 29 , except for flip - flop ffsel 17 , which is not affected by rst signal 4 . this resetting also resets ends signal 8 s , endd signal 8 d , and end signal 8 , and drives two - input and gate g 1 10 and its output ok signal 11 to the logic 0 state . transmission begins when the transmitting device has set the first data bit on - line and sends the first clock pulse , clk signal 5 , which clocks new data 6 into flip - flop ff 1 27 , and advances the etm preset into flip - flip ff 1 2 of the applicable sipo shift register , 28 or 29 . successive pulses of clk signal 5 continue to advance the etm until the fifteenth pulse advances it , in the cases illustrated , to flip - flop ff 16 of sipo shift register 28 or 29 for a transmission of short expected length , or until the twenty - third pulse advances the etm to flip - flop ff 24 of sipo shift register 28 or 29 for a transmission of the longer , default expected length . when flip - flop ffsel 17 has been set to a logic 1 for a transmission of short expected length and flip - flop ff 16 of sipo shift register 28 or 29 contains the etm , the etm is sent via ends signal 8 s to two - input and gate g 2 18 . with q output 22 of flip - flop ffsel 17 and ends signal 8 s both in the logic 1 state , two - input and gate g 2 18 and its output 23 go to the logic 1 state , and a logic 1 is sent to and is passed by two - input or gate g 3 19 via its output 30 to the d input of flip - flop ffok 16 . the sixteenth pulse of clk signal 5 will set flip - flop ffok 16 to the logic 1 state , setting its q output 8 to the logic 1 state . at this time , flip - flop ffbt 3 is in the logic 0 state . the combination of q output 8 of flip - flop ffok 2 and the inverted q output 9 of flip - flop ffbt 3 both in the logic 1 state , drives two - input and gate g 1 10 and its output signal ok 11 to the logic 1 state , thereby indicating receipt of a valid transmission of expected length . when flip - flop ffsel 17 has been set to a logic 0 for an anticipated data transmission of a long , or default expected length , and the etm has been advanced until flip - flop ff 24 of sipo shift register 28 or 29 contains the etm , the etm is sent via endd signal 8 d to two - input or gate g 3 19 and is passed via its output signal 30 to the d input of flip - flop ffok 16 . the twenty - fourth pulse of clk signal 5 will set flip - flop ffok 16 to the logic 1 state , likewise setting its q output 8 to the logic 1 state . at this time , flip - flop ffbt 3 is in the logic 0 state . the combination of the q output 8 of flip - flop ffok 2 and the inverted q output 9 of flip - flop ffbt 3 , both in the logic 1 state , drives two - input and gate g 1 10 and its output signal ok 11 to the logic 1 state , indicating receipt of a valid transmission having an expected length . receipt of any additional pulses of clk signal 5 in excess of sixteen , for a transmission of short expected length , or in excess of twenty - four , for a transmission of long , or default expected length , will drive flip - flop ffbt 3 and its q output , bt signal 12 , to the logic 1 state , indicating receipt of a bad transmission consisting of too many bits . inverted q output 9 of flip - flop ffbt 3 , now in the logic 0 state , drives the two - input and gate g 1 10 and its output , ok signal 11 , to the logic 0 state , terminating ok signal 11 . flip - flop ffbt 3 , once set to the logic 1 state , cannot be reset by additional pulses of lk signal 5 , as its k input 13 is connected logic ground . several specific embodiments of the present invention have been illustrated . however , there are many ways to implement the invention due to the various possible combinations of available logic elements that can be configured to achieve the same results . the circuits can be implemented using any of a multitude of technologies , such as rtl , dtl , cmos , pmos , nmos , ecl , ttl , lsttl or discrete components , such as resistors , transistors , diodes , etc . | 6 |
often in the past , electrical wallbox - mounted door bell chimes have been used through the hotel industry . they were single - gang chimes . these chimes may typically include buttons and indicators to set and clear room status information , such as privacy / do not disturb ( dnd ) and service / make - up - room . for the reason of having these features reasonably accessible to the user , most of the time , door bell chimes may be mounted in the entry way . this mounting may typically require a double gang box at the same location where a light switch or dimmer is mounted that is used to operate a light load external to the device , e . g ., a lighting fixture , in a hallway or an entry of the guestroom . “ room ” noted herein may refer to a unit in a hotel , motel , multiplex residence , multi - party home , and the like . “ room ” here may refer to the unit which incorporates integral rooms . the term “ room ” as referred to in the present description may actually contain one or more integral rooms such as a bathroom , a sleeping area , a study , a closet , and so forth within the room . “ room ” may also refer to a suite which could have one or more integral rooms within the room or suite . in retrofit applications , there generally are no spare gangs at the wallboxes of guestrooms . adding a door bell device may typically require one to either change the wallbox or to completely rewire the wallbox . in some retrofit instances , changing the wallbox is not necessarily an option as there is often no space available to mount another or larger box . rewiring might demand expensive labor and sometimes is not necessarily possible because of limitations as to what can be done structurally to the room . combining the parts of a door bell ( sounder ) with the light actuating device , such as a relay or dimmer , may elegantly solve this dilemma and create competitive advantages because of greatly reduced costs of adding a door bell system to an existing component of a room . there may be an integration of a relay , fet or triac to operate a lighting load , chime circuitry containing a sound outputting device such as a speaker , a user actuated interface such as a push button to operate a light , a user actuated interface to operate the status of one of privacy / do not disturb or service / make - up - room and a power supply to operate this device . adding a wired or wireless communication capability to signal the status of privacy / dnd or service / make - up - room to one or multiple auxiliary locations , such as hallway plates or central status monitoring systems , may be incorporated . the communication capability to allow control of the light actuating device from remote locations may be utilized . the communication capability to control other devices in a building automation system by assigning additional functions to the buttons of the device may be utilized . the present device may feature a light actuator , an rf wireless radio subsystem , and importantly have a replacement of a light switch in a single gang electrical box without needing further fabrication . the term “ present ” may refer to the device , assembly , approach system , and the like that is the subject of this description and claims . one may imagine for example a hotel entry door situation . when one enters through the door , just to the left or right , there may normally be a single gang wall box that contains a switch that controls , for example , a light above in the hallway of the room . with the present device , one may replace the normal wall switch with the new device that not only can switch the light itself but contain all elements of a door bell , and can communicate through a wireless medium along with other aspects of a building control system or a guest room . without the presented solutions , one may have to , at great costs , replace the single gang box with a double gang box ( which may include dry wall work and electrician work ) and then install two devices side - by - side ( e . g ., a networkable light controller and a door bell or chime device ). this present state of affairs may be greatly improved and overcome by the present device . the present device may have two switches for selection of “ do not disturb ” ( dnd ) and a “ make up room ” ( mur ). the guest may choose either the dnd or mur functions without opening the guest room door . if dnd is pressed , a lettered , backlit “ do not disturb ” indicator may be displayed on the external door plate . if mur is selected , a discreet led indicator , readable only by hotel staff , may be displayed on the external plate . the “ do not disturb ” and “ make up room ” functions may be activated from the plate , or from any one of other guestroom control devices . when one of the dnd or mur switches on the present device is pressed , a small led inside the switch may be illuminated , so that the guest knows that function has been activated . additionally , when the dnd command is activated by the guest , the present system may also disable the door chime , divert incoming calls to voice mail , and cancel any active mur requests . as to guest status , dnd and mur requests may be automatically reported to a floor status monitor for use by housekeeping and other staff . both conditions may be automatically cancelled upon guest check out . the present device may be is mounted in one of several ways . when installed during construction , a standard , single gang low - voltage junction box may be mounted directly on the wall stud , and the present device may be secured to the wall stud with standard screws , or the original component may be replaced with the present device in the same space . the present device may incorporate an aesthetically pleasing faceplate , a dnd feature that reduces intrusions on guests , a mur feature that lessens housekeeping labor , eliminates the expense and need for bothersome hanging doorknob tags , enhances guest satisfaction , and so on . no . 8 mounting screws may be vertically placed about 3 . 28 inches apart if the mounting is a typical standard single gang junction box . a minimum box depth of about 1 . 25 inches may be required . the device may have , for instance , example dimensions of about 3 . 9 ″ h × 1 . 7 ″ w × 1 . 2 ″ d . the dimensions may be other ones as long as the device fits in the single gang junction box or other desired and / or already pre - installed box . the dimensions may different for another kind of box . the present device may also have other specifications . the present system and approach , as described herein and / or shown in the figures , may incorporate one or more processors , computers , controllers , user interfaces , wireless and / or wire connections , and / or the like , wherever desired . fig1 is a diagram showing an example of available space for a multi - functional item such as an interface assembly in a guestroom that may replace such things as a light switch assembly 11 situated in a wall of the room . fig2 is a diagram of a replacement item 25 on the room wall . fig3 is a diagram of a wall plate 12 that may be removed from a switch 13 and a single gang electrical connection box 14 . switch 13 may be removed from the single gang box 14 . item 25 may be connected to the wires in box 14 and inserted into box 14 . item 25 may be , for example , regarded as an interface assembly 25 . fig4 illustrates interface assembly 25 for insertion in connection box 14 of fig3 . diagram 26 is a front view of interface assembly 25 . diagram 27 is a perspective view of interface assembly 25 . slots 28 may be for emanating sound such as chimes and audio messages . slots 28 may be utilized for receiving sounds such as those of voice for a microphone . switches 31 and 32 may be for indicating “ privacy ” or “ do not disturb ”, and for “ service ” or “ make up room ”, or controlling the switched light load . there may be more switches for requesting other actions and for restraint or stoppage of certain actions . each switch may have an led light 33 which indicates an activation of a request made by pressing the respective button 31 or 32 . three wires 21 , 22 and 23 such as a phase , neutral and load wires , respectively , may be connected to interface assembly 25 . in some cases or areas of location , there may be a ground or earth wire connected to assembly 25 . switch 31 may be a rocker switch with a middle neutral or off position . it may be labeled as “ privacy ”, mur ( make up room ), service and dnd ( do not disturb “, or other applicable terminology . switch 31 may be spring loaded in that if one presses it to the left side it may make a momentary contact to activate the mur indication to housekeeping , and others as applicable . switch 31 may be pressed to the right side , in the same manner as to the left side , to make a momentary contact to activate the dnd indication to housekeeping , and others as applicable . switch 32 may be a single action button switch or it may be a rocker switch like switch 31 . as a button , switch 32 may be for turning on or off a load . as a spring loaded rocker switch that returns to a middle position with out external pressure , switch 32 may be pressed to the right to click or turn on power to the load or to the left to click or turn off the load . switch 32 still as a rocker switch may be pressed to the right to turn power on to some extent or to left to turn off power to some extent . the extent may mean the when the switch is held down to the right side , the amount of voltage applied to the load gradually increases and stops at a voltage when the switch is no longer held down . the extent may also mean the when the switch is held down to the left side , the amount of voltage applied to the load gradually decreases and stops at a voltage when the switch is no longer held down . holding the switch down to the left will eventually result in zero voltage to the load likewise , holding the switch down to the right will eventually result in a maximum voltage applied to the load . the load may be an entry hall light in the room which may be increased or decreased in intensity with switch 32 being utilized as a dimmer switch . alternatively , switch 32 may be a momentary contact button or an on / off toggle switch . assembly 25 may have additional switches for various other functions , such as adjusting , for example , a thermostat temperature , fan speed , or speaker volume . also , switch 31 , switch 32 and other possibly added switches implemented in interface assembly 25 may be selected from an assortment of various types of switches not necessarily mentioned herein . fig5 is a diagram of a set of views of a housing 35 of an example version of interface assembly 25 used in lieu of an electrical component in a connection box such as box 14 in fig1 . side , end , front and back views 36 are shown . not all components of interface assembly 25 are necessarily shown in fig5 . fig6 is a diagram showing a perspective view 37 of housing 35 . fig7 is a schematic of an example electronics circuit 60 of an interface assembly 25 for an existing connection box 14 previously having had a different electrical component 13 such as a switch for a load 61 like an entry hall light . other circuit designs may be used for electronics 60 . when the electrical component 13 such as a light switch as in fig1 is removed from connection box 14 , a replacement item being like interface assembly 25 , may have electronics , for example , like that of circuit 60 . several wires may exist in box 14 after the previous component 13 is removed . the wires may be a neutral line 51 ( e . g ., ground ), a phase line 52 ( e . g ., 112 vac ) and a load wire 63 . lines 51 and 52 may go to a power supply 53 for converting a line voltage to different magnitudes of voltage for various portions of the circuit such as micro controller 54 , rf receiver and transmitter ( e . g ., a transponder ) 55 , amplifier 56 , indicating mechanism 57 , and so forth . line 52 may also be connected to a load actuator 58 which can be an electrically operated switch , such as a triac , fet , relay and so forth , for controlling power via wire 63 to load 61 , which may be a light , fan , or some other device or appliance . amplifier 56 may be a driver of signals from the microcontroller 54 to a speaker 59 . load actuator 58 may be , for example , an electrical replacement of the electrical component 13 removed from box 14 such as a switch , dimmer or other item . actuator 58 may be connected to electrical load 61 which could be a hall light , or other device or appliance generally in the room controlled by interface assembly 25 . microcontroller 54 may be connected to load actuator 58 and to an rf receiver and transmitter 55 . a keypad 62 , having such things as switches , may be connected to microcontroller 54 . inputs to keypad 62 may provide signals for controlling load actuator 58 , receiver and transmitter 55 , sound output to amplifier 56 and speaker 59 , and sound input from microphone 59 . various requests , such as room privacy and service , and information may be input at keypad 62 for microcontroller to be appropriately provided as signals to be transmitted from transmitter 52 to various places like recipients in the multi - room building . signals via the wireless transponder 55 may be provided in lieu of signals from keypad 62 , for example , such as signals to load actuator 58 . fig8 is a diagram revealing a door chime sending unit 71 for the outside of an entry door for a guest room . unit 71 may have a button or switch 72 for providing a bell or chime signal to interface assembly 25 . unit 71 may have a wireless transmitter that sends the signal to receiver 55 of circuit 60 of the interface assembly , which in turn provides a bell or chime sound over speaker 59 and emanating through slots 28 of assembly 25 ( fig4 ), provided that the do not disturb selection is not activated at the interface assembly . the bell or chime signal may instead be sent from unit 71 to apparatus 25 via a wire connection . in a similar manner under the same conditions , a person such as a housekeeper with an appropriate activation mechanism may speak or provide an audio message via a microphone 73 to the room guest . assembly 25 may be a recipient of messages and announcements that are public in nature relative to the multi - room building . if do - not - disturb selection is activated , the messages and announcements will not necessarily be provided to speaker 59 . however , high priority messages , such as emergency messages , will be provided to speaker 59 despite the activation of the do - not - disturb selection . sounds for speaker 59 , such as alert alarms and fire siren sounds , may also override the do - not - disturb selection . fig9 is a diagram of a unit 71 proximate to an entry door for each of the rooms . unit 71 may also provide visual messages to , for example , housekeeping or other staff in a display 74 as shown in fig9 . the visual messages may incorporate “ do not disturb ”, “ make up room ”, and other information . information on display 74 will not necessarily be visible to just anyone walking down the hall . a housekeeping staff member may use a secret button in the hallway , a key , code or other mechanism in order to see the information on display 74 . these messages may also be transmitted to a wireless receiver in unit 71 from transmitter 55 of circuit 60 in the wall interface assembly of the guest room . the housekeeping staff member may provide or leave a message or response via unit 71 for the room guest . signals between unit 71 and assembly 25 may instead or also be conveyed by wire . signals between other places and apparatus 25 may be sent and received via wire or wireless media . to recap , a system , for installation of an interface assembly , may incorporate an electrical box in a wall of a room for an electrical component , and a room occupant interface assembly installed in the electrical box in lieu of an electrical component . the interface assembly may incorporate an audio speaker , a first switch mechanism for controlling a load in the room , and a second switch mechanism for sending a make - up - room message or a do - not - disturb message . the electrical box may be a single gang electrical box . the load may be a light in the room . the interface assembly may further incorporate a microcontroller connected to the first and second switch mechanisms , the audio speaker and / or a microphone connected to the microcontroller , and a transmitter and / or receiver connected to the microcontroller . if a switch mechanism is activated for a certain action , then a light proximate to or in the switch mechanism may light up to indicate that the action has been activated . if an action has been activated with the second switch mechanism , then the action may be reported to a main desk or floor status monitor for reference by housekeeping or other staff , respectively . a signal for reporting an action to the main desk or floor status monitor may be communicated via a transmitter of the interface assembly to a receiver that receives the signal via a wire and / or wireless mechanism for the main desk or floor status monitor . the system may further incorporate a third switch mechanism attached proximate to outside of an entry door to the room . the third switch mechanism may transmit a signal to the interface assembly for sounding a chime or providing a notice or message for a room occupant . the system may further incorporate a faceplate situated outside a door of the room . the faceplate may indicate to a housekeeping staff a status of the room . the faceplate may have a receiver that receives signals from the interface assembly for indicating any message such as make - up - room or do - not - disturb provided by the room occupant . an electrical assembly for a room may incorporate an interface component for insertion in a single gang electrical box of a room . the interface component may have a microcontroller , a chime connected to the microcontroller , and a load actuator for controlling a load in the room . the load may be a light in the room . the load actuator may be selected from a group consisting of a relay , a triac and a fet . the assembly may further incorporate a wireless transponder connected to the microcontroller . the assembly may also incorporate a switch for requesting room service and / or privacy . the switch may be connected to the microcontroller . the assembly may further incorporate a switch for controlling a state of the load actuator . the switch may be connected to the load actuator . the assembly may also incorporate a switch , for controlling a state of the load actuator , in a remote device . the switch may be connected to the wireless transponder . the interface component may replace an already existing electrical component in the electrical box . the electrical component may be a light switch . the speaker may be capable of outputting a chime sound and an audio stream . if a switch is effected for privacy , then the speaker may be disabled except for emergency messages and sounds , incoming calls may be diverted to voice mail , and / or room service may be cancelled . an approach , for installing an interface component assembly in a room , may incorporate installing an interface component in an existing electrical box or space for an electrical box in the room . the interface component may have an audio speaker , and a load actuator for controlling a load in the room . the load may be a light in the room . the electrical box may be a single gang electrical box . the speaker may provide a chime sound and / or an audio stream . the existing box may be for a light switch . the room may be in a multi - room building , such as a hotel , motel , multiplex residence , and the like . the interface component may have a microcontroller connected to one or more switches , a load actuator and the speaker , and have a wireless transponder connected to the microcontroller for receiving signals to provide the chime sound or audio stream to the speaker and / or for sending signals from the interface component to request privacy or room service . the approach may further incorporate a button outside of and by an entry door to the room in a common hallway of a multitude of rooms , for sending a signal to sound a chime via the speaker in the room . u . s . pat . no . 7 , 053 , 757 , issued may 30 , 2006 , and entitled “ intelligent door plate and chime ”, is hereby incorporated by reference . in the present specification , some of the matter may be of a hypothetical or prophetic nature although stated in another manner or tense . although the present system and / or approach has been described with respect to at least one illustrative example , many variations and modifications will become apparent to those skilled in the art upon reading the specification . it is therefore the intention that the appended claims be interpreted as broadly as possible in view of the related art to include all such variations and modifications . | 7 |
the applicant has recognised that the photosensitisation and resulting uv induced refractive index change occur essentially via a two - step process which may be described by the following reaction equation : a → k 1 b → k 2 c k 1 and k 2 are the rate coefficients describing the transformation of species a to species b and subsequently b to species c . the nature of the these species is uncertain and will vary for different material , but c is believed to be related to one or more forms of a gee ′ centre in germanosilicate . the rate of formation of c , which is related to the final index change achieved in this mechanism , depends on the consumption of b . however , b is not constant since it is itself formed from a . it is believed that the formation of b itself also results in an intermediate index change . from reaction theory , the rate coefficients of formation for the species are : integrating , subsequently substituting where necessary whilst noting that the sum of the concentrations of all the species at any given time must equal the initial concentration of a , [ a ] 0 , leads to the following solutions for the evolution of each species concentration as the reaction progresses with time : a plot of the growth and decomposition of the species , normalised with respect to the initial concentration of a , [ a ] 0 , with time is shown in fig1 . in fig2 the resultant overall refractive index change 100 as a function of fluence is plotted . one can deduce from this model that there is an optimum fluence at which the pre - exposure will be most efficient . this will coincide with the maximum concentration of b , i . e . when the material is most “ photosensitive ” in terms of refractive index changes through formation of c . this point coincides with the roll - over point from the main contribution of the refractive index change coming from formation of species b to the main contribution coming from formation of species c . once grating writing is completed after the pre - exposure , only the unexposed regions ( during the grating writing ) retain the contribution of b whereas the peak exposures experience transformation of b to form c . thus a maximum index contrast per grating writing exposure time can be achieved between the exposed and the un - exposed areas . it is further proposed that in the above model hydrogen plays a catalytic role in enhancing the process — this is supported by the experimental observation that the out - diffusion of hydrogen does not affect strong grating writing within a photosensitised fibre and no significant hydrogen species formation occurs . for example , b may involve ge — h radical formation since this bond has been shown to increase the 240 nm absorption band . however , this step may not contribute overall directly to the index change other than through an increase in the concentration of b , i . e . enhanced absorption sites for formation of c . in this case , it is predicted by the applicant that the thermal stability of an optical structure written in accordance with an embodiment of the present invention should be enhanced over conventionally - written structures in both hydrogen loaded and unloaded photosensitive materials . as mentioned above , c may involve gee ′ formation . consequently , with the exception of the kinetic rates and maximum saturable index , photosensitisation is identical in fibres with and without loading . this similarity indicates that the primary role of hydrogen is to prevent recombination and relaxation , which occurs in unloaded fibres , through alternative pathways and possibly through the dissociation of any hydride formation . the procedure for photosensitising the fibre is outlined in fig2 . the fibre 10 is loaded with hydrogen 12 at a temperature of 353k and pressure of 200 atm for one day . it is then uniformly exposed to cw 244 nm (˜ 3 w / cm 2 ) light 14 from a frequency - doubled ar + laser ( not shown ) by scanning the beam over 1 cm of fibre ( see the upper drawing in fig2 ). a single pass over 1 cm at 10 mm / s was used giving a total fluence of ˜ 50 j / cm 2 . for reference , another piece of similarly hydrogenated fibre was not presensitised . the fibres 10 were then left out in room temperature for 15 days to allow hydrogen out - diffusion prior to grating writing at 244 nm ( see the middle drawings in fig2 ). the 1 cm gratings 16 were written by scanning the beam over one or more passes ( 2 mm / min , fluence : ˜ 600 j / cm 2 , power density : 330 mw / mm 2 ) ( see the lower drawing in fig2 ). the results are summarised in fig3 . without presensitisation , the grating strength possible after out - diffusion was ˜ 4 . 3 db ( curve 20 ). for the same fluence in the 244 nm pre - sensitised fibre the grating strength was ˜ 21 db after out - diffusion ( curve 22 ). also shown is data for a grating written into an unhydrogenated fibre ( curve 24 ). subsequently , gratings were written into several fibres pre - exposed with varying amounts of initial sensitisation fluence . identical writing conditions were maintained and the results are plotted in figure . 4 . the writing fluence used was the same as that above , ˜ 600 j / cm 2 . an optimum sensitisation fluence can be observed at 50 j / cm 2 . clearly , beyond this value the benefit of continued pre - exposure diminishes . the maximum grating strength obtained was ˜ 21 . 5 db under the writing fluence used . the above experiments were repeated using a pre - sensitising wavelength at 193 nm from a pulsed arf laser instead of cw 244 nm . this was to determine whether the chemical route for photosensitisation was sufficiently generic to account for the behaviour observed at other wavelengths . in addition , there is some interest in using the higher energy densities of the pulsed halide gas lasers to accelerate the pre - sensitisation process whilst confining coherent cw sources for the often complex grating writing procedures . different fluences were used and subsequent grating writing was carried out at cw 244 nm under identical conditions to that listed above . the results are shown in fig5 . cross - mixing of the wavelengths is possible , indicating common defect sites involved in both pre - sensitisation methods . however , the required fluence is substantially larger (˜ 120 j / cm 2 ) and the maximum grating strength is less (˜ 16 . 5 db ) for the same writing fluence of ˜ 600 j / cm 2 . it was also observed that even at very low 193 nm pre - sensitisation fluences where no effect was observed on grating strength , blue luminescence was strong . in order to account for differences in optimum pre - sensitisation fluence , the uv spectra of a preform similar to that used to fabricate the fibre was taken . a cary170 spectrophotometer flushed continuously with ultra - high purity nitrogen ( spectrally flat down to 180 nm ) capable of measuring from 190 to 1100 nm was used for the measurements . the preform core was milled out , polished and suspended in a quartz cell filled with doubly distilled and de - ionised water to assist reducing scattering losses off the milled core surface . the water was measured to be flat over the wavelength of interest and a calibration cell filled with the same water and a reference pure silica core was also used . multiple scans were taken at intervals to ensure reproducibility . fig6 shows the measured uv absorption spectrum of the preform core . the 193 nm absorption is substantially less than at 244 nm and the band edge of the glass is not seen above 190 nm . thus it can be concluded that the induced changes are achieved through an identical defect path using either wavelength during the pre - sensitisation stage , indicating that in germanosilicate fibres at least the dominant photosensitivity process is the same at both wavelengths . two - photon absorption processes are also unlikely to contribute to the index change within these fibres — instead , these may account for the relative decrease in grating strength obtained with pulsed 193 nm pre - sensitisation compared to that with cw 244 nm . annealing studies will now be described to investigate the thermal stability of the preferred embodiments of the present invention . the annealing studies were carried out between conventional strong gratings written directly into hydrogen loaded boron - codoped germanosilicate optical fibre and similar fibre pre - exposed with the hydrogen subsequently out - diffused . similar strength gratings were written into each fibre and subsequently annealed at three different temperatures . the aging data , together with fitted stretched exponential curves , are shown in fig7 and 8 . when expanded on a log scale it is observed that at low temperatures the pre - sensitised grating strength actually increases during the decay process , as shown in fig9 . this can be explained by noting that those regions which remain nominally unexposed during grating writing ( the troughs of the writing fringe ) have a faster decay than elsewhere since the species b which was created during pre - exposure has not been bleached to form c during grating writing . from the arrhenius plots shown in fig1 , one can obtain the necessary data to extrapolate the stretched exponential fits to 25 years and estimate the expected decay . for the fully hydrogen loaded case ( curve 30 ) the decay is around 68 %, in agreement with previous results for hydrogen loaded gratings . however , for the pre - exposed case ( curve 32 ) where the hydrogen is subsequently out - diffused prior to grating writing , the decay is only 0 . 1 %. this is better than most stabilised gratings indicating that thermal stabilisation of these gratings after writing is not necessary . further , the decay of conventional hydrogen loading gratings is found to be such that the final grating strength is less than the pre - sensitised gratings before its stability is assured over 25 years . as can be imagined this has major implications for grating manufacture — the removal of an entire phase of the production process has direct implications for commercial productivity . it will be appreciated by a person skilled in the art that numerous variations and / or modifications may be made to the present invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects to be illustrative and not restrictive . | 6 |
one embodiment of a wire electric discharge machine controller having a wire electrode replacement function according to the present invention will be described with reference to fig1 . a wire electric discharge machine controller 10 creates a machining path based on an axis movement command from a machining program and operates a wire electric discharge machine according to the machining program to move a wire electrode and a workpiece relative to each other along the created machining path , thereby machining the workpiece . the wire electric discharge machine controller 10 comprises a program operation control unit 16 , wire remaining lifetime monitoring unit 11 , electric discharge machining time calculation unit 12 , wire electrode replacement timing determination unit 13 , program operation stop command unit 14 , wire cutting control unit 17 , wire electrode replacement control unit 18 , wire connection control unit 19 , and program operation restart command unit 15 . the program operation control unit 16 executes the machining program . the wire remaining lifetime monitoring unit 11 monitors the remaining lifetime of the wire electrode . the electric discharge machining time calculation unit 12 analyzes the machining program and calculates , before the start of electric discharge , an electric discharge machining time in a machining interval before the electric discharge is stopped . the wire electrode replacement timing determination unit 13 determines that the timing of replacement of the wire electrode is reached if the remaining lifetime of the wire electrode is found by comparison to be shorter than the electric discharge machining time . the program operation stop command unit 14 outputs a command for stopping a program operation to the program operation control unit 16 when the replacement timing is reached . the wire cutting control unit 17 outputs a command for cutting the wire electrode to a wire cutting unit 20 and monitors the completion of cutting of the wire electrode . the wire electrode replacement control unit 18 outputs a command for replacing the wire electrode to wire electrode replacement unit 21 and monitors the completion of replacement of the wire electrode . the wire connection control unit 19 outputs a command for connecting the wire electrode to a wire connection unit 22 and monitors the completion of connection of the wire electrode when the replacement of the wire electrode is completed . the program operation restart command unit 15 outputs a command for restarting the program operation to the program operation control unit 16 when the connection of the wire electrode is completed . the wire electrode replacement timing determination unit 13 has a function of calculating the ratio between the remaining lifetime of the wire electrode and the electric discharge machining time and determining that the timing of replacement of the wire electrode is reached if the calculated ratio is smaller than a predetermined value . alternatively , the wire electrode replacement timing determination unit 13 may have a function of calculating the difference between the remaining lifetime of the wire electrode and the electric discharge machining time and determining that the timing of replacement of the wire electrode is reached if the calculated difference is smaller than a predetermined value . further , a robot may be employed as the wire electrode replacement unit . the following is a description of elements of the wire electric discharge machine controller 10 . the wire electrode used in the wire electric discharge machine is a wire - like electrode that serves to generate electric discharge . a wire wound on a bobbin in the wire electric discharge machine is drawn out , electrically discharged , and collected directly into a collection box or the like for disposal . the remaining lifetime of the wire electrode can be monitored according to the operating time of the machine . since the weight , length , and diameter of the wire wound on the bobbin are settled , the remaining lifetime of the wire electrode can be more strictly monitored based on these data and the feed rate of the wire that varies depending on each machining condition . the wire remaining lifetime monitoring unit 11 monitors the remaining lifetime and remaining amount of the wire electrode and outputs the remaining lifetime . the remaining lifetime of the wire electrode may be monitored in the following manner . ( 1 ) the preset lifetime of the wire electrode is compared with the operating time of the machine after replacement with a new wire electrode . ( 2 ) the consumption of the wire electrode is measured based on various set values ( weight , length , diameter , feed rate , etc ., of the wire ) of the wire electric discharge machine , and the time for the full consumption of the wire electrode is estimated . further , the remaining lifetime and remaining amount of the wire electrode may be monitored by using the means disclosed in japanese patent application laid - open no . 2010 - 179377 or 2003 - 25155 . the electric discharge machining time calculation unit 12 analyzes the machining program , calculates , before the start of electric discharge , the electric discharge machining time in the machining interval before the electric discharge is stopped next , and outputs the electric discharge machining time . the analysis of the machining program and the calculation of the electric discharge machining time are performed in the following manner . fig2 is a diagram showing workpiece machining based on machining programs shown in fig3 . fig3 is a diagram showing examples of the machining programs such that machining is repeated three times . the wire electrode is moved relative to the workpiece along a machining path 31 from a machining start point 30 as the machining is performed . when the wire electrode returns to the machining start point 30 , the wire is cut , and the workpiece and a wire guide supporting the wire electrode are relatively moved by rapid traverse 32 and positioned at the next machining point . thereupon , the machining is started . in the case where the machining is repeated three times , as shown in fig2 and 3 , electric discharge machining is performed in an interval for cutting feed in which g 01 is commanded in the machining program . problem occurs that the machined surface quality is degraded if electric discharge is suspended in this interval . therefore , the machining time in this interval is calculated before g 01 is commanded . specifically , the length of this interval can be obtained from a movement command by g 01 , and the machining time in this interval can be calculated based on a set machining speed included in machining conditions ordered by an s - code command and the interval length . it is necessary , therefore , only that this processing be repeated every time this interval is called . in this example , moreover , the g 01 command is monitored as the machining time is calculated . alternatively , however , a dedicated m code may be provided such that machining times in subsequent electric discharge machining intervals can be calculated . in the case of such machining , an operator conventionally replaces the wire electrode with the program operation suspended after the end of the electric discharge machining interval by using an optional stop command of m 01 while monitoring the remaining lifetime of the wire electrode . in another example , machining based on machining programs set up in the manner shown in fig4 and 5 is repeated three times . although the machining shape is the same as that in example 1 , the machining programs may be set up in this manner depending on the machining content . the wire electrode is moved relative to the workpiece along the machining path 31 from the machining start point 30 as the machining is performed . when the wire electrode returns to the machining start point 30 , the wire is cut , and the workpiece and the wire guide supporting the wire electrode are relatively moved by the rapid traverse 32 and positioned at the next machining point . thereupon , the machining is started . when the machining of the last region is finished , the wire electrode returns to the first machining start point 30 by rapid traverse 33 . also in this case , electric discharge machining is performed in the interval for cutting feed in 1 which g 01 is commanded in the machining program . the problem occurs that the machined surface quality is degraded if electric discharge is suspended in this interval . therefore , the machining time in this interval is calculated before g 01 is commanded . specifically , the length of this interval can be obtained from the movement command by g 01 , and the machining time in this interval can be calculated based on the set machining speed included in the machining conditions ordered by the s - code command and the interval length . it is necessary , therefore , only that this processing be repeated every time this interval is called . in this example , moreover , the g 01 command is monitored as the machining time is calculated . as in the case of example 1 , however , the dedicated m code may be provided such that the machining times in the subsequent electric discharge machining intervals can be calculated . also in the case of such machining , the operator conventionally replaces the wire electrode with the program operation suspended after the end of the electric discharge machining interval by using the optional stop command of m 01 while monitoring the remaining lifetime of the wire electrode . the wire electrode replacement timing determination unit 13 compares the remaining lifetime of the wire electrode received from the wire remaining lifetime monitoring unit 11 and the electric discharge machining time received from the electric discharge machining time calculation unit 12 to determine the timing of replacement of the wire electrode and outputs the result of the determination . specifically , it may be determined that the timing of replacement of the wire electrode is reached if ( remaining lifetime )/( electric discharge machining time )& lt ; a ( a is a constant ) is given , or that the timing of replacement of the wire electrode is not reached if ( remaining lifetime )/( electric discharge machining time )& gt ; a is given . although a is normally 1 , it may be a predetermined value obtained by multiplication by a safety factor . alternatively , it may be determined that the replacement timing for the wire electrode is reached if ( remaining lifetime )& lt ;( electric discharge machining time ) is given , or that the replacement timing for the wire electrode is not reached if ( remaining lifetime )& gt ;( electric discharge machining time ) is given . alternatively , moreover , it may be determined that the replacement timing for the wire electrode is reached if ( remaining lifetime )−( electric discharge machining time )& lt ; b ( b is a constant ) is given , or that the replacement timing for the wire electrode is not reached if ( remaining lifetime )−( electric discharge machining time )& gt ; b . although b is normally 0 , it may be set to a value other than 0 in anticipation of safety . the program operation stop command unit 14 outputs a program operation stop command to the program operation control unit 16 if the determination result received from the wire electrode replacement timing determination unit 13 indicates that the replacement timing is reached . the program operation restart command unit 15 outputs a program operation restart command to the program operation control unit 16 after the connection of the wire electrode is completed . the program operation control unit 16 executes the machining program to control the program operation . on receiving the program operation stop command from the program operation stop command unit 14 , the program operation control unit 16 stops the program operation . on receiving the program operation restart command , it restarts the program operation . if the determination result received from the wire electrode replacement timing determination unit 13 indicates that the replacement timing is reached , the wire cutting control unit 17 outputs a wire electrode cutting command to the wire cutting unit 20 and confirms the completion of cutting of the wire electrode . the cutting command may alternatively be output after the stop of the program operation is confirmed . if the determination result received from the wire electrode replacement timing determination unit 13 indicates that the replacement timing for the wire electrode is reached , the wire electrode replacement control unit 18 outputs a wire electrode replacement command to the wire electrode replacement unit 21 and confirms the completion of replacement of the wire electrode . the replacement command may alternatively be output after the cutting of the program operation is confirmed . the wire connection control unit 19 outputs the wire electrode connection command to the wire connection unit 22 and confirms the completion of connection of the wire electrode after the replacement of the wire electrode is completed . the wire cutting unit 20 cuts the wire electrode on receiving the wire electrode cutting command from the wire cutting control unit 17 . the wire electrode replacement unit 21 replaces the wire electrode on receiving the wire electrode replacement command from the wire electrode replacement control unit 18 . an industrial robot may be used as the wire electrode replacement unit 21 . the wire connection unit 22 connects the wire electrode on receiving the wire electrode connection command from the wire connection control unit 19 . fig6 is a flowchart showing control of the wire electric discharge machine controller of fig1 . the following is a sequential description of various steps of operation . [ step sa 01 ] monitoring of the remaining lifetime of the wire electrode is started . [ step sa 02 ] the machining program is analyzed and executed . [ step sa 03 ] it is determined whether or not a block in the machining program is a start block for electric discharge machining . if the block is the start block for electric discharge machining ( yes ), the processing proceeds to step sa 04 . if not ( no ), the processing proceeds to step sa 14 . [ step sa 04 ] the electric discharge machining time is calculated . [ step sa 05 ] it is determined whether or not the wire electrode replacement timing is reached . if it is determined that the replacement timing is reached ( yes ), the processing proceeds to step sa 06 . if not ( no ), the processing proceeds to step sa 14 . [ step sa 08 ] it is determined whether or not the wire electrode cutting is completed . if the cutting is completed ( yes ), the processing proceeds to step sa 09 . if not ( no ), the processing proceeds to step sa 09 after completion of the wire electrode cutting is awaited . [ step sa 09 ] the wire electrode replacement command is output . [ step sa 10 ] it is determined whether or not the wire electrode replacement is completed . if the replacement is completed ( yes ), the processing proceeds to step sa 11 . if not ( no ), the processing proceeds to step sa 11 after completion of the wire electrode replacement is awaited . [ step sa 11 ] the wire electrode connection command is output . [ step sa 12 ] it is determined whether or not the wire electrode connection is completed . if the connection is completed ( yes ), the processing proceeds to step sa 13 . if not ( no ), the processing proceeds to step sa 13 after completion of the wire electrode connection is awaited . [ step sa 14 ] it is determined whether or not the machining program is terminated . if the machining program is terminated ( yes ), this control processing ends . if not ( no ), the processing returns to step sa 01 , whereupon the control processing is continued . | 1 |
the present invention will be explained in regard to the preferred embodiment with reference to the attached drawings . fig1 shows an outer appearance of the sewing machine provided with a device of the invention , in which a reference numeral 1 is a machine housing , 2 is a pattern selecting panel , reference mark sw p indicates collectively a row of pattern selecting switches , and when any one of them is pushed , this operated part is electronically memorized in a control part ( not shown ) installed in the sewing machine . the reference numeral 3 collectively shows lightening lamps for indicating the operated parts of the pattern selecting switches . 4 shows collectively a number of stitch pattern indications each provided in correspondence to each of the pattern selecting switches sw p . 5 is a fine adjustment device of a needle swinging amplitude , and 6 is a fine adjustment device of a fabric feed , and these devices can be manually turned into a clockwise direction or into a counterclockwise direction so as to adjust later mentioned variable resistors respectively . on the other hand these devices 5 , 6 may be pushed to close the switches respectively which are to be mentioned later . 7 and 8 are indicating lamps which are lighted when these fine adjustment devices are made operative by the rotating or pushing operation thereof . fig2 is a fine adjustment circuit for controlling the needle swinging amplitude or the fabric feed . the control circuit includes a central processing unit cpt in common , mm is monostable multivibrator , which may be a μpc 1555c manufactured by nippon electric co ., ltd . the monostable multivibrator has a threshold terminal th and a discharging terminal d connected to each other . the junction receives an electric voltage of a capacitor c which is charged , via a variable resistor vr , by a d . c positive control power source vcc as shown . the discharging terminal d is always operative for discharging the capacitor . cp is a trigger terminal , which receives a pulse signal to make the discharging terminal d inoperative , and at the same time causes the output terminal q to produce a signal of constant level . when the input of the threshold terminal th becomes more than a determined level of the monostable multivibrator mm , it stops the signal from the output q . the variable resistor vr is decreased or increased in its resistance value by rotating , in one direction , the fine adjustment device 5 ( or 6 ) shown in fig1 . thus the variable resistor vr , together with the capacitor c , determines the charging time constant . cpu is a central processing unit of a micro - computer , which is connected to a memory device ( not shown ) to carry out a later mentioned programming control and a memory control based on the operation of the pattern selecting switch sw p and produces at the output terminal po a clock pulse to a trigger terminal cp of the monostable multivibrator mm . the cpu receives at the input terminal pi the output signal q of the monostable multivibrator mm , and digitally counts up the output signal by means of a register ( not shown ) while the output signal is produced . sw r is a fine adjustment switch which is closed by pushing the fine adjustment device 5 ( or 6 ) during its pushing period and at this time gives a control voltage vcc to the central processing unit cpu . the operation of the above mentioned control circuit will be explained in reference to the flow chart in fig3 . when a power source including the control power source vcc is applied , a programm in fig3 is started . a first resistor reg 1 in the central processing unit cpu is set to an initial value o . the discharging terminal d of the monostable multivibrator mm is prepared operative and the capacitor c is under a noncharging state . when the clock pulse po is given to the trigger terminal cp of the monostable multivibrator mm , the monostable multivibrator mm gives an output at the output terminal q to the monostable signal input terminal pi of the cpu . then the register reg 1 progressively increases at a fixed period while the output signal is produced . at the same time , the discharging terminal d is nullified , and the capacitor c starts charging via the resistor vr . the charging velocity is determined by the rotating position of the fine adjustment device 5 ( or 6 ). when the potential of the capacitor c , i . e ., the potential of the threshold terminal th reaches the determined value , the output q is stopped and the input pi becomes o . in the meantime , the register reg 1 progressively increases the stops . subsequently the central processing unit cpu reads out and memorizes the operated conditions of the pattern selecting switch sw p and the fine adjustment switch sw r . as a result , when any one of the pattern selecting switches sw p is operated , the needle swinging amplitude and the fabric feed are automatically set to form a standard stitch pattern , and a selected pattern is indicated by the lamp 3 . if the device 5 or 6 is pushed and it is detected that the fine adjustment switch sw r is closed , the automatic control is switched to that manual control for fine adjustment of a pattern , and the lamp 7 indicates it . in this case the fine adjustment device 5 or 6 was immediately pushed because the device had been rotated to a desired position . the stitches of the pattern may be reduced or enlarged in proportion to the position to which the device 5 or 6 is rotated . while the fine adjustment switch sw r is not operated , or after the order of switching to the manual operation is issued , a second resister reg 2 in the central processing unit cpu is set to the initial value o . the monostable multivibrator mm again gives the output to the input terminal pi of the cpu and the second resistor reg 2 progressively increases and stops just in the same manner as the first resistor reg 1 . at this time , if the fine adjustment device 5 is rotated in the clockwise or counterclockwise direction , the charging time of the capacitor c is differentiated from the previous one , and the resistors reg 1 and reg 2 are differentiated in the values from each other . difference between the values of the resistor reg 1 and the resistor reg 2 is calculated . if this difference is more than a predetermined value such as 2 , for example , the value of the register reg 2 is transferred into the first resistor reg 1 . then the manual operation is made effective and the indicating lamp 7 indicates it . when the fine adjustment switch sw r is not operated , or when there is a slight variance in the contact resistor , the difference between the values of the registers reg 1 , reg 2 is less than 2 . therefore , the value of the first resistor reg 1 is not transferred as said above in reference to fig3 and the previously ordered manual or automatic control is available . if these processes are finished , the switches sw p and sw r are read out and thus the loop is completed . if the operation is not changed , the first resistor reg 1 is not exchanged , and the reading - out , the calculation and the memorization are carried out at the high speed by said loop even if there is a time lag in the operations of the switches sw p , sw r and the variable resistor vr , and it is possible to form stitches of the desired automatically or manually set value . if the stitching is started , though not shown , each of the processes of fig3 is stopped . according to the present invention , when the pattern selecting switch is only operated , the predetermined stitch by the standard needle swinging amplitude and the fabric feed is formed , irrespectively of conditions before the selection of the pattern . when the controlling position of the fine adjustment device is only changed the manual set value is available at this position , and when the fine adjustment device had been already positioned at the desired value the manual set value is available at this position only by the pushing operation . | 6 |
referring to fig1 , a conventional tool has a shaft 12 with a distal end 14 on which is mounted a first ring 16 . welded within the open distal end of the ring 16 , side by side , are four nickel titanium shape memory alloys circular section wires 18 . all four distal ends of the wire 18 are welded within an end ring 20 spaced from the distal end 14 to the shaft 12 and itself representing a distal end of the device 10 . each of the wires 18 is given a bowed shape , as shown in the figure , by thermal treatment as is understood by those skilled in this art . the entire device is telescoped within a sleeve ( not shown ) having an inner diameter big enough to accommodate the rings 16 and 20 . for catching and removing foreign objects , the distal end of the sleeve is advanced to a desired location within the body and then the shaft 12 is advanced until the basket 18 opens just distally beyond the distal end of the sleeve . moving the sleeve , the medical practitioner fishes the target object into the cavity 22 within the basket defined by the wires 18 , and the shaft 12 is withdrawn proximally by a distance sufficient for the distal end of the sheath to squeeze the wires 18 onto the foreign object , thereby retaining it within the basket cavity 20 . then the sheath and shaft are together withdrawn proximally , carrying the object out of the body . the method of use of a tool in accordance with the present invention is similar . however , the manufacture of the tool is quite different , as can be seen from fig2 . fig2 shows a tool 40 based on a single length of tubing 42 having a lumen 44 which runs its full length . the tube is of nitinol shape memory alloy . near the distal end of the tube 42 is provided a plurality of slits , comprising a set of four first slits 46 arranged at ninety degree intervals around the circumference of the tube 42 . evenly spaced between each pair of first slits 46 are the slits of a set of four second slits 48 , again made by laser . fig2 shows a core wire 49 which can be placed within the lumen 44 , at the distal zone of the tubing 42 , if it is desired for the incident laser beam to penetrate only one wall thickness of the tubing 42 , and not go beyond the lumen 44 ( as would be appropriate if , for example , an arrangement of three first slits 46 , at 120 degree intervals around the circumference of the tubing 42 , were to be specified ). the length of the set of first slits 46 corresponds to the desired length of the object - catching basket of the tool 40 . now referring to fig3 , the basket of the fig2 tool can be seen in its spread disposition . just as nitinol stents are given a remembered dimension by heat treatment , so the tool of fig2 is given by heat treatment the basket shape illustrated in fig3 . thus , when the tubing 42 is advanced into a surrounding sheath , the strands 50 between adjacent first slits 46 , and the strands 52 , between adjacent first and second slits 46 , 48 , are squeezed down from the spread disposition of fig3 into the compact disposition shown in fig2 . then , when the distal end of the tubing 42 is advanced distally out of the distal end of the sleeve , the strands 50 and 52 can take up the remembered deployed disposition of fig3 . fig3 , 4 and 5 reveal a valuable technical effect of the present invention , namely , that the mesh size of the basket can be varied , from one end of the basket to the other , allowing foreign objects to be introduced into the basket envelope through the relatively wide aperture zone of the proximal end of the basket , but then more securely retained within the basket at the relatively smaller diameter aperture portions at the distal end of the basket . note also in fig3 the presence of a guide wire 54 . the tool could be advanced on such a guide wire , into a desired location , then the guide wire 54 could be withdrawn proximally , to leave the basket cavity empty , and then the foreign object could be fished into the basket . fig6 shows a tool 40 ′ based on a single length of tubing 42 ′ having a lumen 44 ′ that runs its full length . near the distal end of the tube 42 ′ is provided a plurality of slits , comprising a set of four first slits 46 ′ arranged at ninety degree intervals around the circumference of the tube 42 ′. at a distal end of the first slits 46 ′ and evenly spaced between each pair of first slits 46 ′ are the slits of a set of four second slits 48 ′, again made by laser . at a distal end of the second slits 48 ′ and evenly spaced between each pair of second slits 48 ′ are the slits of a set of eight third slits 58 ′, again made by laser . other slit affangements are contemplated , such as , for example , three first slits 46 ′ at 120 degree intervals around the circumference of the tubing 42 ′. the length of the set of first slits 46 ′ corresponds to the desired length of the object - catching basket of the tool 40 ′. refeffing to fig7 , the basket of the fig6 tool can be seen in its spread disposition . the basket may be constructed by slitting each of the first strands 50 ′ over a distal portion of its length , which is less than the full length of the first strand , thereby defining a set of second strands 52 ′. these second strands 52 ′ may be further slit over a distal portion of its length which is less than the full length of the second strand , thereby defining a set of third strands 60 ′ over a distal part of the length of the basket , setting an aperture size in that zone of the length of the basket smaller than would otherwise be the case in the absence of the third strands 60 ′. the resulting strands achieve an aperture size smaller at the distal end than at the proximal end of the basket envelope , thereby better to retain an object in the smaller mesh size of the distal half of the basket , yet captured in the larger mesh size of the proximal half of the basket . fig8 shows a tool 40 ″ based on a single length of tubing 42 ″ having a lumen 44 ″ which runs its full length . near the distal end of the tube 42 ″ is provided a plurality of slits , comprising a set of four first slits 46 ″ affanged at ninety degree intervals around the circumference of the tube 42 ″. evenly spaced between each pair of first slits 46 ″ are the slits of a set of four second slits 48 ″, again made by laser . evenly spaced between each pair of second slits 48 ″ are the slits of a set of eight third slits 58 ″, again made by laser . other slit arrangements are contemplated , such as , for example , three first slits 46 ″ at 120 degree intervals around the circumference of the tubing 42 ″. the length of the set of first slits 46 ″ corresponds to the desired length of the object - catching basket of the tool 40 ″. referring to fig9 , the basket of the fig6 tool can be seen in its spread disposition . in this embodiment , the first strands 50 ″ extend along the a distal region of the tool head , stopping short of a distal end surface of the tubing . second strands 52 ″ are within a distal portion of the first strand 50 ″, where the length of the second strand 52 ″ is less than a length of the first strand 50 ″. in a spread disposition , the second strand 52 ″ extends from a side of the first strand 50 ″ and is directed distally along its length toward the distal end of the tubing 42 ″. third strand 60 ″ is within a portion of the second strand 52 ″, where the length of the third strand 60 ″ is less than the length of the second strand 52 ″. in the spread disposition , the third strand 60 ″ extends from a side of the second strand 52 ″ and is directed distally along its length toward the distal end of the tubing 42 ″. the distalmost ends of the first strands 50 ″ and second strands 52 ″ may be secured together at the tip 56 ″. in one embodiment , the zone of the third strands could be in a “ belly portion ” of the basket where its diameter is close to its maximum , thereby to achieve an aperture size in this belly portion smaller than an aperture size in a proximal half of the basket envelope , thereby better to retain an object captured in the proximal half of the basket in the smaller mesh size of the distal half of the basket . not immediately evident from the drawings is a further useful technical effect of the present invention . whereas the distal ring 20 of the prior art device has a relatively significant length , the unslitted distal tip 56 of a device in accordance with present invention could be made relatively much shorter in length . this could improve the performance of the device when it is desired to fish into the basket an object which lies rather close to a tissue wall surface within a cavity or lumen of a body . the cutting by laser of slits within the cylindrical wall surface of a tube of nitinol shape memory alloy is a technology which is by now relatively well understood by those companies which specialize in the manufacture of self - expanding stents . for such companies , it will be apparent from the above description that the accompanying drawings and specific description given above represents only one example of how the concept of the present invention can be realized . the concept of the invention permits a new combination of stone destruction insitu by lithotripsy . the technique of lithotripsy involves hitting a stone with a probe which is itself struck by a projectile at the proximal end of the lithotripsy probe , to provide a kinetic energy ballistic impact on the stone to fragment the stone . it is envisaged that the device of the present invention would trap the stone and then a lithotripsy probe would be introduced into the proximal end of the tubular shaft and advanced into the basket at the distal end , to attack the stone trapped therein . a suitable probe can be obtained from ems electromedical systems sa , ch - 1347 , le sentier , switzerland . to such readers , variations and modifications of these specific description above will be evident . the scope of the claims which follow is not to be taken as limited to the specific details of the description given above . | 0 |
the floor sanding vacuum 10 includes a motor 11 coupled to a positive displacement blower 13 . the motor 11 is preferably an electric motor with an integral electronic control pad 15 , as shown in fig1 and fig2 . one skilled in the art will recognize other types of motors can be used with this invention . for instance , as shown in fig3 and 4 , a gasoline motor 17 can be used . the power of the gas engine may be of 12 hp and have a 12 v battery . fig1 and fig2 show the electric motor 11 includes a first drive shaft 19 connected to a coupling 21 . the coupling 21 is connected to a second drive shaft 23 of a displacement blower 13 . with such an arrangement , the rotational force of the electric motor 13 is transferred to the positive displacement blower 13 allowing the blower to create a draw of air or a high vacuum . in an alternate embodiment , shown in fig3 and 4 , the gasoline motor 17 includes a pulley 25 to which is connected a drive belt 27 . the drive belt 27 is connected to a second pulley 29 attached to the displacement blower 13 . one skilled in the art will recognize that other arrangements for transferring the power from the motor to the displacement blower 13 can be used . a gear box would be but one example . the positive displacement blower 13 is connected by suitable duct work 31 to a cyclone separator 33 . the cyclone separator includes a hopper 35 to collect the sanding debris . the duct work 31 may also include a vacuum relief valve 30 . the cyclone separator includes an input 37 to allow for connection to the sanding machine , not shown . the sanding machine , as one skilled in the art will recognize , generates sanding dust as it operates . the sanding machine will often have an output allowing a vacuum to be connected to the sanding machine in order to draw the sanding particles away from the sanding machine , so they are not distributed throughout the room . the connection between the input 37 and the sanding machine is preferably done with a flexible hose , as typically used in vacuum applications . the input 37 is generally suitable for a 2 inch hose , to connect to a sanding machine . when using more than one hose to connect a sanding machine to input 37 , hose connectors will generally be used , or any other suitable means of connecting currently known in the art and hereafter developed . in operation , sanding particulates are drawn through the input 37 into the cyclone separator 33 , where particulates fall out of the air and are collected in the integral hopper 35 . the air is then drawn through a replaceable filter element 39 . the replaceable filter element is preferably a hepa filter , capable of removing 99 . 97 % of particulates 0 . 3 microns or larger . the air is then drawn through the duct work 31 to the positive displacement blower 13 , where it is expelled out in output 41 . the air can also then be sent through an optional silencer 43 , to reduce the noise associated with the operation . the silencer 43 may also filter the exhaust output of the gasoline motor 17 . both the integral hopper 35 , and the silencer 43 , may be part of the base 40 , to which the motor , displacement blower 13 , and the cyclone separator 33 are attached . fig5 , fig6 and fig7 an embodiment of the base ( 40 ) and the silencer 43 being attached . a collector bag ( not shown ), generally made of plastic or any suitable material known in the art , may be connected , by any means known in the art , to the vacuum 10 to collect the dust and debris from the output 41 . the filter element 39 requires regular cleaning , preferably at least once per day when in use . to clean the filter element 39 , the housing 20 , shown in fig9 , is opened with knob 16 . bolt 22 and filter retaining plate 12 are removed to allow access to filter element 39 . the filter element 39 is pulled straight out to remove from housing . to clean the filter element 39 , it is rapped to dislodge any loose dust and is reinserted into the housing . as recognized by those skilled in the art , a pressure gauge may be appropriately adapted to the present disclosure . if a pressure gauge reads 40 ″ w . c . or pressure drop is excessive , the vacuum should be shutdown and filter cleaned as described herein . in another embodiment , shown in fig8 and 9 , the floor sander vacuum 10 has the gasoline motor 17 and includes a pulley 25 , which may also be a sheave , to which is connected a drive belt 27 , which may also be a v - belt . the pulley 25 , may have a first bushing 26 . the drive belt 27 is connected to a second pulley 29 , which may also have a second bushing 28 , attached to the positive displacement blower 13 . in addition , fig9 shows a tensioner 36 to allow for appropriate tension in drive belt 27 . the positive displacement blower 13 is connected by suitable duct work 31 and a hose 24 , secured by a clamp strap 32 to a cyclone separator 33 . the cyclone separator includes a hopper 35 to collect the sanding debris . the duct work 31 may also include a vacuum relief valve 30 . the cyclone separator includes an input 37 , in the embodiment shown in fig9 , there are two locations present for input , to allow for connection to the sanding machine , not shown . in the embodiment shown in fig9 , a knob 16 , having a coupling nut 18 and gasket 14 is located at the superior surface of the cyclone separator 3 and also at the superior surface of the hopper 35 . in operation of the embodiment shown in fig9 , the air expelled from the cyclone separator 33 is then drawn through the duct work 31 , pipe 44 and pipe elbow 42 to , where it is then expelled out of output 41 and optionally through the silencer 43 . fig9 also depicts a mounting bracket 38 , for attaching the motor 17 , displacement blower 13 , and the cyclone separator 33 to base 40 . as will be apparent to those skilled in the art , the dimensional specifications of the present disclosure may vary to suit a variety of apparent embodiments . generally , the vacuum in the present disclosure has a height of approximately 61 inches ( 155 cm ), depth of approximately 28 inches ( 71 cm ), height of approximately 62 . 5 inches ( 159 cm ), weight of approximately 750 pounds ( 340 kg ) and air volume of about 360 cfm max . although preferred embodiments of the disclosure are illustrated and described in connection with particular features , it can be adapted for use with a wide variety of floor and sanding machines . other embodiments and equivalent floor sanding vacuums are envisioned within the scope of the claims . various features of the disclosure have been particularly shown and described in connection with illustrated embodiments . however , it must be understood that the particular embodiments merely illustrate and that the invention is to be given its fullest interpretation within the terms of the claims . | 1 |
in the practice of this invention , referring to the drawing , hot water is pumped through conduit 19 into injection well 10 . included in the hot water or carrier liquid are perforation ball sealers 22 . the hot water can be either fresh water or salt water and preferably should be substantially near the boiling temperature of the water . well 10 is surrounded by a casing 12 which penetrates formation 30 and contains a zone of at least two different permeabilities . well casing 12 contains perforations 24 which enter into the hydrocarbonaceous fluid producing formation . upon introducing the ball sealers 22 into the fluid upstream of the perforated areas of the casing 12 , said sealers are carried down into the well 10 by the fluid flow . once the fluid arrives at the perforated intervals 24 , and into the strata being treated , the fluid is displaced outwardly through said perforations . the flow of the treating fluid through the perforations 24 carries the entrained ball sealers 22 toward said perforations 24 causing them to seat on the perforations 24 . once seated on the perforations , ball sealers 22 are held onto the perforations by the fluid pressure differential which exists between the inside of the casing and the producing strata of said formation on the outside of casing 12 . seated ball sealers 22 serve to effectively close the perforations 24 which have the greatest flow of the carrier liquid therethrough . said perforations will remain sealed until such time as the pressure differential is reversed , and the ball sealers are released . said ball sealers 22 will tend to first seal the perforations through which the carrier liquid is flowing most rapidly . the preferential closing of the high flow rate perforation tends to equalize treatment of the production strata over the entire perforated interval . for maximum effectiveness in seating on perforations 24 , the ball sealers 22 preferably should have a density less than the density of the carrier liquid in the well bore at the temperature and pressure conditions encountered down hole . for example , it is not unusual for the bottom hole pressure to exceed 10 , 000 psi and even reach 15 , 000 psi during the well treatment procedure . sealers and a method for use in well treatment with fluid diversions are discussed in u . s . pat . nos . 4 , 407 , 368 and 4 , 244 , 425 issued to erbstoesser on oct . 4 , 1983 and jan . 13 , 1981 , respectively . these patents are hereby incorporated by reference . once the ball sealers have seated themselves in the perforations , the carrier liquid injection is ceased . thereafter , steam injection is commenced by the injection of steam into conduit 19 which forms a part of injection well 10 . one method for injecting steam in a formation is discussed in u . s . pat . no . 4 , 489 , 783 which issued to w . r . shu on dec . 24 , 1984 . another is discussed in u . s . pat . no . 4 , 417 , 620 which issued to e . g . shafir on nov . 29 , 1983 . both of these patents are incorporated by reference . upon entering the injection well 10 , the steam pressure forces the water into the unblocked perforations in the area of the zone of low permeability causing water in that area to be forced therethrough . steam is injected into injection well 10 via conduit 19 and goes through the open perforations 24 where the ball sealers have not seated and force the hydrocarbonaceous fluid 18 as shown in the drawing into production well 14 . the steam enters production well 14 through perforations 28 and the hydrocarbonaceous fluids along with the steam and water are removed from the production well 14 via conduit 32 . water in the hydrocarbonaceous formation remains in the high permeability zone 26 as is shown in the drawing . although an injection and a production well are shown in the drawing , the method will work where only one injection well is used . following the sealing of the most permeable ( thief ) layer ( s ) of the reservoir by the ball sealers , steam is injected into well 10 to reduce the viscosity of the carbonaceous fluids , thereby helping their recovery from the less permeable layer ( s ). the ball sealers are then released from perforations 24 and well 10 is converted into a production well . this ball sealer aided huff - and - puff cycle can be repeated as desired . ball sealers which can be used in the practice of this invention and which are useful at the steam temperature encountered , are composed of polymer compounds covered with a thin coating of elastomer of low enough density to float in the injected carrier fluid . the densities generally will be low and will be from about 0 . 8 to about 0 . 9 g / cc . the ball sealers will generally be of a diameter of about 3 / 4 inch and will comprise a core wrapped therearound with an elastomer . polymers which can be used to comprise the core include the following : ______________________________________ melting density pointpolymer ( g / cc ) (° c ./° f . ) ______________________________________polystyrene 1 . 11 - 1 . 12 240 / 464poly - 4 - methyl - 1 - pentene 0 . 81 - 0 . 83 250 / 482poly - 3 - methyl - 1 - hexene 0 . 83 - 0 . 86 288 / 550poly - 3 - methyl - 1 - butene 0 . 92 - 0 . 93 310 / 590poly - 4 , 4 - dimethyl - 1 - hexene 0 . 8 - 0 . 9 350 / 662poly ortho - methylstyrene 1 . 07 360 / 680poly 4 , 4 - dimethyl - 1 - pentene 0 . 8 - 0 . 9 380 / 716______________________________________ ball sealers and a method of making same are disclosed in u . s . pat . nos . 4 , 244 , 425 and 4 , 410 , 387 which were issued to erbstoesser and halkerston et al . on jan . 13 , 1981 and oct . 18 , 1983 , respectively . these patents are hereby incorporated by reference . obviously , many other variations and modifications of this invention , as previously set forth may be made without departing from the spirit and scope of this invention as those skilled in the art readily understand . such variations and modifications are considered part of this invention and within the purview and scope of the appended claims . | 4 |
in a preferred variant , the method can also be carried out in a column divided into at least two subcolumns , and the concentration is measured a ) in the region between the subcolumns . preference is given to a variant of the method using subcolumns , characterized in that , instead of the temperatures and mass flows of feed and reflux and also the heat energy , in particular the amount of vapor , the mass flows between the two sub columns and also their temperatures are also used in the process model . preference is given to disposing the analytical instrument in the method in the region between the uppermost fifth and the lowermost fifth of the length of the overall column . alternatively , the measurement of the liquid stream between the two subcolumns can be used together with the heat energy in the process model . instead of an nir spectrometer , it is also possible to use other analytical instruments , for example gas chromatographs , uv - vis spectrometers , liquid chromatographs . the methods are preferably used to separate mixtures having boiling points separated by at most 20 k , in particular 10 k . at a given temperature sensitivity , the concentration is preferably determined via a temperature and pressure measurement . in an alternative variant of the method , the combination of online analysis and process model can also be used for concentration control of the top product . the process is used in particular for the isomer separation of nitrotoluene and is preferably carried out as follows . the analytical instrument measures the concentration of one component ( for example p - nitrotoluene ) in the product stream between the two column sections and passes it on to the process model . building on this information , the model uses parameters measured directly at the column , for example mass flows , vapor feed and temperatures , to calculate the p - nitrotoluene concentration in the liquid phase product . the value determined by the model is treated as the actual value of the control parameter . the difference between the target and the actual value is an input parameter into the regulator , in particular into a pid controller component of the process control system . in the event of deviations between the target and the actual value , the regulator changes the control parameter , i . e . the vapor feed . the value calculated by the online process model for the liquid phase concentration is of predictive character . perturbations , caused , for example , by a change in mass flow or concentration in the feed , are registered at the point of connection of the instrument between the two columns before they reach the liquid phase . the model uses the currently measured concentration value and , with the aid of the present separating performance , calculates the resulting new concentration value for the liquid phase product . this value is the concentration which would be attained in the liquid phase product after approx . 20 to 30 minutes if no intervention were made . as a consequence of the direct coupling of model and regulator , the regulator changes the vapor feed before the concentration perturbation reaches the liquid phase . the back - coupling of the change in the amount of vapor via the model to the regulator changes the amount of vapor only to the extent that it compensates for the concentration change in the product stream between the column sections with a changed separating performance of the second column section . the concept thus simultaneously facilitates an inherent restriction of the control parameter . the early recognition of the perturbation and also the timely and precise control intervention makes the procedure of process control precise and robust . it can be recognized from fig1 a and 1 b that the measurements of feed amount and feed temperature , and also the reflux amount , the reflux and the top temperature , contribute to the process model and thus facilitate a feed forward strategy . to calculate the liquid phase concentration , the process model uses the liquid / vapor ratio and also the number of theoretical plates of the second column section which depends on the column internals , for example trays or structured packing . since the number of theoretical plates can be changed , for example , by fouling , the starting signal of the process model has to be checked with the aid of analytical data at certain time intervals of , for example , every 24 hours . in the event of deviations between the model and the analytical value , the model parameters are changed automatically . in the present case , the model parameter to be adapted is the number of theoretical plates . this is a physically interpretable parameter . the value of and change in this parameter indicates the condition of the column internals and can be used , for example , as information for determining maintenance intervals . the numerical analysis of the process model allows its incorporation into closed - loop control circuits . within the interval times of up to 0 . 5 s required for control purposes , the model calculates the new concentration values . the advantage of the process model is that its algorithm is robust and contains no iterative method , as is the case , for example , in u . s . pat . no . 5 , 260 , 865 . in contrast to the method described in this publication which is based on the concentration measured in the feed , the present process model starts from concentration measurements at the points in the column where the sensitivity is at its highest . compared to other process control concepts in which the target values of auxiliary control parameters , for example temperatures , are adjusted , the present process control also has the advantage that the controller explicitly specifies the desired concentration in the end product as the target value of the control parameter . the invention is illustrated in detail below with the aid of fig1 a and 1 b by the examples which , however , do not constitute any restriction of the invention . fig1 a shows a process schematic of a distillation plant having two subcolumns fig1 b shows a process schematic of a distillation plant having one column fig1 a depicts a process schematic for an isomer separation . a mixture having a 70 % fraction of the isomer a ( p - nitrotoluene ) is separated into a top product having a 30 % isomer a fraction and a liquid phase product having a 99 . 70 % isomer a fraction . the mixture ( p - nitrotoluene a , m - nitrotoluene b ) is fed via a feed line 15 to the upper column section 10 of a two - part distillation column 9 , 10 , and the inlet is disposed in the lower third of column section 10 . the sensor 1 registers the temperature and sensor 2 the feed amount of the a , b mixture . at the top 30 of the column 10 having the temperature sensor 24 , the a , b low boiler fraction is condensed via line 21 at a condenser 16 and partly withdrawn via line 13 . the other portion is recycled as reflux 22 to the top section 30 via a valve having a quantity controller 12 and temperature measuring instrument 11 . between the upper column section 10 and lower column section 9 is disposed a measuring point 29 with a near infrared spectrometer 3 in the region of the connecting lines . at the bottom 23 of the lower column section 9 is mounted a bottom withdrawal line 14 from which a portion of the liquid phase product is recycled via the evaporator 17 and line 20 to the column section 9 . the evaporator 17 is charged with vapor from the vapor line 18 via the control valve 19 . the measurements of the sensors 1 , 2 , 24 , 11 , 12 , 18 and the analytical instrument 3 are passed to the computer 6 . at the withdrawal point 5 , the sample of the liquid phase product is analyzed at certain time intervals ( for example once a day ) for its composition and compared to the calculated value of the liquid phase concentration ( comparator 8 of the process control system 28 which includes the computer 6 ). the online process model 6 used here for the binary a , b system has been derived from the steady state laws of thermodynamics and hydrodynamics , and simplified in such a way that , on the one hand , it reproduces the process behavior with the necessary precision for process control in the envisaged working range and , on the other hand , proceeds by simplified numerical analysis in the process control system 28 and can deliver the results required for control within the predefined time interval . the result of the online process model is of predictive character . for instance , in the event of a perturbation , for example a rise in the low boiler concentration in the feed , the model reproduces its expected rise in the liquid phase product with a delay time of approx . 20 minutes in the stripping section 9 . the model calculates the liquid phase concentration of component a from the concentration of a measured by the analytical instrument 3 at the measuring point 29 according to equation 1 : the concentration of component a in the product stream leaving the bottom corresponds to the liquid phase concentration x a , lp . this is obtained from the concentration of component a measured with the online analytical instrument at measuring point 29 x a , online analysis and the separating performance between this measuring point and the column bottom 23 . to calculate the separating performance , the model can use , inter alia , the liquid to vapor ratio α or else the number of theoretical plates between measuring point 29 and column bottom 23 n . for this purpose , the following equations 2 to 6 are also used : a = f d f = r int + m feed , int equation 3 the liquid to vapor ratio α can be calculated from the amount of feed 2 in combination with the temperature difference determined from the temperatures 1 and 27 , the amount of feed 12 in combination with the temperature difference determined from the temperatures 11 and 24 and the amount of vapor 18 . the number of plates n is dependent on the hydrodynamics determining the mass transfer and also on the condition of the structured packing and the liquid distributor . the number of plates is adjusted by means of laboratory analyses using equation 7 : samples 5 are taken at relatively long time intervals in order to determine the concentration in the product stream 14 which corresponds to the liquid phase concentration . the concentration is compared in 8 with the calculated concentration 25 from the process model . in the event of deviations between the measured and calculated concentration , the number of plates of the process model is adapted ( model adjustment 4 ). since the model relates the increased low boiler fraction ( the low boiler here is component b ) at the measuring point to the present separating performance which was sufficient to maintain the liquid phase concentration before the perturbation , a higher low boiler fraction is calculated in the liquid phase concentration that is not yet present and would only be attained in the equilibrium state , i . e . after approx . 20 minutes . the value 25 calculated by the model is fed to the controller as the actual value of the control parameter . the controller 7 immediately increases the amount of vapor 18 until the increased low boiler fraction at the measuring point 29 together with the reduced liquid to vapor ratio leads back to the target value 26 of the liquid phase concentration . since the change in the amount of vapor 18 is relayed back to the controller 7 via the model without time delay , robust control is obtained . this is supported by the fact that the controller 7 intervenes before the perturbation has reached the bottom 23 and that , as a consequence of the early intervention , the control parameter can be changed 19 in a precise manner . in the event of a reduction in the low boiler fraction at the measuring point 29 , the amount of vapor is only reduced to the extent that the reduced low boiler fraction together with the increased liquid to vapor ratio leads to the target value of the liquid phase concentration . the direct recycling of the amount of vapor 18 via the model back to the controller 7 only reduces the amount of vapor 18 to such an extent as is compatible with the reduced low boiler fraction at the measuring point 29 . this may be regarded as an inherent control parameter restriction . experience has shown that the system behaves robustly even in the event of severe perturbations to give only slight deviations in the actual value from the target value in the transition phase . a list of the symbols used in the equations is given hereinbelow : | 1 |
an example embodiment of the present invention will now be described with reference to protecting video images . the number of users to which the video images are to be distributed determines the number of copies . to each copy an identification code word is added which identifies the copy assigned to one of the users . video images are one example of material , which can be protected by embedding a digital code word . other examples of material , which can be protected by embedding a code word , include software programs , digital documents , music , audio signals and any other information - bearing signal . an example of an encoding image processing apparatus , which is arranged to introduce an identification code word into a copy of an original image , is shown in fig1 . an original image i is received from a source and stored in a frame store 1 . this original image is to be reproduced as a plurality of water marked copies , each of which is marked with a uniquely identifiable code word . the original image is passed to a discrete cosine transform ( dct ) processor 2 , which divides the image into 8 × 8 pixel blocks and forms a dct of each of the 8 × 8 pixel blocks . the dct processor 2 therefore forms a dct transformed image v . in the following description the term “ samples ” will be used to refer to discrete samples from which an image ( or indeed any other type of material ) is comprised . the samples may be luminance samples of the image , which is otherwise , produce from the image pixels . therefore , where appropriate the terms samples and pixels are interchangeable . the dct image v is fed to an encoding processor 4 . the encoding processor 4 also receives identification code words from an identification code word generator 8 . the code word generator 8 is provided with a plurality of seeds , each seed being used to generate one of the corresponding code words . each of the generated code words may be embedded in a copy of the original image to form a watermarked image . the code word generator 8 is provided with a pseudo random number generator . the pseudo random number generator produces the code word coefficients to form a particular code word . in preferred embodiments the coefficients of the code words are generated in accordance with a normal distribution . however , the coefficients of the code word are otherwise predetermined in accordance with the seed , which is used to initialise the random number generator . thus for each code word there is a corresponding seed which is store in a data store 12 . therefore it will be understood that to generate the code word x i , seed i is retrieved from memory 12 and used to initialise the random number generator within the code word generator 8 . in the following description the dct version of the original image is represented as v , where ; v ={ v i }={ v 1 , v 2 , v 3 , v 4 , . . . v n } and v i are the dct coefficients of the image . in other embodiments the samples of the image v i could represent samples of the image in the spatial domain or in an alternative domain . each of the code words x i comprises a plurality of n code word coefficients , where ; x i ={ x j i }={ x 1 i , x 2 i , x 3 i , x 4 i , . . . x n i } the number of code word coefficients n corresponds to the number or samples of the original image v . however , a different number of coefficients is possible , and will be set in dependence upon a particular application . a vector of code word coefficients x i forming the i - th code word is then passed via channel 14 to the encoder 4 . the encoder 4 is arranged to form a watermarked image w i by adding the code word x i to the image v . effectively , therefore , as represented in the equation below , each of the code word coefficients is added to a different one of the coefficients of the image to form the watermark image w i . w i = v 1 + x 1 i , v 2 + x 2 i , v 3 + x 3 i , v 4 + x 4 i , . . . , v n + x n i as shown in fig1 , the watermarked images w i are formed at the output of the image processing apparatus by an forming inverse dct of the image produced at the output of the encoding processor 4 by the inverse dct processor 18 . therefore as represented in fig1 at the output of the encoder 4 a set of the watermarked images can be produced . for a data word of up to 20 - bits , one of 10 000 000 code words can be selected to generate 10 million watermarked w i versions of the original image i . although the code word provides the facility for uniquely identifying a marked copy w i of the image i , in other embodiments the 20 bits can provide a facility for communicating data within the image . as will be appreciated therefore , the 20 bits used to select the identification code word can provide a 20 bit pay - load for communicating data within the image v . the encoding image processing apparatus which is arranged to produce the watermarked images shown in fig1 may be incorporated into a variety of products for different scenarios in which embodiments of the present invention find application . for example , the encoding image processing apparatus may be connected to a web site or web server from which the watermarked images may be downloaded . before downloading a copy of the image , a unique code word is introduced into the downloaded image , which can be used to detect the recipient of the downloaded image at some later point in time . in another application the encoding image processor forms part of a digital cinema projector in which the identification code word is added during projection of the image at , for example , a cinema . thus , the code word is arranged to identify the projector and the cinema at which the images are being reproduced . accordingly , the identification code word can be identified within a pirate copy produced from the images projected by the cinema projector in order to identify the projector and the cinema from which pirate copies were produced . correspondingly , a watermarked image may be reproduced as a photograph or printout in which a reproduction or copy may be made and distributed . generally therefore , the distribution of the watermarked images produced by the encoding image processing apparatus shown in fig1 is represented by a distribution cloud 19 . a detecting image processing apparatus which is arranged to detect one or more of the code words , which may be present in an offending marked image is shown in fig2 . generally , the image processor shown in fig2 operates to identify one or more of the code words , which may be present in an offending copy of the image . the offending version of the watermarked image w ′ is received from a source and stored in a frame store 20 . also stored in the frame store 20 is the original version of the image i , since the detection process performed by the image processor requires the original version of the image . the offending watermarked image w ′ and the original version of the image are then fed via connecting channels 26 , 28 to a registration processor 30 . as already explained , the offending version of the image w ′ may have been produced by photographing or otherwise reproducing a part of the watermarked image w i . as such , in order to improve the likelihood of detecting the identification code word , the registration processor 30 is arranged to substantially align the offending image with the original version of the image present in the frame store 20 . the purpose of this alignment is to provide a correspondence between the original image samples i and the corresponding samples of the watermarked image w i to which the code word coefficients have been added . the effects of the registration are illustrated in fig3 . in fig3 an example of the original image i is shown with respect to an offending marked version of the image w ′. as illustrated in fig3 , the watermarked image w ′ is offset with respect to the original image i and this may be due to the relative aspect view of the camera from which the offending version of the watermarked image was produced . in order to recover a representation of the code word coefficients , the correct samples of the original image should be subtracted from the corresponding samples of the marked offending image . to this end , the two images are aligned . as shown in fig3 , the registered image w ″ has a peripheral area pa which includes parts which were not present in the original image . as will be appreciated in other embodiments , the registration processor 30 may not be used because the offending image w ′ may be already substantially aligned to the originally version of the image i , such as , for example , if the offending version was downloaded via the internet . accordingly , the detecting image processor is provided with an alternative channel 32 , which communicates the marked image directly to the recovery processor 40 . the registered image w ″ is received by a recovery processor 40 . the recovery processor 40 also receives a copy of the original image i via a second channel 44 . the registered image w ″ and the original image i are transformed by a dct transform processor 46 into the dct domain . an estimated code word x ′ is then formed by subtracting the samples of the dct domain marked image v ′ from the dct domain samples of the original image v as expressed by the following equations : = v 1 ′− v 1 , v 2 ′− v 2 , v 3 ′− v 3 , v 4 ′− v 4 , . . . , v n ′− v n − v n , = x 1 ′, x 2 ′, x 3 ′, x 4 ′, . . . x n ′ the output of the recovery processor 40 therefore provides on a connecting channel 50 an estimate of the coefficients of the code word which is to be identified . the recovered code word x ′ is then fed to a first input of a correlator 52 . the correlator 52 also receives on a second input the regenerated code words x i produced by the code word generator 54 . the code word generator 54 operates in the same way as the code word generator 8 which produces all possible code words of the set , using the predetermined seeds which identify uniquely the code words from a store 58 . the correlator 52 forms n similarity sim ( i ) values . in one embodiment , the similarity value is produced by forming a correlation in accordance with following equation : each of the n similarity values sim ( i ) is then fed to a detector 60 . the detector 60 then analyses the similarity values sim ( i ) produced for each of the n possible code words . as an example , the similarity values produced by the correlator 52 are shown in fig4 with respect to a threshold th for each of the possible code words . as shown in fig4 , two code words are above the threshold , 2001 , 12345 . as such , the detecting processor concludes that the watermarked version associated with code word 2001 and code word 12345 must have colluded in order to form the offending image . therefore , in accordance with a false positive detection probability , determined from the population size , which in this case is 10 million and the watermarking strength α , the height of the threshold th can be set in order to guarantee the false detection probability . as in the example in fig4 , if the similarity values produced by the correlator 52 exceed the threshold then , with this false positive probability , the recipients of the marked image are considered to have colluded to form the offending watermarked version of the image w i . the following sections illustrate advantages and features of the operation of the watermarking system illustrated in fig1 and 2 . the process of aligning the offending marked version of the image with the copy of the original image comprises correlating the samples of the original image with respect to the marked image . the correlation is performed for different shifts of the respective samples of the images . this is illustrated in fig5 . fig5 a provides an illustration of discrete samples of the original image i , whereas fig5 b provides an illustration of discrete samples of the offending watermarked image w ′. as illustrated in the fig5 a and 5b , the sampling rate provides a temporal difference between samples of dt . a result of shifting each of the sets of samples from the images and correlating the discrete samples is illustrated in fig5 c . as shown in fig5 c , for a shift of between 6 and 7 samples , the correlation peak is highest . the offending watermarked image is therefore shifted by this amount with respect to the original image to perform registration . as explained above , the code words of the watermarking system are formed by generating a plurality of code word coefficients from pseudo randomly distributed numbers . the numbers are generated by a pseudo random number generator which is initialised by seed , which determines the numbers produced . in some embodiments a unique seed is provided for each word . however in other embodiments at least some of the code words are generated by cyclically shifting a first base code word . each cyclically shifted code word may be permuted in accordance with a secret permutation code to improve resistance to a collusion attack . in preferred embodiments the mean of the numbers produced to form the code word coefficients is 0 and the variance is set at α . the variance α is the value or strength of the watermark . thus the greater the strength , the more likely the code word is to be detected by the detecting image processor . however , conversely , the larger the strength , the more likely the effects of the code word is to be perceivable on the watermarked image . as already explained the detecting image processor is provided with a correlator 52 and a code word generator 54 . the correlator therefore correlates the recovered code word x ′ with respect to each of the code words in a set of code words to produce similarity value sim ( i ). an advantage is provided to the code word generator 54 by setting the variance of the random numbers generated to unity . therefore , although the pseudo random number generator in the code word generator 54 corresponds to the number generator in the code word generator 8 in the encoding image processor , the variance of the numbers produced is set at unity , rather than to α . the strength of the water mark code words is therefore set at 1 . the correlation sum formed by the correlator as illustrated above is not affected by the setting of the variance of the regenerated code words to 1 . this means that if user i is innocent , the similarity value for user i , sim ( i ) is a normally distributed random variable with a mean of 0 and the variance of 1 . as a result , the threshold applied by the detector 60 is always independent of the encoding strength α . as such , the detecting processor does not require knowledge of the encoding strength α . the encoding strength α can therefore be set independently from the detection processor . although the offending marked image will correspond substantially to the original image , even if the images are otherwise aligned , there may appear artefacts in the offending marked image which were not present in the original version of the image . such artefacts may be a caused , for example , when a pirate copy of the watermarked image w ′ is generated . if a camcorder is used to record cinema images of a film , where the marked image is projected onto the cinema screen , artefacts may be introduced into the offending copy of the marked image , for example , if a person &# 39 ; s head moves between the cinema screen and the camcorder . the person &# 39 ; s head will cause part of the watermarked image to be obscured . this is illustrated in fig6 a , which provides an example of the offending marked image w ′ with respect to the original image i shown in fig6 b . as represented in fig6 a , the offending image w ′ includes an artefact caused by a person &# 39 ; s head passing between the cinema screen and the camcorder . the offending copy of the marked image will therefore have features present , which were not present in the original image . as explained above , in order to form the recovered code word x ′, the samples in the dct domain v are subtracted from the samples of the offending watermarked image v ′. however , the parts of the offending watermarked image where the artefacts are present will not correlate with the corresponding parts of the original image . as a result , the similarity values sim ( i ) formed by the correlator 52 with respect to each of the reproduced code words in the set can be significantly affected . this is because large differences between the images will produce recovered code word coefficient values , which may be significantly different from the regenerated code word coefficient values . there is therefore an increased false negative likelihood , because the similarity value sim ( i ) for the correct code word , which corresponds to the recovered code word , will not exceed the threshold in the detector 60 . advantageously , to alleviate this problem caused by artefacts , the registration processor is arranged to compare the samples of the original image with the offending watermarked image . if the mean absolute difference between these samples exceeds a predetermined comparison threshold , then the parts of the offending watermarked image for these samples are replaced with the samples from the original image . this replacement process is illustrated in fig6 c . in fig6 c the offending image w ″ is shown with those parts of the offending marked image w ′ not corresponding to the original image i replaced with corresponding parts from the original image . effectively , although these replaced samples cannot carry corresponding coefficients of a code word , the similarity value sim ( i ) formed by the correlation calculation is less likely to be adversely effected . therefore , a likelihood of correctly detecting the code word from the offending watermarked image , in the presence of artefacts is improved , reducing the false negative probability . this is expressed mathematically as follows : a further improvement is provided to the detection of a watermark code word by pre - processing the marked image before detection of the code word is attempted . the detecting image processor shown in fig2 in accordance with an embodiment of the invention is arranged to pre - process the marked image to the effect of correcting for a difference in contrast between the offending watermarked image and that of the original image . if the offending watermarked image has been reproduced by , for example , photographing the watermarked image , then there is a likelihood of a change in contrast of the offending image produced from the photograph . for example , the samples of the original image to which the code word coefficients have been added may have been formed from the luminance values of the image . as a result , a change in contrast will have an effect of altering the relative difference between the dct coefficients of the original image and the dct coefficients of the offending watermarked image . this can have an effect of reducing the likelihood of correctly detecting the code word from the offending watermarked image . this is because the difference in the values of the samples from the watermarked image with respect to the samples of the original image can reduce the likelihood of correctly recovering the code word . this is represented mathematically below : x ′= cv + cx − v = ( c − 1 ) v + cx where c is a scaling factor introduced as a result of the change in contrast . in order to address this technical problem , the registration processor 30 of the detector shown in fig2 is used to pre - process the offending image . the pre - processing is arranged to reduce a difference between the contrast of the two images . this reduction is effected by normalising the offending watermarked image with respect to the original image by making the standard deviation and the mean of the samples of the offending watermarked image and the samples of the original image the same . this is expressed mathematically as follows : as a result of the normalisation process , the likelihood of false negative detection is reduced , because the relative difference in the magnitude of the offending and original image samples will be substantially the same . in some embodiments the normalised mean μ and the normalised variance σ may be set to predetermined and pre - stored values . in other embodiments the normalised mean μ and the normalised variance σ may be determined by calculating the mean and the variance of the samples of the original image i . in addition to the above - mentioned applications of the encoding data processing apparatus of the watermarking system to a cinema projector and to a web server , other applications are envisaged . for example , a receiver / decoder is envisaged in which received signals are watermarked by introducing code words upon receipt of the signals from a communicating device . for example , a set top box is typically arranged to receive television and video signals from a “ head - end ” broadcast or multi - cast device . as will be appreciated in this application , the encoding data processing apparatus forms part of the set top box and is arranged to introduce watermark code words into the video signals as the signals are received and decoded . in one example embodiment , the watermark code word is arranged to uniquely identify the set top box which receives and decodes the video signals . in a further embodiment a digital cinema receiver is arranged to receive a digital cinema film via a satellite . the receiver is arranged to receive signals representing the digital cinema film and to decode the signals for reproduction . the receiver includes an encoding data processing apparatus , which introduces a watermark code word into the decoded film signals . the watermark code word is provided , for example , to uniquely identify the cinema receiving the film signals . a further example embodiment may comprise a digital camera or camcorder or the like which includes a memory and a memory controller . an encoding data processing apparatus according to an embodiment of the present invention is arranged to introduce a watermark code word stored in the memory into video signals captured by the camera . according to this embodiment , the encoding data processing apparatus does not include a code word generator because the code word is pre - stored in the memory . under the control of the memory controller the code word stored in the memory is embedded into the video signals , uniquely or quasi - uniquely identifying the video signals . in a further embodiment , an encoding data processing apparatus according to an embodiment of the invention is operable to encode a sequence of watermark code words into different frames of digital images forming a continuous or moving picture . the code words may be related to one another and may be used to identify each of the images separately . various further aspects and features of the present invention are defined in the appended claims . various modifications can be made to the embodiments herein before described without departing from the scope of the present invention . | 7 |
let us turn first to fig1 which is a perspective view of the first embodiment . the device 10 is seen to have 3 portions , a handle 11 which has a distal and a proximal end , an elongated shaft second portion 15 which also has distal and proximal ends and an operative head portion 17 formed of a semi - rigid bullet shaped section 18 , attached at its rear to the distal end of the shaft and a rigid cap disposed in the forward end of the bullet shaped section to inhibit deformation of the foam head . the external surface of the cap is generally flat , but may be slightly convex . the handle portion 11 is an elongated rod of a diameter of about 1 inch for easy gripping by young and old alike , and the handle has at its proximal end , a hole either round of about ¼ inch diameter or an elongated slot of about ¼ by ⅝ths inch to permit the unit to be easily hung on a hook in storage awaiting the infrequent occasion when use is required . the handle may have a rubber coating thereon to enhance grippability . recesses spaced apart within the rubber , to create different elevations therein , further enhance grippability of the handle . the second portion 15 is the shaft which can have an overall length of about 12 to 19 inches , though longer shafts up to 24 inches are also contemplated . the shaft 15 is preferably of a smaller diameter than the handle 11 , and may be tubular or a solid rod , depending upon the material employed . while metal such as aluminum or stainless steel may be employed as well as painted wood , the use of an injection molded plastic portion is believed to be the most cost effective mode of manufacture . it is to be noted that the handle portion may be attached at its distal end to the proximal end of a separate shaft portion or the two portions may be formed as a unitary member . by conventional manufacturing techniques . detailed discussion of the operative head portion 17 , will be set out infra . the discussion now moves to fig2 , a rear perspective view of the first embodiment of this device . as can be seen in this view the handle 11 can have a series of recesses 14 therein to enhance grippability of the handle . the handle attached to the shaft is seen attached to the head 17 . at 90 degree intervals the v - shaped flutes or grooves 19 , 21 , 23 , & amp ; 25 are seen . while seen here in the 12 , 3 , 6 , and 9 o &# 39 ; clock positions , the physical location of the grooves during periods of use of the device is irrelevant . fig3 is a closeup view of the handle portion 15 showing the recesses 14 which enhance grippability of the handle , as well as the slot 13 used for hanging the device 10 on a hook . fig4 is a closeup rear view of the head 17 &# 39 ; s operative portion and a part of the shaft . the head is preferably formed of a semi - rigid material which will deform only slightly and which will not absorb water or other fluid from within the toilet bowl . a preferred material employed by applicant is closed cell polyethylene foam having a density of about 4 . 0 pounds per cubic foot and 0 . 02 lbs / sq ft of water absorption . the grooves or flutes , 4 in number , seen at 90 degree intervals , can be cut full length by any conventional technique , be it saw , hot blade , or knife . while 4 grooves are shown more grooves such as 5 or 6 spaced at 72 degrees apart or 60 degrees apart are also contemplated . the distal end of the shaft may be either threaded or unthreaded prior to engagement with the head 15 by insertion into bore 27 at the base of the bullet shaped head . see fig1 . it is believed that difficulty will be had in trying to cut threads into a foam member and the risk of breaking cell walls , could be damaging to the ability of the head to act as intended . thus the end of the shaft is coated with a suitable adhesive such as goop ®, a general purpose industrial and construction adhesive . it is within the skill of the art to determine other suitable general purpose adhesives . among these , mention may be made of gorilla glue , available at any home improvement big box store . fig5 is the next figure for discussion . this figure is a closeup cutaway view of the head portion of this invention . head 17 is seen to have 2 bores therein , the proximal bore 27 is sized to frictionally receive the end of the shaft 15 , with a suitable adhesive thereon . a second bore of about one inch diameter , from the distal end inward 29 is sized to receive cap 31 therein . the incline is about ⅞ths inch in length . fig6 is a top plan view of the bullet shaped head 17 , and showing the top 31 t of the cap 31 . the incline , 17 - 1 of the front surface of the head can range from 45 degrees to about 48 degrees to the horizontal . in fig7 , the entire cap 31 is seen . the top of the cap 31 t is seen to be of a greater diameter tan the body , 31 b . while the diameter of the top 31 t is about 1 . 4 inches in diameter , the body of the cap is only 1 . 0 inches , such that with a suitable adhesive the cap will be retained in bore 29 which should be just slightly greater in diameter such as 1 . 16 inches than the diameter of the body of the cap . the two diameters of cap top and cap body can e seen in fig8 . in fig9 the second embodiment of this invention can be seen , and which is designated 100 with all parts being in the 100 series , wherein like parts retain the same last two digits . the head portion 117 of this embodiment is the same including the v - grooves as in the first embodiment and as such no further discussion is needed . the handle portion 111 , and the shaft 115 however are quite different however . in the second embodiment , 110 , the handle 111 , instead of having the recesses therein , is tape wrapped much like as is seen on a tennis racket . note designator 116 , the tape wrap such as electrical tape which is a vinyl film with adhesive on one side . the slot 13 for hanging the device on a nail or hook is not found n this embodiment . the shaft 115 is seen to be bent at any where from 40 % along the length thereof to 60 percent along the length thereof , at an angle of between 15 and 17 . 5 degrees upwardly to render the movement of the user &# 39 ; s hand easier in that the hand is in a higher position relative to the floor of the bathroom , using this shaft . this allows the user to lower his / her arm in a fulcrum like manner , to raise the head 117 toward the bend in a conventional toilet trap to push the clog along the path . the shaft sections are 115 a and 115 b . it should be noted that either handle 11 or handle 111 can be substituted for the other and that embodiments with a straight or canted ( bent ) shaft with either handle are contemplated . also the employment of a slot in the handle of the second embodiment is also within the scope of this invention . while closed cell polyethylene foam has been mentioned , any semi - rigid closed cell polymeric foam can be employed for the material of the head such as polyurethane closed cell foam . the cap , 131 , and 31 is made of any high impact plastic such as styrene . a typical unit will have a head approximately three inches long by three inches wide with v - grooves of about ¼ inch to ½ inch wide . the shaft can vary from 12 to 18 inches long by about ½ to 1 inch in diameter , with a handle of six to 8 inches long and of a slightly larger diameter than the shaft for ease of use . the cap in the nose of the bullet shaped head should be about 1 . 5 inches in diameter . since certain changes may be made in the described devices without departing from the scope of the invention herein involved , it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . | 4 |
it has been discovered that the addition of an inorganic peroxide to an explosive slurry containing a metallic fuel , counteracts the desensitizing effect which mixing generally has on such slurries . the inorganic peroxides used in the improved slurries may be hydrogen peroxide or alkali metal peroxides , e . g . sodium peroxide , potassium peroxide , lithium peroxide , etc . the preferred inorganic peroxide for the practice of this invention is hydrogen peroxide . the inorganic peroxide is generally employed in a sensitizing amount . a sensitizing amount is a cncentration sufficient to provide a slurry which has approximately the same or greater sensitivity to detonation after mixing or filling operations than it had before such operations . the desired sensitivity will vary with various types of explosive slurries . for instance , for slurries containing high explosive ingredients , sensitivity to detonation with a conventional blasting cap may be desired , whereas , detonation with a booster or primer may be necessary for slurries which do not contain high explosive ingredients . a concentration of inorganic peroxide of from about 0 . 005 wt . % to about 0 . 5 wt . % of the slurry is generally a sensitizing amount . the preferred concentration of inorganic peroxide is from about 0 . 01 wt . % to about 0 . 25 wt . %. the explosive slurries of the present invention advantageously comprise the following ingredients at the indicated approximate concentrations : ______________________________________ wt . % ______________________________________oxidizing salt 20 - 75organic fuel 1 - 20metallic fuel 1 - 10thickening agent 0 . 1 - 5high explosive 0 - 50water 5 - 40inorganic peroxide 0 . 005 - 0 . 5______________________________________ the preferred oxidizing salt is ammonium nitrate or a mixture of ammonium nitrate and an alkali metal nitrate or an alkaline earth nitrate preferably sodium nitrate or calcium nitrate . as hereinbefore stated , suitable organic fuels include a wide variety of non - explosive carbonaceous materials . preferred organic fuels are sugar , carbon black , ground coal , and nut meal . the preferred metallic fuel is finely divided aluminum , e . g . flake aluminum . guar gum in combination with a crosslinking agent selected from the group consisting of potassium dichromate , zinc dichromate , and potassium pyroantimonate , is the preferred thickening agent . nitrostarch is the preferred high explosive ingredient , if such is employed in the slurry . various additional ingredients , familiar to those skilled in the art , may be employed in the explosive slurries of this invention . such ingredients may include an antacid , such as zinc oxide , calcium carbonate , etc ., a stabilizer such as sodium thiosulfate , and additional sensitizers , such as air - entrapping materials , e . g . hollow glass or plastic microspheres . a preferred explosive slurry may comprise the following ingredients at the indicated approximate concentrations : ______________________________________ wt . % ______________________________________ammonium nitrate 30 - 50sodium nitrate 5 - 15calcium nitrate 5 - 15corn sugar 2 - 10ground coal 0 . 1 - 5carbon black 0 . 01 - 2aluminum 2 - 7hollow glass microspheres 0 . 01 - 3nitrostarch 0 - 25water 10 - 30hydrogen peroxide 0 . 01 - 0 . 2______________________________________ it is thus apparent that there have been provided improved explosive slurries which satisfy the objectives , aims and advantages set forth above . although the invention has been described in conjunction with explosive slurries containing certain ingredients , it is not intended to be limited to such slurries but is intended to broadly embrace all aqueous explosive slurries which fall within the spirit and broad scope of the appended claims . the invention is further illustrated by the following examples but is not intended to be limited thereby . two aqueous slurry explosives ( designated a and b ) were prepared by blending the following ingredients at the indicated concentrations : ______________________________________ a bingredient wt . % wt . % ______________________________________ca ( no . sub . 3 ). sub . 2 4 . 76 4 . 76mg ( no . sub . 3 ). sub . 2 4 . 29 4 . 29zno 0 . 8 0 . 8nitrostarch ( from 23 % aqueous slurry ) 21 . 6 21 . 6corn sugar 6 . 0 6 . 0ammonium nitrate 29 . 5 29 . 5sodium nitrate 10 . 0 10 . 0hollow glass microspheres 1 . 0 1 . 0sodium thiosulfate 0 . 4 0 . 4hydrogen peroxide ( from 3 % aqueous solution ) 0 . 03 -- aluminum 5 . 0 5 . 0hydroxy propylated guar gum 0 . 15 0 . 15guar gum 1 . 0 1 . 0zinc chromate 0 . 1 0 . 1water 15 . 37 15 . 40______________________________________ each slurry was mixed for 15 minutes until all ingredients were suspended . portions of both slurries were packed into 11 / 2 inches diameter tubing and were tested for sensitivity . both were sensitive to detonation with an a - 4 blasting cap . the slurries were allowed to stand for 21 / 2 hours until they were quite viscous . they were then agitated for 10 minutes to cause sheering of the aluminum and portions were again packed into 11 / 2 inches diameter tubing and tested for sensitivity to detonation . slurry a was sensitive to detonation with an a - 1 blasting cap , but slurry b required an a - 4 blasting cap for detonation . the experiment of example i is repeated in all essential details except that sodium peroxide is substituted for hydrogen peroxide . the sodium peroxide - containing slurry should retain its sensitivity during mixing and filling . the experiment of example ii is repeated in all essential details except lithium peroxide is substituted for hydrogen peroxide . the lithium peroxide - containing slurry should retain its sensitivity during mixing and filling . | 2 |
in general , the procedure in accordance with the invention , making it possible to establish a diagnosis of the physical state of wood or of wooden structures , more particularly of poles , so as to determine their possible level of degradation , consists in carrying out , by means of a portable measuring apparatus , such as shown diagrammatically in fig1 on the one hand a measurement of the hardness of the wooden structure by depthwise penetration into its thickness of a measurement element , but also and simultaneously a measurement , also depthwise , of the moisture content of the wood , as close as possible to ground level . the measurement of these variables makes it possible , by means of calibrated processing software , to give an instantaneous and accurate result to the user , for example in the form of colored lights , a green light indicating that the structure is good whereas a red light will indicate , on the contrary , that the structure is dangerous , or in digital form which can be transferred to a microcomputer for maintenance statistics , confirming whether the pole is in good condition and therefore may be climbed by a technician without danger , or whether , on the contrary , it has to be visited again within a short space of time , or indeed even changed . the depthwise hardness measurement is , in accordance with the procedure according to the invention , carried out by simultaneous penetration by two spikes which penetrate by means of pressure into the structure on either side of a rigid measurement spacing , over a predetermined and constant depth , the actual penetration force of the two measurement members being measured by a force sensor . in order to carry out the measurement of the depthwise moisture content in the wood , various techniques may be envisaged such as those making use of the insulating properties of anhydrous wood ( unstable state ) and of the conducting properties of wood containing moisture . these techniques are called &# 34 ; resistive &# 34 ; techniques , the resistivity of wood being inversely proportional to its water content . this measurement technique is advantageously used for the implementation of the invention , since it makes it possible to perform a depthwise measurement of the moisture content , for example at 40 mm from the surface , by virtue of electrodes which are insulated over their length and which , advantageously are constituted by the same spikes which enable the resistance to penetration into the wood to be measured . possibly , other known methods for measuring the moisture content , for example capacitive methods measuring the phase shift of a high - frequency wave after propagation in the material , could be envisaged . such methods , which may be more accurate , are , however , more tricky to implement as a result of the surface state and coupling state , the sensitivity to the fibre angles , to the varieties of wood , etc . the appended figures illustrate a preferred embodiment of an apparatus enabling the procedure in accordance with the invention to be implemented , which apparatus makes it possible simultaneously to take the measurement of local hardness in the region of ground level and the measurement of the moisture content , by means of an assembly comprising two simultaneously actuated spikes which are associated with a force sensor and controlled translationally by means of an operating arm , said spikes constituting the electrodes which enable the depthwise moisture content of the wooden structure to be measured . such an apparatus is essentially composed of an assembly designated by the general reference ( 1 ) essentially comprising an all - welded longitudinal body ( 5 ) to which two pairs of positioning stops ( 6 , 7 ) are fitted , these being arranged on either side of the vertical plane of symmetry of said body and intended to bear against the structure to be checked on either side of a rigid measurement spacing . these two pairs of stops ( 6 , 7 ) are separated from each other by a distance of the order of a few tens of centimeters , so as to guarantee that the apparatus fits precisely along the longitudinal generatrix of the pole , the base of the apparatus being arranged in the vicinity of the ground level . this body ( 5 ) is fixed to the pole by means of at least one strap . in the example shown diagrammatically in fig1 two straps ( 8 ) are provided in the region of the positioning stops ; however , in the embodiment illustrated in fig2 to 6 , a single strap ( 8 ) arranged in the intermediate zone between the pairs of stops ( 6 , 7 ) and surrounding the column ( 5 ) turns out to be enough . the ends of this strap comprise means making it possible to lock the apparatus against the pole ( p ), constituted , for example , by a system ( 20 ) based on toothed clicks and ratchets actuated by a lever ( 21 ). the presence of four supports ( 6 , 7 ) makes it possible to ensure perfect fitting against the surface of the structure to be checked . as is clearly apparent from fig5 and fig7 these supports ( 6 , 7 ) are oriented so as to converge towards the rigid measurement spacing . moreover , as is apparent from fig4 and 5 , these supports ( 6 , 7 ) are arranged in the region of the plane of penetration of the spikes / electrodes ( 3 , 4 ) performing the hardness and moisture - content measurement . finally , these supports ( 6 , 7 ) are themselves synchronized onto a reference - position detector when the head of the electrodes is in contact with the surface of the longitudinal generatrix of the wood . associated with this all - welded longitudinal body ( 5 ) is a case ( 10 ) containing the measurement and operating members , that is to say essentially the electrodes ( 3 , 4 ), the force sensor ( c ), the translation device , the structure of which is more particularly apparent in fig6 and which is controlled by an operating arm ( 2 ). advantageously mounted on top of the case ( 10 ) is a cover ( 30 ) on which are arranged the buttons ( 31 ) for starting and stopping the apparatus , the display of the data on colored lights ( 32 ) as well as the link ( 33 ) to a microcomputer . arranged inside the base and the cover are the means which make it possible to provide the memory for the management of the measurement cycle and the data - acquisition storage . also arranged inside the case ( see fig6 ) are start - of - travel and end - of - travel sensors ( 11a , 11b ), an electrical power supply and a measurement chain for the force sensor ( c ) and for the resistivity between the electrodes ( 3 , 4 ). a set of lights ( 34 ) ( see fig5 ) makes it possible to display , in a color code , the physical or mechanical state of the pole . a handle ( 36 ) is provided on top of the cover in order to enable the apparatus to be easily transported from one site to another . the penetration by the spikes of the electrodes ( 3 , 4 ) into the pole ( p ) is achieved by the manual force of the user acting on the operating arm ( 2 ), the depth of penetration , which depends on the length of the spike / electrode , possibly being variable but generally being calibrated to 40 mm . by way of indication , the maximum forces necessary for penetration of the spikes ( 3 , 4 ) into a new pole of high density are approximately 3000n per pair of electrodes of 3 to 3 . 5 mm in diameter . this force corresponds to the pressure peak observed after 40 mm of penetration , taking into account not only the pressure but also the frictional forces . the maximum penetration of the electrodes is depicted by the dotted lines in fig6 . in order to guarantee engagement and disengagement of the electrodes , they are moved by a linear translation of the means for supporting the electrodes , this also being the means for supporting the force sensor . this translation is brought about by human action and it is guaranteed in the mechanical guiding system ( 12 ) which is protected by the case ( 10 ) and sealed by a bellows ( 13 ), which guiding guarantees constant translation over time , especially as regards frictional forces . this also contributes to the accuracy and reliability of the performance of the apparatus . the measurement pressure is not influenced by the diameter of the pole by virtue of the provision of a system of positioners aligned on the electrodes . as a consequence , by virtue of the invention , it is possible to check poles of different diameters ( from small - diameter telephone poles to poles for medium - to high - voltage power lines ). the force sensor shown behind the head of the electrodes measures the force of penetration by said electrodes with an accuracy greater than 2 %. the quality of the translation makes it possible to have excellent repeatability of the measurements . the body of the case ( 10 ) of said apparatus incorporates the wiring for the pair of measurement members ( 3 , 4 ) so as to connect them to the management unit . the management is carried out in real time , with transmission of the information , for example to lamps , indicating the instantaneous state of the wood or of the pole , or else by linking to a microcomputer capable of interpreting the actual measurements taken , it being possible for these to be stored in the apparatus , for statistical studies aiming to optimize the maintenance of the plant visited . it could be envisaged to use other means of processing , for example before storage or by means of serial - line outputs . when the electrodes ( 3 , 4 ) are at the end of their travel ( after 40 mm of penetration , for example ), the sensor transmits the information and initiates the collecting of the measurements of the hardness by reading the force sensor . as regards the moisture content , this is measured in the head of the electrodes ( 3 , 4 ), this making it possible to know the depthwise moisture content of the pole . the body of the electrodes is insulated so as not to be disturbed by the surface moisture content . the measurement of the moisture content is carried out very accurately on account of the fact that it is performed with the electrodes acting in a horizontal plane in the pole embedded in the ground , this therefore guaranteeing a measurement through a greater layer of cells . such an apparatus has a simple design and is easy to operate , the movements of the electrodes ( 3 , 4 ) being easily accomplished by means of the movements of the lever arm ( 2 ) about its pivot point ; the travel of the electrodes is limited by a small check chain or by other equivalent means . it should also be noted that the way in which the apparatus in accordance with the invention is fixed makes it possible to achieve very great stability in the fixing to the pole by virtue of the presence of four constant supports , these being reproducible whatever the diameter of the pole and being stable whatever its hardness , the measurement elements penetrating , for example , precisely along the diametral axis . compared to the prior solutions , such a procedure and apparatus has many advantages and leads to very accurate measurement , on account of the fact that it is based on the metrology of two variables , namely the local hardness and the moisture content . the fact that this measurement is performed by means of two spikes eliminates any risk of a false measurement , for example by penetration into a crack in the pole , the procedure according to the invention , making it possible to measure a force using a force sensor , and this being done at a constant distance ( that of the penetration of all the spikes ), guarantees accuracy in the hardness measurement . moreover , the depthwise measurement of the moisture content makes it possible to determine whether the structure has not been weakened by the biological action of a lignivorous fungus , this measurement making it possible to demonstrate a moisture - content range corresponding to the possibility of the presence of the parasite . the purpose of this measurement is not to give a strictly accurate value of the moisture content but only an indication of a biological nature , namely whether the wood probably contains an active fungus or whether it is sound . finally , according to the invention , the processing of the results is based on electronic analysis and a diagnosis is made on the basis of a laboratory calibration , providing a characteristic strength of the pole for each pair of measured data . the interpretation performed by the machine transposes signals to the user by means of light - emitting diodes indicating different states , for example a very good state , a good state , one in the course of weakening and weakened , and one which is very much weakened and dangerous . such a type of diagnosis therefore guarantees the operating safety of the network as well as better management of the maintenance of the plant visited , by the processing via a microcomputer of all the actual data measured and stored temporarily in the apparatus . of course , the invention is not limited to the embodiment described above , but encompasses all alternative forms of it which are made in the same spirit . | 6 |
referring firstly to fig1 the device illustrated is designated 10 and comprises a base block 12 which has two bores 14 and 16 therein . each bore 14 , 16 has a right angled bend therein , the bores having entrances thereto in the top wall of the block and in the side wall of the block . brass nipples 18 and 20 are screwed into the horizontal portions of the block 10 and a further brass nipple 22 is screwed into the upper end of the bore 14 . gas pipes ( not shown in fig1 ) fit onto the nipples 18 and 20 . the pipe fitted to the nipple 18 leads via a solenoid operated valve ( not shown in fig1 ) to a gas cylinder or other source of inflammable gas . the pipe fitted to the nipple 20 leads to an appliance ( not shown in fig1 ) such as a gas stove or water heater . a sleeve 24 has the lower end thereof inserted into a groove 26 provided in the top face of the block 12 . there is a sealing ring 28 . 1 in the groove 26 . the sleeve 24 is pressed into the groove 26 by means of a top cap 30 and a ring of bolts 32 . the bolts 32 pass downwardly through the cap 30 , through a collar 34 and into tapped blind bores 36 of the block 12 . nuts 38 on the lower ends of the bolts 32 are located in the countersunk lower ends of the bores in the collar 34 . the heads of the bolts 32 are in the countersunk upper ends of the bores in the cap 30 . the lower face of the cap 30 has a circular groove in it and there is a seal 28 . 2 in this groove . the upper end of the sleeve 24 is seated in this groove . a vertical tube 40 is fitted over the nipple 22 and has therein an opaque piston 42 . the piston is relatively light so that it can ` float ` on the gas as a result of the pressure differential between the upper and lower faces thereof when there is a major gas flow . a stop 44 at the upper end of the tube 40 limits upward movement of the piston 42 . small registering holes 46 in the nipple 22 and tube 40 form an orifice and place the bores 14 and 16 in communication with one another at all times . a further larger hole 48 in the tube 40 places the upper part of the tube 40 in communication with the chamber bounded by the block 12 , top cap 30 and sleeve 24 . the collar 34 carries a light source 50 and , at a diametrically opposed position , a light sensitive cell 52 . the piston 42 is between the light source and the cell when it is in the position shown in fig1 . the device described operates in the following manner . gas for the pilot flame of the appliance flows from the bore 14 to the bore 16 through the holes 46 . the piston 42 prevents light from the source 50 reaching the cell 52 . when the appliance is switched on , there is a pressure drop in the bore 16 and hence in the sleeve 24 and upper part of the tube 40 . the pressure of the gas below the piston 42 lifts it to the upper end of the tube 40 so that gas can now flow from the bore 14 to the bore 16 through the hole 48 . when the appliance is switched off the gas in the sleeve 24 and in the bore 16 is used up and the piston then sinks back to the position shown so that light ceases to reach the cell 52 . experimental work has shown that the liquid which is to be found in lpg gas , and which comprises some water and what are known as the heavy - ends of the crude oil , assists in sealing between the piston 42 on the one hand and the tube 40 and the nipple 22 on the other hand . the liquid also acts as a lubricant between the piston 42 and the tube 40 . turning now to fig2 the control panel shown comprises a timer knob 54 which can be set for five , thirty or one hundred and twenty minutes . below the timer knob 54 are two re - set buttons 56 and 58 . the button 56 is to re - set the timer and the button 58 is to re - set the solenoid operated valve which is between the gas cylinder and the device 10 . light emitting diodes ( led &# 39 ; s ) 60 , 62 , 64 , 66 and 68 are provided for indicating respectively that there is an alarm condition ( discussed in more detail below ), that the voltage of the battery which powers the system is low , that the main flame is not burning correctly ( discussed in more detail below ), that the pilot flame has gone out , and that the solenoid operated valve is closed . two other light emitting diodes 70 and 72 indicate that the system has electrical power supplied to it and that there is gas flow . this is also discussed in more detail below . the led 60 has an audible warning device such as a buzzer associated with it . turning now to fig3 the device 10 is shown connected in the gas line between a gas cylinder 74 and a gas appliance 76 . a solenoid operated valve 78 is connected between the cylinder 74 and the device 10 . gas can flow continuously through the device 10 via its orifice for supplying a pilot flame . the signal produced by the cell 52 when the piston lifts upon there being gas flow illuminates an led 72 and is fed to an and gate 80 . the output of the gate 80 is fed to the led 60 which indicates an alarm condition , to a series connected time delay device 82 and to a control unit 84 which is in turn connected to the solenoid operated valve 78 . three sensors and their associated sensor circuits 86 , 88 and 90 detect respectively the voltage level of the battery which powers the system , the presence of a pilot flame and the colour of the main flame when the appliance is on . the voltage level sensor circuit 86 provides a signal when the battery voltage drops from 12 volts to 9 volts . the sensor circuit 88 for the pilot flame includes a light sensitive cell and provides a signal in the absence of any light from the pilot flame . the sensor circuit 90 also includes a light sensitive cell and is set so that it produces a signal should the luminosity of the main flame increase unduly . a flame which is burning too yellow is an indication of a fault in the appliance . the leds 62 , 64 and 66 are shown associated with the detector circuits 86 , 88 and 90 and are illuminated when any sensor circuit provides a signal indicating improper functioning of the appliance or a low voltage . the output from the sensor circuits 86 , 88 and 90 are fed to an or gate 92 and the output from the or gate forms one of the inputs to an and gate 94 . the other input of the and gate 94 is received from the timer which is controlled by the knob 54 . while the voltage level detector 86 and pilot flame detector 88 are providing signals which indicate that the voltage level is above the minimum acceptable value and that there is a pilot flame then no signal is fed to the and gate 94 . it will be understood that as the main flame is off at this stage the detector circuit 90 will not be providing a signal indicating an improper condition . when the timer is set to run for five , thirty or one hundred and twenty minutes then it ceases to provide a signal to the and gate 94 which then provides a signal to the and gate 80 . upon the appliance being switched on the piston 42 lifts and a further signal is applied to the and gate 80 by the device 10 . simultaneously the sensor 90 checks the luminosity of the main flame and provides a signal only if the flame is too yellow . assuming that no signal is received , gas is fed to the appliance until the time period set on the timer expires . a signal is then fed to the gate 80 and the alarm led 60 comes on . unless the button 56 is pressed to set the timed period running again then , after a 30 second delay , the solenoid operated valve 78 is closed . in the event that any one of the sensors detects an improper operating characteristic then a signal is applied through the gates 92 and 94 to the gate 80 . after a thirty second delay the solenoid valve 78 closes even though the time set on the timer may not have expired . the solenoid valve 78 , once closed , can only be re - opened by depressing the button 58 . should there be a leak at the appliance 76 then gas flow will lift the piston 42 and the device 10 will send a signal to the gate 80 . however , there will be an appropriate signal at the other input to the gate 80 if the timer is in its off position . some gas using appliances such as stoves do not have pilot flames associated with their burners . the gas tap of a burner that is to be used is simply turned on and the gas ignited using a match or other heat source . if the above described device is to be used to monitor gas flow to appliances which do not have pilot flames then the flow path constituted by the holes 46 or the bore 96 can be omitted as a continuous minor flow of gas is not in such circumstances required . each gas tap of the stove to which flow of gas is to be monitored has a microswitch associated with it . the microswitches can be normally closed or normally open and are arranged so as to be opened or closed as the gas tap is opened thereby to provide a signal indicating gas flow . associated with each burner of the stove is a heat detector . in the event that , within a predetermined period of time comencing with a gas tap being opened and the microswitch associated with that gas tap thus changing its state , the heat detector does not produce a signal indicating that the main flame has been ignited , a warning is given and the valve 78 closed . | 5 |
referring to fig1 and 2 , an x - ray marker 10 formed from a composite material has a thin base 12 with raised portions 14 . the marker 10 is disposed on a solid flat object ( not shown ), such as an x - ray support platform interposed between an x - ray source and an x - ray sensitive image receptor . by selectively absorbing x - rays emitted by the source , an image replicating the raised portions of the marker 10 is produced on the image receptor . the thin base 12 is formed from a composite material and has a substantially smooth bottom surface 16 and a top surface 18 . the bottom surface 16 engages the support platform disposed between the x - ray source and x - ray sensitive image receptor . the bottom surface releasably attaches to the platform , such as by applying adhesives or the like to the bottom surface , to allow any orientation of the surface without the marker falling off . preferably , the base 12 is formed from a composite material which when formed with the substantially smooth bottom surface 16 adheres to a relatively flat object without the use of adhesives . advantageously , if the adhering bottom surface 16 becomes soiled , it can be washed off to restore its adhering qualities . by providing a marker 10 having a smooth bottom surface which adheres to other smooth objects , the marker 10 can be used on non - horizontal smooth objects without additional means to maintain the marker 10 in position . the top surface 18 has raised portions 14 formed as an integral part of the base 12 . the raised portions 14 form a pattern which extends from the top surface 18 and define letters or symbols , such as prescribed by the american college of radiology , for use as identifying the conditions of production of an x - ray image . such conditions include , but are not limited to laterality , x - ray beam direction , technologist initials and the like . the composite material absorbs the x - rays emitted by the x - ray source in relation to the composite material thickness . therefore , the raised portions 14 absorb a greater amount of x - rays than the surrounding base 12 . the disparity in x - ray absorption results in an image formed on the x - ray sensitive image receptor which substantially duplicates the pattern of the raised portions 14 . although a base 12 having raised portions 14 is described herein , the disparity in x - ray absorption can be accomplished by forming indentations or voids defining a pattern in the base . the indentations allow a greater amount of x - rays to pass through the pattern and form an image in the x - ray sensitive image receptor without departing from the scope of the present invention . the composite material includes a shaping material and an x - ray attenuator . other materials , such as solvents , binding agents , curing accelerators , or color additives may also be included in the composite material to provide specific desirable properties , such as color , flexibility , short curing time or the like , to the composite material . the shaping material provides the marker 10 shape and is a flexible plastic or rubber based base material , such as latex , urethane , or epoxy . preferably , the shaping material has adhering properties , such as urethane which adheres to smooth objects when formed with a smooth surface . the x - ray attenuator is suspended in the shaping material and absorbs x - rays to form an image on the x - ray sensitive image receptor . importantly , the x - ray attenuator is dispersed throughout the shaping material providing the composite material with a substantially uniform density to avoid unwanted images forming on the x - ray sensitive image receptor . advantageously , by forming the marker with a composite material having a substantially uniform density , simple fabrication techniques , such as molding , casting , or the like , may be employed . x - ray attenuators such as , lead , tantalum , barium , barium sulfate , barium titanate , and compounds thereof may be used . barium sulfate is preferred because it is inexpensive , readily available , non - toxic , and non - reactive with the preferred shaping material . preferably , the x - ray attenuator is in the form of a powder which is easily dispersed within with the shaping material . in a preferred embodiment , the composite material includes approximately 25 % to 75 % of urethane by weight and 75 % to 25 % of barium sulfate by weight to provide a marker having a base thickness of approximately 0 . 04 to 0 . 06 inches with raised portions extending another 0 . 09 to 0 . 11 inches from the base top surface . most preferably , the composite material includes approximately 50 % of urethane by weight and approximately 50 % of barium sulfate by weight to provide a marker having a base thickness of approximately 0 . 05 inches with raised portions extending approximately another 0 . 1 inches from the base top surface . of course , other combinations of x - ray attenuator density and raised portion height may be used , such as less barium sulfate in combination with a greater raised portion height , to produce a similar image without departing from the scope of the present invention . preferably , the urethane is a castable transparent urethane elastomer such as skinflex iii provided by bjb enterprises , garden grove , calif . the skinflex iii is provided as a three part mixture which are combined in differing quantities to form an elastomer having desired properties . the three part mixture includes part a ( polyurethane resin ), part b ( polyurethane curing agent ), and part c ( plasticizer - ester ). part a is mixed with part b at an approximately 1 to 2 ratio ( i . e . 1 part of part a is added to 2 parts of part b ) by weight to form the urethane . part c is added to the mixture of part a and part b to provide a more flexible article . preferably , 0 % to 50 % by weight of part c is mixed with the part a / part b mixture to provide the shaping material for the marker . most preferably , approximately 10 % by weight of part c is mixed with the part a / part b mixture to provide a marker which sufficient flexibility for easy handling and adhesion qualities when provided with a substantially smooth base bottom surface . the marker 10 is fabricated by mixing the shaping material , x - ray attenuator , and any other desired additives together to uniformly disperse the x - ray attenuator and create the composite material . appropriate amounts of part a , part b , and part c are combined and mixed for approximately 1 to 2 minutes to form uncured urethane ( i . e . in a fluid state ). the x - ray attenuator is mixed into the uncured urethane thoroughly dispersing the powder throughout the uncured urethane mixture . any other additives , such as a color additive , available from m - f manufacturing in texas or bjb enterprises , is also added to the uncured urethane and thoroughly mixed after parts a , b , c have been combined . as shown in fig3 the composite mixture 20 is then poured into a mold 22 having a cavity 24 formed therein . the cavity 24 defines the shape of the marker base 12 with raised portions 14 . a smooth flat surface 26 , such as a glass sheet is placed over the cavity 24 and engages the mixture 20 to form the smooth marker bottom 16 . the mixture 20 is then allowed to cure at room temperature . other composite materials may require different curing procedures known in the art such as by exposing the molding containing the mixture to heat , uv rays or the like . once cured , the marker 10 is removed from the mold 20 and ready for use . in another embodiment of the present invention , two composite materials such as described above may be used to form the marker . one composite material having more x - ray attenuator than the other . the composite material having a larger amount of x - ray attenuator is poured into the mold first to fill the raised portions defining the pattern in the marker . advantageously , this embodiment provides a sharper pattern image on the image receptor , at the expense , however , of increasing manufacturing complexity . while there has been shown and described what are at present considered the preferred embodiment of the invention , it will be obvious to those skilled in the art that various changes and modifications can be made , therein without departing from the scope of the invention defined by the appended claims . | 6 |
detailed illustrative embodiments of the present invention are disclosed herein . however , specific structural and functional details disclosed herein are merely representative for purposes of describing example embodiments of the present invention . this invention may , however , be embodied in many alternate forms and should not be construed as limited to the embodiments set forth herein . accordingly , while the invention is susceptible to various modifications and alternative forms , specific embodiments thereof are shown by way of example in the drawings and will herein be described in detail . it should be understood , however , that there is no intent to limit the invention to the particular forms disclosed , but on the contrary , the invention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the invention . like numbers refer to like elements throughout the description of the figures . fig2 is a block diagram illustrating a charge pump pll ( phase locked loop ) according to an example embodiment of the present invention . an input clock ( fin ) 201 is inputted to a pre - divider 210 and the pre - divider 210 converts the input clock 201 to a low frequency clock ( fref ) 211 . the low frequency clock 211 is provided to a phase frequency detector 220 . the phase frequency detector 220 compares a phase of the low frequency clock 211 to a phase of a final clock ( ffeed ) 261 generated from a main - divider 260 and outputs an up signal 221 and / or a down signal 222 . when the phase of the low frequency clock 211 leads the phase of the final clock 261 , the up 221 signal is activated and the down signal 222 is inactivated . conversely , when the phase of the low frequency clock 211 lags behind the phase of the final clock 261 , the down signal 222 is activated and the up signal 221 is inactivated . a charge pump 230 outputs currents to a loop filter 240 or pulls currents from the loop filter 240 through two paths 231 and 232 . in particular , a current is outputted to the loop filter 240 through the first path 231 or is pulled from the loop filter 240 through the first path 231 based on the states of the up signal 221 and the down signal 222 . in contrast , the second path 232 controls the quantity of the current , which is outputted to the loop filter 240 or pulled from the loop filter 240 , in proportion to a phase difference between the input clock 211 and the output clock 261 . the loop filter includes resistors r 1 and r 2 and capacitors c 1 and c 2 . the output voltage 241 of the loop filter 240 is provided to a voltage controlled oscillator ( vco ) 250 and is used for controlling a frequency of an output clock 251 , which may be equivalent to the signal fout . the output clock 251 of the vco 250 is divided by the main - divider 260 and then the divided output clock 261 is fed back to the phase frequency detector 220 . the inclusion of a main - divider 260 is optional . fig3 is a circuit diagram illustrating first and second charge pumps and a loop filter included in a fast locking charge pump pll ( phase locked loop ) according to an example embodiment of the present invention . the fast locking charge pump pll shown in fig3 according to an example embodiment of the present invention includes a first charge pump 350 and a second charge pump 300 . the first charge pump 350 pushes ( or pulls ) a current provided from current sources 355 and 356 to / from the loop filter 360 via a first current path 357 using a first switch 353 and a second switch 354 . the first switch 353 and the second switch 354 operate in response to the up signal 221 and the down signal 222 outputted from the phase frequency detector 220 . features of the second charge pump 300 will now be described . an exclusive or gate 305 included in the second charge pump 300 receives the up signal 221 and the down signal 222 outputted from the phase frequency detector 220 , and the result of the logic operation and an enable signal ( en ) 303 are provided to an and gate 306 . the enable signal ( en ) 303 is used for determining whether the second charge pump 300 is enabled or not . the second charge pump 300 can operate based on the up signal 221 and the down signal 222 when the enable signal 303 is activated . when both of the up signal 221 and the down signal 222 are in an inactive state ( e . g ., a logic low level ), the output of the and gate 306 has an inactive state . when the up signal 221 is in an active state and the down signal 222 is in an inactive state or when the up signal 221 is in an inactive state and the down signal 222 is in an active state , the output of the and gate 306 has an active state ( e . g ., a logic high level ). in addition , because both the up signal 221 and the down signal 222 are in an active state during a reset operation of the phase frequency detector 210 , the exclusive - or gate 305 disregards this condition by providing a logic 0 signal to the and gate 306 . a second current path 347 of the second charge pump 300 is coupled to serially coupled resistors 361 and 362 included in the loop filter 360 . in alternative embodiments , the loop filter 360 may have various configurations depending upon filtering characteristics of the loop filter , however , in the illustrated embodiment of the present invention , the loop filter 360 includes a first capacitor 363 coupled between an output terminal 365 of the loop filter 360 and the ground , a second capacitor 364 serially coupled to the resistors 361 and 362 as shown in fig3 . an operation of the second charge pump 300 is now described below with reference to fig3 a through 4 d and 5 a through 5 c . fig4 a through 4d show signal waveforms during an initial stage of phase lock according to an example embodiment of the present invention . in the initial stage of phase lock of fig4 a through 4d , the phase difference between the input clock and the output clock is typically very large . fig5 a through 5c show signal waveforms during a last stage of phase lock according to an example embodiment of the present invention . in the last stage of phase lock of fig5 a through 5c , the phase difference between the input clock and the output clock is typically small . the charge pump pll according to an embodiment of the present invention adaptively operates based on a phase difference between an input clock and an output clock . with reference to fig4 a through 4d , there is explained the first operation in the case where the phase difference of the input clock and the output clock is large during the initial stage of phase lock and , at the same time , a phase of the input clock leads a phase of the output clock . fig4 a is waveform showing the up signal 221 and the down signal 222 outputted from the phase frequency detector 220 in the above - mentioned condition . as shown in fig4 a , the up signal in an active state has wide width and the down signal is in an inactive state . the output of the and gate 306 has an inactive state during a first section 402 where the up signal is in an inactive state and the down signal 222 has an inactive state . when this occurs , the pmos transistor 310 is turned - on and a fast locking up voltage ( hereinafter referred to as “ flu ” voltage ) 343 is pre - charged to a high power supply voltage vdd . the flu voltage 343 is applied to a control electrode of a pmos transistor 335 and then used for controlling the turn - on intensity of the pmos transistor 335 . in addition , a diode coupled nmos transistor 337 , which is serially coupled to the pmos transistor 335 , is controlled by a fast locking down voltage ( hereinafter referred to as “ fld ” voltage ) 344 . the fld voltage 344 has a symmetrical waveform with respect to the waveform of the flu voltage 343 . fig4 b illustrates waveforms showing variations of the flu voltage 343 and the fld voltage 344 according to a state transition of the up signal 221 . after the flu voltage 343 is pre - charged to the high power supply voltage vdd in response to the inactive state of the up signal 221 , when the up signal 221 goes to an active state ( 401 ) from an inactive state ( 402 ), a switch 341 is closed in response to the active state of the up signal 221 . meanwhile , when the up signal 221 goes to the active state ( 401 ), the output of the and gate 306 goes to an active state . in response , the nmos transistor 320 is turned - on . as a result , a predetermined current is provided through a current source 325 and a bias capacitor 330 , and then the flu voltage 343 decreases during the period 401 . while the flu voltage 343 decreases , a pmos transistor 336 is turned - on . in response , a current is outputted from the high power supply voltage vdd to the loop filter 360 through the second current path 347 . fig4 c is waveform showing a current icp 1 provided to the loop filter 360 from a current source 355 in the first charge pump 350 in response to the up signal 221 . fig4 d is waveform showing a current icp 2 , which is controlled by the pmos transistor 336 based on the flu voltage 343 to be provided to the loop filter 360 . the current icp 1 outputted from the first charge pump 350 shown in fig4 c and the current icp 2 outputted from the second charge pump 300 shown in fig4 d are provided to the loop filter 360 together . generally , the second charge pump 300 outputs a relatively high current icp 2 compared with the current icp 1 outputted from the first current sources 355 and 356 of the first charge pump 350 . thus , the second charge pump 300 can reduce the locking time . in the example embodiments of the present invention , the current quantity of the second current source 325 included in the second charge pump 300 is about two to three times as large as the current quantity of the first current sources 355 and 356 included in the first charge pump 350 . there is now explained the second operation in case the phase difference between the input clock and the output clock is large during the initial stage of phase lock and , at the same time , a phase of the output clock leads a phase of the input clock . the second operation , in which the up signal 221 is inactivated and the down signal 222 is activated , may be easily understood with reference to the symmetrical relationship between the flu voltage 343 and the fld voltage 344 as shown in fig4 b . while the down signal 222 is in an inactive state , the flu voltage 343 is pre - charged to the high power supply voltage vdd and pmos transistor 335 is off and the fld voltage 344 goes to the ground voltage level . conversely , while the down signal 222 is in active state , the flu voltage 343 decreases and a level of the fld voltage 344 increases in symmetrical relationship with the flu voltage 343 . as the fld voltage 344 increases , an nmos transistor 338 is turned - on and then pulls a current from the loop filter 360 via the second current path 347 . because the first charge pump 350 and the second charge pump 300 pull a relatively large current from the loop filter 360 , a voltage level of the output terminal 365 in the loop filter 360 rapidly decreases in a similar way as the case when a phase of the input clock leads a phase of the output clock . hereinafter , there is explained operations for the case where a phase difference of the input clock and the output clock is small during a last stage of phase lock with reference to fig5 a through 5c . first , a third operation for the case where a phase of the input clock leads a phase of the output clock will be explained . fig5 a is waveform showing the up signal 221 and the down signal 222 outputted from the phase frequency detector 220 in the above - mentioned condition . as shown in fig5 a , the up signal 221 in an active state has narrow width compared with the up signal 221 shown in fig4 a , and the down signal 222 is in an inactive state . during the period 502 while the up signal is in an inactive state , an output of the and gate 306 has an inactive state . thus , the pmos transistor 310 is turned - on and the flu voltage 343 is pre - charged to the high power voltage vdd . the flu voltage 343 is applied to a control electrode of a pmos transistor 335 , and then is used for controlling the turn - on intensity of the pmos transistor 335 . in addition , a diode coupled nmos transistor 337 , which is serially coupled to the pmos transistor 335 , is controlled by the fld voltage 344 . the fld voltage 344 has a symmetrical waveform with respect to the waveform of the flu voltage 343 as shown in fig5 b . fig5 b shows variations of the flu voltage 343 and the fld voltage 344 according to state transition of the up signal 221 . after the flu voltage 343 is pre - charged to the high power supply voltage vdd in response to the inactive state of the up signal 221 , when the up signal 221 goes to an active state from an inactive state , a switch 341 is closed in response to the up signal 221 . meanwhile , the output of the and gate 306 goes to an active state when the up signal 221 goes to an active state , and then an nmos transistor 320 is turned - on . as a result , a current is provided through a current source 325 and a bias capacitor 330 , and then the flu voltage 343 decreases . while the flu voltage 343 decreases , the pmos transistor 336 remains turned - on . thus , a current is outputted from the high power supply voltage vdd to the loop filter 360 through the second current path 347 . however , the up signal 221 is changed to an inactive state from an active state before the voltage level of the flu voltage 343 completely drops . this is because the period 501 where the up signal 221 is in an active state has a narrow width . consequently , the pmos transistor 336 is turned - off right after the pmos transistor 336 is weakly turned - on . fig5 c is waveform showing current quantity provided to the loop filter 360 from a second charge pump 300 . as shown in fig5 c , the second charge pump 300 provides a relatively low level current to the loop filter 360 compared with the current provided from the second charge pump 300 shown in fig4 d there is now explained a fourth operation for the case where a phase difference between the input clock and the output clock is small during a last stage of the phase lock and , at the same time , a phase of the output clock leads a phase of the input clock . the fourth operation may be easily understood with reference to the symmetrical relationship between the flu voltage 343 and the fld voltage 344 as shown in fig5 b . in the fourth operation , the up signal 221 is inactivated and the down signal 222 is activated . while the down signal 222 is in an inactive state , the flu voltage 343 is pre - charged to the high power supply voltage vdd , and the fld voltage 344 is discharged to the ground voltage . conversely , while the down signal 222 is in active state , the flu voltage 343 decreases since a current is provided through the current source 325 and the bias capacitor 330 . as a result , a level of the fld voltage 344 increases in symmetrical relationship with the flu voltage 343 . accordingly , as the fld voltage 344 increases , the nmos transistor 338 is turned - on , and then a current is pulled from the loop filter 360 via the second current path 347 . in such case , however , the down signal 222 is changed to an inactive state from an inactive state before the fld voltage 344 completely ( or fully ) rises since the period where the down signal 222 is in an active state has a narrow width . consequently , the nmos transistor 338 is turned - off right after the nmos transistor 338 is weakly turned - on . that is , the charge pump 300 pulls a relatively low current from the loop filter 360 . as described above , the second charge pump 300 can control the quantity of current that is provided to the loop filter or is provided from the loop filter by increasing or by decreasing the flu voltage 343 and the fld voltage 344 based on the pulse width of the up signal 221 and the down signal 222 and the bias capacitor 330 . in order to suitably control the quantity of the current , the threshold voltages of the current switching elements pmos transistor 336 and the nmos transistor 338 included in the second charge pump 300 may be adjusted . for example , the threshold voltage of the pmos transistor 336 may be set to a value (( vdd − vss )× ⅔ + vss ). vdd denotes a high power voltage , and vss denotes a low power voltage . vss may have a negative voltage or a ground level . the threshold voltage of the nmos transistor 338 may be set to a value (( vdd − vss )× ⅓ + vss ). fig6 a and 6b show waveforms of an output voltage of a loop filter according to an example embodiment of the present invention . in detail , fig6 a and 6b show a voltage - time graph that indicates improved locking time of the fast locking charge pump pll according to an example embodiment of the present invention . as mentioned above , the locking time may be defined as a time required before a control voltage of the vco 150 is maintained at a fixed voltage level . fig6 a is a simulation waveform showing a locking time measured while the enable signal en is activated . fig6 b is a simulation waveform showing a locking time measure while the enable signal en is inactivated . as shown in fig6 a and 6b , in order to generate a predetermined target frequency , the control voltage of the vco is set to the level of about 0 . 78 volts . as shown in fig6 a , the measured locking time ta is about 463 milliseconds , and as shown in fig6 b , the measured locking time is about 688 milliseconds . therefore , the proposed fast locking charge pump pll according to embodiments of the present invention can reduce the locking time up to about 32 . 7 % in comparison with the locking time of the conventional charge pump pll . according to the example embodiments of the present invention , the quantity of the current outputted from the charge pump is controlled based on the phase difference between the phase of the input clock and the phase of the output clock . in an initial stage of the phase lock , a large current is provided to the loop filter or is provided from the loop filter . in a last stage of the phase lock , a small current is provided to the loop filter or is provided from the loop filter . thus , the locking time may be reduced . while the example embodiments of the present invention and their advantages have been described in detail , it should be understood that various changes , substitutions and alterations may be made herein without departing from the scope of the invention . | 7 |
chloropolysporin is produced by the cultivation of a newly discovered micropolyspora strain herein identified as micropolyspora sp . strain sank 60983 , which was isolated from a soil sample collected in tochigi prefecture , japan . the newly discovered microorganism , micropolyspora sp . strain sank 60983 , has the characteristics described hereafter . these characteristics were determined by cultivation on various media prescribed by the isp ( international streptomyces project ) or with the media recommended by s . a . waksman in volume 2 of &# 34 ; the actinomycetes &# 34 ;, in all cases at a temperature of 28 ° c . strain sank 60983 grows relatively well on various media . the aerial mycelium is hardly visible on almost all media but may occasionally be visible on glycerol - asparagine agar or on potato extract - carrot extract agar . the aerial and vegetative mycelia bear , at the top and the middle , short chains of spores , normally from 1 to 20 , although occasionally more than 20 , spores . no distinct fragmentation of the hyphae is observed with the strain , although it may be observed during later stages of the culture . strain sank 60983 can produce pale yellow , yellowish - brown or yellowish - gray colours . aerial hyphae are not observed on most media , although white aerial hyphae are produced on some media . no soluble pigment is produced . table 1 shows the results obtained after cultivation for 14 days at 28 ° c . on various standard culture media . the color names and numbers used were assigned according to the &# 34 ; guide to color standard &# 34 ;, a manual published by nippon shikisai kenkyusho , tokyo , japan . table 1______________________________________ aerial solublemedium growth mycelium reverse pigment______________________________________yeast abundant , none yellowish - noneextract - raised . brownmalt wrinkled , ( 8 - 8 - 8 ) extract yellowish - agar brown ( isp 2 ) ( 8 - 8 - 8 ) oatmeal good , none dull noneagar smooth , yellow ( isp 3 ) dull ( 8 - 8 - 9 ) yellow ( 8 - 8 - 9 ) inorganic abundant , none yellowish - nonesalt - smooth , gray ( 2 - 9 - 10 ) starch yellowish - to paleagar gray yellowish -( isp 4 ) ( 2 - 9 - 10 ) brown to pale ( 6 - 8 - 9 ) yellowish - brown ( 6 - 8 - 9 ) glycerol - good , poor , yellowish - noneasparagine wrinkled , white brownagar yellowish - ( 2 - 9 - 10 )( isp 5 ) brown ( 2 - 9 - 10 ) peptone - moderate , none pale noneyeast smooth , yellowish - extract - pale browniron agar brown ( 4 - 8 - 9 )( isp 6 ) ( 2 - 8 - 9 ) tyrosine abundant , none dull noneagar raised , yellow ( isp 7 ) wrinkled , ( 10 - 8 - 8 ) pale yellowish - brown ( 14 - 8 - 9 ) sucrose abundant , none pale nonenitrate raised , yellowish - agar wrinkled , brown pale ( 4 - 8 - 8 ) yellow ( 12 - 8 - 10 ) glucose - moderate , none yellowish - noneasparagine smooth , grayagar yellowish - ( 2 - 9 - 10 ) gray ( 2 - 9 - 10 ) nutrient moderate , none pale noneagar smooth , yellowish -( difco ) pale brown yellowish - ( 6 - 8 - 9 ) brown ( 6 - 8 - 9 ) water poor , none yellowish - noneagar smooth , gray yellowish - ( 1 - 9 - 10 ) gray ( 1 - 9 - 10 ) potato moderate , poor , yellowish - noneextract - smooth , white graycarrot yellowish - ( 2 - 9 - 10 ) extract grayagar ( 2 - 9 - 10 ) ______________________________________ the physiological properties of strain sank 60983 are shown in table 2 . table 2______________________________________decomposition : adenine - casein + xanthine - hypoxanthine + urea + hydrolysis of starch ± liquefaction of gelatin + coagulation of milk - peptonization of milk - reduction of nitrates + secretion of + deoxyribonucleasemelanin formation : isp 1 - isp 6 - isp 7 - acid production from : sodium acetate - sodium succinate - sodium citrate - sodium pyruvate - sodium tartarate - d - glucose + l - arabinose + d - xylose + inositol + d - mannitol + d - fructose + l - rhamnose + sucrose + raffinose ± utilization of d - glucose + carbon sources : l - arabinose + d - xylose + inositol + d - mannitol + d - fructose + l - rhamnose + sucrose + raffinose ± growth in nacl : 3 % w / v + 5 % w / v ± 7 % w / v ± 10 % w / v - range of growth 10 ° c . - temperature : 20 ° c . + 28 ° c . + 37 ° c . + 45 ° c . - ______________________________________ in the above table , &# 34 ;+&# 34 ; means positive , &# 34 ;-&# 34 ; means negative and &# 34 ;±&# 34 ; means slightly positive . although coagulation and peptonization of milk are both reported as negative , they may occasionally turn positive after long - term culture . acid hydrolyzates of bacterial cells were assayed by paper chromatography , using the method of m . p . lechevalier et al . [&# 34 ; the actinomycetes taxonomy &# 34 ;, page 225 ( 1980 )]. meso - diaminopimelic acid , arabinose and galactose were found to be present in the cell walls , which are thus of type iv , whilst the whole cell sugar pattern is of type a . the characteristic acyl group of the cell wall was also investigated by the method of uchida et al . [( j . gen . appl . microbiol , 23 , 249 ( 1977 )] and found to be the acetyl group . none of the known genera of actinomycetes has been reported to be capable of forming spores in the middle of the hyphae . however , from a comparison of other characteristics , the new strain is clearly related to the genera actinopolyspora , saccharopolyspora , pseudocardia and micropolyspora . however , both actinopolyspora and saccharopolyspora allow spores to grow only on the tips of aerial hyphae , and the former is a highly halophilic genus , whilst the characteristic acyl group of the cell wall of the latter is the glycolyl group . for these reasons , the new strain sank 60983 cannot be assigned to either of these genera . although strains of the genus pseudonocardia can grow spores on the aerial hyphae and on the vegetative mycelium , as does strain sank 60983 , the site of its growth takes place only at the tip of the hyphae and , moreover , its hyphae characteristically grow by budding ; thus , strain sank 60983 cannot be assigned to the genus pseudonocardia . the only difference between the genus micropolyspora and strain sank 60983 is that the site of growth of spores of micropolyspora is limited to the tips of the hyphae , whereas that of sank 60983 is at both the tip and the middle of the hyphae . at the present time , when there has been virtually no discussion in learned circles as to the implications for taxonomy of difference of this type , it would seem inappropriate to differentiate between genera solely on the basis of differences in the site of growth of their spores . accordingly , it seems most satisfactory to regard the strain sank 60983 as representative of a new species of the genus micropolyspora and it has , accordingly , been named micropolyspora sp . sank 60983 . it should , however , be remembered that assignment of a strain of microorganism to any particular species , genus or even family is largely a matter of consensus amongst those experienced in the study of the particular class of microorganism involved and the original assignment of a microorganism can be , and not infrequently is , changed after wider discussion . the strain sank 60983 has been deposited with the fermentation research institute , agency of industrial science and technology , ministry of international trade and industry , japan , on 10th march 1983 under the accession no . ferm p - 6985 and was re - deposited in accordance with the conditions stipulated by the budapest treaty with said fermentation research institute on 4th june 1984 under the accession no . ferm bp - 538 . it has been established that strain sank 60983 produces chloropolysporin . however , as is well known , the properties of microorganisms falling within the general category of the actinomycetes can vary considerably and such microorganisms can readily undergo mutation , both through natural causes and as the result of induction by artificial means . accordingly , the process of the present invention embraces the use of any microorganism which can be classified within the genus micropolyspora and which shares with the new strain sank 60983 the characteristic ability to produce chloropolysporin . the cultivation of microorganisms of the genus micropolyspora in accordance with the present invention to produce chloropolysporin can be performed under conditions conventionally employed for the cultivation of actinomycetes species , preferably in a liquid culture , and desirably with shaking or stirring and aeration . the nutrient medium used for the cultivation is completely conventional and contains such constituents as are commonly used in the cultivation of the actinomycetes . specifically , the medium should contain an assimilable carbon source , suitable examples of which include glucose , maltose , sucrose , mannitol , molasses , glycerol , dextrin , starch , soybean oil and cottonseed oil ; an assimilable nitrogen source , suitable examples of which include soybean meal , peanut meal , cottonseed meal , fish meal , corn steep liquor , peptone , meat extract , pressed yeast , yeast extract , sodium nitrate , ammonium nitrate or ammonium sulfate ; and one or more inorganic salts , such as sodium chloride , phosphates , calcium carbonate and trace metal salts . where cultivation is effected in a liquid medium , it is generally desirable to incorporate an anti - foaming agent ( for example silicone oil , vegetable oil or a suitable surfactant ) in the medium . the cultivation is suitably performed at a substantially neutral ph value and at a temperature of from 24 ° to 30 ° c ., more preferably at about 28 ° c . the production of chloropolysporin as cultivation proceeds may be monitored by a variety of conventional techniques for monitoring the production of antibiotics by microbial culture and which require little or no elaboration here . a suitable technique might be the paper disc test method ( using , for example , a paper disc of diameter about 8 mm produced by toyo kagaku sangyo co ., ltd ) and using bacillus subtilis pci 219 or staphylococcus aureus fda 209p jc - 1 as the test organism . the amount of chloropolysporin produced normally reaches a maximum after cultivation has proceeded for 55 - 70 hours and it is clearly desirable to separate the chloropolysporin from the culture medium no later than the time when this maximum has been reached . however , this period may vary , depending upon the cultivation conditions and techniques , and a shorter or longer period may be appropriate , depending upon the circumstances . the correct cultivation time may readily be assessed for every case by routine experiment , using suitable monitoring techniques , e . g . as described above . chloropolysporin is mainly released into the liquid portion of the culture broth and can thus be recovered by removing solid matter , including the mycelium , for example by filtration , preferably using a filter aid such as diatomaceous earth , or by centrifugation . it can then be recovered from the separated liquid portion by conventional techniques and , if desired , then purified . chloropolysporin is preferably separated from other products in said liquid portion by means of an adsorbent , either by adsorbing the impurities or by adsorbing the chloropolysporin or by adsorbing both separately or together and then eluting the chloropolysporin . a wide range of adsorbents may be used ; examples which we have found to be particularly satisfactory include : activated carbon ; amberlite ( registered trade mark ) xad - 2 , xad - 4 or xad - 7 ( products of rohm and haas ); and diaion ( registered trade mark ) hp 10 , hp 20 , hp 20ag or hp 50 ( products of mitsubishi chemical industries co ., ltd .). the impurities present in the liquid portion may be removed by passing the solution containing chloropolysporin through a layer or column of one or more of the aforementioned adsorbents or by adsorbing chloropolysporin on one or more of the adsorbents and then eluting the chloropolysporin with a suitable eluent . suitable eluents include mixtures of methanol , acetone or butanol with water . the chloropolysporin obtained may be further purified by various means . suitable methods include : partition column chromatography using a cellulose product , such as avicel ( a registered trade mark for a product of asahi chemical industry co ., ltd .) or sephadex lh - 20 ( a registered trade mark for a product of farmacia , sweden ); reverse phase column chromatography using a carrier for the reverse phase ; extraction based on the difference in distribution in solvents between chloropolysporin and its contaminating impurities ; or the counter - current distribution method . these purification techniques may be used singly or in combination and may , if needed , be repeated one or more times . depending upon the culture conditions , chloropolysporin can exist in the mycelium from the culture broth and can be extracted therefrom by conventional techniques . for example , it can be extracted with a hydrophilic organic solvent ( such as an alcohol or acetone ), and then the solvent removed from the extract to leave a residue , which is dissolved in an aqueous medium . the chloropolysporin can be extracted from the resulting solution and purified as described above . chloropolysporin thus obtained has the physical and chemical properties described above . its minimal inhibitory concentration ( mic ) against various gram - positive and gram - negative bacteria was determined by the agar dilution method , using a mueller - hinton agar medium containing 2 % w / w glycerol ( produced by difco ); the mic against anaerobic bacteria was determined using a gam agar medium ( produced by nissui ). the results are shown in tables 3 and 4 . table 3______________________________________test strain mic ( μg / ml ) ______________________________________staphylococcus aureus fda 209p jc - 1 1 . 56staphylococcus aureus sank 70175 3 . 13staphylococcus aureus smith 3 . 13staphylococcus sank 71575 6 . 25epidermidisstreptococcus faecalis sank 71778 1 . 56bacillus subtilis pci 219 0 . 39mycobacterium smegmatis atcc 607 12 . 5escherichia coli nihj jc - 2 & gt ; 100klebsiella pneumoniae pci 602 & gt ; 100pseudomonas aeruginosa nctc 10490 & gt ; 100serratia marcescens sank 73060 & gt ; 100proteus mirabilis sank 70461 & gt ; 100______________________________________ table 4______________________________________test strain mic ( μg / ml ) ______________________________________bacteroides fragilis & gt ; 100eubacterium aerofaciens 0 . 39fusobacterium necrophorum & gt ; 100peptostreptococcus micros 0 . 78peptostreptococcus parvulus 0 . 39propionibacterium acnes 0 . 78clostridium botulinum 0 . 78clostridium sordellii 0 . 20clostridium histolyticum 0 . 78clostridium difficile 0 . 78______________________________________ from the results given in the above tables , it can be seen that chloropolysporin is effective against gram - positive bacteria , such as staphylococcus aureus , staphylococcus epidermidis , streptococcus faecalis , bacillus subtilis and mycobacterium smegmatis , and against anaerobic gram - positive bacteria , such as eubacterium aerofasciens , peptostreptococcus micros , propionibacterium acnes , clostridium botulinum , clostridium sordellii and clostridium difficile . staphylococcus aureus smith was cultured overnight in tryptosoy bouillon medium ( tryptosoy is a trypsin - solubilized soy , sold by eiken co . ltd ., japan ). this was then inoculated intraperitoneally , together with mucin at a concentration of 5 % w / v , in an amount of 2 . 8 × 10 6 cells per test mouse . the mice employed were male 5 week old mice of the icr / jcl strain and were employed in groups of 10 for each test . both immediately after and 4 hours after the inoculation , an aqueous solution of chloropolysporin at various concentrations was injected subcutaneously . the prophylactic efficiency of chloropolysporin was clearly apparent and its ed 50 value was 11 . 7 mg / kg . the ld 50 value of chloropolysporin on intravenous injection into male 5 week old mice of the icr / jcl strain ( employed in groups 10 for each test ) was 375 mg / kg and no adverse effect was observed on subcutaneous injection up to a dose of 1000 mg / kg . comparison of the properties , chemical , physical and biological , given above of chloropolysporin with those of known antibiotics suggests that it may be similar to the glycopeptide antibiotics containing chlorine , such as vancomycin , avoparcin α and β , actinoidin a and b or a - 35512 b . however , chloropolysporin can be clearly distinguished from these known antibiotics on the basis of the differences shown in the following table 5 . specifically , it has different neutral saccharide components and different amino acids are produced on acid hydrolysis . moreover , it moves a different distance on high voltage paper electrophoresis ( 3300 volts / 60 cm , 1 hour , ph 7 . 5 , in 0 . 1m tris - hydrochloric acid buffer solution ), and it has a different chlorine content . table 5______________________________________ neutral saccha - chlorineantibiotics rides amino acids distance content______________________________________vancomycin glucose aspartic acid 4 . 89 n -- methyl - leucineavoparcin α glucose , 3 - hydroxy - 9 . 4 cm 1 . 85 mannose , phenylglycine rhamnoseavoparcin β glucose , 2 - chloro - 3 - hy - 9 . 4 cm 3 . 65 mannose , droxyphenyl - rhamnose glycineactinoidin a glucose , 3 - hydroxy - 2 . 02 mannose phenylglycine , phenylalanineactinoidin b glucose , 2 - chloro - 3 - hy - 3 . 96 mannose , droxyphenyl - glycine , phenyl - alaninea - 35512b glucose , 1 . 82 mannose , rhamnose , fucoseactaplanin glucose , 1 . 96 mannose rhamnoseristocetin a glucose , 0 mannose rhamnose arabinoseristocetin b glucose , 0 mannose , rhamnosechloropoly - glucose , monochloro - 4 cm 5 . 20sporin mannose , monohydroxy - rhamnose phenylglycine______________________________________ the value reported above as &# 34 ; distance &# 34 ; is the distance of movement on high voltage paper electrophoresis , measured using bioautography with bacillus substilis pci 219 as the test organism . from the above findings , it can be seen that chloropolysporin can be used as an antibiotic against various diseases caused by bacterial infections . the route of administration can vary widely and may be parenteral ( e . g . by subcutaneous , intravenous or intramuscular injection or by suppository ) or oral ( in which case it may be in the form of a tablet , capsule , powder or granule ). the dose will , of course , vary with the nature of the disease to be treated , the age , condition and body weight of the patient and the route and time of administration ; however , for an adult human patient , a daily dose of from 0 . 1 to 10 grams is preferred and this may be administered in a single dose or in divided doses . moreover , in view of the strong activity of chloropolysporin against infectious bacteria of the genus costridium , it can be prepared to be a valuable growth - promoting agent for veterinary use . bacteria of the genus clostridium , particularly clostridium perfringens and clostridium difficile are often present in the intestines of farm animals and are the cause of diarrhoea . since chloropolysporin has a strong activity against such microorganisms , it would suppress their growth in the intestines and thus improve the microbial balance of the intestines . this , in turn , would improve feed efficiency , thus contributing to weight gain and improved milk production in various farm animals , including ruminants , pigs and poultry . moreover , chloropolysporin , in common with the other glycopeptide antibiotics , is likely to have a low rate of absorption through the digestive organs and , as a result , where chloropolysporin is administered in the feed , little will remain in the animal body and hence in animal products , such meat , milk or eggs . when chloropolysporin is used as a growth - promoting agent for animals , it is preferably administered orally . although it may be formulated into an edible composition with any suitable carrier or diluent , it is particularly convenient to administer it in admixture with an animal feed or with drinking water . when the chloropolysporin is used as a feed additive , it may be mixed alone with the feed or it may be mixed in combination with other non - toxic edible excipients , nutrient supplements ( e . g . vitamins , minerals or amino - acids ), other antibiotics , anticoccidal agents or enzymes . for administration to animals as a growth - promoting agent , the chloropolysporin need not necessarily be in a completely purified form and it may be used in a crude or partially purified form , as obtained at any desired stage during the extraction and purification described above . for use as a growth - promoting agent , chloropolysporin is preferably employed in an amount of from 1 to 200 , more preferably from 5 to 60 , ppm by weight on the basis of the feed , drinking water or other carrier to which it is added ; where an impure form of chloropolysporin is employed , a concentration having equivalent activity is used . animals to which chloropolysporin can be administered include farm mammals ( e . g . cattle , horses , swine , sheep and goats ), poultry ( e . g . chickens , turkeys and ducks ) and pet animals ( e . g . dogs , cats and birds ). most significantly , when chloropolysporin is administered orally to animals , their growth is effectively promoted , but it is little absorbed from the gastro - intestinal tract and it exhibits low retention in animal tissues : thus , there is an almost complete absence of chloropolysporin residues in the products ( e . g . milk , meat or eggs ) of animals to which it has been administered , which is a great advantage from the view point of food hygiene . one loopful of micropolyspora sp . sank 60983 was inoculated into a 500 ml erlenmeyer flask containing 80 ml of medium a , which has the following composition ( percentages are by weight ): ______________________________________medium a______________________________________glucose 3 % pressed yeast 1 % soybean meal 3 % calcium carbonate 0 . 4 % magnesium sulfate 0 . 2 % anti - foaming agent ( nissan cb - 442 ) 0 . 01 % water the balance ( adjusted to ph 7 . 0 ) ______________________________________ the microorganism was then cultured for 84 hours at 28 ° c ., using a rotary shaker at 220 r . p . m . 4 ml of the resulting seed culture were inoculated into a 500 ml erlenmeyer flask containing 80 ml of medium b , which has the following composition . ( percentages are by weight ): ______________________________________medium b______________________________________glucose 5 % yeast extract 0 . 1 % soybean meal 1 % polypepton ( a product of daigo 0 . 4 % eiyo co . ltd ., japan ) beef extract 0 . 4 % sodium chloride 0 . 25 % calcium carbonate 0 . 5 % anti - foaming agent ( nissan cb - 442 ) 0 . 01 % water the balance ( adjusted to ph 7 . 2 ) ______________________________________ the microorganism was then cultured at 28 ° c . for 60 hours , using a rotary shaker at 220 r . p . m . at the end of this time , batches of culture broth separately cultivated as described above were combined to give a total of 3 liters of culture broth . celite 545 ( a registered trade mark for a product of johns - manville products corp ., new jersey , u . s . a .) filter aid was added to the culture broth and the mixture was filtered , to give 2 . 8 liters of a filtrate having a ph value of 7 . 3 . this filtrate was adsorbed on 280 ml of diaion hp 20 ( a product of mitsubishi chemical industries co ., ltd . ), and the adsorbent was washed with water and then eluted with 50 % v / v aqueous acetone , yielding 720 ml of fractions showing antibiotic activity . the combined active fractions were condensed by evaporation under reduced pressure to a volume of 115 ml ; and the concentrate was adjusted to a ph value of 4 . 0 and then adsorbed on 280 ml of dowex 50w × 4 ( h + ) ( a registered trade mark for a product of dow chemical co ., michigan , u . s . a .) and eluted with water . the solution thus obtained was lyophilized , giving 2 . 6 g of a crude powder . 1 . 3 g of this crude powder were dissolved in water and then adsorbed by passage through a column containing 360 ml of diaion hp 20 , which had previously been equilibrated with a 40 : 60 by volume mixture of methanol and a 0 . 5 % w / v aqueous solution of sodium chloride . the product was then eluted from the column with the same mixture as was used for the equilibration , in fractions of about 14 ml each , up to fraction 80 . fractions 26 - 58 showed antibiotic activity and were collected to give a total volume of about 470 ml . methanol was distilled off under reduced pressure from the combined active fractions and the residue was adsorbed in a column containing 35 ml of diaion hp 20 . this was washed with water and then eluted with 50 % v / v aqueous acetone and the active fractions were collected . acetone was distilled from the collected active fractions under reduced pressure and the residue was lyophilized , to give 230 . 9 mg of a powder . this powder was adsorbed in a column containing 80 ml of se - sephadex c - 25 ( a registered trade mark for a product of farmacia , sweden ), which had previously been equilibrated with a 0 . 02m ammonium formate buffer solution having a ph of 3 . 0 . the column was then washed with 0 . 05m and 0 . 1m ammonium formate buffer solutions each having a ph of 3 . 0 , after which it was eluted with a 0 . 2m ammonium formate buffer solution having a ph of 3 . 0 , to give 520 ml of active fractions . these active fractions were adsorbed in a column containing 35 ml of diaion hp 20 , which was washed with water and then eluted with 50 % v / v aqueous acetone . acetone was distilled from the resulting active fractions under reduced pressure , and the residue was lyophilized , to give 137 mg of chloropolysporin in the form of a white powder having the properties heretofor described . one loopful of micropolyspora sp . sank 60983 was inoculated into a 500 ml erlenmeyer flask containing 80 ml of medium a , and then cultured for 84 hours at 28 ° c ., using a rotary shaker at 220 r . p . m . 25 ml of the resulting seed culture were inoculated into each of four 2 liter erlenmeyer flasks , each containing 500 ml of medium b , and cultured at 28 ° c . for 24 hours . 750 ml of the resulting culture broth were inoculated into each of two jar fermenters , each having a capacity of 30 liters and each containing 15 liters of medium b . the microorganism was then cultivated for 69 hours with aeration ( at the rate of 15 liters of air per minute ) and stirring ( at the rate of 150 r . p . m .). celite 545 filter aid was added to the resulting combined 30 liters of culture broth and filtered , to give 30 liters of filtrate . this filtrate was adsorbed onto 3 liters of diaion hp 20 , washed with water and then eluted with 50 % v / v aqueous acetone . the active fractions were collected and combined and the acetone was distilled off under reduced pressure . the residue was lyophilized , to give 44 g of a crude powder . 41 g of this powder were dissolved in water and adsorbed into 1 . 8 liters of diaion hp 20 , washed with 5 liters of water and 20 liters of 10 % v / v aqueous acetone , and then eluted with 4 liters of 50 % v / v aqueous acetone . the active fractions from the elution were collected and condensed to a volume of 1 liter by evaporation under reduced pressure . the condensate was centrifuged at 5000 r . p . m . and the resulting precipitate was dried , to give 9 . 6 g of crude chloropolysporin powder . this crude powder was dissolved in 1 liter of 50 % v / v aqueous methanol and then adsorbed onto 200 ml of acidic alumina ( a product of burroughs wellcome & amp ; co . ), which had previously been equilibrated with 50 % v / v aqueous methanol . the adsorbed product was then eluted with the same solvent , and the active fractions , a total of 1 . 1 liters , were collected . the combined active fractions were passed through 60 ml of dowex 21k ( oh - ), and eluted with water . the active fractions , a total volume of 1 . 2 liters , were collected and then condensed by evaporation under reduced pressure to a volume of 30 ml . this condensate was lyophilized , to give 1 . 23 g of powder . the powder was dissolved in aqueous hydrochloric acid of ph 4 . 0 and then adsorbed onto 56 g of polyamide filled with water ( a product of burroughs wellcome & amp ; co .). this was subjected to gradient elution with 400 ml of water and 1 . 2 liters of methanol , in 20 ml fractions , up to fraction 80 . fractions 30 - 60 were collected and combined . the methanol was distilled off under reduced pressure and the resulting concentrate was lyophilized , to give 738 mg of chloropolysporin in the form of a white powder having the properties heretofor described . ______________________________________capsules for oral usethe following ingredients were mixed : ______________________________________chloropolysporin 100 mglactose 100 mgcorn starch 148 . 5 mgmagnesium stearate 1 . 5 mg______________________________________ the mixture was sieved through a 30 tyler standard mesh sieve , giving 350 mg of a fine powder , which was put into a no . 2 gelatin capsule . | 2 |
in the individual figures , respective profile strip systems 1 are shown which can be used both for closing off an edge and also for concealing a joint . it is pointed out that the profile strip system in accordance with the invention and the aforementioned features and those to be described individually below , fundamentally , can also be used for a cable duct formed from a profile strip system , even if it is not shown . in the embodiments shown in fig1 to 4 , fig9 & amp ; 10 , fig1 to 13 and fig1 to 20 , the profile strip system 1 is used for joint concealment , while in the embodiments of fig5 to 8 and fig1 to 17 it is used for closing off the edge for a surface covering 2 . the profile strip system 1 , itself , has a lower elongated base profile 3 and an upper elongated cover profile 4 . between the base profile 3 and the cover profile 4 , there is a latching connection 5 to join the two profiles 3 , 4 to one another . as follows from a comparison , for example , of fig1 & amp ; 2 , the latching connection 5 , however , not only has a connection function , but ensures otherwise vertical adjustability of the cover profile 4 relative to the base profile 3 . thus , for example , in the embodiment shown in fig1 & amp ; 2 , vertical travel of 5 mm can be achieved , while in the embodiment as shown in fig9 & amp ; 10 , there is vertical travel of 8 mm . the latching connection 5 , in all cases , has a latching receptacle 6 into which a latching profile 7 , which has a plurality of latching sites , can be latched . the latching receptacle 6 is formed by two leg profiles 8 , 9 which have latching regions 10 on opposite sides . each of the latching regions 10 has at least two latching sites which are active during latching . therefore , a “ latching region ” is a region at which latching is possible on the leg profiles 8 , 9 . conversely , those regions of the leg profiles 8 , 9 on which latching is not possible are called latching region - free sections 11 . it is provided that there are latching regions 10 only in a limited area of the leg profiles 8 , 9 . moreover the latching region - free sections 11 of the leg profiles 8 , 9 have a greater distance from one another than the latching regions 10 so that the latching profile 7 inserted into the latching receptacle 6 can be pivoted relative to the latching receptacle 6 and the base profile 3 . this state is shown , for example , in fig4 , 13 , 15 & amp ; 17 . in all cases , it is such that the cover profile 4 here is shown pivoted to the left . regardless of the pivoting direction , the pivoting point is within the latching regions 10 , and in the illustrated embodiments , the right leg profile being moved or springing somewhat to the outside . in spite of this outward pressing of the right leg profile , the latching connection is still kept between the latching profile 7 and the two latching regions 10 . here , especially fig1 illustrates that the lower end of the latching profile 7 in the free space or intermediate space 12 provided in the lower region of the latching receptacle 6 without its lower end striking either of the leg profiles 8 , 9 . ultimately , the latching profile 7 is held only on the latching regions 10 , otherwise there is no connection between the leg profiles 8 , 9 and the latching profile 7 . by spacing the latching region - free sections 11 of the leg profiles 8 , 9 apart from one another , as a result the free space 12 is made available which enables pivoting of the latching profile 7 within the latching receptacle 6 . as otherwise follows from the individual figures , there are latching regions 10 on the outer free ends 13 of the leg profiles 8 , 9 . the maximum distance of the latching region - free sections 11 of the leg profiles 8 , 9 which can be used for pivoting of the latching profile 7 within the latching receptacle 6 , here , is at least twice that of the inside width between the latching regions 10 . in this way , when the latching profile 7 is inserted into the latching receptacle 6 , it can be pivoted relative to vertical in a small angular range of up to 100 . to implement spacing or free space 12 within the latching receptacle 6 , the upper region of the respective leg profile 8 , 9 is bent . in the illustrated embodiment , there is a diagonal bend . this diagonal bend has the advantage that the latching profile 7 can be inserted relatively far into the latching receptacle 6 . instead of diagonal bending , it is also fundamentally possible to bend the upper region of the leg profiles 8 , 9 at a right angle . it is also fundamentally possible to arrange the leg profiles 8 , 9 altogether diagonally so that there is a triangle - like shape which is open to the top . in any case , in the invention , it is such that the length of the leg profiles 8 , 9 is more than twice the lengthwise extension of the latching region 10 . in the illustrated embodiments the length of each of the leg profiles 8 , 9 is larger by a factor of at least 5 than the lengthwise extension of the respective latching region 10 . furthermore , in all the illustrated embodiments , it is such that each of the latching regions 10 , in any case , has less than ten latching sites . preferably , there are only two latching sites on each leg profile 8 , 9 . the latching sites here are barb - shaped latching teeth which are ultimately pointed at least essentially downward . accordingly , there are corresponding latching sites or latching teeth on the latching profile 7 . different from the latching regions 10 of the leg profiles 8 , 9 , however , on opposite outer sides of the latching profile 7 , there are latching sites which extend at least essentially over the entire length of the two outer sides of the latching profile 7 . otherwise , in all embodiments , it is such that the latching regions 10 of the leg profiles 8 , 9 run parallel to one another and / or are aligned vertically , even if it is also possible to align the latching regions diagonally relative to one another so that there is a triangular shape which narrows toward the top . fundamentally , it is also possible to make the latching regions crowned . however , in this embodiment , there must be more than two latching sites . furthermore , in all embodiments , it is such that the latching profile 7 , on opposite sides , has other latching regions 14 which run parallel to one another , which are otherwise aligned vertically and which , as stated above , extend essentially over the entire length of latching profile 7 . the leg profiles 8 , 9 are located , here , on the top side on the base profile 3 , the leg profiles 8 , 9 extending upward . accordingly , in any case , the latching profile 7 in the embodiments of fig1 to 17 is located directly on the cover profile 4 , while in the embodiments as shown in fig1 to 8 , it is provided on an intermediate profile 15 which can be connected to the cover profile 4 . comparison of fig1 to 8 , on the one hand , with fig9 & amp ; 10 , on the other , shows that there are different intermediate profiles 15 . specifically , shorter and longer latching profiles 7 can be provided . otherwise , in the embodiments of fig1 to 8 and 9 & amp ; 10 , it is such that there are also correspondingly matched latching receptacles 6 , i . e ., shorter and longer ones . here , it goes without saying that a shorter latching receptacle 6 according to fig1 to 8 with a longer intermediate piece according to fig9 & amp ; 10 can also be used and also a taller latching receptacle 6 can be used with a shorter intermediate piece 15 . otherwise , the cover profile 4 can be pivoted relative to the intermediate profile 15 , as follows , for example , from fig3 , 4 & amp ; 6 . here , defined pivoting in an angular range up to 20 ° relative to vertical is possible . to implement the pivoting capacity , in the embodiments shown in fig1 to 10 , on the intermediate piece 15 , there is a relatively flat articulated head 16 with the shape of a segment of a circular arc , while on the bottom on the cover profile 4 there is a groove 17 with the shape of a segment of a circular arc for insertion of the articulated head 16 . the extension of the arc of the slotted groove 17 is greater than that of the articulated head 16 in order to enable the aforementioned pivoting capacity . it is not shown that the intermediate piece 15 with the articulated head 16 can be inserted into the groove 17 . in this connection , the intermediate piece 15 extends over the entire length of the cover profile 4 . fig1 to 20 show a different version of the articulated head 16 and the groove 17 . the groove 17 is made in the shape of a dovetail , the lower groove surface 17 a being arched to the outside . the articulated head 16 is accordingly dovetail - shaped , the outer head surface 16 a likewise being arched to the outside . as a result of the execution of the articulated head 16 and groove 17 arched to the outside and based on the play between the articulated head 16 and the groove 17 , in contrast to the embodiments as show in fig1 to 10 , there is only spot or partial surface contact of the head surface 16 a with the groove surface 17 a . the head surface 16 a does not adjoin the groove surface 17 a over the entire surface in any state . this embodiment has the advantage that it is relatively flat so that correspondingly little space is required for this version . another difference from the embodiment as shown in fig1 to 10 consists in that the latching profile 7 for the intermediate piece as shown in fig1 to 20 is thicker , here roughly twice as thick as in the initially described embodiment . otherwise , the individual figures show that the latching profile 7 which projects down is located off - center on the cover profile 4 . the off - center arrangement results in a shorter cover leg 18 and a longer cover leg 19 . the length ratio between the two cover legs 18 , 19 is between 1 . 2 and 2 . 0 . in the illustrated embodiment , the length ratio is roughly 1 . 4 . the cover legs 18 , 19 of different length enable better equalization of heights . otherwise , in all the illustrated embodiments , it is such that the base profile 3 , the cover profile 4 and the intermediate profile 15 are made of extruded aluminum strips of given length , the base profile 3 , the cover profile 4 and the intermediate profile 15 preferably each having the same length . for joining to the subfloor , the base profile 3 has a bottom leg profile 20 in which there are a plurality of screw openings 21 . in the illustrated embodiments , one element of the surface covering 2 rests on the free end of the bottom leg profile 20 ; however , it need not necessarily be so . otherwise , in the embodiments shown in fig5 to 8 and 14 to 17 , it is such that there is a side terminating profile 22 which can be connected to the cover profile 4 . this terminating profile 22 is used here for closing off the edge when using the profile strip system 1 . even if it is fundamentally possible to forego the side terminating profile 22 by a corresponding shape and execution of the cover profile 4 with a lengthened and downwardly pointed leg , this profile has the advantage that only one type of cover profile is required , and if necessary , the side terminating profile 22 can be used . to join the terminating profile 22 to the cover profile 4 , on the cover profile 4 , there is a dovetail - shaped groove 23 for inserting a correspondingly matched projection 24 provided on the top side on the terminating profile 22 . the insertion of the projection 24 of the terminating profile 22 into the groove 23 on the cover profile 4 takes place conventionally by sliding it in . in this connection , it is pointed out that the terminating profile 22 , in terms of its length , is matched to the length of the cover profile 4 , and otherwise , also preferably , is made of aluminum . otherwise , the individual figures show that the groove 23 is located at an acute angle diagonally relative to the top 25 or the horizontal . as follows , for example , from fig7 & amp ; 8 and 16 & amp ; 17 , the diagonal arrangement can prevent the terminating profile 22 from striking the latching receptacle 6 when pivoting . as otherwise follows from the drawings , the terminating profile 22 has an inverted u - shape . however , fundamentally , a hollow body version is also possible . the two outer legs 26 , 27 have a different slope . this makes it possible to achieve different installation situations depending on the arrangement of the terminating profile 22 . the shape of the legs 26 , 27 in the region of the transition to the cover profile 4 is chosen such that the transition is essentially stepless . it is not shown that the profile strip system 1 can be offered as a kit , specifically with at least one base profile 3 , at least one cover profile 4 and at least two different intermediate profiles 15 , the length of the latching profiles 7 of the intermediate profiles 15 being different . it goes without saying here that , fundamentally , there can also be a plurality of bottom profiles and cover profiles , then the number of intermediate profiles can be matched accordingly . moreover , the kit can also have at least one terminating profile 22 . the differences between the individual figures are indicated below . in fig1 to 8 , there is a profile strip system 1 with a shorter latching receptacle 6 and a shorter intermediate piece 15 . fig1 to 4 show the use of the profile strip system 1 for concealing a joint 28 . in fig1 & amp ; 2 , the cover profile 4 conceals a joint 28 which , in fig1 , is formed between two relatively flat elements of the covering 2 , and in fig2 , between two conversely thicker elements of the covering 2 . fig3 shows the state in which the covering elements which form the joint 28 are made with different heights . in fig4 , the height difference between the bottom covering elements on the joint 28 is still larger . in this connection , there is not only pivoting of the cover profile 4 relative to the intermediate piece 5 , but also pivoting of the intermediate piece 15 relative to the latching receptacle . in fig5 to 8 , the above described profile strip system 1 is used to close off the edge ; in this case , there being a terminating profile 22 . the latter is inserted into the cover profile 4 in two different installation situations . fig9 & amp ; 10 correspond fundamentally to fig1 & amp ; 2 , and in this connection , the profile strip system 1 has a taller latching receptacle 6 and a longer intermediate piece 15 . in fig1 to 13 , a two - part profile strip system 1 for covering a joint 28 is shown , in which the latching profile 7 is made in one piece with the cover profile 4 . here , fig1 & amp ; 12 show the maximum possible height adjustments . fig1 shows the profile strip system 1 from fig1 & amp ; 12 in the pivoted state with covering elements of different heights . fig1 to 17 show the profile strip system from fig1 to 13 for closing off the edge , and in this case , there is a terminating profile 22 which is inserted into the groove 23 of the cover profile 4 in different installation situations . finally , fig1 to 20 show another embodiment of a profile strip system 1 with states according to fig1 to 3 being shown , to which reference should be made . the difference being in the execution of the intermediate piece and the implementation of the pivoting capacity of the intermediate piece 15 relative to the cover profile 4 . | 4 |
the present invention will now be described on the basis of a single - balanced and double - balanced mixer circuit , as an examples for a balanced circuit arrangement according to the present invention , which may be used in a direct conversion receiver for wcdma ( wideband code division multiple access ) base station applications in 3rd generation mobile communication networks . fig1 shows a block diagram of those parts of the receiver which are essential to the present invention . the receiver comprises an antenna 1 from which a signal is received and filtered by a bandpass filter 2 and amplified by an amplifier 3 . the amplified signal at the radio reception frequency is then mixed to the ( zero ) intermediate frequency in a balanced mixer 6 according to the preferred embodiments of the present invention . a local oscillator 5 feeds a predetermined frequency to the mixer 6 , such that the radio reception frequency is mixed with the determined frequency of the local oscillator 5 to obtained the ( zero ) intermediate frequency . the linearity of the mixer 6 is controlled by a controller 4 by adjusting the load imbalance between the output branches of the mixer 6 . fig2 shows a known gilbert - cell used as a balanced circuit arrangement in amplifiers , multipliers and mixers , such as the mixer 6 of fig1 . in the gilbert - cell , two input voltages v x and v y are multiplied into one output voltage v out , i . e . the voltage difference at the outputs v out + and v out − corresponds to the product or multiplication of the input voltages . the first input voltage v x is applied between the base terminals of transistors q 1 , q 2 and q 3 , q 4 , respectively . the second input voltage v y is amplified by transistors q 5 and q 6 . the transistors q 5 and q 6 are connected at their emitter terminals to a transistor q 7 which is controlled by a bias voltage and coupled to known potential . the output branches of the circuit are coupled to a positive operating voltage through load impedances z la and z lb . the transistors q 1 and q 4 amplify the first input voltage v x in a first polarity direction , and the transistors q 2 and q 3 amplify the first input voltage v x in a second polarity direction opposite to the first polarity direction . the amplified voltages are coupled and cross - coupled , respectively , to the outputs v out + and v out − . according to the present invention , the load values of the load impedances z la and / or z lb are controlled by the controller 4 so as to introduced a load imbalance required to maximize the iip2 performance of the multiplier or mixer circuit . it is noted that the load impedances z la and z lb may be any load means or circuitry which provides a mechanism for adjusting the effective load value introduced into the respective output branch . thereby , the iip2 performance of the mixer circuit can be improved , since the dc and low - frequency effects of the envelope distortions can be compensated by the introduced load imbalance . in general , any transceiver , receiver or transmitter circuit can be calibrated by properly adjusting the load imbalance of an included balanced circuit arrangement . a corresponding calibration method is described in the following . fig3 shows an arrangement by means of which the calibration technique can be implemented . in particular , fig3 shows a direct conversion receiver arrangement comprising a low noise amplifier ( lna ) 10 which is connected to an antenna ( not shown ) for receiving radio frequency signals . a received radio frequency signal is supplied to a bandpass filter 20 ( optional ) via a switching element or switch 11 . the “ bandpass ” filter can be a simple ac - coupling device as well . input signal can be also switched on and off by biasing of the preceding lna 10 , instead of switch 11 . after the received signal has been filtered in the bandpass filter 20 , it is supplied to the mixer 6 , where it is mixed with a receiving local oscillator ( rx lo ) 5 of a predetermined frequency related to the radio reception frequency . the signal converted to the if or zero frequency is supplied to a following receiver circuitry 7 , comprising a test monitoring circuitry 12 , where the signal is detected at one of the test nodes 13 and distortions are extracted to obtain a measurement for the second - order non - linearity performance ( i . e . iip2 performance ) of the receiving or mixer circuitry . a control signal corresponding to the iip2 performance is supplied by the test monitoring circuitry 12 to a digital signal processor ( dsp ) 8 which evaluates the performance and supplies a corresponding control signal or control information to the controller 4 arranged to control the load imbalance in the output branches of the mixer 6 . the procedure can be done independently in both in - phase ( i ) and quadrature ( q ) branches , e . g ., in a direct conversion receiver . however , only one signal and one control path is drawn in fig3 . to obtain a reference or test signal , a transmission local oscillator ( tx lo ) 50 is connected via an amplifier circuit 9 and a second switching element 14 to the input of the mixer 6 . thus , either a received radio signal or the generated test signal or both can be switched to the bandpass filter 20 . the test signal can be any locally or externally generated signal . fig4 shows a flow diagram of a calibration method according to a preferred embodiment . this calibration method is used to adjust or set the load values in the output branches of the mixer 6 by the controller 4 in order to obtain a maximum linearization of the mixer 6 by the means of even - order linearity . this calibration method can be used to calibrate the receiver circuit during a stand - by period or during relatively stable reception conditions , i . e . when input signal changes have only a weak effect on the measured signal . after the start of the method in step s 100 , the switching element 11 is closed to connect the lna 10 while no input signal is supplied to the mixer 6 . in step s 101 , it may be considered or checked whether the receiving local oscillator 5 is switched on or off , since this may lead to different measuring results . then , the output dc or lowpass filtered signal level of the mixer 6 is measured in step s 102 by the test monitoring circuitry 12 at the respective one of the test nodes 13 and the measuring result is supplied to the dsp 8 where it may be stored . in step s 103 , the second switching element 14 is closed to connect to the output terminal of the amplifier circuit 9 so as to supply a sample of the test signal , e . g . the signal from the transmission local oscillator 50 in a receiver calibration , to the mixer 6 , wherein the amplifier circuit 9 is arranged to provide an interface equivalent to that of the lna 10 . alternatively , an attenuated test signal can be connected directly to the input of the lna 10 , while the second switching element 14 remains open or can be dispensed with . due to the second - order non - linearity and imbalance in the mixer 6 , a dc error voltage is generated at the output of the mixer 6 . this dc error is proportional to the amplitude of the even - order spurious signal , and is measured and may be stored in the dsp 8 . based on the measured dc outputs , the dsp 8 provides a control to the controller 4 so as to adjust the load imbalance and thereby minimize the increment or increase in the dc voltage or in the lowpass filtered output signal at the output of the mixer 6 due to the dc error . thus , the receiver circuit can be linearized by this dc level set control . according to fig4 , the calibration process may be an iterative process and the dc error can be monitored by the routines of the dsp 8 e . g . via a / d converters ( not shown ). after each iteration , a check is performed in step 105 as to whether a satisfactory result has been achieved , i . e . whether the circuit has been linearized to a sufficient extent . if not , step 104 is repeated . when a satisfactory result is determined in step 105 , the flow proceeds to step 106 where the user or a system is informed of the system ready state . thus , an automatically controlled calibration of receiver , transmitter or transceiver circuits can be provided . fig5 shows a controllable adjustment block or circuitry for controlling the load value of the load elements z la . the same adjustment circuitry may be provided at the other load element z lb . according to fig5 , the load adjustment or control arrangement comprises a plurality of load elements z l1 to z ln which can be switched to be connected in parallel to the load element z la so as to decrease or increase the total load based on binary control signals provided to the control terminals ctrl 1 to ctrln . as an example , a logical signal “ 1 ” may be used to close the respective switch and to connect the respective load element in parallel to the load element z la . thus , the load value generated by the load adjustment circuitry corresponds to the binary digits of the binary control word applied to the control terminals ctrl 1 to ctrln . the load elements z l1 to z ln may be arranged to provide weighted loads i . e . their load values may be generated by multiplying a basic load value with an integer number . as an example , the load value of an individual load element may be generated based on the following equation : wherein z l denotes a basic load value or unit load value , and k denotes an integer ( 1 . . . n ) selected according to the desired tuning range . due to the fact that the above equation corresponds to the weighting of a dual number system , a direct relation between the binary control word applied to the control terminals ctrl 1 to ctrln and the generated load value can be obtained , while the control terminal ctrl 1 corresponds to the most significant bit ( msb ) and the control terminal ctrln corresponds to the least significant bit ( lsb ). the adjustment circuitry comprises weighted fingers of load elements connected in parallel to a basic or original load . each finger can be selected using the respective switch . thus , in case resistor loads are used , the control terminal ctrln connects the largest parallel resistor finger in parallel to the basic load z l to thereby obtain a minimum load change . the resolution of the load adjustment control can be selected to achieve a desirable range , e . g . the resolution may be 0 . 1 %. as determined on the basis of simulations and measurements , the total tuning range should preferably cover a range of ± 5 % of the basic or original load value . in complex receiver , transmitter or transceiver arrangements , each mixer , modulator or other balanced circuit arrangement can be adjusted separately . the calibration sequence may include counting of digital codes for adjusting the load imbalance , wherein measurements are swapped until the accepted level is reached . fig6 shows a double - balanced multiplier mixer circuit similar to the gilbert - cell shown in fig2 , wherein the bias adjusting transistor q 7 has been removed . nevertheless , the circuitry of fig6 may as well include the bias adjusting transistor q 7 . according to the embodiment of fig6 , both loads z la and z lb can be adjusted by respective load adjustment circuits c + 41 and c − 42 respectively , connected in parallel to the respective load in the respective output branch . thus , an individual or branch - selective load adjustment can be performed by the controller 4 . both load adjustment circuits 41 and 42 may be arranged as shown in fig5 . as can be gathered from fig6 , a local oscillator voltage v lo generated by the receiving local oscillator 5 is applied between the base terminals of the transistors q 1 and q 2 and between the base terminals of transistors q 3 and q 4 , while a radio reception frequency voltage v rf obtained from the lna 10 is supplied between the base terminals of the transistors q 5 and q 6 . thereby , the output voltage v out between the collector terminals of the transistors q 1 and q 3 and the transistors q 2 and q 4 corresponds to a multiplication of the local oscillator voltage v lo and the radio reception frequency voltage v rf . the load value can be trimmed in both output branches to obtain a desired load imbalance . fig7 shows an embodiment of a single - balanced mixer or multiplier circuit , where the load of only one output branch can be adjusted by the controller 4 . in particular , a load adjustment or control circuit c + 41 is connected in parallel to the load z la of one output branch . thus , load trimming is performed in one output branch . in this case , the load value of the other load z lb should be selected according to the following equation : wherein δz indicates the tuning range of the load adjustment circuit 41 in percentages relative to the actual load . thereby , an adjustment of the load imbalance is possible by the same amount in both directions . it is noted that both single - balanced and double - balanced mixers can be linearized by trimming in either both output branches or one of the branches fig8 shows characteristics of a simulated iip2 performance of a mixer circuit versus the mismatch in the load values or resistances , achieved by the load adjustment circuits 41 and / or 42 . the different characteristics have been obtained for different fixed imbalances in the mixer circuit . the behavior is similar and repeatable for both single - balanced and double - balanced mixer circuits or other balanced circuit arrangements . as can be gathered from fig8 , depending on the initial fixed imbalances , which may be the result of component mismatches , the performance peaks of the iip2 performance are located at different percentual load mismatch values . thus , if the corresponding load mismatch value is introduced into the mixer circuit , an optimized iip2 performance can be achieved . fig9 shows a measured trimming performance of an implemented integrated direct conversion receiver . according to fig9 , the measuring results correspond to the simulated characteristics shown in fig8 . in particular , a sharp peak in the iip2 performance of the direct conversion receiver is obtained at a load mismatch of approximately 0 . 7 %. thus , the iterative calibration procedure will lead to a load adjustment to achieve this optimal load mismatch . it is noted that the present invention is not restricted to the concrete circuit arrangements described in the preferred embodiments . the load adjustment may be performed by any control means or elements which are suitable to change or control load values in at least one of the respective output branches . in particular , the load adjustment may be realized by active elements such as bipolar or unipolar transistors , diodes or other semiconductor elements . furthermore , the balanced circuit arrangement may be provided in iq modulators , multi - carrier or multi - frequency receiver and / or transmitter systems . furthermore , the calibration signals used for adjusting the load adjustment circuit can be obtained by using modulated carriers to allow for a greater flexibility of calibration . the measuring of the dc level or the lowpass filtered test signal may be performed solely by the dsp 8 , such that the test monitoring circuitry 12 can be dispensed with . the above preferred embodiments may thus vary within the scope of the attached claims . | 7 |
fig1 shows a block diagram of the fuel control system of a turbine engine the installation comprises a high pressure pump 3 supplied with fuel from a tank 1 by a centrifugal low pressure pump 2 . the pump 3 is of the proportioning type and delivers a flow of fuel proportional to the operation of the turbine engine to a flow regulator 4 which , through a valve 5 ( referred to hereafter as a stop valve ), supplies the main fuel injection system for the combustion chamber of the engine 6 . a pressure drop detector 7 receives at two inlets 71 and 72 the pressure pam , taken at a point 8 situated between the high pressure pump 3 and the flow regulator 4 , and the pressure pav taken downstream of the regulator 4 . under the action of fuel at pressure pam taken at point 8 , the detector 7 provides at its outlet 73 a pressure pmod which controls the opening or closing of a control valve 10 having an input connected to the point 8 at pressure pam , and an output connected upstream to a point 11 in the pipe connecting the low pressure pump 2 and the high pressure pump 3 . the control valve 10 operates in response to the detection of a variation of the pressure drop pam - pav across the flow regulator to by - pass the excess fuel which is situated between the high pressure pump 3 and the regulator 4 so as to keep constant the pressure drop across the regulator . this is a condition for the fuel flow supplied to the injectors , which is proportional to the flow passage cross - section of the regulator and to the square root of the pressure drop , to be a function only of the displacement of the regulator piston . an overspeed limiter 12 , which is driven by the turbine engine and thus receives input information on the rotational speed n of the plant , is operative to reduce the flow in the injection system of the turbine engine 6 when an overspeed threshold is reached so as to keep the engine at a tolerable speed . to do so , the overspeed limiter has a bushing disposed in a bore coaxial with a slide of the pressure drop detector 7 which it drives in rotation and on which it is able , on exceeding the overspeed threshold , to act in the same direction as when an increase of the pressure drop is detected by the detector 7 to reduce the pressure pmod at the output of the detector . the effect of this is to open the control valve 10 quickly , and thus reduce the flow to the receiver installation 6 , thereby preventing the operating rate from increasing further and avoiding the destruction of the engine . the fuel regulator 4 comprises a differential piston which is displaceable linearly by means of a control computer 13 which acts on one or more servo valves 14 to modify the pressures in control chambers of the regulator , while the position of the piston is measured by one or more displacement detectors 15 which transmit the position data to the computer 13 . the displacement of the regulator piston towards its minimum flow position is limited by a safety stop 16 which can be retracted by actuation of a solenoid valve 17 to enable the regulator 4 to assume a position of closure or of nil outflow , in which position an annular chamber of the regulator permits a control pressure pam taken at point 8 to be supplied to the stop valve 5 in order to close the valve 5 and cut off the injection system . reference will now be made to fig2 and 3 for further description of the control system and some of its components , the same reference numerals being used for identical elements . referring particularly to fig3 it will be seen that the pressure drop detector 7 consists of a slide 21 movable linearly and rotationally in a bore of a casing 22 and having a piston 21a defining , together with the casing 22 , two control chambers of which one 23 is connected to the inlet 71 to receive the pressure pam and the other 24 is connected to the inlet 72 to receive the pressure pav . the slide 21 also defines with the casing 22 two working chambers , one 25 arranged to receive the pressure pam and the other 26 in communication with the low pressure pca , separated by a shoulder 21f which , through the linear movement of the slide , controls communication between the outlet 73 and either the first working chamber 25 at the pressure pam or the second working chamber 26 at the pressure pca to provide the output control pressure pmod in response to a decrease or an increase , respectively , of the pressure drop pam - pav . the displacement of the slide 21 when the pressure drop increases takes place against an elastic stop comprising a spring 27 which is disposed in a first slide end chamber 29 situated in the casing at the left in fig3 and which is adjustable by means of a screw 28 . at its other end the slide 21 extends into a second slide end chamber 37 in the casing 22 and carries a finger 30 by which the slide is rotated by a fork 31 carried by a member 32 of the overspeed limiter 12 which also carries the fly - weight system in the chamber 37 . between the control chamber 23 receiving fuel at the high pressure pam and the second slide end chamber 37 the slide 21 has an annular groove 21b which forms with the casing 22 an intermediate chamber 35 connected by a duct 36 , on the one hand through a throttle 38 to a return pipe leading to the low pressure pca at a point 34 situated upstream of the pump 2 ( see fig1 ) and on the other hand to an output 45 of the feed regulator 4 which is communicable with the high pressure pam when the regulator piston approaches the position of nil output flow . an axial channel 21c extending right through the slide 21 , and radial ducts 21d , 21e , opening therefrom into the chambers 26 and 35 respectively , permit , in the absence of the high pressure pam in the chamber 35 , hydraulic balancing of the slide 21 so that only variations of pam and pav in the control chambers 23 , 24 leading to a change in pressure drop pam - pav control the displacement of the slide 21 . on the other hand , when the pressure pam is applied to the chamber 35 , a throttle 39 situated between the chambers 26 and 35 prevents fuel at the pressure pam from entering the chamber 26 , while allowing it to pass to the second slide end chamber 37 to ensure displacement of the slide 21 leftwards in fig2 and 3 . the overspeed limiter comprises a bushing 40 disposed in a bore 41 in the casing 22 coaxial with the slide 21 add situated on the other side of the second slide end chamber 37 . the bushing 40 is rotatably driven by gearing 42 which is itself driven through a step - down gear by the turbine engine so that the bushing 40 rotates at a speed proportional to the speed n of the turbine engine . the bushing 40 has a through bore 43 in which a flanged plug 44 is slidable under the action of the levers 46 of the fly - weight system 33 in the chamber 37 and an opposing spring 47 disposed between a part 32a of the fly - weight support 32 and a bearing face 44a of the plug 44 . a second spring 48 is disposed in the bore 43 between the plug 44 and a piston 49 having a position which is limited at the right in fig3 by a screwed stop 50 ensuring the fluid - tight closure of the assembly and permitting regulation of the overspeed threshold . between the bushing 40 , the piston 49 , and the stop 50 , the free space forms a chamber 51 which will be referred to as the test control chamber and which , through radial bores 52 in the bushing 40 , communicates normally with the low pressure pca at point 34 ( see fig1 ) through a throttle 53 , and can be communicated temporarily with the high pressure pam at point 8 by means of a solenoid valve 18 controlled by a switch 19 for the purpose of testing the displacement of the piston 49 , the plug 44 and the slide 21 . the operation of the modular sub - assembly just described is as follows . when the turbine engine is working it rotates the bushing 40 through its gearing 42 , and the rotation of the bushing is transmitted to the slide 21 by means of the fork 31 carried by the bushing and the finger 30 rigid with the slide 21 . under normal operating conditions the chambers 26 , 29 , 35 , 37 and 51 are subjected to the low pressure pca , the solenoid valve 18 for test control being closed and the position of the slide - piston of the feed regulator 4 , limited by the stop 16 , not allowing the pressure pam to pass to the stop control output 45 for supply to the stop valve 5 and to the intermediate chamber 35 of the pressure drop detector slide 21 . in this case the slide 21 is hydraulically balanced as the pca low pressure prevails in its end chambers 29 and 37 . the pressure drop detector 7 receives through its inlets 71 and 72 the pressures pam and pav respectively upstream and downstream of the flow regulator 4 . when the pressure drop pam - pav increases , the slide 21 moves to the left and the shoulder 21f reveals to a varying extent the outlet port 73 to the chamber 26 so that the pressure pmod decreases . conversely , when the pressure drop pam - pav decreases , the slide 21 moves to the right and the shoulder 21f controls the outlet port 73 to increase the pressure pmod . this pressure pmod is supplied to the control chamber of the control valve 10 and acts on the valve against the high pressure pam , so that when pmod decreases the valve 10 opens and allows part of the fuel delivered to point 8 upstream of the flow regulator to by - pass back to a point 11 upstream of the pump 3 . when the speed of the engine nears the overspeed threshold preset by the positioning of the stop 50 , the plug 44 moves , freely at first , leftwards under the centrifugal action of the fly - weight system 33 , and when the overspeed threshold is reached the plug 44 comes into contact with the slide 21 . if the speed exceeds the threshold , the plug 44 pushes the slide 21 leftwards and brings about the leftward displacement of the shoulder 21f which establishes communication between the outlet port 73 and the chamber 26 at the low pressure pca , thus decreasing the pressure pmod and opening the control valve 10 . this effects a reduction of the flow which passes through the regulator 4 to the injection system and hence limits the overspeed of the plant . when the pilot wishes to stop the plant , he must simultaneously open the solenoid valve 17 controlling the retraction of the safety stop 16 and act upon the throttle control lever to signal the computer 13 to close the flow regulator 4 and stop the flow of injected fuel . the slide of the regulator 4 then moves fully leftwards , communicating the high pressure pam with the stop control port 45 which thus actuates closure of the stop valve 5 and pressurizes the intermediate chamber 35 to the pressure pam . this high pressure prevails through the radial channel 21e and the part of the axial channel 21c to the right of the throttle 39 into the chamber 37 where it acts to push the slide 21 to the left , which has the effect of reducing the control pressure pmod to cause opening of the control valve 10 to allow the fuel flow upstream of the regulator 4 to return upstream of the pump 3 . when the engine stops or when the stop command has been cancelled , the high pressure which had been established in the chamber 37 is vented to the low pressure point 34 through the throttles 38 and 39 and the slide 21 is repositioned to the right . to test on the ground the operation of the combined pressure drop detector and overspeed limiter sub - assembly , the high pressure pam is communicated temporarily with the chamber 51 by opening the solenoid valve 18 . the chamber 51 is then isolated from the low pressure by the throttle 53 and the pressure in the chamber 51 pushes the piston 49 to the left and effectively lowers the setting of the overspeed threshold . the pilot is then able , by opening the throttle lever to maximum , to cause the overspeed limiter to operate as described above in order to verify its working . he should verify that the rate does not exceed , under these conditions , a predefined value below the maximum rate normally authorised . the sub - assembly described uses a hydraulic rotating slide amplifier of recognised reliability , and brings together in one modular hydraulic unit of very simple and reliable construction a pressure drop detector , an overspeed limiter , and a control for the opening of the control valve coupled with the control for stopping the flow of fuel injected . furthermore , by incorporating into it a ground test control facility , the safety and reliability of the sub - assembly is further improved . | 5 |
generally , a post - manufacturing customization system and method of custom fitting an article of footwear may be configured by providing a customer with an apparatus for steaming an article of footwear with the article of footwear in a container . fig1 is a view of an embodiment of a container 100 that is configured to receive an article of footwear . in some cases , the container may be a box with a detachable lid . in other cases , the container may be a box with a hinged lid . in one exemplary embodiment , article of footwear may be a shoe . however , in other embodiments , article of footwear could be any type of footwear , including , but not limited to : a running shoe , a basketball shoe , a high heel shoe , a boot , a slip - on shoe , a low top shoe , as well as other types of footwear . additionally , while a single article of footwear is shown in the current embodiment , the same principles taught in this detailed description could be applied to a second , complementary article of footwear . referring to fig1 and 2 , an apparatus for steaming an article of footwear may be provided within a container 100 holding the article of footwear . in this embodiment , container 100 includes a detachable lid 102 . in different embodiments , the apparatus for steaming an article of footwear may be provided in a container in various ways . in some embodiments , the apparatus for steaming an article of footwear is provided attached to a lid of the container . in a different embodiment , the apparatus for steaming an article of footwear may be provided separately in the container . referring to fig2 , an apparatus for steaming an article of footwear 200 may be attached to a lid 102 of a container 100 for holding an article of footwear 200 . container 100 holds article of footwear 200 and a steaming apparatus . in this embodiment , steaming apparatus is a steam tent 202 that can be attached to the container lid 102 . fig3 illustrates an exemplary embodiment of a steaming apparatus where steaming apparatus is a steam tent . referring to fig3 , steam tent 202 is shown in a non - deployed position folded inside lid 102 . in one embodiment , steam tent 202 can include a bottom portion 304 arranged with holes , at least two movable supports 300 , 302 and a cover material 306 . in one exemplary embodiment , cover material 306 is plastic sheeting . in different embodiments , cover material may be any material configured to envelop an article of footwear in a steam environment . cover material may include , but is not limited to : plastic sheeting , metallic film , synthetic material , cloth , as well as other types of materials . in addition , in some cases , cover material may be transparent or semi - transparent . in other cases , cover material may be opaque or nontransparent . referring to fig4 , steam tent 202 is illustrated in a partially deployed position . in this embodiment , steam tent 202 includes a left movable support 300 and a right movable support 302 . in other embodiments , steam tent can include two or more movable supports . right movable support 302 and left movable support 300 are raised from a non - use position . cover material 306 can be attached to bottom portion 304 and disposed over right movable support 302 and left movable support 300 . bottom portion 304 of steam tent 202 is provided with holes 400 for allowing steam to enter into steam tent 202 and subject article of footwear 200 to a steam environment . fig5 illustrates a fully deployed position of steam tent 202 . right movable support 302 and left movable support 300 are raised from non - use positions to fully deployed positions . in some embodiments , movable supports are fully deployed in an upright position . in some embodiments , movable supports may engage with bottom portion to maintain an upright position . in an exemplary embodiment , right movable support 302 and left movable support 300 may include legs 500 to hold the movable supports upright against bottom portion 304 . cover material 306 can be disposed between fully deployed right movable support 302 and left movable support 300 to form steam tent 202 . referring to fig6 and 7 , steam tent 202 is illustrated with a door 600 . door 600 allows an article of footwear 200 to be inserted inside steam tent 202 . in an exemplary embodiment , door 600 may be provided along one side of steam tent 202 . in other embodiments , any entry point may be provided that allows an article of footwear to be placed in the interior of steam tent . fig7 illustrates an exemplary embodiment of steam tent 202 containing an article of footwear 200 . article of footwear can be placed inside steam tent in any position . as illustrated in fig7 , after article of footwear 200 is placed inside steam tent 202 , door 600 can be closed or sealed . fig8 illustrates an exemplary embodiment of a source of steam 802 . in this embodiment , a source of steam 802 is a pot 800 containing boiling water . in other cases , a source of steam may be provided by introducing water to a heat source , including , but not limited to : a microwave , an oven , a stovetop , a heating coil , as well other sources of steam . referring to fig9 and 10 , steam tent 202 can be placed in proximity to a source of steam 802 . in this embodiment , steam tent 202 is placed over pot 800 containing boiling water . as illustrated in fig1 , steam 802 enters from pot 800 into the interior of steam tent 202 through holes 400 in the bottom portion 304 of steam tent 202 . steam 802 moves around article of footwear 200 . steam 802 is trapped inside steam tent 202 by cover material 306 . article of footwear 200 can be subjected to steam environment inside steam tent 202 . fig1 - 13 illustrate an embodiment of a method of custom fitting an article of footwear . for purposes of illustration , fig1 - 13 illustrate an embodiment of a method of custom fitting an article of footwear using a post - manufacturing customization system . however , the method of custom fitting an article of footwear described herein may be performed on an article of footwear subjected to a steam environment by any method . some embodiments may include provisions for instructing a user about how to customize an article of footwear . generally , a set of instructions may be supplied in any format . in some cases , the set of instructions may be a printed copy of instructions . in one exemplary embodiment , instructions for custom fitting an article of footwear can be provided as a booklet within the container . in different embodiments , instructions for custom fitting an article of footwear may be provided in the container in various ways , including , but not limited to : as an instruction sheet , booklet , diagram or other printed material . in other embodiments , instructions for custom fitting an article of footwear may be printed on a container lid . in some cases , instructions for custom fitting an article of footwear may be printed on a steaming apparatus . in an exemplary embodiment instructions may be printed on a bottom portion , a top portion or both of a steam tray . in another exemplary embodiment , instructions may be printed on a cover material of a steam tent . in different embodiments , instructions may be provided both in the container and on a steaming apparatus . referring to fig1 , an article of footwear 200 is shown that has been subjected to a steam environment according to an exemplary embodiment . article of footwear may be subjected to steam environment for a specified duration of time . the duration of time may vary and allows article of footwear to be exposed to steam environment for a sufficient amount of time to become moldable . in some cases , the duration of time may vary depending on the type of article of footwear . in other cases , the duration of time may vary depending on the size of article of footwear or may be the same for all types of article of footwear . as illustrated in fig1 , article of footwear 200 is removed from the steam environment and readied for a foot 1100 to be inserted . referring to fig1 , an embodiment of custom fitting an article of footwear to a foot is shown . as illustrated in fig1 , after article of footwear 200 is removed from the steam environment , foot 1100 is inserted into article of footwear 200 . in some cases , a foot may be kept inside article of footwear for a predetermined amount of time sufficient to allow article of footwear to conform to the shape and contours of the foot . article of footwear can be composed of a moldable material that can stretch or shrink to assume a customized shape . moldable material allows article of footwear to be custom fitted to a foot as the article of footwear cools . moldable material may be any material that becomes pliable at an elevated temperature and is capable of retaining a shape as it cools . in some embodiments , the moldable material may be synthetic leather . in some cases , article of footwear may contain multiple moldable materials with different properties , including , but not limited to : pliability , temperature at which it becomes moldable , hardness , as well as other characteristics . fig1 illustrates an article of footwear that has been custom fitted to a foot . as illustrated in fig1 , custom - fitted article of footwear 1300 retains its shape and contours molded from contact with the foot after the foot is removed from article of footwear 1300 . the method of custom fitting an article of footwear results in an article of footwear 1300 that closely fits the shape and contour of the foot that was inserted in article of footwear 1300 while it cooled . fig1 - 22 illustrate another embodiment of an apparatus for steaming an article of footwear . referring to fig1 , an apparatus for steaming an article of footwear may be included in a container 100 for holding an article of footwear . the container 100 holds an article of footwear and steaming apparatus . as illustrated in fig1 , in this embodiment , steaming apparatus is a steam tray 1500 that is provided in the container 100 for holding an article of footwear 200 . in this embodiment , article of footwear 200 can be packaged inside steam tray 1500 in container 100 . in other embodiments , article of footwear and steam tray may be packaged separately in the container . fig1 illustrates an exemplary embodiment of a steaming apparatus where steaming apparatus is a steam tray . referring to fig1 , steam tray 1500 sized and dimensioned to receive an article of footwear 200 can be included inside a container . in some embodiments , the steam tray may be held by a sleeve while in the container . in other embodiments , a sleeve may not be included to hold the steam tray . fig1 illustrates an embodiment of steam tray 1500 . in this embodiment steam tray 1500 can include a bottom portion 1700 and a top portion 1702 . bottom portion 1700 is provided with holes 1704 for allowing steam to enter into steam tray 1500 and subject an article of footwear to a steam environment . in some cases , bottom portion may be metal . in other cases , bottom portion may be plastic . in one embodiment , top portion 1702 is releasably engaged to bottom portion 1700 . in some embodiments , top portion may be detachable from bottom portion . in other embodiments , top portion may be attached to bottom portion . in some cases , top portion may be rigid . in other cases , top portion may be a sheet or film . in addition , in some cases , top portion may be transparent or semi - transparent . in other cases , top portion may be opaque or nontransparent . referring to fig1 and 19 , steam tray 1500 can be sized and dimensioned to receive an article of footwear 200 . in some cases , a steam tray may be provided of a size and dimension to receive a specific type of article of footwear . in other cases , a steam tray is sized and dimensioned to receive multiple types of article of footwear . as illustrated in fig1 , bottom portion 1700 of steam tray 1500 receives article of footwear 200 . referring to fig1 , top portion 1702 is placed over bottom portion 1700 to enclose article of footwear 200 within steam tray 1500 . article of footwear may be placed into the bottom portion of steam tray in any position . fig2 - 22 illustrate an exemplary embodiment of a steam tray containing an article of footwear subjected to a steam environment . referring to fig2 , steam tray 1500 can be placed in proximity to a source of steam 802 . as illustrated in fig2 , in this embodiment , steam tray 1500 is placed over a pot 800 containing boiling water . as illustrated in fig2 , steam 802 enters from pot 800 into the interior of steam tray 1500 through holes 1704 in the bottom portion 1700 of steam tray 1500 . steam 802 moves around article of footwear 202 . steam 802 is trapped inside steam tray 1500 by top portion 1702 . article of footwear can be subjected to steam environment inside steam tray . article of footwear is then custom fitted as illustrated in fig1 - 13 and as discussed above . fig2 - 32 illustrate another embodiment of an apparatus for steaming an article of footwear . referring to fig2 , an apparatus for steaming an article of footwear may be provided as the lid 2300 of container 100 . fig2 illustrates an exemplary embodiment of a steaming apparatus where steaming apparatus is the container lid . referring to fig2 , container lid 2300 is provided with a predetermined removable area 2302 sized and dimensioned to fit a portion of an article of footwear . the predetermined removable area may be provided on container lid in any location . fig2 illustrates an embodiment of a steaming apparatus provided as a container lid . in an exemplary embodiment , container lid 2300 is configured as a steaming apparatus by forming a hole in lid 2300 of container 100 sized and dimensioned to hold a portion of an article of footwear 200 . a predetermined removable area 2302 is provided on container lid 2300 of a size and dimension of the hole to be formed in container lid 2300 . referring to fig2 , predetermined removable area 2302 is sized and dimensioned to receive a portion of an article of footwear 200 . in this embodiment , predetermined removable area 2302 is indicated by a delineated outline 2500 on container lid 2300 . in some cases , predetermined removable area may be of a size and dimension to receive a portion of a specific type of article of footwear . in other cases , predetermined removable area is sized and dimensioned to receive a portion of multiple types of article of footwear . in other cases , predetermined removable area may consist of multiple predetermined removable areas . referring to fig2 - 28 , a hole 2600 sized and dimensioned to fit a portion of an article of footwear may be formed by removal of predetermined removable area 2302 . in one embodiment , predetermined removable area 2302 may be made removable by applying a force to punch out the removable area along the delineated outline 2500 . as illustrated in fig2 , predetermined removable area 2302 is partially separated from container lid 2300 . in some cases , predetermined removable area may be perforated . in other cases , predetermined removable area may be scored on one side . in other embodiments , predetermined removable area may be marked on either side of a container lid by dotted or dashed lines for removal by a customer . as illustrated in fig2 , predetermined removable area 2302 is fully removed from container lid 2300 to form hole 2600 . hole 2600 is sized and dimensioned to fit a portion of an article of footwear 200 . fig2 illustrates an exemplary embodiment of a steaming apparatus provided as a container lid holding in place an article of footwear . in one embodiment , hole 2600 in container lid 2300 is configured to hold an article of footwear 200 in an inverted position . in other embodiments , the hole in the container lid may hold an article of footwear in any position . fig2 illustrates a cross - section detail of an embodiment of a steaming apparatus as a container lid holding in place an article of footwear . in this embodiment , article of footwear 200 includes throat 2900 configured to receive a foot of a wearer . throat 2900 allows a foot to be inserted into an interior portion 2902 of article of footwear 200 . in this embodiment , throat upper 2904 is a portion of article of footwear 200 that surrounds the throat 2900 . in some embodiments , hole 2600 in container lid 2300 is sized and dimensioned to hold article of footwear 200 in an inverted position by contacting throat upper 2904 of article of footwear . in other embodiments , hole in container lid may be sized and dimensioned to hold a different portion of article of footwear . fig3 - 32 illustrate an exemplary embodiment of a steaming apparatus as a container lid containing an article of footwear subjected to a steam environment . referring to fig3 , container lid 2300 containing an article of footwear 200 can be placed in proximity to a source of steam 802 . as illustrated in fig3 , in this embodiment , container lid 2300 containing an article of footwear 200 is placed over a pot 800 containing boiling water . as illustrated in fig3 , steam 802 enters from pot 800 through throat 2900 and into the interior 2902 of article of footwear 200 . steam 802 moves around interior 2902 of article of footwear 200 . article of footwear can be subjected to steam environment . article of footwear is then custom fitted as illustrated in fig1 - 13 and as discussed above . while various embodiments of the invention have been described , the description is intended to be exemplary , rather than limiting and it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible that are within the scope of the invention . accordingly , the invention is not to be restricted except in light of the attached claims and their equivalents . also , various modifications and changes may be made within the scope of the attached claims . | 1 |
various other objects , features and attendant advantages of the present invention will be more fully appreciated as the same becomes better understood from the following detailed description when considered in connection with the accompanying drawings in which like reference characters designate like or corresponding parts throughout the several views and wherein fig1 shows the device as including an enclosure 1 which contains both the reacting board generally indicated as 2 and measuring apparatus generally indicated as 3 . the enclosure 1 is a tank which is maintained at the best reaction temperature for the particular reaction involved . the temperature is maintained by a thermostatically controlled heating device ( not shown ). the particular best temperature depends on the particular microorganisms and enzymes present in the sample to be analyzed . accordingly the temperature at which the enclosure is maintained should be variable over a range of values . the reacting board is a centrally located rotatable holder for a series of reacting containers 4 which are mounted around the periphery of the board . the board is rotated by means of a motor and gearing arrangement generally indicated as 11 which turns a rotating shaft 5 in the center of the board . a base plate 6 which may be transparent , is mounted on the rotating shaft 5 and turns therewith . also mounted on the shaft at positions above the base plate are an intermediate plate 7 and a top plate 8 . the intermediate plate and top plate have concave portions 9 and 10 ( see fig2 ) at a number of locations around their periphery . a reacting container 4 may be placed on the base plate and extend upwardly through the concave portions 9 and 10 in the upper two plates . a container may be placed in each set of concave portions . by controlling the motor 11 , the rotating shaft 5 may be made to drive the various reacting containers to the position in front of the measuring apparatus 3 . this location is the measuring section and is the space for measuring the fluorescent substance in the reacting container . the measuring section is made so that a measurement may be made of any fluorescent substance by applying a fluorescent exciting ray and receiving a result according to the particular make up of the reaction involved . the other positions of the reacting board away from the measurement section may be utilized as a reacting section . in this section a reactive liquid with a fluorescent substrate is applied to a sample in the reacting container 4 . the reactive liquid and the sample are mixed . any substance with an ingredient which forms fluorescent substances in response to a fluorescent substrate can be used for measuring samples . examples of these are foods , cosmetics , pharmaceuticals , etc . factors forming fluorescent substances in response to the fluorescent substrate include microorganisms such as bacteria , mold , yeast , and various enzymes . all substances forming fluorescent substances with enzymes may be employed as fluorescent substrates . for example , when a sample contains micro - organisms , 4 - methylumbelliferil phosphate is used as a fluorescent substrate and the fluorescent substance formed is 4 - methyl - umbelliferone ( 4mu ). in the case of a sample including peptidase , arginyl mca or leucil mca is used as a fluorescent substrate and the formed fluorescent substance is methylcoumarin ( mca ). fixed tubes 12 are provided around the rotating shaft and extend radially outwardly therefrom . one tube is provided for each reacting container and thus are provided at positions corresponding to concave portions 9 and 10 . the tubes are preferably located above the top plate and thus above the reacting containers 4 . the flexible coupling tube 13 is connected to each fixed tube and extends downwardly to a nozzle 14 which is contained within each reacting container . the ends of the fixed tubes 12 are connected to a supply of compressed air ( not shown ) by way of channels in the rotating shaft 5 . thus , compressed air travels through the channels , fixed tubes 12 , flexible coupling tubes - 3 and nozzle 14 . as seen in fig3 the lower end of the nozzle is open so that air is bubbled through the solution in the reacting container 4 . as further seen in fig3 the reacting container is made of a reacting tube 17 , a cover 18 and a measuring tube 19 . the measuring tube 19 and reacting tube 17 are screwed together using interacting screw threads 21 and 29 and gasket 40 . cover 18 carries coincident l - shaped pieces 26 made on the opposite lower parts of the inner boundary thereof . likewise , the reacting tube carries coincident l - shaped pieces 20 on the periphery of the upper end which is aligned with coincident pieces 26 to seal and fix the cover 18 to the reacting tube 17 using a gasket 27 . a nozzle hole 24 is drilled into the center of cover 18 and is used for inserting and fixing the nozzle 14 and joining the nozzle to flexible coupling tube 13 . a purge hole 25 is also drilled in the cover in order to allow air to escape from the reacting tube . the measuring tube is approximately cylindrical in shape as is the reacting tube 17 . cover 18 , reacting tube 17 and measuring tube 19 are all transparent synthetic resin or glass . the bottom of reacting tube 17 is formed by horizontal surface to which a filling tube 22 projects downwardly , thus providing an exit for liquid in the reacting tube . this bottom surface is covered by a filter plate 23 which is fixed to the upper surface of the filling tube 22 . thus , in order for liquid to pass through the filling tube 22 , it is necessary for it to pass through filter 23 . an air tube 30 projects from the side wall of measuring tube 19 in the direction of the rotating shaft 5 . this air tube is connected to an air suction and exhaust unit ( not illustrated ) by way of a coupling tube 31 and channels formed in the rotating shaft 5 . if desired , the connection to the suction source may only occur at certain positions along the circular travel of the apparatus such as only at the measuring station . fig4 shows a reacting container in position at the measuring section . the measuring apparatus 3 is placed so as to be below the base plate and also just outside the outer periphery of this base plate . a light source 34 provides a light beam which is focused by lens 33 and passes through an exciting ray filter 32 which allows rays of a specific wavelength , such as 360 nm to pass into the bottom of the measuring tube 19 . an angled frame 35 is placed adjacent and radially outside of the measuring tube . fluorescent rays which originate within the measuring tube pass through the transparent wall of the measuring tube and are focussed by lens 36 onto a fixed reflector 37 and through a fluorescent filter 38 which only allows light of a certain wavelength , for example 450 nm to pass . a light receiving unit 39 receives this light and measures the amount of light in a known manner in order to determine the presence of microorganism in the sample . the result of the measurement is passed through cables extending through the thermostatically controlled housing to a cathode ray tube display ( not shown ) or other indicator which is installed outside of the housing . in operation , the reacting container 4 with the cover 18 removed is used to mix a sample , for example of soup and a reactive liquid , for example of 10 - 3 mole of 4 - methylumbelliferil phosphate . since the filter 23 blocks the passage of the liquid , the liquid stays in the reacting tube 17 . the cover 18 may then be placed over the reacting tube and the entire reacting container attached to the reacting board 2 . air tube 30 is connected to the connecting tube 31 and nozzle 14 is connected to flexible coupling tube 13 through the nozzle hole 24 . the thermostatically controlled enclosure automatically controls the temperature of the apparatus to be about 40 ° c . or other desired temperature during the remainder of the measuring cycle . of course , at the same time other samples may also be prepared in other reacting containers and placed on the reaction board in a similar fashion . it is also possible to insert and remove other reacting containers during the course of the reaction time . the reaction occurs for about 2 hours in the reactive container 4 while air is supplied through a nozzle 14 . the air acts to keep the liquid stirred up . when the reaction time is complete the air supply is halted and rotating shaft 5 is rotated so that the particular reacting container of interest is placed at the measuring section 3 . when in position , air is sucked from the air tube 30 and connecting tube 31 , causing a negative pressure in measuring tube 19 . as a result , the liquid in the reacting tube 17 passes through filter 23 and filling tube 22 and is received in the measuring tube 19 . the liquid is then irradiated by 360 nm rays passing from the light source 34 , lens 33 and filter 32 into the bottom of the measuring tube 19 . the fluorescent rays emitted from the fluorescent substance in the measuring liquid are concentrated on the receiving unit 39 by lens 36 and reflector 37 . light of other wavelengths are removed using filter 38 . the amount of incident light of the desired wavelength is measured and displayed . these measurements reveal the fluorescent substance concentration in the measuring liquid and the presence or absence of microorganisms in the sample and their concentration . thus , by placing both the reacting section and the measuring section of the device in a thermostatically controlled enclosure the present invention allows the continuous reaction testing of a sample with a reactive liquid and the measurement of the resultant fluorescent substance concentration without removing the reacting container . as a result the analysis may be done easily on a large number of samples without any unnecessary movements on the part of the operator . as can be easily seen , the device may also be automated since it is only necessary to sequentially perform the operation on the various reacting containers by moving the containers using motor 11 . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein . | 2 |
the present invention modifies commercial p ( vdf - trfe ) and produces a high performance copolymer that has particular application to pyroelectric conversion . the copolymer of p ( vdf - trfe ) is purified of unknown impurities , thereby improving the performance of the copolymer under severe operating conditions . in the preferred embodiment , pellets of a commercially available 60 %- 40 % p ( vdf - trfe ) copolymer are dissolved in methyl ethyl ketone ( mek ) to produce about a 4 % solution by weight . after the pellets are dissolved , anhydrous ethanol ( etoh ) is added to the homogeneous solution . this procedure results in copolymer gel precipitation . the gel is separated from the solvent ( mek / etoh ) by filtration using a filter paper . subsequently the gel is washed with ethanol . the purified gel ( copolymer ) is then air - dried in an oven at 50 ° c . for 3 h , and further air - dried at room temperature for three days . it was found that solvent extraction removes approximately 0 . 4 wt % of un - identifiable ‘ impurities ’. although the amount removed appears small , the electrical resistivity of the purified copolymer is approximately 35 % higher than that of unpurified copolymer . thus , the pyroelectric conversion can be operated at a significantly higher voltage and at a higher temperature without developing a large leakage current . tests show that the upper limit of the electric field can be increased by about 33 % to contribute to the higher net power output . purification in itself also significantly increases the net power output nearly three - fold from 95 j / l of copolymer used to 279 j / l of copolymer used . in one type of test , a differential scanning calorimeter ( dsc ) was used to compare purified and unpurified materials resulting in unexpected differences in phase transition peaks . fig1 and 2 compare dsc data for two samples : purified and unpurified ( or as received ) samples . these samples were not annealed and the dsc test was performed at 10 ° c ./ min . fig1 illustrates the dsc thermograms for ferroelectric to paraelectric phase transition and fig2 illustrates the dsc thermograms for melting temperature . it can be seen that the thermal analysis of purified and unpurified materials have different phase transitions . ferro - electric to para - electric transition after purification exhibits only one peak , while unpurified material has two , which corresponds to a mix of highly polar β phases with other non - polar phases . these non - polar phases disappear after purification and the interval of the transition becomes wider , while corresponding amounts of enthalpy of dipole contribution increases . these changes improve the pyroelectric properties of the material . the increase in the polarity corresponds to the increase in capacitance , i . e ., ability to hold electric charge . fig3 shows a comparison of the dsc thermograms for ferroelectric to paraelectric phase transition comparing purified and annealed copolymer versus purified but non - annealed . after the purified film has been annealed , the shift of the ferroelectric to paraelectric peaks is not very significant . fig4 shows a comparison of the dsc thermograms for melting temperature of annealed and non - annealed purified copolymers . upon review of the non - annealed results of fig1 , there is only one phase transition peak at about 78 ° c . for the purified copolymer . thus , the purified non - annealed p ( vdf - trfe ) has a transition temperature approximately 10 ° c . higher than that of the unpurified copolymer and slightly higher than that of the annealed purified copolymer . to summarize the test results of fig1 to 4 , ferro - electric ( polar ) to para - electric ( non - polar ) transition in purified material show only one peak whereas unpurified material has two . the total area of two peaks in the unpurified copolymer corresponding to a simple phase transition plus ferroelectric transition is more than that of the single peak in the purified material . however , the output from the purified material was much higher than that from the unpurified material . the two peaks in the unpurified copolymer overlap . resolving or separating the peaks with a mathematical method results in the observation that the dielectric contribution from the polar peak in the unpurified material is small . conversely , the area of the single peak in the purified material is broader than the polar peak in the unpurified material . ferroelectrics that have a higher curie transition point also have more trans sequences ( polar ) and less gauche ( non - polar ). table 1 summarizes enthalpies and entropies at phase transition temperatures and melting temperatures for these different samples . the purified copolymer shows a significant increase in electrical resistivity and an improved ferro - electric to para - electric phase transition response . furthermore , the purified material is significantly easier to precondition ( pre - polarize ) prior to pyroelectric conversion . the resulting high performance copolymer allows operation of pyroelectric conversion at significantly more severe process conditions . consequently , the net power output is increased substantially over commercial copolymers by reducing internal leakage current and also by changing the pyroelectric response , i . e ., heat - to - electrical charge response . proper pre - polarization and high resistivity are key factors for superior pyroelectric materials that achieve high pyroelectric conversion efficiency . high film resistivity minimizes the internal conductive current , resulting in a higher net power output . it was discovered that purified p ( vdf - trfe ) is easier to pre - polarize and eliminates instances of short - circuiting during film pre - polarization . purified p ( vdf - trfe ) films show a significant increase in resistivity and an increase in the available electron discharge across the phase transition temperature , while the time required for complete pre - polarization decreases . the purified copolymer surprisingly exhibited an increased net power output from 95 j / l copolymer used to 279 j / l of the copolymer used . fig5 compares pre - polarization time for unpurified or as received p ( vdf - trfe ) and purified p ( vdf - trfe ) samples according to the present invention ; s 1 , s 2 and s 3 . the tests were performed at 85 ° c . with a 20 mv / m applied electric field . the vertical axis that is labelled “ total current ” represents the leakage current . fig5 shows a significant decrease in the total current during the first 10 to 15 min . after about 90 min of pre - polarization , the decrease in the total current for unpurified material has nearly ceased , whereas the total current continues to decrease for the other three purified copolymer samples . when an electric field is applied to the un - poled copolymer , structural changes occur that include phase transformation , reduction in the conformational defects of crystallites and the orientation and alignment of all dipoles into the field direction . these changes occur in the first 10 to 15 minutes of the test . as the poling continues , impurities are transported to the electrodes . the time required for the complete pre - polarization varies depending on the degree of purification , i . e ., the sample preparation conditions such as thermal and solution history . if the electric field is switched off after 15 minutes and the copolymer is cooled immediately , all the crystallite dipoles will remain frozen in the field direction , resulting in remnant polarization . complete pre - polarization , as a sum of crystalline changes and polling of impurities , is much longer for unpurified film than that for the samples previously subjected to cleaning and thermal treatment . fig6 shows the copolymer resistivity as a function of pre - polarization time . it is evident that purification and pre - polarization under a slightly elevated temperature increase the copolymer resistivities . after 90 minutes of pre - polarization the resistivity of the unpurified film no longer increases , which indicates that the internal electrical conduction also does not decrease after this point . however , as the pre - polarization procedure continues , the resistivity of the purified films ( s 1 , s 2 and s 3 ) continues to increase . when compared at the 90 minute mark the purified films s 1 , s 2 and s 3 have higher resistivity than the unpurified film by about 30 %, 40 % and 9 % respectively . thus , purification of the p ( vdf - trfe ) copolymer by the solvent extraction of the present invention not only improves electrical resistivity , but also makes the step of pre - conditioning of pyroelectric copolymer simplified and more effective . this is a key technology for developing a high performance pyroelectric converter system . the high performance copolymer has uses in industries such as electric power generating stations , petro - chemical companies , steel works , and the pulp and paper industry . it will be appreciated by one skilled in the art that variants can exist in the above - described procedure . for example , the amount of air - drying in an oven can be varied , which will vary the length of time required for air - drying at room temperature . in addition , one could replace ethanol with other polar alcohols such as methanol , propanol and higher alcohols . when methanol is used , water should be added to cause p ( vdf - trfe ) precipitation from the alcohol / mek mixture . similarly , methyl ethyl ketone ( mek ) could be replaced by n - n - dimethyl formamide ( dmf ). as another example , other common methods of separation of the solvent from the gel may also be employed . | 7 |
referring now to the embodiment of the invention shown in fig1 , a new bicycle seat height adjusting assembly is presented and generally designated by the reference number 20 . the seat height adjusting assembly 20 generally comprises a seat post 21 that is positioned within an insert tube 23 . the insert tube 23 is shown inserted into the seat tube 28 of a bicycle frame 34 . the insert tube 23 retrofits into the bicycle seat tube 28 in the place of a traditional seat post . the seat post 21 is adjustable up and down , being telescopically slidable within the insert tube 23 . a cable housing 38 is shown extending outwardly from the upper portion of the insert tube 49 . the cable housing is further connected to an actuation lever 15 that is positioned on the bicycle handlebar 32 . the seat 22 is clamped to the top portion of the seat post 21 through any conventional clamping method 26 . a post clamp 24 is positioned around the seat tube 28 of the bicycle frame 34 for fixedly securing the insert tube 23 with respect to the seat tube 28 . referring now to the preferred embodiment of the invention shown in fig1 through 9 , a third tubular structure 60 is positioned at the lower support platform 71 of the insert tube 23 . the third tubular structure 60 extends up into the inner area 61 of the seat post 21 . a fourth tubular structure 64 that has a closed top end and an open bottom end is positioned within the inner area 61 of the seat post 21 . the third tubular structure 60 slides mainly within the fourth tubular structure 64 . a perimeter air seal 68 positioned around the upper area of the third tubular structure 60 forms an air tight seal between the outer wall of the third tubular structure 60 and the inner wall of the fourth tubular structure 64 to form a first air chamber 62 and a second air chamber 65 . the first air chamber 62 is formed within the third tubular structure 60 . the second air chamber 65 is formed within the contained area of the fourth tubular structure 64 . an air valve 70 , such as a schrader air valve , extends down from the bottom of the third tubular structure 60 , through the support platform 71 , to where the air valve 70 is capable of delivering pressurized air into the first air chamber 62 , from an air pump type device . air is pumped through the air valve 70 and travels into the first air chamber 62 . an air damper opening 66 that is sized to control the speed of air flow , is positioned at the top of the third tubular structure 60 . a portion of the air that is pumped into the first air chamber 62 will then travel through the air damper opening 66 of the first air chamber 62 and be further contained within the second air chamber 65 . the air pressure increase within the first air chamber 62 and the second air chamber 65 further causes the air within the second air chamber 65 to want to expand and push up on the top surface of the fourth tubular structure 64 and expand to push down on the third tubular structure 60 . as the third tubular structure 60 is held in place by the stationary insert tube 23 , the pressurized air within the first air chamber 62 and the second air chamber 65 , forms a main air spring unit 67 that urges the seat post 58 to rise . the air damper opening 66 will restrain the seat post 21 from rising too fast . fig2 and 6 show a row of locking holes 56 that are positioned along the front side of the insert tube 23 . a locking pin 72 that is square in profile , is positioned within a lock housing 73 that is positioned at the bottom section of the seat post 21 . the locking pin 72 is positioned on the lower front side of the seat post 21 so that the locking pin 72 is able to enter into one of the lock holes 56 . the locking pin 72 has a supplemental spring 80 positioned against the back wall of the lock housing 73 that pushes the locking pin 72 outward and into one of the lock holes 56 . to push the locking pin 72 out of the lock holes 56 , a first groove 81 is formed in centered alignment with the lock holes 56 , along the inner wall of the insert tube 23 . a first spline rod 82 and a second spline rod 83 have flat wedging projections 84 extending from the first spline rod 82 to the second spline rod 83 . the first spline rod 82 and the second spline rod 83 are positioned against the back wall of the first groove 81 . the depth of the first spline rod 82 , the second spline rod 83 and the flat wedging projections 84 are all equal to the depth of the first groove 81 . the height of each of the flat wedging projections 84 is equal to the height of each of the lock holes 56 . the first spline rod 82 and second spline rod 83 connect at their top to form an outward pointing holder 86 . the first spline rod 82 and second spline rod 83 connect at their bottom to form an inward pointing holder 88 . each of the flat wedging projections 84 is positioned to be pulled up and in front of a portion of each one of the lock holes 56 as the outward pointing holder 86 is lifted . a supplemental wedge 76 is positioned at the outer edge of the locking pin 72 . the locking pin 72 has outer locking dog edges 74 , 74 that are rounded to fit and lock into the curve of the locking holes 56 . slots 77 , 77 are positioned on either side of the supplemental wedge 76 to let the first spline rod 82 and second spline rod 83 enter into the slots 77 , 77 as the locking dog edges 74 , 74 are pushed into one of the lock holes 56 . projection openings 90 are positioned between each of the flat wedging projections 84 . the supplemental wedge 76 fits through one of the projection openings 90 when the locking dog edges 74 , 74 are locked into one of the locking holes 56 . as shown in fig6 and 7 , when the flat wedging projections 84 are lifted , one of the flat wedging projections 84 pushes back the supplemental wedge 76 to push the outer locking dog edges 74 , 74 out of one of the lock holes 56 to unlock the locking pin 72 from the lock holes 56 . the main air spring unit 67 is then able to expand and force the seat post 21 to rise , with the locking pin 72 being fully pushed out of the locking holes 56 . each of the flat wedging projections 84 is now positioned up and in front of a portion of each one of the lock holes 56 . the supplemental wedge 76 has a return curve 78 positioned at the outer portion of the supplemental wedge 76 to enable the supplemental wedge 76 to slide up and over each of the flat wedging projections 84 as the seat post 21 rises . the outer portion of the supplemental wedge 76 further extends outward a small amount more then the locking dog edges 74 , 74 , so that the locking dog edges 74 , 74 do not engage any one of the lock holes 56 as the seat post 58 rises or lowers . a cable 36 first attaches onto the actuation lever 30 that is positioned on the handlebar 32 . the cable 36 extends through the cable housing 38 . the cable 36 further extends from the cable housing 38 , into the cable opening 42 that is positioned on the front of the collar protrusion 54 . within the collar protrusion 54 is a protrusion chamber that contains the outward pointing holder 86 and a leveraging arm 46 of a pivoting lift rod 48 . the cable end barb 40 is then positioned within the leveraging arm 46 of the pivoting lift rod 48 . the end of the pivoting lift rod 48 is positioned under the outward pointing holder 86 . as the cyclist pulls the actuation lever 30 , the cable end barb 40 pulls the lifting rod 48 up , to push the outward pointing holder 86 up and thereby unlock the locking pin 72 from one of the locking holes 56 . referring back to fig1 , 2 and 3 , when the cyclist releases the actuation lever 30 the flat wedging projections 84 are no longer being pulled upwards , as a return leaf spring 94 pulls the inward pointing holder 88 back down . as the flat wedging projections 84 are pulled down and away from the openings to the lock holes 56 , the locking dog edges 74 , 74 are able to re - enter into any one of the lock holes 56 and re - lock the seat post 21 at a given height . fig4 and 5 distinctly show the first spline rod 82 and the second spline rod 83 with the flat wedging projections 84 extending from the first spline rod 82 to the second spline rod 83 . the outward pointing holder 86 and the inward pointing holder 88 are also shown . the projection openings 90 are shown positioned between each of the flat wedging projections 84 . referring now to fig2 and 3 , there are a number of other details of interest . a wiper seal 52 is positioned around the seat post 21 . the wiper seal 52 is positioned within the top section of the insert tube 23 . the wiper seal 52 will shed mud off the seat post 21 and keep mud from entering into the insert tube 23 . a limiting platform 100 is formed at the lower portion of the insert tube 23 to limit the downward motion of the seat post 21 . the insert tube 23 has a slight collar 50 at the upper portion that acts to limit the insert tube 23 from sliding entirely into the bicycle frame seat tube 28 . a cable housing opening 44 is also shown just in front of the cable opening 42 . a first counter rotational boss 110 and a second counter rotational boss 112 are shown in fig3 and also shown in fig9 . referring now to fig9 , the first counter rotational boss 110 and the second counter rotational boss 112 are shown attached to the lower section of the seat post 21 . a second groove 106 is formed longitudinally within a second side of the inner wall of the insert tube 23 . the first counter rotational boss 110 slides within the second groove 106 to keep the seat post 21 from rotating relative to the insert tube 23 . a third groove 108 is formed longitudinally within a third side of the inner wall of the insert tube 23 . the second counter rotational boss 112 slides within the third channel 108 to further to keep the seat post 21 from rotating relative to the insert tube 23 . a first ball bearing 114 with a second supplemental spring 115 is positioned within the seat post 21 , below said first boss 110 . the first ball bearing 114 slides partially within the second groove 106 and is pressed outwardly by the second supplemental spring 115 , to eliminate the smallest rotational movements by the seat post 21 . a second ball bearing 116 with a third supplemental spring 117 is positioned within the seat post 21 , below said second boss 112 . the second ball bearing 116 slides partially within the third groove 108 and is pressed outwardly by the second supplemental spring , to further eliminate the smallest rotational movements by the seat post 21 . a maximum height limiting system is shown in fig9 . a plurality of threaded openings 120 are formed into the exterior wall of the seat post 21 , above the first counter rotational boss 110 . a maximum height set screw 122 is positioned within one of the threaded openings 120 . the maximum height set screw 122 slides partially within the second groove 106 . the maximum height set screw 122 is limited in its upward movement by the top surface of the second groove 106 . positioning of the maximum height set screw 122 , into one of the threaded openings 120 , limits how high the seat post 21 is able to raise . the threaded openings 120 of the maximum height adjust system are meant to be present on only the lowest section of the seat post 21 where they are only needed , as not to require any threaded openings 120 to be visible once the seat post assembly 20 is installed in the bicycle frame 34 . fig8 and 9 show a second groove opening 111 and a third groove opening 113 . the second groove opening 111 allows for the adding and the removal of the maximum height set screw 122 , the first boss 110 , the first ball bearing 114 and the second supplemental spring 115 from the seat post 21 . the third groove opening 113 allows for the adding or removing of the second boss 112 , the second ball bearing 116 and the third supplemental spring 117 from the seat post 21 . fig8 further shows the lock holes 56 positioned through the front of the insert tube 23 . fig1 presents the same embodiment of the invention as presented in fig1 through 9 except that each of the lock holes 56 are divided into double lock holes 55 , 55 to accommodate one of the locking dog portion 74 and the supplemental wedge 76 separately . fig1 presents the same embodiment of the invention as presented in fig1 through 9 except that each of the lock holes 56 are divided into triple lock holes 57 , 57 , 57 to accommodate the locking dog portions 74 , 74 and the supplemental wedge 76 separately . fig1 presents the same embodiment of the invention as presented in fig1 except that the cable housing 38 extends from the actuation lever 30 to an opening in the lower portion of the bicycle seat tube 28 . in this configuration , a height adjusting seat post assembly 20 that has the cable 36 exiting from the lower portion of the insert tube 23 is possible . the embodiment of the invention presented in fig1 , 14 and 15 is the same as the embodiment of the invention presented in fig2 through 9 , except for a few differences . the cable end 40 extends though the support platform opening 44 and is attached to the inward pointing holder 88 . the return compression spring 96 is positioned within a smaller protrusion chamber 97 . each of the tapered wedging projections 85 has a taper at their top and bottom for smoother movement against the supplemental wedge 76 . the supplemental wedge 76 is flipped over to maintain a similar locking and unlocking operation as the tapered wedging projections 85 are pulled downward rather then upward to unlock the locking dog edges 74 , 74 from the lock holes 56 . a connecting rod 130 extends from a pivot 131 that is attached to an inner support structure 132 that is positioned along the inner wall of the seat post 21 . the connecting rod 130 connects to the locking pin 72 to give the locking pin 72 a pivotal movement rather then a linear movement . the fourth tubular structure 64 has been removed from fig1 and 14 with the perimeter air seal 68 extending out to the inner wall of the seat post 21 to form a seat post air chamber 63 . fig1 shows the locking pin 72 fully engaged into one of the lock holes 56 . fig1 shows the tapered wedging projections 85 being pulled downward by the cable end 40 and having pushed back the supplemental wedge 76 . fig1 distinctly shows the tapered form of the tapered wedging projections 85 . the embodiment of the invention presented in fig1 through 19 is the same as the embodiment of the invention presented in fig1 through 9 except for a few differences . in fig1 through 19 the second spline rod 83 is removed and a plurality of wedge shape projections 92 are used in place of the wedging projections 84 . the wedge shape projections 92 are turned to point inwards , towards the seat post 21 . a wedge shape is formed for the outer profile of each of the wedge projections 92 . a narrower first inner groove 140 is used . the supplemental wedge 76 and slots 77 , 77 are removed from the locking pin 72 . the inner surface of the insert tube 23 extends straight across rather then being curved just above each locking hole 56 , to create more room for the wedge shaped projections 87 . the front of the seat post 21 has a flat surface to accommodate the flat inner surface of the insert tube 23 . fig1 and 17 show the seat post 21 in a locked position . fig1 and 19 show the locking pin 72 pushed back by the wedge projections 92 as the wedge shaped projections 92 are pulled upward . a return curve 93 is positioned at the outer edge of each of the wedge shaped projections 92 to enable the locking pin 72 to smoothly rise while pressing against each of the wedge projections 92 . the main air spring unit 67 presented in fig2 through 9 is replaced within the alternative embodiment presented in fig1 through 19 , by a main coil compression spring 124 that has an aligning tube 126 positioned within it to keep the main compression spring 124 from deforming . the alignment tube 126 and main compression spring 124 are both contained into position by a compression spring platform 128 that is positioned at the lowest portion of the insert tube 23 . | 1 |
fig1 depicts one embodiment of the deterioration resistant retaining wall block 10 comprising a top panel 12 , a bottom panel 14 and a wall assembly 16 . fig1 illustrates the top panel 12 , which includes one or more apertures 18 . the apertures 18 may be of any size and shape suitable for the receiving of fill material . the bottom panel 14 includes a relatively flat surface or contoured to rest uniformly with the top panel 12 of one or more blocks 10 positioned below . the bottom panel may also include or be adjoined to an anchoring device 20 . fig2 depicts the side view of an embodiment of the present invention , which includes an anchoring device 20 in the form of a retaining flange 22 adjoined to the bottom surface 14 of the block 10 . on a constructed wall , each retaining flange 22 is a wall retention device that operates to inhibit outward movement of the wall . normally , the retaining flange 22 extends downward from the back of the bottom panel 14 and rests against the back of the retaining block 10 located below the bottom panel 14 . the retaining flange 22 may be a unitary piece extending downward from the back of the retaining block 10 or a series of fingers extending downward from the back of the retaining block 10 . another embodiment of the present invention may include an anchoring device 20 in the form of insertable pegs 24 . in fig3 the insertable pegs 24 are adjoined to the bottom panel 14 and are configured to be securely receivable in the apertures 18 of an additional adjoining top panel 12 of another retaining block 10 . the insertable pegs 24 can be made of any shape and size , which can be securely fit into the apertures 18 of the top panel 12 . the insertable pegs 24 may also function to seal the interior of the retaining block 10 from outside elements . fig4 and 5 depict another type of peg configuration . fig4 illustrates a bottom panel 14 of one embodiment of the present invention wherein the insertable pegs 24 are lockable . the insertable pegs 24 are positioned on the bottom panel 14 at an angled configuration . the top panel 12 , illustrated in fig5 includes apertures 18 adapted to receive the lockable insertable pegs 24 . in operation a block 10 is maneuvered so that the pegs 24 of one block are inserted into the apertures 18 of another block . the block 10 possessing peg 24 is then turned into position thereby locking the two blocks together . the pegs 24 on a block 10 may also be configured to fit into the apertures of two adjacent blocks positioned below . this application is beneficial if the blocks of adjacent rows are staggered in positioning . see fig6 a and 6b for an illustration of a staggered retaining wall . the deterioration resistant retaining block 10 also includes a wall assembly 16 , which is also depicted in fig1 . the wall assembly 16 comprises one or more outside walls 25 . many embodiments of the present invention include wall assemblies 16 that are adjoined to the top panel 12 and bottom panel 14 . the adjoinment of the wall assembly 16 to the top panel 12 and bottom panel 14 creates a chamber 26 located within the retaining block 10 . the chamber 26 is normally filled with materials such as sand , gravel , dirt , cement , water , or other like materials to provide weight and structure stability to the retaining block 10 and the entire retaining wall . another embodiment of the present invention is depicted in fig7 - 9 . the embodiment shown in fig7 comprises a deterioration resistant retaining block 10 with the top panel 12 removed , wherein the wall assembly 16 defines more than one chamber 26 within the retaining block 10 . the multiple chambers 26 are defined by interior partitions 28 . the interior partitions 28 may also be utilized to add additional support to the retaining block 10 to prevent any possible crushing of the block 10 . fig8 depicts one embodiment of the top panel of a partitioned retaining block 10 . the interior partitions 28 are within the interior of the retaining block 10 and are depicted by dashed lines . the top panel 12 in this embodiment is permanently fixed to the wall assembly 16 and includes multiple apertures 18 to accommodate filling of each individual chamber 26 with appropriate fill material , such as sand , gravel , soil , cement or any other suitable material . fig9 depicts another possible embodiment of the top panel 12 , which is configured in a cover formation that may be adapted to securely fit over the retaining wall block 10 illustrated in fig7 . the top panel 12 of this embodiment comprises a closed section 30 that includes overlapping edges 32 , which overlap securely over the outside walls of the wall assembly 16 , but does not include apertures . however , the top panel may also secure to the wall assembly 16 in other ways , such as locking tabs , twist locks , clamps , clips , adhesives or any other fastener . the top panel 12 of this embodiment may optionally be hingedly secured to the retaining block 10 by any type of hinge device 29 , thereby providing a unitary configuration of the retaining wall block 10 . fig9 a depicts one embodiment of the present invention including a top panel 12 hingedly adjoined to the wall 16 of the retaining wall block 10 . multiple chambers 26 also allow for the retaining block 10 to be cut into various shapes and still maintain a chamber that can receive and retain fill materials . fig1 depicts a section of the retaining block 10 as shown in fig7 wherein the corners have been removed and the block 10 has been cut in half . the ability to cut the retaining block 10 and still retain the same features is particularly useful in preparing ends and awkward segments of retaining walls . dashed lines depicted in fig9 illustrate alternate cover configurations to conform to the various shapes of a retaining block 10 or portions thereof . an additional embodiment of the present invention is depicted in fig1 and 12 . fig1 illustrates a top view of a retaining block 54 wherein multiple units 34 are incorporated into a single block 54 . a single multi - unit block 54 provides the appearance of multiple retaining blocks present in a single structure . the top panel 12 may be a single sheet or multiple sheets of material which covers each unit 34 and optionally includes apertures 18 . the interior of the retaining block 54 of this embodiment includes one or more interior partitions 28 . fig1 depicts the front view of the mutli - unit retaining block 54 , which has the appearance of multiple separate units 34 . these multiple separate units 34 provide the appearance similar to the partial assembly of a retaining wall comprising a plurality of individual blocks , such as depicted in fig6 a and 6b . the multi - unit retaining block 54 may be a unitary structure or may include multiple components , such as a multi - unit block 54 including a single top panel ( not shown ), similar to the top panel depicted in fig9 . fig1 depicts another embodiment of a multi - unit retaining wall block 54 , which includes a common flexible wall 56 . for example flexible wall 56 may be positioned as the back wall of the multi - unit block 54 . in this embodiment of the present invention , tabs 58 may be positioned between each individual unit 34 on the front or back of the multi - unit block 54 . if a curved wall is desired , the tabs 58 may be disengaged , thereby allowing the multi - unit block 54 to be maneuvered into a curved position . another type of anchoring device 20 included in the present invention may be a side locking mechanism . as depicted in fig1 - 17 one or more interlocking keys 36 and locks 38 may be included in the retaining block . each key 36 may include a rounded relatively flat cylinder 40 adjoined to a neck 42 that is attached to the side wall 44 of a retaining block 10 . each lock 38 comprises a partially enclosed cavity 46 , which is configured to receive and securely retain the key 36 when inserted into the lock 38 . as depicted in fig1 ., wings 48 located on the front of each retaining block 10 function to hide the key and lock system from the view of an observer of the retaining wall . the retaining wall blocks of the present invention may include other side attachments , such as hook and pile attachments ( not shown ). the retaining wall block 10 depicted in fig1 - 21 includes a top panel 12 , a bottom panel 14 and a wall assembly 16 configured to form one or more chambers 26 . the top panel 12 and bottom panel 14 do not include apertures . furthermore , the top panel 12 , bottom panel 14 and wall assembly 16 may be a unitary structure or piece . the difference in this embodiment is that the back wall 50 includes one or more back apertures 52 that can be sealed , after it is filled , with a cover or other type of plugging device ( not shown ). the back apertures 52 can be of any shape and size and may include an aperture that may extend to any or all of the side panels 16 , top panel 12 and / or bottom panel 14 . the embodiment depicted in fig1 - 21 may also include an anchoring device , such as a retaining flange 22 or any other type of anchoring device . the embodiment of the present invention as depicted in fig1 is preferably used when retaining walls are embedded into or positioned flush with a hill or other type of ridge thereby further sealing the one or more apertures . the retaining wall block 10 may be filled with a filling material from the back and then placed into position on the retaining wall . once in position on the retaining wall , the fill material utilized to secure and weight the retaining wall block is maintained within the chamber 26 by the cover or plug and further by the soil , sand , gravel , rock or similar material , which makes up the hill or ridge . an embodiment including multiple units ( not shown ) may also incorporate into the structure a back panel with an aperture . the presence of an aperture positioned in the back wall 50 may also allow for easy storage and transport due to the stackable capabilities present . for example , an individual block 10 may be inserted into the back of another block 10 , thereby creating a stackable arrangement . another embodiment of the present invention , as depicted in fig2 , illustrates a retaining block 10 wherein an aperture 18 may be sealed with a sealing device 60 , such as a cap or plug , after filling the block 10 with an appropriate fill material , such as a liquid . the sealing device 60 may be sealed in a variety of ways known in the art such as screw caps , snap caps , press fit caps , locking caps or any other similar sealing means . for example , the embodiment of fig2 may be filled with water and then sealed with a cap 60 thereby preventing loss of the fill material and providing the weight necessary to give the block 10 stability . in one embodiment , the block 10 may or may not include an expansion chamber 61 , which would allow for expansion of the liquid in situations such as freezing . embodiments of the expansion chamber 61 may include one or more flexible panels within the chamber or a flexible bladder inserted within the chamber . alternatively , the utilization of water or other liquids susceptible to freezing may include an adequate amount of antifreeze to prevent freezing of the fill material in cold climates . various embodiments of the present invention , such as those depicted in fig1 - 21 , also provide for ease in transport and storage due to stackable features . an additional example of a stackable retaining block 10 may be similar to that as shown in fig1 wherein the top panel 12 is removable and allows for the retaining block to be inserted within the chamber of another block . the top panel 12 for such a retaining block 10 may include a cover similar to the cover shown in fig9 . as previously mentioned , the present invention may be manufactured from a deterioration resistant , substantially rigid composite or polymeric material including , but not limited to , plastic , a rubber composition , fiberglass , or any other similar material or a combination thereof . preferable materials comprise light - weight and slightly flexible . generally , the embodiments of the present invention may comprise any type of material that would have the similar characteristics to plastic , vinyl , silicone , fiberglass , rubber or a combination of these materials . it is noted that the material utilized in the present invention should be rigid enough to hold its form upon addition of filling material and also when placed in contact with other objects . another preferable material may be comprised of a material similar to that utilized in the production of some types of garbage cans or the utilization of recycled rubber from objects such as tires . such materials would be capable of holding rigidity and still offer flexibility when placed in contact with other objects , such as ice . also , such materials have the ability to regain its original form when the object or material has been removed . embodiments of the present invention may also vary in appearance . since embodiments of the present invention may be manufactured by a process such as injection molding , the molds may include any type of design or shape . furthermore , the front panels of the retaining wall block 10 , as shown in fig4 and 6 a - b , could be molded in almost any type of configuration . in one embodiment , multiple retaining wall blocks could be molded to include designs that , when positioned on a retaining wall , would complete a larger single design , such as the spelling of a company or school name in large letters or the completion of a large image . also , since the present invention may be manufactured from a number of different products , such as plastic , a rubber composition or fiberglass , the retaining wall block may comprise any color or a multitude of colors . for example , a retaining wall installed in a beach setting may be manufactured of a plastic or rubber product and be colored in so that organic matter wash up on it would not show up as readily . as previously suggested the environment resistant retaining wall block is utilized in the construction of any type of wall or border . in application , a foundation is first created in the area that the wall or border is to be constructed . the foundation preferably is flat and or level and can accommodate one or more retaining blocks 10 . once a foundation is completed , a first row is laid by filling each individual retaining block 10 with a fill material and placing each individual or multi - unit block , side by side until the row is completed . the filling of the retaining wall block gives it the added weight that it needs to retain its structure and hold it in place . a funneling device may be utilized , which fits securely into the openings or apertures of the retaining wall block to guide fill into the chamber of the block . the first row may be straight or rounded . an example of a rounded first row is depicted in fig2 . upon completion of the first row , additional rows are constructed by performing the same filling process and placing the retaining wall block 10 in the proper position until a continuous retaining wall is completed . generally , a continuous retaining includes stacked rows wherein individual retaining blocks are placed adjacently to one another thereby eliminating or minimizing cracks or gaps in the wall . retaining wall blocks 10 may be positioned directly over other retaining wall blocks 10 in lower rows or may be staggered . it is noted that each retaining wall block placed in the retaining wall may be configured to retain and seal the contents of the fill material . this is accomplished by either one or more plugs or covers that seals each open aperture or by enclosing an open aperture with a portion of an adjacent block . furthermore , the retaining wall blocks 10 of the upper rows may overlap the back of retaining wall blocks 10 of lower rows if a retaining flange 24 is included on the block . in the alternative or additionally , each individual retaining block 10 may be locked into position with adjacent blocks if pegs 24 and apertures 18 or keys 36 and locks 38 are present on the retaining block 10 . upon completion of the top row of the retaining wall , a cover may be placed over the top row to close the apertures 18 of the top panels 12 or to provide a finishing border to the top of the retaining wall . embodiments of the present invention may also be used in conjunction with regular keystone bricks or stones . a retaining wall constructed in water or along a waterfront property may utilize the retaining wall block of the present invention at water level and below and then the regular keystone or retaining wall materials can be used on top of the retaining wall block of the present invention . the utilization of the retaining wall block of the present invention would be easy to match colors with the conventional retaining wall building materials because the materials utilized to manufacture the present invention can be colored and designed to match virtually any type of retaining wall construction material . furthermore , the retaining wall block may be manufactured in a multitude of different sizes , shapes and configurations . for example , an embankment or steep shoreline could support a retaining wall configured in a step like arrangement or design . such a structure , may be utilized as a retaining wall and / or a stairway down to the beach or to the water . while the invention has been illustrated and described in detail in the drawings and foregoing description , such an illustration and description is to be considered as exemplary and not restrictive in character , it being understood that only the preferred embodiments have been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected . | 4 |
fig1 shows a layout of solid - block interferometer 10 utilizing a continuous - wave light source 12 . laser 12 may be a nd : yag laser or an er 3 + : glass laser which emits beam 38 having a p polarization that enters prism 16 and impinges polarization beamsplitter coating 22 which is coated on the surface of block 14 . coating 22 reflects any laser light which has an s orientated linear polarization . laser 12 may be tilted so as to create a slight s oriented polarization in its beam so that a portion of beam 38 is reflected by coating 22 as beam 42 in an s - oriented polarization . coating 22 passes light having a p polarization and reflects light having an s polarization . the linear polarization of beam 38 may also be shifted or tilted by the use of a faraday rotator 40 so as to obtain beam 42 . the power of beam 42 is only about 0 . 2 % of the power of beam 38 . beam 42 constitutes the local oscillator for system 10 . the remainder of beam 38 having the p oriented polarization goes through coating 22 and impinges surface 20 which is a mirror having a reflectivity of nearly 100 %. beam 38 is reflected off surface 20 and goes on through coating 24 . coating 24 is an anti - reflective coating on certain surfaces of prisms 16 and 18 . beam 38 , still having a p - oriented polarization , passes through coating 22 and exits prism 18 to enter a beam expander 44 having concave lens 32 and convex lens 34 . beam 38 then passes through quarter - wave plate 36 . plate 36 converts the p - oriented linear polarization of beam 38 into beam 38 having a first circular polarization . beam 38 then impinges a target and is reflected back by the target as beam 46 having a second circular polarization . beam 46 passes through quarter - wave plate 36 which transforms the second circular polarization into an s - oriented linear polarization for beam 46 . beam 46 then passes through expander 44 and enters prism 18 and impinges polarization coating 22 which reflects s - oriented linearly polarized light of which beam 46 is . beam 46 , as a return beam , is reflected by surface 22 on through prism 18 and prism 16 . the common adjoining surfaces 48 of prisms 16 and 18 have an anti - reflective coating . beam 46 passes through surface 48 with very little loss . likewise , beam 42 is reflected by surface 48 with very large loss . however , a sufficient amount of beam 42 ( i . e ., approximately 1 %) is reflected to join in a common beam with beam 46 . the reason for the disparate treatment of beams 42 and 46 , respectively , is that beam 42 has a strong power origin and return signal 46 is a signal that is weak relative to beam 38 . the common beam of beams 42 and 46 passes through focus lens 28 and on to detector 30 . reflected beam 46 is affected in frequency by movement of the target which reflects doppler - shifted beam 46 . the combining of beam 46 with beam 42 results in an interference as indicated by detector 30 so as to provide information about the target , such as velocity . fig2 shows block 14 and prisms 16 and 18 with more detail . surface abcd has optical coating 20 which has a high reflectivity for p - oriented linearly polarized light under a 45 degree angle of incidence . surface eghj has a polarization beamsplitter coating 22 which for an angle of incidence of 45 degrees has a high transmission for linearly polarized light of a p orientation and a high reflection for linearly polarized light of an s orientation . these transmission and reflection ratios are in excess of 99 %. surface efhi of prism 16 has an anti - reflective coating 24 with a reflectivity of less than 0 . 2 %. surface ekhl of prism 16 has an anti - reflective coating having a reflectivity of less than 0 . 2 %. surface fkil of prism 16 has a reflective coating having a reflectivity of about 1 %. surface fgij of prism 18 has an anti - reflective coating 24 which has a reflectivity of less than 0 . 2 %. surface kglj of prism 18 has an anti - reflective coating which has a reflectivity of less than 0 . 2 %. surface fkil has a reflective coating which has a reflectivity of about 1 %. for the continuous - wave embodiment 10 , the dimensions of block 14 for lengths ab , cd , eg , hj are five centimeters . the dimensions of block 20 for lengths bg , dj , bd , gj , ae , ch , ac , and eh are 1 . 5 centimeters . the dimensions of prisms 16 and 18 for lengths fi , kl , eh , gj are 1 . 5 centimeters . dimensions of prisms 16 and 18 for lengths ef , fg , hi , and ij are 2 . 5 centimeters . fig3 shows a pulse - wave embodiment 50 of the present invention . such a system 50 may be used where high - powered pulses 76 are propagated toward a target 85 and scattered pulse return 77 is mixed against a continuous - wave local oscillator 60 . system 50 prevents high - powered pulses 76 that are being propagated toward target 85 , from falling on detector 30 and thereby avoiding saturation of detector 30 . beam 60 and beam 76 of embodiment 50 of fig3 described below and in fig4 are parallel to each other as they enter prism 16 . a distance 84 between beam 60 and beam 76 affects certain dimensions of block 14 and prisms 16 and 18 as described in fig2 . lengths ae , ch , bg and dg are increased by distance 84 multiplied by √ 2 / 2 . lengths ab , eg , cd and hg are increased by distance 84 multiplied by √ 2 . lengths ef , hi , gf and ji are each increased by distance 84 multiplied by √ 2 / 2 , lengths fk and il are increased appropriately to maintain prisms 16 and 18 and block 14 within the specifications as noted below . the parallelity of surface abcd to surface eghj of block 14 is equal to or less than 1 arc second . the relationship of surface efhi to surface fkil of prism 16 is 90 degrees +/- 1 arc second , the relationship of efhi to surface ekhl of prism 16 is 45 degrees +/- 1 arc second , the relationship of surface fkil to surface ekhl of prism 16 is 45 degrees +/- 1 arc second , the relationship of gfji to surface fkil of prism 18 is 90 degrees +/- 1 arc second , the relationship of surface fkil to surface kglj of prism 18 is 45 degrees +/- 1 arc second , the relationship of fgij to surface kglj of prism 18 is 45 degrees +/- 1 arc second . the surface flatness of all above mentioned surfaces is approximately 0 . 2g or 1 / 5 of the wave - length of the light transmitted or reflected . the scratch / dig ratio is 40 / 20 , injection laser 54 emits a beam 52 having a linear polarization of p orientation , beam 52 impinges glass slab 56 having a thickness from 3 / 8 to 1 / 2 inch . an anti - reflective coating 58 is on slab 56 . coating 58 reflects about 0 . 2 % of beam 52 as local oscillator beam 60 having a polarization of p orientation . beams 52 and 60 are continuous - wave laser beams . remaining beam 52 goes on through glass slab 56 and enters device 62 which is regarded as a unidirectional ring laser 62 . beam 52 enters q - switch 64 . pulse - wave beam 66 , having a linear polarization of p orientation , exits q - switch 64 and impinges and is reflected by mirror 68 which is situated on a piezoelectric support 70 which functions to move mirror 68 so as to tune ring laser 62 . beam 66 is reflected out to gain medium 72 . gain medium 72 is pumped and then exits a high power laser pulse beam 76 having a linear polarization of p orientation . gain medium 72 , piezoelectric movable mirror support 70 , q - switch 64 and detector 30 are connected to electronics 74 for appropriate implementation of unidirectional ring laser 62 . electronics 74 is illustrated in fig5 . beam 76 from gain medium 72 impinges mirror 78 and is reflected to glass slab 56 at the area where original beam 52 entered ring laser 62 . beam 76 passes through slab 56 and exits as a pulse beam which is parallel to and at a distance 84 from local oscillator beam 60 . beam 76 impinges and enters prism 16 , and exits prism 16 into block 14 . beam 76 is reflected by reflective surface 20 of block 14 , out of block 14 into and through prism 18 . from prism 18 , beam 76 goes through beam expander 44 to quarter wave length plate 36 . plate 36 converts the p - oriented linear polarization of beam 76 into beam 76 having a first circular polarization . beam 76 impinges a target 85 and is returned as beam 77 having a second circular polarization . returning beam 77 goes through quarter - wave length plate 36 and becomes beam 77 having an s - oriented linear polarization . beam 77 goes through beam expander 44 , enters prism 18 and impinges coating 22 . coating 22 is a polarization beam splitter coating which reflects light having an s - oriented linear polarization . thus , beam 77 is reflected and impinges boundary 80 of prisms 16 and 18 . boundary 80 has a polarization beam splitter film which reflects linearly polarized light having an s orientation . beam 77 is reflected by boundary 80 on through lens 28 and into detector 30 . beam 60 , as reflected by surface 58 of slab 56 , goes through faraday rotator 82 . faraday rotator 82 rotates beam 60 , which has a p orientation of linear polarization , just so slightly as to provide a beam 60 having a bit of s - orientation of linear polarization . beam 60 enters prism 16 and impinges coating 22 which reflects the s - oriented portion of polarized beam 60 back out of prism 16 , partially through boundary 80 which further diminishes the amplitude of beam 60 . beam 60 exits prism 18 , goes through lens 28 and enters detector 30 . detector 30 compares beams 60 and 77 , and determines the frequency difference between beams 60 and 77 , and indicates the velocity of the target impinged by beam 76 and reflecting beam 77 . embodiments 10 and 50 are merely among others that may implement the solid - block homodyne doppler interferometer . | 6 |
before explaining the disclosed embodiments of the present invention in detail it is to be understood that the invention is not limited in its application to the details of the particular arrangement shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . the following is a list of reference numerals used in the figures and throughout the description to identify elements of the present invention . the present invention provides devices , methods , systems and apparatus for a liquid lens with a variable focal length . fig1 a shows a pair of layers , the top layer 10 has a reservoir hole 11 there though and the bottom layer 12 has a lens through hole 11 . the material of the top and bottom layers 10 and 12 for the lens cell should be rigid , such as polycarbonate , glass , transparent crystal plate , rigid polymer , plastic , metal or other material that is obvious to those skilled in the art . in a preferred embodiment , the top layer 10 is a clear material while the bottom layer 12 is rigid it is not necessarily clear . the reservoir and lens holes 11 and 13 in the top and bottom layers 10 and 12 can be made by drilling , rubbing , patterning or other process that is commonly known to those skilled in the art . while the top and bottom layers are show as circular layer it is for illustration only , alternative geometric structure of the layers can be designed with disk - shape , square , rectangular or other special shape , depending on the applications . the reservoir hole 11 and lens hole 13 are sealed with an elastic membrane 13 and 14 as shown in fig1 b . in this example , the reservoir hole 11 is sealed on the outer surface of the top layer 10 with an elastic membrane 14 and the lens hole 13 in the bottom layer 12 is sealed with elastic membrane 15 on the outer top surface of the bottom layer 12 . in the embodiment shown , the elastic membranes 14 and 15 are attached to the surface of the top and bottom layers 10 and 12 . the elastic membrane is preferably a flexible , optically transparent , water impermeable material , such as saran ( polyvinylidene chloride resins or films ) rubber , polydimethyl - silioxane ( pdms ) membrane , or an elastic polymer . the elastic membrane may be adhered on the layers or may be wedged using a circular ring . in the preferred embodiment , the variable - focus liquid lens is fabricated with a fluid filled in the cell chamber 18 . a cell chamber 18 is formed between the top layer 10 and the bottom layer 12 as shown in fig1 c by leaving a thin gap between the top and bottom layers when adhering the periphery edges of the top and bottom layers 10 and 12 with an adhesive 16 material . in an embodiment , the size of the gap is controlled using polymer or glass strips when the periphery edge between the top and bottom layers 10 and 12 is sealed with the adhesive 16 . in a preferred embodiment , the adhesive used for sealing the various structures is preferably cyanoacrylate , commonly known as “ super glue ,” or alternatively an epoxy adhesive , or ultraviolet monomer can be substituted . an opening 17 is left in the adhesive 16 for injecting liquid into the cell chamber 18 formed by the gap . fig1 d is a side view of the variable - focus liquid lens structure of the cell with liquid filled in the cell chamber 18 . after the cell chamber 18 is filled with liquid , the opening 17 is sealed tightly with glue . the volume of liquid injected into the chamber 18 is controlled so that the top membrane 14 and bottom membrane 15 are flat . the liquid encapsulated in the cell chamber 18 is preferably colorless , but can also be tinted , depending on the application of the variable - focus lens . for example , when the intended application is for sunglasses , the fluid is preferably tinted . fluids having an appropriate index of refraction and viscosity suitable for use in the lens cell include but are not limited to liquids such as degassed water , mineral oil , glycerin and silicone products . in this example , the cell chamber 18 has two holes but the holes are not overlapped as shown in fig1 a through 1 d . as described above , the lens hole 13 is sealed on the inner surface of the bottom layer using clear elastic membrane 15 and the reservoir hole 11 is sealed with elastic membrane 14 on the outer surface of the top layer . the periphery of the cell chamber 18 , the space between the top and the bottom layer , is sealed to form the cell chamber which is filled with liquid prior to completing the seal to prevent liquid leakage . while materials useful in the fabrication of the liquid lens of the present invention have been described , alternative material may be substituted without deviating from the scope of the present invention since those skilled in the art could easily select alternative materials that perform the desired function . when the elastic membrane 14 covering the reservoir hole 11 is pressed inward as shown in fig2 , liquid in the cell chamber 18 is redistributed , forcing the elastic membrane 15 covering the lens hole 13 to inflate outward . in the example shown in fig2 , the focusing effect of the cell chamber 24 as the membrane 22 on the top layer 20 is depressed inward using a ball - headed lever 25 . the pressure propagates through liquid 24 and because the liquid 24 is not constringent , the pressure forces the distensible lower layer membrane 23 on the bottom layer 21 to swell outward . the extended membrane 23 acts as a spherical or aspherical profile , causing the outgoing light to focus . fig3 shows another kind of cell where the top layer 30 is clear with no any hole and the bottom layer 31 has two holes at the same side . the hole 32 is sealed by an elastic membrane 33 from outside . the hole 34 is adhered with an elastic membrane 35 from inside . pressing the elastic membrane 33 inward of the cell can result in liquid in the chamber 36 to be redistributed . thus , the elastic membrane 35 inflates outward . the tunable focus lens configuration shown in fig4 is similar to the configuration shown in fig1 d except the upper layer 40 has a convex lens 42 formed directly above the lens hole in the bottom substrate so that the center of the convex lens 42 is located at the center of lens hole 41 . similarly , the configuration shown in fig5 is similar to fig4 except the top layer 50 has a concave lens 52 centered directly above the center of lens hole 51 . fig6 shows yet another example of a variable - focus lens cell structure . in this example , the top layer 60 has two separated reservoir holes 62 and 64 and the bottom layer 61 has one lens hole 63 . the left reservoir hole 63 and bottom lens holes 64 overlap and are sealed with elastic membrane respectively on the inside surface of the top layer and inside surface of the bottom layer . alternatively , the holes can be sealed on the outer surface of the top and bottom layers . the hole 63 and the hole 64 should have the same aperture . the other reservoir hole 62 in the top layer 60 is sealed with an elastic membrane on the outer surface of the top layer . fig7 a shows the single layer 70 that has an array of holes 71 . fig7 b shows the side view of a variable - focus cell structure with the layer 70 shown in fig7 a as the bottom layer 70 forming a cell chamber 75 between the top layer 72 and bottom layer 70 . the array of lens holes 71 in the bottom layer are sealed with an elastic membrane 73 adhered to the inner surface of the bottom substrate adjacent to the liquid in the cell chamber 75 . the single reservoir hole in the top substrate is sealed using an elastic membrane 74 on the outer surface of the top layer 72 . as previously described , a liquid 75 is sealed in the cell chamber of the lens . fig8 a shows an experimentally demonstrated image in the non - focusing state of the lens structure shown in fig1 d , the incoming light is an ambient white light . fig8 b shows an experimentally demonstrated image in the focusing state of the lens structure shown in fig2 , as with the previous example , the incoming light is an ambient white light . in comparison with the image shown in fig8 a , the image in fig8 b is enlarged significantly . the variable - focus lens according to the present invention is polarization independent and has a resolution of approximately 30 line pairs per millimeter . an experimentally measured response time during focus change is shown in the graph of fig9 . response time is an important parameter for active imaging devices because it determines the data acquisition rate . the response time of a variable - focus liquid lens according to the present invention was measured by probing the lens activation using a he — ne laser beam . initially the lens has no focus , so the received beam intensity is weak . when the pdms membrane is deformed to form a convex shape , the beam is converged increasing the light received by the photo - detector . as a result , a transmission peak is obtained . the rise time of the transmission depends on the impulse of the pressure . when the pressure is removed , the lens returns to its original state . as shown in fig9 , the lens recovery time is approximately 30 ms in this example . the lens response time is affected by the following factors : viscosity of the filled liquid , lens aperture , pdms thickness , and the cell gap of the cell chamber . selecting the appropriate liquid having a high index and low viscosity and by reducing the cell gap , the response time of the liquid lens is improved to achieve video rate response time for real time active imaging applications . according to the above device structure and the device performance , the present invention provides a unique and simple method for changing the curvature of the liquid - filled lens to vary its focal length . the size of the reservoir and lens holes can varied so that the aperture of the liquid lens can be made in the millimeter to centimeter range . a single lens or lens array can be fabricated easily . the invented self - contained liquid lens exhibit following attractive features : polarization independence , large focusing power and wide focus - tuning range , high resolution , broad spectral bandwidth , fast response time , and simple fabrication process which leads to low cost . while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended . | 6 |
referring to fig1 a preferred embodiment of the stuck point detection apparatus according to the present invention comprises a downhole apparatus 10 suspended in a drill string 11 at the end of a cable 12 . the drill pipes 11 placed in a borehole 13 are stuck by the earth formations at a point 14 whose depth is to be determined . the drill pipes are suspended at the surface in a known manner from a derrick ( not shown ) equipped with mechanisms making it possible to apply tensional and torsional forces to these drill pipes . the cable 12 has one or more electrical conductors connected to surface equipment 15 . this equipment is adapted to send the downhole apparatus an electric power supply current and electric control signals and to receive , process , display , and record signals coming from the apparatus . the downhole apparatus 10 comprises in general an electronic section 20 ( usually a sealed casing containing electronic circuits ) and a mechanical section 21 . at the bottom of the mechanical section is a support 22 for receiving an explosive , such as several lengths of detonating cord designed to be ignited at the level of selected joint of the drill pipes . the resulting explosion helps unscrew all the drill pipes above the selected joint during a &# 34 ; back - off &# 34 ; operation , as is well known by those skilled in the art . the mechanical section 21 includes a body made up of two parts 23 and 24 rotatably and slidably mounted for limited longitudinal and angular movements with respect to each other . the upper and lower parts are equipped with several anchoring arms 25 and 26 , respectively . the anchoring arms are hinged on the body and can be extended under control from the surface to anchor the apparatus inside the drill pipes . the mechanical section is shown in greater detail in fig2 a and 2b . the sealed casing 30 of the electronic section 20 is fixed by a threaded bushing 31 at the body upper part 23 . the electrical connections between the electronic and mechanical sections are provided by plug - in connectors 32 which go in a sealed and insulated manner through head 33 fixed in the body upper part 23 . inside the upper part 23 is a first chamber 35 under head 33 . chamber 35 is filled with a hydraulic fluid kept substantially at the pressure of the borehole , as further described below . at the bottom of the chamber 35 is a bore 36 in which an actuating rod 37 equipped with an o - ring 38 is slidably mounted and sealed . the body part 23 has recesses 40 for receiving three anchoring arms 25 mounted rotably around pivots 41 . a pin 42 , which fits into a transverse groove of the actuating rod 37 , is mounted rotatably on each anchoring arm 25 so that longitudinal movement of this rod makes the arms rotate around their respective pivots 41 . the bottom of actuating rod 37 goes through a longitudinal bore 43 in the body part 23 . with an o - ring 44 on rod 37 providing sealing at this region , the rod 37 then continues into a second chamber 45 which communicates with the first chamber 35 via a longitudinal passage 46 in the axis of the rod 37 . the second chamber 45 contains a case 47 which holds driving elements for moving the actuating rod 37 longitudinally . at the bottom of case 47 is an assembly 50 made up of an alternating - current motor and a reducer . the output shaft of the reducer is connected by an oldham coupling 51 to a ball thrust bearing 52 and then to a ball screw 53 . the nut element of the ball screw 53 is fixed to the enlarged lower end of the actuating rod 37 . when current is supplied to the motor 50 , the reducer output shaft rotates , driving the ball screw 53 which moves the actuating rod 37 longitudinally . the motor , under control from the surface , can rotate in either direction for opening or closing the anchoring arms 25 . chamber 45 communicates with the inside of the case via a passage 54 so that the free spaces will be occupied by hydraulic fluid which bathes the motor 50 , the thrust bearing 52 , and the ball screw 53 . passages are provided between the case 47 and the body to conduct the wiring of the electrical conductors from the connectors 32 to the bottom of the chamber 45 . at the bottom of chamber 45 , the body thus includes an axial tube 54 whose interior communicates with chamber 45 . at its periphery , the body also has a cylindrical wall 55 around the tube 54 , thereby defining an annular chamber 56 in which slides a pressure - equalizing floating piston 57 . over the floating piston 57 , the annular chamber 45 , filled with hydraulic fluid , communicates with the interior of the tube 54 through a passage 60 . the lower face of piston 57 is in contact with the borehole fluids through a passage 61 . sealing between the piston and the tube 54 is provided by a seal 62 , and between the piston and the cylindrical wall 55 by a seal 63 . the body upper part 23 extends downward below the annular chamber 56 on a mandrel 65 which extends into the body lower part 24 . a seal 66 provides sealing between part 24 and an annular end 67 of the upper part 23 . the body lower part 24 can move away and rotate in relation to the shoulder 59 which terminates the annular end 67 . the mandrel 65 has an axial channel 68 which , connecting through the interior of tube 54 , places chamber 45 in communication with another chamber 69 located in the body lower part 24 . channel 68 also serves as a passage for the electrical conductors . in the body lower part 24 , and surrounding mandrel 65 , is a sleeve 70 which is movably mounted between an upper position uncoupled from the upper part 23 ( fig2 b ) and a lower position uncoupled from the lower part 24 ( fig4 ). a disconnectable link 70 , 72 , and 73 connects the sleeve 70 , in the lower position , to the body upper part 23 . ( the cross - section lines 3 -- 3 and 2b -- 2b in fig2 b and 3 , respectively , are taken through this link .) screws 71 fix diametrically opposite lugs 72 on the mandrel 65 , the lugs having two sides parallel to the longitudinal direction and an upper edge in the form of an inverted v . oppositely placed windows 73 having oblique ramps at their upper parts are cut in the sleeve 70 . the lugs 72 , positioned in the windows 73 , are dimensioned to allow longitudinally and angularly limited movements of the mandrel 65 with respect to the sleeve 70 when the sleeve is in the upper position . the upward movement of the sleeve 70 is limited by its abutment with a shoulder 75 of the body lower part 24 . the upper edges of the lugs 72 and of the windows 73 form ramps which both immobilize the sleeve 70 when it is moved downwardly and reposition it to a first position corresponding angularly to the zero of the angular detection means . the sleeve 70 has an upper part of smaller diameter ( fig4 ) around which is placed a helical spring 74 mounted in compression between the sleeve 70 and the shoulder 75 on the body lower part 24 . as indicated above , when the windows 73 come up against the top of the lugs 72 ( fig4 ), the sleeve 70 is zeroed and coupled , in the lower position , to the mandrel 65 , and the spring 74 applies a biasing return force to the two parts 23 and 24 of the body which loads them toward each other . this force is sufficient to keep the two parts of the body in the retracted position ( fig4 ) when the apparatus is suspended by the cable 12 during raising and lowering within the borehole . according to the present invention , the apparatus also includes means for detecting longitudinal and angular movements between the sleeve and the mandrel . these detection means , described in detail in the above - mentioned &# 39 ; 218 u . s . patent application , comprise two differential transformers . a first axial - coil transformer has a primary 80 fixed to tha mandrel , and a secondary , made up of two coils 81 and 82 , fixed to the sleeve . this first transformer detects longitudinal movements between the parts of the body but is insensitive to angular movements . a second radial - coil transformer , having a primary 83 fixed to the mandrel and a secondary , made up of two coils 84 and 85 fixed to the sleeve , detects angular movements but is insensitive to longitudinal movements between the parts of the body . at the zero of the longitudinal detection means , the primary 80 of the firsti transformer is centered between the two coils 81 and 82 of the secondary ( fig2 b ). at the zero of the angular detection means , the primary 83 of the second transformer has its axis perpendicular to that of the coils 84 and 85 of the secondary . the sleeve and the mandrel are placed in this initial position prior to the measurement by the interaction of the lugs 72 and the windows 73 . a case 86 containing driving elements is mounted slidably in the body lower part 24 under the sleeve 70 . the interior of the case communicates with chamber 69 via a passage 88 . an assembly 87 consisting of an alternating - current electric motor and a reducer is fixed in case 86 . the reducer output shaft 90 , mounted rotatably in the case through a ball thrust bearing 91 , is connected to the threaded shaft of a ball screw 92 . the nut element of the ball screw 92 is fixed to an actuating rod 93 which comes out of the case 86 and goes through a transverse partition 94 of the body , downwardly closing off chamber 69 which is filled with hydraulic fluid . sealing between the actuating rod 93 and the transverse partition 94 is provided by a seal 95 . underneath the transverse partition 94 , the body has recesses 96 for three anchoring arms 26 which are articulated on pivots 97 . beneath the recesses 96 , the actuating rod 93 passes through a bore 100 in the axis of the body and into a chamber 101 . a seal 102 provides sealing in this region between the rod 93 and the body . between the seals 95 and 102 , the actuating rod has a triangular cross section with three transverse grooves 103 . on each anchoring arm 26 a pin 104 is rotatably mounted , each pin having a projecting rib which engages in one of the grooves 103 . the motor - reducer assembly 87 can be supplied with electric current for moving the actuating rod 93 longitudinally either downwardly or upwardly in relation to the case 86 . a longitudinal channel 105 cut in the actuating rod 93 provides communication between the chamber 69 and the chamber 101 . an electrical conductor placed in the channel 105 is connected to an insulated and sealed connector 106 mounted at the bottom of the body lower part 24 . screws 107 fix the upper part 108 of the explosive support 22 on this end of body part 24 . an electric detonator ( not shown ) for firing the explosive is connected to the connector 106 . to carry out a stuck point measurement , the downhole apparatus 10 is first connected to the cable 12 for lowering into the drill pipes 11 . the upper and lower anchoring arms 25 and 26 respectively are closed and the different elements contained in the lower part of the body are in the position shown in fig 4 . in particular , the case 86 is in the lower abutting position against the transverse partition 94 . the actuating rod 93 , in the upper position in the case 86 , keeps the lower anchoring arms 26 closed . the sleeve 70 , driven back by the spring 74 , is in the lower position , immobilized by the lugs 72 which are driven against the upper part of the windows 73 . the angular movement detector ( coils 83 , 84 and 85 ) is thus placed in its zero angular position . also , spring 74 applies an upward return force to the lower part of the body to keep the two parts 23 and 24 in the retracted position . apparatus 10 is then lowered into the borehole to a first depth where it is desired to determine whether the rods are free . at this depth , motor 50 ( fig2 a ) is supplied with current to extend the upper anchoring arms 25 . after anchoring the body upper part 23 , and after having released the tension from the cable 12 , motor 87 is supplied with current . the lower anchoring arms then extend away from the body until they are in contact with the internal wall of the drill pipes 11 . case 86 rises slightly in the lower part of the body until it comes up against the bottom of the sleeve 70 . at this point , the lateral application force of the anchoring arms 26 is determined by the longitudinal biasing or return force of the spring 74 transmitted via the sleeve 70 and the case 86 to the actuating rod 93 . the anchoring arms 26 , having reached their maximum extension in the drill pipes , stop the downward movement of the actuating rod 93 in relation to the lower part 24 of the body . when the motor continues to rotate , the case 86 moves upward , driving the sleeve 70 , which compresses spring 74 . this movement continues until the upper end of sleeve 70 comes up against shoulder 75 . sleeve 70 is then blocked in the upper position in the lower part 24 of the body . during this movement , the oblique contact surfaces of the windows and of the lugs move away from each other , thereby disconnecting or uncoupling the link between the sleeve 70 and the mandrel 65 . sleeve 70 , blocked at this point in the lower part 24 of the body , is free for limited movement angularly toward the right or the left and longitudinally in extension , relative to mandrel 65 . this upper position of the sleeve , for which the angular and longitudinal detection means are substantially at zero , is shown in fig2 b . the apparatus is then ready to carry out a measurement , i . e . to detect movements between the parts of the body when tensile and torsional stresses are applied to the drill pipes from the surface . after such a measurement , the motors 87 and 50 are supplied with current to close the lower and upper anchoring arms . it is then possible to move the downhole apparatus by means of the cable 12 to carry out other measurements at different depths . during the movements of the apparatus in the borehole ( fig4 ), sleeve 70 is kept on the mandrel 65 in the lower position in which the angular movement detector is substantially at zero . however , in this position of the sleeve , the longitudinal movement detector indicates a maximum elongation , coil 80 being offset upwardly by a distance d in relation to the midpoint of the coils 81 and 82 . after anchoring the two parts of the body , sleeve 70 is brought to its upper position relative to mandrel 65 , which position is not changed angularly in relation to the preceding lower position . for this upper position of sleeve 70 , the longitudinal movement detector is substantially at zero , and sleeve 70 , while still connected to the lower part of the body , is disconnected from the upper part . thus , any biasing return force tending to oppose longitudinal or angular movements between the upper and lower parts of the body is eliminated during the measurement . moreover , the indications given by the longitudinal movement detector during the anchoring of the apparatus make it possible to verify proper operation from the surface . when the detector indicates that the two body parts have moved toward each other from a value d to a substantially zero value , the operator knows that the sleeve 70 has moved correctly in the lower part of the body from its lower position to its upper position . information is thus provided on the proper operation of the automatic resetting system of the apparatus . the apparatus just described can of course form the subject of many variants without departing from the framework of the invention . in particular , the detection means can be made in a form different from the electromagnetic transducer described hereinabove . | 4 |
in the following description , numerous specific details are set forth in order to provide a more thorough description of the present invention . it will be apparent , however , to one skilled in the art , that the present invention may be practiced without these specific details . in other instances , well - known features have not been described in detail so as not to obscure the invention . due to the growth of the information technology ( it ) infrastructure and general decrease in costs and sizes of gps device components , there has been a growing demand for gps implementation within portable assets , such as portable computing devices . as individuals and enterprises expand the use of portable computing devices such as with laptop , tablet , and handheld computers ( e . g ., smartphones ), there has been an increasing recognition of the vulnerability such devices have for theft or loss and the corresponding increase in economic value and corresponding loss when theft or loss occurs . for example , of the more than 10 , 000 laptops that go missing every month at chicago o &# 39 ; hare airport , approximately only 22 % are ever recovered . a problem in the prior art has been an inability to configure and fabricate gps devices that were compact enough to conveniently install on portable computing devices . a further problem is the inability to configure an embedded antennae configuration with such a compact gps device that will reliably transmit such signals usable by a gps tracking network for device recovery in the event of theft or loss . a still further problem has been a lack of means to configure such gps devices for simple , rapid and covert installation into existing portable computing devices that will be both efficacious yet difficult to detect and disable by thieves . a still further problem in the prior art is the lack of an enabling system to instruct the installed gps device in a portable computing device to instruct the computing device to transmit , alter or destroy stored data files to prevent economic loss or breach of privacy rights . a still further problem is the lack of a suitable business method and process to price , acquire and install such gps devices , concurrent with a method to price and provide a risk management financial instrument to compensate a purchaser for potential the risk of toss and impairments occasioned by the irrecoverable or partial recovery of portable computing devices and data therein installed . currently , gps is a fast - growing field . for instance , cell phones currently have the ability to have gps on them , as do automobiles , thereby giving gps products off - the - shelf availability . however , in the present invention , the device &# 39 ; s solutions and implementation , and the size of the unit make it unique . in addition , the present invention includes a novel , computationally based recovery replacement program that utilizes a generated insurance service to mitigate the risks and costs associated with theft and loss of portable computing devices . therefore , a first object of the present invention is to disclose a novel and useful gps device and antennae system that may be covertly and efficiently installed into a portable computing device through the memory slots on the motherboard . a second further object of the invention is to disclose a novel means to employ specific software ( referred to herein as “ silver bullet software ”) in the gps device that may independently instruct the portable computing device to transmit , alter or destroy data files in the portable computing device to prevent loss of economic value or personal privacy through the unique coding of the silver bullet software application . a third further object of the present invention is to disclose a novel computerized and enabled method to acquire and install such a gps device and software and to provide a computer generated insurance product to compensate for accidental loss or theft of such portable computing devices . the present invention is embedded into the portable computing device via au open card slot on the motherboard of said portable computing device , which is respectively illustrated in the diagrams of fig1 a , 1b , and 1c . in a preferred embodiment , the device is always powered on , even when the portable computing device is not plugged in . the power drain is minimal due to the fact the device is in “ sleep mode ” and allows for a sms message to be sent to the device on demand and therefore locating the portable computing device with accuracy within 5 meters . unlike prior art products that are required to be connected to the internet , the present invention can be located on demand regardless of whether or not the portable computing device is plugged in or connected to the internet . a sms text message is sent to the device and it responds with longitude / latitude parameters of its locations . these parameters are entered into a mapping software system and locate the device and display its location on a map of the area within 5 meters of accuracy . in contrast , prior art devices are typically embedded into the systems bios and can only be located from internet “ hotspots ” such as starbucks coffee , bookstores and other wired locations , etc . this means the portable computing device can only be located from an internet connection in which it is connected therefore no on demand capability exist with the prior art products and , therefore , are less accurate . the present invention incorporates other novel features as well . for example , if desired by the owner , a transmitted message to the silver bullet software can be sent to and through the present invention to destroy the data contained on the hard drive rendering the portable computing device useless . the silver bullet software function will issue a command to the present invention that will activate a binary overwrite command that will fill the entire hard drive with 1 &# 39 ; s and 0 &# 39 ; s rendering the portable computing device useless and even unable to boot up since the operating system will also be overwritten . prior art products do not offer or anticipate this capability . furthermore , in the unlikely event the portable computing device is not recovered within a definite time ( e . g ., 15 calendar days ), the risk management process of the present invention will electronically commence an order , payment and shipment process to replace the portable computing device with a comparable product of like , kind and quality or better . additionally the risk management process can also electronically provide compensation to the owner for the lost economic value of the data files stored on the unrecovered portable computing device . it will be obvious to one skilled in the art that the invention may take numerous forms of device and system configurations that will accommodate a diversity of covert gps tracking devices , portable computing devices , and electronically implemented , software - based insurance and purchase business systems . what follows is a preferred embodiment of the useful novelties of the present invention . however , for one skilled in the art it will be obvious that the novel features disclosed herein may be employed with equal utility to alternate configurations of the invention elements . the disclosed invention is the gps personal tracking and recovery device used inside of laptops and other types of portable computing devices . in a preferred embodiment with this type of system , a battery or power source is required . if the device is charged using its internal battery it typically has four hours of run time and three days of standby time . however , if the invention device is charged using the laptop power source in which the invention device was installed , that device can operate efficiently using inside power as long as that power is available . in some cases , people will disconnect the power and / or repackage . however , when it becomes time to re - engage power , the invention device will begin transmitting again and has been set on a protocol that allows the user to continue to transmit immediately . if somebody attempts to change the exterior of the portable computing device , the invention &# 39 ; s embedded chip will still react . referring now to fig1 a , the exemplary invention is shown in frontal plane view . at 100 the flexible antenna for gms transmission is displayed . at 102 , a gps antenna is displayed . a telephone modern 104 provides for reception and transmission of software enabled data and instructions between the invention device and a remote invention user . a gps transmitter 106 enables the invention device to transmit and obtain location signals from a gps / gsm array . a simm card housing and apparatus 108 together with the modem 104 , antennae 102 , 100 and the gps transmitter 106 are affixed and communicate with a circuit board 110 . in the present embodiment , the circuit board 100 is in signal communication with the computing element of portable computing device through a connector rail 112 , the circuit board 110 has an electric power connection with the portable computing device at 114 . referring now to fig1 b is a back plane “ through view ” of the exemplary invention which was previously referenced in fig1 a . the invention illustrated in fig1 b maintains the same orientation as fig1 a and the observer views the back plane view through the front plane orientation . the conspicuous feature of fig1 b is a rechargeable battery element 118 , affixed to the circuit board 110 , which communicates with external recharging power through the battery recharge port at 114 . referring now to fig1 c is an alternative side view of the invention device illustrating an alternative positioning of some of the invention device elements . more specifically , the circuit board 110 is shown housing various communication circuit elements 120 within the circuit board 110 itself . the flexible antenna 100 is mechanically affixed to the rechargeable battery 118 . the connector rail 112 and battery recharge port elements are deliberately omitted in the plane view to highlight other invention elements . however , for one skilled in the art such alternate assemblies are well understood and frequently used to minimize overall device size and / or connection compatibility to the portable computing device . further , flexibility in the invention device element assembly lends itself to covert design in either imitation of other circuit elements or compact size . either option is novel and useful in preventing invention device tampering or detection . for this exemplary application , the invention tracking device will be used inside of a laptop computing device , deriving its power source directly from said computer &# 39 ; s battery source as shown at 114 in fig1 a and 1b respectively . the invention device allows the laptop owner to use either a desktop computer , a third party tracking service and / or a cellular phone for immediate tracking capability . additionally , once the invention device registers the laptop as missing , an owner has the ability to initiate regular monitoring whereby , for example , the installed device can transmit a location , based upon plain sight , every two minutes up to every 24 hours . this invention &# 39 ; s tracking device is useful because of the fact that there is a high theft and low recovery rate of laptops , an additional novel benefit is that this invention device can be used in almost any type of device which utilizes an ac / dc power source to and which can be converted to the 12 - volt standard typically required , the usefulness of this device is self - evident with the ability to recover misplaced or stolen products through the ability to have immediate real - time access based upon gps satellite transmission . fig2 is a block diagram indicating an exemplary software enabled process utilizing the tracking device . such a process starts 200 with physical installation of the device at a step 205 , referenced in fig1 a - c . concurrently at step 205 , the software components are installed in the invention device and a covert tracker device 225 such as a desktop computer , cellular phone or a telecommunications service provider system . the enabled covert tracking device system remains dormant at a step 210 until activation by a transmitted request from the owner or authorized user to an operational covert tracker device . an activation of the installed device at a step 215 results in a query at a decision step 220 on whether to activate the tracking program routine . a “ no ” response at decision step 220 returns the installed device to a dormant mode at step 210 . a “ yes ” at decision step 220 requires manual activation of the software elements to activate tracking operations at a step 225 through transmission and detection of gps location coordinates at a step 230 . upon activation , the owner or authorized user is queried as to whether to commence data file management via the installed tracker device at a decision step 235 . a “ no ” at decision step 235 returns either to the decision step 220 tracker query option or to automated tracking at step 225 that continues periodic detection and transmission of gps location coordinates . a “ yes ” at decision step 235 is indicative of a threat that data on the portable computing device is at risk of unauthorized use or unacceptable loss . a “ yes ” at decision step 235 thus queries the owner or authorized user to encrypt or destroy portable computing device data files at a decision step 240 . if the “ destroy ” option is authorized , the invention initiates its silver bullet software routine to overwrite and destroy portable computing device data files . it will be obvious to one skilled in the art that the silver bullet software may also be used to uninstall or disable stored software programs , protocols or operating systems deemed proprietary and a cause of economic loss in the event of loss or imminent unauthorized use of the portable computing device . if the encrypt option is selected at decision step 240 then the owner / authorized user is queried whether to transmit such data files at a decision step 245 . if a “ yes ” occurs at decision step 245 then the installed tracking device uploads and sends such files to the activation location at a step 250 . if an owner successfully recovers the portable computing device at a decision step 260 , the tracking routine ends and the system is returned to its initial settings of the dormant state at step 210 . if the laptop or data are not recovered within a definite time at decision step 260 , the owner then electronically files an insurance claim at a step 265 , which makes compensation to the owner for loss . upon replacement of the lost hardware , the user process returns to step 205 for installation and protection of the replacement device . referring now to fig3 , a preferred embodiment of the method of the present invention is shown . a laptop computer owner 360 who will own or owns a portable laptop 330 will procure the covert gps device 320 in connection with a purchase agreement that incorporates an insurance policy related to a future event involving theft or loss of laptop 330 . the policy will be produced using a novels series of software algorithms that utilize , without limitation , a plurality of data inputs ; the cost of gps in device 320 , the cost of installation of gps device , the cost of monitoring service 340 , the cost of communications from monitoring service to gps satellite array 310 , the cost of communication of the ups satellite with covert gps device 320 , a future time based value of information and data maintained or to be maintained on laptop 330 for which owner 360 will be compensated in the event of theft or loss of laptop . the payments is made by laptop owner 360 to insurer 350 may be a lump sum or a series of fixed or variable payments . the covert gps device 320 will be installed by a certified contractor and will place the covert device into laptop 330 in a manner that makes it difficult to recognize the covert device as other than the normal hardware of laptop . the contractor will also connect the covert device power receptacle to the power system of laptop 330 . the contactor will enable an anti tampering feature of covert gps device 320 to trigger an alarm or automatic transmission signal as part of the security protection features of the invention . the covert gps device 320 will be electronically enabled using embedded software algorithms that may also be encrypted to provide security to the owner 360 and an identifier code for monitoring service 340 and gps satellite array 310 . in the event of a theft or loss of laptop 330 , owner 360 will communicate the event to insurer 350 . insurer 350 will communicate with service 340 to initiate a tracking algorithm to locate laptop 330 . alternately , the owner 360 call report will be automatically forwarded to monitoring service 340 . gps device 320 will receive an enabling transmission from gps satellite 310 and commence periodic gps location emissions using power derived from laptop 330 power source . in a further variation of the invention , the monitoring service 340 will manually or automatically transmit to the gps satellite array 310 an authorization for covert device 320 to initiate a wireless data transmission of files stored on laptop 330 to secure files managed by the monitoring service 340 . these files will be forwarded under secure transmission or recorded on to a suitable data storage medium for physical delivery of such data files stored on laptop 330 to owner 360 . in a still further variation of the invention the instructions regarding data stored on laptop 330 may instruct the laptop to alter or eradicate such stored files . in summary and without limitation , the invention is comprised of the following elements : a first element consisting of fabricating an installed covert tracking device further comprised of circuit , electronic and power elements as shown in fig1 a , 1b , and 1c that is compatible with the portable computing device into which it is installed ; a second element where said covert tracking device is acquired in conjunction with a software generated insurance policy and tracking system to mitigate the risk of loss of a portable computing device into which said covert tracking device is installed ; a third element of installing the covert tracking device covertly inside the portable computing device and further attaching it to the power source and / or battery of said portable computing device where said tracking device itself does not rely on any functions from the portable computing device and is stand - alone other than the power source ; a fourth element where , once the tracking device is installed in the portable computing device , and in the event for whatever reason the portable computing device is misplaced and or stolen , an owner of the lost portable computing device will have the ability to telecommunicate to activate a recovery protocol utilizing the tracking features of the covert tracking device ; a fifth element where recovery of all portable computing devices using this tracking device invention is based upon real - time gps locations and , in the event recovery is not immediate , the tracking device itself receives a communication that allows the tracking device to power on and regularly source and transmit gps location data until actual recovery or determination of an unrecoverable loss of said portable computing device . a sixth element where a portable computing device being misplaced or stolen , a certain minimum time must lapse ( e . g ., 5 days ) before it is deemed unrecoverable . if the portable computing device is not recovered within the lapsed period , a risk management underwriter will be obligated , through said insurance policy , to replace the unrecovered portable computing device together with a compensable sum for the economic loss of proprietary data files . it will be obvious to one skilled in the art that this invention device , method and process apply to numerous other types of portable computing devices . the immediate invention opportunity appears to be with laptops , as there is apparently a unique and unmet need to mitigate sensitive and valuable data storage and restriction issues in the event of loss or theft of the portable computing device . while various embodiments of the invention have been described , it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible that are within the scope of this invention . in addition , the various features , elements , and embodiments described herein may be claimed or combined in any combination or arrangement . | 6 |
in general , the present invention provides a method and system for protecting publicly accessible network computer services from undesirable network traffic in real - time and is useful within a larger system which combats denial of service attacks without requiring any changes to the existing internet routing infrastructure . this larger system , in general , combines network topology information and coarse - grained traffic statistics from routers to detect , backtrack , and filter distributed attacks on enterprise networks and websites . this larger system exploits information from routers without requiring any changes to the existing internet routing infrastructure . the larger system as well as the present invention works with the existing routing infrastructure deployed at internet service providers , application service providers , and enterprise networks . the method and system is enabled by functionality that the major routing vendors have put into their latest products . the larger system includes a number of complementary components as follows : a set of data mining and network profiling techniques that are used to define “ normal ” traffic patterns and set dynamic thresholds that are continually monitored for early detection and notification . a new process for real - time monitoring , detection , and notification of denial of service attacks and network anomalies . continuous or periodic sampling is employed for collecting network statistics and extracting network topology information from routers . a new protocol for correlating anomalous distributed events that enables tracking a denial of service attack back to its source . a unique solution for protecting and minimizing the impact of denial of service attacks on websites and web hosting services . this solution is based on the unique protocol scrubber technology . in general , the method and system of the invention use internet routing data in conjunction with passive traffic data to identify application - level denial of service attacks . an example includes a client fetching pages from an http server for the sole purpose of utilizing the server &# 39 ; s inbound or outbound bandwidth . another example is a malicious client setting up streaming media connections for the purpose of exhausting a server &# 39 ; s connections and bandwidth . in the invention , a server &# 39 ; s request stream — such as a web server &# 39 ; s web logs — are monitored to build a profile of requests from a topologically clustered set of machines in the internet . these clusters are identified by their administrative domain . these administrative domains are inferred by examining the internet &# 39 ; s bgp routing tables from several points in the internet . by generating the server &# 39 ; s request profiles for sets of clusters in the internet , malicious hosts that are launching application - level denial of service attacks can be detected . while this clustering technique has been used in the past for identifying appropriate web caches for minimizing web fetch latency , they have not been applied to detecting denial of service attacks . once these malicious hosts are identified , their requests can be filtered either at the server or upstream in the network . a denial of service scrubber ( dos scrubber ) is an actively interposed network element or system that removes denial of service attacks from legitimate network traffic in real - time . the denial of service scrubber removes a new type of denial of service traffic from publicly accessible internet services . in particular , the dos scrubber removes denial of service attacks on publicly accessible internet service . moreover , it uses data mining techniques to remove a class of previously unidentifiable denial of service attacks . this new class of attacks appear to the service as legitimate service requests ; however , these requests are generated by a malicious agent with the sole purpose of denying resources to servicing legitimate requests . [ 0083 ] fig1 shows an example use of the dos scrubber . it depicts a network server providing a publicly accessible service — a public web server for example . the dos scrubber is interposed between the server and the internet . as such , it sees all the traffic that passes between the server and its remote clients . as a public server , both legitimate and malicious users gave equal access to its resources . however , by analyzing the service request distributions and packet statistics , the dos scrubber can identify malicious users of the service and either filter completely or throttle back their access . protecting web ( hypertext transfer protocol , or http ) services is one specific application of the dos scrubber . when scrubbing http traffic , the dos scrubber separates legitimate from malicious web requests . the scrubber leverages the fact that http is layered on top of the tcp transport protocol . because tcp sessions cannot be spoofed — that is the source address cannot be forged , due to shared random initial sequence numbers — the client - end of service requests are clearly and uniquely identified . by pairing a client &# 39 ; s unique identity — its ip source address — with its connection statistics and request distribution , a profile can be constructed through data mining . this profile can be compared to the normal profile that is obtained through data mining techniques by the scrubber during a training session . this training can also be updated on - line as the system runs . clients with profiles that are flagged as anomalous are then candidates for their subsequent requests to be attenuated or completely filtered . [ 0085 ] fig2 denotes the denial of service scrubber &# 39 ; s high - level architecture . it is comprised of two primary components : the forwarding and the analysis engines . the forwarding engine ( fe ) has two main responsibilities : applying filtering and rate limiting to sets of internet hosts , and generating request statistics . the analysis engine ( ae ) is responsible for the collection and subsequent data mining of the forwarding engine &# 39 ; s statistics . upon detection of malicious hosts , appropriate actions are fed back from the analysis engine to the forwarding engine for filtering or rate limiting the host &# 39 ; s requests . the dos scrubber &# 39 ; s forwarding engine serves both as an enforcement mechanism and statistics generator . when internet protocol ( ip ) packets enter the scrubber , they are given to the forwarding engine . upon receipt , the fe determines if the packets belong to an old request , or are part of a new request . if the request is new , a variety of safeguards remove many of the common types of denial of service — such as tcp syn floods . however , the safeguards also include checking to see if requesting client has been determined malicious by the analysis engine . if so , the request is dealt with in a policy configured manner . for example , if the service is not overwhelmed , it may allow the request to happen ; however it can be throttled back using a custom rate limiter . when packets arrive that are not discarded , statistics are collected that are later sent to the analysis engine . examples of these statistics include : size : the request and subsequent reply &# 39 ; s size , both in bytes and packets . request payload : content of the request at the application layer ( e . g ., http get string ). number of fragments : the number of fragments in the request can be used to detect some types of malicious use . the analysis engine uses the stream of request statistics as a feed into a data mining system . the system compares the various client request statistics to sets of profiles . there are two sets of profiles : canned and trained profiles . the canned profiles represent anomalous behavior at the service level . these canned profiles can be changed through a control interface to match an administrator &# 39 ; s specifications . the trained profiles are generated by training on the server &# 39 ; s genuine request statistics . sophisticated denial of service attacks that were previously unidentifiable can be detected by comparing a client &# 39 ; s request distribution to those of the profiles . the system differs from firewalls in that it protects publicly accessible services from attack . the system recognizes attacks on edge services and adapts the forwarding rules to remove them from the network . statistics and data from service requests are sent from the forwarding engine to the analysis engine . these data are then analyzed using data mining techniques to find malicious or anomalous service request patterns . the analysis engine then feeds this information back into the forwarding engine to filter or attenuate access to the public service from these inappropriate sites . unlike firewalls , the scrubber does not proxy the connections or authenticate access to a service ; it forwards statistics from a series of client service requests to be analyzed for attack behavior . in general , the hierarchical network profiler ( hnp ) is a new approach to network traffic profiling . it aggregates network statistics using a novel cross - product of hosts , network and router interfaces to profile network traffic at a measurement point . in particular , the hierarchical network profiler ( hnp ) represents a quantum leap forward in the area of network traffic profiling . this technology identifies gross bandwidth anomalies automatically at any point in a network &# 39 ; s routing infrastructure . the goal of network profiling is to construct a model of network traffic . the approach the hnp takes is to model the network at the granularity of network flows . a network flow is defined as “ a unidirectional sequence of packets that are collocated within time that have invariant feature across all the packets .” these features may include the source and destination addresses , a protocol type , and any application layer port information . an example of an internet flow is a sequence of packets that all have the same ip source and destination addresses , ip protocol value , and udp or tcp source and destination ports . [ 0098 ] fig3 a and 3 b show two ways to measure flow statistics in a networking environment : at a single networking link of fig3 a , and at a multi - link switching point of fig3 b . in the single link case , a measurement device sits on a single networking link and constructs flow statistics for the underlying network traffic . switchpoint statistics generally require measurement support in the hardware , such as cisco system &# 39 ; s netflow technology , or juniper network &# 39 ; s internet processor ii &# 39 ; s packet sampling technology and cflowd . this hardware support typically provides the standard flow invariants described above in addition to information about the incoming and possibly outgoing interfaces . the hnp can profile the traffic flows gathered in either of these manners . the hnp automatically adjusts to its position in the network by identifying the typical traffic source and destination pairs for flows that transit the measurement point — e . g ., router . the diagram in fig4 illustrates the possibilities for cross - products of incoming and outgoing endpoints for transit flows . the most specific endpoint — at the lowest aggregation level — is a host &# 39 ; s ip address . when hosts are aggregated into network blocks — such as cidr blocks — fewer endpoint statistics are required . these are represented by the middle block of endpoints in fig4 . finally , the router &# 39 ; s interfaces are the highest level of aggregation — and the least specific . the hnp adjusts the amount of aggregation that it keeps on each interface depending on the level of diversity the flow endpoints exhibit along that interface . this diversity is directly proportional to the distance from the measurement interface to the endpoints . for example , a router close to a set of enterprise hosts will be able to maintain flow statistics about each host — a host corresponds to a flow &# 39 ; s endpoint when their number will not be prohibitive . however , in this example , the other endpoint of the flow may be very far from this router . therefore , the hnp may only keep a profile of its measurement interface . this example illustrates the general application of the hnp : the hnp keeps a profile for the cross - product of the flows that traverse it . in this example , it may keep the cross product a × d for flows destined for the internet from this set of hosts . [ 0100 ] fig5 represents the algorithm for the hierarchical network profiler ( hnp ). at the beginning of the process iteration , the hnp receives network flow statistics from the network - forwarding infrastructure . these statistics represent summaries of network traffic that the hnp uses to build its profile . after receiving a set of flow summaries ( or records ), the hnp iterates over each specific flow record . it determines if it is interested in the record ; that is , a profile is maintained for either the flow &# 39 ; s source or destination aggregate . if not , the hnp updates the source and destination profile with the flow &# 39 ; s statistics . the hnp then checks to see if the memory and user - defined requirements continue to be met . if not , the aggregation level for the profiles is adjusted so that the requirements are met . when the aggregation level is met , the hnp inserts the statistics into the sample profile . the system then checks to see if a sampling window has been crossed . when this occurs , the hnp writes the oldest profile to persistent storage , and initializes a new profile . if the sampling window has not been crossed , the new samples are added to the existing profiles . after the iteration over the flow statistics has completed , the system then goes back to query for further flow statistics , and begins the process over again . the hnp takes many available parameters into consideration when constructing a traffic profile based on temporal parameters , static network parameters , and dynamic routing parameters . temporal parameters are important to discern important differences in traffic behavior . the most important temporal properties are : time of day , day of the week , day of the month , and holidays . additionally , the hnp uses static network parameters to gauge the importance of downstream hosts and networks for aggregation purposes . similarly , dynamic routing information can be used as an input parameter to the hnp . together dynamic routing and topology information form a powerful mechanism for identifying salient network flow characteristics . the hnp is very good at detecting gross anomalies in network behavior between network endpoints . these types of anomalies are the exact signatures left in the wake of denial of service attacks . as such , the hnp provides a basis for detecting denial of service attacks . the hnp can be used for capacity planning and traffic characterization . bugs in network configurations often manifest themselves as a change in the network &# 39 ; s end - to - end behavior . the hnp can easily detect these types of configuration problems . the hierarchical network profile ( hnp ) differs from past attempts to profile network traffic in two ways . first , is uses the network flow statistics available both from the routing infrastructure and single link measurement infrastructure . second , it profiles network traffic in proportion to its distance from either the source or destination . hnp can profile the network with more accuracy than traditional approaches by leveraging flow statistics collected directly at the router . the second innovation in the hnp is its notion of hierarchy — or distance from a packet &# 39 ; s source or destination — when constructing a profile . the hnp constructs traffic profiles differently , depending on where the measurements are collected . specifically , it keeps track of more information about the flows , the closer the measurements are collected to the underlying flows &# 39 ; endpoints . this novel approach to profiling allows the hnp to generate useful network profiles at any point in the internet . as previously mentioned , stormprofiler represents a quantum leap forward in the area of network traffic profiling . this technology allows network provider and enterprise managers to identify gross bandwidth anomalies automatically at any point in their routing infrastructure . not coincidentally , these types of anomalies are the exact signatures left in the wake of denial of service attacks . the stormprofiler differs from past attempts to profile network traffic in two ways . first , it uses the network flow statistics available from the routing infrastructure . second , it profiles network traffic at a router in proportion to its distance from either the source or destination . stormprofiler can profile the network with more accuracy than traditional approaches by leveraging flow statistics collected directly at the router . past profiling attempts have focused on placing passive measurement devices at points in the network . these only allow for measuring the traffic on a specific link between two routers . in contrast , by profiling directly at the routers , stormprofiler can determine how specific traffic is typically routed . an analogy would be hiring someone to sit by the side of a road and count how many cars are going in one direction — this is the old approach to profiling . in the . same analogy , the stormprofiler sits instead at an intersection , and can tell you how many cars from each direction went down which fork . clearly , you know much more about your traffic patterns from studying the behavior at the intersection ( the router ). in this manner , the stormprofiler builds a model over time of how much traffic is routed from one point to another at a specific internet intersection . this profile has several uses : the foremost for our purpose is denial of service detection . the second innovation in the stormprofiler is its notion of hierarchy — or distance from a packet &# 39 ; s source or destination — when construction a profile . the stormprofiler constructs traffic profiles differently , depending on where the router is in the network . specifically , it keeps track of more information about the flows , the closer the router is to the source ( or destination ) it is . this novel approach to profiling allows stormprofiler to scale to any point in the internet . in general , the denial of service detector and tracker is a system that detects and backtraces internet denial of service attacks using packet and flow statistics gathered directly from the internet routing and forwarding infrastructure . in particular , the denial of service tracker ( dos tracker ) is a system that detects , backtraces and blocks internet denial of service attacks . it works by gathering packet and flow statistics directly from the internet routing and forwarding infrastructure — hereafter called the forwarding infrastructure . by collecting flow statistics directly from the forwarding infrastructure , the dos tracker is able to trace dos attacks that are untraceable by prior art . specifically , the dos tracker can pinpoint the origin of internet denial of service attacks that are launched with forged source addresses . the dos tracker specifically tracks flood - based denial of service attacks . these types of attacks attempt to overwhelm either network or end - host resources by generating a stream of packets either directly or indirectly destined for a target . fig6 shows an example denial of service attack that can be tracked through a sample network . the path of the attack traffic goes through router - a , router - b , and router - c . the most insidious types of attacks hide their origin by forging the source internet protocol ( ip ) address on the attack packets . the problem this causes for administrators and security officers is that when the target discovers itself under attack , it cannot determine its origin ; therefore making it impossible to shut the attack down . our key observation is that we can take statistics directly from the forwarding infrastructure itself to determine the path and origin of the attack traffic — even when it is forged . for example , on some types of forwarding infrastructure — such as cisco and juniper routers — one can interface directly with the infrastructure to find out which interfaces are affected by an attack . in the example of fig6 the inbound and outbound interfaces that the attack travels across can be ascertained . when pairing this information with knowledge of the physical and logical topology , it is possible to trace the attack through the network to its source . [ 0118 ] fig7 illustrates the dos tracker &# 39 ; s overall architecture . it is comprised of a two - stage hierarchy : collectors and controllers . the collectors interface with the forwarding infrastructure ; they collect the statistics and report those findings to the controllers . the controllers analyze the statistics , looking for denial of service attacks and tracking them to their source . the dos tracker &# 39 ; s collector takes samples of statistics from the forwarding infrastructure . the dos tracker utilizes two types of statistics that routers may collect on our behalf : single packet statistics , and flow - based statistics . single packet statistics are those that provide essential information about a set of packets entering a forwarding node — a router . some of the statistics kept include : destination and source ip addresses , incoming interface , protocol , ports , and length . after collection , these single packet statistics can be collected from the router for analysis . juniper network &# 39 ; s packet sampling technology is an example of single packet statistic support in the infrastructure . flow - based statistics are statistics that describe a set of packets that are related to the same logical traffic flow . the concept of flow is generally defined as a stream of packets that all have the same characteristics : source address , destination address , protocol type , source port , and destination port . they may be either unidirectional or bidirectional . flow statistics aggregate a flow &# 39 ; s individual packet statistics into a single statistic . examples include a flow &# 39 ; s duration , number of packets , mean bytes per packet , etc . cisco system &# 39 ; s netflow and juniper network &# 39 ; s cflowd mechanism are widely deployed flow - based statistic packages . once the controller has received the statistics from the collector , it takes one of two approaches to trace the dos attacks : directed tracing and distribution correlation . in directed tracing , one utilizes the knowledge of network topology to work backward toward the source of the attack . with distributed correlation , the controller compares the attack signature with those discovered at other nodes in the topology . attacks that correlate strongly are associated together and implicitly form the path from the source to the target . directed tracing relies on the fact that one has both the router &# 39 ; s incoming interface statistic for an attack and the knowledge of the topology to determine what routers are upstream on that link . with this knowledge , upstream routers can then be queried for their participation in transiting the attack . it is useful to note that since these upstream routers are looking for a specific attack signature , it is much easier to find the statistics of merit . this contrasts with the distributed correlation approach where a general attack profile is extracted from every router &# 39 ; s statistics to uncover the global path for the attack . after detection and tracing , the dos tracker blocks denial of service attacks as close to their source as possible . by taking a global view of the internet — across service providers and network — dos tracker is able to coordinate both the routing infrastructure &# 39 ; s ability to filter certain types of traffic in conjunction with custom filtering hardware that can be incrementally deployed in the network . for example , juniper &# 39 ; s internet processor ii and cisco &# 39 ; s acl car can be utilized to download coarse - grained filters that will remove unwanted dos attacks in real - time . furthermore , the dos blocker can be used as a way to filter at a fine - grain at high speeds in any networking environment , regardless of the routing infrastructure &# 39 ; s implementation . as a custom hardware solution to blocking dos attacks , the dos blocker is simply a configurable network filter . the blocker , due to its simplicity of design , is very scalable . the dos tracker approach differs from conventional network - based intrusion detection ( nid ) in that it uses statistics from the networking infrastructure itself in contrast to prior art . prior art in nid systems uses passive measurement techniques at a single point in the network to acquire statistics . these point probes don &# 39 ; t provide any information about the source of a forged attack and are therefore useless for tracing denial of service attacks back to their source . moreover , nid systems are single point measurement systems that have very little support for multi - node measurement correlation or cooperation and are unable to scale to service provider networks . cisco system &# 39 ; s netflow flow statistics have not been used for tracking network attacks . they have only been used for access control and traffic billing . moreover , we have automated a way of polling the netflow cache in contrast to the continuous mode of netflow operation used by most products . juniper &# 39 ; s packet sampling technology and cflowd mechanism have not been used for tracing attacks . another novel feature of the present approach is the filtering of denial of service attacks upstream in the internet . current practice is for a target of an attack to stop dos attacks at their firewall or border router . the present invention differs in that it communicates with the networks and routers along the path back toward the attacker . when this path is identified , the system can filter the attack as close to its source as possible . as previously mentioned , the distributed approach to global dos attack detection is based on a notion of both hierarchical and neighboring zones . the philosophy behind this approach lies in the following observation : every detection / traceback node cannot know about all of the outgoing attacks in the internet ; instead , these points should only know about the attacks that are occurring in their neighborhood . to handle very large scale — internet wide — dos detection and traceback , the approach utilizes the natural hierarchy of the internet addressing scheme . specifically , the internet is broken down into manageable portions called zones . these zones then communicate with their neighbors , sharing both specific and aggregated attack signatures and traceback information . the internet scales because of hierarchy in addressing and routing . routers and end hosts could not route packets if they had to know about all of the endpoints or routes . by aggregating this information through hierarchy , the internet is possible . the same approach was taken when designing the algorithm for coordinating global denial of service detection and traceback . [ 0127 ] fig8 provides a graphical overview of how a portion of the internet — consisting , in this example , of three autonomous systems ( ases )— could be organized . the figure shows how the size of the autonomous system can be accommodated by increasing the corresponding number of zones . there are two types of zones : base zones and aggregate zones . a base zone is a zone that consists purely of a set of routers . these routers all reside within the same as . the local detection and tracing system described above corresponds to the detection and tracing system for a base zone . higher level zones , or aggregate zones , can be constructed from sets of base and other aggregate zones . in general , a single zone will not span multiple autonomous systems , but this is not strict . the zones communicate with each other in a decentralized , distributed manner using the anomaly description protocol ( adp ), similar to the way global routing peers communicate using the border gateway protocol . the global zone topology is constructed in three ways : local - as configuration , peer - as configuration , and remote - as configuration . zones within an autonomous system are configured — a local - as configuration — to communicate with each other . since they reside within the same administrative entity , their neighbor parameters can be set specifically . when crossing autonomous systems between as peers , neighboring zones can also be set according to policy and topology constraints — a peer - as configuration . when connecting zones to a non - adp enabled as , a resource discovery algorithm is used to determine the closest neighboring zones through the chain of non - participating peering ases . the zones operate autonomously , and share information about both local and remote attacks using the anomaly description protocol . when attacks are detected locally , a zone will propagate the attack to its neighbors using the adp . this propagation includes the attack &# 39 ; s signature which can be used for both detection and blocking . when a zone receives an adp message from one of its neighbors , it adds this attack to those the local zone looks for . it is then further propagated to other neighboring zones when it is detected locally . adp messages are therefore constrained to their appropriate portion of the internet , allowing for scalability . moreover , when passing attack information to neighbors , the adp attempts to aggregate attack information so that multiple attacks that are described with the same aggregate profile , resulting in a single adp entry . the stormdetector is a mechanism for identifying denial of service attacks within an isp , a web hosting service , or an enterprise network . it combines a network &# 39 ; s dynamic profile — generated by the stormprofiler described hereinbelow — with internal static signatures of denial of service attacks to instantly identify malicious traffic . this technology utilizes custom algorithms to identify denial of service attacks in the reams of incoming traffic flow statistics gathered from the routing infrastructure . [ 0131 ] fig1 demonstrates the utility of the stormdetector system . a host in isp - a is bombarding a target server in the web hosting service with a denial of service attack . however , the attacker is forging the return address on the packets in the attack , making is impossible to determine their true origin . the stormdetector &# 39 ; s analysis engine receives flow statistics from the routers in the target &# 39 ; s hosting service . from these statistics , it can detect the attack at some set of the affected routers along its path . this path leads directly from the target to isp - a &# 39 ; s border , where the attack originates . this example demonstrates the utility of the stormdetector deployed within a web hosting service &# 39 ; s network . it can also be used in both source and transit networks . when employed at an attacker &# 39 ; s originating network , stormdetector can pinpoint the location of the attacker . in this case , it will backtrack the attack directly to its source &# 39 ; s first - hop router . it may be that the attacker is a zombie residing on a compromised machine in an enterprise network . in addition to uncovering those traditional launchpads , stormdetector will be instrumental in identifying attacks originating from home machines that connect to the internet through persistent tier - 2 ; isp &# 39 ; s adsl or cable modem connections . [ 0133 ] fig9 represents the process for detecting anomalies in the network statistics within a single zone . at the start , the system picks a measurement node at random . a set of coarse flow statistics or packet header samples is collected . this set of statistics is examined for anomalies . these anomalies include both clearly defined misuse of the network resources , and also significant differences between the profile of the various endpoints and the behavior measured in the sample . if any new anomalies are detected in the sample , they are added as conditional anomalies , and the collector is updated with these new conditional anomalies . next , a refined sample is taken with respect to the pending conditional anomalies at the collector . the system then looks at the refined sample of the network statistics for the presence of both new conditional anomalies as well as old anomalies . for each anomaly found , its status is updated . the system then goes through the outstanding anomalies and prunes out any stale ones . finally , the system updates the database with the latest summary statistics for each of the outstanding anomalies . the system then repeats , by beginning at the start node . as previously mentioned , stormtracker includes a set of algorithms that provide the functionality for tracking anonymous denial of service attacks to their sources . these algorithms provide two main functions : directed searching and path reconstruction . directed searching is an algorithm for quickly separating the attack traffic from the legitimate network traffic — essentially quickly finding needles in haystacks . by narrowing the scope of the upstream detection points , directed search provides the means for scalable tracking of large - scale attacks . path reconstruction takes multiple measurements of distributed denial of service attacks and determines their global topology characteristics . specifically , given a huge distributed denial of service attack , stormtracker allows many statistics collected from around the internet to be quickly and robustly correlated to reconstruct the attack tree . the stormtracker protocol binds these distributed detection points together . this protocol allows multiple autonomous stormdetectors to cooperate and exchange attack information , enabling a globally scoped solution . stormtracker needed a clear definition of denial of service attacks in order to communicate effectively . the stormtracker protocol codifies this definition as a standard for exchanging attack information between multiple stormdetector networks . [ 0136 ] fig1 shows an example of how two systems with stormdetectors can cooperate using the stormtracker protocol to trace the attack to its origin . stormbreaker is another piece of the solution to denial of service attacks : stopping the attack . specifically , once stormdetector and stormtracker trace an attack to its origin , the network uses stormbreaker to filter its effects . it protects the target by both guaranteeing it fill connectivity to the internet as well as ensuring its ability to provide legitimate clients with service . the stormbreaker technology works with both standard network infrastructure and custom filtering technology . specifically , it can use the filtering abilities of both cisco and juniper routers for removal denial of service attacks . in addition to standard networking solutions , a custom filtering appliance has been developed that will remove attacks from an interposed link at high - speed line rates . this custom solution is based on the intel ixp network processor . the example in fig1 shows the use of stormbreaker to block a denial of service attack at its source . the attack has comprised a machine in the enterprise network and has been attacking a host downstream in isp - b . once the attack has been detected and tracked to its origin , stormbreaker determines the appropriate filtering response . specifically , stormbreaker uses knowledge about the topology and infrastructure components in a network to make the best filtering decision . in this example , stormbreaker applies a filtering rule to the attacker &# 39 ; s router to remove its traffic from the network . the overall system solution to denial of service attacks is comprehensive , sophisticated , scalable , and effective . the stormtools suite of solutions detect malicious attacks , as shown in fig1 , trace them back to their origin , as shown in fig1 , and remove their packets from the internet , as shown in fig1 . together they guarantee a host — such as a besieged web server previously left incapacitated and unable to provide service to legitimate clients — sustained network connectivity to legitimate users . while the best mode for carrying out the invention has been described in detail , those familiar with the art to which this invention relates will recognize various alternative designs and embodiments for practicing the invention as defined by the following claims . | 7 |
gold nanocolloids have attracted strong interest from scientists for over a century and are now being heavily investigated for their potential use in a wide variety of medical and biological applications . for example , potential uses include surface - enhanced spectroscopy , biological labeling and detection , gene - regulation , and diagnostic or therapeutic agents for treatment of cancer in humans . their versatility in a broad range of applications stems from their unique physical , chemical , and surface properties , such as : ( i ) size - and shape - dependent strong optical extinction and scattering at visible and near infrared ( nir ) wavelengths due to a localized surface plasmon resonance of their free electrons upon excitation by an electromagnetic field ; ( ii ) large surface areas for conjugation to functional ligands ; and ( iii ) little or no long - term toxicity or other adverse effects in vivo allowing their high acceptance level in living systems . these new physical , chemical , and surface properties , which are not available from either atomic or bulk counterparts , explain why gold nanocolloids have not been simply chosen as alternatives to molecule - based systems but as novel structures which provide substantive advantages in biological and medical applications . the prerequisite for most of intended biological and medical applications of gold nanoparticles is the further surface modification of the as - synthesized gold nanoparticles via conjugation of functional ligand molecules to the surface of the gold nanoparticles . the surface functionalization of gold nanoparticles for any biological or medical applications is crucial for at least two reasons . first is control over the interaction of the nanoparticles with their environment , which is naturally taking place at the nanoparticle surface . appropriate surface functionalization is a key step to providing stability , solubility , and retention of physical and chemical properties of the nanoparticles in the physiological conditions . second , the ligand molecules provide additional and new properties or functionality to those found inherently in the core gold nanoparticle . these conjugated gold nanoparticles bring together the unique properties and functionality of both the core material and the ligand shell for achieving the goals of highly specific targeting of gold nanoparticles to the sites of interest , ultra - sensitive sensing , and effective therapy . nowadays , the major strategy for surface modification of gold nanoparticles include coating gold nanoparticles with polymer , for example peg containing reactive functional groups , such as — cooh and — nh 2 , which are ready for the conjugation of targeting ligands . however , current strategy of coating gold nanoparticles with functional groups , such as — cooh and — nh 2 , often results in highly charged surfaces , which promote their binding to biomolecules in the biological systems through ionic interactions , causing nanoparticles to aggregate in biological environments and thus exhibit strong non - specific binding to various cells and tissues that is undesirable in many in vitro and in vivo applications . in the present invention , provided are methods which permits versatile and controllable surface modification of gold nanoparticles with both positive charged peg and negative charged peg ( e . g ., for addressing the issues and challenges described above ) and provide methods to fabricate gold nanoparticles having minimum cellular uptake by macrophage cells via forming zwitterionic surface containing both positive and negative charges on the same gold nanoparticle . it is believed that , prior to the present invention , there was no way to conjugate a defined number of positive charged ligands and negative charged ligands onto the surface of gold nanoparticles to control the surface charge ( or zeta potential ) for optimizing their biomedical performance . as discussed above , the overwhelming majority of gold nanoparticles are prepared by the standard sodium citrate reduction reaction . this method allows for the synthesis of spherical gold nanoparticles with diameters ranging from 5 to 200 nanometers ( nm ) which are capped with negatively charged citrate ions . the capping controls the growth of the nanoparticles in terms of rate , final size , geometric shape and stabilizes the nanoparticles against aggregation by electrostatic repulsion . in contrast to the prior process of bottom - up fabrication using wet chemical processes , in certain embodiments , the gold nanoparticles used in the present invention are produced by a top - down nanofabrication approach . the top - down fabrication methods of the present invention start with a bulk material in a liquid and then break the bulk material into nanoparticles in the liquid by applying physical energy to the material . the physical energy can be mechanical energy , heat energy , electric field arc discharge energy , magnetic field energy , ion beam energy , electron beam energy , or laser beam energy including laser ablation of the bulk material . the present process produces a pure , bare colloidal gold nanoparticle that is stable in the ablation liquid . the ablation liquids comprise a plurality of solvents selected from but not limited to deionized water , methanol , ethanol , acetone , and dimethylformamide . the present invention is noted limited by the top - down nanofabrication approach used in the present invention . these methods involve the generation of the nanoparticles from the bulk material in the presence of the suspension medium . in one embodiment the process comprises a one step process wherein the application of the physical energy source , such as mechanical energy , heat energy , electric field arc discharge energy , magnetic field energy , ion beam energy , electron beam energy , or laser energy to the bulk gold occur in the suspension medium . the bulk source is placed in the suspension medium and the physical energy is applied thus generating nanoparticles that are immediately suspended in the suspension medium as they are formed . in another embodiment the present invention employs a two - step process including the steps of : 1 ) fabricating gold nanoparticle arrays on a substrate by using photo , electron beam , focused ion beam , nanoimprint , or nanosphere lithography as known in the art ; and 2 ) removing the gold nanoparticle arrays from the substrate into the suspension liquid using one of the physical energy methods . tabor , c ., qian , w ., and el - sayed , m . a ., journal of physical chemistry c , vol 111 ( 2007 ), 8934 - 8941 ; haes , a . j . ; zhao , j . ; zou , s . l . ; own , c . s . ; marks , l . d . ; schatz , g . c . ; van duyne , r . p . journal of physical chemistry b , vol 109 ( 2005 ), 11158 . in both methods the colloidal gold is formed in situ by generating the nanoparticles in the suspension medium using one of the physical energy methods . in certain embodiments of the present invention , colloidal suspensions of gold nanoparticles are produced by pulsed laser ablation of a bulk gold target in deionized water as the suspension medium . fig1 schematically illustrates a laser - based system for producing colloidal suspensions of nanoparticles of complex compounds such as gold in a organic liquid using pulsed laser ablation . in certain embodiments , a laser beam 1 is generated from an ultrafast pulsed laser source , not shown , and focused by a lens 2 . the source of the laser beam 1 can be a pulsed laser or any other laser source providing suitable pulse duration , repetition rate , and / or power level as discussed below . the focused laser beam 1 then passes from the lens 2 to a guide mechanism 3 for directing the laser beam 1 . alternatively , the lens 2 can be placed between the guide mechanism 3 and a target 4 of the bulk material . the guide mechanism 3 can be any of those known in the art including piezo - mirrors , acousto - optic deflectors , rotating polygons , a vibration mirror , or prisms . preferably the guide mechanism 3 is a vibration mirror 3 to enable controlled and rapid movement of the laser beam 1 . the guide mechanism 3 directs the laser beam 1 to a target 4 . in one embodiment , the target 4 is a bulk gold target . the target 4 is submerged a distance , from several millimeters to preferably less than 1 centimeter , below the surface of a suspension organic liquid 5 . the target 4 is positioned in a container 7 additionally but not necessarily having a removable glass window 6 on its top . optionally , an o - ring type seal 8 is placed between the glass window 6 and the top of the container 7 to prevent the liquid 5 from leaking out of the container 7 . additionally but not necessarily , the container 7 includes an inlet 12 and an outlet 14 so the liquid 5 can be passed over the target 4 and thus be re - circulated . the container 7 is optionally placed on a motion stage 9 that can produce translational motion of the container 7 with the target 4 and the liquid 5 . flow of the liquid 5 is used to carry the nanoparticles 10 generated from the target 4 out of the container 7 to be collected as a colloidal suspension . the flow of liquid 5 over the target 4 also cools the laser focal volume . the liquid 5 can be any liquid that is largely transparent to the wavelength of the laser beam 1 , and that serves as a colloidal suspension medium for the target material 4 . in one embodiment , the liquid 5 is deionized water . the system thus allows for generation of colloidal gold nanoparticles in situ in a suspension liquid so that a colloidal gold suspension is formed . the formed gold nanoparticles are immediately stably suspended in the liquid and thus no dispersants , stabilizer agents , surfactants or other materials are required to maintain the colloidal suspension in a stable state . in work conducted during the development of embodiments of the present invention , the following laser parameters were used to fabricate gold nanocolloids by pulsed laser ablation of a bulk gold target in acetone : pulse energy of 10 uj ( micro joules ), pulse repetition rate of 100 khz , pulse duration of 700 femtoseconds , and a laser spot size on the ablation target of about 50 um ( microns ). for the preparation of au nanocolloids a 16 mm ( millimeter ) long , 8 mm wide , and 0 . 5 mm thick rectangular target of au from alfa aesar was used . for convenience , the au target materials can be attached to a bigger piece of a bulk material such as a glass slide , another metal substrate , or a si substrate . more generally , for the present invention the laser ablation parameters are as follows : a pulse duration in a range from about 10 femtoseconds to about 500 picoseconds , preferably from about 100 femtoseconds to about 30 picoseconds ; the pulse energy in the range from about 1 μj to about 100 μj ; the pulse repetition rate in the range from about 10 khz to about 10 mhz ; and the laser spot size may be less than about 100 μm . the target material has a size in at least one dimension that is greater than a spot size of a laser spot at a surface of the target material . work conducted during the development of embodiments of the present invention found that stable colloidal solution of gold nanoparticles with only partial surface modification could be fabricated . also , the surface coverage amount of functional peg molecules on the surface of the gold nanoparticles can be tuned to be any percent value between 0 and 100 %. fig2 shows the physical characteristics of aunps (˜ 20 nm in diameter based on tem imaging ) after mixing with hs - peg - cooh ( thiolated negative charged peg molecule terminated with carboxyl group at its distal end ) with different hs - peg - cooh / aunp molar ratios from zero to 2000 . this molar ratio range was chosen based on the surface area of 20 - nm aunps and the footprint of peg molecules . for pegylation we selected thiolated peg 5000 with molecular weight of 5000 daltons , which is most widely used to modify gold nanoparticles . the thiol concentration (& gt ; 95 %) was confirmed by an ellman &# 39 ; s test . during pegylation , the au nanoparticle concentration was fixed at 1 . 0 nm , determined by correlating our measured extinction spectra to the experimentally determined extinction cross - section data ( 8 . 8 × 10 8 m − 1 cm − 1 for aunps with a diameter of 20 nm ). fig2 a and 2 b show the optical spectra of aunps at all hs - peg - cooh / aunp ratios and the corresponding optical density ( od ) at the absorption peak , respectively . the overlapping curves and the constant od reveal that there is no loss of aunps after pegylation for each of the hs - peg - cooh / aunp molar ratio . the high colloidal stability of laser - made aunps after pegylation with different molar ratios is probably attributed to the highly negatively charged surface as displayed in fig2 c , which shows that the zeta potential is independent of the hs - peg - cooh / aunp molar ratio . although there are not any capping ligands on the aunp surfaces before pegylation , the aunps made by femtosecond pulse laser ablation have a natural negative surface with zeta potential of about − 33 . 3 mv . the negatively charged surface is caused by partial oxidation from the oxygen present in solution , followed by proton transfer to adjacent hydroxide ions . the pegylation process was further demonstrated by monitoring the change in particle size after pegylation with increasing hs - peg - cooh / aunp molar ratios , as shown in fig2 d . the data show that the hydrodynamic layer thickness consistently increased with increasing molar ratios of hs - peg - cooh / aunp , and reached a constant at 26 nm after the aunp surface was saturated at molar ratio of 500 . this reveals an increase in peg chain density on aunp surfaces upon increasing the hs - peg - cooh / aunp molar ratio . for free peg molecules in a good solvent , the radius of gyration r g can be empirically calculated by : r g = 0 . 181 × n 0 . 58 where n is the number of ethylene glycol ( eg ) monomer units per peg chain . for the peg 5000 used here , r g is 2 . 8 nm and the size increase should be around 11 . 2 nm ( 2 . 8 × 4 ) if the peg chains form isolated hemispheres ( mushroom ) on the surface with a critical peg density σ *( 1 / πr g 2 ) around 0 . 04 peg / nm 2 . at molar ratio of 500 the peg density σ is around 0 . 4 peg / nm 2 , which is 10 times higher than the critical grafting density . the grafting peg chains are most likely reconfigured , stretching out in a brush conformation as shown in the insert of fig1 d . this explains why the hydrodynamic layer thickness ( δd ) is more than four times the radius of gyration . the differential peg - cooh chain density on aunps after pegylation at varying molar ratios of hs - peg - cooh / aunp was detected by centrifuging the solutions and re - suspending the pellet of aunps . for molar ratios less than 100 the pellet could not be re - dispersed after centrifugation , as shown in fig3 a , revealing the peg - cooh chain density is too low to maintain a stable formulation . as the molar ratio increases from 100 to 200 the absorption spectra show that more aunps are recovered after centrifugation , determined by the increase of the absorption peak at 524 nm . however , detection of a second , smaller peak ( or ‘ bump ’) at ˜ 650 nm suggests these partially pegylated aunps tend to form aggregates after centrifugation , indicating a higher peg - cooh chain density is required to maintain stability . fig3 b shows the od at the absorption peak of aunps pegylated with hs - peg - cooh at different molar ratios . the data clearly show which pegylated aunp formulations are stable after centrifugation , based on the peg density on the aunp surfaces . as the molar ratio increases from 100 to 300 the od number increases by 25 times , with a relative change from 4 % to 100 % when compared to the od before centrifugation , respectively . the data also indicate that even though the aunp surfaces are not fully covered with peg at a molar ratio of 300 , the aunps are stable against centrifugation . furthermore , surface modification was carried out on gold nanoparticles with hs - peg - nh 2 ( thiolated positive charged peg molecule terminated with amine group at its distal end ). fig4 shows the physical characteristics of aunps (˜ 20 nm in diameter based on tem imaging ) after mixing with hs - peg - nh 2 with different hs - peg - cooh / aunp molar ratios from zero to 2000 . the aunp concentration decreases after incubation at a range of molar ratios from 200 to 500 . for the molar ratio of 300 , a dip was observed in the od for the peak wavelength of the absorption spectra after incubation with aunps as shown in fig4 a and 4 b . it is worth noting that the color of the solutions at these ratios does not change to purple and there are no bumps on any of the absorption spectra including that for a molar ratio of 300 , revealing that the loss of the aunps was not because of aggregation of aunps . it was found that , at these molar ratio ranges , aunps become stuck on the eppendorf tube ( observing that the inside of the tube is red ). as the molar ratio of hs - peg - nh 2 / aunp increases from 50 to 300 , the zeta potential of pegylated aunps transforms from highly negative (− 44 . 9 mv ) to slightly positive (+ 14 . 4 mv ) as shown in fig4 c . as previously mentioned , at a molar ratio of 300 the aunps are only 60 % fully covered . this data suggests that two factors attribute to the dip formation observed in fig4 b : a zeta potential close to zero and partial pegylation . as discussed below , this unstable range can be avoided by addition of peg molecules with opposite charges ( e . g ., hs - peg - cooh ) prior to adding , for example , hs - peg - nh 2 . as the molar ratio of hs - peg - nh 2 / aunp further increases to 500 the zeta potential reaches + 52 . 2 mv and becomes constant when the molar ratio is higher than 500 , indicating successful pegylation with increasing peg - nh 2 chain density on the aunps until the surfaces become saturated . successful pegylation was also demonstrated by monitoring the size increase after pegylation with increasing hs - peg - nh 2 / aunp molar ratios , as shown in fig4 d . the data show that the hydrodynamic layer thickness increases by 26 nm at the saturated hs - peg - nh 2 / aunp molar ratio of 500 , which is consistent with the pegylation using hs - peg - cooh . the data combined clearly reveal a controlled increase in the peg - nh 2 chain density as one increases the hs - peg - nh 2 / aunp molar ratio . using conjugation of gold nanoparticles with hs - peg - nh 2 molecules as an example , worked conducted during the development of embodiments of the present invention further analyzed the efficiency of pegylation using a fluorescamine - based assay to quantify the concentration of free hs - peg - nh 2 in the supernatant . in this assay a non - fluorescent fluorescamine reacts with a primary amine to generate a compound that emits fluorescence at 480 nm when excited at 390 nm . originally developed for quantification of primary amines in biomolecules , this assay has sensitivity on the pm scale . in doing this experiment , the hs - peg - nh 2 concentration was varied during incubation from 50 to 2000 nm while keeping the aunp concentration constant at 1 . 0 nm . therefore , the initial input molar ratio between hs - peg - nh 2 and gold nanoparticle ranges from 50 to 2000 . fig5 a and 5 b show the fluorescence spectra and the corresponding calibration curve that correlates the fluorescence intensity at 480 nm to the concentration of free hs - peg - nh 2 without mixing with aunps . a linear relationship was found in the concentration range of 50 to 2000 nm of hs - peg - nh 2 . this assay was then applied to measure the free hs - peg - nh 2 in the supernatants after incubation with aunp at different molar ratios followed by centrifugation , shown in fig5 c and 5 d . although the hs - peg - nh 2 concentration increases 10 times up to 500 nm , there is no obvious fluorescence increase after measuring the supernatants until the pegylation becomes saturated ( at molar ratio of 500 ). this reveals that most of the added hs - peg - nh 2 bind to aunps without any detectable free hs - peg - nh 2 in the supernatants . measuring the peg concentration in supernatants to estimate the peg chain density on aunps is a widely used method . when the ratio is higher than 500 one begins to see the fluorescence increase in the supernatant , indicating that the aunps gradually become saturated . this result is consistent with the zeta potential measurements . these combined experiments demonstrate a highly efficient pegylation process that allows control of the peg density on aunps by manipulating the molar ratio between hs - peg - cooh or hs - peg - nh 2 and aunp , as long as the ratio is less than the saturated one . based on controllable stable conjugation of hs - peg - cooh molecules and hs - peg - nh 2 molecules on surface of gold nanoparticles described above with the surface coverage amount of hs - peg - cooh molecules and hs - peg - nh 2 molecules on the surface of the gold nanoparticles can be tuned to be any percent value between 0 and 100 %. as such , the present invention allows methods of fabricating gold nanoparticles with zwitterionic surface , which permits precisely control of number of both negative charged ligands and positive charged ligands bound onto surface of gold nanoparticles . in certain embodiments , this method comprises : performing surface modification of gold nanoparticles for forming zwitterionic surface by conjugation of both negative charged ligands and positive charged ligands onto surface of colloidal gold nanoparticles in a sequential manner . exemplary steps include the follows ; step 1 : the negative charged ligands are first mixed with said colloidal suspension of gold nanoparticles at room temperature for at least 30 minutes . step 2 : addition of positive charged ligands to colloidal suspension of gold nanoparticles also at room temperature . the total amount of negative charged ligand added to the said colloidal gold nanoparticles is no more than the minimum amount required to provide a monolayer of bound negative charged ligand to the total of colloidal gold nanoparticles based on a footprint of negative charged ligand bound on gold nanoparticles and total amount of positive charged ligand added to the colloidal gold nanoparticles is no more than the minimum amount required to bind to all free binding sites left on surface of colloidal gold nanoparticles after conjugation of negative charged ligands onto surface of colloidal gold nanoparticles . step 3 : after mixing , the mixture is kept undisturbed for 24 hours at room temperature to provide a sufficient amount of time for both positive charged ligands and negative charged ligands to be conjugated onto the surfaces of colloidal au nanoparticles ; and optionally , after step 2 and before step 3 , adding to colloidal gold nanoparticles more said negative charged ligands to ensure saturation of said binding sites on surface of said colloidal gold nanoparticles for maximizing colloidal stability of said colloidal gold nanoparticles . as an example , work conducted during the development of embodiments of the present invention used the above method to fabricate gold nanoparticles with zwitterionic surface containing both hs - peg - cooh molecules and hs - peg - nh 2 molecules . the schematic illustration of fabrication of gold nanoparticles with zwitterionic surface bearing both peg - cooh molecules and peg - nh 2 molecules on their surface in a sequential manner is shown in fig6 . first partially pegylating aunps with hs - peg - cooh at room temperature for at least 30 minutes , then pegylating with hs - peg - nh 2 . as long as the aunps are not saturated ( e . g ., the molar ratio between combined number of hs - peg - cooh and hs - peg - nh 2 and number of au nanoparticles is lower than about 500 ), one can control the density of both hs - peg - cooh and hs - peg - nh 2 covalently attached to aunps . at least 30 minutes after addition of hs - peg - nh 2 , than adding more hs - peg - cooh to saturate the surface for maximum aunp stability . finally , collection of fabricated gold nanoparticles with zwitterionic surface by centrifuge at 15000 g for 30 minute , removing the supernatant , and then redispersing into a phosphate buffered saline ( pbs ) with a ph of 7 . 4 prior to their use in cell experiments . in addition , power of fabricated gold nanoparticles with zwitterionic surface could be also formed after collection of them from solution . in work conducted during the development of embodiments of the present invention , a series of colloidal solutions of gold nanoparticles with zwitterionic surface have been made using method as shown in the fig6 . the molar ratio between the number of hs - peg - cooh and the number of gold nanoparticles is fixed at 150 and the molar ratio between the number of hs - peg - nh 2 and the number of gold nanoparticles ranges from 0 to 300 . the stability of these obtained gold nanoparticles after redispersed into phosphate buffered saline ( pbs ) with a ph of 7 . 4 is examined and the results are shown in the fig7 . for all obtained gold nanoparticles , they are very stable . two hours after being redispersed into pbs buffer , the decrease of surface plasmon resonance of gold nanoparticles is less than 40 %. thus , the method could fabricate gold nanoparticles having zwitterionic surface containing both hs - peg - cooh and hs - peg - nh 2 with their surface coverage could be controlled to be any amount between 0 and 100 %, which are stable in phosphate buffered saline . the term “ stable ” means that the decrease of absorbance intensity caused by localized surface plasmon resonance of gold nanoparticles at 518 to 530 nm , more specifically at 520 nm two hours after redispersing gold nanoparticles into pbs buffer is less than 40 % compared to the absorbance measured at time zero ( immediately after redispersing ). next , non - specific uptake of obtained gold nanoparticles was tested with zwitterionic surface by macrophage cells . as shown in fig8 , the data show that as the amount of peg - nh 2 on aunps increases from 50 to 300 , the non - specific uptake of au / cell ( pg ) decreases by half from 0 . 63 ± 0 . 01 to 0 . 33 ± 0 . 01 . the reduced cell uptake is likely due to the overall surface charge becoming more neutral with addition of more peg - nh 2 . as shown in the table 1 , with fixed amount of peg - cooh , the increase of amount of peg - nh 2 do increase the zeta potential of gold nanoparticle from − 48 mv , − 35 mv , − 17 mv , and to − 2 mv as increasing amount of peg - nh 2 per gold nanoparticle from 0 to 500 . table 1 shows the zeta potential of gold nanoparticles with zwitterionic surface as function of number of peg - cooh molecules and peg - nh 2 molecules bound onto surface of gold nanoparticles . the number of peg - cooh per gold nanoparticle is fixed at 150 and the number of peg - nh 2 ranges from 0 to 900 . furthermore , these aunps with zwitterionic surface have significant less non - specific uptake than the control aunps decorated with a single type of peg - r ( i . e . — och 3 , — cooh , — nh 2 ). for instance , the double - charged aunps show a relative uptake ranging from 40 % to 76 % when compared to aunp - peg - och 3 , the control with the least uptake . various chemical functional groups , such as thiol , amine , disulfide , and phosphine , possess a high affinity for the surface of gold nanoparticles . thiol groups are considered to show the highest affinity for gold surfaces , approximately 200 kj / mol , and therefore a majority of gold nanoparticle surface functionalization occurs through using ligand molecules having thiol groups which bind to surfaces of gold nanoparticles via a thiol - au bond . in addition to peg or poly ( ethylene oxide ) ( peo ) polymer , other polymers having molecular weight in the range of from 200 daltons to 100 , 000 , 000 daltons selected from but not limited to poly ( 2 -( methacryloyloxy ) ethyl phosphorylcholine ), poly ( 2 -( dimethylamino ) ethyl methacrylate ), poly ( acrylic acid ), and poly ( ethylene glycol ) containing at least one functional group having an affinity for surface of said gold nanoparticles could also be used as functional ligand . in certain embodiments , the au nanoparticles have the shape of a sphere , rod , prism , disk , cube , or core - shell structures , cages , and frames , wherein they have at least one dimension in the range of from 1 to 200 nm ( e . g ., 1 . . . 50 . . . 100 . . . 150 . . . or 200 nm ). in addition , the method of surface modification described in this invention can be used for structures ( e . g ., nanostructures ) which have outer surfaces that are only partially covered with gold . thus , while only certain embodiments have been specifically described herein , it will be apparent that numerous modifications may be made thereto without departing from the spirit and scope of the invention . further , acronyms are used merely to enhance the readability of the specification and claims . it should be noted that these acronyms are not intended to lessen the generality of the terms used and they should not be construed to restrict the scope of the claims to the embodiments described therein . it is intended that the invention not be limited by the specific embodiments and their variations and combinations as described herein - above . | 0 |
the measurement process is first clarified with reference to fig1 and 2a . fig2 a depicts a rectangular coordinate system in which the x - axis 1 corresponds to the surface being measured , and the recorded measured brightness values and the measured surface values obtained by the process according to the invention , from which the quality index is then derived , are plotted on the y - axis 2 . the signal curve of the measured brightness values is indicated with the reference number 3 and the smoothed measured surface values , which are used for the derivation of the quality index , are indicated with the reference number 4 . the measurement of a certain point x k proceeds as follows . a number n 1 of measured values is first recorded , whose x - coordinate is smaller than x k and which each have a constant spacing . the x - axis thus directly reproduces the distance coordinate of the surface being measured . after n 1 equidistant measured values have been recorded , the actual measured value x k is recorded and then finally n 2 measured values which , in turn , are determined at equidistant straight - line points is measured . in the embodiment presented here , the straight - line spacing of the individual points recorded before the measured value x k and the spacing of the points recorded after the measured value x k are equal . furthermore , the number n 1 preceding the measured surface value being recorded is also exactly as great as the number n 2 following this value . the measured surface value for the location x k is now determined from the recorded measured values n 1 , x k and n 2 . this is done by a statistical analysis of the recorded measured brightness values , e . g ., a mean value derivation . weighing the measured values has proven to be particularly favorable ; i . e ., allowing the values to enter into the statistical analysis in proportion to their proximity to the measuring point x k . curve 3 in fig2 a shows the measured brightness values , each of which was determined for a respective measuring point x i on the x - axis without taking the preceding measured values n 1 and the following measured values n 2 into consideration . the graph shows a very strongly fluctuating curve from which no reliable data concerning the surface structure can be derived . curve 3 thus shows the result of the brightness measurement without the process according to the invention . curve 4 shows the result of the measurement process according to the invention . an elongated wave , which can be accurately analyzed with respect to its amplitude and its wavelength , is clearly visible here . it is thereby possible to distinguish between short - wave and long - wave surface disturbances in a painted surface . short - wave surface disturbances in a painting are , for example , caused by spray mists , while long - wave structures are conditioned by flow disturbances in the paint . it is thus possible by means of the analysis to determine that a certain percentage of painted surfaces exhibit long - wave disturbances , i . e ., flow disturbances , and to improve the painting process accordingly . since , as shown in fig2 a , a series of measured values must be recorded following and preceding a certain measuring point on the surface , it has proven to be particularly favorable that all measured brightness values are determined first and entered in a data base , and that the measured values are then subsequently read from the memory and evaluated in the manner described . for the evaluation of painting of automobile bodies , it has proven to be particularly favorable to select a length of 11 cm as the measurement length , from which 1300 measured values are recorded . these measured values are stored and then analyzed . in an improvement of this method , the numbers n 1 and n 2 of the measured values used for deriving a measured surface value at a location x k can then be varied . if the number is lower , e . g ., 10 measured values to the left and right of x k , the short - wave disturbances are much more prominent ; if the number is greater , the long - wave disturbances become more clearly visible . fig2 b shows by means of actual recorded measured values how this different analysis influences the measurement result . the x - axis , which is again designated 1 , indicates the location of each measuring point on the surface being measured while the numbers 0 to 10 represent the straight - line distance in centimeters . the total measured distance is thus here about 11 cm . the respective measurement results , with dimensionless values , are plotted on the y - axis which is indicated as 2 . curve 5 indicates the measured brightness values which were actually recorded during the measurement . these were stored in a memory and were then subsequently analyzed in a process according to the invention . curve 6 shows the measured surface values which are obtained from the long - wave analysis of the measured brightness values . it can be clearly seen that this yields a basic surface structure which is free of smaller variations and from which , e . g ., the flow of the paint can be evaluated . curve 7 shows the measured surface values for a short - wave analysis of the measured brightness values depicted in curve 5 . the long - wave surface disturbances do not play any role here , as can be seen . one or several quality indices for the evaluation of the surface quality are now obtained from curves 6 and 7 . this can be carried out , e . g ., by determining the variance of the measured surface values . the schematically drawn device in fig1 functions according to the previously described principle ; i . e ., it records at once a predetermined number of measuring points with a constant distance and then evaluates this according to the process according to the invention . the measuring device has a laser 10 which preferably functions in the wavelength range of visible light , which improves the measurement and is also more favorable with respect to safety . the light which is emitted from the laser at an angle of 60 ° to the surface is reflected from the surface and strikes a photodetector 12 . the photodetector 12 has a filter which is adjusted to the wavelength of the laser so that the ambient light exerts only a negligibly low influence . the device also has a position pickup 14 which determines the displacement intervals of the device in relation to the surface being measured and produces a pulse when a certain distance has been covered and a new measured value can be recorded . the laser 10 , the photodetector 12 , and the position pickup 14 are connected via respective signal processors 18 , 19 , and 20 to a processor , preferably a microprocessor 25 , which regulates the function of the entire device . the microprocessor is in turn connected to a timer 27 , a standard value memory 28 , and a memory for optional access 29 . the timer functions to regulate the time for the entire device ; a program that controls the device is stored in the standard value memory 28 . the measurement data are stored in the memory 29 . the microprocessor 25 is , in turn , connected through a signal processor 32 to a display 34 which functions to indicate the measured values and for dialogue with the user . in addition , an led 36 , which for safety reasons always lights up when the laser is active , is connected to this signal processor . a switching device 38 , which has several switches so that control signals can be given by the user , is also included . a battery ( not represented in fig1 ) is used to supply power to the device . the device is moved , either as a unit or only with a component which contains the laser 10 , the photodetector 12 , and the position pickup 14 , relative to the surface being tested 8 . in this step the speed of this movement does not play any role . the laser is supplied with energy and beams light onto the reflecting surface . the reflected light is recorded by the photodetector and conducted over the signal processor circuit 19 , where , e . g ., an a / d conversion takes place , to the microprocessor 25 . a first measured value is recorded and stored in the memory 29 whereby the position pickup 14 determines the position of this first measuring point . subsequently , a new measured value is determined and read when the position pickup produces a signal indicating that the respective measuring point on the surface has advanced along the predetermined distance . the laser and the photodetector are thereby constantly in operation . as soon as , in the preceding case , a measured distance of 11 cm has been covered , and thus about 1300 measured values have been stored in the memory 29 , the actual measuring process is completed . the device can thus be set up so that the measured surface values and one or several quality indices , which provide the user with information about the quality of the tested surface , are determined from these values by means of the program stored in the memory 28 and shown on the display 34 . in an alternative configuration of the device , the values can also be read out to an external computer which then determines the measured surface values and the quality indices from the measured values . in the latter version , the memory 29 and the program 28 are set up so that several series of measured values , e . g ., 5 or 10 for different tested surface sections , can be recorded in the memory 29 . it is , of course , also possible to connect the device on - line to a computer , i . e ., to first collect the measured values and then transfer them in one reading process to the controlling computer . the results determined by the controlling computer can thereby be transferred back to the device and displayed there . one embodiment of a device which is designed according to the block schematic in fig1 will now be described with reference to fig3 and 4 . the device represented is designed so that it can be set up in a housing whose dimensions are smaller than 180 mm × 50 mm × 120 mm . however , the device is only partially represented in fig3 and 4 . the device has a u - shaped frame 40 which is constructed , e . g ., of aluminum , and which extends essentially over the entire length of the device . the frame has a bottom plate 40a , a first side flange 40b , and a second side flange 40c . the frame has a symmetry plane 41 which is perpendicular to the bottom plate 40a . a block 43 is screwed in place on the bottom plate 40a by means of screws 42 . the block 43 has two cylindrical holes 45 and 46 whose axes 45a and 46a lie in the symmetry plane 41 . the holes are both inclined by exactly 30 ° relative to the bottom plate 40a which means that they each have an angle of 60 ° to the vertical symmetry plane 41 . the holes are set up so that their axes 45a and 46a intersect exactly at a point of the surface being measured . a conventional semiconductor laser 50 , which emits a light beam with a wavelength of 670 nm in a direction which exactly corresponds to the direction of the axis 45a , is set up in the first hole 45 . the laser 50 is cemented into the hole 45 with a plastic block 51 . the photodetector 54 is set up in the hole 46 . the detector contains a tube 56 which is closed on its front end by means of a color filter 58 . the color filter is adjusted so that it essentially transmits only the wavelength of the laser light of the laser 50 . an infrared filter 60 , which is used as a thermal insulation filter as well as a rectangular diaphragm whose aperture is about 0 . 3 × 0 . 8 mm , is located on the end 56a of the tube . to this is connected the light - sensitive part 64 in which an electrical analog signal , which is a function of the amount of incidental light , is produced . an aperture 68 , which permits the exit and re - entry of the laser light from the device , is in the lower region of the bottom plate 40a . in order to permit working with the device outside of special light - protection areas and also without protective glasses , the power of the laser is adjusted so that it is a maximum of 1 mw . this power is also preferably controlled by the microprocessor 25 in a suitable manner . two axles 70 and 72 , which are set up in holes 73 of the side flanges 40b and 40c and penetrate the side flanges , are located in the end regions of the frame 40 . the axles 70 and 72 are parallel to the bottom plate 40a of the frame 40 . the guiding of the axles in the side flanges is carried out by means of bearing housings 74 which are indicated schematically in fig4 . primary wheels 80 with a larger diameter and secondary wheels 82 with a smaller diameter are impressed on both ends of the axles 70 and 72 . the wheels are constructed of plastic and have a groove 83 along the perimeter into which a rubber ring 84 , preferably an o - ring , is inlaid . the shore hardness of these rubber rings 84 is selected so that the ring is soft enough on the one hand to allow contact with the surface being measured without damaging the surface , but so that it on the other hand is not so soft that it allows dust particles and the like to settle on it . the axle 70 of the large wheels 80 penetrates a conventional angle of rotation sensor 86 and is connected to it free of rotational play . the housing of the angle of rotation sensor 86 is fixed with reference to the frame 40 . the angle of rotation sensor is adjusted so that an electrical pulse is always produced when the axle 70 rotates through a predetermined angle , e . g ., 1 °. the frame 40 and the block 43 attached to it are attached in a housing which is not represented for the sake of clarity . this housing also contains a battery and all electronic components which were described above with reference to fig1 . the housing is set up so that the wheels 80 and 82 and their respective axles can rotate freely . the housing , which when installed has approximately the size of a thick paperback book , is held in the hand by an operator and placed on the surface being measured using the wheels 80 and 82 . the device is then moved by hand corresponding to the orientation of the wheels 80 and 82 over the surface so that the wheels rotate . after the beginning of the measuring cycle , 1300 measuring points are recorded and stored in the memory 29 , as described . the required equidistance of the measuring points is controlled by the angle of rotation sensor 86 whose pulses are used by the microprocessor for regulating the measurement recording . the speed with which the device is moved over the surface being tested and whether the speed is changed while the measured values are recorded is , therefore , unimportant to measurement accuracy . based on the distance which the contact points of the wheels 80 and 82 on the surface of the profile 40 being measured exhibit , it is ensured that the device is suitable for scanning curved areas , e . g ., in the fender or roof region of a vehicle body . in this context , it should be noted that vehicle bodies never have completely planar surfaces due to technical reasons of manufacture . in order to ensure a reliable measurement recording under all conditions , the microprocessor can also control whether all required marginal conditions of the measurement have been maintained . it can then , e . g ., issue a warning if the measuring path along which the device was moved was too short and the like . the device according to the invention , as it has been described above , offers considerable advantages for routine testing , e . g ., in vehicle painting . for instance , the device according to the invention can be placed on the paint locations where the tester suspects or determines deficiencies in quality from a visual inspection , and the quality index or indices of the surface can be determined . the tester can then determine whether the tested paint area is still within the permissible tolerance margins for paint quality by means of an exactly defined value . he is thereby no longer dependent on his subjective feeling , in contrast to the conventional process . in addition , the device can provide detailed information on the wave region in which the respective optical disturbance is located so that the analysis of the apparent disturbances can be used for optimizing the painting equipment . in addition to the described manual use of the device , it is also possible to use the device automatically . as an example , a device , as depicted in fig3 and 4 , can also be placed by a handling robot on a surface being tested . in this case , the device is then preferably connected on - line to the computer which influences the control of the manufacturing process . in case corresponding equipment is available , the wheels and the angle of rotation indicator can also be omitted , if necessary , during an automatic measurement recording , and a different technique can be used for recording position . | 6 |
referring to the circuit layout in fig4 as one of the preferred embodiments of the present invention , the filtering circuit of the present invention comprises an equivalent circuit of the first capacitor 10 , an equivalent circuit of the second capacitor 20 and a transmission line 30 . further , the transmission line 30 connects the equivalent circuit of the first capacitor 10 and the equivalent circuit of the second capacitor 20 . in this embodiment , the equivalent circuit of the first capacitor 10 and the equivalent circuit of the second capacitor 20 each comprise a resistor , a capacitor and an inductor ( r 1 , c 1 , l 1 and r 2 , c 2 , l 2 ). the values of r 1 , r 2 , l 1 and l 2 of the circuit correspond to either the devices themselves and / or the manufacture of the circuit board and therefore cannot be altered arbitrarily . the transmission line 30 is to connect the equivalent circuit having the first capacitor 10 with the equivalent circuit having the second capacitor 20 ; the present invention suppresses the resonance between two capacitors ( c 1 and c 2 ) by selecting the characteristic impedance and the length of the transmission line 30 . in this embodiment , the width of the transmission line 30 is inverse proportional to its characteristic impedance ; that is , the thinner the width of the transmission line 30 becomes , the higher the characteristic impedance will be , thus requiring a transmission line with a shorter length . in the present invention , the filtering effect from the filtering circuit is assessed with the transmission coefficient of the scattering parameters . as the transmission coefficient decreases , it implies that energy of a signal on one side is more difficult to reach the other side of the circuit ; on the contrary , as the transmission coefficient increases ( approaching 0 db ), it implies that it becomes easier for energy of a signal on one side to reach the other side of the circuit . referring again to the circuit layout in fig4 , adjusting the length ( l t ) of the transmission line 30 can alter the resonant effect between two capacitors . as length ( l t ) begins to increase from 0 , the resonant effect between two capacitors will gradually weaken to a point where the length of the transmission line 30 reaches an optimized value , whereby the resonance between two capacitors can almost be fully suppressed . when the length of the transmission line 30 exceeds its optimized value , the resonance between two capacitors will again take place and gradually become worse as the length of the transmission line 30 continues to increase . the optimized length of the transmission line 30 also relates to other parameters in the circuit . generally speaking , if , in fig4 , the difference in capacitance between the two capacitors becomes larger , or the characteristic impedance ( z 0 ) of the transmission line 30 decreases , that optimized length will increase accordingly . however , circuit layout designers in practice would not necessarily adjust the length of the transmission line 30 to the optimized value instead lowering the resonant effect to be suppressed to within an acceptable range will be sufficient . in the filtering structure shown in fig4 , adjusting different capacitances can lead to different filtering effects . referring to fig5 , the method of the present invention for suppressing resonance between shunt capacitors is employed by the mean of adjusting the length of the transmission line in the circuit , comprising the following steps : first of all , a frequency range is determined as the operating frequencies of the shunt capacitors circuit , in which the frequencies include a maximum frequency and a minimum frequency ( step s 21 ). followed the above step , the characteristic impedance of the transmission line is then calculated subject to the width constraint on that transmission line ( step s 22 ). due to limitations on the manufacture of the circuit board affecting the width of the transmission line 30 , infinite downsizing becomes unfeasible , hindering the possibility to infinitely increase the characteristic impedance of the transmission line 30 arbitrarily . calculating the characteristic impedance of the transmission line 30 is a well - known art in the related field ; therefore it will be not further described herein . the first capacitance of the equivalent circuit having the first capacitor 10 is the calculated subject to the median of the frequency range . ( step s 23 ) for example , as the frequency range selected by the filtering circuit falls between 200 mhz ˜ 500 mhz , assuming the equivalence inductance and the equivalence resistance equal to 0 . 5 nh and 0 . 1ω respectively , to set the minimum impedance of the first capacitor at the median of the frequency range as order . therefore , selecting the median 350 mhz of the frequency range as the standard , the first capacitance ( c 1 ) is calculated as follows : 2 * π * ( 200 * 10 6 + 500 * 10 6 ) 2 = 1 0 . 5 * 10 - 9 * c 1 the result of the first capacitance c 1 is equal to 400 pf . then the second capacitance of the equivalent circuit having the second capacitor 20 is calculated subject to the minimum frequency of the above frequency range ( step s 24 ). by setting the minimum impedance of the second capacitor at the minimum frequency range as order and selecting 200 mhz as the standard , the second capacitance ( c 2 ) is calculated as follows : 2 * π * 200 * 10 6 = 1 0 . 5 * 10 - 9 * c 2 the result of the second capacitance c 2 is equal to 1200 pf . finally , the length of the wire is properly adjusted subject to the equivalent circuit having the first capacitor 10 , the equivalent circuit having the second capacitor 20 and the transmission characteristic impedance of said transmission line . ( step s 25 ) in this embodiment , assuming the characteristic impedance of the transmission line equals to 50ω , the optimized length of the wire ( l t ) will then be equal to 3 . 3 mm . referring to the circuit layout shown in fig4 , the filtering circuit of the present invention utilizes the 3 . 3 mm transmission line 30 with the characteristic impedance ( z 0 ) at 50ω to connect two capacitors ( c 1 = 400 pf and c 2 = 1200 pf ). the resonant effect due to parasitic inductance can be effectively suppressed with proper selections for the characteristic impedance ( z 0 ) and the length ( l t ) of the transmission line . referring to the frequency response diagram in fig6 , first of all , two capacitors , each having 400 pf , are connected in parallel without adding the connection with the transmission line ( l t = 0 ). this kind of connection is the conventional method to avoid parallel resonant effect due to the presence of serial inductors , where a minimum value for the transmission coefficient is at 350 mhz . secondly , two capacitors , each having 400 pf , are connected in parallel with a 6 mm transmission line with its characteristic impedance at 50ω . this kind of connection allows a lower transmission coefficient at around 350 mhz ; however , due to the length of the transmission line , which is not properly complied with the capacitance , a peak value of the transmission coefficient appears at around 210 mhz , implying that the filtering effect at the range is defective . thirdly , two capacitors , with one having 400 pf and the other having 1200 pf , are connected in parallel with a transmission line at the optimized length of 3 . 3 mm long . as shown in fig6 , the resonant effect has been significantly suppressed while the transmission coefficient yields a better result than that employing the conventional method with only two 400 pf shunt capacitors filtering structure . from the above it is known that the method of the present invention for suppressing resonance between shunt capacitors by adjusting the length of the transmission line between the shunt capacitors can effectively suppress the resonant effect due to the parasitic inductance effect in the circuit . also the method can further shorten the length of the filtering structure , allowing the area of the circuit to be significantly reduced . the method of the present invention is not limited to second - order filtering circuits , but can also be applied on any filtering structure comprising equivalent circuits having more than three capacitors . although the present invention has been explained in relation to its preferred embodiment , it is to be understood that many other possible modifications and variations can be made without departing from the scope of the invention as hereinafter claimed . | 7 |
fig1 shows the equivalent circuit of the mesfet with zero - voltage dc drain bias . the channel conductance g ( v ) g is a weakly nonlinear conductance and is primarily responsible for the circuit &# 39 ; s resistive mixing . this conductance is controlled by the internal gate / source voltage v g , which consists of a dc bias component and an lo - frequency voltage . thus , g ( v g ). tbd . g ( t ) and varies with time at the lo frequency . the resistances r g , r s , and r d are the gate , source , and drain parasitic resistances , and are approximately the same as those in the biased device . when the drain bias is zero , the mesfet &# 39 ; s gate / channel capacitance is divided approximately equally between c gs and c gd . the rf signal is applied to the mesfet &# 39 ; s drain terminal , and the lo is applied to the gate . resistive mixing in the channel conductance g ( v g ) causes if currents to be generated in g ( v g ), and these currents are filtered from the rf currents and applied to the if output port . because the conductance g ( v g ) is weakly nonlinear , the intermodulation currents generated in g ( v g ) are very small , so the level of the mixer &# 39 ; s intermodulation distortion is very low . because the dc drain voltage is zero , the drain / gate capacitance c gd is much greater than it would be in a biased mesfet . this large value of c gd is a potential problem in designing a mixer : first , because it reduces rf / lo isolation ; and second , because lo voltage coupled to the drain or rf voltage coupled to the gate may increase intermodulation distortion . therefore , in order to minimize distortion , the lo voltages are short - circuited at the drain and the rf voltages are short - circuited at the gate . these short circuits can be realized by either filters or a balanced structure . fig2 shows the preferred embodiment of the invention . the rf input port 2 is connected to the input of the rf transformer 4 via a short length of microstrip transmission line 6 and two capacitors 8 . the rf transformer is approximately one - quarter wavelength long , and its output is connected to the drain terminals of two fets 10 . the purpose of this rf transformer 4 is to match the rf impedance of the fets &# 39 ; channels to the 50 - ohm rf source impedance . in order to prevent short - circuiting the if currents in the fets &# 39 ; channels , which have a 180 degree phase difference , the transformer is split longitudinally . a small - value capacitor 12 ( 5 . 1 pf ) connects the fets &# 39 ; drains at the rf and lo frequencies , without short - circuiting the if . the lo input port 14 is connected via a short length of 50 - ohm microstrip transmission line 16 to the lo balun 18 . the lo balun consists of a half - wavelength of 50 - ohm microstrip transmission line , the ends of which are connected to the gates of the fets 10 . this balun causes the lo voltages at the gates to have a 180 degree phase difference , and thus the channel conductances will vary 180 degrees out of phase . also , because of the 180 degree lo phase difference , the lo leakage through the gate / drain capacitances in fig1 ) of the fets has a 180 degree phase difference . thus , the capacitor 12 causes the drain terminals of the fets to be virtual grounds ( short circuits ) for lo leakage , as required to minimize intermodulation distortion . the rf leakage through c gd is in phase at the fets &# 39 ; gates ; however , a well - known property of the lo balun is that it presents a short circuit to in - phase inputs . thus , it short - circuits the rf voltages , as required , at the fets &# 39 ; gates . also shown in fig2 is a simple l - c bias circuit 20 used to apply dc bias to the gates of the fets , and simple if filters 22 and 24 consisting of a high - impedance , 90 - degree microstrip line and a 90 degree open - circuit stub , are used to separate the if currents . the outputs of the if filters are connected to the inputs of an if hybrid coupler 26 ; in this circuit the if hybrid is realized by means of a center - tapped transformer 26 ( mini - circuits co . type t4 - 1 ) having a turns ratio of 2 : 1 . the output of the hybrid is connected directly to the if port 28 . the bias and if circuits are conventional and can be realized in a variety of ways . this embodiment of the invention was designed to operate at an rf frequency of approximately 10 ghz with an if of 10 to 300 mhz . fig3 a shows the conversion loss as a function of rf frequency with the if fixed at 60 mhz , and fig3 b shows the relative conversion loss as a function of if frequency with the lo frequency fixed at 10 . 5 ghz . the conversion loss is comparable to that of a diode mixer . fig4 shows the conversion loss as a function of lo power and gate dc bias voltage , indicating that good conversion efficiency can be achieved with moderate lo power levels . fig5 shows the if output power of the third - order intermodulation distortion components when the rf input power is - dbm ; this figure shows that very low distortion levels can be achieved with moderate lo power levels . fig6 shows the output levels of the linear , second - order , and third - order if output levels as a function of rf input power level , when the lo power level is 18 dbm and the gate dc bias voltage is - 1 . 10 v . other embodiments of the invention are possible ; the common property of all such embodiments is that the lo is applied to the gate , the rf is applied to the drain , and the fet &# 39 ; s channel operates as a resistive mixer . one possible embodiment is a single - ended mixer in which only one mesfet is used . in this case the gate and drain rf and lo short circuits are realized by filters ; the rf and lo frequencies must be separated enough to allow effective filtering , so the if must be relatively high ( approximately 1 ghz for a 10 - ghz rf frequency ). the invention is applicable at frequencies throughout the rf , microwave , and millimeter - wave range . | 7 |
the present invention provides methods to reduce , preferably substantially or entirely eliminate , partitioning of 4 - mu ( or derivatives ) in droplet - based bioassays on a droplet actuator . in one embodiment , surfactants ( detergents ) may be used to retain 4 - mu ( or derivatives ) within an aqueous phase droplet . the methods of the invention provide significantly improved signal retention and substantially reduced cross - contamination between droplets . the methods of the invention also provide significantly improved discrimination between a positive signal and a negative signal in 4 - mu - based bioassays . further , the invention provides a droplet actuator with a droplet operations surface having a hydrophobic coating that is chemically compatible with the perfluorinated oil ( or solvents ) and that also ensure suitable droplets operations performance . the invention provides methods of depositing hydrophobic coatings on the droplet operations surfaces of a droplet actuator to render them suitable for use with perfluorinated solvents . the invention also provides hydrophobic coatings for improving operations performance . for example , the invention provides droplet actuators with coatings applied by liquid deposition processes as well as coatings applied by plasma - enhanced chemical vapor deposition ( pecvd )- based processes . 4 - mu - containing substrates ( a . k . a 7 - hydroxy 4 - methylcoumarin ) are used in a number of fluorometric enzyme assays ( e . g ., enzymatic assays for the detection of lysosomal storage disorders in newborns ). the fluorometric enzyme assays are based on the hydrolysis of a 4 - mu - containing substrate by a specific enzyme to yield the fluorescent molecule 4 - mu . in the droplet operations environment of a droplet actuator , partitioning of 4 - mu between the aqueous phase ( i . e ., droplet ) and the organic phase ( filler fluid ) may result in a reduction in the assay signal and potential contamination of neighboring samples . the enzymatic turnover of the 4 - mu substrate requires a low - ph environment ( acidic environment ). at low ph ( pk of 4 - mu = 7 . 9 ), 4 - mu is non - ionic and hydrophobic and partitions preferentially from the aqueous droplet phase into the oil filler phase ( 100 : 1 ). droplets subsequently prepared for the detection step of the bioassay are at a high ph . fluorescence of 4 - mu is optimal at elevated ph ( ph & gt ; 10 ). a high ph ( ph & gt ; 10 ) facilitates reverse partitioning of 4 - mu from the oil phase back into an aqueous phase droplet . the potential for droplet cross - contamination occurs when an acidic droplet with elevated enzyme concentration ( producing significant amounts of 4 - mu product ) is in proximity of a basic droplet with substantially lower 4 - mu concentrations . the efficacy of different surfactants ( detergents ) in containing 4 - mu ( or derivatives ) within an aqueous phase may , for example , be evaluated using a partitioning assay . parameters that may be varied in the assay for evaluation of surfactants in aqueous containment of 4 - mu ( or derivatives ) include , but are not limited to , the ph of the aqueous phase solution , and the critical micelle concentration of the surfactant . fig1 shows a diagram of an example of an on - bench assay protocol 100 for evaluating the effect of aqueous surfactants on 4 - mu partitioning . the assay format includes forward transfer partitioning ( forward extraction ; fe ) of 4 - mu from an aqueous phase to an oil phase and backward transfer partitioning ( backward extraction ; be ) of 4 - mu from an oil phase to an aqueous phase . the assay is performed in 96 - well microtiter substrates ; clear 96 - well substrates ( e . g ., costar 3631 ) for evaluation of forward transfer partitioning with bottom probe fluorescence detection and solid black 96 - well substrates ( e . g ., costar 3915 ) for evaluation of backward transfer partitioning with top probe fluorescence detection . a biotek synergy ht instrument with 3 mm top probe and 5 mm bottom probe , may , for example , be used for fluorescence measurements . an example of an assay format used for testing the effect of surfactants on contamination through 4 - mu partitioning includes , but is not limited to , the following steps : pipette an aliquot ( 20 μl ) of an aqueous phase solution ( e . g ., at ph 2 to ph 10 . 5 ) containing 0 . 01 % tween ® 20 in a well of a 96 - well clear microtiter plate . the aqueous phase solution may also include 4 - mu ( e . g ., 100 μm ), nacl ( e . g ., 50 mm ), and bsa ( e . g ., 1 mg / ml ). add 130 μl of oil ( e . g ., silicone oil 5 cst , 0 . 1 % triton x - 15 ) to each well that contains an aqueous phase droplet . seal the plate with aluminum foil and shake using a bench top shaker ( e . g ., thermofisher shaker at speed setting 5 ) for 30 min at room temperature . carefully remove the aluminum foil and observe each well to note and record any defects in droplet quality ( minimize light exposure during this step ). measure the fluorescence of each well using a bottom probe at gains 40 , 45 , and 50 . transfer , without disturbing the aqueous droplet , 75 μl of the oil phase ( fe oil ) from each well into the respective well of a solid black microtiter plate that contains 75 μl of 200 mm nahco 3 in each well . seal the plate with aluminum foil and shake using , for example , a thermofisher bench top shaker ( e . g ., speed setting 5 ) for 60 min at 40 ° c . remove the aluminum foil and measure the fluorescence of each well using a top probe at gains 50 , 60 , 70 , and 80 . fig2 shows a bar graph 200 of relative fluorescence readings for backward transfer partitioning ( backward extraction ; be ) of a 4 - mu partitioning assay used to evaluate the effect of aqueous phase surfactants on 4 - mu containment . in this example , surfactants were selected from an array of different surfactants available in the detergent screening kit hr2 - 408 from hampton research , inc . the experiment was performed using 5 cst silicone oil with 0 . 1 % w / v triton x - 15 as the organic phase ( oil phase ). each surfactant was used at 1 . 5 times the surfactant &# 39 ; s critical micellar concentration ( cmc ). the identity of each surfactant is listed in tables 1 and 2 . as17 ( anapoe ®- 20 or tween ® 20 ) was used as a reference signal ( 43 , 000 - 44 , 000 rfu ) and reflects an example of the level of droplet cross - contamination that may be observed in a 4 - mu - based bioassay ( e . g ., newborn screening assay ) performed on a droplet actuator . surfactants that retained 4 - mu more efficiently than as17 ( anapoe ®- 20 or tween ® 20 ), i . e ., to the left of the arrow in fig2 , are listed in table 1 . surfactants that were less efficient than as17 in retaining 4 - mu , i . e ., to the right of the arrow in fig2 , are listed in table 2 . classification of the most efficient surfactants ( detergents ) in retaining 4 - mu in an aqueous droplet is shown in table 3 . the zwitterionic surfactant group ( 14 ) includes sulfobetaines , betaine and lipid - like phosphocholine and phosphoethanolamine . the non - ionic surfactant group ( 9 ) includes sugar - based surfactants ( glycosides , glucamides ). enzymatic indicators of lysosomal storage diseases ( lsds ) can be identified using droplet based assays on a droplet actuator . in one embodiment , assays of the appropriate glycosidase activity may be used to detect altered activity of a particular glycosidase , which may be an indicator of a particular lysosomal storage disease . examples of enzyme deficiencies and lsds include , but are not limited to , the following : a deficiency in iduronate - 2 - sulfae sulphatase is a diagnostic indicator of hunter disease ; a deficiency in acid β - d - glucosidase or chitotriosidase is a diagnostic indicator of gaucher disease ; a deficiency in acid sphingomyelinase or chitotriosidase is a diagnostic indicator of niemann - pick disease ; a deficiency in α - glucosidase activity is a diagnostic indicator of pompe disease ; a deficiency in α - galactosidase activity is a diagnostic indicator of fabry disease ; a deficiency in α - l - iduronidase is a diagnostic indicator of hurler disease ; a deficiency in heparan sulfate sulfamidase is a diagnostic indicator of sanfilippo a ( mps iiia ); a deficiency in alpha - n - acetylglucosaminidase is a diagnostic indicator of sanfilippo b ( mps iiib ); and a deficiency in arylsulfatase a is a diagnositic indicator of metachromatic leukodystrophy . multiple diseases and / or multiple samples can be tested simultaneously on a single droplet actuator . the lysosomal enzyme tests are performed in aqueous droplets within an oil filled gap of the droplet actuator . samples and assay reagents are manipulated as discrete droplets upon an electrode array ( digital electrowetting ). sample droplets are blood or blood - derived samples , such as plasma , serum , tissue , cell fractions , and treated , fractionated , concentrated and / or diluted forms of the foregoing . for example , diagnosis for pompe disease is performed on fibroblasts . other biological fluids may be used as samples ; nonlimiting examples include tears , semen , urine , saliva , amniotic liquid and cerebrospinal fluid . for example , in the testing to diagnose fabry disease , tears may be used as the input sample droplet . biological fluids may be treated as necessary to prepare them for being subjected to the protocols of the invention . for example , samples may be diluted or buffered , heated or cooled ; ph may be adjusted ; and / or blood samples may be treated with one or more anticoagulants . in some embodiments , the sample includes a reconstituted dried blood spot and / or dried plasma spot . samples may be loaded into a reservoir associated with a droplet actuator , and may be dispensed into one or more subsamples . in some cases , the subsamples are unit - sized subsamples . the subsamples may be in contact with or surrounded with one or more filler fluids . assay reagents for testing for lysosomal storage disorders ( e . g ., lsds ) on a droplet actuator may include any one or more of the following : reaction buffer , 4 - mu enzyme substrate , supplemented secondary enzyme , assay - specific inhibitor , and stop buffer ( e . g ., 0 . 2m sodium bicarbonate ph 10 . 0 with 0 . 01 % tween ® 20 ). examples of 4 - mu substrates include , but are not limited to , 4 - methylumbelliferyl - α - l - iduronide - 2 - sulfate ( 4 - mu - αidoa - 2s ), hunter substrate ; 4 - methylumbelliferyl α - d - galactopyranoside ( 4 - mu - α gal ), fabry substrate ; 4 - mu - α - d - glucopyranoside ( 4 - mu - α - glue ), pompe substrate ; 4 - methyumbelliferyl - β - d - glucopyranoside ( 4 - mu - β - glue ), gaucher substrate ; 4 - methylumbelliferyl - α - l - iduronide sodium salt ( 4 - mu - α - idu ), hurler substrate ; 4 - trifluoromethylumbelliferylchitroside , gaucher and niemann - pick substrate ; 4 - methylumbelliferyl - β - galactose ( 4 - mu - β - galactose ), morquio b substrate ; 4 - methylumbelliferyl - α - n - sulpho - d - glucosaminide ( mu - αglcns ), sanfilippo a ( mps iiia ) substrate ; 4 - methylumbelliferyl - α - d - n - acetylglucosamine , sanfilippo b ( mps iiib ); and 3 - o - sulfate - β - d - galactosyl - 4 - methylumbelliferyl ), metachromatic leukodystrophy ( mld ) substrate . in one embodiment , the invention provides a 4 - mu assay in which a droplet comprising assay reagents and a zwitterionic surfactant is dispensed and merged using droplet operations with a sample droplet in a droplet operations gap or on a droplet operations surface . the combined reaction droplet is split using droplet operations into 2 reaction droplets . one reaction droplet is combined using droplet operations with a stop buffer droplet . fluorescence of the combined droplet is measured ( t = 0 h ). the second reaction droplet is incubated for a predetermined time and then the reaction droplet is combined with a stop buffer droplet . end point fluorescence is measured ( t = end h ). in this example , a single sample droplet is dispensed and analyzed . however , any number of sample droplets may be dispensed and analyzed . the concentration of zwitterionic surfactant is preferably about in the range of 1 . 5 times the surfactant &# 39 ; s critical micellar concentration ( cmc ). examples of suitable zwitterionic surfactants ( detergents ) include n - octylphosphocholine ( fos - choline ®- 8 ), n - nonylphosphocholine ( fos - choline ®- 9 ), n - decylphosphocholine ( fos - choline ®- 10 ), n - dodecylphosphocholine ( fos - choline ®- 12 ), 3 - cyclohexyl - 1 - propylphosphocholine ( cyclofos ™- 3 ), decylphospho - n - methylethanolamine ( fos - mea ®- 10 ), n - decyl - n , n - dimethylglycine , n - octyl - n , n - dimethyl - 3 - ammonio - 1 - propanesulfonate ( zwittergent ® 3 - 8 ), n - decyl - n , n - dimethyl - 3 - ammonio - 1 - propanesulfonate ( zwittergent ® 3 - 10 ), n - dodecyl - n , n - dimethyl - 3 - ammonio - 1 - propanesulfonate ( zwittergent ® 3 - 12 ), n - tetradecyl - n , n - dimethyl - 3 - ammonio - 1 - propanesulfonate ( zwittergent ® 3 - 14 ), dimethylbenzylammonium propane sulfonate ( ndsb - 256 ), 3 -[( 3 - cholamidopropyl )- dimethylammonio ]- 1 - propane sulfonate ( chaps ), and 3 -[( 3 - cholamidopropyl )- dimethylammonio ]- 2 - hydroxy - 1 - propanesulfonate ( chapso ). the droplet operations gap or surface may be coated , filled or partially filled with a filler fluid . for example , the filler fluid may be 5 cst silicone oil with 0 . 1 % triton x15 . in another embodiment , the invention provides a 4 - mu assay in which a droplet comprising assay reagents and a non - ionic surfactant is dispensed and merged using droplet operations with a sample droplet in a droplet operations gap or on a droplet operations surface . the combined reaction droplet is split using droplet operations into 2 reaction droplets . one reaction droplet is combined using droplet operations with a stop buffer droplet . fluorescence of the combined droplet is measured ( t = 0 h ). the second reaction droplet is incubated for a predetermined time and then the reaction droplet is combined with a stop buffer droplet . end point fluorescence is measured ( t = end h ). in this example , a single sample droplet is dispensed and analyzed . however , any number of sample droplets may be dispensed and analyzed . the concentration of non - ionic surfactant is preferably about in the range of 1 . 5 times the surfactant &# 39 ; s critical micellar concentration ( cmc ). examples of suitable non - ionic surfactants ( detergents ) include n - hexyl - β - d - glucopyranoside , 2 - cyclohexyl - 1 - ethyl - β - d - maltoside ( cymal ®- 2 ), 3 - cyclohexyl - 1 - propyl - β - d - maltoside ( cymal ®- 3 ), octanoyl - n - methylglucamide ( mega - 8 ), nonanoyl - n - methylglucamide ( mega - 9 ), octanoyl - n - hydroxyethylglucamide ( hega ®- 8 ), nonanoyl - n - hydroxyethylglucamide ( hega ®- 9 ), n - hexyl - β - d - glucopyranoside , and α -[ 4 -( 1 , 1 , 3 , 3 - tetramethylbutyl ) phenyl ]- δ - hydroxy - poly ( oxy - 1 , 2 - ethanediyl ) ( anapoe ® x - 305 ). the droplet operations gap or surface may be coated , filled or partially filled with a filler fluid . for example , the filler fluid may be 5 cst silicone oil with 0 . 1 % triton x15 . in yet another embodiment , the invention provides a 4 - mu assay in which a droplet comprising assay reagents and an ionic surfactant is dispensed and merged using droplet operations with a sample droplet in a droplet operations gap or on a droplet operations surface . the combined reaction droplet is split using droplet operations into 2 reaction droplets . one reaction droplet is combined using droplet operations with a stop buffer droplet . fluorescence of the combined droplet is measured ( t = 0 h ). the second reaction droplet is incubated for a predetermined time and then the reaction droplet is combined with a stop buffer droplet . end point fluorescence is measured ( t = end h ). in this example , a single sample droplet is dispensed and analyzed . however , any number of sample droplets may be dispensed and analyzed . the concentration of ionic surfactant is preferably about in the range of 1 . 5 times the surfactant &# 39 ; s critical micellar concentration ( cmc ). examples of suitable ionic surfactants ( detergents ) include cationic benzyldimethyldodecylammonium bromide ( bam ) and anionic 3α , 7α , 12α - trihydroxy - 5β - cholan - 24 - oic acid , monosodium salt ( sodium cholate ). the droplet operations gap or surface may be coated , filled or partially filled with a filler fluid . for example , the filler fluid may be 5 cst silicone oil with 0 . 1 % triton x15 . fig3 illustrates cross section of a portion of an example of a droplet actuator 300 that has hydrophobic coatings on the droplet operations surfaces . the gap in droplet actuator 300 may be filled with perfluorinated oil . droplet actuator 300 may include a bottom substrate 310 and a top substrate 312 that are separated by a gap 314 . bottom substrate 310 may , for example , be a printed circuit board ( pcb ), plastic , silicon , glass , or other suitable material . top substrate 312 may , for example , be formed of glass , injection - molded plastic , silicon , or other suitable material . bottom substrate 310 may include an arrangement of droplet operations electrodes 316 ( e . g ., electrowetting electrodes ). droplet operations electrodes 316 are arranged in a manner that permits them to be used to mediate droplet operations using droplets in the droplet operations gap . top substrate 312 may include a conductive layer 318 . conductive layer 318 is on the side of top substrate 312 that is facing gap 314 . in one example , conductive layer 318 is formed of indium tin oxide ( ito ), which is a material that is electrically conductive and substantially transparent to light . droplet operations are conducted between droplet operations electrodes 316 and conductive layer 318 . droplet operations electrodes 316 of bottom substrate 310 are coated with a dielectric material 328 . a hydrophobic layer 320 is provided atop dielectric material 328 of bottom substrate 310 . a hydrophobic layer 322 is provided atop conductive layer 318 of top substrate 312 . in operation , gap 314 of droplet actuator 300 is filled or partially filled with a filler fluid 324 . filler fluid 324 may be a perfluorinated oil or solvent , such as perfluorinated silicone oil . one or more droplets 326 are provided in gap 314 . droplet 326 may be subjected to droplet operations the filler fluid 324 . these droplet operations are mediated by droplet operations electrodes 316 . fig4 a and 4b illustrate water contact angle ( θ ) with respect to hydrophilicity and hydrophilicity , respectively . referring to fig4 a , a water droplet tends to spread on a hydrophilic surface . the evaluation of hydrophilicity is made through water contact angle ( θ ) measurements . referring to fig4 b , hydrophobicity refers to the physical property of a material that repels a mass of water . because a water droplet is repelled by hydrophobic material , a water droplet tends to contact only a small area of the surface and the shape of the droplet is spherical . details of examples of evaluating various chemistries and various methods of depositing hydrophobic coatings are described with reference to tables 4 , 5 , and 6 and fig5 a through 9 below . water contact angle ( θ ) and hysteresis evaluations as well as droplet operations tests were performed on m - type cytop ® coating ( an amorphous fluoropolymer ) that is deposited on a substrate via a liquid deposition process . additionally , water contact angle ( θ ) and hysteresis evaluations as well as droplet operations tests were performed on hydrophobic coatings deposited on a substrate via various plasma - enhanced chemical vapor deposition ( pecvd ) processes . pecvd is a process used to deposit thin films from a gas state ( vapor ) to a solid state on a substrate . for example , tests were performed using the pecvd system from plasmatreat us lp ( elgin , ill .). other tests were performed using the pecvd system from triton systems , inc . ( chelmsford , mass . ), which is a spray - based process . yet other tests were performed using the pecvd system from gvd corporation ( cambridge , mass . ), which is a chamber - based process . the m - type cytop ® coating evaluation may be considered the standard against which the pecvd processes are evaluated . in all cases , the droplet operations performance is evaluated with respect to perfluorinated oil or solvent , such as silicone oil , in the gap of a droplet actuator . water contact angle ( θ ) and respective hysteresis values were determined for various treatments of a glass surface . for example , the surface of a glass slide ( e . g ., 25 mm × 25 mm × 1 mm thick ) was treated and evaluated with respect to water contact angle ( θ ) and hysteresis . for each sample , a water droplet of known volume is deposited on the glass and then the water contact angle ( θ ) is measured using a goniometer . when liquid is added to the droplet , the volume of the droplet increases and , therefore , the water contact angle ( θ ) also increases . this is referred to as theta advancing ( θa ). theta advancing ( θa ) is greater than the static water contact angle ( θs ), or θa & gt ; θs . by contrast , when liquid is removed from the droplet , the volume of the droplet decreases and , therefore , the water contact angle ( θ ) also decreases . this is referred to as theta receding ( θr ). theta receding ( θr ) is less than the static water contact angle ( θs ), or θr & lt ; θs . a hysteresis value is determined by θa minus θr , or hysteresis = θa − θr . table 4 shows an example of evaluation results for five initial screening tests . the five tests are summarized as follows . test # 1 is m - type cytop ® coating liquid deposition process on glass at high temperature ( i . e ., 120 ° c .). fig3 a and 3b show droplet operations tests related to test # 1 . test # 2 is hydrophobic coatings deposited on glass using the plasmatreat pecvd process . fig4 shows a droplet operations test related test # 2 . test # 3 is hydrophobic coatings deposited on glass using the triton pecvd process . fig5 shows a droplet operations test related test # 3 . test # 4 is hydrophobic coatings deposited on glass using the gvd pecvd process at room temperature . fig6 shows a droplet operations test related test # 4 . test # 5 is hydrophobic coatings deposited on glass using the gvd pecvd process at high temperature ( i . e ., 125 ° c .). fig7 shows a droplet operations test related test # 5 . following the aforementioned tests , droplet operations performance was tested on five droplet actuators . the five droplet actuators had bottom substrates coated with m - type cytop ® coating per the liquid deposition process . however , the respective top substrates are unique in each test , as described with reference to fig5 a through 9 . this evaluation is performed to determine whether the hydrophobic coatings perform well under standard droplet operations conditions . fig5 a and 5b show top down views of a portion of a droplet actuator 500 that includes m - type cytop ® coatings applied using the liquid deposition process , which substantially corresponds to the process used in test # 1 of table 4 . droplet actuator 500 includes bottom substrate 510 . an electrode arrangement 520 is patterned on bottom substrate 510 . electrode arrangement 520 may include , for example , various reservoir electrodes ( of on - actuator reservoirs ) and droplet operations electrodes . in the top down view of droplet actuator 500 , bottom substrate 510 is visible through a substantially transparent top substrate , which is present but not visible . bottom substrate 510 and the top substrate ( not visible ) are separated by a gap . in this example , bottom substrate 510 is a pcb that is coated with m - type cytop ® coating per the liquid deposition process . the top substrate ( not visible ) is formed of ito - coated glass that is also coated with m - type cytop ® coating per the liquid deposition process . the gap between bottom substrate 510 and the top substrate is filled with silicone oil . in a test performed on droplet actuator 500 , droplet operations are conducted atop the various electrodes to determine the droplet operations performance of m - type cytop ® coating with respect to silicone oil . fig5 a and 5b show a volume of fluid 522 at a reservoir electrode , which is the electrode of an on - actuator reservoir . a droplet 524 is dispensed from the fluid 522 at the on - actuator reservoir and transported along a line of droplet operations electrodes . fig5 a and 5b show that a droplet of fluid is successfully dispensed from the on - actuator reservoir . further , the size of the droplet is suitable for use in assay protocols and the droplet transported well . fig6 shows a top down view of a portion of a droplet actuator 600 that includes hydrophobic coatings applied using the plasmatreat pecvd process , which substantially corresponds to the process used in test # 2 of table 4 . droplet actuator 600 includes bottom substrate 610 . an electrode arrangement 620 is patterned on bottom substrate 610 . electrode arrangement 620 may include , for example , various reservoir electrodes ( of on - actuator reservoirs ) and droplet operations electrodes . in the top down view of droplet actuator 600 , bottom substrate 610 is visible through a substantially transparent top substrate , which is present but not visible . bottom substrate 610 and the top substrate ( not visible ) are separated by a gap . in this example , bottom substrate 610 is a pcb that is coated with m - type cytop ® coating per the liquid deposition process . however , the top substrate ( not visible ) is formed of ito - coated glass that is coated with hydrophobic material per the plasmatreat pecvd process . the gap between bottom substrate 610 and the top substrate is filled with silicone oil . in a test performed on droplet actuator 600 , droplet operations are conducted atop the various electrodes to determine the droplet operations performance of the hydrophobic material deposited via the plasmatreat pecvd process with respect to silicone oil . fig6 shows a volume of fluid 622 at a reservoir electrode , which is the electrode of an on - actuator reservoir . a droplet 624 is dispensed from the fluid 622 at the on - actuator reservoir and transported along a line of droplet operations electrodes . fig6 shows that a droplet of fluid is successfully dispensed from the on - actuator reservoir . however , the size of the droplet is not suitable for use in assay protocols and the droplet did not transport well . fig7 shows a top down view of a portion of a droplet actuator 700 that includes hydrophobic coatings applied using the triton pecvd process , which substantially corresponds to the process used in test # 3 of table 4 . droplet actuator 700 includes bottom substrate 710 . an electrode arrangement 720 is patterned on bottom substrate 710 . electrode arrangement 720 may include , for example , various reservoir electrodes ( of on - actuator reservoirs ) and droplet operations electrodes . in the top down view of droplet actuator 700 , bottom substrate 710 is visible through a substantially transparent top substrate , which is present but not visible . bottom substrate 710 and the top substrate ( not visible ) are separated by a gap . in this example , bottom substrate 710 is a pcb that is coated with m - type cytop ® coating per the liquid deposition process . however , the top substrate ( not visible ) is formed of ito - coated glass that is also coated with hydrophobic material per the triton pecvd process . the gap between bottom substrate 710 and the top substrate is filled with silicone oil . in a test performed on droplet actuator 700 , droplet operations are conducted atop the various electrodes to determine the droplet operations performance of the hydrophobic material deposited via the triton pecvd process with respect to silicone oil . fig7 shows a volume of fluid 722 at a reservoir electrode , which is the electrode of an on - actuator reservoir . a droplet 724 is dispensed from the fluid 722 at the on - actuator reservoir and transported along a line of droplet operations electrodes . fig7 shows that a droplet of fluid is successfully dispensed from the on - actuator reservoir . further , the size of the droplet is suitable for use in assay protocols and the droplet transported well . fig8 shows a top down view of a portion of a droplet actuator 800 that includes hydrophobic coatings applied using the gvd pecvd process at room temperature , which substantially corresponds to the process used in test # 4 of table 4 . droplet actuator 800 includes bottom substrate 810 . an electrode arrangement 820 is patterned on bottom substrate 810 . electrode arrangement 820 may include , for example , various reservoir electrodes ( of on - actuator reservoirs ) and droplet operations electrodes . in the top down view of droplet actuator 800 , bottom substrate 810 is visible through a substantially transparent top substrate , which is present but not visible . bottom substrate 810 and the top substrate ( not visible ) are separated by a gap . in this example , bottom substrate 810 is a pcb that is coated with m - type cytop ® coating per the liquid deposition process . however , the top substrate ( not visible ) is formed of ito - coated glass that is also coated with hydrophobic material per the gvd pecvd process at room temperature . the gap between bottom substrate 810 and the top substrate is filled with silicone oil . in a test performed on droplet actuator 800 , droplet operations are conducted atop the various electrodes to determine the droplet operations performance of the hydrophobic material deposited via the gvd pecvd process at room temperature with respect to silicone oil . fig8 shows a volume of fluid 822 at a reservoir electrode , which is the electrode of an on - actuator reservoir . a droplet 824 is dispensed from the fluid 822 at the on - actuator reservoir and transported along a line of droplet operations electrodes . fig8 shows that a droplet of fluid is successfully dispensed from the on - actuator reservoir . further , the size of the droplet is suitable for use in assay protocols and the droplet transported well . fig9 shows a top down view of a portion of a droplet actuator 900 that includes hydrophobic coatings applied using the gvd pecvd process at high temperature ( e . g ., about 125 ° c . ), which substantially corresponds to the process used in test # 5 of table 4 . droplet actuator 900 includes bottom substrate 910 . an electrode arrangement 920 is patterned on bottom substrate 910 . electrode arrangement 920 may include , for example , various reservoir electrodes ( of on - actuator reservoirs ) and droplet operations electrodes . in the top down view of droplet actuator 900 , bottom substrate 910 is visible through a substantially transparent top substrate , which is present but not visible . bottom substrate 910 and the top substrate ( not visible ) are separated by a gap . in this example , bottom substrate 910 is a pcb that is coated with m - type cytop ® coating per the liquid deposition process . however , the top substrate ( not visible ) is formed of ito - coated glass that is also coated with hydrophobic material per the gvd pecvd process at high temperature . the gap between bottom substrate 910 and the top substrate is filled with silicone oil . in a test performed on droplet actuator 900 , droplet operations are conducted atop the various electrodes to determine the droplet operations performance of the hydrophobic material deposited via the gvd pecvd process at high temperature with respect to silicone oil . fig9 shows a volume of fluid 922 at a reservoir electrode , which is the electrode of an on - actuator reservoir . a droplet 924 is dispensed from the fluid 922 at the on - actuator reservoir and transported along a line of droplet operations electrodes . fig9 shows that a droplet of fluid is successfully dispensed from the on - actuator reservoir . further , the size of the droplet is suitable for use in assay protocols and the droplet transported well . referring again to table 4 and fig5 a through 9 , the samples having a water contact angle ( θ ) greater than about 100 correlate to the samples having the most suitable droplet operations performance . for example , the samples of tests # 1 , # 3 , # 4 , and # 5 have water contact angles ( θ ) greater than about 100 , while the corresponding droplet actuators 300 , 500 , 600 , and 700 , respectively , demonstrated suitable droplet operations performance by contrast , the sample of test # 2 has a water contact angle ( θ ) of about 85 and the corresponding droplet actuator 400 did not demonstrate suitable droplet operations performance . therefore , in certain circumstances , the plasmatreat pecvd process may be a less desirable process for depositing hydrophobic material on a droplet actuator . additionally , while the hydrophobic material deposited via the gvd pecvd process at room temperature and at high temperature provides a good hydrophobic surface , the hydrophobic surface is brittle . therefore , in certain circumstances , the gvd pecvd process may not be a preferred process for depositing hydrophobic material on a droplet actuator . as a result , the m - type cytop ® coating liquid deposition process and the triton pecvd process may be a less desirable processes for depositing hydrophobic material on a droplet actuator . with respect to the m - type cytop ® coating liquid deposition process , currently the m - type cytop ® coating is cured at about 93 ° c . for 1 hour . tests were performed to evaluate the water contact angle ( θ ) and hysteresis when m - type cytop ® coating samples are cured at up to about 200 ° c ., before and after exposure to galden ® ht170 fluid ( a perfluoropolyether ) for about 2 hours . the galden ® ht170 fluid is an example of a specific brand of perfluorinated solvent that is available from solvay solexis ( west deptford , n . j .). m - type cytop ® coating samples were prepared and cured at various temperatures in order to evaluate the chemical stability to galden ® ht170 fluid . the preference is that the high temperature cure results in little or no change in water contact angle ( θ ) and hysteresis . table 5 shows chemical stability results of samples treated with m - type cytop ® coating process vs . gvd pecvd process vs . triton pecvd process before and after exposure to galden ® ht170 fluid . in each test , a droplet was deposited on the glass slide and the water contact angle ( θ ) and hysteresis were measured . in the process of testing the samples before and after exposure to galden ® ht170 fluid , the samples were washed with isopropyl alcohol between runs . referring to table 5 , the test results show a slight decrease in water contact angle ( θ ) after exposure to galden ® ht170 fluid . the ht170 did not affect the droplet operations performance for m - type cytop ® coating cured at low temperature ( 93 ° c . ), mid - temperature ( 120 ° c . ), and high temperature ( 160 ° c .). referring now to table 6 , tests were performed before and after exposure to novec ™ 7500 engineered fluid ( available from 3m of st . paul , minn .) for about 2 hours . m - type cytop ® coating samples were prepared and cured at various temperatures in order to evaluate the chemical stability to the novec ™ 7500 fluid . referring again to tables 4 and 5 , with respect to the m - type cytop ® coating liquid deposition process , the extra - high temperature process ( i . e ., 160 ° c . to 200 ° c .) for about 1 hour may be the preferred process . optionally , the high temperature cure step and / or the extra - high temperature cure step may be preceded by a prebake step at 80 ° c . for about 30 minutes . fig1 illustrates a functional block diagram of an example of a microfluidics system 1000 that includes a droplet actuator 1005 . digital microfluidic technology conducts droplet operations on discrete droplets in a droplet actuator , such as droplet actuator 1005 , by electrical control of their surface tension ( electrowetting ). the droplets may be sandwiched between two substrates of droplet actuator 1005 , a bottom substrate and a top substrate separated by a droplet operations gap . the bottom substrate may include an arrangement of electrically addressable electrodes . the top substrate may include a reference electrode plane made , for example , from conductive ink or indium tin oxide ( ito ). the bottom substrate and the top substrate may be coated with a hydrophobic material . droplet operations are conducted in the droplet operations gap . the space around the droplets ( i . e ., the gap between bottom and top substrates ) may be filled with an immiscible inert fluid , such as silicone oil , to prevent evaporation of the droplets and to facilitate their transport within the device . other droplet operations may be effected by varying the patterns of voltage activation ; examples include merging , splitting , mixing , and dispensing of droplets . droplet actuator 1005 may be designed to fit onto an instrument deck ( not shown ) of microfluidics system 1000 . the instrument deck may hold droplet actuator 1005 and house other droplet actuator features , such as , but not limited to , one or more magnets and one or more heating devices . for example , the instrument deck may house one or more magnets 1010 , which may be permanent magnets . optionally , the instrument deck may house one or more electromagnets 1015 . magnets 1010 and / or electromagnets 1015 are positioned in relation to droplet actuator 1005 for immobilization of magnetically responsive beads . optionally , the positions of magnets 1010 and / or electromagnets 1015 may be controlled by a motor 1020 . additionally , the instrument deck may house one or more heating devices 1025 for controlling the temperature within , for example , certain reaction and / or washing zones of droplet actuator 1005 . in one example , heating devices 1025 may be heater bars that are positioned in relation to droplet actuator 1005 for providing thermal control thereof . a controller 1030 of microfluidics system 1000 is electrically coupled to various hardware components of the invention , such as droplet actuator 1005 , electromagnets 1015 , motor 1020 , and heating devices 1025 , as well as to a detector 1035 , an impedance sensing system 1040 , and any other input and / or output devices ( not shown ). controller 1030 controls the overall operation of microfluidics system 1000 . controller 1030 may , for example , be a general purpose computer , special purpose computer , personal computer , or other programmable data processing apparatus . controller 1030 serves to provide processing capabilities , such as storing , interpreting , and / or executing software instructions , as well as controlling the overall operation of the system . controller 1030 may be configured and programmed to control data and / or power aspects of these devices . for example , in one aspect , with respect to droplet actuator 1005 , controller 1030 controls droplet manipulation by activating / deactivating electrodes . in one example , detector 1035 may be an imaging system that is positioned in relation to droplet actuator 1005 . in one example , the imaging system may include one or more light - emitting diodes ( leds ) ( i . e ., an illumination source ) and a digital image capture device , such as a charge - coupled device ( ccd ) camera . impedance sensing system 1040 may be any circuitry for detecting impedance at a specific electrode of droplet actuator 1005 . in one example , impedance sensing system 1040 may be an impedance spectrometer . impedance sensing system 1040 may be used to monitor the capacitive loading of any electrode , such as any droplet operations electrode , with or without a droplet thereon . for examples of suitable capacitance detection techniques , see sturmer et al ., international patent publication no . wo / 2008 / 101194 , entitled “ capacitance detection in a droplet actuator ,” published on aug . 21 , 2008 ; and kale et al ., international patent publication no . wo / 2002 / 080822 , entitled “ system and method for dispensing liquids ,” published on oct . 17 , 2002 ; the entire disclosures of which are incorporated herein by reference . droplet actuator 1005 may include disruption device 1045 . disruption device 1045 may include any device that promotes disruption ( lysis ) of materials , such as tissues , cells and spores in a droplet actuator . disruption device 1045 may , for example , be a sonication mechanism , a heating mechanism , a mechanical shearing mechanism , a bead beating mechanism , physical features incorporated into the droplet actuator 1005 , an electric field generating mechanism , a thermal cycling mechanism , and any combinations thereof . disruption device 1045 may be controlled by controller 1030 . it will be appreciated that various aspects of the invention may be embodied as a method , system , computer readable medium , and / or computer program product . aspects of the invention may take the form of hardware embodiments , software embodiments ( including firmware , resident software , micro - code , etc . ), or embodiments combining software and hardware aspects that may all generally be referred to herein as a “ circuit ,” “ module ” or “ system .” furthermore , the methods of the invention may take the form of a computer program product on a computer - usable storage medium having computer - usable program code embodied in the medium . any suitable computer useable medium may be utilized for software aspects of the invention . the computer - usable or computer - readable medium may be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . the computer readable medium may include transitory and / or non - transitory embodiments . more specific examples ( a non - exhaustive list ) of the computer - readable medium would include some or all of the following : an electrical connection having one or more wires , a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), an optical fiber , a portable compact disc read - only memory ( cd - rom ), an optical storage device , a transmission medium such as those supporting the internet or an intranet , or a magnetic storage device . note that the computer - usable or computer - readable medium could even be paper or another suitable medium upon which the program is printed , as the program can be electronically captured , via , for instance , optical scanning of the paper or other medium , then compiled , interpreted , or otherwise processed in a suitable manner , if necessary , and then stored in a computer memory . in the context of this document , a computer - usable or computer - readable medium may be any medium that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . program code for carrying out operations of the invention may be written in an object oriented programming language such as java , smalltalk , c ++ or the like . however , the program code for carrying out operations of the invention may also be written in conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the program code may be executed by a processor , application specific integrated circuit ( asic ), or other component that executes the program code . the program code may be simply referred to as a software application that is stored in memory ( such as the computer readable medium discussed above ). the program code may cause the processor ( or any processor - controlled device ) to produce a graphical user interface (“ gui ”). the graphical user interface may be visually produced on a display device , yet the graphical user interface may also have audible features . the program code , however , may operate in any processor - controlled device , such as a computer , server , personal digital assistant , phone , television , or any processor - controlled device utilizing the processor and / or a digital signal processor . the program code may locally and / or remotely execute . the program code , for example , may be entirely or partially stored in local memory of the processor - controlled device . the program code , however , may also be at least partially remotely stored , accessed , and downloaded to the processor - controlled device . a user &# 39 ; s computer , for example , may entirely execute the program code or only partly execute the program code . the program code may be a stand - alone software package that is at least partly on the user &# 39 ; s computer and / or partly executed on a remote computer or entirely on a remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through a communications network . the invention may be applied regardless of networking environment . the communications network may be a cable network operating in the radio - frequency domain and / or the internet protocol ( ip ) domain . the communications network , however , may also include a distributed computing network , such as the internet ( sometimes alternatively known as the “ world wide web ”), an intranet , a local - area network ( lan ), and / or a wide - area network ( wan ). the communications network may include coaxial cables , copper wires , fiber optic lines , and / or hybrid - coaxial lines . the communications network may even include wireless portions utilizing any portion of the electromagnetic spectrum and any signaling standard ( such as the ieee 802 family of standards , gsm / cdma / tdma or any cellular standard , and / or the ism band ). the communications network may even include powerline portions , in which signals are communicated via electrical wiring . the invention may be applied to any wireless / wireline communications network , regardless of physical componentry , physical configuration , or communications standard ( s ). certain aspects of invention are described with reference to various methods and method steps . it will be understood that each method step can be implemented by the program code and / or by machine instructions . the program code and / or the machine instructions may create means for implementing the functions / acts specified in the methods . the program code may also be stored in a computer - readable memory that can direct the processor , computer , or other programmable data processing apparatus to function in a particular manner , such that the program code stored in the computer - readable memory produce or transform an article of manufacture including instruction means which implement various aspects of the method steps . the program code may also be loaded onto a computer or other programmable data processing apparatus to cause a series of operational steps to be performed to produce a processor / computer implemented process such that the program code provides steps for implementing various functions / acts specified in the methods of the invention . the foregoing detailed description of embodiments refers to the accompanying drawings , which illustrate specific embodiments of the invention . other embodiments having different structures and operations do not depart from the scope of the present invention . the term “ the invention ” or the like is used with reference to certain specific examples of the many alternative aspects or embodiments of the applicants &# 39 ; invention set forth in this specification , and neither its use nor its absence is intended to limit the scope of the applicants &# 39 ; invention or the scope of the claims . this specification is divided into sections for the convenience of the reader only . headings should not be construed as limiting of the scope of the invention . the definitions are intended as a part of the description of the invention . it will be understood that various details of the present invention may be changed without departing from the scope of the present invention . furthermore , the foregoing description is for the purpose of illustration only , and not for the purpose of limitation . | 1 |
we have found surprisingly that peroxy acid compounds of the invention can be contacted directly with living plant tissue in the form of a seed , a cutting , a root stock , graft , tuber juvenile or adult plant and reduced microbial populations without substantially affecting the health of the living tissue . the invention is also based upon the surprising discovery that when a c 5 - c 12 peroxyacid is combined with a c 2 - c 4 peroxycarboxylic acid , a synergistic effect is produced and greatly enhanced antimicrobial activity is exhibited when compared to the c 8 - c 12 peroxyacid or the c 2 - c 4 peroxycarboxylic acid alone . the present blend of a c 8 - c 12 peroxyacid and a c 2 - c 4 peroxycarboxylic acid can effectively kill microorganisms ( e . g ., a 5 log 10 reduction in 30 seconds ) from a concentration level below 100 ppm and as low as 20 ppm of the peracid blend . a variety of c 5 - c 12 peroxyacids may be employed in the composition of the invention such as peroxyfatty acids , monoperoxy - or diperoxydicarboxylic acids , and peroxyaromatic acids . the c 5 - c 12 peroxyacids employed in the present invention may be structurally represented as : r 1 — co 3 h , wherein r 1 is a hydrocarbon moiety having from about 4 to 11 carbon atoms . r 1 may have substituents in the chain , e . g ., — oh , co 2 h , or heteroatoms ( e . g ., — o — as in alkylether carboxylic acids ), as long as the antimicrobial properties of the overall composition are not significantly affected . it should be recognized that “ r 1 ” substituents or heteroatoms may change the overall acidity ( i . e ., pka ) of the carboxylic acids herein described . such modification is within the contemplation of the present invention provided the advantageous antimicrobial performance is maintained . furthermore , r 1 may be linear , branched , cyclic or aromatic . preferred hydrocarbon moieties ( i . e . preferred r 1 &# 39 ; s ) include linear , saturated , hydrocarbon aliphatic moieties having from 7 to 11 carbon atoms ( or 8 to 12 carbon atoms per molecule ). specific examples of suitable c 8 - c 12 carboxylic fatty acids which can be reacted with hydrogen peroxide to form peroxyfatty acids include such saturated fatty acids as caprylic ( octanoic ) ( c 8 ), pelargonic ( nonanoic ) ( c 9 ), capric ( decanoic ) ( c 10 ), undecyclic ( undecanoic ) ( c 11 ), lauric ( dodecanoic ) ( c 12 . these acids can be derived from both natural and synthetic sources . natural sources include animal and vegetable fats or oils which should be fully hydrogenated . synthetic acids can be produced by the oxidation of petroleum wax . particularly preferred peroxyfatty acids for use in the composition of the invention are linear monoperoxy aliphatic fatty acids such as peroxyoctanoic acid , peroxydecanoic acid , or mixtures thereof . other suitable peroxyacids are derived from the oxidation of dicarboxylic acids and aromatic acids . suitable dicarboxylic acids include sebacic acid ( c 10 ). an example of a suitable aromatic acid is benzoic acid . these acids can be reacted with hydrogen peroxide to form the peracid form suitable for use in the composition of the invention . preferred peracids in this group include monoperoxy - or diperoxyadipic acid , monoperoxy - or diperoxysebacic acid , and peroxybenzoic acid . the above peroxyacids provide antibacterial activity against a wide variety of microorganisms , such as gram positive ( e . g ., staphylococcus aureus ) and gram negative ( e . g ., escherichia coli , salmonella , etc .) microorganisms , yeast , molds , bacterial spores , etc . when the above c 5 - c 12 peroxyacids are combined with a c 2 - c 4 peroxycarboxylic acid , greatly enhanced activity is shown compared to the c 2 - c 4 peroxycarboxylic acid alone or the c 8 - c 12 peroxyacid alone . the c 2 - c 4 peroxycarboxylic acid component can be derived from a c 2 - c 4 carboxylic acid or dicarboxylic acid by reacting the acid , or the corresponding anhydride or acid chloride , with hydrogen peroxide . examples of suitable c 2 - c 4 carboxylic acids include acetic acid , propionic acid , glycolic acid , and succinic acid or their corresponding anhydrides or acid chlorides . preferable c 2 - c 4 peroxycarboxylic acids for use in the composition of the invention include peroxyacetic acid , peroxypropionic acid , peroxyglycolic acid , peroxysuccinic acid , or mixtures thereof . the antimicrobial concentrate of the present invention can comprise about 0 . 1 to 20 wt . %, preferably about 0 . 1 to 5 wt . %, and most preferably about 0 . 1 to 2 wt . % of a c 8 - c 12 peroxyacid , and about 1 to 20 wt . %, preferably about 1 to 15 wt . % and most preferably 4 - 15 wt . % of a c 2 - c 4 peroxycarboxylic acid . the concentrate composition preferably has a weight ratio of c 2 - c 4 peroxycarboxylic acid to c 8 - c 12 peroxyacid of about 15 : 1 to 1 : 1 . the concentrate contains sufficient acid so that the end use solution has a ph of about 2 to 8 , preferably about 3 to 7 . some acidity may come from an inert acidulant which may be optionally added ( e . g ., sulfinic or phosphoric acid ). the peracid components used in the composition of the invention can be produced in a simple manner by mixing a hydrogen peroxide ( h 2 o 2 ) solution , or by utilizing powdered peroxide generators such as percarbonates or perborates , with the desired amount of acid . with the higher molecular weight fatty acids , a hydrotrope coupler may be required to help solubilize the fatty acid . the h 2 o 2 solution also can be added to previously made peracids such as peracetic acid or various perfatty acids to produce the peracid composition of the invention . the concentrate can contain about 1 to 30 wt . %, preferably about 5 to 25 wt . % of hydrogen peroxide . the concentrate composition can further comprise a free c 8 - c 12 carboxylic acid , a free c 2 - c 4 carboxylic acid , or mixtures thereof . the free acids will preferably correspond to the starting materials used in the preparation of the peroxyacid components . the free c 8 - c 12 carboxylic acid is preferably linear and saturated , has 8 to 12 carbon atoms per molecule , and can also comprise a mixture of acids . the free c 8 - c 12 carboxylic acid and free c 2 - c 4 carboxylic acid can be present as a result of an equilibrium reaction with the hydrogen peroxide to form the peroxyacids . various optional materials may be added to the composition of the invention to help solubilize the fatty acids , restrict or enhance the formation of foam , to control hard water , to stabilize the composition , or to further enhance the antimicrobial activity of the composition . the composition of the invention can contain a surfactant hydrotrope coupling agent or solubilizer that permits blending short chain perfatty acids in aqueous liquids . functionally speaking , the suitable couplers which can be employed are non - toxic and retain the fatty acid and the perfatty acid in aqueous solution throughout the temperature range and concentration to which a concentrate or any use solution is exposed . any hydrotrope coupler may be used provided it does not react with the other components of the composition or negatively affect the antimicrobial properties of the composition . representative classes of hydrotropic coupling agents or solubilizers which can be employed include anionic surfactants such as alkyl sulfates and alkane sulfonates , linear alkyl benzene or naphthalene sulfonates , secondary alkane sulfonates , alkyl ether sulfates or sulfonates , alkyl phosphates or phosphonates , dialkyl sulfosuccinic acid esters , sugar esters ( e . g ., sorbitan esters ), amine oxides ( mono -, di -, or tri - alkyl ) and c 8 - c 10 alkyl glucosides . preferred coupling agents for use in the present invention include n - octanesulfonate , available as nas 8d from ecolab , n - octyl dimethylamine oxide , and the commonly available aromatic sulfonates such as the alkyl benzene sulfonates ( e . g . xylene sulfonates ) or naphthalene sulfonates . some of the above hydrotropic coupling agents independently exhibit antimicrobial activity at low ph . this adds to the efficacy of the present invention , but is not the primary criterion used in selecting an appropriate coupling agent . since it is the presence of perfatty acid in the protonated neutral state which provides biocidal activity , the coupling agent should be selected not for its independent antimicrobial activity but for its ability to provide effective interaction between the substantially insoluble perfatty acids described herein and the microorganisms which the present compositions control . the hydrotrope coupling agent can comprise about 0 . 1 to 30 wt . %, preferably about 1 to 15 wt . %, and most preferably about 2 to 15 wt . % of the concentrate composition . compounds such as mono , di and trialkyl phosphate esters may be added to the composition to suppress foam . such phosphate esters would generally be produced from aliphatic linear alcohols , there being from 8 to 12 carbon atoms in the aliphatic portions of the alkyl phosphate esters . alkyl phosphate esters possess some antimicrobial activity in their own right under the conditions of the present invention . this antimicrobial activity also tends to add to the overall antimicrobial activity of the present compositions even though the phosphate esters may be added for other reasons . furthermore , the addition of nonionic surfactants would tend to reduce foam formation herein . such materials tend to enhance performance of the other components of the composition , particularly useful nonionic surfactant for use as a defoamer is nonylphenol having an average of 12 moles of ethylene oxide condensed thereon , it being encapped with a hydrophobic portion comprising an average of 30 moles of propylene oxide . chelating agents can be added to the composition of the invention to enhance biological activity , cleaning performance and stability of the peroxyacids . for example , 1 - hydroxyethylidene - 1 , 1 - diphosphonic acid commercially available from the monsanto company under the designation “ dequest ” has been found to be effective . chelating agents can be added to the present composition to control or sequester hardness ions such as calcium and magnesium . in this manner both detergency and sanitization capability can be enhanced . other materials which are sufficiently stable at the low ph contemplated by the present composition may be added to the composition to impart desirable qualities depending upon the intended ultimate use . for example , phosphoric acid ( h 3 po 4 ) can be added to the composition of the invention . additional compounds can be added to the concentrate ( and thus ultimately to the use solution ) to change its color or odor , to adjust its viscosity , to enhance its thermal ( i . e ., freeze - thaw ) stability or to provide other qualities which tend to make it more marketable . the composition of the invention can be made by combining by simply mixing an effective amount of a c 8 - c 12 peroxyacid such as a peroxyfatty acid with some source of a c 2 - c 4 peroxycarboxylic acid such as peroxyacetic acid . this composition would be formulated with preformed perfatty acid and preformed peroxyacetic acid . a preferred composition of the invention can be made by mixing a c 2 - c 4 carboxylic acid , a c 8 - c 12 carboxylic acid , a coupler and a stabilizer and reacting this mixture with hydrogen peroxide . a stable equilibrium mixture is produced containing a c 2 - c 4 peroxycarboxylic acid and a c 8 - c 12 peroxyacid by allowing the mixture to stand for from one to seven days at 15 ° c . to 25 ° c . as with any aqueous reaction of hydrogen peroxide with a free carboxylic acid , this gives a true equilibrium mixture . in this case , the equilibrium mixture will contain hydrogen peroxide , a c 2 - c 4 peroxycarboxylic acid , a c 8 - c 12 carboxylic acid , a c 2 - c 4 peroxycarboxylic acid , a c 8 - c 12 peroxyacid , water , and various couplers and stabilizers . by using the above approach , the composition of the invention can be formulated by merely mixing readily available raw materials , e . g ., acetic acid , hydrogen peroxide and fatty acid . by allowing solution time for equilibrium to be obtained , the product containing both of the active biocides is obtained . in varying the ratio of c 2 - c 4 carboxylic acid to c 8 - c 12 carboxylic acid , it is easy to vary the ratio of c 2 - c 4 peroxycarboxylic acid to c 8 - c 12 peroxyacid . the present invention contemplates a concentrate composition which is diluted to a use solution prior to its utilization as a microbicide . primarily for reasons of economics , the concentrate would normally be marketed and the end user would dilute the concentrate with water to a use solution . a preferred antimicrobial concentrate composition comprises about 0 . 1 to 20 wt . %, preferably about 0 . 1 to 5 wt . %, of a c 8 - c 12 peroxyfatty acid , about 1 to 20 wt . % of a c 2 - c 4 peroxycarboxylic acid , about 1 to 15 wt . % of a hydrotrope coupling agent , and about 1 to 30 wt . % of hydrogen peroxide . other acidulants may optionally be employed in the composition such as phosphoric acid . the level of active components in the concentrate composition is dependent upon the intended dilution factor and desired acidity in the use solution . the c 8 - c 12 peroxyacid component is generally obtained by reacting a c 8 - c 12 carboxylic acid with hydrogen peroxide in the presence of a c 2 - c 4 carboxylic acid . the resulting concentrate is diluted with water to provide the use solution . generally , a dilution of 1 fluid oz . to 4 gallons ( i . e . dilution of 1 to 500 by volume ) of water can be obtained with 2 % to 20 % total peracids in the concentrate . the compositions of the invention can be applied to growing plant tissue in a variety of techniques . the aqueous solution can be sprayed , painted , daubed , fogged , flooded onto or into the plant , the plant hydroponic substrate , the agricultural earth . the material can be reapplied periodically as needed . the examples given herein describe the treatment of a snow mold fungus isolated from a mountain ash ( sorbus americana ) tree . testing consisted of an untreated control versus treating the fungus with peroxy acetic acid ( poaa ) ( c 2 ) and peroxyacetic / peroxyoctanoic ( poaa / pooa ) ( c 2 / c 8 ) composition . this testing showed that the latter was very effective in killing the fungus . thus , approximately 10 cm 2 of “ snow mold ” was removed from the branch section and split it into three parts ; putting each into water . one section was untreated . a second was treated with 500 ppm peroxyacetic acid , and a third was treated using a mixed peracid system ( c 2 / c 8 ). after two days : 1 . the control was still thriving and very moist to the touch ; with a large jelly - like volume of fungi . 2 . the poaa sample treated was approximately ½ dead with what appears to be a dead outer crust over approximately ⅔ the sample and a dried completely dead patch over the rest . the ⅔ crusted area still had the soft jelly - like mass . 3 . the c2 / c8 penoxyacid blend treated fungi appeared all dead and dried up . no mass of jelly left . the study was conducted on growing plant tissues using sprays done before 8 : 00 am . testing was conducted on usually disease free plants to investigate possible side effects such as burning of plant tissue . the data demonstrates both peracid compositions to be similar in effect to the growing plant tissue during application ; with both being relatively inert on the tissue surfaces except for high surface area crops such as asparagus leaves ( no effect on stems ). b same test plants and test area as per previous table , unless noted . minimum inhibitory concentration of peracetic acid vs . mixed peracid composition against botrytis cinera plant pathogen this example compares the effect of the prior art using peracetic acid ( poaa ) vs . the combination peracid formula of the present invention . the objective is to determine the minimum inhibitory concentrations against the botrytis cinera atcc 11542 plant pathogen organism . botrytis cinera culture was prepared by inoculating the center of ten sabouraud dextrose agar filled dishes and incubating at 26 ° c .- 30 ° for 15 days . mycelial mats were removed by adding 10 ml of sterile water and using a sterile spatula to brush the microbial growth from agar surface . the suspension was transferred to tissue grinder and macerated with 10 - 25 ml of sterile water , then filtered through cheesecloth and stored in a glass bottle at 4 ° c . until test time . product dilutions were prepared in a sabouraud dextrose broth at levels of % poaa adjusted to deliver a part per million consternation of 30 , 45 , 60 , 75 , 150 and 300 . solutions were inoculated with 0 . 5 ml of the prepared culture suspensions and incubated at 26 ° c .- 30 ° c . for 15 days to observe growth . one tube of sabouraud dextrose broth was used as a positive growth control for each culture , and 1 tube was used to observe sterility of broth . table 1 compares the minimum inhibitory concentration ( the lowest peracid efficacy level to impart no growth in the plant pathogen ) of the mixed peracid compositions ( line 1 ) and those of the single peracid ( lines 2 ) for the reduction of common plant pathogens . the results demonstrate the 5 - fold improved efficacy results of the mixed peracid compositions for the reduction of botrytis cinera atcc 11542 ( cf ., lines 1 and 2 ); i . e ., the minimum inhibitory concentration for controlling botrytis cinera is 60 ppm peracid with the current formulas , while 300 ppm peracid is required using the prior art . table 2 compares the antimicrobial effect of using the present mixed peracid system and prior known materials as fruit and vegetable treatments for human pathogen reduction . thus , we compare the novel mixed c 2 / c 8 peracid system to of using sodium hypochlorite or peracetic acid . testing was performed on three produce surfaces : tomatoes , leaf lettuce and apples , and also using four test organisms — listeria monocytogenes , salmonella javiana , natural bacteria flora , and penicillium expansum . for the pathogenic organisms , a 1 : 10 dilution of a 10 7 cfu / ml test system suspension was prepared . 50 grams of the leaf lettuce , a whole tomato , or whole apple were placed into a plastic bag . each bag was inoculated with 10 . 0 ml test system suspension resulting in an inoculum level of 10 7 cfu / ml ( colony forming units per milliliter ). bags were gently shaken for even distribution of the test system for 5 minutes . the produce types were then stored overnight at 4 ° c . untreated controls ( no bacterial inoculum — 10 ml of phosphate buffered dilution water ) were also prepared . two liter volumes of the test solutions were prepared in 4 liter beakers . solutions were prepared in laboratory tap water to simulate industry conditions . the vegetables were then exposed to the test solution by submersion for 5 minutes at 72 ° f . at the end of the specified exposure time , the vegetables were removed from the test solution and thoroughly rinsed under fresh running tap water . fifty grams of the vegetable ( lettuce ) or whole produce ( tomato or apple )+ 100 ml buffered dilution water were placed into a stomacher bag . the vegetables were stomached ( lettuce ) or massaged ( tomato or apple ) for 60 seconds . serial dilutions were made and plated on tge ( salmonella ), sab ( penicillium ) and bhi ( listeria ). plates were incubated at 35 ° c . for 48 hours . the following controls were performed in each test : untreated control ( no inoculation , no chemical treatment ) for the background microbial load , an inoculated control ( inoculated but no chemical treatment ) for the inoculum plus background microbial load on vegetable surface , and a tap water control with a serial dilution to determine if microbial contamination was present in the rinse water or product dilutent . the results demonstrate the enhanced effectiveness of the mixed peracid system vs . the conventional ( sodium hypochlorite or peracetic acid ) treatment systems . thus , substantial improvements over the sodium hypochlorite treatments are found when using the peracid formulas . additionally , the mixed peracid composition of the present invention ( c 2 / c 8 ) yields log reduction improvements of 0 . 5 - 1 . 0 log vs . a single c 2 peracid composition ; or comparable log reductions using 50 % less of the active peracids . example 3 compares the temperature effect of using peracetic acid ( poaa ) vs . a mixed peracid system under cold water applications . the experiments were run as in example 2 ; however , a cold water ( 40 ° f .) application temperature was used . in contrast to the experiments of table 2 where peracetic acid applications outperformed sodium hypochlorite for surface reduction of microbials , the results of table 3 demonstrate that colder treatment temperatures impedes the activity of the single peracid composition . conversely , the mixed peracid system is unexpectedly less effected , and still substantially outperforms the known systems . the objective of this example was to compare the use of a single peracid vs . mixed peracids for microbial reduction during hydroponic growth of alfalfa sprouts . ongoing concern in the industry is the control of microbial populations ; especially human and plant patogenics , but also nutrition - solution molds and fungi . the following test as conducted to determine potential microbial control during the hydroponic growing cycle . table 4 compares the results of utilizing the continuous hydroponic treatment technique of the present invention in contrast to u . s . pat . no . 5 , 168 , 655 which utilizes peracetic acid disinfection of hydroponic substrates ; i . e ., substantial (& gt ; 5 - log ) microbial reductions can be found if the peracid treatment is ongoing vs . essentially no reduction if only the substrate is treated to hydroponic growth . 2 the water control was used as the background basis for the treatment efficiency log reductions for each treatment day . typically log counts of ˜ 1 × 10 9 cfu / ml were found . 3 poaa - pooa = peroxyacetic acid from an equilibrium composition , using the method of application of us 5 , 168 , 655 . 4 poaa = peroxyacetic - peroxyoctanoic acids from an equilibrium composition , using the current art method of application . poaa and poaa - pooa treatment of alfalfa sprouts with variable concentrations of peracids the objective of this example was to evaluate microbial reduction using peracid misting during the daily hydroponic growth of alfalfa sprouts ; against natural bacterial flora . commercially , bean and alfalfa sprouts are grown by overhead misting of seed plates for 3 - 5 days . the sprouts are harvested and the seed waste disposed of . an ongoing concern in the industry is the control of microbial populations ; especially human and plant pathogenics , but also nutrition - solution molds and fungi . the following test was conducted to determine potential microbial control during the hydroponic growing cycle . the alfalfa sprouts were soaked in various concentrations of equilibrium obtained peracetic ( poaa ) or peracetic - peroctanoic poaa - pooa solutions . one sample was soaked in water as a control . the following morning the alfalfa sprouts were placed into a sterile petri dish by evenly spreading the seeds on the bottom of the dish . the petri dishes were covered with cheese cloth for the growing procedure . during growing ( days 1 - 4 ) the alfalfa seeds were treated twice daily at 8 : 00 am and 4 : 45 pm by misting with 10 ml of the same concentration of peracid in which they were soaked . the water control was misted with water . microbial samplings were taken at 8 : 00 am each of the 4 treatment days . a 1 : 10 , wt : wt , mixture of sprout : water was stomached and plated onto tge agar subculture media using a pour plate technique with phosphate buffered dilutions of 10 − 3 , 10 − 5 , 10 − 7 . after 48 hours at 35 ° c . the micro results were determined and are shown in table 2 : the results of table 5 demonstrate the ability to effect microbial populations during hydroponic growth of plant tissue using continuous peracid applications . in contrast to u . s . pat . no . 5 , 168 , 655 which utilizes peracetic acid disinfection of hydroponic substrates prior to a crop production cycle , the microbial peracids of the present invention demonstrates the novel utility of using peracids to effect continuous microbial control during the entire hydroponic growth cycle , without loss to crop yield ( see examples 4 and 5 ). the data also indicates the need to modify the dosing procedure to enhance the microbial reduction near the end of the hydroponic cycle . this hypothesis is tested in example 3 . the objective of this example was to evaluate microbial reduction using a more continuous ( hourly ) peracid misting procedure during the daily hydroponic growth of alfalfa sprouts ; against natural bacterial flora . this should allow for a lower dosage profile of peracids . using the above microbial technique , the alfalfa sprouts were soaked in 80 ppm of poaa or poaa - pooa solutions . one sample was soaked in water as a control . the following morning the alfalfa sprouts were placed into a sterile petri dish by evenly spreading the seeds on the bottom of the dish . the petri dishes were covered with cheese cloth for the growing procedure . during growing ( days 1 - 4 ) the alfalfa seeds were treated from 8 : 00 am to 3 : 00 pm on an hourly basis by misting with 10 ml of the same concentration of peracid in which they were soaked . the water control was misted with water . microbial samplings were taken at 4 : 00 pm each of the 4 treatment days . the results of table 6 demonstrate the improved efficacy of : using a more continuous dosing system , and for using a mixed peracid system for microbial control during hydroponic growth of plant tissue . while peracetic acid can impart an initial ( day 1 - 2 ) microbial reduction vs . the control ( cf ., experiment 1 , 2 ), it fails after the 2nd growing day . conversely the mixed peracetic - peroctanoic acid ( poaa - pooa ) system yields continuous microbial control (& gt ; 20log ) over the entire sprout growing time ( experiment 3 ). for all the experiments the germination rate of the seed was greater than 95 %. the objective of this example was to evaluate microbial reduction using a continuous ( hourly over 24 - hours ) peracid misting procedure during the daily hydroponic growth of alfalfa sprouts ; against natural bacterial flora . using the above microbial technique , the alfalfa sprouts were soaked in 80 ppm or poaa or poaa - pooa solutions . one sample was soaked in water as a control . the following morning the alfalfa sprouts were placed into a sterile petri dish by evenly spreading the seeds on the bottom of the dish . the petri dishes were covered with cheese cloth or the growing procedure . during growing ( days 104 ) the alfalfa seeds were treated on an hourly basis ( over the entire 24 hour day ) by misting with 10 ml of the same concentration of peracid in which they were soaked . the water control was misted with water . microbial samplings were taken at 4 : 00 pm each of the 4 treatment days . the results of table 7 demonstrates the unexpected result that continuous 24 hour per day misting does not improve — over the previous examples 7 - times per day peracid mapplication — the final growing day microbial control efficacy for either peracid system during hydroponic production of plant tissue ( cf ., table 6 , experiments 2 , 3 vs . table 7 experiment 2 , 3 ). additionally , the germination yield dropped off tremendously (& lt ; 50 %) in all the 24 - hour per day studies as compared to the results of example 3 . the objective of this example was to evaluate the germination rate for the various peracid applications during the hydroponic growing cycle of alfalfa sprouts . using the above microbial technique , the alfalfa sprouts were soaked in 80 ppm of poaa or poaa - pooa solutions . one sample was soaked in water as a control . the following morning the alfalfa sprouts were placed into a sterile petri dish by evenly spreading the seeds on the bottom of the dish . the petri dishes were covered with cheese cloth for he growing procedure . during growing ( days 1 - 4 ) the alfalfa seeds were treated using various application times as per examples 2 - 4 by misting with 10 ml of the same concentration of peracid in which they were soaked . the water control was misted with water . after 4 days the germination rate was visually determined . the results of table 8 demonstrate : that proper selection of the application rate and peracid composition is necessary to impart both microbial reduction and hydroponic seed germination . both upper and lower application limits are found . a the water control was used as the background basis for the treatment efficiency log reduction at the end of the treatment cycle . hydroponic poaa and poaa - pooa treatments of alfalfa sprouts with a predosing misting procedure the objective of this example was to evaluate microbial reduction using a predosing of a peracid ( s ), followed by subsequent water - only mistings during the daily hydroponic growth of alfalfa sprouts ; against natural bacterial flora . again , this allows for a lower overall dosage profile of peracids . using the above microbial technique , the alfalfa sprouts were soaked in 80 ppm of poaa or poaa - pooa solutions for 16 hours . one sample was soaked in water as a control . the following morning the alfalfa sprouts were placed into a sterile petri dish by evenly spreading the seeds on the bottom of the dish . the petri dishes were covered with cheese cloth for the growing procedure . during growing ( days 1 - 4 ) the alfalfa seeds were treated from 8 : 00 am to 3 : 00 pm on an hourly basis by misting with water only ( no peracids in these subsequent hydroponic growth cycles ). likewise , the water control was misted with water . microbial samplings were taken at 4 : 00 pm each of the 4 treatment days . the results of table 9 demonstrate that the peracid systems impart a residual antimicrobial effect over the entire hydroponic growing cycle . surprisingly , the mixed peracid system yields a much improved efficacy verses the peracetic - alone formula ; i . e ., while peracetic acid can impart an initial ( day 1 ) microbial reduction (& gt ; 1 - log ) vs . the control ( cf , experiment 1 , 2 ), it fails after the 2nd growing day . conversely the mixed peracetic - peroctanoic acid ( poaa - pooa ) system yields continuous microbial control (& gt ; 2 - log ) over the entire sprout growing time ( experiment 3 ) even though the growing seeds were only inoculated in the peracid formula for all the experiments the germination rate of the seed was greater than 95 %. | 0 |
the beam steering method of the present invention is disclosed herein with particular regard to an illustrative optical beam steerer . this illustrative beam steerer , providing subaperture addressing of a multiplicity of phase shifters , is disclosed in detail in copending united states patent application , &# 34 ; optical beam steerer having subaperture addressing ,&# 34 ; filed for terry a . dorschner and daniel p . resler on the same day as the present application , and assigned to the assignee of the present invention . it is intended to incorporate by reference the teachings of the above - cited patent application into the present application . referring to fig1 there is shown , in diagrammatical cross - sectional view , a liquid crystal beam steering device 10 of the type described for use in the present invention . device 10 comprises a liquid crystal cell having windows 12 and 14 which are optically transparent at the frequency range of interest . common electrode 16 , affixed to window 12 , is electrically conductive and optically transparent . electrodes 18 1 , 18 2 , 18 3 , . . . , referred to collectively as electrodes 18 , affixed to window 14 , comprise a plurality of electrically - conductive , optically - transparent stripes . illustratively , for steering of carbon dioxide laser beams , electrodes 18 may be 4 - 10 micrometers ( μm ) in width , and spaced from one another by approximately one μm . the space between windows 12 and 14 is filled with a layer of liquid crystal molecules 20 , illustratively long , thin , rod - like organic molecules of the so - called &# 34 ; nematic &# 34 ; phase . the optical beam phase shifter 10 of fig1 is responsive to a light source and beam forming network ( not shown ) which provide a polarized light beam 22 , ranging from visible through far infrared . light beam 22 , represented in part by rays 22a - 22c , is directed onto window 14 of optical device 10 . light beam 22 may be incident perpendicular to the plane formed by stripe electrodes 18 , or it may be incident obliquely , preferably such that its projection onto the plane formed by stripe electrodes 18 is parallel to the longitudinal direction of electrodes 18 . it is characteristic of liquid crystal molecules whose orientation is well - defined by alignment layers as described above , that the application of an electric field perpendicular to the alignment layer affects the speed of light whose polarization is parallel to the alignment layers propagated therethrough , and hence , the retardance . thus , in the simplified example of fig1 the application of different potentials between common electrode 16 and the individual stripe electrodes 18 from control voltage generator 26 results in differential electric fields in the regions between the individual stripe electrodes 18 1 , 18 2 , 18 3 , . . . and common electrode 16 , thereby creating local variations of the refractive index in the liquid crystal layer 20 . in the present simplified example , the potentials applied to the electrodes 18 onto which rays 22a , 22b and 22c are incident , shown diagrammatically as staircase waveform 26a , are such as to cause the greatest retardation to emergent ray 24c , and the least retardation to emergent ray 24a . thus , the wavefront 17 of the beam 24 which emerges from the optical beam deflector 10 is tilted with respect to the incident wavefront . it is therefore seen that the optical beam deflector 10 of fig1 provides selective beam steering in accordance with the electrical potentials applied to stripe electrodes 18 . the application of control voltage signals to the individual stripe electrodes 18 for the purpose of beam steering is analogous to the methods used in conventional microwave radar beam steering as taught , for example , in radar handbook , m . i skolnik , ed ., mcgraw - hill , new york , 1970 , at chapter 11 . as shown by illustrative waveform 26a , a plurality of control voltage signals , being periodic in space and having a continuous progression of voltage steps within each period between a minimum value and a maximum value , may be applied to the multiplicity of stripe electrodes 18 . however , it is not intended to limit the present invention only to pluralities of control voltage signals which are periodic . operation of the beam steerer is as follows : a staircase of voltage 26a is applied to electrodes 18 , the voltage levels chosen to result in a uniform staircase , or an approximation to a ramp , of phase shift across the aperture . because the response of the liquid crystal is not linear , the voltage ramp does not necessarily comprise equal steps . the phase shifters may be operated modulo 2π , as with microwave arrays , to avoid the requirement of large phase shifts . the resultant &# 34 ; sawtooth &# 34 ; distribution of phase is equivalent to a single continuous phase ramp , which acts like a prism and steers the input beam according to the degree of phase ramp imposed . considering now the means for providing control voltages individually to the stripe electrodes 18 , the referenced dorschner et al . application discloses structure for combining the multiplicity of electrodes into a plurality of subarrays , wherein each subarray comprises a number of electrodes sufficient to provide an adequate distribution of beam steering angles for the intended application . referring now to fig2 a and 2b , there are shown diagrammatical plan and cross - sectional views , respectively , of a portion of a simplified beam steering assembly according to the principles of the present invention . the assembly includes a liquid crystal cell 52 having windows 40 and 44 and a layer of liquid crystal molecules 50 therebetween . as in the beam steering device 10 of fig1 cell 52 includes a common electrode 42 on an inner surface of window 44 , and a multiplicity of stripe electrodes 30 ( 1 , 1 ), 30 ( 1 , 2 ), . . . , 30 ( 1 , 6 ), 30 ( 2 , 1 ), . . . , 30 ( 2 , 6 ), . . . , 30 ( n , 1 ), . . . , 30 ( n , 6 ), referred to collectively as stripe electrodes 30 , on an inner surface of window 40 . it is therefore seen that the beam steering assembly of fig2 a and 2b comprises a large array of striped phase shifters , wherein each phase shifter is formed by one of the stripe electrodes 30 , the common electrode 42 and the liquid crystal molecules 50 therebetween . the phase shifters have a lateral dimension λ 0 = w + δ , where w is the width of the stripe electrode 30 , and δ is the gap between stripe electrodes 30 . the phase shifters uniformly cover substantially the entire aperture of the beam steering assembly . in accordance with the teachings of the dorschner et al . reference , a plurality of n subarrays 38 ( 1 ), . . . , 38 ( n ), referred to collectively as subarrays 38 , are formed by jumper straps 32 ( 1 ), 32 ( 2 ), . . . , 32 ( 6 ), referred to collectively as jumper straps 32 . for ease of illustration , a subarray size of six phase shifters is depicted . jumper strap 32 ( 1 ) interconnects stripe electrodes 30 ( 1 , 1 ), 30 ( 2 , 1 ), . . . , and 30 ( n , l ); jumper strap 32 ( 2 ) interconnects stripe electrodes 30 ( 1 , 2 ), 30 ( 2 , 2 ), . . . , and 30 ( n , 2 ); etc . jumper strap 32 ( 1 ) is connected to stripe electrode 30 ( 1 , 1 ) by conductor 34 ( 1 , 1 ), to stripe electrode 30 ( 2 , 1 ) by conductor 34 ( 2 , 1 ), . . . , and to stripe electrode 30 ( n , l ) by conductor 34 ( n , l ). in general , it may be said that jumper straps 32 ( i ) are connected to stripe electrodes 30 ( j , i ) by conductors 34 ( j , i ), wherein j runs from 1 to the number of subarrays , n , and i runs from 1 to the number of phase shifters , m , within each subarray . each jumper strap 32 ( i ) terminates in a contact pad 36 ( i ) for interconnection with external wiring for the purpose of application of control voltages thereto . similarly , conductor 46 is interconnected with common electrode 42 by conductor 44 , and terminates in a contact pad 48 for interconnection with an external lead for the purpose of application of a reference voltage thereto . in the example depicted in fig2 a and 2b , every sixth electrode 30 is connected in parallel , and there are just six address lines which must be connected via contact pads 36 to external power supplies , instead of the thousands which would ordinarily be required for apertures of one cm or larger . there is also a single ground connection required , independent of the number of electrodes 30 in a subarray 38 , or in the entire array . although the illustratively six phase shifters of each subarray 38 are independently addressable , each phase shifter is permanently connected in parallel to the corresponding phase shifter of each of the other subarrays 38 . thus , whatever spatial phase distribution is applied to one subarray 38 is repeated across the full aperture . the subarray - addressed optical beam steerer , disclosed herein and described in detail in the dorschner et al . reference , may be operated similarly to a conventional phased array , that is , a step - wise approximation to a phase ramp across the beam steering aperture is formed by the application of a corresponding staircase profile of voltages to the electrodes ( see fig1 ). as with conventional phased arrays , the phase ramps may be applied modulo 2π with maximum amplitude 2π . in the present example , however , only a limited number of ramp periods can be synthesized because only a limited number of phase shifters , namely m , the number in each subarray , are independently addressable . this limits the number of addressable beam positions ; however , a rather large number of positions are nevertheless possible , even for moderate subarray sizes , as is discussed below . identical ramps with periods nλ 0 which are integral factors of the subarray period mλ 0 can be applied without any discontinuities at the subarray edges . that is an important consideration for maintaining low levels of sidelobes . ramps comprised of n phase steps , with n given by ± 6 , ± 3 , ± 2 , and infinity , can be illustratively formed with the subarrays of fig2 a and 2b . each of these ramp periods corresponds to an addressable beam position given by θ = sin - 1 ( λ / nλ 0 ), where λ is the freespace wavelength of the optical beam . for the case of half - wave spacing , i . e ., λ = 2λ 0 , the set of angles obtainable is ± 19 . 47 °, ± 41 . 81 °, ± 90 °, and 0 °, respectively . these are large steering angles , which is a consequence of the subarray being very small . the 90 ° case is actually not of practical utility since very little energy would actually be steered in that direction ; the effective radiating area of the device reduces to zero . in general , subarrays with larger numbers of phase shifters include smaller steering angles . as an example , subarrays of 48 phase shifters give the distribution of steering angles shown in fig3 for the case of exact factorial periods ( labeled &# 34 ; ramp pitch &# 34 ; here ). a spacing λ 0 of one wavelength between the stripe electrodes of the phase shifters has been assumed . only those angles subtending a ± 10 ° field of regard are shown ; that is a fairly typical range of interest . it may be seen from fig3 that the distribution of obtainable angles is fairly uniform and is , in fact , approximately multiples of the smallest steering angles , θ min = sin - 1 ( λ / mλ 0 ). this trend toward uniform angle spacing increases as the number of elements in the subarray increases ; the spacing between beams likewise decreases as the number of elements in the subarray increases . other driving techniques enable additional beam directions to be addressed . as one example , additional periods can be formed by the linear superposition of the above exact periods . different and distinct effective periods can also be formed by the combination of periods which sum to the subarray dimension , and thereby give no discontinuities at the subarray edge . for the above six - element subarrays , the only different effective waveform is a two - element ramp followed by a four - element ramp . however , for subarrays having a larger number m of phase shifters , there are many such combinations giving different effective periods . in particular , combinations can be found to provide each possible integral multiple of 2π phase shifts ( whole waves ) across the subarray , ranging from unity through m / 2 , with m being the number of phase shifters in the subarray . this corresponds to m / 2 nearly equally spaced , distinct ( full rayleigh spot ) beam steering directions on each side of boresight . the quality of these m beams ( and others ) can be gauged as follows . laser radars and other high - performance optical systems require high quality beams having limited aberration and delivering maximal energy on target . under these conditions a useful figure of merit for beam quality is the so - called strehl ratio . when aberrations are small , the ratio of the axial intensity i of an aberrated beam to the axial intensity i 0 for an unaberrated beam may be expressed by the strehl ratio as where σ is the root mean square deviation of the wave front from its ideal value . the strehl ratio is generally considered a useful criterion for beam quality over the range 0 . 6 & lt ; i / i 0 & lt ; 1 . 0 . a strehl ratio of unity corresponds to an ideal , diffraction - limited beam . a strehl ratio of 0 . 6 corresponds to a one - tenth wave rms phase error across the aperture of an optical system . rms phase errors between one - fourteenth and one - twentieth of a wave are considered to correspond effectively to the classical quarter - wave rayleigh criterion , and correspond to strehl ratios of 0 . 8 and 0 . 9 , respectively . at the rayleigh criterion , two adjacent , equal - intensity sources have the first dark ring of the diffraction pattern of one point image coincident with the center of the second diffraction pattern , and are said to be just resolvable . the λ / 14 case is also known as the marechal criterion . beams satisfying either criterion are in practice considered to be diffraction limited . deviations of the phase profile across the aperture of a beam steerer from the preferred linear ( sawtooth ) profile can be treated as aberrations and the performance quantified by the strehl ratio . in particular , for steering angles not addressable by identical periods , there may be multiple combinations of periods which will steer to the same angle ; however , the phase profile for each such combination deviates from the ideal phase profile , and generally by differing amounts . the strehl ratio can then be used to select the best combination or distribution for a given steering angle , as well as to evaluate quantitatively the performance of that selection relative to an ideal ( equal period ) case . the smaller the deviation from the ideal wavefront , the smaller are the aberrations and the larger is the fraction of energy steered to the desired angle . energy not steered to the desired angle is scattered by the phase aberrations into unwanted sidelobes ; the fractional energy in the sidelobes is just unity minus the strehl ratio . as an example , consider the case of simulating a phase ramp of five waves phase shift across the aperture of a 48 - element subarray . this requires a 2π phase reset every 9 . 6 elements , corresponding to ideal periods of 9 . 6 elements , which is not realizable with a 48 - element subarray . however , exactly five waves can be obtained with combinations of three periods of ten electrodes each and two of nine electrodes each . irrespective of the permutational order in which these periods are arranged , the steering angle remains fixed to first order ; namely , the angles for five waves phase shift , which , for the case of the interphase - shifter spacing of one wave , is ± 5 . 98 °, shown in fig3 as beam positions 62 . however , the amount of energy steered into the desired direction does vary with the period order . the case of periods ordered as [ 10 , 10 , 10 , 9 , 9 ] exhibits a larger maximial phase deviation from the ideal linear phase front than does an ordering of [ 10 , 9 , 10 , 9 , 10 ]. the former ordering concentrates the phase deviations , which is penalized with the rms weighting . the latter ordering generates a wavefront which oscillates about the ideal , thereby accumulating less rms phase error . the calculated strehl ratios for the two cases are 0 . 95 and 0 . 98 , respectively . in this example , both orderings would generally be useful ; however , the alternated ordering has only one - third the sidelobe energy and is preferred . in accordance with another technique for driving the subarrays of a subaperture - addressed beam steerer , periods which are not exact integral multiples of the subarray size also may be employed , albeit with degraded beam quality . an example of this technique is a staircase ramp of five steps followed by one step out of place , such as a repeat maximum or minimum step value . the acceptability of such states depends on the amount of beam degradation allowable . this must be considered on a case - by - case basis using the strehl ratio as a criterion . however , it appears that the use of a 3 - bit phase quantization is adequate to maintain sidelobe levels under 20 db for gaussian beam illumination , at least for beam steering angles which are not large , typically under 20 °. thus , deviations of the phase ramp from ideal which are as large as 45 ° may be acceptable . in conclusion , it is seen that by employing the methods of the present invention many beam steering positions may be obtained with only moderate - sized subarrays . for the discussed case of a subarray having m phase shifters , there are at least m useful states . while the principles of the present invention have been demonstrated with particular regard to the methods disclosed herein , it will be recognized that various departures from such disclosed methods may be undertaken in the practice of the invention . the scope of this invention is not intended to be limited to the methods disclosed herein but should instead be gauged by the breadth of the claims which follow . | 6 |
it has been found that the dietary intake of cocoa procyanidins counteracts oxidative stress as measured by reduction of ldl peroxidation . consequently , there was reduction in the formation of ldl peroxidation products , such as malondialdehyde ( mda ), which may be potentially toxic to the cell . plasma lipid peroxides were measured photometrically using a thiobarbituric acid ( tba ) reaction based on methods described in yagi , k ., assay for blood plasma or serum , methods in enzymology 105 : 328 - 331 ( 1984 ) academic press , inc ., orlando , fla . ( ed . l . packer ). mda is a low molecular weight end - product that forms via decomposition of the products formed by lipid peroxidation . the mda found in the plasma can be quantified using the yagi et al . methods because at low ph and elevated temperature , mda reacts with tba to generate a fluorescent red adduct of mda and tba ( 1 : 2 ratio ). the fluorescent intensity of the mda : tba adduct , which can be accurately quantified , parallels the concentration of the adduct . hence , the amount of lipid peroxide produced can be fluorometrically measured using the tba reaction , using an mda standard . substances other than the lipid peroxides can react with tba and thereby distort results . these water - soluble substances are eliminated from the plasma sample by isolating the lipids using precipitation along with the serum protein using a phosphotungstic acid - sulfuric acid system . as shown below , levels of mda decreased at 2 and at 6 hours following ingestion of semisweet chocolate high in cocoa polyphenols . similarly , mda levels decreased at 2 and at 6 hours following ingestion of dark chocolate high in cocoa polyphenols . the decreases were more pronounced when the intake of chocolate was increased . mda levels also decreased ( albeit not as much ) when tested at 6 hours following ingestion of a dark chocolate which contained less of the cocoa polyphenols ( that is , lower amounts of cocoa polyphenols than contained in the test chocolates ). all of the chocolates used in the experiments described herein were made using the methods discussed hereinafter . all test products contained enriched levels of cocoa procyanidins . for example , the dark chocolate test product contained 147 mg total cocoa procyanidins ( 40 . 6 mg monomer ) per 36 . 9 gram test product . the dark chocolate control product contained only 3 . 3 . mg cocoa procyanidins ( 1 . 8 mg monomers ) per 36 . 9 gram control product . the semisweet products contained 185 mg total cocoa procyanidins ( 45 . 3 mg monomers ) per a 35 gram bag of semisweet chocolate bits . a single bag serving was consumed as the single dosage size . a two bag serving ( 70 grams ) of semisweet chocolate bits product contained 370 mg total cocoa procyanidins and a three bag serving ( 105 grams ) of semisweet chocolate bits product contained 555 mg total cocoa procyanidins . the quantities of cocoa procyanidin monomers and oligomers in the test products were measured by the analytical methods discussed hereinafter . procyanidin levels were determined by analyzing levels of chocolate liquor or jet black cocoa powder and calculating the percentage of powder in the final product . the low levels of procyanidins in the control dark chocolate product precluded direct analysis . the chocolate liquor used to make the test products and the control product was a blend of cocoa beans , some of which were underfermented . the beans were prepared by the methods described in pct / us97 / 15893 ( published as wo 98 / 09533 on mar . 12 , 1998 ), which is herein incorporated by reference . standard of identity rules governed the different levels of chocolate liquor and sugar which were used to prepare semisweet versus dark chocolate . the semisweet chocolate had higher levels of chocolate liquor and sugar . the semisweet chocolate and the dark chocolate test products were used to demonstrate that even though the cocoa procyanidins were delivered using two different forms of test products , similar effects were exhibited by each . methods for preparing cocoa mass are described in u . s . pat . no . 5 , 554 , 645 ( issued sep . 10 , 1996 ) which is herein incorporated by reference . harvested cocoa pods were opened and the beans with pulp were removed for freeze - drying . the pulp was manually removed from the freeze - dried mass and the beans were subjected to the following manipulations . the freeze - dried cocoa beans were first manually dehulled and ground to a fine powdery mass with a tekmar mill . the resultant mass was then defatted overnight by soxhlet extraction using redistilled hexane as the solvent . residual solvent was removed from the defatted mass by vacuum at ambient temperature . the chocolate liquor and / or cocoa solids can be prepared by roasting the cocoa beans to an internal bean temperature of 95 ° c . to 160 ° c ., winnowing the cocoa nibs from the roasted cocoa beans , milling the roasted cocoa nibs into the chocolate liquor and optionally recovering cocoa butter and partially defatted cocoa solids from the chocolate liquor . the cocoa solids can be further defatted using conventional methods . alternatively , partially defatted cocoa beans having a high cocoa polyphenol content , i . e ., a high cocoa procyanidin content , can be obtained by processing without a bean or nib roasting step and without milling the beans to chocolate liquor . even higher levels can be achieved if underfermented cocoa beans are used in this process . this method conserves the cocoa polyphenols because it omits the traditional roasting step . the method consists essentially of the steps of : ( a ) heating the cocoa beans to an internal bean temperature just sufficient to reduce the moisture content to about 3 % by weight and loosen the cocoa shell , typically using a infra red heating apparatus for about 3 to 4 minutes ; ( b ) winnowing the cocoa nibs from the cocoa shells ; ( c ) screw pressing the cocoa nibs ; and ( d ) recovering the cocoa butter and partially defatted cocoa solids which contain cocoa polyphenols including cocoa procyanidins . optionally , the cocoa beans are cleaned prior to the heating step , e . g ., in an air fluidized bed density separator . preferably , the cocoa beans are heated to an internal bean temperature of about 100 ° c . to about 110 ° c ., more preferably less than about 105 ° c . the winnowing can be carried out in an air fluidized bed density separator . the above process of heating the cocoa beans to reduce the moisture content and loosen the cocoa shell is disclosed in u . s . patent application ser . no . 08 / 709 , 406 ( now allowed , issue fee paid ) which is herein incorporated by reference . the internal bean temperature ( ibt ) can be measured by filling an insulated container such as a thermos bottle with beans ( approximately 80 - 100 beans ). in order to maintain the temperature of the beans during transfer from the heating apparatus to the thermos , the insulated container is then appropriately sealed in order to maintain the temperature of the sample therein . a thermometer is inserted into the bean filled insulated container and the temperature of the thermometer is equilibrated with respect to the beans in the thermos . the temperature reading is the ibt temperature of the beans . ibt can also be considered the equilibrium mass temperature of the beans . the cocoa beans can be divided into four categories based on their color : predominately brown ( fully fermented ), purple / brown , purple , and slaty ( unfermented ). preferably , the cocoa solids are prepared from underfermented cocoa beans , i . e ., slaty cocoa beans , purple cocoa beans , mixtures of slaty and purple cocoa beans , mixtures of purple and brown cocoa beans , or mixture of slaty , purple , and brown cocoa beans . more preferably , the cocoa beans are slaty and / or purple cocoa beans have a higher cocoa polyphenol content than fermented beans . the cocoa polyphenol content of cocoa ingredients , for example , the roasted cocoa nibs , chocolate liquor and partially defatted or nonfat cocoa solids , is higher when the cocoa beans or blends thereof having a fermentation factor of 275 or less . preferably , these cocoa beans are used for processing into cocoa ingredients . the “ fermentation factor ” is determined using a grading system for characterizing the fermentation of the cocoa beans . for example , slaty beans are designated 1 , purple beans as 2 , purple / brown beans as 3 , and brown beans as 4 . the percentage of beans falling within each category is multiplied by the weighted number . thus , the “ fermentation factor ” for a sample of 100 % brown beans would be 100 × 4 or 400 , whereas for a 100 % sample of purple beans it would be 100 × 2 or 200 . a sample of 50 % slaty beans and 50 % purple beans would have a fermentation factor of 150 [( 50 × 1 )+( 50 × 20 )]. conventional processing techniques do not provide food products , especially confectioneries which adequately retain the cocoa polyphenol concentrations . however , high cocoa polyphenol food products may be prepared using conventional chocolate liquors or these high cocoa polyphenol chocolate liquors and / or conventional chocolate cocoa solids or high cocoa polyphenol cocoa solids by protecting the milk and / or sweetener with a pretreatment ingredient selected from the group consisting of an antioxidant , an emulsifier , a fat , a flavorant and mixtures thereof , before adding the cocoa ingredient . preferred pretreatment ingredients are a mixture of cocoa butter and lecithin . examples of high cocoa polyphenol food products include pet food , dry cocoa mixes , puddings , syrups , cookies , savory sauces , rice mixes and / or rice cakes , beverages , including cocoa beverages and carbonated beverages . preferably , the high cocoa polyphenol foods are chocolate confectioneries , for example , dark chocolate , semisweet chocolate , sweet chocolate , milk chocolate , buttermilk chocolate , skim milk chocolate , mixed dairy milk chocolate and reduced fat chocolate . cocoa polyphenols may be added to white chocolate and white chocolate coating to create products with high levels of cocoa polyphenols . these confectioneries may be either standard of identity chocolates or non - standard of identity chocolates . preferable non - chocolate food products include nut - based products such as peanut butter , peanut brittle and the like . also included are low - fat food products prepared with defatted or partially defatted nut meats . cocoa procyanidins are also used in dietary supplements and pharmaceuticals . also included are food products comprising at least one cocoa polyphenol and l - arginine . the procyanidin and l - arginine may be provided , respectively , by cocoa and / or nut procyanidins and an l - arginine containing component , such as a nut meat . the l - arginine may be derived from any available arginine source , e . g ., arachis hypogaea ( peanuts ), juglans regia ( walnuts ), prunus amygdalus ( almonds ), corylus avellana ( hazelnuts ), glycine max ( soy bean ) and the like . the nut may be nut pieces , a nut skin , a nut paste , and / or a nut flour present in amounts which provide the desired amount of l - arginine , which will vary depending upon the nut source . the l - arginine - containing ingredient may also be a seed , a seed paste , and / or a seed flour . the cocoa polyphenols , including cocoa procyanidins , may be synthetic or natural . the procyanidins may from a source other than cocoa beans . the food product may contain polyphenols , such as procyanidins , from a source other than cocoa , e . g ., the polyphenols found in the skins of nuts such as those described above . peanut skins contain about 17 % procyanidins , and almond skins contain up to 30 % procyanidins . in a preferred embodiment , the nut skins are used in the food product , e . g ., the nougat of a chocolate candy . polyphenols from fruits and vegetables may also be suitable for use herein . it is known that the skins of fruits such as apples and oranges , as well as grape seeds , are high in polyphenols . as used herein “ food ” is a material consisting of protein , carbohydrate and / or fat , which is used in the body of an organism to sustain growth , repair vital processes , and to furnish energy . foods may also contain supplementary substances , such as , minerals , vitamins , and condiments ( merriam - webster collegiate dictionary , 10th edition , 1993 ). as used herein “ food supplement ” is a product ( other than tobacco ) that is intended to supplement the diet that bears or contains one or more of the following dietary ingredients : a vitamin , a mineral , an herb or other botanical , an amino acid , a dietary substance for use by man to supplement the diet by increasing the total daily intake , or a concentrate , metabolite , constituent , extract or combination of these ingredients . ( merriam - webster collegiate dictionary , 10th edition , 1993 ). when the term is used on food labels , “ supplement ” means that nutrients have been added in amounts greater than 50 % above the u . s . recommended daily allowance (“ understanding normal and clinical nutrition , 3rd edition , editors whitney , cataldo and rolfes at page 525 ). as used herein “ pharmaceutical ” is a medicinal drug . ( merriam - webster collegiate dictionary , 10th edition , 1993 ). the cocoa procyanidins in these products are part of a larger family of cocoa polyphenols which are present in cocoa beans . suitable cocoa procyanidin - containing ingredients include roasted cocoa nibs or fractions thereof , chocolate liquor , partially defatted cocoa solids , nonfat cocoa solids , cocoa powder milled from the cocoa solids , and mixtures thereof . preferably , the ingredients are prepared from underfermented beans since these beans contain higher amounts of cocoa polyphenols including the cocoa procyanidins . cocoa procyanidins can be obtained from several theobroma cacao genotypes which represent the three recognized horticultural races of cocoa , namely , trinitario , forastero and criollo . see engels , j . m . m ., genetic resources of cacao : a catalogue of the catie collection , tech . bull . 7 , turrialba , costa rica ( 1981 ). an extract containing cocoa polyphenols , including cocoa procyanidins , can be prepared by solvent extracting the partially defatted cocoa solids prepared from the underfermented cocoa beans or cocoa nibs having a fermentation factor of 275 or less , as described herein . the analytical method described below was used to separate and quantify , by degree of polymerization , the procyanidin composition of the seeds from theobroma cacao and of chocolate . the analytical method described below is based upon work reported in hammerstone , j . f ., lazarus , s . a ., mitchell , a . e ., rucker r ., schmitz h . h ., identification of procyanidins in cocoa ( theobroma cacao ) and chocolate using high - performance liquid chromatography / mass spectrometry , j . ag . food chem . ; 1999 ; 47 ( 10 ) 490 - 496 . the utility of the analytical method described below was applied in a qualitative study of a broad range of food and beverage samples reported to contain various types of proanthocyanidins , as reported in lazarus , s . a ., adamson , g . e ., hammerstone , j . f ., schmitz , h . h ., high - performance liquid chromatography / mass spectrometry analysis of proanthocyanidins in foods and beverages , j . ag . food chem . ; 1999 ; 47 ( 9 ); 3693 - 3701 . the analysis in lazarus et al . ( 1999 ) reported analysis using fluorescence detection because of higher selectivity and sensitivity . composite standard stock solutions and calibration curves were generated for each procyanidin oligomer through decamer using the analytical method described below , as reported in adamson , g . e ., lazarus , s . a ., mitchell , a . e ., prior r . l ., cao , g ., jacobs , p . h ., kremers b . g ., hammerstone , j . f ., rucker r ., ritter k . a ., schmitz h . h ., hplc method for the quantification of procyanidins in cocoa and chocolate samples and correlation to total antioxidant capacity j . ag . food chem . ; 1999 ; 47 ( 10 ) 4184 - 4188 . samples were then compared with the composite standard to accurately determine the levels of procyanidins . the fresh seeds ( from brazilian cocoa beans ) were ground in a high - speed laboratory mill with liquid nitrogen until the particle size was reduced to approximately 90 microns . lipids were removed from 220 grams ( g ) of the ground seeds by extracting three times with 1000 milliliters ( ml ) of hexane . the lipid free solids were air dried to yield approximately 100 g of fat - free material . a fraction containing procyanidins was obtained by extracting with 1000 ml of 70 % by volume acetone in water . the suspension was centrifuged for 10 minutes at 1500 g . the acetone layer was decanted through a funnel with glass wool . the aqueous acetone was then re - extracted with hexane (˜ 75 ml ) to remove residual lipids . the hexane layer was discarded and the aqueous acetone was rotary evaporated under partial vacuum at 40 ° c . to a final volume of 200 ml . the aqueous extract was freeze dried to yield approximately 19 g of acetone extract material . approximately 2 g of acetone extract ( obtained above ) was suspended in 10 ml of 70 % aqueous methanol and centrifuged at 1500 g . the supernatant was semi - purified on a sephadex lh - 20 column ( 70 × 3 centimeters ) which had previously been equilibrated with methanol at a flow rate of 3 . 5 ml / min . two and a half hours after sample loading , fractions were collected every 20 minutes and analyzed by hplc for theobromine and caffeine see clapperton , j ., hammerstone , j . f ., romanczyk , l . j ., yow , s ., lim , d ., lockwood , r ., polyphenols and cocoa flavour , proceedings , 16 th international conference of groupe polyphenols , lisbon , portugal , groupe polyphenols : norbonne , france , 1992 ; tome ii , pp . 112 - 115 . once the theobromine and caffeine were eluted off the column (˜ 3 . 5 hours ), the remaining eluate was collected for an additional 4 . 5 hours and rotary evaporated under partial vacuum at 40 ° c . to remove the organic solvent . then the extract was suspended in water and freeze dried . the cocoa extract from above ( 0 . 7 g ) was dissolved in ( 7 ml ) mixture of acetone / water / acetic acid in a ratio by volume of 70 : 29 . 5 : 0 . 5 , respectively . a linear gradient ( shown in the table below ) was used to separate procyanidin fractions using a 5 um supelcosil lc column ( silica , 100 angstroms ( å ); 50 × 2 cm ) ( supelco , inc ., bellefonte , pa .) which monitored by uv at a wavelength of 280 nanometers ( nm ). methylene chloride / methanol / time acetic acid / water acetic acid / water flow rate ( minutes ) ( 96 : 2 : 2 v / v )(%) ( 96 : 2 : 2 v / v )(%) ( ml / min ) 0 92 . 5 7 . 5 10 10 92 . 5 7 . 5 40 30 91 . 5 8 . 5 40 145 78 . 0 22 . 0 40 150 14 . 0 86 . 0 40 155 14 . 0 86 . 0 50 180 0 100 50 fractions were collected at the valleys between the peaks corresponding to oligomers . fractions with equal retention times from several preparative separations were combined , rotary evaporated under partial vacuum and freeze dried . to determine purity of the individual oligomeric fractions , an analysis was performed using a normal - phase high - performance chromatograph ( hplc ) method interfaced with online mass spectrometry ( ms ) analysis using an atmospheric pressure ionization electrospray ( api - es ) chamber as described by lazarus et al . ( 1999 ), supra . chromatographic analyses were formed on an hp 1100 series ( hewlett - packard , palo alto , calif .) equipped with an auto - injector , quaternary hplc pump , column heater , diode array detector , and hp chemstation for data collection and manipulation . normal - phase separations of the procyanidin oligomers were performed on a phenomenex ( torrance , calif .) luna silica column ( 25 × 4 . 6 mm ) at 37 ° c . uv detection was recorded at a wavelength of 280 nm . the ternary mobile phase consisted of ( a ) dichloromethane , ( b ) methanol , and ( c ) acetic acid and water ( 1 : 1 v / v ). separations were effected by a series of linear gradients of b into a with a constant 4 % of ( c ) at a flow rate of 1 ml / min as follows : elution starting with 14 % of ( b ) into ( a ); 14 - 28 . 4 % of ( b ) into ( a ), 0 - 30 min ; 28 . 4 - 50 % of ( b ) into ( a ), 30 - 60 min ; 50 - 86 % of ( b ) into ( a ), 60 - 65 min ; and 65 - 70 min isocratic . hplc / ms analyses of purified fractions were performed using an hp 1100 series hplc as described above and interfaced to an hp series 1100 mass selective detector ( model g1946a ) equipped with an api - es ionization chamber . the buffering reagent was added via a tee in the eluant stream of the hplc just prior to the mass spectrometer and delivered with an hp 1100 series hplc pump , bypassing the degasser . conditions for analysis in the negative ion mode included 0 . 75 m ammonium hydroxide as a buffering reagent at a flow rate of 0 . 04 ml / min , a capillary voltage of 3 kv , a fragmentor at 75 v , a nebulizing pressure of 25 psig , and a drying gas temperature at 350 ° c . data were collected on an hp chemstation using both scan mode and selected ion monitoring ( sim ). spectra were scanned over a mass range of m / z 100 - 3000 at 1 . 96 seconds per cycle . the ammonium hydroxide was used to adjust the eluant ph to near neutrality via an additional auxiliary pump just prior to entering the ms . this treatment counteracted the suppression of negative ionization of the (−)- epicatechin standard due to the elevated concentration of acid in the mobile phase . the purity for each fraction was determined by peak area , using uv detection at a wavelength of 280 nm in combination with a comparison of the ion abundance ratio between each oligomeric class . a composite standard was made using commercially available (−)- epicatechin for the monomer . dimers through decamers were obtained in a purified state by the methods described above . standard stock solutions using these compounds were analyzed using the normal - phase hplc method described above with fluorescence detection at excitation and emission wavelengths of 276 nm and 316 nm , respectively . peaks were grouped and their areas summed to include contributions from all isomers within any one class of oligomers and calibration curves generated using a quadratic fit . monomers and smaller oligomers had almost linear plots which is consistent with prior usage of linear regression to generate monomer - based and dimer - based calibration curves . these calibration curves were then used to calculate procyanidin levels in samples prepared as follows : first , the cocoa or chocolate sample ( about 8 grams ) was de - fatted using three hexane extractions ( 45 ml each ). next , one gram of de - fatted material was extracted with 5 ml of the acetone / water / acetic acid mixture ( 70 : 29 . 5 : 0 . 5 v / v ). the quantity of procyanidins in the de - fatted material was then determined by comparing the hplc data from the samples with the calibration curves obtained as described above ( which used the purified oligomers ). the percentage of fat for the samples ( using a one gram sample size for chocolate or one - half gram sample size for liquors ) was determined using a standardized method by the association of official analytical chemists ( aoac official method 920 . 177 ). the quantity of total procyanidin levels in the original sample ( with fat ) was then calculated . calibration was performed prior to each sample run to protect against column - to - column variations . human volunteers were instructed to fast overnight and to maintain low phytochemical intake the evening before the study . phytochemicals are components in plants and foods derived from plants including many fruits , coffee , some teas , green peppers , garlic , onions , yogurt , bran , and cruciferous vegetables such as broccoli , cabbage , and cauliflower , etc . blood was drawn from the subjects prior to consumption of any food . the subjects ingested either semisweet or dark chocolate . the two different chocolates were used to demonstrate that the cocoa polyphenols could be delivered in different forms and still exhibit the same effects . the chocolates have different levels of chocolate liquor and sugars as defined by the standard of identity rules for semisweet chocolate and dark chocolate . the chocolate liquor used to make these products was a blend of beans , some of which were underfermented . after the initial blood was drawn , the subjects were divided into two groups . one group was tested with the semisweet chocolate and the other group was tested with the dark chocolate . both chocolates had enhanced levels of cocoa procyanidins . the conserved levels were obtained by the process described herein . for the dark chocolate experiment , the control subjects consumed a control bar which contained a low level of cocoa procyanidins , i . e ., only 3 . 3 . mg cocoa procyanidins ( 1 . 8 mg monomer ) per 36 . 9 gram control product . the dark chocolate test product contained 147 mg total cocoa procyanidins ( 40 . 6 mg monomer ) per 36 . 9 gram test product . blood samples were drawn at 2 hours , after which another bagel was consumed . at 6 hours , another blood sample was drawn . fig1 shows the nanomoles ( nmol ) of malondialdehyde ( mda ) in plasma at 2 and at 6 hours following ingestion of ½ bagel with the dark chocolate test product or ½ bagel with the control chocolate product having the low cocoa procyanidins . as demonstrated by the data in fig1 the higher the level of cocoa procyanidins ingested , the lower the levels of mda in the plasma . the control chocolate product which some of the subjects ingested was prepared from jet black cocoa powder that is approximately ten to twelve percent fat that is completely alkalized . the powder was reconstituted in cocoa butter to give the proper percentage fat in the dark chocolate test bar ( taking into account the 9 . 87 % fat in the powder itself ). the control bar was formulated with 49 . 335 % sugar , 19 . 75 % jet black cocoa powder , 27 . 344 % cocoa butter , 2 . 61 % anhydrous milk fat , 0 . 06 % vanillin , 0 . 75 % lecithin , 0 . 15 % prova vanilla , and 0 . 001 % orange oil . the level of monomer was calculated to be 1 . 8 mg per bar based upon the 3 . 3 mg per bar level of cocoa procyanidins and the known levels of fat . for the semisweet experiment , the control subjects consumed ½ bagel alone and no chocolate . the test group consumed ½ bagel with one of three different chocolates , each with a different level of cocoa procyanidins per bag . the first chocolate test product was a 35 gram semisweet chocolate product containing 185 mg total cocoa procyanidins ( 45 . 3 mg monomer ) per 35 grams . the second chocolate test product was a 70 gram semisweet chocolate product containing 370 mg total cocoa procyanidins . the third chocolate test product was a 105 gram semisweet chocolate product containing 555 mg total cocoa procyanidins . blood samples were drawn at 2 hours , after which another bagel was consumed . after 6 hours , another blood sample was drawn . fig2 shows the nanomoles ( nmol ) of malondialdehyde ( mda ) in plasma at 2 and at 6 hours following ingestion of ½ bagel alone and following ingestion of ½ bagel with increasing quantities of semisweet chocolate product , i . e ., 35 , 70 and 105 grams , containing increasing quantities of total cocoa procyanidins , i . e ., 185 , 370 and 555 mg . as demonstrated by the data in fig2 the higher the level of cocoa procyanidins ingested , the lower the levels of mda in the plasma . for the analysis of the thiobarbituric reactive substances ( tbars ), a plasma sample ( 100 l ) was mixed with 4 % butylated hydroxytoluene ( bht ) and then frozen overnight . the sample was then thawed at room temperature and a 100 l sample was mixed with 200 l sodium dodecyl sulfate ( sds ). the following reagents were then added in sequence : 800 l 0 . 1 n hydrochloric acid ( hcl ), 100 l 10 % 1 , 4 - benzenedicarboxylic acid ( pta ), and 400 l 0 . 7 % thiobarbituric acid ( tba ). the sample mixture was incubated in 95 c water bath for 30 minutes . after cooling on ice , 1 ml of 1 - butanol was added . the sample was then centrifuged for 10 minutes at 1800 g ( 3000 rpm ) at 4 c . a 200 l aliquot of the butanol phase was assayed for extracted mda by fluorometry . this quantity was used for each of the 96 wells of the plate which was read with excitation at 515 nrm , slit 5 nm and emission at 555 nm , slit 5 nm . the effect of the cocoa procyanidin levels on the oxidative stress , as measured by the tbars assay , was apparent at 2 hours and at 6 hours as shown by the change in total nanomoles of mda per milliliters of plasma . whether the cocoa procyanidins were present in the dark chocolate test product or in the semisweet chocolate test products made no difference . in addition , the effect was more pronounced as the amounts of total cocoa procyanidins consumed increased . | 8 |
a tree transplanting machine 20 includes a split ring stand 22 pivotally mounted by a mounting means 24 to ring stand support arms 26 , 26 . these stand support arms 26 , 26 are pivotally mounted as at 28 to a vehicle 30 . welded onto a split upper disc 46 of the ring stand and symmetrically spaced around it are a plurality of hollow , curved , upstanding stanchions 32 . eight stanchions are shown herein , but six , four or some other number will work satisfactorily . each of these stanchions guidably supports a digging spoon 34 in a manner to be described . a cylinder 36 of a hydraulic linear piston - cylinder digging motor 38 is pivotally mounted adjacent its rod end to an upper portion of each stanchion 32 as at 40 . a piston rod 44 of each such linear digging motor 38 is connected to a piston 42 thereof . digging spoon drive pinions 43 , 43 are rotatably mounted , one on each of opposite sides of the outer ends of each piston rod 44 . a digging spoon rack 45 is integral with and extends outwardly from the upper half of the inner surface of each digging spoon 34 . a stanchion rack 47 is integral with an interior surface of the stanchion 32 and is in parallel spaced apart relationship with respect to the digging spoon rack 45 . pinions 43 , 43 are each located in meshing , operational relationship with respect to both the digging spoon rack and the stanchion rack . as the linear digging motor 38 is operated , piston 42 and piston rod 44 force the digging spoon drive pinions 43 , 43 either down or up with respect to the stanchion . since the stanchion rack 47 is fixed to its stanchion , this causes the digging spoon rack 45 and hence its digging spoon 34 to be moved twice as far as the linear motor piston rod and the pinions move . while a double rack and pinion arrangement is effective to obtain this &# 34 ; two - for - one &# 34 ; motion , other similar means could also be used . for example , a sheave could be placed on each side of the outer end of the piston rod 44 and cables dead - ended to each end of the stanchions . the cables would each pass around one of the sheaves and be fastened to spaced apart points along the digging spoon . similar cable arrangements could give spoon movement three or more times as great as piston rod movement . the split ring stand 22 , in addition to the split upper disc 46 includes a matching split lower disc 48 . the upper disc is provided with an integral downwardly extending upper disc skirt 50 ; while the lower disc 48 is provided with an integral upwardly extending lower disc skirt 52 . a pair of gusset plates 54 , 54 are welded between the upper and lower discs in approximate alignment with each of the stanchions 32 . the stanchions are secured by welding to the upper surface of the upper disc 46 just opposite where these gusset plates 54 , 54 are secured to the lower surface of the upper disc by welding . as seen in fig1 , 3 and 4 , the pivotal mounting means 24 includes a hollow ring stand pivot bar 56 , which is pivotally mounted over a solid ring stand pivot rod 58 . also mounted on pivot rod 58 are two mutually perpendicular collars , together indicates as 60 . the lower collar being permanently affixed to the outer end of each ring stand support arm 26 , and the upper collar being pivotally received on the ring stand pivot rod 58 . the hollow ring stand pivot bar 56 has a cylinder 62 of a ring splitting hydraulic linear motor 64 integral therewith and extending outwardly therefrom . this cylinder is supported by brackets 66 , 66 with respect to bar 56 . as best seen in fig8 and fig9 the inner split edges of each half of the split ring stand 22 are joined to each other at overlapping collars 68 and 70 each welded to one of the two upper one - half discs 46 and collars 72 and 74 are each welded to one of the two one - half lower discs 48 . these collars are held in pivotal relation to each other by a vertical pivot pin 76 which is attached through a collar 78 to a piston rod 80 of the ring splitting hydraulic linear motor 64 . each of the halves of the split ring stand 22 are independently supported in pivotal relationship to the outer ends of ring stand support arms 26 , 26 by a collar and boss 82 which is pivotally mounted on the ring stand pivot rod 58 and by a collar and split ring swing arm 84 pivotally mounted on the boss portion of the collar and boss 82 . a vertical split ring control pole 86 is integral with and extends upwardly from each of the halves of the split ring stand 22 ; and a diagonal control pole brace 88 extends from an upper portion of the pole to a outwardly extending portion of its half of the ring stand . a forward end of the ring swing arm 84 includes an additional collar 90 which is rotatably mounted about the split ring control pole 86 between the split upper disc 46 and the split lower disc 48 . a vertical swing arm brace 92 is integral with ring swing arm 84 , extends upwardly therefrom , and terminates in a collar 94 which is rotatably mounted with respect to an upper end portion of the split ring control pole 86 . each of these braces 92 are provided with ears 96 , both of which are pivotally connected to mechanism indicated generally at 98 for tipping the split ring stand 22 about the horizontal axis of the ring stand pivot rod 58 . as best seen in fig2 this mechanism 98 includes other linkages pivotally connected to the vehicle 30 , and a hydraulic linear motor for controlling those linkages . it is by controlling these mechanisms indicated generally at 98 that the split ring stand can be moved between the angular position as seen in fig2 and the horizontal position as seen in fig1 . for transport over the road , this same mechanism is utilized to tip the split ring stand and the tree and ball then associated therewith to position in clearing relationship to the roadway over which the tree is to be carried . the horizontal positioning of the split ring stand 22 is controlled , not so much by the mechanism 98 , as by a pair of hydraulic linear ring stand height control motors 100 , 100 , each of which includes a cylinder 102 pivotally mounted as at 104 to the frame of the vehicle 30 , and a piston ( not shown ) and piston rod 106 each of which is pivotally mounted as at 108 to an outer end of one of the ring stand support arms 26 . the outer ends of each half of the split ring stand 22 are provided with upstanding ears 110 , 110 on the split upper disc 46 . after the split ring has been positioned to encompass a tree 112 to be transplanted , a bolt 114 is passed through both of the ears 110 , 110 and into a nut 116 to securely and temporarily fasten the ring stand into one unit . each of the stanchions 32 forms a positive guide and lateral support for its associated digging spoon 34 . each spoon is curved in such a manner that it will move smoothly into the earth , and each stanchion is curved so that its spoon will move in precise parallel relationship to it . each hollow stanchion 32 includes spaced apart parallel side walls 118 , 118 , and integral curved solid back wall 120 , and a slotted front wall , curved to lie in parallel spaced relation to the back wall and constituted as a pair of mutually aligned spaced apart flanges 122 , 122 , each extending inwardly from one of the side walls 118 . each digging spoon rack 45 is constituted as a plurality of spaced apart spoon rack bars 124 . these rack bars are supported as by welding on a digging spoon rib 126 which is , itself , supported as by welding down a longitudinal center of its associated digging spoon 34 . as best seen in fig7 the front wall flanges 122 , 122 of the stanchion 32 , together with the side walls 118 , 118 thereof form a t - slot to positively position the rack bars 124 of the spoon rack 45 with respect to the stanchion . this construction not only positively supports and guides the vertical up and down movement of the digging spoons 34 , but also insures that the pinions 43 , 43 will be in proper meshing relationship with respect to both the digging spoon rack 45 and the stanchion rack 47 . to prepare to transplant a tree , the bolt 114 and nut 116 will be disconnected , and ring stand height control motors 100 will be activated to bring the two halves of the split lower disc 48 of the ring stand 22 into clearing relationship with respect to the ground . ring splitting hydraulic linear motor 64 will then be elongated to cause its piston rod 80 to force vertical pivot pin 76 outwardly from position as seen in fig3 to position as seen in fig4 thus forcing the two halves of the split ring 22 apart as shown in fig4 . vehicle 30 will be backed toward the tree 112 to be transplanted , and when the halves of the split ring are properly positioned , ring splitting motor 64 will be contracted to bring the parts back to the position as seen in fig3 . the bolt 114 and the nut 116 will then be used to lock the ring stand 22 into a unitary complete and solid ring . ring stand height control motors 100 , 100 , will be lowered or relaxed to allow the ring stand 22 to rest on the ground and to cause the tips of the digging spoons 34 to penetrate the ground in concentric relationship to the tree 112 , all as seen in fig1 . next hydraulic fluid will be introduced into the top portion of each of the cylinders 36 of the digging motors 38 to move pinions 43 , 43 in downward direction so as to force the digging spoons 34 in a similar direction but at double the distance traveled by the pinions . while a hydraulic power source associated with the vehicle 30 could be sufficiently large and powerful to force all of the spoons into the ground at the same time , it is more satisfactory to force the spoons into downward position one at a time . the weight of the entire machine is then available to react against the digging force of first one or two spoons . the &# 34 ; dug - in &# 34 ; spoons themselves also then serve to react against the digging force of subsequent spoons . one or two linear motors can be moved from stanchion to stanchion to force the blades down one after another in their turn if necessary . in order to get uniform digging action and to overcome and tendency for strains to develop due to canting , two digging spoons oppositely disposed across the ring stand can be activated at any one time . when obstructions are encountered , and the progress of a digging spoon is slowed or blocked , the particular digging motor 38 can be reciprocated by reversing the force of hydraulic pressure on either side of the piston 42 . in this manner an obstruction can be pushed to one side or broken through as the case may be . using this technique , the present inventor has actually encountered old foundations including building stone and cement blocks , and has actually encapsulated portions of such a structure within the tree ball . such reciprocation can be over a relatively long distance or stroke , or over a relatively short stroke . in fact , machines which cause the digging spoons to vibrate furnish the ultimate in short - term reciprocation , and such machines , when added to the structure , can under certain circumstances and conditions , allow digging spoons to be moved into the ground with a great reduction of hydraulic power applied . once all of the digging spoons 34 have reached position as shown to the right in fig5 the tree roots and the associated earth will have been substantially separated from the earth to form a tree ball 128 , and the tree 112 and this tree ball are then ready to be transported to the new location . mechanism 98 is then operated to tip the tree , tree ball and ring stand 22 forwardly with respect to the front of the vehicle 30 , swinging about the ring stand pivot rod 58 until the ring stand and the spoons are in clearing relationship with respect to the ground on which the vehicle is situated . this tipping can continue until the ring stand 22 is substantially directly above the ring swing arms 84 , 84 . the vehicle is then driven to the new location for the tree , and the mechanism 98 is reversed to lower the tree into a newly provided hole once the vehicle is situated in alignment therewith . when so situated , the ring stand is lowered to the ground and hydraulic fluid is introduced into the rod end of each of the cylinders 36 of the digging motors 38 to withdraw each of the digging spoons 34 from the ground thus to leave the newly transplanted tree 112 in position as seen in fig1 . the nut 116 and the bolt 114 are separated , ring stand height control motors 100 are contracted to remove the ring stand 22 and the tips of the digging spoons 34 from the ground , ring splitting motor 64 is elongated to split the ring stand 22 from position as seen in fig3 to the position as seen in fig4 and the vehicle is driven away from the newly transplanted tree 112 . when more than one tree is to be transplanted from a first growing area to a second use area , the tree transplanting machine will then be situated in the place where the second tree is to be put , and the transplanting machine will be activated in the manner set out above to separate from the earth a ball of earth which will be of size and shape to receive the second tree . if desired , this ball of earth can be carried from the area where the trees are to be used back to the growing area , and it and the digging spoons 34 of the ring stand can be lowered down into the hole left by the first tree and tree ball , and the spoons withdrawn thus to fill in this first hole . then the second tree can be dug in the manner set out , carried to the newly dug location at the use site , and transplanted therein . the digging spoon racks 45 extend only from the middle to the top of the inside surface of each digging spoon 34 ; but with the digging spoon ribs 126 extending virtually the entire length of their digging spoon . below the racks 45 , the maximum dimension of the ribs 126 is substantially reduced . thus , the passage of each digging spoon into the earth is virtually unimpeded except by the profile of the spoon and the reduced rib themselves until the rack arrives at the surface of the earth . see fig5 . at this point , the path for the spoon is pretty well established within the earth , and the additional resistance caused by having to force the rack bars 124 of the digging spoon rack 45 into the ground during the last half of the progress of a particular digging spoon into the ground will not cause difficulty . the earth itself , over the first half of the digging spoon , serves as a guide to continue the spoon on its way in spite of the added resistance caused by the bulk of the digging spoon rack . also referring to fig5 when the digging spoons are withdrawn from the ground , the earth clinging to the spaced apart rack bars 124 will be forced by the pinions 43 , 43 into the area on either side of the digging spoon rib 126 to drop harmlessly down on the interior surface of the digging spoon 34 . a feature of the invention involves the digging motor 38 being pivotally mounted by the rod end of the cylinder 36 to the upper part of the hollow stanchion 32 , thus to allow the force exerted by the pinions 43 , 43 on the digging spoon rack 45 to be virtually a straight downward force designed to most easily cause the spoon to go into the earth , in spite of the fact that the spoon is following a curved path . this relationship is best understood by considering the alignment of the piston rod 44 on the left side of fig5 where the digging motor 38 is fully contracted and the force is being applied substantially exactly parallel to the desired direction of travel of the digging spoon ; and the alignment of the piston rod 44 on the right side of fig5 as the digging spoon just reaches the bottom of its movement . with digging motor 38 fully extended , the positioning of piston rod 44 is such that the force on the pinions 43 , 43 is still virtually exactly parallel with the direction of the final movement of digging spoon 34 . | 0 |
fig1 shows a curve calibrated by the photographic method of a standardized signal in the case of a flow of air bubbles in a volume of water . on the ordinate is plotted the ratio of the mean value of the maximum amplitudes of the wave trains received at the outlet of the two - phase mixture to the mean value of the maximum amplitudes of the wave trains received after passing through the water only . the ordinate is marked in 0 , corresponding to pure air and in 1 corresponding to pure water . on the abscissa is plotted the value of the interfacial area in meters - 1 , because it is in fact a specific surface per unit of volume . curve 1 of fig1 represents a continuous function decreasing from the value 1 of the standardized signal corresponding to water only and the value of this signal decreases regularly as a function of the increase in the interfacial area per unit of volume within the two - phase flow . as this function is biunivocal , it can be seen that a single value of the interfacial area corresponds to any given value of the standardized signal . for example , when the ratio of the mean values of the maximum amplitude is 0 . 5 , fig1 shows that the interfacial area value is approximately 110 m 2 specific surface per cubic meter of mixture . the invention consists of measuring by ultrasonic means the aforementioned ratio of the mean values of the maximum amplitudes , i . e . using a curve like that of fig1 precalibrated on the mixture to be examined and ultimately the sought interfacial area value can be obtained therefrom . in practical terms , the invention proposes two types of arrangements for the ultrasonic examination of the two - phase flow . fig2 shows the first and simplest arrangement for small - size contactors , such as e . g . a pipe 2 , whose walls are relatively close together . in this case , the gas bubbles 3 flowing in the liquid phase 3a are examined with the aid of two sound transducers which are the transmitter 4 and the receiver 5 located on either side of the walls of pipe 2 in accordance with the diameter of the latter . the arrangement of fig3 which is intended for large contactors has , in the same way as that according to fig2 a transmitter transducer 4 and a receiver transducer 5 , which are located on a fork - shaped support 6 , which is immersed in the flow of bubbles 3 in liquid 3a . the lateral branches 7 and 8 of support 6 are used for the passage of two conductors 9 , 10 , which respectively supply transmitter 4 and receiver 5 . fig4 shows the amplitude as a function of time of the ultrasonic wave trains transmitted by transmitter transducer 4 . in the case of fig4 there are two successive wave trains 11 , 12 lasting in each case 50 microseconds and separated by 0 . 5 milliseconds . the oscillating frequency of the ultrasonic wave in each of the trains is approximately 750 khz . the interval of time between two transmitted wave trains and the duration of each train must be such that there is no superimposing of two successive trains on reception . the oscillating frequency of the ultrasonic wave of each of the trains must be such that the corresponding wavelength in the liquid clearly exceeds the diameter of the bubbles . fig5 shows the amplitudes as a function of time of successive wave trains received by receiver 5 , after passing through the liquid with no bubbles present . it can be seen that the wave trains 13 and 14 , which respectively correspond to the reception of wave trains 11 , 12 in fig4 are still separated by the same interval of time of 0 . 5 milliseconds and have the same duration of 50 microseconds . however , their form or shape is significantly modified compared with the transmitted wave train 11 , 12 . thus , they comprise on the one hand a rising front lasting approximately 10 microseconds and due to the transient response time of the transducers and on the other hand , at the end of the signal , by a certain number of reflections of the wave within the medium or on the container walls . if it is now wished to modify the physical conditions of the medium by having a flow of gas bubbles pass through it , the results visible in fig6 are obtained showing the amplitudes as a function of time of the various wave trains received by transducer 5 . these wave trains , which are still separated from one another by 0 . 5 milliseconds , all have essentially the same general form , i . e . the envelope of the signal retains the same profile . however , the signal obtained has an amplitude which is attenuated in various ways on the different wave trains 15 , 16 , 17 and 18 of fig6 which correspond to bubble densities flowing in the liquid between two different transducers 4 and 5 at the time of the propagation of each wave train . in practical terms , and for given vacuum levels and gas bubble sizes , it is wished to know the mean value of the maximum amplitudes of the different wave trains received , so as to compensate fluctuations between individual wave trains . the apparatus according to fig7 is used for performing this measurement of the mean value of the maximum amplitude of the wave trains received . fig7 shows a two - phase flow of gas bubbles 3 in a liquid 3a passing through a pipe 2 . ultrasonic transmitter 4 and ultrasonic receiver 5 are in the same position as in the arrangement of fig2 . the ultrasonic sound wave trains are produced by generator 20 , which supplies the transmitter 4 by its line 21 . at the output 22 of receiver 5 are arranged in series a current amplifier 23 , followed by a peak detector 24 , a sample and hold circuit 25 and a low pass filter 26 . the function of peak detector 24 is to determine the maximum amplitude of a wave train received and the sample and hold circuit stores the value of this maximum amplitude . the low pass filter 26 determines the mean value of the signals collected by the sample and hold circuit 25 . at the output of low pass filter 26 , a conductor 27 supplies divider 28 , which makes it possible to establish the ratio of the mean values determined by filter 26 on the one hand in the liquid alone in the absence of bubbles and on the other hand in the presence of the gas bubble flow . a first monostable circuit 29 connected to the ultrasonic signal generator 20 by line 30 controls by means of line 32 the sample and hold circuit 25 , whose operation it initiates for each pulse train . a second monostable circuit 31 controls , by means of conductor 33 , the resetting of peak detector 24 following each recording by the sample and hold circuit 25 . the two monostable circuits 29 and 31 constitute the logic part of the processing apparatus , whereas peak detector 24 , sample and hold circuit 25 and low pass filter 26 are the analog part thereof , they supply electrical quantities representing the maximum amplitudes of the ultrasonic wave trains received . it is pointed out that the ultrasonic pulse generator 20 is duplicated , namely it has a first generator which produces rectangular pulses controlling the second generator which produces sine waves . this leads to wave trains , such as will now be described relative to the diagrams of fig8 which provide a better understanding of the processing of the signals . in fig8 the amplitudes are plotted on the ordinate and the time on the abscissa . in fig8 it is firstly possible to see the rectangular pulses 40 , 41 transmitted by the first part of ultrasonic generator 20 . the two following lines show the rectangular pulses 42 , 43 of the first monostable circuit 29 and the rectangular pulses 44 , 45 of the second monostable circuit 31 . on the following line , it is possible to see the two wave trains 46 , 47 at a frequency of 750 khz , as produced by the second part of the ultrasonic wave generator 20 and whose durations are limited by the rectangular pulses 40 , 41 of the first generator . these ultrasonic wave trains 46 , 47 are applied directly by conductor 21 to transmitter transducer 4 . on the following line are shown at 48 , 49 , the wave trains received after passing through the two - phase flow by receiver 5 , whereby wave train 48 corresponds to wave train 46 and wave train 49 to wave train 47 . on the following line , it is possible to see how the maximum amplitudes reached by the wave trains 48 , 49 are taken into account by the peak detector 24 , which transforms them into constant amplitude signals 50 , 51 until the corresponding pulse ( in this case 45 ) of the second monostable circuit 31 controls the resetting of the peak detector . on the following line , it can be seen how the sample and hold circuit 25 controlled by the pulses of the first monostable circuit 29 produces a square signal 52 representing the same maximum amplitude . at the output of low pass filter 26 , signal 53 is obtained , which represents the mean value of the different amplitudes 52 recorded in the sample and hold circuit 25 , following the reception of a large number of ultrasonic wave trains , such as 48 or 49 . it is then merely necessary to perform the same measurement with the same apparatus in the absence of gas bubbles 3 in pipe 2 to have a different mean value for the amplitudes of the outgoing wave trains at the output of low pass filter 26 and to form the ratio of these two mean values , so that the sought value of the coefficient of the interfacial area in the examined volume can be obtained by plotting the thus found value on a precalibrated curve comparable to that of fig1 . the process and apparatus according to the invention consequently has numerous applications in the development and checking of the operation of bubble contactors , such as bubble columns and stirred reactors used in chemical engineering . they also make it possible to follow the development of a two - phase flow by studying the variations of the interfacial area , which e . g . makes it possible to check the state of the flow in certain components of water nuclear reactors , as well as in pipes for transporting petroleum products . | 6 |
the exemplary embodiments of the present invention are described and illustrated below to encompass apparatuses and associated methods to protect assets from degradation and / or destruction that might otherwise result from unprotected exposure to a fire or a high temperature thermal energy source . of course , it will be apparent to those of ordinary skill in the art that the preferred embodiments discussed below are exemplary in nature and may be reconfigured without departing from the scope and spirit of the present invention . however , for clarity and precision , the exemplary embodiments as discussed below include optional steps and features that one of ordinary skill should recognize as not being a requisite to fall within the scope and spirit of the present invention . referencing fig1 and 2 , an exemplary structure 10 may represent a residential , commercial , industrial , institutional , or other building . for purposes of explanation only , the exemplary structure 10 discussed below will be referred to as a residential building , however , it is to be understood that the reference to a residential building may be replaced with reference to a commercial building , industrial building , institutional building , or any other building without requiring a separate explanation in order to practice the present invention . referring to fig3 and 4 , a first exemplary embodiment 12 comprises a thermal energy reflective and fire resistant blanket 14 adapted to protect the residential building 10 from a fire and / or a high temperature thermal energy source ( collectively a “ destructive threat ”), such as , without limitation , a wildfire . the blanket 14 may be deployed over the entire residential building 10 or only over selected aspects of the residential building potentially exposed to the destructive threat . an exemplary blanket 14 for use with the present invention may include a fire retardant layer and a heat resistive / reflective layer . the blanket 14 may include a nonconductive carbonized acrylic fiber layer ( nonwoven , such as pxr available from n . l . f . protective services , inc ., of dubuque , iowa 52003 ) and / or a fiberglass layer ( available from n . l . f . protective services , inc ., of dubuque , iowa 52003 ) including a coating applied thereto for at least one of fire and heat resistance . exemplary coatings include aluminum foils and aluminum based coatings . those of ordinary skill in the relevant art will recognize that alternate materials providing a fire retardant property and / or a heat resistive / reflective property may be utilized in place of or in combination with the exemplary materials discussed above . exemplary blankets 14 in accordance with the present invention may include reconfigurable segments amendable to conforming to the exterior features of the residential building 10 for a more tailored fit . such segments may be cut and sewn , heat welded , or otherwise reconfigured and fastened together to accommodate the exterior features of the residential building 10 . in addition , the segments of the blanket 14 may be permanently mounted to one another , or may be temporarily mounted to one another during the period of use , only thereafter to be disassembled for storage , egress , or other reasons . storage of the blanket 14 prior to deployment may be accomplished using one or more enclosures ( not shown ) positioned on the roof of the residential building 10 or near the building . an exemplary method of storing the blanket 14 may includes rolling up the entire blanket within a single enclosure or breaking down the blanket into two or more portions for storage within a plurality of enclosures . it is preferred that the blanket be stored in a manner to facilitate an organized and predictable withdrawal of the blanket 14 from the enclosure during deployment of the blanket . for purposes of explanation , an exemplary deployment of the blanket includes draping the blanket 14 from the rooftop of the building 10 . in this manner , the blanket 14 is unrolled or extended from the roof of the building 10 and directed downward toward the base of the building . it should be noted , however , that the blanket 14 is not required to fully reach the base of the building to impart protection . deployment may optionally include bringing the blanket 14 in contact with the ground or another structure surrounding the residential building 10 to effectively seal off the building from an approaching fire and unwanted thermal energy source . as used herein , “ sealing off ” does not necessitate creating or maintaining and fluid - tight seal . after the blanket 14 is initially deployed , it is mounted to one or more supports to secure the protective orientation of the blanket with respect to the building 10 . this securing process may include repositioning the blanket 14 to eliminate appreciable gaps and openings that would otherwise enable direct contact between the building 10 and destructive threat . as used herein , protective orientation generally refers to , without limitation , an orientation of the blanket 14 operative to provide protection to the residential building 10 from the destructive threat . cables , straps , chains , quick disconnect snaps , or come - alongs to ground anchors , or other fasteners 16 may be utilized to secure the blanket 14 in its protective position . the fasteners 16 may be heat and / or fire resistant and may comprise metals and other suitable materials sufficient to secure the blanket 14 in its protective position . likewise , the blanket 14 may include eyelets or sockets for receiving fasteners 16 , such as quick connect straps , already strategically positioned in proximity to the residential building 10 . still further , the blanket 14 may include fasteners 16 , such as hooks integrally formed therein , some of which may be adapted to mount to a fixed or repositionable anchor . it may also be advantageous to provide fasteners 16 at predetermined spaced increments to increase the stability of the blanket 14 . such increased stability may be especially advantageous if and when the residential building 10 is subjected to severe gusts of the wind resulting from convection currents generated by the destructive threat . the blanket 14 may be deployed manually , automatically , or using a combination of both in response to identifying a destructive threat to the residential building 10 . automatic deployment of the blanket 14 may include one or more motors engaging the enclosure and / or the blanket to reposition the blanket 14 to a protective orientation . in addition to , or in lieu of , motors , the blanket 14 may be repositioned using spring loaded mechanisms and / or carbon dioxide canisters . those of ordinary skill will readily understand the scope of potential techniques and devices for use in such techniques for deploying the blanket 14 . it is also within the scope and spirit of the present invention to provide entrances and / or exits 18 within the blanket 14 that may correspond to those in the residential building 10 , such as , without limitation , front doors , back doors , garage doors , etc ., to enable egress into and from the residential building 10 while the blanket 14 is deployed and secured until such time as the residents of the residential building 10 must be evacuated or the destructive threat is alleviated . it is likewise within the scope and spirit of the present invention to utilize a blanket to protect assets such as , without limitation , vehicles , recreational vehicles , mobile homes , utility trailers , boats , planes , etc . in each the aforementioned exemplary applications , a protective blanket may be stored remotely such as in a garage , or on - board the respective asset , and be adapted to be deployed manually or automatically to protect the asset from a destructive threat . the blanket may be secured to the ground , to another fire or thermal energy barrier , or otherwise secured to seal off the asset from the destructive threat . following from the above description and invention summaries , it should be apparent to those of ordinary skill in the art that , while the methods and apparatuses herein described constitute exemplary embodiments of the present invention , the invention contained herein is not limited to this precise embodiment and that changes may be made to such embodiments without departing from the scope of the invention as defined by the claims . additionally , it is to be understood that the invention is defined by the claims and it is not intended that any limitations or elements describing the exemplary embodiments set forth herein are to be incorporated into the interpretation of any claim element unless such limitation or element is explicitly stated . likewise , it is to be understood that it is not necessary to meet any or all of the identified advantages or objects of the invention disclosed herein in order to fall within the scope of any claims , since the invention is defined by the claims and since inherent and / or unforeseen advantages of the present invention may exist even though they may not have been explicitly discussed herein . | 1 |
the features of the present invention , which are believed to be novel , are set forth with particularly in the appended claims . the invention , together with further objects and advantages thereof , may best be understood with reference to the following description , taken in conjunction with the accompanying drawings , in the several figures of which like reference numerals identify like elements , and in which : fig8 illustrates an encoding system 800 consisting of input signal x ( z ) to an analysis filter bank 801 which can either take a form of any as that shown in fig1 , 12 , 14 , 15 , 16 , 17 , 18 , and a compressor 802 . the compressor 802 comprises a quantizer 803 to compress or quantize the subbands generated by the analysis filter bank , and coder 804 to further compress and format the data appropriately to provide a bit rate efficient compressed data output c ( z ). fig9 illustrates a decoding system 900 consisting of an input compressed data signal c ( z ) to a decompressor 901 . the decompressor 901 comprises an inverse coder 902 to decompress and un - format the data with the purpose of packing the data bytes in a form that facilitates subband correlation extraction during synthesis ( inverse wavelet transformation , idwt ). an inverse quantizer 903 is used to further decompress the data . a synthesis filter bank 904 may take the form as that shown in fig1 , 18 , while a subband predictor 905 is used to extract those subbands that were not encoded or transmitted and which at the decoder are predicted from other spatially correlated subbands . the subband predictor 905 is used to improve the signal quality of the recovered signal . a signal formatter 906 is further used to arrange the data bytes of the recovered signal { tilde over ( x )}( z ). in the case where the arranged data is 2 - dimensional , it may be ready to be displayed . it is highly desirable that the design of the encoding and decoding systems shown in fig8 and 9 , respectively be such that the recovered signal { tilde over ( x )}( z ) shown at the output of fig9 be as similar in quality as signal x ( z ) shown as input to fig8 . fig1 illustrates a wired or wireless system consisting of a transmitter 1000 comprising an encoder 1001 optionally having the form of the encoder shown in fig8 . the transmitter 1000 wirelessly transmits the signal from encoder 1001 in compressed output . a receiver 1002 comprising a decoder 1003 has a form as shown in fig9 to decompress the received signal from the encoder . a converter 1004 such as a display is then used to allow viewing of the recovered and uncompressed signal . it has been observed that the image subbands obtained from discrete wavelet transformation ( dwt ) processing of a two - dimension signal , such as an image , exhibit large magnitudes in contour lines which follow similar paths on the spatially correlated subbands . these contours contain the image edges , object outlines . the system proposed by this invention exploits the correlation that exists between certain subbands to reduce the number of bits necessary to code the discrete wavelet transformed image . the process of applying a wavelet transform signal decomposition stage in a subband coding system , such as the three - level analysis filter bank shown in fig1 , involves decimation of the samples ( represented herein as “↓”) at the low - pass and high - pass filter outputs . decimation introduces spatial location variance , which causes the spatial subband correlation among the subbands to be less obvious . this means decimation makes it more difficult to exploit the subband correlation . this invention proposes various systems to overcome the difficulty imposed by the decimation steps . fig1 shows decimation at the output of each filter 1100 as it is customarily seen in filter banks . prediction block 1104 uses signal y 1 ( z ) to predict the higher frequency subbands 8 , 9 and 10 corresponding to the subbands generated by a first - level discrete 2 - d wavelet transformation ( dwt ). this predicted signal is denoted by ŷ 0 ( z ). as well known in the art , decimation reduces the amount of data . therefore , decimation by 2 , denoted by ↓ 2 , causes the number of samples at the output of each filter ( h 0 ( z ) and h 1 ( z )) for the first level to be reduced by two . therefore , for the case where x ( z ) is a 2 - d input signal , the number of samples output of the first level dwt after horizontal and vertical processing is reduced by two along each dimension . in most analysis bank applications , the decimator is preceded by the filter to ensure that the signal being decimated is band - limited . the process of decimation , which is a linear but time - varying system , introduces spatial location variance , making cross - subband correlation much more difficult to exploit . a solution that lowers the number of computations from one level of the discrete - wavelet transformation ( dwt ) to the next dwt level is sought while minimizing the spatial location variance introduced by the decimation process . as seen in fig1 , a one - dimensional or a two - dimensional signal processed separately is inputted to a two - level analysis filter bank 1100 , 1101 in a subband coding system . all signals and filters are to be in the z - domain , the networks being considered in this embodiment are two level . however , it should be evident to those skilled in the art that such networks in the analysis of synthesis filter banks can easily be expanded to higher level systems . signal x ( n ) is inputted to a quadrature mirror filter bank consisting of filter h 0 ( z ) 1100 and high - pass filter h 1 ( z ) 1101 . the design of these fir filters as well as the low - pass and high - pass synthesis filters h 0 ( z ) and h 1 ( z ), respectively , may be such as to guarantee perfect reconstruction of the entire encoding ( analysis bank ) and decoding ( synthesis bank ) system . their number of terms and coefficient values are determined in the design process , whose procedure and imposed design criteria and requirements fall outside the scope of this invention . it should also be noted that at the output of each filter , the signal is decimated by a factor of 2 . prediction block 1104 is added at the output of the higher frequency subbands after applying the first level wavelet filter bank 1101 and the bandpass subbands outputted by the second level wavelet filter bank 1100 , 1101 . all unpredicted subbands pass through unpredicted subband filter 1105 . the low frequency subbands from this first level decomposition are again passed through the low - pass and high - pass analysis filters 1102 , 1103 to obtain the output band - pass subbands y 1 ( z ) and the lowest frequency subband y 2 ( z ). thus , the two - level analysis bank is applied as a separable transform to an input image signal x ( z ) yields a signal y 1 ( z ) which corresponds to band - pass subbands 5 , 6 , and 7 as shown in fig7 . similarly , signal y 0 ( z ) corresponds to subbands 8 , 9 and 10 also as shown in fig7 . subbands 1 , 2 , 3 , and 4 , represented by y 2 ( z ) at the output of filter ( 1102 ) in fig1 , correspond spatially to the low - frequency subband region obtained after applying the two - level analysis bank of fig1 horizontally and vertically as a separable transform to input signal x ( z ). prediction block 1104 is used to predict subbands y 0 ( z ) from subbands y 1 ( z ) to yield y 0 ( z ). x ( z ) is a two - dimensional ( 2 - d ) input signal . fig1 shows an equivalent representation of the two - level analysis filter bank presented in fig1 , where the filters yielding the lowest frequency and bandpass subbands , y 2 ( z ) and y 1 ( z ), respectively , are expressed using the noble identities ( from p . p . vaidyanathan , multirate systems and filter banks , prentice - hall , 1993 ) illustrated in fig1 . if the functions representing filters h 0 ( z ) and h 1 ( z ) are rational , that is , polynominals in z or z − 1 , then by using these noble - identities , one can easily arrive at the representation shown in fig1 . prediction block 1204 is immediately placed after the filters h 1 ( z ) ( 1202 ) and h 0 ( z ) h 1 ( z 2 ) 1201 and prior decimation with the purpose to eliminate any spatial location variance and allow optimal subband prediction . unpredicted subbands are filtered using unpredicted subband filter 1203 . however , the improved extraction of cross - band dependence is achieved at the expense of increased computational cost due to filtering . the lowest frequency subband from the two - level wavelet decomposition in fig1 is y 2 ( z ) in the output path of filter 1200 . fig1 illustrates a three - channel , two - level analysis filter bank , with distributed decimation around prediction block . this implementation differs from fig1 in that a reduction in data size and computations can be achieved by performing partial decimation prior to the prediction block 1401 . this scheme yields more computational cost at the predictor but less at the filtering step . this system provides a compromise between computational intensity and subband prediction effectiveness . fig1 illustrates a method to further reduce the amount of computations at the filtering step . the method illustrates a three - channel , two - level analysis filter bank with prediction of the higher frequency subbands y 0 ( z ) from the band - pass subbands y 1 ( z ) outputted after applying the second level wavelet transformation . second level , and high - pass filters , h ′ 0 ( z ) 1502 and h ′ 1 ( z ) 1503 , respectively , are different from those used in the first level wavelet transformation . these analysis filters have less number of taps than those used in the first level 1500 and 1501 . this solution optimizes subband prediction while lowering the number of computations required at filtering by reducing the number of fir filter taps or terms . by using shorter finite impulse response ( fir ) filters for low - pass h ′ 0 ( z ) 1502 and high - pass h ′ 1 ( z ) 1503 filters in the second level of the discrete wavelet transformation , the computational cost is reduced without requiring partial decimation prior prediction . again , by having the decimators in the band - pass subbands y 1 ( z ) and in the high - frequency subbands y 0 ( z ) at the output of prediction block 1504 , spatial localization variance is minimized , allowing best prediction to be achieved for the high - frequency subbands . in systems where the wavelet transformation is followed by quantization and coding , such that perfect reconstruction is not a sought condition , using shorter fir filters , h ′ 0 ( z ) 1502 and h ′ 1 ( z ) 1503 for the high - pass at the second and higher levels in a two - dimensional filter bank is a highly considerable approach for reducing the number of computations . fig1 shows a one - dimensional analysis filter bank , which can be used in a two - dimensional system as a separable transform by first applying the filter bank in one dimension ( for example along y ) then in the other dimension ( for example along x ). in this system the second level low - frequency subbands y 2 ( z ) are at the output of h 0 ( z ) h 0 1 ( z 2 ) 1600 . similarly , the band - pass subbands y 1 ( z ) are obtained from h 0 ( z ) h ′ 1 ( z 2 ) 1601 output path . fig1 shows a system where the computational intensity at the filtering stages is reduced by using shorter fir filters in the second stage , h ′ 0 ( z ) and h ′ 1 ( z ) 1602 , and further by splitting the decimators in the band - pass subbands around the predictor block 1604 . while this scheme offers less computations at filtering compared to that required in fig1 , it introduces certain spatial localization variance prior prediction due to decimation being split . fig1 illustrates analysis - by - synthesis prediction of the first level high - pass subbands y 0 ( z ) to obtain the predictor parameters ŷ 0 ( z ). h 0 ( z ) and h 1 ( z ), as denoted previously are part of the analysis filter bank , are represented in this two - level wavelet decomposition ( 1710 ) by filters h 0 ( z ) h 0 ( z 2 ) 1700 , h 0 ( z ) h 1 ( z 2 ) 1701 and h 1 ( z ) to yield in their output paths the lowest frequency subband y 2 ( z ), band - pass subbands y 1 ( z ) and highest frequency subbands y 0 ( z ), respectively . similarly , g 1 ( z ) and g 0 ( z ) correspond to the synthesis inverse discrete wavelet transform , idwt , represented by block 1711 . full interpolation (↑) illustrates that there is no distribution of the decimators around the predictor 1707 . only the output of v 1 ( z ) 1706 , in the inverse discrete wavelet transformation , idwt , section of system 1711 is used by the predictor to extract the highest frequency subbands y 0 ( z ), from the synthesized signal v 1 ( z ) 1706 . in fig1 , this predicted subband is represented by signal v ′ 0 ( z ). thus , the output recovered signal { tilde over ( x )}( z ) is obtained by processing the lowest frequency subbands v 2 ( z ) 1705 , the bandpass subbands v 1 ( z ) and the predicted subbands v ′ 0 ( z ), which must be filtered by the synthesis lowpass filter g 1 ( z ) 1709 to yield v 0 ( z ). it is then the summation 1708 of signals v 2 ( z ), v 1 ( z ), and v 0 ( z ) which give the recovered input signal x ( z ) represented by { tilde over ( x )}( z ). it should be noted that { tilde over ( x )}( z )= x ( z ) in a perfectly reconstructed system . however , in fig1 , { tilde over ( x )}( z ) illustrates a best approximation of the input signal x ( z ). to completely avoid the spatial location variance due to decimation , fig1 illustrates where the highest frequency subband , y 0 ( z ) is predicted to obtain the predictor parameters ŷ 0 ( z ) from the synthesized signal v 1 ( z ) 1706 . again , v 1 ( z ) is obtained by applying the inverse discrete wavelet transformation by using synthesis filters g 0 ( z ) and g 1 ( z ) to the second level band - pass filter output signal , y 1 ( z ). in the case of a two - dimensional input , such as an image , the channels , y 0 ( z ), y 1 ( z ) and y 2 ( z ) correspond to subbands [ 8 , 9 , 10 ] for signal y 0 ( z ), subbands [ 5 , 6 , 7 ] for y 1 ( z ) and [ 1 , 2 , 3 , 4 ] for signal y 2 ( z ) where subbands [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 ] are as shown in fig7 . again referring to fig1 , output signal { tilde over ( x )}( z ) is the sum of the synthesized subbands v 2 ( z ) 1705 v 1 ( z ) 1706 and v 0 ( z ) 1710 . the synthesis bank processes the outputs from the analysis bank at the encoder by performing the inverse discrete wavelet transformation . this process begins be interpolating by 4 the lowest frequency subband y 2 ( z ) and also interpolating by 4 the band - pass subband y 1 ( z ). the interpolated y 2 ( z ) signal is filtered by the filters g 0 ( z 2 ) g 0 ( z ) to obtain the synthesized signal v 2 ( z ) corresponding to the lowest frequency subbands of the recovered signal . similarly , the interpolated y 1 ( z ) signal is filtered by g 1 ( z 2 ) g 0 ( z ) to obtain the synthesized signal v 1 ( z ). v 1 ( z ) from the synthesis bank and y 0 ( z ) from the analysis bank are inputted to the predictor to obtain the predictor parameters , denoted by ŷ 0 ( z ) and v ′ 0 ( z ). signal v ′ 0 ( z ) is then filtered by the synthesis high - pass filter g 1 ( z ) to obtain v 0 ( z ). the following equations , written in matrix form , show the relationship between the signals of fig1 . inputs , outputs , and filters are all in the z - domain . however , to simplify the expressions z is omitted , for example , y ( 1 ) ( z )≡ y ( 1 ) , h 0 ( z )≡ h 0 , h 0 ( z ) x ( z ) h 0 t ( z )≡ h 0 xh 0 t . . . and so on eq . ( 5 ) consider the two - dimensional case as an extension of the one - dimensional case . let x ( z )≡ x be the input image of size n × n . at the analysis bank , the forward discrete wavelet transforms ( dwt ) in fig1 is represented as a two - dimensional two - level filter bank . applying this analysis bank along both dimensions of input image x ( z ), the first - level dwt , y ( 1 ) is expressed as : y ( 1 ) = [ h 0 h 1 ] x [ h 0 t h 1 t ] = [ h 0 xh 0 t h 0 xh 1 t h 1 xh 0 t h 1 xh 1 t ] = [ y ll y lh y hl y hh ] eq . ( 6 ) where h 0 t represents the transpose of the matrix representation of analysis h 0 ( z )≡ h 0 . similarly h 1 t represents transpose of the matrix representation of analysis high - pass h 1 ( z )≡ h 1 . y ll , y lh , y hl , and y hh are the four subbands obtained after applying the first level forward discrete wavelet transform , dwt . y ll represents the low - frequency subband , y lh and y hl are band - pass vertically oriented subband and band - pass horizontally oriented subband , respectively . y hh is the high frequency ( diagonal ) subband . referring to fig1 , y 0 ( z ) corresponds to y hl , y lh and y hh when processing the analysis band two - dimensionally . again considering the case where the input signal is two - dimensional , the second level forward discrete wavelet transformation , dwt , uses the decimated subband y ll from the first level as the input to the second level , in order to obtain signal y ( 2 ) in eq . ( 7 ). in eq . ( 7 ) signal y ( 2 ) contains subbands y hl , y lh , and y hh , which are the first level decomposition subbands related to signal y 0 ( z ) shown in fig1 . matrix y ( 2 ) will also contain the elements obtained by applying the second level dwt to y ll of eq . ( 6 ) to give the two - dimensional representation of signals y 1 ( z ) and y 2 ( z ). it can also be easily observed that y 2 ( z ) in fig1 corresponds to subband y llll in eqs . ( 7 ) and ( 8 ) and similarly y 1 ( z ) corresponds to subbands y lllh , y hlll , and y hhhh also from eq . ( 7 ), eq . ( 9 ), eq . ( 10 ) and eq . ( 11 ). y ( 2 ) = [ [ h 0 ′ h 1 ′ ] y ll [ h 0 ′ t h 1 ′ t ] y lh y hl y hh ] = [ [ h 0 ′ y ll h 0 ′ t h 0 ′ y ll h 1 ′ t h 1 ′ y ll h 0 ′ t h 1 ′ y ll h 1 ′ t ] y lh y hl y hh ] = [ [ y llll y lllh y hlll y hhhh ] y lh y hl y hh ] eq . ( 7 ) where the second - level discrete wavelet transformation ( dwt ) processing is expressed with “ primed ” matrices shown in eq . ( 7 ) and ‘ t ’ denotes transpose . from equation ( 7 ) we derive : y lll = h 0 ′ y ll h 0 ′ t eq . ( 8 ) y lllh = h 0 ′ y ll h 1 ′ t eq . ( 9 ) y hlll = h 1 ′ y ll h 0 ′ t eq . ( 10 ) y hhhh = h 1 ′ y ll h 1 ′ t eq . ( 11 ) again , ‘ t ’ denoting the transpose of the matrix and ‘ primed ’ representing the second - level discrete wavelet transformation . applying now synthesis to subbands y llll , y lllh , y hlll , y hhhh , we have : y ll = [ g 0 ′ t g 1 ′ t ] [ h 0 ′ y ll h 0 ′ t h 0 ′ y ll h 1 ′ t h 1 ′ y ll h 0 ′ t h 1 ′ y ll h 1 ′ t ] [ g 0 ′ g 1 ′ ] eq . ( 12 ) where g 0 ′, and g 1 ′ are the and high - pass synthesis filters in matrix form . t denotes the transpose of the matrix , such that g 0 ′ t is the matrix transposed of g 0 ′ matrix filter and g 1 ′ t is the matrix transposed of the high - pass filter g 1 ′ also represented in matrix form . i =. g 0 ′ t h 0 ′+ g 1 ′ t h 1 ′ eq . ( 13 ) therefore from eq . ( 12 ) the synthesized ll subband is the sum of four parts , of which the ones of interest are : s lh = g 1 ′ t h 1 ′ y ll h 0 ′ t g 0 ′ ( vertical subband ) eq . ( 15 ) s hl = g 1 ′ t h 1 ′ y ll h 0 ′ t g 0 ′ ( horizontal subband ) eq . ( 16 ) s hh = g 1 ′ t h 1 ′ y ll h 1 ′ t g 1 ′ ( diagonal subband ) eq . ( 17 ) the vertical , horizontal , and diagonal subbands of eq . ( 15 ), ( 16 ), and ( 18 ), respectively , correspond to signal v 1 ( z ) of fig1 assuming two - dimensional processing . therefore , these are the signals of interest to be applied to the predictor block of fig1 . several known methods or models of prediction such as auto - regressive - moving ,- average ( arma ), moving average ( ma ), auto - regressive ( ar ), linear , may be used to predict the desired subbands . for example , the process of predicting the vertical subband , y lh , resulting from a first - level discrete wavelet transformation after applying a first - level analysis filter bank , from a synthesized s lh subband expressed accordingly in equation ( 15 ), may be expressed by the general equation ( 18 ) as follows : predicted vertical subband ≡ predicted y lh ≡ ŷ lh = p ( y lh , s lh ) eq . ( 18 ) predicted horizontal subband ≡ predicted y hl ≡ ŷ hl = p ( y hl , s hl ) eq . ( 19 ) predicted diagonal subband ≡ predicted y hh ≡ ŷ hh = p ( y hh , s hl ) eq . ( 20 ) where ŷ denotes predicted subband , s lh , s hl , and s hh are the synthesized subband from the second - level inverse wavelet transformation as given by equations ( 15 ), ( 16 ), and ( 17 ), respectively . fig1 illustrates analysis - by - synthesis prediction of the first - level , high - pass subband , y 0 ( z ) to obtain the predicted subband ŷ 0 ( z ). h 0 ( z ) and h 1 ( z ) are the low and high - pass filters , respectively , corresponding to the analysis filter bank . g 0 ( z ) and g 1 ( z ) are the low - pass and high - pass synthesis filters , respectively , corresponding to the inverse discrete wavelet filter bank ( idwt ). fig1 shows the system in fig1 with partial interpolation in front of synthesis . thus , in summary , the invention includes an encoder and decoder that utilizes a filter bank to decorrelate an input data signal ; decimators to down sample the filtered input data signal and a predictor to extract cross - subband dependence . a decoder then recovers the received data signal and includes interpolators to upsample the received compressed data signal , multilevel filter bank to perform an inverse wavelet transformation and a predictor to extract cross - subband correlations . while the preferred embodiments of the invention have been illustrated and described , it will be clear that the invention is not so limited . numerous modifications , changes , variations , substitutions and equivalents will occur to those skilled in the art without departing from the spirit and scope of the present invention as defined by the appended claims . | 6 |
referring to fig1 to 7 , what is shown is a method for the treatment of glaucoma by trabecular bypass surgery . in particular , a seton implant is used to bypass diseased trabecular meshwork at the level of trabecular meshwork to use or restore existing outflow pathways and methods thereof for background illustration purposes , fig1 shows a sectional view of an eye 10 , while fig2 shows a close - up view , showing the relative anatomical locations of the trabecular meshwork , the anterior chamber , and schlemm &# 39 ; s canal . thick collagenous tissue known as sclera 11 covers the entire eye 10 except that portion covered by the cornea 12 . the cornea 12 is a thin transparent tissue that focuses and transmits light into the eye and the pupil 14 which is the circular hole in the center of the iris 13 ( colored portion of the eye ). the cornea 12 merges into the sclera 11 at a juncture referred to as the limbus 15 . the ciliary body 16 begins internally in the eye and extends along the interior of the sclera 11 and becomes the choroid 17 . the choroid 17 is a vascular layer of the eye underlying retina 18 . the optic nerve 19 transmits visual information to the brain and is sequentially destroyed by glaucoma . the anterior chamber 20 of the eye 10 , which is bound anteriorly by the cornea 12 and posteriorly by the iris 13 and lens 26 , is filled with aqueous . aqueous is produced primarily by the ciliary body 16 and reaches the anterior chamber angle 25 formed between the iris 13 and the cornea 12 through the pupil 14 . in a normal eye , the aqueous is removed through the trabecular meshwork 21 . aqueous passes through trabecular meshwork 21 into schlemm &# 39 ; s canal 22 and through the aqueous veins 23 which merge with blood - carrying veins and into venous circulation . intraocular pressure of the eye 10 is maintained by the intricate balance of secretion and outflow of the aqueous in the manner described above . glaucoma is characterized by the excessive buildup of aqueous fluid in the anterior chamber 20 which produces an increase in intraocular pressure ( fluids are relatively incompressible and pressure is directed equally to all areas of the eye ). as shown in fig2 , the trabecular meshwork 21 constitutes a small portion of the sclera 11 . it is understandable that creating a hole or opening for implanting a device through the tissues of the conjunctiva 24 and sclera 11 is relatively a major surgery as compared to a surgery for implanting a device through the trabecular meshwork 21 only . a seton implant 31 of the present invention for either using or restoring existing outflow pathways positioned through the trabecular meshwork 21 is illustrated in fig5 . in a first embodiment , a method for increasing aqueous humor outflow in an eye of a patient to reduce the intraocular pressure therein . the method comprises bypassing diseased trabecular meshwork at the level of the trabecular meshwork and thereby restoring existing outflow pathways . alternately , a method for increasing aqueous humor outflow in an eye of a patient to reduce an intraocular pressure therein is disclosed . the method comprises bypassing diseased trabecular meshwork at a level of said trabecular meshwork with a seton implant and using existing outflow pathways . the seton implant 31 may be an elongated seton or other appropriate shape , size or configuration . in one embodiment of an elongated seton implant , the seton has an inlet end , an outlet end and a lumen therebetween , wherein the inlet end is positioned at an anterior chamber of the eye and the outlet end is positioned at about an exterior surface of said diseased trabecular meshwork . furthermore , the outlet end may be positioned into fluid collection channels of the existing outflow pathways . optionally , the existing outflow pathways may comprise schlemm &# 39 ; s canal 22 . the outlet end may be further positioned into fluid collection channels up to the level of the aqueous veins with the seton inserted either in a retrograde or antegrade fashion with respect to the existing outflow pathways . in a further alternate embodiment , a method is disclosed for increasing aqueous humor outflow in an eye of a patient to reduce an intraocular pressure therein . the method comprises ( a ) creating an opening in trabecular meshwork , wherein the trabecular meshwork comprises an interior side and exterior side ; ( b ) inserting a seton implant into the opening ; and ( c ) transporting the aqueous humor by said seton implant to bypass the trabecular meshwork at the level of said trabecular meshwork from the interior side to the exterior side of the trabecular meshwork . fig3 shows an embodiment of the seton implant 31 constructed according to the principles of the invention . the seton implant may comprise a biocompatible material , such as a medical grade silicone , for example , the material sold under the trademark silastic ™, which is available from dow corning corporation of midland , mich ., or polyurethane , which is sold under the trademark pellethane ™, which is also available from dow corning corporation . in an alternate embodiment , other biocompatible materials ( biomaterials ) may be used , such as polyvinyl alcohol , polyvinyl pyrolidone , collagen , heparinized collagen , tetrafluoroethylene , fluorinated polymer , fluorinated elastomer , flexible fused silica , polyolefin , polyester , polysilison , mixture of biocompatible materials , and the like . in a further alternate embodiment , a composite biocompatible material by surface coating the above - mentioned biomaterial may be used , wherein the coating material may be selected from the group consisting of polytetrafluoroethlyene ( ptfe ), polyimide , hydrogel , heparin , therapeutic drugs , and the like . the main purpose of the seton implant is to assist in facilitating the outflow of aqueous in an outward direction 40 into the schlemm &# 39 ; s canal and subsequently into the aqueous collectors and the aqueous veins so that the intraocular pressure is balanced . in one embodiment , the seton implant 31 comprises an elongated tubular element having a distal section 32 and an inlet section 44 . a rigid or flexible distal section 32 is positioned inside one of the existing outflow pathways . the distal section may have either a tapered outlet end 33 or have at least one ridge 37 or other retention device protruding radially outwardly for stabilizing the seton implant inside said existing outflow pathways after implantation . for stabilization purposes , the outer surface of the distal section 32 may comprise a stubbed surface , a ribbed surface , a surface with pillars , a textured surface , or the like . the outer surface 36 , including the outer region 35 and inner region 34 at the outlet end 33 , of the seton implant is biocompatible and tissue compatible so that the interaction / irritation between the outer surface and the surrounding tissue is minimized . the seton implant may comprise at least one opening at a location proximal the distal section 32 , away from the outlet end 33 , to allow flow of aqueous in more than one direction . the at least one opening may be located on the distal section 32 at about opposite of the outlet end 33 . in another exemplary embodiment , the seton implant 31 may have a one - way flow controlling means 39 for allowing one - way aqueous flow 40 . the one - way flow controlling means 39 may be selected from the group consisting of a check valve , a slit valve , a micropump , a semi - permeable membrane , or the like . to enhance the outflow efficiency , at least one optional opening 41 in the proximal portion of the distal section 32 , at a location away from the outlet end 33 , and in an exemplary embodiment at the opposite end of the outlet end 33 , is provided . fig4 shows a top cross - sectional view of fig3 . the shape of the opening of the outlet end 33 and the remaining body of the distal section 32 may be oval , round or some other shape adapted to conform to the shape of the existing outflow pathways . this configuration will match the contour of schlemm &# 39 ; s canal to stabilize the inlet section with respect to the iris and cornea by preventing rotation . as shown in fig3 , the seton implant of the present invention may have a length between about 0 . 5 mm to over a meter , depending on the body cavity the seton implant applies to . the outside diameter of the seton implant may range from about 30 μm to about 500 μm . the lumen diameter is preferably in the range between about 20 μm to about 150 μm . the seton implant may have a plurality of lumens to facilitate multiple flow transportation . the distal section may be curved at an angle between about 30 degrees to about 150 degrees , in an exemplary embodiment at around 70 - 110 degrees , with reference to the inlet section 44 . fig5 shows another embodiment of the seton implant 45 constructed in accordance with the principles of the invention . in an exemplary embodiment , the seton implant 45 may comprise at least two sections : an inlet section 47 and an outlet section 46 . the outlet section has an outlet opening 48 that is at the outlet end of the seton implant 45 . the shape of the outlet opening 48 is preferably an oval shape to conform to the contour of the existing outflow pathways . a portion of the inlet section 47 adjacent the joint region to the outlet section 46 will be positioned essentially through the diseased trabecular meshwork while the remainder of the inlet section 47 and the outlet section 46 are outside the trabecular meshwork . as shown in fig5 , the long axis of the oval shape opening 48 lies in a first plane formed by an x - axis and a y - axis . to better conform to the anatomical contour of the anterior chamber 20 , the trabecular meshwork 21 and the existing outflow pathways , the inlet section 47 may preferably lie at an elevated second plane , at an angle θ , from the first plane formed by an imaginary inlet section 47 a and the outlet section 46 . the angle θ may be between about 30 degrees and about 150 degrees . fig6 shows a perspective view illustrating the seton implant 31 , 45 of the present invention positioned within the tissue of an eye 10 . a hole / opening is created through the diseased trabecular meshwork 21 . the distal section 32 of the seton implant 31 is inserted into the hole , wherein the inlet end 38 is exposed to the anterior chamber 20 while the outlet end 33 is positioned at about an exterior surface 43 of said diseased trabecular meshwork 21 . in a further embodiment , the outlet end 33 may further enter into fluid collection channels of the existing outflow pathways . in one embodiment , the means for forming a hole / opening in the trabecular mesh 21 may comprise an incision with a microknife , an incision by a pointed guidewire , a sharpened applicator , a screw shaped applicator , an irrigating applicator , or a barbed applicator . alternatively , the trabecular meshwork may be dissected off with an instrument similar to a retinal pick or microcurrette . the opening may alternately be created by retrograde fiberoptic laser ablation . fig7 shows an illustrative method for placing a seton implant at the implant site . an irrigating knife or applicator 51 comprises a syringe portion 54 and a cannula portion 55 . the distal section of the cannula portion 55 has at least one irrigating hole 53 and a distal space 56 for holding a seton implant 31 . the proximal end 57 of the lumen of the distal space 56 is sealed from the remaining lumen of the cannula portion 55 . for positioning the seton 31 in the hole or opening through the trabecular meshwork , the seton may be advanced over the guidewire or a fiberoptic ( retrograde ). in another embodiment , the seton is directly placed on the delivery applicator and advanced to the implant site , wherein the delivery applicator holds the seton securely during the delivery stage and releases it during the deployment stage . in an exemplary embodiment of the trabecular meshwork surgery , the patient is placed in the supine position , prepped , draped and anesthesia obtained . in one embodiment , a small ( less than 1 mm ) self sealing incision is made . through the cornea opposite the seton placement site , an incision is made in trabecular meshwork with an irrigating knife . the seton 31 is then advanced through the cornea incision 52 across the anterior chamber 20 held in an irrigating applicator 51 under gonioscopic ( lens ) or endoscopic guidance . the applicator is withdrawn and the surgery concluded . the irrigating knife may be within a size range of 20 to 40 gauges , preferably about 30 gauge . from the foregoing description , it should now be appreciated that a novel approach for the surgical treatment of glaucoma has been disclosed for releasing excessive intraocular pressure . while the invention has been described with reference to a specific embodiment , the description is illustrative of the invention and is not to be construed as limiting the invention . various modifications and applications may occur to those who are skilled in the art , without departing from the true spirit and scope of the invention , as described by the appended claims . | 0 |
before the description of the preferred embodiments , prior art lcd apparatuses will be explained with reference to fig1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 a , 9 b , 10 , 11 , 12 , 13 , 14 and 15 . in fig1 , which illustrates a first prior art lcd apparatus , reference numeral 11 designates an lcd panel having m × n dots where m is 640 and n is 480 , for example . that is , the lcd panel 11 includes m data lines dl 1 , dl 2 , dl 3 , dl 4 , . . . , dl m − 1 , dl m driven by a data line driver circuit 12 , n gate lines gl 1 , gl 2 , gl 3 , gl 4 , . . . , gl n − 1 , gl n driven by a gate line driver circuit 13 , and m × n pixels p ij ( i = 1 , 2 , 3 , 4 , . . . , m − 1 , m ; j = 1 , 2 , 3 , 4 , . . . , n − 1 , n ) each located at one intersection between the data lines dl 1 , dl 2 , dl 3 , dl 4 , . . . , dl m − 1 , dl m and the gate lines gl 1 , gl 2 , gl 3 , gl 4 , . . . , gl n − 1 , gl n . each of the pixels p ij is constructed by one thin film transistor ( tft ) q ij such as q 11 , one pixel capacitor c ij such as c 11 including liquid crystal connected between the tft q ij and a common electrode to which a common voltage vcom is applied . in fig2 , which illustrates a detailed circuit diagram of the data line driver circuit 12 of fig1 , the data line driver circuit 12 is constructed by a shift register circuit 121 , a data register circuit 122 , a data latch circuit 123 , a digital / analog ( d / a ) conversion circuit 124 , and an output buffer circuit 125 . the shift register circuit 121 shifts a horizontal start pulse signal ( hst ) as shown in fig3 in synchronization with a horizontal clock signal hck as shown in fig3 . the shift register circuit 121 is formed by serially - connected d - type flip - flops 1211 , 1212 , 1213 , 1214 , . . . , 121 m − 1 , 121 m clocked by rising edges of the horizontal clock signal hck to generate latch signals la 1 , la 2 , la 3 , la 4 , , lam − 1 , lam , sequentially , as shown in fig3 . note that the horizontal start pulse signal hst is generated from a horizontal timing generating circuit ( not shown ) which receives a horizontal synchronization signal hsync . also , the horizontal clock signal hck is generated from a clock signal generating circuit ( not shown ). the data register circuit 122 latches an 8 - bit gradation video data signal vd represented by b 0 , b 1 , . . . , b 7 in accordance with the latch signals la 1 , la 2 , la 3 , la 4 , . . . , lam − 1 , lam . the data register circuit 122 is formed by 8 d - type flip - flops 1221 clocked by the latch signal la 1 to latch digital video data d 1 of the gradation video signal vd as shown in fig3 , 8 d - type flip - flops 1222 clocked by the latch signal la 2 to latch digital video data d 2 of the gradation video signal vd as shown in fig3 , 8 d - type flip - flops 1223 clocked by the latch signal la 3 to latch digital video data d 3 of the gradation video signal vd as shown in fig3 , 8 d - type flip - flops 1224 clocked by the latch signal la 4 to latch digital video data d 4 of the gradation video signal vd as shown in fig3 , 8 d - type flip - flops 122 m − 1clocked by the latch signal lam − 1to latch digital video data dm − 1of the gradation video signal vd as shown in fig3 , and 8 d - type flip - flops 122 m clocked by the latch signal lam to latch digital video data dm of the gradation video signal vd as shown in fig3 . in this case , the digital video data d 1 , d 2 , d 3 , d 4 , . . . , dm − 1 , dm of the 8 - bit gradation video signal vd are sequentially generated from a signal processing circuit ( not shown ). the data latch circuit 123 latches and multiplexes the digital video data d 1 , d 2 , d 3 , d 4 , . . . , dm − 1 , dm . the data latch circuit 123 is formed by latch circuits 1231 , 1232 , 1233 , 1234 , , 123 m − 1 , 123 m clocked by a horizontal strobe signal hstb as shown in fig3 which is generated from the horizontal timing generating circuit , and multiplexers 1231 ′, 1232 ′, . . . , 123 m / 2 ′ clocked by a polarity signal pol as shown in fig3 which is also generated from the horizontal timing generating circuit . this polarity signal pol is used for carrying out a dot inversion method which is advantageous in power consumption . the d / a conversion circuit 124 is formed by positive - side d / a converters 1241 , 1243 , . . . , 124 m − 1 for generating analog gradation voltages on the positive side with respect to the common voltage vcom and negative - side d / a converters 1242 , 1244 , . . . , 124 m for generating analog gradation voltages on the negative side with respect to the common voltage vcom . that is , if pol =“ 1 ”, the latch circuits 1231 , 1232 , 1233 , 1234 , , 123 m − 1 , 123 m are connected by the multiplexers 1231 ′, 1232 ′, . . . , 123 m / 2 ′ to the d / a converters 1241 , 1242 , 1243 , 1244 , . . . , 124 m − 1 , 124 m , respectively . as a result , the d / a converters 1241 , 1242 , 1243 , 1244 , . . . , 124 m − 1 , 124 m generate analog video signals corresponding to the digital video signals d 1 , d 2 , d 3 , d 4 , . . . , dm − 1 , dm , respectively . on the other hand , if pol =“ 0 ”, the latch circuits 1231 , 1232 , 1233 , 1234 , . . . , 123 m − 1 , 123 m are connected by the multiplexers 1231 ′, 1232 ′, . . . , 123 m / 2 ′ to the d / a converters 1242 , 1241 , 1244 , 1243 , . . . , 124 m , 124 m − 1 , respectively . as a result , the d / a converters 1241 , 1242 , 1243 , 1244 , . . . , 124 m − 1 , 124 m generate analog video signals corresponding to the digital video signals d 2 , d 1 , d 4 , d 3 , . . . , dm , dm − 1 , respectively . the output buffer circuit 125 multiplexes the analog video signals from the d / a conversion circuit 124 in accordance with a data selection signal dsl as shown in fig3 similar to the polarity signal pol . the data selection signal dsl is generated from the horizontal timing generating circuit . the output buffer circuit 125 is formed by amplifiers ( usually , voltage - follower - type operational amplifiers ) 1251 , 1252 , 1253 , 1254 , . . . , 125 m − 1 , 125 m for amplifying the analog video signals from the d / a converters 1241 , 1242 , 1243 , 1244 , . . . , 124 m − 1 , 124 m , respectively , and multiplexers 1251 ′, 1252 ′, . . . , 125 m / 2 ′ clocked by the data selection signal dol . in this case , the multiplexers 1251 ′, 1252 ′, . . . , 125 m / 2 ′ operate in the same way as the multiplexers 1231 ′, 1232 ′, . . . , 123 m / 2 ′, respectively , of the data latch circuit 123 . that is , if dsl =“ 1 ”, the multiplexers 1251 ′, 1252 ′, . . . , 125 m / 2 ′ are in a through state , while if dsl =“ 0 ”, the multiplexers 1251 ′, 1252 ′, . . . , 125 m / 2 ′ are in a cross state . therefore , the analog video signals corresponding to the digital video signals d 1 , d 2 , d 3 , d 4 , . . . , dm − 1 , dm are supplied to the data lines dl 1 , dl 2 , dl 3 , dl 4 , . . . , dl m − 1 , dl m , respectively . note that the analog video signals corresponding to the digital video signals d 2 , d 1 , d 4 , d 3 , . . . , dm , dm − 1 are never supplied to the respective data lines dl 1 , dl 2 , dl 3 , dl 4 , . . . , dl m − 1 , dl m . in fig4 , which illustrates a detailed circuit diagram of the gate line driver circuit 13 of fig1 , the gate line driver circuit 13 is constructed by a shift register circuit 131 for shifting a vertical start pulse signal vst as shown in fig5 in synchronization with a vertical clock signal vck as shown in fig5 , and an output buffer circuit 132 formed by amplifiers ( usually , voltage - follower - type operational amplifiers ) 1321 , 1322 , 1323 , 1324 , . . . , 132 n − 1 , 132 n . note that one vertical start pulse signal vst is generated per one frame period . this shift register circuit 131 is formed by serially - connected d - type flip - flops 1311 , 1312 , 1313 , 1314 , . . . , 131 n − 1 , 131 n clocked by rising edges of the vertical clock signal vck to generate gate line signals ( or scan line signals ) as shown in fig5 on the gate lines gl 1 , gl 2 , gl 3 , gl 4 , . . . , gl n − 1 , gl n , respectively . as illustrated in fig6 , in a first frame period t 1 , when video data { circle around ( 1 )}+, { circle around ( 2 )}−, { circle around ( 3 )}+ and { circle around ( 4 )}− are supplied to the data lines dl 1 , dl 2 , dl 3 and dl 4 , respectively , while the gate line signal at the gate line gl 1 is high , the video data { circle around ( 1 )}+, { circle around ( 2 )}−, { circle around ( 3 )}+ and { circle around ( 4 )}− are written into pixels a , b , c and d , respectively , at time t 1 as illustrated in fig7 . next , in a second frame period t 2 , when video data { circle around ( 1 )}′−, { circle around ( 2 )}′+, { circle around ( 3 )}′− and { circle around ( 4 )}′+ are supplied to the data lines dl 1 , dl 2 , dl 3 and dl 4 , respectively , while the gate line signal at the gate line gl 2 is high , the video data { circle around ( 1 )}′−, { circle around ( 2 )}′+, { circle around ( 3 )}′− and { circle around ( 4 )}′+ are written into pixels e , f , g and h , respectively , at time t 2 as illustrated in fig7 . next , in a third frame period t 3 , when video data { circle around ( 1 )}″+, { circle around ( 2 )}″−, { circle around ( 3 )}″+ and { circle around ( 4 )}″− are supplied to the data lines dl 1 , dl 2 , dl 3 and dl 4 , respectively , while the gate line signal at the gate line gl 3 is high , the video data { circle around ( 1 )}″+, { circle around ( 2 )}″−, { circle around ( 3 )}″+ and { circle around ( 4 )}″− are written into pixels i , j , k and l , respectively , at time t 3 as illustrated in fig7 . in the lcd apparatus of fig1 , however , the quality of display deteriorates due to the residual image phenomenon . for example , if the lcd apparatus of fig1 is of a twisted nematic ( tn ) type , the response speed is on the order of 10 ms which is longer than one frame period such as 1 / 60 sec . as a result , as illustrated in fig8 , the application of a displayed pixel gradation voltage ( brightness ) actually cannot follow the writing of its corresponding video data to one of the data lines dl 1 , dl 2 , dl 3 , dl 4 , . . . , dl m − 1 , dl m . for example , it will take three or four frame periods for the actual displayed pixel gradation voltage to reach its target voltage represented by the corresponding video data . thus , the above - mentioned residual image phenomenon is caused by the low response speed of the lcd apparatus of fig1 . additionally , the above - mentioned residual image phenomenon is caused , since the lcd apparatus of fig1 is of a hold type ( see : taiichiro kurita , “ degradation of quality of moving images displayed on hold type displays and its improving method ”, 1999 symposium of ieice , sc - 8 - 1 , pp . 207 - 208 , 1999 ). that is , as illustrated in fig9 a , in a hold type display apparatus such as the lcd apparatus of fig1 , since a supplied video data gradation holds for one frame period , the supplied video data remains until the next video data is supplied , which would enhance the residual image phenomenon . on the other hand , as illustrated in fig9 b , in an impulse type display apparatus such as a cathode ray tube ( crt ) display apparatus , a supplied video data gradation holds only for a short time such as several milliseconds , which would suppress the residual image phenomenon . in fig1 , which illustrates a second prior art lcd apparatus ( see : jp - a - 2000 - 122596 ), in order to suppress the residual image phenomenon , while video data are supplied to pixels on one gate line , black signals are supplied to pixels on another gate line . in fig1 , an lcd panel 21 , a data line driver circuit 22 and a gate line driver circuit 23 are provided . in this case , the lcd panel 21 and the data line driver circuit 22 have the same configuration as the lcd panel 11 and the data line driver circuit 12 , respectively , of fig1 . in fig1 , which illustrates a detailed circuit diagram of the gate line driver circuit 23 of fig1 , the gate line driver circuit 23 is constructed by shift register circuits 231 and 232 for shifting a vertical start pulse signal vst as shown in fig1 in synchronization with a vertical clock signal vck as shown in fig1 , a gate circuit 233 , and an output buffer circuit 234 formed by amplifiers ( usually , voltage - follower - type operational amplifiers ) 2341 , 2342 , 2343 , 2344 , . . . , 234 n − 1 , 234 n . the shift register circuit 231 is formed by serially - connected d - type flip - flops 2311 , 2312 , 2313 , 2314 , . . . , 231 n − 1 , 231 n clocked by rising edges of the vertical clock signal vck to generate signals s 1 , s 2 , s 3 , s 4 , . . . , s n − 1 , s n as shown in fig1 . the shift register circuit 232 is formed by serially - connected d - type flip - flops 2321 , 2322 , 2323 , 2324 , . . . , 232 n − 1 , 232 n clocked by falling edges of the vertical clock signal vck to generate signals s 1 ′, s 2 ′, s 3 ′, s 4 ′, . . . , s n − 1 ′, s n ′ as shown in fig1 . the gate circuit 233 is formed by a gate 2331 for receiving the signals s 1 and s 1 ′, a gate 2332 for receiving the signals s 2 and s 2 ′, a gate 2333 for receiving the signals s 3 and s 3 ′, a gate 2334 for receiving the signals s 4 and s 4 ″, . . . , a gate 233 n − 1 for receiving the signals s n − 1 , and s n − 1 ′, a gate 233 n for receiving the signals s n and s n ′, to generate gate line signals ( or scan line signals ) on the gate lines gl 1 , gl 2 , gl 3 , gl 4 , . . . , gl n − 1 , gl n , respectively , as shown in fig1 . in fig1 , two vertical start pulse signals vst are generated per one frame period . a first one of the vertical start pulse signals vst is used for writing black data , while a second one of the vertical start pulse signals vst is used for writing video data . as illustrated in fig1 , in the former half t 1 of a first frame period , when video data { circle around ( 1 )}+, { circle around ( 2 )}−, { circle around ( 3 )}+ and { circle around ( 4 )}− are supplied to the data lines dl 1 , dl 2 , dl 3 and dl 4 , respectively , while the gate line signal at the gate line gl 1 is high , the video data { circle around ( 1 )}+, { circle around ( 2 )}−, { circle around ( 3 )}+ and { circle around ( 4 )}− are written into pixels a , b , c and d , respectively , at time t 1 as illustrated in fig1 . subsequently , as illustrated in fig1 , in the latter half t 1 ′ of the first frame period , when black data b +, b −, b + and b − are supplied to the data lines dl k + 1 , dl k + 2 , dl k + 3 and dl k + 4 , respectively , while the gate line signal at the gate line gl k + 1 is high , the black data b +, b −, b + and b − are written into pixels ba , bb , bc and bd , respectively , at time t 1 ′ as illustrated in fig1 . next , in the former half t 2 of a second frame period , when video data { circle around ( 1 )}′−, { circle around ( 2 )}′+, { circle around ( 3 )}′− and { circle around ( 4 )}′+ are supplied to the data lines dl 1 , dl 2 , dl 3 and dl 4 , respectively , while the gate line signal at the gate line gl 2 is high , the video data { circle around ( 1 )}′−, { circle around ( 2 )}′+, { circle around ( 3 )}′− and { circle around ( 4 )}′+ are written into pixels e , f , g and h , respectively , at time t 2 as illustrated in fig1 . subsequently , in the latter half t 2 ′ of the second frame period , when black data b −, b +, b − and b + are supplied to the data lines dl 1 , dl 2 , dl 3 and dl 4 , respectively , while the gate line signal at the gate line gl k + 2 is high , the black data b −, b +, b − and b + are written into pixels be , bf , bg and bh , respectively , at time t 2 as illustrated in fig1 . next , in the former half t 3 of a third frame period , when video data { circle around ( 1 )}″+, { circle around ( 2 )}″−, { circle around ( 3 )}″+ and { circle around ( 4 )}″− are supplied to the data lines dl 1 , dl 2 , dl 3 and dl 4 , respectively , while the gate line signal at the gate line gl 3 is high , the video data { circle around ( 1 )}″+, { circle around ( 2 )}″−, { circle around ( 3 )}″+ and { circle around ( 4 )}″− are written into pixels i , j , k and l , respectively , at time t 3 as illustrated in fig1 . subsequently , in the latter half t 3 ′ of the third frame period , when video data b +, b −, b + and b − and supplied to the data lines dl 1 , dl 2 , dl 3 and dl 4 , respectively , while the gate line signal at the gate line gl k + 3 is high , the video data b +, b −, b + and b − are written into pixels bi , bj , bk and bl , respectively , at time t 3 ′ as illustrated in fig1 . thus , as illustrated in fig1 , a black region having a width of k gate lines where k = 1 , 2 , 3 , . . . is scanned on a screen to suppress the residual image phenomenon . in the lcd apparatus of fig1 , however , since the data line driver circuit 22 has the same configuration as the data driver circuit 12 of fig2 , the data line driver circuit 22 is still large in scale , preventing the lcd apparatus from being compact in size . also , since the output buffer circuit of the data driver circuit 22 has the same number of power consuming amplifiers ( voltage followers ) as the data lines dl 1 , dl 2 , . . . , dl m , the power consumption is enormously increased . in fig1 , which illustrates a first embodiment of the lcd apparatus according to the present invention , reference numeral 1 designates an lcd panel having m × n dots where m is 640 and n is 480 , for example . that is , the lcd panel 1 includes m data lines dl 1 , dl 2 , dl 3 , dl 4 , . . . , dl m − 1 , dl m driven by a data line driver circuit 2 , ( n + 1 ) gate lines gl 1 , gl 2 , gl 3 , gl 4 , . . . , gl n − 1 , gl n , gl n + 1 , and m × n pixels p ij located at intersections between the data lines dl 1 , dl 2 , dl 3 , dl 4 , . . . , dl n − 1 , dl n and the gate lines gl 1 , gl 2 , gl 3 , gl 4 , . . . , gl n − 1 , gl n , gl n + 1 , the gate line gl n + 1 is additional to the gate lines gl 1 , gl 2 , gl 3 , gl 4 , . . . , gl n − 1 , gl n of fig1 and 10 ; however , this would never increase the manufacturing steps . each of the pixels p ij is constructed by two tfts q ij and q ij ′ and one pixel capacitor c ij including liquid crystal connected to a common electrode to which the common electrode voltage vcom is applied . the tft q ij is connected between the data line dl i and the tft q ij ′, and the tft q ij ′ is connected between the tft q ij and the pixel capacitor c ij . if i + j = 2 , 4 , 6 , . . . , the pixel p ij is of a first type where the gate of the tft q ij such as q 11 is connected to the gate line gl j such as gl 1 and the gate of the tft q ij ′ such as q 11 ′ is connected to the gate line gl j + 1 such as gl 2 . therefore , when the voltages at the gate lines gl j and gl j + 1 are both high , video data or black data is supplied from the data line dl i to the first type pixel p ij ( i + j = 2 , 4 , 6 , 8 , . . . ). on the other hand , if i + j = 3 , 5 , 7 , 9 , . . . , the pixel p ij is of a second type where the gates of the tft q ij and q ij ′ such as q 21 and q 21 ′ are both connected to the gate line gl j such as gl 1 . therefore , when the voltage at the gate line gl j is high , video data or black data is supplied from the data line dl i to the second type pixel p ij ( i + j = 3 , 5 , 7 , 9 , . . . ). the first type pixels p ij ( i + j = 2 , 4 , 6 , 8 , . . . ) and the second type pixels p i j ( i + j = 3 , 5 , 7 , 9 , . . . ) are staggered in the lcd panel 1 . that is , the first type pixels p ij ( i + j = 2 , 4 , 6 , 8 , . . . ) and the second type pixels p ij ( i + j = 3 , 5 , 7 , 9 , . . . ) are alternately arranged in rows , columns . in fig1 , which illustrates a detailed circuit diagram of the data line driver circuit 2 of fig1 , the data line driver circuit 2 is constructed by a shift register circuit 21 , a data register circuit 22 , a data latch circuit 23 , a digital / analog conversion circuit 24 , a black data voltage generation circuit 25 , and an output buffer circuit 26 . the shift register circuit 21 shifts a horizontal start pulse signal hst as shown in fig1 in synchronization with a horizontal clock signal hck as shown in fig1 . the shift register circuit 21 is formed by serially - connected d - type flip - flops 211 , 212 , . . . , 21 m / 2 clocked by rising edges of the horizontal clock signal hck to generate latch signals la 1 , la 2 , . . . , lam / 2 , sequentially as shown in fig1 . note that two horizontal start pulse signals hst are generated per one horizontal synchronization signal hsync from a horizontal timing generating circuit ( not shown ) which receives the horizontal synchronization signal hsync . also , the horizontal clock signal hck is generated from a clock signal generating circuit ( not shown ). the data register circuit 22 latches an 8 - bit gradation video data signal vd represented by b 0 , b 1 , . . . , b 7 in accordance with the latch signals la 1 , la 2 , . . . , lam / 2 . the data register circuit 22 is formed by 8 d - type flip - flops 221 clocked by the latch signal la 1 to latch digital video data d 1 or d 2 of the gradation video signal vd as shown in fig1 , 8 d - type flip - flops 222 clocked by the latch signal la 2 to latch digital video data d 3 or d 4 of the gradation video signal vd as shown in fig1 , . . . , 8 d - type flip - flops 22 clocked by the latch signal la 1 m / 2 to latch digital video data dm − 1 or dm of the gradation video signal vd as shown fig1 . in this case , the digital video data d 1 , d 3 , . . . , dm − 1 , d 2 , d 4 , . . . , dm of the 8 bit gradation video signal vd are sequentially generated from a signal processing circuit ( not shown ). in more detail , in a first horizontal period , the digital video data d 1 , d 3 , . . . , dm − 1 , d 2 , d 4 , . . . , dm are sequentially generated , and in a second horizontal period alternately with the first horizontal period , the digital video data d 2 , d 4 , . . . , dm , d 1 , d 3 , . . . , dm − 1 are sequentially generated . the data latch circuit 23 latches the digital video data d 1 or d 2 , d 3 or d 4 , . . . , dm − 1 or dm . the data latch circuit 23 is formed by latch circuits 231 , 232 , 23 m / 2 clocked by a horizontal strobe signal hstb as shown in fig1 which is generated from the horizontal timing generating circuit . the d / a conversion circuit 24 is formed by multiplexers 2411 , 2412 , . . . , 241 m / 2 clocked by a polarity signal pol as shown in fig1 , positive - side d / a converters 2421 , 2423 , . . . , 242 m − 1 for generating analog gradation voltages on the positive side with respect to the common voltage vcom , negative - side d / a converters 2422 , 2424 , 242 m for generating analog gradation voltages on the negative side with respect to the common voltage vcom , and multiplexers 2431 , 2432 , . . . , 243 m / 2 clocked by the polarity signal pol . that is , if pol =“ 1 ”, the positive - side d / a converters 2421 , 2423 , 242 m − 1 are selected by the multiplexers 2411 , 2412 , . . . , 241 m / 2 and the multiplexers 2431 , 2432 , . . . , 243 m / 2 . as a result , the d / a conversion circuit 24 generates positive polarity analog video signals corresponding to the digital video signals d 1 or d 2 , d 3 or d 4 , . . . , dm − 1 or dm , respectively , and transmits them to the output buffer circuit 26 . on the other hand , if pol =“ 0 ”, the negative - side d / a converters 2422 , 2424 , 242 m are selected by the multiplexers 2411 , 2412 , . . . , 241 m / 2 and the multiplexers 2431 , 2432 , . . . , 243 m / 2 . as a result , the d / a conversion circuit 24 generates negative polarity analog video signals corresponding to the digital video signals d 1 or d 2 , d 3 or d 4 , . . . , dm − 1 or dm , respectively , and transmits them to the output buffer circuit 26 . the black data voltage generation circuit 25 is formed by a multiplexer 251 clocked by the polarity signal pol and an amplifier 252 . the multiplexer 251 operates in the same way as the multiplexers 2411 , 2412 , . . . , 241 m / 2 and the multiplexers 2431 , 2432 , . . . , 243 m / 2 . that is , if pol =“ 1 ”, black data b − is selected , amplified and transmitted to the output buffer circuit 26 . on the other hand , if pol =“ 0 ”, black data b + is selected , amplified and transmitted to the output buffer circuit 26 . the output buffer circuit 26 multiplexes the analog video signals from the d / a conversion circuit 24 and the black data voltage b − or b + in accordance with a data selection signal dsl which is nearly equal to a signal obtained by dividing the polarity signal pol . the data selection signal dsl is generated from the horizontal timing generating circuit . the output buffer circuit 26 is formed by amplifiers ( usually , voltage - follower - type operational amplifiers ) 2611 , 2612 , . . . , 261 m / 2 for amplifying the analog video signals from the multiplexers 2431 , 2432 , . . . , 243 m / 2 , respectively , of the d / a conversion circuit 24 and multiplexers 2621 , 2622 , . . . , 262 m / 2 clocked by the data selection signal dsl . in this case , if dsl =“ 1 ”, the multiplexers 2621 , 2622 , . . . , 262 m / 2 are in a through state , while , if dsl =“ 0 ”, the multiplexers 2621 , 2622 , . . . , 262 m / 2 are in a cross state . therefore , in a first horizontal period , when pol =“ 1 ” ( positive ) and dsl =“ 1 ” ( through state ), signals d 1 (+), b −, d 3 (+), b −, . . . , dm − 1 (+), b − and generated from the output buffer circuit 26 , and subsequently , when pol =“ 0 ” ( negative ) and dsl =“ 0 ” ( cross state ), signals b +, d 2 (−), b +, d 4 (−), . . . , b +, dm (−) are generated from the output buffer circuit 26 . on the other hand , in a second horizontal period , when pol =“ 1 ” ( positive ) and dsl =“ 0 ” ( cross state ), signals b −, d 2 (+), b −, d 4 (+), . . . , b −, dm (+) are generated from the output buffer circuit 26 , and subsequently , when pol =“ 0 ” ( negative ) and dsl =“ 1 ” ( through state ), signals d 1 (−), b +, d 3 (−), b 4 , . . . , dm − 1 (−), b + are generated from the output buffer circuit 26 . in fig1 , which illustrates a detailed circuit diagram of the gate line driver circuit 2 of fig1 , the gate line driver circuit 3 is constructed by shift register circuits 31 and 32 for shifting a vertical start pulse signal vst as shown in fig2 in synchronization with a vertical clock signal vck as shown in fig2 , a gate circuit 33 and an output buffer circuit 34 formed by amplifiers 341 , 342 , 343 , 344 , . . . , 34 n − 1 , 34 n . note that two vertical start pulse signals vst are generated per one frame period . the shift register circuit 31 is formed by serially - connected d - type flip - flops 311 , 312 , 313 , 314 , . . . , 31 n − 1 , 30 n , 31 n + 1 , 31 n + 2 clocked by rising edges of the vertical clock signal vck to generate signals s 1 , s 2 , s 3 , s 4 , . . . , s n − 1 , s n , s n + 1 , s n + 2 as shown in fig2 . the shift register circuit 32 is formed by serially - connected d - type flip - flops 321 , 322 , 323 , 324 , . . . , 32 n − 1 , 32 n , 32 n + 1 clocked by falling edges of the vertical clock signal vck to generate signals s 1 ′, s 2 ′, s 3 ′, s 4 ″, . . . , s n − 1 ′, s n ″, s n + 1 ′ as shown in fig2 . the gate circuit 33 is formed by a gate 331 for receiving the signals s 1 ′ and s 2 , a gate 332 for receiving the signals s 2 ′ and s 3 , a gate 333 for receiving the signals s 3 ′ and s 4 , a gate 334 for receiving the signals s 4 ′ and s 5 , . . . , a gate 33 n − 1 for receiving the signals s n − 1 ′ and s n , a gate 33 n for receiving the signals s n ′ and s n + 1 , and a gate 33 n − 1 for receiving the signals s n + 1 ′ and s n + 2 . also , the gate circuit 33 is formed by a gate 331 ′ for receiving the signal s 1 and an output signal s 1 ″ of the gate 331 , a gate 332 ′ for receiving the signal s 2 and an output signal s 2 ″ of the gate 332 , a gate 333 ′ for receiving the signal s 3 and an output signal s 3 ″ of the gate 333 , a gate 334 ′ for receiving the signal s 4 and an output signal s 4 ″ of the gate 334 , . . . , a gate 33 n − 1 ′ for receiving the signal s n − 1 and an output signal s m − 1 ″ of the gate 33 n − 1 , a gate 33 n ′ for receiving the signal s n and an output signal s n ″ of the gate 33 n , and a gate 33 n − 1 ′ for receiving the signal s n + 1 and an output signal s n + 1 ″ of the gate 33 n − 1 . thus , the gate circuit 33 generates gate line signals ( or scan line signals ) on the gate lines gl 1 , gl 2 , gl 3 , gl 4 , . . . , gl n − 1 , gl n , gl n + 1 , respectively , as shown in fig2 . as shown in fig2 , two vertical start pulse signals vst are generated per one frame period . a first one of the vertical start pulse signals vst is used for writing black data , while a second one of the vertical start pulse signals vst is used for writing video data . as illustrated in fig2 , in the former half t 1 of a first frame period , when video data { circle around ( 1 )}+ and { circle around ( 3 )}+ are supplied to the data lines dl 1 and dl 3 , respectively , and black data b − is supplied to the data lines dl 2 and dl 4 while the gate line signals at the gate lines gl 1 , gl 2 , gl k + 1 and gl k + 2 are high , the video data { circle around ( 1 )}+ is written into pixels a , e and ba , the video data { circle around ( 3 )}+ is written into pixels c , g and bc , and black data b − is written into pixels b , d , bb , bd , bf and bh , at time t 1 as illustrated in fig2 . subsequently , in the latter half t 1 ′ of the first frame period , when video data { circle around ( 2 )}− and { circle around ( 4 )}− and supplied to the data lines dl 2 and dl 4 , respectively , and black data b + is supplied to the data lines dl 1 and dl 3 while the gate line signals at the gate lines gl 1 and gl k + 1 are high , the video data { circle around ( 2 )}− is written into pixel b , the video data { circle around ( 4 )}− is written into pixel d , and black data b + is written into pixels ba and bc , at time t 1 ′ as illustrated in fig2 . next , in the former half t 2 of a second frame period , when video data { circle around ( 2 )}′+ and { circle around ( 4 )}′+ are supplied to the data lines dl 2 and dl 4 , respectively , and black data b − is supplied to the data lines dl 1 and dl 3 while the gate line signals at the gate lines gl 2 , gl 3 , gl k + 2 and gl k + 3 are high , the video data { circle around ( 2 )}′+ is written into pixels f , j and bf , the video data { circle around ( 4 )}′+ is written into pixels h , l and bh , and black data b − is written into pixels e , g , be , bi , bg and bk , at time t 2 as illustrated in fig2 . subsequently , in the latter half t 2 ′ of the second frame period , when video data { circle around ( 1 )}′− and { circle around ( 3 )}′− and supplied to the data lines dl 1 and dl 3 , respectively , and black data b + is supplied to the data lines dl 2 and dl 4 while the gate line signals at the gate lines gl 2 and gl k + 2 are high , the video data { circle around ( 1 )}′− is written into pixel e , the video data { circle around ( 3 )}′− is written into pixel g , and black data b + is written into pixels bf and bh , at time t 2 ′ as illustrated in fig2 . next , in the former half t 3 of a third frame period , when video data { circle around ( 1 )}″+ and { circle around ( 3 )}″+ are supplied to the data lines dl 1 and dl 3 , respectively , and black data b − is supplied to the data lines dl 2 and dl 4 while the gate line signals at the gate lines gl 3 , gl 4 , gl k + 3 and gl k + 4 are high , the video data { circle around ( 1 )}″+ is written into pixels i , m and bi , the video data { circle around ( 3 )}″+ is written into pixels k , o and bk , and black data b − is written into pixels j , l , bj , bn , bl and bp , at time t 3 as illustrated in fig2 . subsequently , in the latter half t 3 ′ of the third frame period , when video data { circle around ( 2 )}″− and { circle around ( 4 )}″− and supplied to the data lines dl 2 and dl 4 , respectively , and black data b + is supplied to the data lines dl 1 and dl 3 while the gate line signals at the gate lines gl 3 and gl k + 3 are high , the video data { circle around ( 2 )}″− is written into pixel j , the video data { circle around ( 4 )}″− is written into pixel l , and black data b + is written into pixels bi and bk , at time t 3 ′ as illustrated in fig2 . thus , in the same way as in the second prior art lcd apparatus of fig1 , a black region having a width of k gate lines where k = 1 , 3 , 5 , . . . is scanned to suppress the residual image phenomenon . in the lcd apparatus of fig1 , since the data line driver circuit 2 of fig1 has a smaller configuration than the data line driver circuit 12 of fig2 , the data line driver circuit 2 can be small in size , so that the integration can be enhanced . also , since the output buffer circuit 26 of fig1 has half the number of power consuming amplifiers as that of the data lines dl 1 , dl 2 , . . . , dl m , the power consumption can be remarkably reduced . in fig2 , which illustrates a second embodiment of the lcd apparatus according to the present invention , the lcd panel 1 of fig1 is replaced by an lcd panel 1 ′ where the first type of two consecutive pixels p ij ( i = 1 , 2 , 5 , 6 , . . . under j = 1 , 3 , 5 , . . . , and i = 3 , 4 , 7 , 8 , . . . under j = 2 , 4 , 6 , . . . ) and the second type of two consecutive pixels p ij ( i = 3 , 4 , 7 , 8 , . . . under j = 1 , 3 , 5 , . . . , and i = 1 , 2 , 5 , 6 , . . . under j = 2 , 4 , 6 , are staggered . that is , two first type pixels p ij and two second type pixels p ij are alternately arranged in rows , columns . each of the first type pixels p ij is the same as those of fig1 . that is , the gate of the tft q ij such as q 11 is connected to the gate line gl j such as gl 1 and the gate of the tft q ij ′ such as q 11 ′ is connected to the gate line gl j + 1 such as gl 2 . therefore , when the voltages at the gate lines gl j and gl j + 1 are both high , video data or black data is supplied from the data line dl i to the first type pixel p ij . also , each of the second type pixels p ij is the same as those of fig1 . that is , the gates of the tft q ij and q ij ′ such as q 22 and q 22 ′ are both connected to the gate line gl j such as gl 2 . therefore , when the voltage at the gate line gl j is high , video data or black data is supplied from the data line dl i to the second type pixel p i j . also , in fig2 , the data line driver circuit 2 of fig1 is replaced by a data line driver circuit 2 ′ which is illustrated in fig2 in detail . in fig1 , the data line driver circuit 2 ′ is constructed by a shift register circuit 21 ′, a data register circuit 22 ′, a data latch circuit 23 ′, a d / a conversion circuit 24 ′, a black data voltage generation circuit 25 ′, and an output buffer circuit 26 ′. the shift register circuit 21 ′ shifts a horizontal start pulse signal hst as shown in fig2 in synchronization a horizontal clock signal hck as shown in fig2 . the shift register circuit 21 ′ has the same configuration as the shift register circuit 21 of fig1 . that is , the shift register circuit 21 ′ is formed by serially - connected d - type flip - flops 211 , 212 , . . . , 21 ( m / 2 − 1 ), 21 m / 2 clocked by rising edges of the horizontal clock signal hck to generate latch signals la 1 , la 2 , . . . la ( m / 2 − 1 ), lam / 2 , sequentially as shown in fig2 . the data register circuit 22 ′ latches an 8 - bit gradation video data signal vd represented by b 0 , b 1 , . . . , b 7 in accordance with the latch signals la 1 , la 2 , . . . , la ( m / 2 − 1 ), lam / 2 . the data register circuit 22 ′ has the same configuration as the data register circuit 22 of fig1 . that is , the data register circuit 22 ′ is formed by 8 d - type flip - flops 221 clocked by the latch signal la 1 to latch digital video data d 1 or d 3 of the gradation video signal vd as shown in fig2 , 8 d - type flip - flops 222 clocked by the latch signal la 2 to latch digital video data d 3 or d 4 of the gradation video signal vd as shown in fig2 , . . . , 8 d - type flip - flops 22 ( m / 2 − 1 ) clocked by the latch signal la ( m / 2 − 1 ) to latch digital video data dm − 3 or dm − 2 of the gradation video signal vd as shown in fig2 , and 8 d - type flip - flops 22 clocked by the latch signal lam / 2 to latch digital video data dm − 2 or dm of the gradation video signal vd as shown in fig2 . in this case , the digital video data d 1 , d 2 , d 5 , . . . , dm − 3 , dm − 2 , d 3 , d 4 , d 7 , . . . , dm − 1 , dm of the 8 bit gradation video signal vd are sequentially generated from a signal processing circuit ( not shown ). in more detail , in a first horizontal period , the digital video data d 1 , d 2 , d 5 , . . . , dm − 3 , dm − 2 , d 3 , d 4 , d 7 , . . . , dm − 1 , dm are sequentially generated , and in a second horizontal period , alternately with the first horizontal period , the digital video data d 3 , d 4 , d 7 , . . . dm − 1 , dm , d 1 , d 2 , d 5 , . . . , dm − 3 , dm − 2 are sequentially generated . the data latch circuit 23 ′ latches the digital video data d 1 or d 3 , d 2 or d 4 , . . . , dm − 3 or dm − 1 , dm − 2 or dm . the data latch circuit 23 ′ has the same configuration as the data latch circuit 23 of fig1 . that is , the data latch circuit 23 ′ is formed by latch circuits 231 , 232 , . . . , 23 ( m / 2 − 1 ), 23 m / 2 clocked by a horizontal strobe signal hstb as shown in fig2 which is generated from the horizontal timing generating circuit . the d / a conversion circuit 24 ′ has the same configuration as the d / a conversion circuit 24 of fig1 . that is , the d / a conversion circuit 24 ′ is formed by multiplexers 2411 , . . . , 241 m / 2 clocked by a polarity signal pol as shown in fig2 , positive - side d / a converters 2421 , . . . , 242 m − 1 for generating analog gradation voltages on the positive side with respect to the common voltage vcom , negative - side d / a converters 2422 , . . . , 242 m for generating analog gradation voltages on the negative side with respect to the common voltage vcom , and multiplexers 2431 , 2432 , . . . , 243 m / 2 clocked by the polarity signal pol . that is , if pol =“ 1 ”, the positive - side d / a converters 2421 , . . . , 242 m − 1 are selected by the multiplexers 2411 , . . . , 241 m / 2 and the multiplexers 2431 , . . . , −, 243 m / 2 . as a result , the d / a conversion circuit 24 ′ generates positive polarity analog video signals corresponding to the digital video signals d 1 or d 3 ,. d 2 or d 4 , . . . , dm − 3 or dm − 1 , dm − 2 or dm , respectively , and transmits them to the output buffer circuit 26 ′. on the other hand , if pol =“ 0 ”, the negative - side d / a converters 2422 , . . . , 242 m are selected by the multiplexers 2411 , . . . , 241 m / 2 and the multiplexers 2431 , . . . , 243 m / 2 . as a result , the d / a conversion circuit 24 ′ generates negative polarity analog video signals corresponding to the digital video signals d 1 or d 3 , d 2 or d 4 , . . . , dm − 3 or dm − 1 , dm − 2 or dm , respectively , and transmits them to the output buffer circuit 26 . the black data voltage generation circuit 25 ′ is similar to the black data voltage generation circuit 25 of fig1 . that is , the black data voltage generation circuit 25 ′ is formed by a multiplexer 251 clocked by the polarity signal pol and amplifiers 252 and 253 . the multiplexer 251 operates in the same way as the multiplexers 2411 , . . . , 241 m / 2 and the multiplexers 2431 , . . . , 243 m / 2 . therefore , if pol =“ 1 ”, black data b + and b − are amplified and transmitted to the output buffer circuit 26 ′. on the other hand , if pol =“ 0 ”, black data b − and b + are amplified and transmitted to the output buffer circuit 26 ′. the output buffer circuit 26 ′ multiplexes the analog video signals from the d / a conversion circuit 24 ′ and the black data voltage b + or b − in accordance with a data selection signal dsl which is generated from the horizontal timing generating circuit . the output buffer circuit 26 ′ is similar to the output buffer circuit 26 of fig1 . that is , the output buffer circuit 26 ′ is formed by amplifiers 2611 , 2612 , . . . , 261 ( m / 2 − 1 ), 261 m / 2 for amplifying the analog video signals from the multiplexers 2431 , . . . , 243 m / 2 , of the d / a conversion circuit 24 ′ and multiplexers 2621 , . . . , 262 m / 4 clocked by the data selection signal dsl . in this case , if dsl =“ 1 ”, the multiplexers 2621 , . . . , 262 m / 4 are in a through state , while , if dsl =“ 0 ”, the multiplexers 2621 , 262 m / 4 are in a cross state . therefore , in a first horizontal period , when pol =“ 1 ” ( positive ) and dsl =“ 1 ” ( through state ), signals d 1 (+), d 2 (−), b +, b −, . . . , dm − 3 (+), dm − 2 (−), b +, b − and generated from the output buffer circuit 26 ′, and subsequently , when pol =“ 1 ” ( positive ) and dsl =“ 0 ” ( cross state ), signals b +, b −, d 3 (+), d 4 , . . . , b +, b −, dm − 1 (+), dm (−) are generated from the output buffer circuit 26 ′. therefore , in a second horizontal period , when pol =“ 0 ” ( negative ) and dsl =“ 0 ” ( cross state ), signals b −, b +, d 3 (−), d 4 (+), . . . , b −, b +, dm − 1 (−), dm (+) are generated from the output buffer circuit 26 ′, and subsequently , when pol =“ 0 ” ( negative ) and dsl =“ 1 ” ( through state ), signals d 1 (−), d 2 (+), b −, b +, . . . , dm − 3 (−) dm − 2 (+), b −, b + are generated from the output buffer circuit 26 ′. note that the gate line driver circuit 3 has the same configuration as that of fig1 . as illustrated in fig2 , in the former half t 1 of a first frame period , when video data { circle around ( 1 )}+ and { circle around ( 2 )}− are supplied to the data lines dl 1 and dl 2 , respectively , and black data b + and b − and supplied to the data lines dl 3 and dl 4 while the gate line signals at the gate lines gl 1 , gl 2 , gl k + 1 and gl k + 2 are high , the video data { circle around ( 1 )}+ is written into pixels a , e and ba , the video data { circle around ( 2 )}− is written into pixels b , f and bb , black data b + is written into pixels c , bc and bg , and black data b − is written into pixels d , bd and bh , at time t 1 as illustrated in fig2 . subsequently , in the latter half t 1 ′ of the first frame period , when video data { circle around ( 3 )}+ and { circle around ( 4 )}− and supplied to the data lines dl 3 and dl 4 , respectively , and black data b + and b − and supplied to the data lines dl 1 and dl 2 while the gate line signals at the gate lines gl 1 and gl k + 1 are high , the video data { circle around ( 3 )}+ is written into pixel c , the video data { circle around ( 4 )}− is written into pixel d , black data b + is written into pixel ba , and black data b − is written into pixel bb at time t 1 ′ as illustrated in fig2 . next , in the former half t 2 of a second frame period , when video data { circle around ( 3 )}′− and { circle around ( 4 )}′+ are supplied to the data lines dl 3 and dl 4 , respectively , and black data b − and b + are supplied to the data lines dl 1 and dl 2 while the gate line signals at the gate lines gl 2 , gl 3 , gl k + 2 and gl k + 3 are high , the video data { circle around ( 3 )}′− is written into pixels g , k and bg , the video data { circle around ( 4 )}′+ is written into pixels g , l and bh , black data b − is written into pixels e , be and bi , and black data b + is written into pixels f , bf and bj at time t 2 as illustrated in fig2 . subsequently , in the latter half t 2 ′ of the second frame period , when video data { circle around ( 1 )}′− and { circle around ( 2 )}′+ are supplied to the data lines dl 1 and dl 2 , respectively , and black data b − and b + are supplied to the data lines dl 3 and dl 4 while the gate line signals at the gate lines gl 2 and gl k + 2 are high , the video data { circle around ( 1 )}′− is written into pixel e , the video data { circle around ( 2 )}′+ is written into pixel f , black data b + is written into pixel bg , and black data b + is written into pixels bh , at time t 2 ′ as illustrated in fig2 . next , in the former half t 3 of a third frame period , when video data { circle around ( 1 )}″+ and { circle around ( 2 )}″− and supplied to the data lines dl 1 and dl 2 , respectively , and black data b + and b − and supplied to the data lines dl 3 and dl 4 while the gate line signals at the gate lines gl 3 , gl 4 , gl k + 3 and gl k + 4 are high , the video data { circle around ( 1 )}″+ is written into pixels i , km and i , the video data { circle around ( 2 )}″− is written into pixels j , o and bk , black data b + is written into pixels k , bk and bo , and black data b − is written into pixels l , bl and bp , at time t 3 as illustrated in fig2 . subsequently , in the latter half t 3 ′ of the third frame period , when video data { circle around ( 3 )}″+ and { circle around ( 4 )}″− and supplied to the data lines dl 3 and dl 4 , respectively , and black data b + and b − and supplied to the data lines dl 1 and dl 2 while the gate line signals at the gate lines gl 3 and gl k + 3 are high , the video data { circle around ( 3 )}″+ is written into pixel k , the video data { circle around ( 4 )}″− is written into pixel l , black data b + is written into pixel bi , and black data b − is written into pixel bj , at time t 3 ′ as illustrated in fig2 . thus , in the same way as in the second prior art lcd apparatus of fig1 , a black region having a width of k gate lines where k = 1 , 3 , 5 , . . . is scanned to suppress the residual image phenomenon . even in the lcd apparatus of fig2 , since the data line driver circuit 2 ′ of fig2 has a smaller configuration than the data line driver circuit 12 of fig2 , the data line driver circuit 2 ′ can be small in size , so that the integration can be enhanced . also , since the output buffer circuit 26 ′ of fig2 has half the number of power consuming amplifiers as that of the data lines dl 1 , dl 2 , . . . , dl m , the power consumption can be remarkably reduced . in the above - described embodiments , although the black data voltage b + or b − is set to be a maximum voltage or a minimum voltage in a normal white type lcd apparatus , the present invention can be applied to a normal black type lcd apparatus where the black data voltage b + or b − is set to be the common voltage vcom . also , in the above - described embodiments , the second type pixel includes two tfts connected to one gate line ; however , this second type pixel can include one tft whose on resistance is equivalent to the two tfts . further , in the above - described embodiments , the locations of the first type pixels and the locations of the second type pixels can be exchanged with each other . in this case , the operation for the first horizontal period and the operation for the second horizontal period are exchanged with other . still , in the above - described embodiments , one or two first type pixels and one or two second type pixels are staggered ; however , three or more first type pixels and three or more second type pixels can be staggered . furthermore , in the above - described embodiments , inversion methods other than the dot inversion method can be adopted . additionally , the present invention can be applied to hold type image display apparatuses other than an lcd apparatus , such as an electroluminescence ( el ) display apparatus . as explained hereinabove , according to the present invention , the data line driver circuit can be small in size and its power consumption can be reduced . | 6 |
fig1 shows a device body 1 , in whose one part the battery loading chamber 1a is provided . a battery loading chamber 1a has sufficient room for loading two conventional cylindrical unit batteries 6 , 7 . an operable cover 2 covers the opening in the battery loading chamber 1a , and is linked on the device body 1 as is shown in fig4 and 5 and has an operable engaging claw 4 engageable with the device body 1 so as to hold the battery cover chamber in the closed position . a conductive piece 5 fixed on the internal surface of the battery chamber cover 2 , has a contact 5a for the positive electrode of the cylindrical unit battery 6 , 7 and a contact 5b for the negative electrode . around the contact 5a a circular insulation member 14 having an internal diameter smaller than the external diameter of the cylindrical unit battery 6 , 7 is secured , whereby the circular insulation member 14 is taller than the contact 5a . electrode springs 11a and 11b are in contact with the one electrode , urging the other electrode to the contacts 5a and 5b and leading the current from the cylindrical unit battery 6 , 7 to the device body 1 by means of a conductive means ( not shown ). an electrode base plate 12 for fixing the electrode springs 11a , 11b , is secured on the bottom of the battery chamber 1a by means of a holding member 13 . the holding member 13 has a contact portion 13a brought in contact with a one body type battery 15 at the projecting end , whereby the contact portion 13a is positioned not to be in contact with the cylindrical battery 6 , 7 . fig1 shows the two cylindrical unit batteries 6 and 7 normally loaded . the insulation member 14 is composed in such a manner that when the battery 7 is inversely loaded the negative electrode is prohibited from being in contact with the contact 5a to prevent counter conductivity . furthermore , because the cylindrical batteries 6 , 7 are loaded independently , there is no large fluctuation of contact pressure even if the cylindrical batteries 6 , 7 somewhat vary in dimension due to manufacturing tolerances . fig2 shows the one body type battery 15 loaded in the above battery loading chamber 1a . the one body type battery 15 has almost the same sectional shape as the battery loading chamber 1a , is shaped to be loaded in the loading chamber 1a with little room and has the same length as that of the cylindrical unit battery 6 , 7 . furthermore , the positive and the negative electrodes project out of one end surface of the battery 15 in alignment . as is shown in the drawing , the positive and the negative electrode of the battery 15 are in contact with the springs 11a and 11b , while the end surface 15a has no electrode depressed against the contact 5b and the insulation member 14 . in this situation the electrical circuit of the device body , has the same voltage applied as when the two cylindrical unit batteries 6 , 7 are connected in series . when the upper surface of the insulation member 14 is made as tall as that of the contact 5b , there is no danger that the battery 15 will be inclined and the terminals of the battery 15 are surely brought in contact with the springs 5a and 5b . furthermore , even if there is a small difference in the projection amount of the terminal there is no danger of inferior contact . although the contact portin 13a of the holding member 13 projects beyond the surface of the electrodes of the battery 15 , it is not in contact with the body of the battery 15 or the electrodes and the one body type battery 15 is loaded normally . fig3 shows the one body type battery 15 inversely loaded by mistake . in this situation the contact portion 13a of the holding member 13 is in contact with the surface 15a of the battery 15 having no electrode preventing the battery 15 from being pushed in further . thus , the battery cover 2 cannot be closed completely so that the operator can recognize that the battery 15 has been misloaded . fig4 shows the sectional shape of the one body type battery 15 and the battery loading chamber 1a . the battery 5 has an almost rectangular section , whereby only the corner 15c in contact with one side 15b is circular shaped with a comparatively large diameter , while the remaining two corners are circular shaped with remarkably small diameters . the opening and the section of the battery loading chamber 1a is shaped almost equal to the section of the battery 15 . in the drawing the battery 15 is directed normally and can be loaded normally if depressed along the direction of the arrow . the battery 5 in fig . 5 is inverted to that shown in fig4 . in this case the corner 15d of the battery projects beyond the circular shaped part r of the opening and is in contact with the edge 1b so that the battery 15 can not be loaded , preventing counter conductivity . although in the present embodiment the section of the battery 15 and the battery loading chamber 1a are asymmetrically shaped with reference to the line binding the centers of the two electrodes , the present invention is not limited to that . the same purpose can be achieved when the section of the battery 15 is similar to the opening of the battery loading chamber 1a , there is not a large difference between them in dimension and they have a projection asymmetrical with reference to the center of their sections . in the drawing , the device body 1 has the battery loading chamber 1a elliptical in section . the battery chamber cover 2 is linked on the device body 1 with a shaft 3 . the battery chamber cover 2 has the engaging claw 4 engageable with the body 1 , whereby in the closed state of the battery chamber cover 2 the cover 2 is held in engagement , while engagement is released from outside when the cover 2 is opened . the battery chamber cover 2 is provided with the conductive piece 5 and the contacts 5a and 5b of the conductive piece 5 are respectively in contact with a positive electrode 6a and a negative electrode 7a of the battery 15 . the movable separation plate 8 projects into the battery chamber 1a so as to prevent the displacement of the battery 15 as is shown in fig6 when the cylindrical batteries 6 , 7 are used and retires from the battery chamber 1a when the one body type battery 9 is loaded . fig7 shows the one body type battery to be used for the present embodiment , whereby the one body type battery 9 corresponds to the cylindrical batteries 6 and 7 connected in series and having the external dimension equivalent to the two cylindrical batteries 6 , 7 placed side by side . fig8 shows the central section of the battery chamber 1a of the present invention , whereby the cylindrical battery 6 is loaded . in the drawing , the movable separation plate 8 projects into the battery chamber 1a , being urged by the spring 10 , while the separation plate 8 , which is depressed from outside , is slidable in the direction of the arrow a . a spring 11 is disposed in contact with the one electrode of the battery 6 . in fig6 the cylindrical batteries 6 , 7 are loaded so that the movable separation plate 8 projects out of the internal wall of the battery chamber 1a . fig9 also shows the central section , whereby the one body type battery 9 shown in fig7 is loaded . in this situation most of the movable separation plate 8 is , being pushed by the one body type battery 9 , outside of the battery chamber 1a in such a manner that the loading of the one body type battery 9 is not prevented . hereby , a part 8a of the movable separation plate 8 is conically shaped in such a manner that the movable separation plate 8 can be slid smoothly when the one body type battery 9 is loaded . as has been explained in detail in the battery loading chamber 1a of the present invention a number of cylindrical batteries 6 , 7 are loaded in the cylindrical battery chamber 1a and connected in series , while the one body type battery 15 corresponding to a plural number of the cylindrical batteries 6 , 7 is also used . hereby , no matter whether the cylindrical batteries 6 , 7 or the one body type battery 15 are used , not only is a stabilized contact obtained at the contact part but also all the electrical difficulties due to misloading of the batteries can be avoided . | 7 |
fig1 illustrates the differential constellation diagram utilized in a conventional π / 4 - dqpsk modulator . as previously described , π / 4 - dqpsk modulation is a 2 - level modulation technique transmitting two bits per symbol . a π / 4 - dqpsk modulator receives a stream of bits , two bits at a time , i . e ., one symbol at a time , and responds to each bit pair by generating a two - component output signal specifying one of eight points a - h equally spaced about a circle , shown dotted at 10 , in the complex plane defined by real ( i ) and imaginary ( q ) axes . the phase of each point a - h represents a different phase with respect to a carrier on which the output signal is modulated . each of the four possible 2 - bit combinations results in a different one of four ( 2 2 ) possible shifts from the previous phase , namely , ± π / 4 and ± π / 4 . accordingly , the output of a π / 4 - dqpsk modulator depends not only on its current 2 - bit input , but also on the state of its previous output . as fig1 shows , if the symbol generated at a given time represents an even multiple of π / 4 ( states a , c , e or g ), the subsequent symbol can represent only an odd multiple of π / 4 ( states b , d , f or h ). the same is true of all odd multiples of π / 4 . if the phase that results from one symbol in the bit stream is an odd multiple of π / 4 ( states b , d , f or h ), the phase resulting from the subsequent symbol will be an even multiple of π / 4 ( states a , c , e or g ). as an example , assume that the current symbol is at state a , representing a phase angle of 0 radians . the subsequent symbol can represent only an odd multiple of π / 4 . that is , from state a , phase transitions can only occur to states b ( π / 4 ), d ( 3π / 4 ), f (- 3π / 4 ) or h (- π / 4 ). assume that the phase transitioned to state b . then , the next symbol subsequent to state b , can represent only an even multiple of π / 4 . thus , from state b , phase transitions can only occur to states c ( π / 2 ), e ( π ), g (- π / 2 ) or a ( 0 ). the phase transitions occur throughout the bit stream . fig2 shows a differential constellation of the enhanced π / 4 - dqpsk modulation technique according to the present invention , illustrating the primary and secondary phase ( or channel ) transitions . the primary phase transitions occur between states a - h and are the phase transitions which occur in conventional π / 4 - dqpsk modulation as previously described with respect to fig1 . the secondary phase transitions are illustrated as “ x &# 39 ; s ” around the primary phase transitions a - h . for convenience , secondary channel transitions are only illustrated at states b , d , f and h in fig2 . the primary phase transitions contain the bulk of the phase information , while the secondary phase transitions contain smaller amounts of phase information used to adjust or modify the primary phase transition . an understanding of the different constellation shown in fig2 will become apparent as the transmitter and receiver according to the present invention are described below . fig3 is a block diagram of a transmitter , shown generally at 12 , according to the present invention . the transmitter 12 includes an enhanced π / 4 - dqpsk modulator 14 . in such an arrangement , a signal ( voice , data , etc .) is applied to the transmitter 12 front - end circuitry ( not shown ), which digitizes the signal , performs various levels of encoding and framing of the resultant raw digitized signal , and produces a resultant output as a stream of bits . these are illustrated in fig3 as primary 16 and secondary 18 bit streams , respectively . the primary bit stream 16 is input to an impulse stream encoder 20 which generates a complex signal as a series of impulses on a line 21 representative of the primary bit stream 16 . the secondary bit stream 18 is also input to an impulse stream encoder 22 , which generates a complex signal as a series of impulses on a line 23 representative of the secondary bit stream 18 . however , the series of impulses on the line 23 produced by the impulse stream encoder 22 is dependent on the series of impulses on the line 21 produced by the impulse stream encoder 20 , via the next state info signal 24 produced by the impulse stream encoder 20 and received by the impulse stream encoder 22 . the next state info signal 24 contains information regarding the primary phase transition . the impulse stream encoder 20 determines the phase transition from the present primary state to the next primary state . for instance , referring to fig2 if the primary phase transition occurred between states a ( present state ) and state d ( next state ), the impulse stream encoder 20 would add 3π / 4 to the present state a to transition to the next state d . the next state info signal 24 essentially informs the impulse stream encoder 22 of the amount of angular movement in the primary phase transition , along with the state transition information , e . g ., state transition from state a to state d . this information is utilized by the impulse stream encoder 22 to determine the secondary phase transition to arrive at one of the sub - states ( x &# 39 ; s ) around the primary phase transition . the impulse stream encoder 22 will shift the primary phase transition (+ 3π / 4 ) a predetermined amount of radians to arrive at the secondary phase transition . both the primary and secondary transitions can be viewed as moving from a reference point to a next point in the differential plane of fig2 defined by the real ( i ) and imaginary ( q ) axes . an example of illustrating operation is provided below . referring to fig2 and 3 , assume the primary bit stream 16 represents the digitized bits “ 001101 . . . ” and the secondary bit stream 18 represents the digitized bits “ 011011 . . . ”. since π / 4 - dqpsk modulation is a 2 - level modulation technique , two bits are represented in each dqpsk symbol . the impulse stream encoder 20 receives the first two bits of the primary bit stream 16 , namely , “ 00 ”. assume further that the present state is state a , indicated as the active state in fig2 . receiving bits “ 00 ” at the impulse stream encoder 20 represents a primary phase transition of 45 ° to state b . ( for clarity purposes , phase transitions will hereafter be referred to in terms of degrees rather than radians .) the resulting impulse stream 21 output by the impulse stream encoder 20 will reflect this phase transition . transitioning from state a to state b can be viewed as simply adding 45 ° to state a to transition to state b . this addition of 45 °, along with state transition information in the form of the present to next state transition , is represented on the next state info signal 24 input to the impulse stream encoder 22 . the impulse stream encoder 22 receives the first two bits of the secondary bit stream 16 , namely , “ 01 ”. by knowing the phase (+ 45 °) and state ( a to b ) transitions of the primary channel , via next state info signal 24 , and knowing a priori the bit representations of the secondary phase transitions , the impulse stream encoder 22 is able to generate the impulse stream 23 representing a modification of the primary phase transition , i . e ., the secondary phase transition . the impulse stream encoder 22 is programmed with the secondary phase transition spread and also with the bits represented by each secondary state within the spread . for example , assume that the secondary spread is 10 °, then the secondary states would occur around the primary states a - h at ± 10 ° intervals , with the number of secondary states limited by the number of bits per symbol increase associated with the secondary channel . as shown in fig2 increasing the data rate by two bits per symbol , results in four secondary states surrounding each primary state a - h . if a 10 ° secondary spread is assumed , one bit allocation scheme might be as follows : + 20 ° represents 00 ; + 10 ° represents 01 ; − 10 ° represents 1 ; and − 20 ° represents 11 . of course , other bit allocation schemes and / or phase spreads may be utilized without departing from the spirit and scope of the present invention . further , while the secondary channel is being described herein as adding two bits per symbol , three , four , five , etc . bits per symbol can be added by the secondary channel on top of the existing two bits per symbol of the primary channel . for instance , if the secondary channel added three bits per symbol , eight ( 2 3 ) secondary states would surround each primary state a - h in fig2 . the number of bits per symbol added by the secondary channel and the secondary phase spread are limited by zero level transitions . the impulse stream encoder 22 knows , via next state info signal 24 , that the primary phase transition is + 45 ° ( state a to state b ). the impulse stream encoder 22 also knows that the first two bits of the secondary bit stream “ 01 ” represent a secondary phase transition of + 10 °. in order to represent “ 01 ” in the secondary phase transition , the impulse stream encoder 22 has to add 10 ° to the primary phase transition of 45 ° ( state b ). thus , the impulse stream on the line 23 output by the impulse stream encoder 22 represents such addition / subtraction . the impulse streams on lines 21 , 23 are summed at a summation block 26 producing a complex signal on a line 27 representative of the modified dqpsk phase transition illustrated by arrow 28 in fig2 . the operation of the impulse stream encoders 20 , 22 is primarily done via lookup tables . the complex output of the summation block 26 on the line 27 is input to one or more conventional raised cosine filters 30 , generally having a very consistent impulse response . the complex filtered signal on line 31 is fed to a conventional iq , or quadrature , modulator 32 which modulates a carrier 34 primarily with the generated phase information representative of the primary 16 and secondary 18 bit streams . the phase modulated signal 36 is transmitted over the air by the transmitter 12 via antenna 38 . in this manner , the effective transmission rate of the transmitter 12 can be doubled . for instance , if the transmitter 12 is transmitting data packets 0 - 10 , conventionally the transmitter would send the first data packet in slot 0 , wait for an acknowledgement from the receiver , send the next data packet in slot 1 , wait for an acknowledgement from the receiver , send the next data packet in slot 2 , wait for an acknowledgement from the receiver , etc . by utilizing the above - described secondary channel transitions , the transmitter 12 can simultaneously send the primary channel transition in slot 0 and the secondary channel transition , representing the next data packet , in slot 1 . if an acknowledgement is received from the receiver indicating that both slots were received , the transmitter 12 knows that the receiver is receiving the secondary channel and the data rate of the transmitter 12 has been effectively doubled . this would require the implementation of some type of ack / nack ( acknowledge / not acknowledge ) protocol to let the transmitter know whether the secondary channel transitions are being demodulated . rssi ( received signal strength information ) levels , or some other means , could be used as well . fig4 illustrates a receiver , shown generally at 40 , according to the present invention . the receiver 40 includes a demodulator 42 receiving the transmitted signal 36 via an antenna 44 . a phase differentiator , or differential phase extractor , 46 measures the differential phase in the received / demodulated signal on line 48 . the differential phase output by the differential phase extractor 46 is received by a phase to bit converter 50 which converts the measured differential phase into a string of primary channel bits . the string of bits output by the phase to bit converter 50 is input to a bit to phase converter 52 , which converts the primary channel bits into a relative phase . a summation block 54 subtracts the relative phase from the measured differential phase . the output of the summation block 54 is fed to a phase to bit converter 56 which converts the resulting phase values to a string of secondary channel bits . detailed operation of the receiver 40 is provided below . the demodulator 42 receives the transmitted signal 36 and essentially extracts only the phase information present on the modulated carrier of the transmitted signal . the phase information is output by the demodulator 42 as a series of symbols on the line 48 . the series of symbols on the line 48 are input to the differential phase extractor 46 which extracts the differential phase over a period of one symbol . essentially , the differential phase extractor 46 extracts the phase at the beginning and at the end of a symbol , and determines the difference . the output of the differential phase extractor 46 is fed to a sync control 58 which determines if there is a sequence of phase transitions that represent a sync word . the sync control 58 enables the acquisition of initial phase , initial frequency offset , and symbol / frame timing , which are necessary for demodulation . after syncing is complete , the receiver 40 essentially knows the precise point at which the transmitted data begins , and can begin demodulating . the output of the differential phase extractor 46 is also input to the phase to bit converter 50 which takes the phase difference determined by the differential phase extractor 46 and maps it to two bits . the phase to bit converter 50 maps the phase differences to the primary channel bits . as an example , referring to fig2 and assuming that the secondary channel transitions are not present , assume that the present state is state a and the differential phase extractor determined a phase difference of 45 °. a phase transition of 45 ° indicates a transition to state b . the phase to bit converter 50 maps the phase transition of 45 ° to state b and outputs “ 00 ” as the primary channel bits . similarly , a phase transition of 135 ° indicates a transition to state d . the phase to bit converter 50 maps the phase difference of 135 ° and outputs “ 01 ” as the corresponding primary channel bits . however , since the primary phase transitions have been adjusted to accommodate secondary channel bits , the differential phase extractor 46 will determine phase differences not equal to the phase differences associated with the primary channel transitions a - h . accordingly , the phase to bit converter 50 must be able to accommodate the adjustments made to the primary phase transition by the secondary channel . depending on the spread of the secondary channel , ranges can be set around the primary transitions a - h wherein if a differential phase is determined that falls within a particular range , it will be mapped by the phase to bit converter 50 to the primary transition associated with that particular range . for example , a primary phase transition from state a to state b may be defined as occurring within the range of 10 °− 80 °, 5 °− 85 °, 0 °− 90 °, etc . thus , if the phase to bit converter 50 receives any phase difference within that range , it outputs “ 00 ” as the primary channel bits . similar ranges may be utilized for the other primary phase transitions . the output of the phase to bit converter 50 is routed to the bit to phase converter 52 which determines the appropriate phase transition from the primary bits . for example , if the primary bits output by the phase to bit converter 50 are “ 00 ”, the bit to phase converter 52 would map the primary bits to the corresponding primary channel transition of 45 °. essentially , the bit to phase converter 52 maps the primary bits to the associated primary channel transition , regardless of the phase difference actually determined by the differential phase extractor 46 . in our previous example , the primary channel transition was 45 ° ( state a to state b ), and the secondary channel transition was + 10 °, resulting in a modified phase transition of 55 ° as shown by arrow 28 in fig2 . thus , the output of the differential phase extractor 46 would be 55 °; the modified phase transition transmitted on signal 36 across the radio channel . this value should fall within an appropriate range set at the phase to bit converter 50 , and is mapped by the phase to bit converter 50 to primary bits “ 00 ” which are output as the primary channel bits . the primary bits “ 00 ” are fed to the bit to phase converter 52 , which maps them to the primary channel transition of 45 °, which is output by the bit to phase converter 52 . the outputs of the differential phase extractor 46 and the bit to phase converter 52 are fed to the summation block 54 , which subtracts the phase value output by the bit to phase converter 52 from the differential phase value determined by the differential phase extractor 46 . in the above example , the summation block 54 performs the operation 55 °− 45 °= 10 °. the output of the summation block 54 , 10 ° in the previous example , is fed to the phase to bit converter 56 . the phase to bit converter 56 maps the phase output by the summation block 54 to the secondary channel bits . the phase to bit converter 56 knows a priori the secondary channel spread and the secondary bits associated therewith . the phase to bit converter 56 also receives a state info signal 60 from the phase to bit converter 50 . the state info signal 60 basically tells the phase to bit converter 56 the primary phase transition . by knowing the primary phase transition , the phase to bit converter 56 is able to map the phase values output by the summation block 54 to the secondary bit stream . for instance , referring to fig2 and 4 in the above example , the state info signal 60 informs the phase to bit converter 56 that the primary phase transition was 45 °, namely , from state a to state b . the phase to bit converter 56 , upon receiving a + 10 ° signal from the summation block 54 , maps + 10 ° to the secondary bits “ 01 ” which are output as the secondary channel bits . similarly , if the phase to bit converter 56 would have received a + 20 ° value , it would have mapped phase value to secondary bits “ 00 ”. it follows that a − 10 ° value would be mapped to secondary bits “ 10 ”, and a − 20 ° value would mapped to secondary bits “ 11 ”. the primary and secondary channel bits are then fed to a data modem , a vocoder , a control device , or any other device at the receiving end . it should be noted that the phase values described above will not be exact due to internal component tolerances and external noise and other factors affecting the transmitted signal . however , such fluctuations are common and can be taken into account in system / component design . if the secondary spread is made small , precise phase value measurements are necessary in order to determine the secondary channel transitions . if this is the case , some form of adaptive equalization may be required at the receiver end in order to remove the effects isi ( intersymbol interference ) on the transmitted signal . isi is generally caused by the if filters at the receiving end , and may need to be removed if accurate phase measurement is required . in addition , fading may cause fluctuations in the transmitted signal . if the fluctuation is fast it usually means that a magnitude notch , i . e ., a dip in the signal , is present . otherwise , the phase is probably moving slow relative to the transmitted symbol rate . if the magnitude of the transmitted signal is drastically changing , then both the primary and secondary channels will suffer . in that case the overall bit rate of both the primary and secondary channels would have the same basic ber ( bit error rate ). single root raised cosine filters may be used in place of the raised cosine filter at the transmitter . however , both the transmitter and the receiver would require a single root raised cosine filter . adaptive equalizers may also need to be added for the detection of smaller phase values . at the receiver , the root raised cosine filter would need to placed at the base band signal . transparent detection of the secondary channel presumes that some fec ( forward error correction ) or other coding is used to verify the success or failure of detection . non - transparent detection of the secondary bits would not require this sensing and would be done by simply transmitting raw bits indicating transmission of the secondary channel . while the invention has been described with particular reference to the drawings , it should be understood that various modifications could be made without departing from the spirit and scope of the present invention . | 7 |
in fig1 reference numeral 10 generally designates the swing mount according to the present invention . reference numeral 11 designates a portion of a support beam for the swing . support 11 may be a log as shown in fig1 or it may be a metal or other type of beam . support 11 is part of a frame for the swing , and is held generally horizontally the desired distance above the ground by suitable frame members which would be attached to the ends of support 11 , not shown in fig1 . a saddle bracket 12 is attached to support 11 by means of a pair of bolts 13 . attached to the saddle bracket 12 is a housing 14 which defines a socket . a ball is positioned inside the socket , and a load supporting stem 15 extends from the socket through an aperture 16 . an eye 17 is attached to the end of the load supporting stem 15 . a clevis and clevis pin generally designated by reference numeral 20 is used to connect the eye 17 to the chains 21 . the other end of chains 21 are connected to the seat 22 , which in the embodiment shown in fig1 comprises a tire , by any suitable means ( not shown ). it will be understood that any type of seat might be used in place of the tire 22 shown . likewise , cables or ropes or other means for suspending the seat from the swing mount might be used in place of the chains 21 . referring now to fig2 the support 11 is shown in cross section . in the case of a cylindrical support log , bracket 12 is preferably formed in a saddle shape with a central portion 23 and edge portions 24 which are bent up at an angle to provide a more secure mounting to support 11 . in the case of a rectangular or other flat bottomed support , the bracket 12 could comprise only the flat portion 23 ; or , the outer portions 24 could be bent at right angles and spaced apart by a dimension corresponding to the width of the support . as shown in fig2 and 3 , bolts 13 pass through holes in bracket 12 and support 11 . bolts 13 have heads 25 and threaded ends on which are placed washers 26 and nuts 27 . flat spots are shown cut into the top of support 11 to provide good attachment points for washers 26 and nuts 27 . housing 14 , which defines the socket , is preferably welded to the bracket 12 . the aperture 16 is sized in consideration of the extent of angular motion which the mount is to provide , and also in consideration of the strength and support required in view of the load to be transmitted to the socket by the ball . as shown in fig2 and 3 , the ball 30 is positioned inside the socket . in the preferred embodiment , the ball is not a complete sphere , but is a segment of a sphere . the generally spherical surface is in contact with the socket , and the ball has a flat side positioned generally away from the aperture 16 of the socket . in the preferred embodiment , the ball comprises somewhat more than a hemisphere , with the edges between the spherical surface and the flat side being rounded off , so as to provide smooth action of the ball inside the socket . the ball has a central bore therethrough , and the load supporting stem 15 , which in the preferred embodiment comprises a lag bolt , is positioned in the central bore , as shown in fig2 . the lag bolt 15 has a head 35 positioned within the socket above the ball , and a shank , the end portion of which contains threads 36 . the eye 17 is threaded onto the bolt 15 , and is welded in place as indicated at 37 . a safety retainer 40 , which in the preferred embodiment comprises a washer , is placed on the lag bolt and is held in place between the flat surface of the ball and head 35 of the lag bolt . the ball and the safety retainer are thus attached to the head of the load supporting stem 15 , in the sense that loads placed on the load supporting stem pull the head 35 and the safety retainer 40 into load bearing contact with the ball 30 . the load is then transferred by the ball to the socket . of course , the safety retainer 40 and the head 35 of the bolt need not be rigidly secured to each other or to the ball , since normal loads hold them in position . a grease fitting 38 is provided in the housing 14 so that the space within the socket around the ball can be filled with grease . the ball 30 in the preferred embodiment is molded from nylon in a two - step process . the ball 30 , as shown in fig2 comprises an inner core 31 and an outer shell 32 . the inner core 31 is first formed , then the outer shell 32 is molded therearound . the formation of the ball with the two layers serves a dual purpose . in the molding of the ball , it helps reduce shrinkage due to cooling which might otherwise cause the ball to pull away from the mold and make an irregular or uneven outer surface . however , in the two - step process , the shrinkage on cooling of the outer surface is minimized since only the relatively small amount of plastic material in the outer shell is subject to cooling and shrinking in the final step . any shrinking of the inner core during its own molding process is immaterial , since any loss in thickness is made up in the molding in the outer shell . the use of a two - step molding and remolding process to eliminate shrinkage is known in the plastics molding art . however , another reason for the two - part construction of the ball in the present invention is that it provides a means for visual determination of wear on the ball . the inner core and the outer shell , although both molded from nylon , may contain coloring agents so that the inner core and outer shell are of different colors . in use , some of the material of the outer shell will be worn away over a period of time through normal use . when the outer shell is worn to the point that the inner core is visible in places , this can serve as an indication that the ball should be replaced . visual inspection can be performed on the portion of the ball visible through aperture 16 , as the stem 15 is moved through its extreme arc . in the preferred embodiment , safety retainer 40 is intentionally sized larger than aperture 16 , so that it will not pass therethrough . additionally , retainer 40 should be made of thick enough and strong enough material to support the weight of the swing and occupants against the socket in case the nylon ball should break or disintegrate . should this happen , the load support stem and the seat and occupants of the swing might drop an inch or two , but the safety retainer 40 would engage the socket to prevent the swing from dropping free . it will also be appreciated that by providing both threads and a weld to hold eye 17 to the lag bolt 15 , added safety is obtained because the thread will still support the load in case the weld should fail . | 5 |
in the ribbon line 1 shown in fig1 a number of light - wave conductors 2 are contained between two ribbons 3 and 4 which are provided on one side with a layer of adhesive . the adhesive layers of the ribbons 3 and 4 face each other upon the manufacture of the ribbon line 1 so that , upon lamination they are bonded to the light - wave conductors 2 and , in the intermediate spaces between them as well as at the edges , to each other . as already mentioned , within the ribbon line 1 there are contained a number of light - wave conductors 2 all of which can be simultaneously connected to each other or connected to other apparatus by means of corresponding connecting elements or splicing devices . this is true , in particular , if the light - wave conductors 2 lie alongside of each other in a predetermined raster over the entire width of the ribbon line 1 . for example , 10 to 60 light - wave conductors 2 can lie alongside of each other in a ribbon line 1 . the ribbons 3 and 4 consist of a material the temperature coefficient of which corresponds to that of the light - wave conductors 2 . in that way , the result is obtained that variations in temperature do not have an effect on the ribbon line 1 . in a preferred embodiment , any desired fiberglass reinforced plastic can be used as material for the ribbons 3 and 4 . if several ribbon lines 1 are to be arranged in a light - wave conductor cable , they can then be arranged one above the other in the manner shown in fig2 . however , it is also possible to arrange the ribbon lines 1 in random fashion within the cross section of the light - wave conductor cable , as shown in fig3 . in this case , they can also , as shown in fig4 be curved around their longitudinal axis , whereby their flexibility as a whole is improved . however , it is also possible to arrange within the core of the light - wave conductor cable only one ribbon line 1 the width of which is greater than the diameter of the cable 1 . in order that the cross section in a light - wave conductor cable having such a wide ribbon line 1 can be filled up as well as possible , the ribbon line 1 is suitably curved . there are various possibilities for this : as shown in fig5 the ribbon line 1 can , for instance , be folded along its longitudinal direction so that an approximately circular or sinuous form results as envelope . in the embodiment shown in fig6 the ribbon line 1 is curved around a core 5 in the form of open tube . this tubular structure has a slit 6 which extends in the longitudinal direction of the cable . this tubular structure is also preferably twisted around its longitudinal axis so that the slit 6 extends helically with a long lay . the core 5 can consist of any desired material within which , in principle , elements of high tensile strength can be arranged . however , it is also posible to arrange ordinary copper wires within the core 5 , they being used for communication with traditional devices when a light - wave conductor cable is laid . the ribbon line 1 can also be wound around the core 5 , as shown in fig7 preferably with a loong lay . in this case the individual turns of the ribbon line 1 can overlap each other . in all embodiments , the light - wave conductor cable has a jacket 20 of high tensile strength which can be applied by methods known from cable construction technique . the jacket 20 can , for instance , be a closed metal tube which is formed from a longitudinally entering ribbon and welded together with a longitudinal seam . such a ribbon may consist , for instance , of steel . it is also possible to corrugate such a tube transverse to its longitudinal direction so as to impart greater bendability to it . the jacket 20 of high tensile strength can , however , also consist of thinner sheet - like metal ribbon which is stabilized by threads of high tensile strength . such threads can , for instance , consist of steel or of polyaramide . in principle , the jacket 20 of high tensile strength may be of any desired construction . assurance must be had that it can take up essential tensile forces such as may occur , for instance , upon the laying of the light - wave conductor cable . a layer of plastic can possibly be further provided over the jacket of high tensile strength . for the manufacture of a light - wave conductor cable which contains at least one ribbon line 1 such as shown in fig1 one may proceed for instance , as follows : with reference to fig8 light - wave conductors 2 are removed from a number of bobbins 8 corresponding to the desired number of light - wave conductors 2 and led to a pair of rolls 9 . ribbons 3 and 4 are furthermore introduced into the pair of rolls 9 , the ribbons 3 and 4 being supplied from bobbins 10 and 11 . the two ribbons 3 and 4 are brought up to the light - wave conductors 2 from different sides . by means of the pair of rolls 9 , the light - wave conductors are laminated between the two ribbons 3 and 4 so that the final ribbon line 1 emerges from the pair of rolls 9 . in a following shaping device 12 , the ribbon line 1 can be folded for instance in the manner shown in fig2 . around the ribbon line 1 , which has been folded in this way there is shaped , in a shaping stage 13 , a metal ribbon 14 which is drawn off from a bobbin . from this there is produced the jacket 20 ( fig2 - 6 ) of high tensile strength in accordance with the above embodiments . the jacket 20 can be welded with a longitudinal seam in a station 15 . the station 15 can , however , also serve to bond a thin metal ribbon stabilized by threads of high tensile strength on an overlap place which extents in longitudinal direction . a layer of plastic can be applied by an extruder 16 in the same operation onto the jacket 20 . the finished light - wave conductor cable 17 can then be wound on a bobbin 18 . the light - wave conductor cable 17 can , corresponding to the above remarks , therefore be produced in a single operation , including the manufacture of the ribbon line 1 . in principle , however , it is also possible to procuce the ribbon line 1 in advance and introduce it only later on into a light - wave conductor cable . in particular , in the case of the last - mentioned manner of procedure it is also possible to arrange two or more ribbon lines 1 in one light - wave conductor cable . the light - wave conductor cables 2 are protected not only mechanically but also against moisture by the laminating in the ribbon line 1 . the light - wave conductor cable 17 can also be developed as a whole as moisture - protected and , in particular , as longitudinally water - tight if all cavities within the jacket 20 are filled with sealing material . such a material can , for instance , be a petrojelly having a base of petroleum jelly which is customary in cable construction techique . in principle , however , foamable material can also be used . | 6 |
referring to fig1 a progressive display device 10 is shown having a base 12 , a finger recess 14 , a cover 16 and a slide 18 . this figure shows the device in its “ closed ” or inactivated state with the slide or pull strip 18 fully retracted into base 12 . the base 12 is made of stock sufficiently thick to prevent bending . the cover 16 is of lesser thickness than base 12 . “ leaves ” or “ pages ” 20 are sandwiched between cover 16 and base 12 . [ 0019 ] fig2 shows the base 12 of the display device 10 with the leaves 20 omitted completely . key strip 40 is shown only partially for the sake of clarity , but is secured to base 12 at the end of base 12 as shown in fig2 . the base 12 is provided with a rectangular recess 22 defined by edges 24 , 25 , 26 , and 27 in which slide 18 is received . recess 22 is located slightly below the upper surface of base 12 . slider 18 is also provided with ears 28 and 30 which are captured in slots 32 and 34 located beneath the surface of base 12 . slide 18 is shown having a “ key ” sheet tongue 36 ( partially shown ) attached to the upper surface of slide 18 at end 38 . the tongue 36 limits the travel of slider 18 to the distance between edges 24 and 26 . the tongue 36 is part of the ,“ key ” strip 40 shown more completely in fig3 , 5 , 6 , 7 , 8 9 , 10 and 11 . tongue 36 is of such thickness that the top surface of tongue 36 is flush with or slightly above the upper surface of base 12 . key strip 40 is therefore attached to slider 18 by means of tongue 36 ; the other end of key strip 40 is fixedly attached to base 12 at the end of base 12 adjacent recess 14 . slider 18 is thus manually movable in a translatory fashion between edges 24 and 26 . this motion is limited by both the length of slots 32 and 34 in base 12 or by the tongue 36 engaging edges 24 and 26 of recess 22 . as slider 18 is moved in base 12 , the tongue 36 is pulled or pushed back and forth by the slider 18 between the edges 24 and 26 . referring now to fig3 and 4 it will be seen how the folding mechanism functions . tongue 36 as shown forms an attachment for the key strip 40 to slider 18 . strip 40 is - the basis of a folding hinge mechanism that “ rolls ” back and forth as slider 18 is pulled or pushed . this folding action causes the cover 16 and leaves 42 , 44 , 46 , 48 to progressively turn over as the slider 18 is moved between its extreme positions . key strip 40 is provided with score lines 50 , 52 , 54 , 56 , 58 and 60 to promote the progressive hinging of the strip 40 at these locations . leaves 42 - 48 are attached to key strip 40 at the “ flats ” 53 , 55 , 57 and 59 existing between scorelines 452 , 54 , 58 and 60 respectively . cover 16 is attached to flat 51 at key strip 40 . [ 0026 ] fig5 , 7 , 8 , 9 and 10 show the progressive rolling hinge action performed by key strip 40 as slider 18 is progressively moved from its “ home ” position in fig1 to the left . [ 0027 ] fig5 shows the display device at “ rest ” where cover 16 and leaves 42 , 44 , 46 and 48 are all lying in a flat stacked position on key strip 40 and base 12 . in fig6 slider 18 has been moved slightly to the left carrying the attached tongue 36 with it . the leftward movement of slider 18 causes the key strip 40 to buckle at score line 52 due to the compressive force exerted on key strip 40 by the leftward movement of slider 18 . this causes the cover 16 to be raised slightly . as scoreline 52 buckles upwardly the cover leaf 16 rotates to the position shown in fig6 ( about 20 ° from its rest position ). the key strip 40 buckles at hinge or scoreline 52 first because cover 16 is the only single leaf in the pile available to twist . the balance of the leaves 42 , 44 , 46 and 48 are prevented from twisting because they are stacked one upon the other so that they are prevented from any rotation . as the slider continues its motion in the leftward direction , as shown in fig7 the key strip 40 continues to deform at scorelines 50 and 52 , with the scoreline 50 now subtending an angle of about 135 ° ( between tongue 36 and the first flat 51 of key strip 40 ). the angle of the fold at scoreline 52 has rotated from an angle of 180 ° in fig5 to about 60 ° in fig7 and cover leaf 16 has now rotated through an angle of about 135 ° from that shown in fig6 . note that at this position , the bend at scoreline 52 is at its maximum . moving on to fig8 the cover sheet 16 has now completed its 1800 angle of rotation from fig6 and now lies flat on base 12 . leaf is 42 is shown in a vertical position and the angle formed by key strip 40 at scoreline 54 is now 90 °. the angle at scoreline 52 is now 90 ° as well . [ 0031 ] fig9 shows the progression of the rolling action of key strip 40 to the point where leaf 42 is now almost horizontal ( having rotated through almost 180 °) and leaf 44 is now vertical . note that while key strip 40 “ rolls ” and the leaves 16 , 42 , 44 , 46 , 48 are in the process of turning , the leaves which have completed turning lie flat on base 12 and now slide to the left along base 12 as they are pulled leftward by slider 18 . [ 0032 ] fig1 shows the situation with the last leaf 48 approaching its final destination . at this point the key strip 40 will have seen each scoreline 52 , 54 , 56 , 58 and 60 bend through an angle of about 135 ° and then unbend through the same 135 ° angle as each leaf completes its rotation of 180 °. [ 0033 ] fig1 shows an illustration of how the display device 10 may be used to show a progressively changing display . as slider 18 is manipulated the cover 16 and leaves 42 , 44 , 46 , 48 and 50 show a changing scene . [ 0034 ] fig1 shows the display 10 with a ; “ pop up ” element 70 mounted between leaves 44 and 46 . as leaves 44 and 46 open , member 70 swings upwardly attracting additional attention . as leaves 44 and 46 close , the element 70 swings back down to its original position . the success of this - invention lies in the selection of material for the leaves 42 , 44 , 45 and 48 , and the key strip 40 . the key strip 40 must be scored at scorelines 50 , 52 , 54 , 56 , 58 and 60 sufficiently to weaken the key strip 40 at these fold lines but not sufficiently to cause the key strip 40 to tear at the fold lines during manipulation . the leaves 42 , 44 , 46 and 48 and cover 16 must be carefully bonded to key strip 40 at each of the associated flats in a very precise manner . it may be necessary to remove some of the material of the leaves and cover 16 at the place of bonding to keep the build up of material at the hinge to a reasonable thickness . the hinging action of the various scorelines is interesting scoreline 50 forms the only hinge which rotates through a full 180 ° during a complete turning process . the balance of the scorelines 52 , 54 , 56 and 58 all begin at 180 ° and fold through an angle of about 135 ° to produce an enclosed angle of about 45 ° before opening up to 180 ° again . it will be seen that the display device 10 encompasses a moving attraction which is not limited to single representation as the prior art shows . the versatility of the device allows for a wide range of applications , from greeting cards to commercial advertisements and instruction procedures . the key element to the success lies in the folding action of key strip 40 which is capable of undergoing large angular excursions at each score line before returning to the original configuration . | 6 |
unless otherwise noted , identical or functionally identical elements and signals are assigned the same reference characters in the figures . referring now to the figures of the drawing in detail and first , particularly , to fig2 thereof , there is shown a bus signal hold cell 2 that is connected to a bus line 1 by its primary input / output i / o . the input / output i / o can be driven bidirectionally ; i . e ., data can be read from the bus , and data of the bus signal hold cell 2 can be written onto the bus line 1 . the bus signal hold cell 2 includes two drivers 3 , 4 that are realized as inverters . the output of each driver 3 , 4 controls the input of the respective other driver 3 , 4 . the input of the first driver 3 is connected to the bus line 1 via the input / output i / o . the output of the second driver 4 is connected to the bus line 1 via the input / output i / o . in the present exemplary embodiment , the first driver 3 has a higher drive power than the second , recessive driver 4 . the second inverter could also be realized as a high - impedance - switchable inverter . the drive power of the second , recessive driver 4 is dimensioned such that it is less than the drive power of the weakest subscriber connected to the bus line 1 . this guarantees that , in case one of the subscribers connected to the bus line 1 wants to transmit data , this driver 4 exhibits recessive behavior and allows the data transmission of the subscriber . it would also be possible to increase the drive power of the first and / or second driver 3 , 4 or to make this adjustable . the bus signal hold cell 2 inventively includes an additional serial data input tdi , via which a test signal di can be appplied into the bus signal hold cell 2 . the additional data input tdi is coupled with the input of the first driver 3 in this case . a multiplexer configuration 5 is arranged between the input of the driver 3 and the data input tdi , as well as between the input of the driver 3 and the input / output i / o . a control input te is provided for controlling the multiplexer configuration 5 , via which the multiplexer configuration 5 can be charged with a control signal en . the bus signal hold cell 2 has two operating modes : a normal mode and a test mode . in the normal mode , the multiplexer 5 is controlled such that a bus signal in is input to the inverter 3 . in the test mode , on the other hand , the test signal di is switched onto the inverter via the data input tdi . fig3 represents a circuit diagram of a development of the bus signal hold cell 2 . as compared to the bus signal hold cell 2 in fig2 here the bus signal hold cell 2 additionally includes a serial data output tdo . the condition of the bus signal hold cell 2 can be read via the data output tdo at any time . for instance , in the normal mode the condition of the bus signal hold cell 2 can be determined via the data output tdo . in addition , in the test mode , the data response do can be read that results from a data signal input to the data input tdi . fig4 shows a circuit diagram of a particular development of the bus signal hold cell shown in fig3 . the bus signal hold cell in fig4 includes a shift register arrangement , which , in the present exemplary embodiment , is realized as two scan flip - flops or latches 10 , 11 configured in series . the input of the first latch 10 is connected to the additional data input tdi , whereas the output of the first latch 10 controls the first input of the in - series second latch 11 . the output of the second latch 11 is connected to the additional data output tdo and to an input of the multiplexer 5 . each latch 10 , 11 includes a first inverter 12 , 13 in its signal path and a second inverter 3 , 14 in its feedback path . a respective multiplexer 15 , 16 is connected to the input of one of the inverters 12 , 13 . the output signal of the feedback inverter 3 , 14 and the latch input signal are applied to the inputs of the multiplexers 15 , 16 , respectively . the multiplexers 15 , 16 are controlled via a clock signal ck 0 , ck 1 . the test cycle , i . e . the clock of the control signals ck 0 , ck 1 which are applied via the control inputs 17 , 18 , can be derived from the system clock of the integrated circuit in connection with the control signal en of the bus signal hold cell . in a particularly advantageous development , the feedback inverter 3 of the latch 11 on the output side is simultaneously the first inverter 3 of the bus signal hold cell 2 . the output signal d 0 of the output - side latch 11 or a bus signal in can thus be supplied to this inverter via the multiplexer 5 . only two latches 10 , 11 are provided in this exemplary embodiment , though a greater or lesser number of latches 10 , 11 can be provided , depending on the application . beyond this , the shift register arrangement could be realized as any arrangement . fig5 is a circuit diagram of a development of the bus signal hold cell 2 which has been simplified compared to that in fig4 . the bus signal hold cell is furnished with two standard scan flip - flops 10 , 11 in series , which are interposed between the data input tdi and the data output tdo . the output of the multiplexer 5 is connected to the in - series flip - flops 10 , 11 . one input of the multiplexer 5 is connected to the data input tdi and another input of the multiplexer 5 is connected , via the input / output i / o and the inverter 3 , to the bus line 1 . the output of the multiplexer 5 is connected to the first flip - flop 10 , whereby the multiplexer output signal can be fed to the input / output i / o , and thus to the bus line 1 via the feedback branch and via the inverter 4 simultaneously . the bus signal hold cell according to fig4 and 5 supports the testing of the bus lines of a scan - based integrated circuit wherein an automatic test pattern generation ( atpg ) is utilized . fig6 is a block circuit diagram representing an advantageous application of a number of the inventive bus signal hold cells 2 for testing highly complex bus systems . the bus system shown in fig6 includes a bus 20 with five bus lines 1 and bus signal cells 2 that are allocated to these bus lines 1 . the bus signal hold cells 2 are represented as blocks , but they can be realized according to any of the embodiments shown in fig2 to 4 . the bus signal hold cells 2 are connected to a bus line 1 via their primary input / output i / o , respectively . beyond this , each bus signal hold cell 2 is connected to another bus line 1 ( advantageously a neighboring line ) via the additional data input tdi . fig6 thus represents a bus system whose bus lines 1 are interconnected into a single signal line using the inventive bus signal hold cells 2 . so coupled , the bus lines 1 and the bus signal hold cells 2 produce a single contiguous unidirectionally operable signal line having an input 21 to which test data can be applied and having a test response that can be read at an output 22 . the functioning of the inventive bus signal hold cells — that is to say , the bus system which is equipped with bus signals hold cells 2 of this type — will now be described in detail : the inventive method can be implemented to enable the testing of bus lines using bus signal hold cells 2 . this is accomplished using a control or synchronization signal en . via the control signal en , the bus signal hold cell 2 is switched into test mode . all other signal sources that can write data onto the bus line , for instance subscribers which are connected to the bus line , are deactivated . using the additional data input tdi , a strictly prescribed test value ( test signal di ) can then be inserted into the bus signal hold cell 2 and thus written onto the allocated bus line 1 . using the additional data output tdo , the bus condition can be observed in test mode . the bus signal hold cells 2 store the present condition on the bus line 1 , i . e . at the bus signal hold cell 2 , at a defined time . to this end , a test signal di which is to be observed is written onto a bus line 1 . the bus signal hold cell 2 stores this item of test data di , preferably in a latch . the test data di is forwarded to the additional output tdo of the bus signal hold cell 2 and can then be compared to the expected test response . the bus signal hold cell can be configured such that it loses its sequential behavior and lays a combinatorial signal path between the primary bus terminal and the additional data output . alternatively , the bus signal hold cell can also be configured in such a way that it loses its sequential behavior and lays a combinatorial path between the additional data input and the primary bus terminal . the test patterns are written into a test pattern source having an output that is connected to the bus line . this test pattern source can be the output of a macromodule , the output of a bus signal hold cell in test control mode , or an externally generated test signal . the test pattern source writes the test pattern onto the bus line . the test patterns that are written onto the bus are stored in the bus signal hold cells . the test response signals are compared to the expected values that are expected . this can be accomplished in that the test pattern is read from the circuit serially , forwarded to a data output via multiplexers , compressed into a signature , or forwarded to an additional bus line that is to be tested . the comparison occurs via a bus signal hold cell , a macromodule or a signal output of the integrated circuit . the macromodule must be constructed in such a way that it generates the appropriate test patterns itself . in the case of a bus structure , the above described test can also be performed in parallel fashion . for testing a plurality of bus lines of a bus , the above described methods can be appropriately combined . this can occur as follows : the bus signal hold cells are so arranged that one or more serial signal lines emerge , which connect different bus lines to one another in the test mode . the signal path of a signal line can advantageously contain storage elements , macromodules , or combinatorial elements . the circuit is so configured that an item of test data is applied at the input of the serial signal line or lines . all other subscribers which are connected to the bus lines and can write onto the bus lines in normal mode are deactivated in test mode . the test data which is coupled in on the input side is forwarded by the interconnected bus lines . at the output of the serial signal line , the test response signal , i . e . its signal value , the time delay and / or the signal shape , can be observed . for purposes of testing macromodules , a plurality of macromodules are interconnected by bus lines as follows : the macromodules are so constructed that bus signal hold cells are placed at their data inputs and outputs . a test sequence control appropriately configures the macromodules in the test mode . for the testing of the buses / bus lines between the macromodules , the bus signal hold cells are active and all other drivers that are connected to the buses / bus lines are inactive . the bus lines can be tested by the above described testing methods . for the testing of a macromodule , the bus signal hold cells are configured as test data sources at their data inputs and as test data sinks at their data outputs . all other signal sources at the data inputs are deactivated . in sum , by providing a new bus signal hold cell that includes an additional data input and / or data output , the testability , i . e . the controllability and observability , can be significantly enhanced . the present invention has been laid out in a manner that best illustrates the principle of the invention and its practical application , however , the invention can of course be modified by the expert in many ways . | 6 |
the present invention is more particularly described in the following exemplary embodiments that are intended as illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art . as used herein , “ a ,” “ an ,” or “ the ” can mean one or more , depending upon the context in which it is used . as used herein , the direction or orientation “ horizontal ” is intended to mean a direction or orientation along the longitudinal axis of the elongated lamp , while the direction or orientation “ vertical ” is intended to mean a direction or orientation perpendicular to the longitudinal axis of the longitudinal lamp . as described herein , light or a portion thereof that is emitted or reflected in a horizontal direction can include light that is emitted or reflected in a direction at an angle to the horizontal direction , and having a horizontal directional vector and a vertical directional vector . as used herein , the term “ nadir ” is typically a direction from a light source toward the center of earth , and perpendicular to the horizon . when the lamp of the light fixture is disposed in a horizontal plane relative to earth , nadir is the downward vertical direction . in a typical parking lot or parking garage application , there is a linear roadway and a plurality of parking spaces on either or both sides of the roadway , each parking space being approximately rectangular in shape and oriented with its length perpendicular to or at a slight angle to the direction of the roadway . the light fixture of the present invention is typically disposed on the ceiling or on a support above the roadway with its longitudinal axis disposed in the direction of the roadway , whereby the laterally emitted and reflected light extends toward the parking spaces . an embodiment is now described with reference to the figures , in which like reference characters indicate like parts throughout the several views . referring to fig1 - 4 , a light fixture 10 or troffer of the present invention for illuminating an area includes a support means , illustrated as a support pan 11 , a reflector assembly 20 , and one or more linear light source 12 and 12 ′. the light source extends along a light longitudinal axis 100 between a first end 14 of the light source and a spaced second end 15 thereof . the fixture 10 also has a first side edge 16 and an opposite second side edge 17 . light emanating from the light source 12 and reflected by the reflector assembly passes through a lens assembly 90 that is positioned between the light source 12 and the area to be illuminated . the light source 12 may be a conventional fluorescent lamp , such as a type t5 , t8 or t12 . the reflector assembly 20 includes a pair of elongated reflector elements 22 , 22 ′. at least a portion of each reflector element 22 forms a reflective surface . in one aspect , at least a portion of the reflector element 22 can be painted or coated with a reflective material or formed from a reflective material . the reflective material may be substantially glossy or substantially flat . in one example , the reflective material is mirror - finished reflective aluminum to efficiently reflect incident light , and typically is miro - 4 ( 95 % minimum reflectivity ) available from alanod aluminum — veredlung gmbh & amp ; co . kg . each reflector element 22 includes a proximal portion shown as a base reflector 23 that is affixed to the housing proximate the support pan i 1 , and an extending reflector 24 that extends from the base reflector 23 to a distal edge 25 . the two reflector elements 22 and 22 ′ can be either temporarily or permanently attached together to form the reflector assembly . the distal ends 25 of each reflector element 22 , 22 ′ are shown overlapped one on the other , which ends can be secured together with conventional attachment or fixture means , such as a screw , threaded nut and bolt , latch , a catch , a weld or adhesive . the reflector element 22 , including the base reflector 23 and extending reflector 24 portions , are elongated and commensurate with the elongated light source 12 . the extending reflector 24 extends substantially in a vertical direction ( as shown in fig4 , when the support pan 11 of the light fixture lies in a horizontal plane ), substantially normal to the base reflector 23 . the extending reflector 24 is shown integral with the base reflector 23 , but can also be a separate , attachable element . as shown in greater detail in fig5 and 6 , the base reflector 23 can be formed having a plurality ( numbered “ m ”) of adjacent elongated panels 23 a , 23 b , etc ., along elongated folds 27 , where m is greater than 1 and typically equals 2 - 10 , though more than 10 panels can be used . each panel 23 m lies in a plane disposed at an angle α at a proximal edge from the horizontal plane ( line h ) through support pan 11 . thus , panel 23 a lies in plane through its proximal edge at fold line 27 a at an angle α a relative to plane h ; panel 23 b lies in plane through its proximal edge at fold line 27 b at an angle α b relative to plane h ; and panel 23 c lies in plane through its proximal edge at fold line 27 c at an angle a relative to plane h . the angle α m is deemed a positive angle when the elongated panel angles from its proximal edge away from the lamp 12 ( centerline 100 ), and a negative angle when the elongated panel angles from its proximal edge toward the lamp . in the illustrated embodiment , α a is about + 20 ° to + 26 ° , α b is about − 24 ° to about − 30 °, and α c is about − 3 ° to about + 3 °. the panels 23 m are typically planar . when the panels have a curvilinear cross section in a vertical plane , a tangent light to the curved surface has the respective angles α . the reflecting function of each base reflector panel 23 m is affected by its disposed angle α and its respective width “ w 23 ”, shown in fig6 , as well as its position relative to the elongated lamp . for orientation purposes , the position 27 a , representing the proximal end of the extending reflector portion 24 , is shown disposed by distances x and y from the centerline 100 of the elongated lamp . distal base panel 23 d can have any length ( width ) and configuration useful for its securement to the support pan 11 or housing 50 . the extending reflector 24 can be formed having a plurality ( numbered “ n ”) of adjacent elongated panels 24 a , 24 b , etc ., along elongated folds 28 , where n is greater than 2 and typically equals 2 - 10 , though more than 10 panels can be used . each panel 24 n lies in a plane disposed at an angle β at a proximal edge from a vertical plane ( line v ) perpendicular to the lamp axis 100 . thus , panel 24 a lies in a plane through its proximal edge at fold line 28 a at an angle β a relative to vertical line v ; panel 24 b lies in plane through its proximal edge at fold line 28 b at an angle β b relative to line v ; etc . the angle β m is deemed a positive angle when the elongated panel angles from its proximal edge away from the lamp , and a negative angle when the elongated panel angles from its proximal edge toward the lamp . in the illustrated embodiment , β a is about + 27 ° to about + 33 °, β b is about + 8 ° to about + 14 °, β b is about + 1 ° to about − 5 °, and β d is about − 11 ° to about − 17 °. the panels 24 n are typically planar , though they can have a curvilinear cross section in a vertical plane . the reflecting function of each extending reflector panel 24 n is affected by its disposed angle β and its respective width “ w 24 ”, shown in fig6 , as well as its position relative to the elongated lamp . distal edge panel 25 can have any width and be disposed at any angle useful for its securement in the fixture . table a shows the angles α and β , widths w , and dimensions x and y of the base reflector panel and the extending reflector panel for a typical reflector element of the present invention . in another aspect of the invention , one or more extending reflector panels 24 n extend vertically beyond ( below ) the lamp 12 . in another aspect of the invention , at least one of the one or more extending reflector panels is angled toward the lamp with an angle 131 . the base reflector 23 and the extending reflector 24 , and the panels thereof , can be formed from a single piece of material or from a plurality of adjoined pieces . as one will appreciate , the reflector assembly can be formed from any code - compliant material . for example , the reflector can be formed from steel , aluminum , or metallized formed plastic , including extruded plastic . the base reflectors 23 and extending reflectors 24 are secured in position to the support pan 11 to avoid accidental and incidental movement or rotation of panels out of the preselected position and orientation that is determined to reflect light emitted from the positioned and secured light source 12 to a predetermined location below and laterally spaced from the light fixture . each panel 23 m of the base reflector 23 and panel 24 n of the extending reflector 24 reflects the light that is emitted by the light source at respective incident angles relative to the centerline 100 of the elongated light source 12 . as shown in fig7 , each base reflector panel 23 a , 23 b , and 23 c is disposed distance wise and angularly relative to the centerline 100 of the light source 12 , wherein light from the light source 12 ( depicted as emitting from centerline 100 ) strikes the plane of the panel 23 m at an incidence angle δ . thus , panel 23 a receives light emitted from the light source 12 at an incidence angle δ a , and reflects the light at equivalent reflectance angle δ a ; panel 23 b receives light emitted from the light source 12 at an incidence angle δ b , and reflects the light at equivalent reflectance angle δ b ; and panel 23 c receives light emitted from the light source 12 at an incidence angle δ c , and reflects the light at equivalent reflectance angle δ c . each extending reflector panel 24 a , 24 b , 24 c and 24 d likewise is disposed distance wise and angularly relative to the centerline 100 of the light source 12 , wherein light from the light source 12 strikes the plane of the panel 24 n at an incidence angle θ . thus , panel 24 a receives light emitted from the light source 12 at an incidence angle θ a , and reflects the light at equivalent reflectance angle θ a ; panel 24 b receives light emitted from the light source 12 at an incidence angle θ b , and reflects the light at equivalent reflectance angle θ b ; panel 24 c receives light emitted from the light source 12 at incidence angle θ c , and reflects the light at equivalent reflectance angle θ c ; and panel 24 d receives light emitted from the light source 12 at an incidence angle θ d , and reflects the light at equivalent reflectance angle θ d . it can also be understood that the light received at different positions along the width w of a planar panel strikes and reflects at different incidence and reflectance angles . the positioning of the lamp 12 in relation to each of the panels 23 and 24 of the reflector element 22 provides capture and control of the light to ward areas below and laterally away from the light fixture 10 where lighting is desired . in the illustrated embodiment , a portion of the light emitted upward toward the housing is reflected off of the first and second base reflector panels 23 a and 23 b and directed to areas below and laterally away from the light fixture . the light emitted toward the second base reflector 23 b is received at a first angle φ 1 from vertical ( v ), and is reflected at a second opposing angle φ 2 from vertical that is greater than φ 1 . another portion of the light emitted upward toward the housing is reflected off of the first base reflector panel 23 a and further reflects off of one of the vertical reflector panels ( illustrated as the first extending reflector panel 24 a ) and to an area below the light fixture . the light fixture is configured to reflect a majority of the light that is emitted by one lamp 12 at the opposed second lamp 12 ′, toward the opposite horizontal direction and away from the fixture to an area where lighting is needed , and typically laterally below and away from the fixture . as shown in fig2 , all light emitted from the lamp 12 at an angle λ of at least about 45 degrees from the first vertical direction v , toward the extending reflector portion 24 ( in the h 1 direction ), is reflected by the extending reflector portion 24 . in can be seen that light emitted from the lamp 12 in the angular range λ would otherwise alight onto the area below and laterally in the same direction away from the fixture , but for its reflection by the extending reflector portion 24 . it can be seen that the effect of the extending reflector 24 is to reflect the light emitted in an angular range λ in a controlled manner to an area more laterally distant from the light fixture 10 . a portion of the emitted light in the angular range λ is reflected off of the extending reflector panels 24 b , 24 c and 24 d in the opposite horizontal direction h 2 . fig7 shows one or more extending reflector panels , such as reflector panels 24 c and 24 d , positioned to extending vertically below and angled toward the lamp . this positioning of the reflector panels reflects the light emitted from the lamp in a first horizontal direction h 1 at a first angle φ 3 from vertical ( v ) toward the second opposite horizontal direction h 2 at an angle φ 4 from vertical that is greater than φ 3 . thus , the reflector throws light toward areas more laterally remote from the fixture . light emitted by the second light source 12 ′ can be similarly reflected by the second reflector element 22 ′. one can envision a conventional dual lamp fixture without a reflector assembly , in which light emitted by the lamp at the second lamp is substantially absorbed by the second lamp , or is diffusely scattered . in contrast , the present invention also provides a fixture wherein light emitted by the first light source 12 in a generally first horizontal direction at or toward the second lamp source 12 ′ reflects off of the extending reflector 24 and toward the opposite horizontal direction h 2 . light that would otherwise be wasted by striking and diffusing off of the adjacent lamp is captured and directed as usable light by the extending reflector panels in the generally opposite horizontal direction . as shown in fig1 - 3 , the light fixture 10 typically has an external housing 50 and a support means , illustrated as a support pan 11 , associated within an inner surface of the housing . the housing has an outer surface having opposed first and second end faces 52 , and a first side wall 62 and a second side wall 64 on opposed first and second end edges of the support pan 11 . the first and second end faces 52 and the first 62 and second 64 side walls cooperate with an upper mounting surface 66 to define an enclosed volume within the light fixture . the support pan 11 supports and secures the lamp sockets , reflector , and ballasts within the housing . each of the end faces and side walls extends downwardly away from and along the edges of the support pan 11 toward a common bottom edge 55 of the housing . each of the first and second end faces 52 and each of the first and second side walls 62 , 64 may be substantially planar or non - planar . in the non - planar embodiments , portions of the first and second end faces and the first and second side walls are curved . the curved portions of the first and second end faces can be substantially concave or substantially convex . in one aspect , at least a portion of the lamp 12 extends in the first vertical direction beyond the bottom edge 55 of the housing . the support pan 11 is typically affixed to the housing 50 with conventional attachment means , such as screws , bolts and nuts , latches , catches , etc . the reflector assembly 20 is positioned relative to and attached , typically removably attached , to the support pan 11 by convention attachment means , such as screws , bolts and nuts , latches , catches , and others . removal of the reflector assembly 20 may be needed to replace a faulty ballast or other component , or to reposition the reflector assembly to improve its performance or to achieve a different lighting effect . another embodiment of the invention provides a light fixture having a single lamp light with an extending reflector disposed on one side of the lamp horizontally disposed from the single lamp . light reflecting off of the panels 24 n of the extending reflector 24 is directed to an area below and to the horizontal direction opposite from the lamp . in an aspect of the invention , the light fixture 10 is constructed and arranged to mount an electrical socket 59 or receptacle for detachably securing a selected end of the light source thereto . in one example , the electrical socket 59 is mounted onto a portion of the support pan 11 or its associated structure . the light fixture 10 also includes at least one conventional light ballast ( not shown ) constructed and arranged for electrically connecting the light source to an external power source . in one aspect , the at least one ballast is positioned within the interior of the enclosed volume , to a portion of the support means . in one aspect , the light fixture is suspended from a ceiling . in the illustrated embodiment , the housing is spaced from the ceiling a predetermined distance and is mounted to the ceiling via conventional suspension means , including bolts securing a bracket 67 disposed on the mounting surface 66 to the ceiling . referring to fig3 , the lens 90 of the present invention is constructed and arranged to direct light emitted by the light source 12 and reflected from the reflector assembly 20 out to the areas to be illuminated . a basic function of the lens 90 is to protect the mounted light sources 12 and the extending reflector element from obstructions and the elements . as shown in fig1 , in one aspect , the lens 90 includes a first side face 92 having a first side edge 93 , an opposed second side face 94 having a second side edge 95 , and a central face 96 extending between the first side face 92 and the second side face 94 . the lens 90 typically has opposed side faces 97 which enclose the volume between the first and second end faces 92 , 94 , with an opening defined by a housing - engaging rim 98 including the first and second end edges 93 , 95 and the edges of the first and second end faces 92 , 94 . the lens has a lens longitudinal axis 200 that extends between the first and second end faces 97 , and is generally parallel to the light source longitudinal axis 100 . the rim 98 engages the outer peripheral edge 55 of the housing , such that the light sources 12 and 12 ′ and the extending reflectors 24 are positioned within the volume of the lens , as shown in fig4 . the lens 90 can be made from any suitable , code - compliant material such as , for example , a polymer or plastic . for example , the lens 90 can be constructed by extruding pellets of meth - acrylate or polycarbonates into the desired shape of the lens . the lens 90 can be of a clear material or a translucent material . in another aspect , the lens can be colored or tinted . the lens 90 is constructed and arranged for detachable connection to the light fixture 10 . the lens can be secured to the light fixture by any well known means , such as clamps , straps , slots and t - bolts , threaded bores and screws . fig3 shows a plurality of clamps 99 having a fixed end secured to the housing and a hooked free end that engages a slot , latch or other engagement means disposed on the end faces 92 , 94 , to secure the rim 98 of the lens 90 to the housing . the lens assembly 90 can also include a conventional diffuser inlay , such as , for example , a optigrafix ™ film product , which is a diffuser film that can be purchased from grafix plastics , a division of graphic art systems , inc . of cleveland , ohio . the diffuser inlay can be pliable or fixed in shape , transparent , semi - translucent , translucent , and / or colored or tinted . the use of the reflector assembly of the present invention in fluorescent light fixtures can provide a number of advantages , including improved lighting , increased lighting in areas laterally , and longitudinally , remote from the fixture , the opportunity to use a lamp of lower wattage requirements , resulting in an energy savings in an existing light fixture arrangement ; and an improvement in the positioning and lighting , with fewer lighting fixtures and reduced energy consumption , in new lighting applications . a representative embodiment of the invention has a housing , lens and reflector assembly substantially as shown in fig1 - 7 , denoted eg - 30 , with two pairs of sockets for supporting a pair of 54 watt , 4 - foot t5ho lamps . the shape and orientation of the reflector assemblies are shown in table a - 1 . the light output of the embodiment mounted at 8 feet above ground level is compared with a conventional light fixture that is the same in every aspect , with the same two powered lamps , with a conventional planar , reflector pan in place of the reflector assembly , and likewise mounted at 8 feet above ground level . the test results for the conventional light fixture (“ conventional eg ”) and for the representative light fixture of the present invention (“ eg - 30 ”) are included in fig8 a and 8b , respectively , with a side - by - side ( actually , top and bottom ) comparison shown in fig8 c , with the conventional light fixture (“ conventional eg ”) shown in the top half and the representative light fixture of the present invention shown in the bottom half . eg stands for “ enclosed and gasketed ”. the triangular emblem in the figures shows the direction of traffic in the parking garage . the comparison shows that the representative light fixture provides more light than the conventional light fixture , below the fixture and toward areas both to the sides ( axially from the lamps , in the a direction ) and laterally ( transverse to the axis of the lamp , in the t direction ) remote from the light fixture . although several embodiments of the invention have been disclosed in the foregoing specification , it is understood by those skilled in the art that the invention is not limited to the specific embodiments disclosed hereinabove , and that modifications and other embodiments and are intended are included within the scope of the appended claims . | 5 |
a loose tube optical waveguide fiber cable 10 according to the present invention may be constructed as schematically depicted in fig1 . the cable 10 contains two optical fibers 2 surrounded by a coating ( not shown ) that is applied directly over the optical fiber 2 . the optical fiber 2 may contain a core and a cladding surrounding the core , with one or more polymer coatings applied over the cladding . the protective tube 1 ( or outer jacket ), which is formed of flame - retardant material , loosely surrounds the optical fibers 2 . in other words , the optical fibers 2 are loosely provided within the protective tube 1 . the number of optical fibers 2 is not restricted to a specific number . the cable 10 contains neither gel - like compounds nor any strengthening members . accordingly , protective tube 1 is a hollow structure of uniform composition and has open space between the optical fibers 2 and the inner wall of the tube 1 . cable 10 is suitable for riser or plenum applications . the cable 10 according to the present invention typically comprises a minimum static bend radius of 25 millimeters with standard single mode fibers and a minimum static bend radius of 10 millimeters with low - bend loss fibers . in a typical embodiment of the present invention , the wall thickness of the protective tube 1 is in a range of 0 . 3 to 0 . 45 times the outer diameter of the tube . the material of the protective tube 1 is typically a halogen - free , flame - retardant polymer . a suitable material of the protective tube 1 is a flame - retardant material with a high degree of inorganic fillers . the flame - retardant material typically has a density of greater than 1 . 35 g / cm 3 . according to one embodiment , the inner diameter of the protective tube 1 of the loose tube optical waveguide fiber cable 10 is at least 0 . 5 millimeter greater than the diameter of the closest theoretical circle that would fit around all of the two or more optical waveguides 2 . the present invention provides a cable with two or more optical waveguides 2 surrounded by a single protective tube 1 , also referred to as a “ polymer jacket ” or a “ sheath ,” wherein no filling gels or swellable materials , and no strengthening elements , like rods or yarns , are used . such a cable is to be regarded as a totally dry structure . the term “ single ” means a protective tube 1 made of one material ( i . e ., a single layer protective tube 1 ). the protective tube 1 according to the present invention contains no elements besides the optical waveguides 2 . fiber access is easy due to the use of halogen - free , fire - retardant sheathing material made of thermoplastics and a high fraction of inorganic fillers . this material breaks easily when an initial cut is made . a simple way to access the optical fibers 2 is to perform a circular cut with a conventional knife without cutting through completely , breaking the protective sheath by repeated bending , and then pulling away the protective sheath 1 over the optical fibers 2 . because of the absence of any filling compound in the tube 1 this can be done in one operation over the desired length . another possibility is to use a conventional cable stripper , adjusted not to cut through the inner surface of the sheath 1 . the next steps are to break the sheath 1 by repeated bending and then pulling away the sheath 1 over the optical fibers 2 . again , because of the absence of any filling compound in the tube , 1 this can be done in one operation over the desired length . the method for manufacturing the loose tube optical waveguide fiber cable 10 is similar to buffer tube extrusion at standard secondary coating lines . for maintaining certain values of excess fiber length , the fiber payoff is equipped with a tension control device . typical values are around 0 . 5 to 2 n . the fiber passes the extruder crosshead . the extruder is typically equipped with a specially designed screw , a breaker , a crosshead and tooling for working with the flame - retardant material . a pull - off capstan or similar device is located adjacent to the first cooling section . the cable 10 is turned with at least one turn — typically two to four turns — around a required capstan . this capstan is necessary because the lack of filling compound causes the capstan to couple the fibers 2 to the tube 1 . also , the distance between crosshead and capstan affects the excess fiber length . the excess fiber length is further affected by ( i ) cooling conditions , ( ii ) the tension controlled between the capstan and the downstream pulling device , and ( iii ) the tension between the pulling device and the take - up device . examples of the materials that can be used for the protective tube are draka dhf9822 , draka dhf9761 and scapa melgolon s 550 . the above noted materials are generally composed of polymers or copolymers of polyolefins . other plastic materials such as eva , polyamides or polyphenylene ester might be suitable and can be filled with mineral fillers ( e . g ., aluminium hydroxide or magnesium hydroxide ) to give the desired level of flame retardance . typically , cables according to this invention contain additional components , such as uv stabilizers , antioxidants , color pigments , and processing additives . in the specification and the figure , typical embodiments of the invention have been disclosed . the present invention is not limited to such exemplary embodiments . specific terms have been used only in a generic and descriptive sense , and not for purposes of limitation . the scope of the invention is set forth in the following claims . | 6 |
referring to fig1 and 2 , a mobile batch plant 10 consists of a main frame 12 having a rearward wheel assembly 14 and a forward tow connector 16 . a rearward tower assembly 18 provides elevated support for a concrete bin 20 having a dust collector 22 , as well as a water surge tank 24 , waterweigh tank 26 and a cement weigh bin 28 . the structure is essentially of rectangular formation , i . e . opposite sides appear identical although reversed , and left and right designations will be used to designate duplicate components . the main frame 12 is an elongated retangular frame consisting of opposite side i - beam frames 30 - l , r and having an overall width of about eleven feet as interconnected by a plurality of transverse cross beams 32 . the forward portion of main frame 12 includes a riser formed from vertical brace 34 - l , r secured as by welding to opposite side frames 30 - l , r and as further formed into upper platform 36 in support of tow connection 16 . the upper platform 36 may be suitably formed from opposite side i - beams 38 - l , r as fortified by suitablecross members 40 . a suitable decking is provided over the top surface of upper platform 36 inorder to support the system power works . a gasoline engine 42 , on the orderof 40 to 50 horsepower , provides generator drive to produce an electrical output suitable for distribution in control of various solenoids about theapparatus 10 . power output from engine 42 also activates hydraulic and pneumatic systems as shown generally by housing 44 as these control modes are applied around the system . hydraulics are applied for variable speed control of the hydraulic motor 44of conveyor 46 and the hydraulic motor 48 of screw feeder 50 leading centrally out of the bottom of cement weigh bin 28 . hydraulic power as controlled by various levers at control station 52 ( fig1 ) is also applied in control of forward jacks 54 - l , r , rearward jacks 56 - l , r , and theopposite side hydraulic hoist cylinders 58 - l , r . the hydraulic linear actuators 58 - l , r are each a three stage telescoping cylinder having 4 , 5 and 6 inch telescoping stages ; that is , hydraulic cylinders model no . 63 - 2 - 84 as commercially available from custom hoists , inc . of haysville , ohio . the forward end of main frame 12 adjacent upper platform 36 includes an aggregate hopper 60 disposed over and functioning with conveyor 46 . hopper60 is actually divided into two separate bins 62 and 64 , e . g . for sand and course rock , as supported by upright posts 66 - l , r and 68 - l , r . actually , the bin 60 is supported on posts 66 and 68 through a plurality of load cells which allow continual weight data to be transmitted to the control system in the doghouse 70 , during decumulation of sand and / or aggregate , as will be further described . the lower release gates 70 and 72 of bin 62 and 64 are positioned adjacent the belt of conveyor 46 , a conventional type of elongated rubber belt conveyor for moving the decumulated aggregate and / or sand upward to a funnel - type collector 74 which directs entry of the various constituents downward into a cement mixer as mounted on a truck . truck access is by backing in under the collector 74 in the direction of arrow 76 to receive charge of the concrete materials . a canvas cowl 77 ( fig2 ) may be inserted into the mixer to reduce dust escape . the lower end of conveyor 46 is hung by a means of yoke members 78 - l , r to apivot flange 80 - l , r as secured rigidly to opposite side rails 30 - l , r . the conveyor 46 includes opposite side rails 82 - l , r with a conveyor belt supported therebetween in conventional manner , to terminate at the upper end in connection to the collector 74 . the belt is movably supported by a lower end roller 84 and an upper end roller 86 as driven by hydraulic motor 44 . a pair of support chains 88 - l , r are connected between opposite side rails 82 of conveyor 46 and the front of tower 18 , as will be furtherdescribed , and this connection functions to move the conveyor 46 in conjunction with tilt control of the tower 18 . during work operation , a suitable brace 90 as hingedly secured beneath opposite side rails 82 - l , r is fastened to the cross beam 32 of main frame 12 . the tower 18 is supported at the bottom by a quadrature array of rearward support posts 92 - l , r and forward support posts 94 - l , r as they are secured at bottom ends to the respective opposite frame channel members 30 - l , r as by welding . as can be noted in fig2 the rearward support posts 92 - l , r are of relatively heavy construction as they are formed of an interior beam or channel member 96 with heavy steel plates 98 , 100 welded on each side . the opposite side plates 98 , 100 extend upward over the end of beam 96 to provide respective clevis connections 102 - l , r and 104 - l , r , respectively . only the parallel plates 98 , 100 are used in the forward support posts 94 - l , r to allow folding of the tower posts , as will be described . a pair of pivot plates 106 and 108 are welded to the rear support post 92 - rto pivotally retain the control station or doghouse 70 so that the doghouse70 can be swung outboard into the operative position as shown in fig2 butpivoted inward within the truck entry space for roadway transport as shown in fig3 . cross beams 110 - l , r and angle braces 112 - l , r are secured along with certain lateral angle braces 114 and gussets to provide transversal stability to the support posts . the tower assembly 18 is supported primarily by a quadrature array of towerposts consisting of rearward tower posts 116 - l , r and forward tower posts 118 - l , r and these two are stabilized by a plurality of cross beams 120 , 122 and angle braces 124 , 126 . the rearward tower posts 116 are pivotally connected into respective clevises 102 by hinge pins 126 - l , r , and the forward tower posts 118 - l , r are connected into forward clevises 104 by removable pins 128 - l , r . eye connectors 130 - l , r are welded to respective forward tower posts 118 toward the upper extremities in order to secure the upper ends of conveyor support chains 88 . the tower 18 includes the concrete bin 20 , e . g . a 275 barrel capacity bin , as welded securely atop the four tower posts 116 , 118 . the bin 20 extends a conical or pyrimidal lower portion 132 downward to terminate in a release gate 134 . the release gate 134 may be such as a solenoid operated gate valve to release cement for gravity fall downward into weigh bin 28 through entry cowl 136 . the gate 134 and entry cowl 136 are closely associated to avoid unnecessary loss of dust into the surrounds . the weighbin 28 is supported by a plurality of rods 138 and load cells 140 secured beneath the pyramidal walls 132 , and load cells 140 function to provide a weight measure signal for transmission down to the computer console withindoghouse 70 , as will be further described . the alloted cement is then movedby the hydraulically actuated screw 50 rearward for release at gate 142 downward through collector cowl 74 for direction into a waiting cement mixer truck . water tank 24 , e . g . a five hundred gallon surge tank , is secured across therear of the tower between the tower posts 116 - 1 and 116 - r . an outside source of water is hose - connected to the surge tank 24 , and a suitable form of float switch maintains an adequate water level therein . water is released from tank 24 by means of a solenoid operated valve 144 through pipe 146 into the water weigh tank 26 which is also supported by rod / load cell connectors 148 that function to transmit a water weight signal downward to the control computer . subsequent release of water from weigh tank 26 is effected by a valve conduit 150 which releases the water down through the collector cowl 74 for entry into the truck mixer assembly . the telescoping cylinders 58 - l , r are connected at an optimum angle for effecting raising and lowering of tower 18 . thus , the cylinders are connected to a corner brace 152 - l , r at a point adjacent the rear support posts 92 - l , r with the telescoping or active ends pivotally connected to a suitable connector 154 - l , r as welded to the cross beam 120 - l , r adjacent the juncture to the forward tower posts 118 - l , r . in operation , the batch plant apparatus 10 provides a mobile structure of relatively compact construction and reasonably narrow size such that it can be readily drawn by a towing vehicle over any standard - sized roads or highways . the apparatus has the additional advantages of being easily handled by a single person in set - up and take - down . fig3 illustrates theapparatus 10 in its compacted , road - ready attitude , the tow vehicle not being shown . upon arrival at the work site , and before uncoupling the tow truck , the operator energizes the engine 42 and the hydraulic and pneumatic power systems 44 whereupon operation of controls at the operatorstation 52 enables lowering of the hydraulic jacks 54 and 56 on both the left and right sides of apparatus 10 . fine adjustment leveling may be achieved with the hydraulics at control station 52 whereupon a plurality of screw jacks 156 , four on the left side and four on the right side as shown , are installed and adjusted in firm leveling support of apparatus 10 . at this point the tow truck can be uncoupled and the batch plant apparatus is ready for operation . the operator at station 52 then proceeds to energize the two telescoping cylinders 58 - l , r . fig4 shows partial elongation of the telescoping cylinders 58 as the tower assembly 18 is partially raised upward as the rearward tower posts 116 - l , r revolve around hinge pins 126 - l , r on the upper end of rearward support posts 92 - l , r . the forward tower posts 118 - l , r being disposed between respective plate pairs 98 , 100 , forming forward support posts 94 - l , r , merely slide through as tower assembly 18 progresses upward . when the tower assembly 18 approaches an angle of about 60 ° relativeto the ground plane , the conveyor chains 88 become taut and commence lifting of conveyor 46 as tower assembly 18 proceeds toward its upright , locking position . when the upright position is achieved , the bottom hole in the forward tower post 118 - l , r come into alignment with the clevis connection 104 - l , r of the forward support posts 94 - l , r and the respective removable keypins 128 - l , r are inserted to lock the tower assembly 18 into operative position . also , conveyor chains 88 have lifted conveyor 46 into operative position and the leg brace 90 can be released from its stowed , upward position and dropped down for pin engagement on a cross member 32 of main frame 12 thereby to provide reliable support during operation of the batching plant apparatus 10 . the doghouse 70 may then be swung from its stowed , inboard position ( fig3 ) towards the rear and around to an outboard position on the right hand side ( fig2 ) and the system is ready for functional operation . dry concrete is blown in by conventional means through a tube or pipe leading up to concrete bin 20 , and an outside source of water is connected to the water tank 24 . sand , coarse rock and the like is then input to the forwardbins 62 and 64 by means of front end loader or auxiliary conveyor system and the apparatus 10 is ready for batching of concrete mix . the doghouse 70 includes all controls and a central computer for operating the batch plant apparatus 10 . the particular type of control system and computer is a type that is commercially available from weigh systems , inc . of elgin , tex . the control system functions to proportion amounts of cementmix , aggregate ( or sand ) and water for release through collector cowl 74 downward into the mixer of a waiting mixer truck , as backed into the rear of the tower in the direction of arrow 76 . the computer controls are capable of proportioning concrete mix in accordance with desired slump andconsistency in any size batch up to a considerable number of yards , e . g . the capacity of the conventional truck mixer . water in the water tank 24 is continually maintained by means of a suitable float valve controlling input from an outside source , and concrete mix and aggregate materials aresupplied as needed to the main storage hoppers and bins . break down of the equipment is as easy as set - up . all mixed materials are first removed and washed where necessary to avoid concrete hardening problems . the support leg 90 is removed and stowed in its upward position beneath conveyor 46 . the removable key pins 128 - l , r are then removed as engine 42 and the hydraulics are energized , and the operator at station 52exercises control over the multi - stage hydraulic cylinders 58 - l , r to draw hydraulic fluid therefrom and retract the telescoping sections . the tower assembly 18 then progresses downward through attitudes shown in fig4 andonce again to that of fig3 as conveyor chains 88 lower the conveyor downward into contact along main frame 12 as the entire tower assembly 18 lays horizontally thereon . finally , the doghouse 70 is swung around rearwardly and forward into the access space between rearward support posts 92 - l , r . the tow truck can then be connected with subsequent removal of screw jacks 156 and release of hydraulic jacks 54 , 56 , and when engine 42 is secured the rig is ready for road transport . the foregoing discloses a novel form of concrete batch plant apparatus of ahighly portable type that is easily handled by a single operator from transport through operational attitude and vice - versa . the apparatus is easily transformed between ( 1 ) a user friendly and road worthy apparatus or ( 2 ) a rugged batching plant that is capable of long term , heavy duty concrete batching usage at a specified location . changes may be made in combination and arrangement of elements as heretoforset forth in the specification and shown in the drawings ; it being understood that changes may be made in the embodiments disclosed without departing from the spirit and scope of the invention as defined in the following claims . | 8 |
fig1 shows the device 10 in isolation . the device has an elongate catheter body 8 with a proximal end 12 and a distal end 14 . the device 10 will be approximately 135 cm long as is customary in this field , and the device is shown in fragmentary view and is not to scale to emphasize certain features of the device 10 . the proximal end 12 includes a port 30 for fluid injection represented by fluid arrow 34 . the fluid 34 may be heated or cooled with a heater or other energy transfer device 50 . the heater embodiment supplies heat to the inflation fluid 34 that in the preferred embodiment activates the shape memory polymer surface 18 of the distal end 14 of the device . in this first embodiment the device 10 the proximal end may have a guide wire lumen port 32 for receiving a guidewire 24 . it must be understood that various techniques can be used to heat or cool the fluid to activate or deactivate the polymer surface . shape memory polymers including preferred polyurethanes are available for mitsubishi industries among others . these materials and their properties are well known and are commercially available . the distal end 14 of the device 10 shows two nested concentric balloons . the interior deployment balloon 20 communicates with the fluid inflation source through an appropriate lumen in the catheter body 8 . in general the fluid 21 when injected inflates the balloon 20 that in turn moves the walls of the exterior deployment balloon 18 into contact with the vessel walls ( see fig2 ). the space between the interior and exterior deployment balloons operates as a reservoir 23 to hold a drug or other therapy agent . the drug reservoirs may alternatively be manufactured as integral spaces within the walls of either the interior or exterior balloon . in general the maximal diameter or “ size ” of the interior balloon 20 and the exterior balloon 18 together form the “ injector ” for forcing the drug out of the reservoir 23 through a micro spine structure . the external surface of the exterior balloon 18 is preferably a thermally activated surface with a very small feature size spine structure . in the figure the spines typified by spine 36 are shown in exaggerated scale to emphasize their position and operation . fig2 shows the distal portion of the device in cross section in a vessel 40 . the spines typified by spine 36 are shown engaged with the neotintima layer 44 of the vessel 40 having passed through the thin endothelial layer of the vessel 40 . fig3 a shows one preferred construction for the micro spine structure . in this embodiment the balloon material is perforated as indicated by aperture 46 . although the aperture is aligned with the spine 36 in the figure for clarity of description it is to be appreciated that the apertures or pores in the balloon material 18 will statistically align with the many spines on the surface . each spine is formed from a shape memory plastic or polymer forming spikes or spines . the average height of the spines is expected to range from 10 to 250 microns each spine has a lumen 48 that is closed off as seen in fig3 a at a specific temperature range . fig3 b shows the thermal surface of fig3 a activated by heat 48 conducted from the inflation fluid through the reservoir 23 . each spine lumen will open allowing drug 50 to exit the reservoir and enter the tissue shown in the figure s the neointima 44 . as reported in the medical and scientific literature drugs suitable for this application have included anti cancer agents and antibiotics . in general it is expected that all of the drugs that have been delivered to coronary arteries via drug eluting stents are candidate drugs for this device . a multitude of agents such as rapamycin analogs , taxol / taxan , actinomycin d , antisense dexamethasone , angiopeptin batimistat , translast , halofuginon , nicotine , heparin , and asa have been or are currently under consideration as deliverable from the surface or from within voids in a stent wall or stent coating . much research has been conducted to determine dosage , dose delivery rate , drug action control , drug take up and time duration of delivery and desired targeting of specific cell communities within the arterial wall . treatment of and retention of drug within endothelium , intima , media , adventia as well as vasa vasorum have been investigated . the physical features of the catheter described in this invention as well as the application of forces from the balloon itself can be altered or adjusted to accommodate parametric requirements such as dosage , delivery rate and depth of treatment within the layers of the blood vessels . it must be recognized that the spines can pretreat or post - treat a stent deployment site . or alternatively the device and method can form an independent therapy . fig4 a depicts a shape memory polymer surface 49 which overlays an unperforated balloon surface 19 . when thermally activated as seen in fig4 b the micro surface expands to the “ programmed height ” h . fig5 a and fig5 b should be considered together . in this alternative embodiment of the invention the proximal end 100 of the device 102 provides for the insertion of a guide wire 104 through a guidewire port 105 and provides for inflation of a distal balloon though an inflation port 106 . the distal end 108 of the device 102 has a balloon 110 which can expand a super elastic metal web 112 that forms a set of small spikes or spines typified by spine 114 . the elastic nature of the web 112 allows the web to form a compact low profile shape seen in fig5 b when the balloon 110 is deflated . a retractable sheath 116 can be advanced of the web as seen in fig5 b to shield the vessel walls from contact with the spines during navigation to the treatment site . fig6 a shows a drug delivery embodiment with a representative spine 280 engaged in the neointima of a vessel . in this figure several spines of differing height are depicted showing drug delivery into each of the several layers of the vessel . it should be understood that the preferred devices all deliver drug therapy or injury to one presented level of tissue . the regions 220 represent sections of a stent . in this application the device is delivering a drug from reservoir 23 to aid in the stent therapy . fig6 b is an example of the use of the device set forth in fig5 a and fig5 b to treat the neointima without a drug . in this figure several spines of differing height are depicted including spines 230 240 and 250 showing drug delivery and or injury into each of the several layers of the vessel . it should be understood that the preferred devices all deliver therapy to one presented level of tissue . fig7 is a plan view of the web 112 showing the interconnections of the spines typified by spine 114 . | 0 |
it will be readily understood that the components of the present invention , as generally described and illustrated in the figures herein , could be arranged and designed in a wide variety of different configurations . thus , the following more detailed description of the embodiments of the invention , as represented in the figures , is not intended to limit the scope of the invention , as claimed , but is merely representative of certain examples of presently contemplated embodiments in accordance with the invention . the presently described embodiments will be best understood by reference to the drawings , wherein like parts may be designated by like numerals throughout . referring to fig1 , in general , a solid oxide electrolyzer cell 100 ( which may also , in selected embodiments , function as a fuel cell 100 when the current direction is reversed ) may include an anode 102 , a cathode 104 , and an electrolyte layer 106 . each of the layers 102 , 104 , 106 may , in selected embodiments , be composed of solid - state ceramic materials . in general , the anode 102 and cathode 104 may be composed of a material that is both electronically and ionically conductive . the electrolyte , on the other hand , may be composed of a material that is ionically conductive but electronically insulating . thus , electrons flowing between the anode 102 and cathode 104 may need to flow through an external path 108 or circuit 108 in order to bypass the electrolyte 106 . the electrolyte layer 106 may be composed of one or more known ionically - conductive but electrically - insulating ceramic materials such as , for example , yttria stabilized zirconia ( ysz ), scandium stabilized zirconia ( scsz ), or lanthanum strontium gallate magnesite ( ls gm ). when operating in electrolysis mode , oxygen - containing molecules , such as h 2 o or co 2 , may be received at the cathode 104 , where they may react to generate a fuel , such as h 2 , co , or a mixture thereof . electrons flowing from an external power source 110 may be consumed by this reaction . similarly , negatively charged oxygen ions may be liberated by this reaction . these oxygen ions may be conducted through the electrolyte layer 106 to the anode 102 , where they may react to form oxygen molecules . the reaction at the anode 102 may release electrons , which may in turn flow through the pathway 108 or circuit 108 . as mentioned , electrodes that perform well in fuel cell mode typically do not perform as well in electrolysis mode , and vice versa . for example , electrodes used in many fuel cells exhibit unacceptably high polarization losses when operated in electrolysis mode . this reduces the desirability of using the cell in electrolysis mode because it is inefficient and may not be competitive with other means of producing hydrogen ( or carbon monoxide ). thus , it would be desirable to provide electrodes that perform equally well in both fuel cell and electrolysis modes . for example , as illustrated in fig2 a , in fuel cell mode , the voltage across a typical fuel cell will drop as current conducted through the fuel cell increases . this may be observed from the downward slope of the trace 200 , which is an indicator of the cell &# 39 ; s internal resistance , or polarization . when operated in electrolysis mode , however , a disproportionately larger voltage is needed to produce a roughly equal increase in current through the cell . this may be observed from the steeper slope of the trace 202 , which is indicative of the higher resistance , or polarization , of many conventional fuel cells when operated in electrolysis mode . ideally , the resistance of the cell ( and thus the slope of the traces 200 , 202 ) is minimized in both fuel cell and electrolysis modes , with the resistance in electrolysis mode ideally being roughly equivalent to the resistance in fuel cell mode . thus , the slope of the trace 202 in electrolysis mode will ideally be roughly equal to the slope of the trace 200 in fuel cell mode , as indicated by the dotted line 204 , with each slope being minimized as much as possible . referring to fig2 b , determining whether electrodes 102 , 104 behave in a manner consistent with the ideal slope 204 illustrated in fig2 a may be challenging because the resistance of a cell may vary with temperature . this problem may be compounded by the fact that conversion of h 2 and / or co to h 2 o and / or co 2 ( fuel cell mode ) is exothermic , whereas conversion of h 2 o and / or co 2 to h 2 and / or co ( electrolysis mode ) is endothermic . thus , the fuel cell reaction generates heat whereas the electrolysis reaction absorbs heat , as represented by the linear curve 206 . on the other hand , heat generated by resistive losses ( i . e ., i 2 r ) due to the flow of current may be roughly equal for current flowing in either direction through the cell , as represented by the curve 208 . the two curves 206 , 208 may be added together to provide a resultant curve 210 . as shown by the resultant curve 210 , a cell operating in electrolysis mode will initially cool but then begin to heat up once the heat from resistive losses is greater than the heat absorbed by the reaction . this concept becomes important when interpreting the test data illustrated in fig5 . referring again to fig1 , in selected embodiments , an electrolyzer cell 100 that operates with substantially equal efficiency in both fuel cell mode and electrolyzer mode may include an anode 102 containing an electron - conducting phase intermingled with an ion - conducting phase . the electron - conducting phase may include a perovskite generally represented by the chemical formula abo 3 , wherein “ a ” and “ b ” represent a - and b - side cations . the a - side cations may be represented generally by the formula ( pr ( 1 - x ) la x ) ( z - y ) a ′ y , wherein 0 ≦ x ≦ 0 . 5 , 0 ≦ y ≦ 0 . 5 , and 0 . 8 ≦ z ≦ 1 . 1 , and a ′ represents one or more alkaline earth metals , such as calcium and strontium . the alkaline earth metals may create defects in the crystalline structure of the perovskite to improve its electronic conductivity . the b - side cations may include one or more transition metals , such as manganese , cobalt , iron , or combinations thereof . the ∂ may refer to the oxygen non - stoichiometry which may depend on the crystalline chemistry and electro - neutrality conditions . suitable materials for the electron - conducting phase may be represented generally by the formula ( pr ( 1 - x ) la x ) ( z - y ) a ′ y bo ( 3 -∂) and may include , for example , ( pr ( 1 - x ) la x ) ( z - y ) sr y mno ( 3 -∂) , ( pr ( 1 - x ) la x ) ( z - y ) sr y feo ( 3 -∂) , and ( pr ( 1 - x ) la x ) ( z - y ) sr y coo ( 3 -∂) . the ion - conducting phase may include one or more oxides . for example , the ion - conducting phase may include zirconia doped with one or more of yttrium oxide , ytterbium oxide , calcium oxide , magnesium oxide , scandium oxide , cerium oxide , or the like . in other embodiments , the ion - conducting phase may include ceria by itself or doped with one or more of yttrium oxide , ytterbium oxide , calcium oxide , magnesium oxide , scandium oxide , zirconium oxide , or the like . one advantage of ceria is that it is both electronically and ionically conductive , with much better ionic conductivity than zirconia . the enhanced ionic conductivity is at least partly due to the fact that oxygen is less firmly attached to the ceria molecule than it is with zirconia , providing improved oxygen conductivity and better electrochemical performance . as shown by the chemical formula above , the molar concentration of praseodymium ( pr ) may equal , exceed , or completely replace lanthanum ( la ), a common material in conventional electrodes . lanthanum and zirconia are known to react to form the insulating product lanthanum zirconate , which may accumulate between the ion and electron - conducting phases and increase the resistance of the electrode over time . to reduce this problem , praseodymium , an element which does not react with zirconia , may be used to replace all or part of the lanthanum . in selected embodiments , the anode 102 may also be infiltrated with an electrocatalyst such as praseodymium , cobalt , cerium , europium , or other rare earth elements or combinations thereof . the anode 102 may be fabricated to have a desired porosity , such as , for example , between about ten and twenty percent porosity by volume . these pores may be infiltrated with the electrocatalyst to increase the catalytic activity of the anode 102 . in certain embodiments , the anode 102 may be infiltrated with the electrocatalyst by saturating the anode 102 with an electrocatalyst - containing solution . for example , nanoparticles of praseodymium cobalt nitrate suspended in solution may be used to saturate the pores of the anode 102 . the nitrate may then be burned off to leave the catalyst finely deposited on the porous surface of the anode 102 . in selected embodiments , the cathode 104 of the electrolyzer cell 100 may also include an electron - conducting phase intermingled with an ion - conducting phase . the electron - conducting phase may , in selected embodiments , include a solid solution of nickel oxide and magnesium oxide . in selected embodiments , the molar ratio of nickel oxide to magnesium oxide is greater than or equal to three . upon operating the electrolyzer cell 100 , the nickel oxide may be reduced to nickel in the presence of a reducing gas , such as hydrogen , to provide the electronically conducting phase . the magnesium oxide , on the other hand , will remain in oxide form because it is a more stable oxide . this magnesium oxide will remain finely dispersed through the nickel . the magnesium oxide improves the performance of the cathode 104 by reducing the tendency of the nickel to coarsen over time as it is subjected to high temperatures . otherwise , very fine particles of nickel will tend to sinter and grow together when subjected to high temperatures . this reduces electrochemical performance at least partly because it reduces the surface area of the nickel . in some cases , the courser nickel particles may pull apart from adjacent particles and lose conductivity therewith . the distribution of magnesium oxide particles through the nickel tends to reduce or at least slow down the coarsening of the nickel , thereby improving electrochemical performance . the ion - conducting phase of the cathode 104 may also include one or more oxides , such as oxides of zirconia , ceria , or mixtures thereof . for example , the ion - conducting phase may include zirconia doped with one or more of yttrium oxide , ytterbium oxide , calcium oxide , magnesium oxide , scandium oxide , or the like . in other embodiments , the ion - conducting phase may include ceria doped with one or more of samarium oxide , gadolinium oxide , yttrium oxide , ytterbium oxide , calcium oxide , magnesium oxide , scandium oxide , or the like . as mentioned above , ceria may provide better electronic and ionic conductivity than zirconia . the enhanced ionic conductivity and oxygen availability of ceria may be used to further improve the electrochemical performance . like the anode 102 , the cathode 104 may also be infiltrated with an electrocatalyst such as praseodymium , cobalt , cerium , europium , other rare earth elements , or combinations thereof . this electrocatalyst provides additional activation energy to break the bonds of h 2 o and co 2 molecules supplied to the cathode 104 , further improving electrochemical performance . one notable characteristic of the anode and cathode materials described above is that they exhibit significantly improved performance when electrolyzing co 2 to generate co . with many conventional electrode materials , it has been observed that the kinetics of the co 2 to co electrolysis reaction are far worse than the kinetics of the h 2 o to h 2 reaction . stated otherwise , conventional electrodes exhibit far greater inherent resistance when converting co 2 to co than they do when converting h 2 o to h 2 . consequently , a good indicator of the overall performance of electrodes is how well they will convert co 2 to co . it has been noted that the electrodes 102 , 104 described herein exhibit significantly improved electrocatalytic performance for the co 2 to co reaction when compared to historical electrode materials . it should be recognized that various different processes and techniques may be used to fabricate the electrolyzer cell 100 and electrodes discussed herein . for example , the electrode materials discussed herein may be used to produce an ink which may be screen printed on the electrolyte layer 106 . in other embodiments , the electrodes may be sprayed or tape cast , laminated , and sintered onto the electrolyte layer 106 . thus , electrodes in accordance with the invention are not limited any one method of fabrication , but rather encompass all processes and techniques used to fabricate electrodes 102 , 104 which incorporate the novel materials disclosed herein . the following paragraphs provide one non - limiting example of a process for producing an electrolyzer cell 100 in accordance with the invention . the material for the anode 102 was produced by initially synthesizing a perovskite composition having a formula of approximately pr 0 . 8 sr 0 . 2 mno ( 3 -∂) . this composition was synthesized using a liquid nitrate mix process . to produce this composition , stoichiometric proportions of constituent nitrates were mixed and charred over a hot plate at about 150 ° c . the resulting char was then mixed and calcined at approximately 1000 ° c . to form a perovskite crystalline phase . the synthesized perovskite powder was then milled in a container with partially stabilized zirconia media to reduce it to appropriate particle size distribution and specific surface area suitable for making screen - printable ink . an ink was then produced using a commercial organic vehicle ( heraeus v - 006 ) and terpineol . the material for the cathode 104 was also synthesized using a liquid nitrate mix process . specifically , a mixture of nitrates of nickel , magnesium , cerium , and calcium powders were combined such that the ni : mg molar ratio was about 90 : 10 . the final mixture contained about fifty to seventy percent by weight ni ( mg ) o ( solid solution of nickel oxide and magnesium oxide ) with the remainder being ce ( ca ) o ( 2 -∂) ( ceria doped with calcium oxide ). this mixture was then calcined at about 1000 ° c . and milled to achieve a desired particle size distribution and specific surface area . an ink was then produced using a process similar to that used for the anode 102 . a batch of scandium - doped zirconia ( daiichi , japan ) was tape cast and sintered to provide electrolyte sheets of about 0 . 18 to 0 . 20 millimeters thick . the anode and cathode inks were then screen printed on opposite sides of the electrolyte sheet and sintered at about 1300 ° c . in some cases , the cathode ink was first printed and sintered at about 1400 ° c . the anode ink was then printed and sintered at a temperature between about 1250 ° c . and 1300 ° c . the above - described process was used to create two different sizes of electrolyzer cells . the first size included button cells containing an electrolyte layer with a diameter of about forty millimeters . the button cells were used primarily for electrode characterization . the second size included square cells measuring about ten centimeters along each edge . the square cells were used primarily for stack evaluation . platinum mesh was attached to the electrodes of the button cells for current collection . a layer of scandium - doped lanthanum cobaltite ink was printed on the anode 102 and nickel ink was printed on the cathode 104 to provide current collection for the square cells . a stainless steel layer with gas flow passages and cell - to - cell interconnects were then placed in contact with the anode 102 and cathode 104 of the square cells . prior to testing the button cells and stacks of square cells , the anodes 102 and cathodes 104 were treated and infiltrated with a catalyst material . this was accomplished by saturating the porous electrodes 102 , 104 with a praseodymium cobalt nitrate solution . the molar ratio of praseodymium to cobalt in the solution was approximately one to one . the button cells and stacks of square cells were then heated for testing . in some cases , multiple infiltrations were conducted on the electrodes 102 , 104 along with heat treatments at various intermediate temperatures at or around 600 ° c . fig3 and 4 show the performance of the button cells when operated in fuel cell and electrolysis modes . fig5 and 6 show the performance of the square cells in twenty - five cell stacks when operated in fuel cell and electrolysis modes . referring to fig3 , as shown by the graph , the button cell exhibited an area specific resistance ( asr ) of approximately 0 . 5 ohm - cm 2 in both fuel cell and electrolysis modes , showing the button cell performed equally well in either mode . this resistance was measured while feeding the button cell a mixture containing approximately fifty percent steam and fifty percent hydrogen at an operating temperature of around 800 ° c . the button cell &# 39 ; s small size and environment allowed it to either absorb heat from or radiate heat to its surroundings . thus , the button cell was substantially isothermal at a temperature of around 800 ° c . while operating in both fuel cell and electrolysis modes . referring to fig4 , the long term performance of the button cell was observed over approximately 600 hours of operation . during that period , the button cell was switched between fuel cell and electrolysis modes of operation . as shown by the relationship between cell voltage and current density in both fuel cell and electrolysis modes , the asr of the cell remained reasonably stable during the approximately 600 hours of operation . referring to fig5 , as shown by the graph , a stack of twenty - five square cells exhibited an asr of approximately 1 . 04 ohm - cm 2 in fuel cell mode and an asr of approximately 1 . 3 ohm - cm 2 in electrolysis mode . in electrolysis mode , the stack had a core temperature of approximately 816 ° c . with steam utilization of approximately 49 . 4 percent . in fuel cell mode , the stack had a core temperature of approximately 896 ° c . with hydrogen utilization of approximately 72 . 4 percent . the ratio of hydrogen to steam was approximately 3 : 4 . the higher asr of the cell stack compared to the button cell , as demonstrated by fig3 , may be attributed to the longer current path and additional components ( e . g ., interconnects , etc .) that are used to implement the cell stack architecture . furthermore , the variation in the asr of the cell stack in fuel cell and electrolysis modes may be attributed primarily to the difference in core operating temperature for each mode , as was described in association with fig2 b . that is , the approximately 80 ° c . difference in the stack core temperature in fuel cell and electrolysis modes causes a significant difference in the measured asr . thus , the button cell , as described in association with fig3 , may provide a better picture of actual electrode performance since the cell was substantially isothermal in both fuel cell and electrolysis modes . referring to fig6 , the long term performance of the cell stack was observed over approximately 400 hours of operation . during that period , the cell stack was operated in electrolysis mode . as shown by the relationship between the cell stack voltage and current , the asr of the cell stack remained reasonably stable during the approximately 400 hours of operation . the cell stack voltage was also monitored and measured for the high and low groups of five cells , as indicated by the lower data points of the graph . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope . | 7 |
the following embodiments and aspects thereof are described and illustrated in conjunction with systems , apparatuses and methods which are meant to be illustrative , not limiting in scope . fig1 illustrates an example lto tape cartridge 10 and fig2 illustrates example lto tape drive housing 200 with the cartridge 10 of fig1 inserted . cartridge 10 is inserted into drive 200 in a direction specified by arrow 12 . cartridge 10 also includes grip lines 14 for easy handling . additionally , cartridge 10 includes various lock depressions 18 ( also repeated on the opposite side ) that mate with a male counterpart , in drive 200 , to ensure a snug fit after cartridge 10 is inserted into drive 200 . drive 200 includes an eject button 202 and various indicators 204 . the drive 200 may be designed to fit into a half - high 5 . 25 inch form factor for installation into a bay of a desktop or server box . of course , other implementations are possible . for example , the drive 200 may be a stand - alone unit , such as a desktop drive that is external from a host computing system . fig3 is a top - down view of the cartridge 10 inserted into the tape drive 200 which includes a magnetic head adjustment system that incorporates aspects of the claimed embodiments . a full description of the various components of drive 200 is intentionally not included in order to not unnecessarily obscure the claimed embodiments . however , some of the major components include a take - up hub 300 , various tape - threading roller guides ( 302 , 306 ), magnetic head 304 and head flex circuits ( 310 , 312 ). drive 200 will also typically contain one or more processors , a memory and a controller . one possible implementation of the invention is detailed in reference to fig4 - 9 which show various views of an actuator assembly that includes a magnetic head adjustment system and related parts thereof . actuator assembly 400 primarily includes a top plate 402 , a bottom plate 404 , a pair of ball - ended guide rods ( 406 , 408 ). in between the top plate 402 and the bottom plate 404 is a base structure 410 , a retaining cap 412 and a magnetic head assembly 414 which includes the magnetic head 304 . as the name suggests , the ball - ended guide rods ( 406 , 408 ) have ends ( 406 a , 406 b , 408 a , 408 b / refer to fig9 to view 406 b and 408 b ) that are ball - shaped . each of the ends ( 206 a , 406 b , 408 a , 408 b / refer to fig9 to view 408 a and 408 b ) mates with a corresponding socket ( 402 a , 402 b , 404 a , 404 b ) on the top or bottom plate ( 406 , 408 ). the claimed embodiments can also utilize other shapes for the ball - ended guide rods ( 406 , 408 ) such as a slightly oval shape or a slightly elliptical shape . azimuth and zenith adjustment is provided for via adjustment screws . specifically , zenith adjustment screw 416 ( see fig8 ) provides for the zenith adjustment ( in and out from the tape travel path ) and azimuth adjust screws ( 418 , 420 ) provide for the azimuth adjustment ( parallel to the tape travel path ). when a desired azimuth and a desired zenith are achieved , zenith clamp screws ( 421 , 422 ) and guide rod clamp screws ( 424 , 426 ) are tightened . once the zenith clamps screws ( 420 , 422 ) are tightened , additional movement of the magnetic head into and out of the tape travel path is inhibited . tightening of the guide rod clamp screws ( 424 , 426 ) also inhibit zenith movement and further inhibits movement of the magnetic head in the azimuth / parallel to the tape travel path . additional screws ( not shown ) are also utilized at 436 and 438 to secure the ends ( 406 b , 408 b ) to the baseplate 404 . adjustment of the azimuth and the zenith is possible since the top plate 402 is movable , to a degree , due to the ball - shaped ends ( 406 a , 408 a ) that are mated with the corresponding sockets ( 402 a , 402 b ) in the top plate 402 . for example , as the zenith of the magnetic head 304 is adjusted via the azimuth adjust screw ( 416 ), top plate 402 and the guide rods ( 406 , 408 ) will also move . the magnetic head assembly 414 is slidably coupled to the guide rods ( 406 , 408 ). as a result , the magnetic head assembly 414 , and the magnetic head 304 , will also move when the zenith adjust screw 416 is adjusted . in a similar manner , the magnetic head 304 will also move when the azimuth adjust screws ( 418 , 420 ) are adjusted . referring to fig5 which is an isometric view of the top plate 402 , the top plate 402 is configured with flexures ( 430 , 432 ) in a four - bar linkage pattern . this flexure configuration allows for precise azimuth adjustment of the magnetic head 304 while maintaining a high degree of stiffness in the vertical direction . the four bars of the four bar linkage pattern include the flexures ( 430 , 432 ), a front portion 428 of the top plate 402 and a back portion 434 of the top plate 402 . the four - bar linkage pattern provides the top plate 402 with the property of being able to apply a force to one corner of the top plate 402 and opposing sides of the top plate 402 will remain parallel to each other . while opposite sides of the top plate remain parallel , adjacent sides will no longer be perpendicular to each other . when screws 418 and 420 ( refer to fig4 ) are tightened , the flexures ( 430 , 432 ) will deform . however , front portion 428 , which corresponds generally to the location of ends 406 a and 408 a , will remain parallel to its original location before the screws ( 418 , 420 ) were tightened . due to this , front portion 428 will not become skewed at an odd angle which would translate to the magnetic head 304 also being skewed at an odd angle . since the flexures ( 430 , 432 ) are made from the top plate 402 , a reduction of parts is achieved as prior art magnetic head adjustment systems will typically include flexures as discrete parts . the reduction of parts is additionally advantageous in that it contributes to a space savings in a tape drive enclosure . the claimed embodiments also have other advantages . one advantage is that adjusting the azimuth will not affect the zenith . similarly , adjusting the zenith will not affect the azimuth . adjustment of the zenith and azimuth is mutually perpendicular . due to this , there is no interaction between the zenith and azimuth . another advantage is that the top plate 402 will generally not move up or down when the zenith or azimuth is adjusted . due to this feature , a tape drive design does not need to allow for extra room above the top plate 402 to allow it to move in the vertical direction during zenith and azimuth adjustments . for completeness , the next sections describe various parts depicted in the figures that work in conjunction with the claimed embodiments . referring to fig8 , stepper motor terminals 440 provide a power inlet for stepper motor 442 . stepper motor 442 rotates threaded barrel 444 which in turn drives gear 446 . gear 446 in cooperation with other parts that are not shown in the figures move the magnetic head assembly 414 along the guide rods ( 406 , 408 ). the stepper motor 442 , threaded barrel 444 , gear 446 , retaining cap 412 , base structure 410 , retaining cap 412 and the guide rods ( 406 , 408 ) form what is known as a coarse positioning structure . cover / clamping plate 454 ( refer to fig9 ) holds the stepper motor 442 in place . gear teeth 450 works in conjunction with structure 452 to rotate the entire actuator assembly 400 to equalize a tape wrap angle . structure 452 is utilized to pivotally attach baseplate 404 to part of a tape drive and gear teeth 450 are engaged by a gear that is not shown in the figures . the tape wrap angle is the angle between the plane of the tape , as it approaches or leaves the magnetic head 304 , and tape guiding surfaces on the head . referring to fig4 , 6 and 8 - 9 , it can be seen that the base structure fully surrounds guide rod 408 while guide rod 406 is only partially enclosed . this is done so that the alignment of the moving section of the coarse positioner structure is controlled only by guide rod 408 as the base structure 410 wraps tightly around the guide rod 408 . the guide rod 406 provides a stop for the moving section , of the coarse positioning structure , to keep it from rotating . what is not shown is a small spring - loaded flap which rides on the guide rod 406 to keep the coarse positioning structure pressing lightly on the guide rod 406 . while a number of exemplary aspects and embodiments have been discussed above , those of skill in the art will recognize certain modifications , permutations , additions and sub - combinations thereof . it is therefore intended that the following appended claims and claims hereafter introduced are interpreted to include all such modifications , permutations , additions and sub - combinations as are within their true spirit and scope . | 6 |
generally , the present invention provides a method and apparatus for reduced noise band switching circuits . turning to fig1 , a schematic diagram of a prior art voltage - controlled oscillator ( vco ) is shown . the vco 10 comprises a bias control 12 which is connected to an amplifier bias 14 and a tank bias 16 . a voltage source 18 and a digital control 20 , along with the amplifier bias 14 and tank bias 16 , are connected to a vco core 22 . the vco core 22 comprises an amplifier 24 , and a tank 26 . the outputs from the amplifier 24 and the tank 26 are transmitted as an output voltage 28 . fig2 provides a graph 30 of the output voltage 28 with respect to the frequency at which the vco 10 is operating . turning now to fig3 , apparatus for a reduced noise band switching circuit is shown . the apparatus is directed at a vco for signal generation in wireless radio frequency ( rf ) applications . the apparatus , or vco , 50 comprises a bias control 52 connected to an amplifier bias 54 and a tank bias 56 . the two biases 54 and 56 are connected , along with a voltage source 58 which has been attenuated by attenuator 60 , to a vco core 62 . the vco core 62 comprises an amplifier , or amplifier circuit 64 and a tank , or tank circuit 66 and has its output connected to a phase locked loop ( pll ) 68 which is connected to the input of the voltage source 58 . within the vco core 62 , the amplifier circuit 64 is coupled to the tank circuit 66 with the amplifier circuit 64 being biased by the amplifier bias 54 and the tank circuit 66 being biased by the tank bias 56 . in operation , the voltage source 58 generates an input voltage for the tank circuit 66 of the vco core 62 . simultaneously , the bias control 12 transmits a first set of control signals to the amplifier bias 54 and a second set of control signal to the tank bias 56 . after the input voltage has been generated , it is transmitted to the attenuator 60 before being transmitted to the tank circuit 66 . while the input voltage is being attenuated , the amplifier bias 54 and the tank bias 56 control operation of the amplifier circuit 64 and the tank circuit 66 by providing a noiseless bias voltage as will be described below . the combination of the attenuated input voltage and the noiseless biasing voltage results in an output which is also noiseless which results in a cleaner output signal . an example of the output is shown in fig4 which shows the result of attenuation on the output frequency ( f out ) in relation to the output voltage ( v out ). with attenuation , the slope of f out versus source voltage , or k vco , decreases so that for any change in source voltage , there is a small change in f out . a lower k vco , results in a reduction in phase noise as shown in the following equation : phase noise = α 2 v 2 ( k vco f ) 2 therefore , the attenuation of the input voltage provides a reduced noise signal to the tank circuit , further allowing the output of the vco core to be reduced in noise . turning to fig5 , a first embodiment of the attenuator 60 is shown which is in the form of a capacitance voltage divider . the attenuator 60 comprises a first capacitor 70 , also designated as c 1 in the equation below , connected in series with a second capacitor 72 , designated as c 2 in the equation below , to ground 74 . the attenuator 60 also includes a switch 71 . the first capacitor 70 receives its input ( v in ) from the voltage source 58 and an output ( v out ) 80 of the attenuator 60 goes to the tank circuit 66 in the vco core 62 . the output 80 of the attenuator 60 is between the first and second capacitors 70 and 72 . the capacitance voltage divider attenuates the input voltage as : when an input voltage is delivered , the phase lock loop 68 start operating and the switch 71 is closed ( in the on state ) to create a path to charge the second capacitor 72 to the value of the input voltage ( v in ). after the phase lock loop 68 has been able to lock , the capacitance voltage divider is seen as in a enabled state and therefore only a small loop gain is experienced at point a which also allows for the noise of the voltage signal to be reduced which , in turn , results in small variations in frequency due to noise . this is because the dc portion of the input voltage is relatively constant and the ac portion of the input voltage has been attenuated which causes the noise from the input voltage to also attenuate which , in turn , reduces the frequency variation due to noise . the output 80 of the attenuator is connected to the tank circuit and acts as a tuning , or control , voltage for the tank circuit 66 . the output of the attenuator is connected between a pair of varactors 108 as shown in fig9 . fig6 shows an alternate embodiment of the attenuator 60 . in this embodiment , the attenuator 60 is similar to the embodiment of fig5 with the addition of a diode 80 . the diode 80 is preferably forward biased . furthermore , an output 81 of the attenuator 60 is also fed back via a switch 79 to the input , v in , of the attenuator in a negative phase lock loop 83 . the feedback loops allows for correction of any variation in the input voltage to pull v out back to a desired voltage . any loss in charge due to the leakage path resistance ( the path provider by the resistor 78 ) is also corrected by the feedback loop 83 and the diode 80 . when an input voltage is delivered , the switch 79 is closed ( in the on state ) to create a path to charge the second capacitor 72 to the value of the input voltage ( v in ). after the second capacitor 72 reaches the value of vin , the capacitance voltage divider is seen as in a enabled state and therefore only a small loop gain is experienced at point a which also allows for small variations in frequency due to noise . fig6 a shows a comparison of v out and input voltage v i n over time . with the negative feedback loop 83 , when v in fluctuates to 5v , v out increases to 2 . 5 volts as determined by the capacitance divider equation , v out is then fed back to , which corrects the voltage source pulling v in back down to 1v . fig7 shows a further embodiment of the attenuator 60 . in this embodiment , the attenuator 60 comprises a double capacitance voltage divider . the attenuator 60 receives its input ( v in ) from the voltage source 58 and comprises a first capacitor 82 connected in series to a second capacitor 84 and ground 86 . the first capacitor 82 is also connected to ground 86 via a third capacitor 88 and a fourth capacitor 90 which are connected in series . the third and fourth capacitors 88 and 90 are parallel to the second capacitor 84 . the capacitors 82 , 84 , 88 and 90 are connected in parallel with a forward biasing diode 92 . as further shown in the figure , a first capacitance voltage divider is divided by a second capacitance voltage divider such the first 82 and second 84 capacitors are divided by the third and fourth capacitors 88 and 90 . the first 82 and third 88 capacitors are in parallel with the forward biased diode 92 . the attenuator 60 also comprises a pair of switches 94 and 96 which are used to assist in the charging of the capacitors during the initial period when the phase lock loop 68 is attempting to lock . the output voltage v out is attenuated by the equation shown below : where α = ( c 1 c 1 + c 2 ) ( c 3 c 3 + c 4 ) the attenuated output of the attenuator allows for a less noisy input voltage to the tank circuit 66 than if the voltage source 58 was connected directly to the tank circuit 66 since the double capacitance voltage divider lowers the value of a which in turn lowers the phase noise of the circuit . turning to fig8 , a schematic diagram of part of the vco 50 is shown . the bias control 52 is connected to the amplifier bias 54 which is connected to the amplifier circuit 64 of the vco core 62 . operation and the contents of the amplifier circuit 64 will be well known to one skilled in the art . the amplifier bias 54 comprises a pair of switches 100 which are controlled by the bias control 52 along with an amplifier biasing voltage source 102 . the bias control 52 also controls an amplifier biasing voltage source 102 . in order to provide a noiseless bias voltage to the amplifier circuit 64 , when the bias control 52 senses a logic high ( indicating a power up state for the vco 10 ), the first set of control signals are sent to the amplifier bias 54 and to the amplifier biasing voltage source 102 , comprising an amplifier switch control signal and a v biasampflifiercontrol signal , respectively . upon receipt of the amplifier switch control signal , the switches 100 in the amplifier bias 54 close and , upon receipt of the v biasamplifiercontrol signal , the biasing voltage source 102 starts . the amplifier biasing voltage source 102 charges across the switches 100 to provide an output voltage to the amplifier circuit 64 . after a predetermined period of time , the bias control 52 transmits a signal to the amplifier bias 54 to open the switches 100 . this occurs after the output voltage of the switches 100 has attained a predetermined value . by opening the switches 100 after the predetermined voltage has been reached , the voltage being transmitted from the switches 100 to the amplifier circuit 64 may be seen as noiseless since there is no direct connection between the amplifier biasing voltage source 102 and the amplifier circuit 64 . therefore , the vco core 62 may operate under noiseless bias conditions . a sample timing diagram is shown in fig8 a . turning to fig9 , a schematic diagram of the vco core , the tank bias circuit and the bias control is shown . the bias control 52 is connected to the tank bias 56 which is connected to the tank circuit 66 of the vco core 62 . operation and the contents of the tank circuit 64 will be well known to one skilled in the art . as with the amplifier bias , the tank bias 56 comprises a pair of switches 104 which are controlled by the bias control 52 by the second set of control signals which includes a tank switch control signal . a tank bias voltage source 106 is controlled by a v biastankcontrol control signal which is transmitted by the bias control 52 . operation of the tank bias 56 is similar to the operation of the amplifier bias 54 , as disclosed above with respect to fig8 . due to the size and costs of the parts required for the attenuators of the present invention , it will be understood that these attenuators are beneficial for use in integrated circuits . the provision of an attenuated voltage and the bias control voltage to the vco core , provides a reduced noise band switching circuit . the above - described embodiments of the invention are intended as examples only . alterations , modifications and variations may be effected to the particular embodiments by those of skill in the art without departing from the scope of the invention , which is defined solely by the claims appended hereto . | 7 |
referring now to fig1 and 2 , the reference numeral 10 generally indicates the heat sink clip assembly of this invention . the heat sink clip assembly is used in conjunction with gate array 12 having a square or rectangular housing 14 and plurality of downwardly depending leads 16 projecting from a lower surface ( not shown ) of the housing . pad 18 is formed on the upper surface 20 of housing 14 and is in thermal contact with a semicondutor device ( not shown ) contained within the housing for rapidly transferring heat exteriorly of the gate array package . finned heat sink 24 is provided for use with gate array 12 . the finned heat sink 24 includes a post 26 having one end in intimate thermal contact with pad 18 of the gate array . however , it is recognized that certain gate array designs do not incorporate a pad . therefore the finned heat sink is placed in direct contact with the upper surface of the gate array housing . a plurality of longitudinally spaced fins 28 project radially from the post and present a large collective surface area for dissipating heat from the gate array through the heat sink . frame 32 , shown in more detail in fig3 and 4 , includes cavity 34 for receiving the gate array 12 in close confinement about the side edges of the gate array housing . the frame is preferably constructed of electrically insulating material such as nytron or delrin and is easily molded or manufactured to conform to a desired shape . the frame includes shoulder 36 extending inwardly into cavity 34 so as to contact the lower surface and side edges of the gate array housing and support the gate array in a predefined position within the cavity . further , the inner edge of the cavity may include a plurality of semicircular notches 38 . each of the notches 38 is aligned with one of the outermost downwardly depending leads 16 of the gate array when the gate array is located in the cavity of the frame . the notches 38 assist in aligning the gate array housing with respect to the frame . a pair of spaced latching members 40 are formed on the perimeter of the frame . specifically , the latching members 40 are located on opposite corners of the frame and each includes an outwardly projecting tooth 42 with inclined surface 44 . if desired , the latching members may be formed on opposite sides of the frame rather than on opposite corners as illustrated . heat sink clip 50 , shown in more detail in fig5 - 7 , is provided to secure the finned heat sink 24 to the gate array 12 . the heat sink clip is constructed of resilient , preferably metallic , material and includes an elongated body 52 terminating at both ends in downwardly depending flanges 54 . each flange includes an opening 56 and an outwardly flaring lip 58 . the body includes an intermediate arcuate section 60 defining aperture 62 . the aperture has an internal diameter at least equal to the outer diameter of the post 26 of the finned heat sink 24 . tapered edges 64 lead into the aperture from one side of the heat sink clip . in assembled condition the gate array 12 is positioned in the cavity 34 of the frame 32 with the leads 16 of the gate array extending downwardly for presentation to aligned preformed holes ( not shown ) in a printed circuit board ( not shown ). as is shown in greater detail in fig8 a , the heat sink clip 50 is inserted between two fins of the finned heat sink so that post 26 is captured within aperture 62 of the arcuate section 60 of the clip . the finned heat sink is then brought downwardly in direction 66 into contact with pad 18 of the gate array housing . the flanges 54 of the heat sink clip are each aligned with one of the latching members 40 of the frame . by simultaneously deflecting the flanges of the heat sink clip downwardly as the heat sink is lowered toward the frame , the flanges 54 are each brought into engagement with one of the latching members 40 . specifically , the lips 58 of the flanges encounter the inclined surface 44 of the latching member and deflect the flanges outwardly until the openings 56 encounter the bottom of the teeth 42 . the flanges then assume a relaxed position , as shown in fig8 b , with the teeth 42 caught in openings 56 and securing the clip to the frame with the finned heat sink in intimate thermal contact with pad 18 of the gate array . preferably , the heat sink clip 50 is inserted between a pair of fins at a sufficient height above the gate array so that the clip exerts a resilient force in direction 66 on the finned heat sink urging it into intimate thermal contact with the pad . in such a position and as shown in fig2 the body of the heat sink clip assumes a bowed or concave posture . the heat sink clip assembly may be quickly and easily disassembled by disengaging the flanges 54 of the heat sink clip from the latching members 40 of the frame and withdrawing the finned heat sink from the gate array . another advantage of the heat sink clip of this invention is that the heat sink clip and frame cooperate to automatically align the finned heat sink with the gate array , thus reducing assembly time and expense while maintaining the heat sink in alignment even if the assembly is subjected to mechanical vibration or other forces . location of the latching members 40 at opposite corners of the frame is advantageous in situations where two or more gate arrays are mounted on a printed circuit board or the like in close proximity . in such a case the distance between the frames of adjacent heat sink clip assemblies may be minimized by offsetting the opposing latching members . that is , the latching members are located on opposite corners of adjacent frames so that the distances which the latching members protrude from their respective frames at least partially overlap instead of being additive . however , such an arrangement is not required for the heat sink clip assembly of this invention . an alternate embodiment 50 &# 39 ; of the heat sink clip is shown in fig5 a . the heat sink clip 50 &# 39 ; includes an elongated body 52 &# 39 ; terminating at either end in downwardly depending flanges 54 . each of the flanges includes an opening 56 and an outwardly flaring lip 58 as in the embodiment of fig5 - 7 . the body 52 &# 39 ; includes an arcuate section 60 &# 39 ; defining aperture 62 &# 39 ;. the aperture 62 &# 39 ; has an internal diameter at least equal to the outer diameter of the post 26 of the finned heat sink 24 . tapered edges 64 &# 39 ; lead into the aperture from one side of the heat sink clip . however , in this embodiment the aperture 62 &# 39 ; encompasses a greater portion ( i . e . at least 270 °) of the periphery of the post of the finned heat sink and thus more securely mounts the finned heat sink in contact with the gate array . in all other respects , this alternate embodiment is as described above with respect to the embodiment of fig5 . an alternate embodiment of the heat sink clip assembly as shown in fig9 - 13 . as in the embodiment of fig1 - 8 , the heat sink clip assembly 110 is used in conjunction with gate array 112 having a retangular housing 114 and a plurality of downwardly depending leads 116 projecting from a lower surface ( not shown ) of the housing . pad 118 is formed on upper surface 120 of the housing 114 and is in thermal contact with a semiconductor device ( not shown ) contained within the housing for rapidly transferring heat from the gate array housing . finned heat sink 124 is provided for use with gate array 112 . the finned heat sink 124 is substantially similar to finned heat sink 24 and includes a post ( not shown in fig9 and 10 ) having one end in thermal contact with pad 118 of the gate array . a plurality of longitudinally spaced fins 128 project radially from the post and present a large collective surface area for dissipating heat from the gate array through the heat sink . frame 132 , shown in more detail in fig3 and 4 , includes cavity 134 for receiving the gate array 112 in close confinement about the side edges of the gate array housing . the frame is preferably constructed of electrically insulating material such as nytron or delrin and is easily molded or manufactured to conform to a desired shape . frame 132 includes shoulder 136 extending inwardly into cavity 134 so as to contact the lower surface of the gate array housing and support the gate array in a predefined position within the cavity . further , the inner edge of the cavity may include a plurality of semicircular notches 138 . each of the notches 138 is aligned with one of the outermost downwardly depending leads 116 of the gate array when the gate array is located in the cavity of the frame . the notches 138 assist in aligning the gate array housing with respect to the frame . a pair of spaced latching members 140 is formed on the perimeter of the frame . specifically , the latching members 140 are located on opposite sides of the perimeter of the frame and each includes an outwardly projecting tooth 142 . if desired , the latching members may be formed on opposite corners of the frame rather than on opposite sides as illustrated in the embodiment of fig1 - 8 . heat sink clip 150 is provided to secure the finned heat sink 124 to the gate array 112 . the heat sink clip is constructed of resilient material and includes an elongated rod - like body 152 terminating at both ends in downwardly deflected arcuate ends 154 and 156 . the embodiment of heat sink clip assembly shown in fig9 - 13 is assembled similarly to that shown in fig1 - 8 . gate array 112 is positioned in cavity 134 of frame 132 with the leads 116 of the gate array extending downwardly for presentation to aligned preformed holes ( not shown ) in a printed circuit board ( not shown ). the heat sink clip 150 shown in fig9 and 10 is placed over the uppermost fin of the finned heat sink 124 . the finned heat sink is then urged into contact with the pad 118 ( not shown in fig1 ) of the gate array housing . the ends 154 and 156 of the heat sink clip are each aligned with one of the latching members 140 of the frame 132 . by simultaneously deflecting the ends 154 and 156 of the heat sink clip downwardly toward the frame , the ends are each brought into engagement with one of the latching members . specifically , the ends encounter the teeth 142 of the latching member . the ends then assume a position engaging the teeth and securing the clip to the frame with the finned heat sink in contact with the gate array . in an alternate embodiment 150 &# 39 ; of the heat sink clip ( shown in fig1 - 13 ), the body 152 &# 39 ; includes an arcuate section 160 . the arcuate section defines aperture 162 having an internal diameter (&# 34 ; d &# 34 ; in fig1 ) at least equal to the outer diameter of the post 126 ( shown in fig1 ) of the finned heat sink 124 . the heat sink clip 150 &# 39 ; of fig1 - 13 is inserted between two fins 128 of the finned heat sink 124 so that the post 126 is captured within aperture 162 of arcuate section 160 of the clip . preferably , the heat sink clip 150 &# 39 ; is inserted between a pair of fins at a sufficient height above the gate array so that the clip exerts a resilient downward force on the finned heat sink urging it into intimate thermal contact with the pad . fig1 shows another alternative embodiment 210 of the heat sink clip assembly of this invention . the heat sink clip of fig1 is used in conjunction with gate array 212 having a rectangular housing 214 and a plurality of downwardly depending leads ( not shown ) projecting from a lower surface of the housing . pad 218 is formed on upper surface 220 of the housing 214 and is in thermal contact with a semiconductor device ( not shown ) contained within the housing for rapidly transferring the heat from the gate array package . finned heat sink 224 is provided for use with gate array 21 . the finned heat sink 224 includes a post ( not shown ) having one end adapted for intimate thermal contact with pad 218 of the gate array . a plurality of longitudinally spaced fins 228 project radially from the post and presents a large collective surface area for dissipating heat from the gate array through the heat sink . frame 232 includes a cavity 234 for receiving the gate array 212 in close confinement about the side edges of the gate array housing . the frame includes a shoulder ( not shown ) extending inwardly into cavity 234 to contact lower surface and side edges of the gate array housing in close confinement and support the gate array in a predefined position within the cavity . further , the inner edge of the cavity may include a plurality of semicircular notches ( not shown ). each notch is aligned with one of the outermost downwardly depending leads of the gate array when the gate array is located in the cavity of the frame . the notches assist in aligning the gate array housing with respect to the frame . a pair of spaced latching members 240 ( only one of which is shown in fig1 ) is formed on the perimeter of the frame . specifically , the latching members 240 are located on opposite sides of the frame and each includes an outwardly projecting tooth 242 having an inclined surface 244 . if desired , the latching members may be formed on opposite corners of the frame rather than on opposite sides as illustrated in the embodiment of fig1 - 8 . heat sink clip 250 is provided to secure the finned heat sink 224 to the gate array 212 . the heat sink clip 250 is constructed of resilient , preferably metallic , material and includes body 252 terminating at both ends in downwardly depending flanges 254 . each flange 254 includes an opening 256 and an outwardly flaring lip 258 . aperture 262 is defined in the body 252 of the heat sink clip having a diameter greater than the outer diameter of the post of the finned heat sink 224 . four tabs 264 extend upwardly from the body of the heat sink clip opposite the flanges and each of the tabs includes an inwardly projecting tang 266 . in assembled condition the gate array 212 is positioned in the cavity 234 of the frame 232 with the leads of the gate array extending downwardly for presentation to aligned preformed holes ( not shown ) in a printed circuit board ( not shown ). the heat sink clip 250 is pressed down into frame 232 with the flanges 254 aligned with one of the latching members 240 . the flanges 254 are each brought into engagement with one of the latching members . specifically , the lips 258 of the flanges encounter the inclined surface 244 of the latching member and to deflect the flanges outwardly . the flanges then assume a relaxed position with the teeth caught in the openings and securing the heat sink to the frame with the finned heat sink in contact with the gate array . the finned heat sink is then brought down into contact with the pad 218 of the gate array housing and the fins 228 of the heat sink encounter the tabs 264 of the heat sink clip . the tabs are deflected outwardly as the heat sink is lowered into the gate array . when the heat sink is mounted on the pad of the gate array , the tabs 264 spring inwardly and return to a relaxed position with the respective tangs 266 in contact with the upper side of one of the fins . the finned heat sink is thus automatically aligned and secured against lateral or upward movement with respect to the gate array . the heat sink clip 250 simultaneously exerts a resilient downward force on the finned heat sink urging it into intimate thermal contact with the pad . the heat sink clip assembly may be quickly and easily disassembled by disengaging the ends of the heat sink clip from the latching members of the frame and withdrawing the finned heat sink from the gate array . alternatively , the finned heat sink 224 may be preassembled to the heat sink clip 250 by engagement with the tabs 264 as herein described and the sub - assembly then mounted on the frame with the post of the finned heat sink in contact with the pad 218 of the gate array 212 by engaging the flanges of the heat sink clip with the latching members 240 of the frame . although the invention has been disclosed above with regard to particular and preferred embodiments , these are advanced for illustrative purposes only and are not intended to limit the scope of this invention . for instance , although the heat sink clip assembly has been illustrated in use with a finned heat sink and gate array , the invention is applicable for use with other heat sink designs as well as other types of electronic device packages . it is to be understood , therefore , that various changes and modifications may be resorted to without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
referring now to fig1 there is illustrated a blending plant , identified in general by the reference numeral 10 , comprising a box 12 for cut ribs and stems which is usually approximately cuboidal and open at the top , the bottom of which is formed by a horizontal conveyor belt 14 so that the horizontal layers of tobacco located in the box 12 for cut ribs and stems , as indicated schematically , are transported out of the open end of the box 12 , shown on the left in fig1 and brought to a more or less vertical dispensing conveyor 22 which feeds the cut rib and stem tobacco to further processing . the box 12 receives the cut ribs and stem tobacco from above by a blending trolley 19 comprising a conveyor belt 18 mounted on rollers 26 in a horizontal frame 28 having rails so that the conveyor belt 18 may be shuttled or reciprocated horizontally in the frame 28 . arranged above the conveyor belt 18 , as viewed in the transporting direction of the tobacco , are two rim slats 30 preventing the tobacco from dropping off the side of the conveyor belt 18 . at its two longitudinal ends the frame 28 comprises further rollers 32 running on cross rails 34 so that the complete frame 28 may be shifted at right angles to the direction of movement of the blending trolley 19 and thus shuttled or reciprocated over the width of the box 12 for cut ribs and stems , as a result of which a single , relatively narrow blending trolley is able to feed the total width of the box 12 for cut ribs and stems . the blending trolley 19 is fed with cut rib and stem tobacco from above by a further conveyor belt 36 , indicated schematically in fig1 this conveyor belt being synchronized to the horizontal movement of the blending trolley 19 . for this purpose the conveyor belt 36 is , as a rule , included in the movement of the blending trolley 19 horizontally so that continuous feeding of the blending trolley 19 with cut rib and stem tobacco is assured . from the discharge end 20 of the blending trolley 19 the cut rib and stem tobacco is deposited by free fall into the box 12 for cut ribs and stems where it is stacked in layers , as indicated schematically by the zig - zag lines in fig1 and materialize from the horizontal movement of the blending trolley 19 . each layer contains a specific grade of tobacco furnished by the aforementioned synchronization of the conveyor belt 36 so that it is not until all layers are present that the desired tobacco blend materializes . the tobacco mass 16 in the box 12 for cut ribs and stems is discharged to the left as shown in the illustration of fig1 and tilts at the discharge end 12 of the conveyor belt 14 to the left to drop onto a near vertical dispensing conveyor 22 . referring now to fig2 in particular it is evident that horizontal separating webs 24 are provided in the frame 28 , these webs being formed by approximately roof - shaped sections of sheet metal and extending at right angles to the longitudinal edges of the frame 28 over the full frame opening ( see fig2 ). when the frame already exists , a ladder - type component having longitudinal edges 25 and webs 24 may be produced as a single unit which is then inserted in the frame 28 . the falling stream of tobacco continually discharged from the discharge end 20 of the blending trolley is &# 34 ; intercepted &# 34 ; by the separating webs 24 so that the stream of tobacco is deflected somewhat by these webs 24 , so that the portions of the box 12 for cut ribs and stems located vertically directly below the webs 24 are not directly fed with tobacco . by slightly shifting the tobacco horizontally as it impacts at the bottom , a compact tobacco mass 16 forms . this is less dense in the regions under the separating webs 24 , however , so that the tobacco mass 16 consists of vertical tobacco columns 16a which are separated from each other by &# 34 ; predetermined break points &# 34 ; 16b , namely regions of less tobacco density below the webs 24 . when the tobacco mass 16 is moved out of the box 12 for cut ribs and stems to the left as shown in fig1 and comes up to the discharge end 13 of the conveyor belt 14 at which the tobacco 16 is tilted to the left and then finally drops off , then the first tobacco column 16a separates at these &# 34 ; predetermined break points &# 34 ; 16b from the remainder of the tobacco mass and is deposited as a uniform homogenous portion of tobacco on the dispensing conveyor 22 containing tobaccos from all horizontal layers . referring now to fig2 it is evident that a blade 38 is applied to the blending trolley 19 below its discharge end 20 , this blade sweeping the remaining tobacco from the top edges of the separating webs 24 . this blade 38 may be formed by a sweeper plate of sheet metal , this necessitating , however , that the lower edge of the blade 38 is set highly exactly to the upper edge of the webs 24 so that a spacing of approximately 1 mm at the most exists between these two edges to ensure that the tobacco is swept off safely and reliably . as an alternative to the above arrangements the blade 38 may be formed of a deformable material which strokes the surface of the separating webs 24 to thereby sweep off the remaining tobacco . the separating webs have a spacing of approximately 30 to 60 cm from each other so that the tobacco columns 16a have a corresponding width and the associated homogenous amount of tobacco is deposited on the dispensing conveyor 22 . the separating webs 24 are roof - shaped as viewed from the side , i . e . in the form of an isosceles triangle having a horizontal open underside approximately 120 mm wide . the height of the triangle amounts to approximately 100 mm . with these dimensions the side surface areas of the separating webs 24 form an angle to each other such that the tobacco is able to slide downwards on these surface areas with no problem . | 0 |
as a preamble , it is specified that the expression “ between ” used in the rest of this description should be understood as including the limits cited . the term “ mxd ” is understood to mean meta - xylylenediamine or a mixture of meta - xylylenediamine ( mxd ) and of para - xylylenediamine ( pxd ). preferentially , mxd diamine will be predominant in the mixture . this mxd and / or pxd diamine is commonly produced from resources of fossil origin . the term “ biobased ” is understood within the meaning of standard astm d68652 , and more preferentially within the meaning of standard astm d6866 , as indicated above . the term “ conditioning ” is intended to mean residence of the material for 15 days at 23 ° c . at a relative humidity of 50 %. the term “ reinforcement ” is intended to mean short or long fibers , woven or nonwoven continuous fibers , a woven or nonwoven mat , or else ground materials , flours , which allow the tensile modulus to be increased when they are combined with polymeric matrices . the composition according to the invention comprises at least one polyamide , said polyamide having at least one mxd entity . according to a first variant of the invention , this polyamide is a homopolyamide which corresponds to the formula mxd . z , the mxd entity being as defined above and the z entity being an aliphatic , cycloaliphatic or aromatic , c 4 - c 36 dicarboxylic acid . according to a second variant of the invention , this polyamide is a copolyamide corresponding to the formula a / mxd . z , in which : the mxd entity is as defined above , the z entity is an aliphatic , cycloaliphatic or aromatic , c 4 - c 36 dicarboxylic acid , and the a entity is chosen from a lactam , an α , ω - aminocarboxylic acid and the product of the reaction of an aliphatic , cycloaliphatic or aromatic , c 4 - c 36 dicarboxylic acid with an aliphatic , cycloaliphatic , arylaliphatic or aromatic , c 4 - c 36 diamine . preferably , the weight proportion of the mxd . z unit , in the copolyamide of formula a / mxd . z , represents more than 50 %, preferably more than 75 % and more preferentially more than 85 %. otherwise worded , the molar proportion of the mxd . z unit , in the copolyamide of formula a / mxd . z , represents more than 25 %, preferably more than 50 % and more preferentially more than 65 %. whether in the context of the first or the second variant of the invention , the z entity may be an aliphatic dicarboxylic acid comprising at least 6 , advantageously 7 and more preferentially 10 carbon atoms . thus , z may be an aliphatic diacid of formula hooc —( ch 2 ) y — cooh with ( y + 2 )= 4 , 6 , 7 , 8 , 9 , 10 , 12 , 14 , 16 , 18 . when a is present , it may be obtained from a lactam monomer ( in particular caprolactam or lauryllactam ), an α , ω - aminocarboxylic acid ( such as 6 - aminohexanoic acid , 10 - aminodecanoic acid , 11 - aminoundecanoic acid or else 12 - aminododecanoic acid ) or the product of reaction between a dicarboxylic acid and a diamine . saturated or unsaturated , preferably linear , aliphatic diamines chosen , for example , from butanediamine , pentanediamine , hexanediamine , heptanediamine , nonanediamine , decanediamine , undecanediamine , dodecanediamine , tridecanediamine , tetradecanediamine , hexadecanediamine , octadecanediamine , octadecenediamine , eicosanediamine , docosanediamine and diamines obtained from fatty acids , aromatic or arylaliphatic diamines , such as , for example , mxd and pxd ( para - xylylenediamine ), cycloaliphatic diamines , such as , for example , isophorone diamine , piperazine , 1 , 3 - bisaminomethylcyclohexane or bis ( methylaminocyclohexyl ) methane ( bmacm ), saturated or unsaturated , preferably linear , aliphatic diacids chosen , for example , from succinic acid , adipic acid , heptanedioic acid , azelaic acid , sebacic acid , undecanedioic acid , dodecanedioic acid , brassylic acid , tetradecanedioic acid , hexadecanedioic acid , octadecanoic acid , octadecenoic acid , eicosanedioic acid , docosanedioic acid and dimers of fatty acids containing 36 carbons , aromatic or arylaliphatic diacids , such as , for example , isophthalic acid , terephthalic acid , 2 , 6 - naphthalenedicarboxylic acid ( ndca ) or furandicarboxylic acid , cycloaliphatic diacids , such as , for example , 1 , 4 - cyclohexanedicarboxylic acid ( chda ). when the polyamide corresponds to the formula a / mxd . z , the a entity may be a lactam or an α , ω - aminocarboxylic acid comprising at least 6 , and more preferentially at least 10 , carbon atoms . advantageously , the a entity is chosen from caprolactam , lactam 12 , 11 - aminoundecanoic acid and 12 - aminododecanoic acid . in the case where the a entity is the product of condensation of a diamine with a dicarboxylic acid , said diamine is an aromatic diamine , preferably meta - xylylenediamine or a mixture of meta - xylylenediamine and of para - xylylenediamine . the choices of a and z are preferably made such that : a and / or z are of partially or totally biobased origin , the melting point of the ( co ) polyamide is less than or equal to 215 ° c . ( measured by dsc — ramp of 20 ° c ./ min — according to standard iso 11357 - 3 ( 1999 )), the tensile modulus of the ( co ) polyamide is greater than or equal to 2000 mpa ( measured according to standard iso 527 1ba on conditioned samples ). preferably , the following polyamides will be favored : mxd . z with z being suberic acid , azelaic acid , sebacic acid , dodecanedioic acid or tetradecanedioic acid . more preferably , z is sebacic acid . sebacic acid is commonly obtained from castor oil , which is obtained from the plant of the same name . a / mxd . z with a being 11 - aminoundecanoic acid or 10 - aminodecanoic acid , z being adipic acid , sebacic acid or dodecanedioic acid . more preferably , z is adipic acid and a is 11 - aminoundecanoic acid . 11 - aminoundecanoic acid is commonly obtained from castor oil , which is obtained from the plant of the same name ; a / mxd . z , with a being caprolactam or lactam 12 , z being adipic acid , sebacic acid or dodecanedioic acid . more preferably , z is adipic acid ; a / mxd . z with a being the product of condensation of a dicarboxylic acid and a diamine , z being adipic acid , sebacic acid or dodecanedioic acid . preferably , the dicarboxylic acid of a is chosen from adipic acid , sebacic acid , dodecanedioic acid , isophthalic acid and terephthalic acid . preferably , the diamine is chosen from hexamethylenediamine , decanediamine , dodecanediamine and mxd . the decanediamine is commonly obtained by amination and then hydrogenation of sebacic acid , itself commonly obtained from castor oil . when it may prove to be necessary , it is not out of the question to mix the mxd - based polyamide with another polyamide or copolyamide . thus , the composition according to the invention may also comprise at least one second polyamide , it being possible for the latter to be a homopolyamide or a copolyamide . the proportion by weight of this other polyamide or copolyamide ( relative to all the polyamides present in the composition ) is less than 50 %, preferably less than 25 %, more preferably less than 15 %. the first and / or second polyamide ( s ) of the composition may be totally or partially biobased , i . e . comprise organic carbon derived from biomass and determined according to standard astm d6866 . thus , the biobased nature of the composition as a whole is further reinforced . the biobased reinforcement of the composition according to the invention comprises at least one element chosen from plant fibers or flours , animal fibers , biobased polymers , biobased carbon fibers and biobased carbon nanotubes , the term “ biobased ” always being understood within the meaning of standard astm d6852 , and more preferentially within the meaning of standard astm d6866 . a mixture of two , or more , reinforcements of the same category or of different categories can of course be envisioned in the context of the present invention . the biobased reinforcements with which the invention is concerned may be : plant fibers or flours which comprise fibers or flours originating from the seminal hairs of seeds ( cotton , kapok ), bast fibers or flours extracted from plant stems ( flax , hemp , kenaf , jute , ramie , etc . ), hard fibers or flours extracted from leaves ( sisal , abaca , etc . ), from trunks ( manilla hemp , wood in general ), from husks of fruits ( coconut , etc . ), animal fibers which originate from hairs , such as animal fleece , and secretions such as silk , carbon fibers or carbon nanotubes derived from biobased starting materials , polymeric fibers obtained from biobased materials , ground materials from barks , peels or pips ( hazelnuts , walnuts , etc . ), from animal shells ( crabs , etc . ), from grains ( rice , etc .). preferably , the invention is concerned with plant fibers , and more particularly , flax , hemp , sisal , kenaf , abaca or jute fibers . preferentially , the biobased reinforcement , whether it consists of just one or several of the elements detailed above , represents from 5 % to 50 %, preferably from 15 % to 40 % by weight of the total weight of the composition . in one particular version of the invention , when the biobased reinforcement is made up of nanotubes of biobased origin , the weight ranges may be reduced in such a way that this reinforcement represents from 2 % to 20 % by weight of the total weight of the composition according to the invention . in one advantageous version of the invention , the biobased reinforcement is in the form of a ground material , of a flour , of a short fiber , of a long fiber , of woven continuous fibers , of nonwoven continuous fibers , or of a mat of woven or nonwoven fibers . the invention also concerns woven or nonwoven , continuous biobased fibers , and biobased tissues ( woven or nonwoven mats obtained using these fibers or combinations of these fibers ). when necessary , it is not out of the question to add non - biobased reinforcements such as carbon fibers or carbon nanotubes of fossil origin , glass fibers , etc ., in addition to the biobased reinforcement , or else fillers such as talc , chalk , mica , kaolin or montmorillonite . thus , the composition according to the invention may also comprise at least one second reinforcement which is not biobased within the meaning of standard astm d6852 , and more preferentially within the meaning of standard astm d6866 , it being possible for said second reinforcement to be a carbon fiber , carbon nanotubes or glass fibers . preferentially , the weight proportion of all the reinforcements , namely of the biobased reinforcement ( s ) and , where appropriate , of the non - biobased reinforcement ( s ), is between 5 % and 80 %, advantageously between 10 % and 70 %, preferably between 15 % and 50 %, and even more preferably between 15 % and 40 %, of the total weight of the composition . advantageously , the ( biobased reinforcement ( s ))/( non - biobased reinforcement ( s )) mass ratio is greater than 0 . 3 , preferably greater than or equal to 1 , and more particularly greater than or equal to 3 . preferably , these other non - biobased reinforcements represent less than 30 % and more particularly less than 20 % by weight of the total weight of the composition according to the invention . it is also sometimes necessary to modify the reinforcements , in particular the fibers , of the composition according to the invention by means of an appropriate treatment for improving the adhesion of these reinforcements to the matrix . thus , the biobased reinforcement and , where appropriate , the non - biobased second reinforcement may undergo a treatment aimed at improving their adhesion with respect to the polyamides , said treatment being chosen from : a chemical treatment , a precoating of the reinforcement with a polymeric coupling agent , a plasma treatment , a mechanical or thermomechanical treatment , a laser treatment , a γ - or uv - irradiation . thus , chemical treatments such as the use of aminosilanes , precoating of the fibers with a polymeric coupling agent , plasma , laser , γ - irradiation or uv - irradiation treatment , or another chemical or mechanical treatment for improving the adhesion of these reinforcements , in particular in the form of fibers , to the matrix may be considered . in certain cases , a basic treatment ( sodium hydroxide ), optionally followed by washing with water , may be used in order to eliminate certain surface compounds , thus allowing better coupling . moreover , the compositions of the present invention may also contain one or more additives , such as coupling agents , which may be polymeric , impact modifiers , processing aids , uv - stabilizers , heat - stabilizers , fire - retardants such as in particular mg ( oh ) 2 , al ( oh ) 3 and phosphinates . the coupling agents targeted herein are intended to improve the adhesion of the reinforcements to the polyamide ( s ). these additives generally represent less than 50 % by weight , preferably less than 30 % by weight , of the total weight of the composition . for the coupling agents , impact modifiers , processing aids , uv - stabilizers and heat - stabilizers , the content is in particular less than 20 % and preferably less than 10 % by weight of the total weight of the composition . finally , the composition according to the invention may also comprise fillers such as talc , montmorillonite , chalk , mica and kaolin , preferably in a weight proportion that can represent less than 30 %, and more particularly less than 20 %, of the total weight of the composition . the compositions based on polyamides and on biobased reinforcements according to the invention are characterized by a tensile modulus in the conditioned state ( measured according to standard iso 527 1ba on samples conditioned for 15 days at 23 ° c . and at 50 % relative humidity ) preferably greater than 3500 mpa , more preferably greater than 5000 mpa . these compositions may be used for the production of a composite material from a composition comprising one ( or more ) biobased reinforcement ( s ) in the form of short fibers , said method comprising the following steps : a — compounding of the biobased reinforcement and of the polyamide ( s ) in an extruder or a co - kneader between 180 and 240 ° c ., in particular between 200 and 240 ° c ., for example 215 ° c ., b — extrusion of the rod , c — granulation of the rod . for a biobased reinforcement in the form of short fibers , by injection molding at 215 ° c . ( or injection compression ) of granules of short fibers , with the granule being obtained by compounding the compositions of the invention on an extruder or co - kneader , between 180 and 240 ° c ., in particular between 200 and 240 ° c ., for example at 215 ° c ., and cutting up the rod obtained ; for a biobased reinforcement in the form of long fibers , by injection molding at 215 ° c . ( or injection compression ) of granules of long fibers , the granule being obtained by impregnating bundles of continuous fibers in the molten polyamide between 180 and 240 ° c ., in particular between 200 and 240 ° c ., for example at 215 ° c ., by means of a cross - head extruder , and then cutting up the rod obtained . the long fibers in the form of a roving can also be incorporated directly during the injection molding ; for a biobased reinforcement in the form of woven or nonwoven mats , obtaining stratified sheets via hot pressing at between 180 and 240 ° c ., in particular between 200 and 240 ° c ., for example at 215 ° c ., of a stack of alternating woven or nonwoven fiber mats and films of the polyamide ( s ), or rolling of woven or nonwoven fiber mats onto a film of polyamide ( s ); for a biobased reinforcement in the form of fiber bundles , or a mat of fibers ( woven or nonwoven ), production of preimpregnated materials obtained either by impregnation ( coating ) of the fibers in a bath of molten polyamide of between 180 and 240 ° c ., in particular between 200 and 240 ° c ., for example at 215 ° c . ( in the case of fiber bundles , with a crosshead extruder ), or by impregnation in a fluidized bed ( i . e . electrostatic powder coating and then melting of the powder of polyamide ( s ) in an oven brought to between 180 and 240 ° c ., in particular between 200 and 240 ° c . ( for example at 215 ° c . ), or by powder - coating and then melt - coating at between 180 and 240 ° c ., in particular between 200 and 240 ° c ., for example at 215 ° c ., and then production of the composite from the preimpregnated materials , either by filament winding ( winding of the fiber bundles on a mandrel ), for the production of hollow bodies for example , or else by pressing and thermoforming of sheets produced from the mats of preimpregnated fibers , for the production of casings ; finally , for a biobased reinforcement in the form of fiber bundles , production of the composite by pultrusion in order to produce profiles ( drawing of the fiber bundles and continuous impregnation of the polyamide ( s ) in the molten state or in a fluidized bed and passage through a heating fixture giving the shape of the cross section of the profile ), brought between 180 and 240 ° c ., in particular between 200 and 240 ° c ., and for example at 215 ° c . unless otherwise indicated , the temperature ranges which have just been mentioned are those measured in the composition in the molten state . the objects obtained from the compositions according to the invention may be components intended : for the nonlimited automotive sector , such as cylinder - head cover , intake manifold , radiator housing , for construction sectors , for electrical or electronic sectors , such as housings , casings or cabinets , for sporting goods sectors , such as , for example , an element of shoes . iso 527 1ba dumbbell - shaped specimens of polyamide mxd . 10 synthesized from meta - xylylenediamine and sebacic acid having a melt flow index ( mfi ) of 20 g / 10 min at 275 ° c . under 2 . 16 kg are injection - molded at 210 ° c . in a mold maintained at 30 ° c . or 120 ° c . with a 60 - tonne injection - molding press . the granules of polyamide mxd . 10 were predried at 60 ° c . for 12 hours in an oven under vacuum . the melting point is measured by dsc according to standard iso11357 . the dumbbell - shaped specimens of mxd . 10 , but also of pa6 and of pa11 , are conditioned for 15 days at 23 ° c . at a relative humidity of 50 %. the tensile properties are obtained with the protocol described in standard iso 527 1ba . in table 1 hereinafter , the tensile moduli are compared between mxd . 10 injection - molded at 210 ° c ., polyamide - 6 ( pa6 , ultramid ® 8202 sold by basf ) injection - molded at 260 ° c . and polyamide - 11 ( pa11 , rilsan ® bmno tld sold by arkema ) injection - molded at 240 ° c . it is important to note that the pa mxd . 10 is much less sensitive to the conditioning ( less water uptake ) than pa6 since the tensile moduli decrease by 2 % to 6 % for the pa mxd . 10 , whereas for pa6 , the modulus decreases by 66 %. this advantage is considerable especially when untreated natural reinforcements which generally increase the water uptake of the compound are introduced . furthermore , the pa mxd . 10 can be injection - molded at 210 ° c ., whereas polyamide - 6 , for its part , is preferentially injection - molded at 260 ° c . and polyamide - 11 at 240 ° c . it emerges from this comparison that it is necessary to take into account the properties , in particular mechanical properties , measured on samples which have been conditioned . various compositions comprising 85 % of a polyamide and 15 % by weight of reinforcements were prepared from the following products : the polyamide mxd . 10 ( mp of 193 ° c .) is identical to that of examples 1 and 2 ; the polyamide 6 ( denoted pa6 , mp of 220 ° c .) corresponds to the ultramid ® b3 commercial grade from the company basf ; the polyamide 11 ( pa11 , mp of 187 - 191 ° c .) corresponds to the rilsan ® bmno grade from the company arkema france . the melting points mp mentioned above were measured by dsc according to standard iso 11357 . the non - biobased reinforcement is made up of glass fibers which have been sized in order to provide coupling with the matrix . these glass fibers are denoted “ gf ” in table 2 below . cellulose microfibrils ( denoted “ cellulose ” in table 2 below ) sold by the company rettenmaier under the trademark arbocel ®. the grade chosen in this example is bww40 consisting of more than 99 % by weight of cellulose ; flax fibers ( denoted “ flax ” in table 2 below ) sold by the company dehondt under the trademark lintex ®. the grade chosen in this example is m10f . before mixing , these biobased reinforcements are predried at between 100 ° c . and 110 ° c . in an oven for 12 hours under vacuum . likewise , the granules of pa mxd . 10 , pa6 and pa11 are predried at between 60 ° c . and 80 ° c . for 12 hours in an oven under vacuum . the mixtures of polyamides and of biobased reinforcements as detailed in table 2 below are prepared in an explore ® co - rotating twin - screw microextruder from the company dsm . this tool consists of a thermoregulated mixing chamber equipped with 2 co - rotating screws . the products are introduced by means of a sliding piston . the mixing chamber is equipped with a recirculation channel and with a die that can be closed , which makes it possible to recirculate the material for a fixed period of time . the die is then opened and the material is collected in a chamber which is also thermally regulated ( heat gun ). this heat gun is then connected to a microinjector which makes it possible to mold iso 527 1ba standardized dumbbell - shaped specimens by applying a cycle of varying pressures and controlled molding times , like what is commonly done with an injection - molding press . the mold is also thermoregulated , which makes it possible to mold at varying temperatures . at a temperature between 190 ° c . and 220 ° c . measured in the molten material for the mixtures comprising pa mxd . 10 , or pa11 , and natural reinforcements , and at a temperature of 230 ° c . measured in the molten material for the mixtures comprising pa6 and natural reinforcements . the biobased reinforcements and the polyamides are introduced into the thermoregulated mixing chamber by means of the sliding piston . the mixtures are prepared with a screw speed set at 100 rpm . the recirculation time chosen is 90 seconds . during the injection , the heat gun is thermoregulated at a temperature similar to the mixing temperature and the mold at between 40 ° c . and 80 ° c . the maximum pressure of the cycle is 16 bar . the residence times in the mold are between 6 and 20 seconds . the dumbbell - shaped specimens obtained from various compositions of examples 3 and 4 in accordance with the invention and of comparative examples e and f are then conditioned for 15 days at 23 ° c . at a relative humidity of 50 %. the mechanical properties of these dumbbell - shaped specimens after conditioning , in particular the values of the tensile moduli , are evaluated by adhering to the protocol described in standard iso 527 1ba . the tensile modulus values ( mpa ), the standard deviation values and also the density values are given in table 2 below . this table 2 also reports the tensile modulus values ( according to standard iso 527 1ba ) and density values recorded : for comparative example c : on the technical sheet of the ultramid ® b3eg3 ( pa6 + glass fibers ) commercial grade from the company basf , for comparative example d : on a technical sheet of a mixture of pa11 and glass fibers , manufactured by the company arkema france . it is observed that the tensile moduli of examples 3 and 4 reach values which are at least equal to , or even greater than , those of conditioned dumbbell - shaped specimens formed from pa6 and glass fibers ( comparative example c ), for much lower densities . moreover , the tensile modulus values of example 4 ( mxd . 10 + flax ) are very much greater than those of comparative example e ( pa11 + flax ) and even remain greater than those of comparative example d ( pa11 + glass fibers ). finally , the tensile modulus values of example 4 ( mxd . 10 + flax ) are also very much greater than those of comparative example f ( pa6 + flax ). various compositions comprising 70 % by weight of a polyamide and 30 % by weight of reinforcements were prepared from the products indicated hereinafter . the polyamide mxd . 10 ( mp of 193 ° c .) is identical to that of examples 1 to 4 , the polyamide 6 ( pa6 , mp of 220 ° c .) corresponds to the ultramid ® b36 commercial grade from the company basf , the polyamide 11 ( pa11 , mp of 187 - 191 ° c .) corresponds to the rilsan ® bmno commercial grade manufactured by the company arkema france . the melting points mp mentioned above were measured by dsc according to standard iso 11357 . the non - biobased reinforcement is made up of the same sized glass fibers mentioned for comparative examples c and d described above . these glass fibers are denoted “ gf ” in table 3 below . the flax fibers ( denoted “ flax ” in table 3 below ) are the same as those already used in example 4 and comparative examples e and f . the protocol for preparing the compositions and for producing the dumbbell - shaped specimens which is described for examples 3 and 4 and comparative examples e and f is reproduced , but with 30 % by weight of biobased reinforcements in the dry mixture before introduction into the microextruder , the granules of polyamides and also the reinforcements having been dried under the same conditions as those previously described . the dumbbell - shaped specimens obtained from various compositions of example 5 in accordance with the invention and comparative examples h and k are subsequently conditioned for 15 days at 23 ° c . at a relative humidity of 50 %. the mechanical properties of these dumbbell - shaped specimens after conditioning , in particular the tensile modulus values , are evaluated by adhering to the protocol described in standard iso 527 1ba . the tensile modulus values ( mpa ) and density values are given in table 3 below . this table 3 also reports the tensile modulus values ( according to standard iso 527 1ba , except in the case of comparative example g ) and density values recorded : for comparative example g : in example ( 9 ) of document ep 0 960 162 ( it being specified that the tensile modulus measurement is given according to standard din 53455 ); for comparative example i : on the technical sheet of the rilsan ® bzm30 o tl grade ( pa11 + glass fibers ) sold by the company arkema france ; for comparative example j : on the technical sheet of the ultramid ® b3eg3 commercial grade ( pa6 + glass fibers ) from the company basf . it is observed that the tensile modulus for example 5 reaches a value comparable of conditioned dumbbell - shaped specimens formed from pa6 and from glass fibers ( comparative example j ), which are known to be particularly satisfactory in terms of modulus , for a much lower density . it is of course possible to adapt the choice of biobased fibers to the mechanical properties , in particular of tensile modulus and density , desired . for a comparable nature and amount of biobased reinforcements , the compositions according to the invention make it possible to obtain a material which is much more effective in terms of mechanical properties than a material based on pa11 or pa6 . reference may in particular be made to example 5 and comparative example h , in the case of pa11 , and to example 5 and comparative example k in the case of pa6 . in the case of a composition based on pa11 , this observation still remains valid , even if the biobased flax fibers are replaced with an equivalent weight amount of glass fibers ( see example 5 and comparative example i ). | 2 |
with reference to fig2 and 3 of the annexed drawings the preferred embodiment of the present invention will be herein described for indicative purposes and by no means as of limitation . fig2 and 3 show a two - piece moulding assembly 20 comprising a base piece 22 and a decorative piece 40 . the base piece 22 is of elongate rectangular form having a top surface 24 , a generally opposed bottom surface 26 , a front surface 28 and a generally opposed back surface 30 with two end surfaces 32 , 34 between which the other surfaces 24 , 26 , 28 , 30 longitudinally extend . the front surface 28 of the base piece 22 is formed with a tongue 36 extending outwardly and upwardly therefrom and longitudinally of the base piece 22 . the tongue 36 is orientated at an obtuse angle a in relation to the top surface 26 and is typically rounded over at its free end 38 . the decorative piece 40 has a front outwardly facing front face 42 of contoured form as at 43 and has a mounting face 44 with an angularly oriented back face 45 , generally opposite the front face 42 , extending obtusely from the mounting face 44 . the decorative piece 40 further has a top surface 48 . a groove 50 extends longitudinally of the piece 40 and is machined in an obtuse orientation in the mounting face 44 . the groove 50 thus extends substantially parallel to the back face 45 . this parallelism is of particular advantage for the machining of the groove in that the cutting tool needs only to be disposed in a horizontal plane rather than an awkward acute angle as with the prior art . in use , in order to assemble the two pieces , the groove 50 of the decorative piece 40 is brought into mating engagement with the tongue 36 of the base piece and in so doing an interlocking engagement , i . e . interlocking registration , is established by virtue of the obtuse angular orientation of the tongue and groove . at the same time , the front surface 42 is brought into abutting contact in a substantially vertical plane with the mounting face 44 when the tongue 36 is engaged in the groove . for application to a cabinet top ( not shown ), the base piece 22 is suitably affixed thereto , generally with the bottom surface 26 abutting thereagainst the cabinet top , with the tongue 36 extending outwardly as seen in fig3 and the decorative piece 40 is then directed as shown by dotted lines into the engagement relationship with the base piece 22 . the interlocking tongue and groove may be permanently secured together by a bonding agent and / or by at least one panel pin or brad nail . the invention thus facilitates application of a decorative finishing to a cabinet top since the decorative piece is able to sit on the base piece , positively supported thereon by virtue of the tongue and groove which maintain the interlocking relationship for the fixing operation of the assembly 20 to the cabinet top . although the present invention has been described with a certain degree of particularity , it is to be understood that the disclosure has been made by way of example only and that the present invention is not limited to the features of the embodiments described and illustrated herein , but includes all variations and modifications within the scope and spirit of the invention as hereinafter claimed . | 4 |
fig1 is a circuit diagram of a communication circuit 101 including a variable capacitance element and a high - frequency device that include a control voltage application circuit . the communication circuit 101 is one example of nfc modules . the communication circuit 101 preferably includes an rfic 11 , a control ic 12 , an antenna coil 13 , and a variable capacitance element 14 . the variable capacitance element 14 and the rfic 11 constitute a variable - capacitance - element built - in rfic 110 . in the present preferred embodiment , the variable capacitance element 14 preferably is the variable capacitance element including a control voltage application circuit . a circuit configured by the variable - capacitance - element built - in rfic 110 and the antenna coil 13 corresponds to a “ high - frequency device ” according to various preferred embodiments of the present invention . the rfic 11 includes io terminals 11 p for gpio ( general purpose input / output ). similarly , the control ic 12 includes io terminals 12 p for gpio . the rfic 11 performs conversion between a baseband signal and a high - frequency signal . the control ic controls the rfic 11 , and receives and transmits data including communication data . the variable capacitance element 14 includes control terminals 14 p . the variable capacitance element 14 includes a capacitance element whose capacitance value is determined according to a control voltage , and a resistance voltage divider circuit that generates the control voltage by dividing a voltage inputted to the control terminals . to two rx terminals ( received signal terminals ) of the rfic 11 , the variable capacitance element 14 and the antenna coil 13 of a parallel circuit are connected . the io terminals 11 p of the rfic 11 and the io terminals 12 p of the control ic 12 are connected by signal lines 15 a , and the control terminals 14 p of the variable capacitance element 14 are connected to the signal lines 15 a and 15 b . the rfic 11 and the control ic 12 receive and transmit communication signals via the data transmission lines 16 , and the control ic 12 controls various setting or the like for the rfic 11 via the signal lines 15 a . in addition , the rfic 11 or the control ic 12 supplies control data to the variable capacitance element 14 via the signal lines 15 a and 15 b . the variable capacitance element 14 and the antenna coil 13 constitute an antenna circuit which is an lc parallel resonance circuit , and determine a resonant frequency of the antenna circuit . the antenna coil 13 is coupled with an antenna of a communication destination by electromagnetic field coupling , and performs transmission and reception for close range communication . fig2 is a detailed diagram of circuits provided between the rfic 11 and the antenna coil 13 . fig2 also shows a circuit connected to two tx terminals ( transmitted signal terminal ) of the rfic 11 . in fig2 , the antenna coil 13 defines and serves as a radiating element , and exchanges wireless signals with a coil antenna of a destination of communication based on magnetic field coupling with the coil antenna of the destination of communication . the antenna coil 13 preferably is a looped electrode pattern including a plurality of turns or winds . capacitors c 21 and c 22 are elements that adjust a degree of coupling between the rfic 11 and the antenna coil 13 . further , the inductors l 11 and l 12 and the capacitors c 11 , c 12 , and c 20 constitute a transmission filter . for example , since the rfic 11 operates passively when the communication circuit operates in the card mode , the rfic 11 generates a source voltage from an input signal inputted to the rx terminal and reads a reception signal , and performs load modulation of a circuit ( load ) connected to the tx terminal in transmission . further , for example , since the rfic 11 operates actively when the communication circuit operates in the reader / writer mode , the rfic 11 opens the rx terminal to transmit a transmission signal from the tx terminal in transmission , and opens the tx terminal to receive a reception signal from the rx terminal . in this manner , in the communication circuit , impedance from the rfic 11 toward the antenna coil 13 changes depending on the operation mode . as will be later described , the variable capacitance element 14 is controlled so that the resonant frequency of the antenna circuit is optimized depending on the operation mode ( so that the impedance from the rfic 11 toward the antenna coil matches ). here , the esd protection elements 17 a and 17 b are connected between the ground and both end terminals of the antenna coil 13 , respectively . fig3 is an entire circuit diagram within the variable capacitance element 14 . the variable capacitance element 14 includes a control voltage application circuit 14 r and a variable capacitance unit 14 c . a capacitance value between ports p 11 - p 12 of the variable capacitance unit 14 c is determined according to a voltage applied between ports p 13 - p 14 . ports p 21 - p 25 of the control voltage application circuit 14 r are connected to gpio ports ( gpio0 - gpio4 ) of the rfic 11 shown in fig1 . the ports p 21 - p 25 are connected to one terminals of resistance elements r 21 - r 25 , and the other terminals of the resistance elements r 21 - r 25 are connected in common to the port p 13 . the rfic 11 shown in fig1 selectively sets the io terminals 11 p as the gpio ports to high level ( source voltage ) or low level ( ground voltage ). therefore , each of the resistance elements r 21 - r 25 works as a resistance voltage divider circuit according to the level of the corresponding io terminal of the rfic 11 , and a control voltage according to its voltage dividing ratio and the source voltage is applied to the port p 13 of the variable capacitance unit 14 c . since the port p 14 of the variable capacitance unit 14 c is grounded , the control voltage is applied between the ports p 13 - p 14 of the variable capacitance unit 14 c . the effect of the voltage dividing will be described later in detail . in the variable capacitance unit 14 c , the control voltage is applied to both end terminals of each of the capacitance elements c 1 - c 6 via rf resistance elements r 11 - r 17 . the rf resistance elements r 11 - r 17 preferably have the same resistance value . the rf resistance elements r 11 - r 17 apply the control voltage to the capacitance elements c 1 - c 6 , and prevent an rf signal applied between the ports p 11 - p 12 from leaking to the ports p 13 and p 14 . each of the capacitance elements c 1 - c 6 preferably is a ferroelectric capacitor configured such that a ferroelectric film is sandwiched between opposing electrodes , for example . since the ferroelectric film changes its amount of polarization depending on an intensity of an electric field to be applied to change an apparent dielectric constant , it is possible to determine the capacitance value by the control voltage . fig4 is a chart showing a relationship between 5 - bit values from the ports p 21 - p 25 shown in fig3 and the resistance voltage dividing ratio . the resistance values of the resistance elements r 21 - r 25 shown in fig3 are determined to be in a ratio based on powers of 2 with respect to a lowest value among the resistance values . for example , the ratio between the resistance values of the resistance elements r 21 , r 22 , r 23 , r 24 , and r 25 is determined to be approximately 1 : 2 : 4 : 8 : 16 . for example , when r 21 is about 10 kω , r 22 is about 20 kω and r 25 is about 160 kω . for example , when the port p 21 is high level and all of the ports p 22 - p 25 are low level , the resistance element r 21 constitutes an upper arm of the resistance voltage divider circuit , and a parallel circuit of the resistance elements r 22 - r 25 constitutes a lower arm . alternatively , for example , when the ports p 21 and p 22 are high level and the ports p 23 , p 24 , and p 25 are low level , a parallel circuit of the resistance elements r 21 and r 22 constitutes the upper arm of the resistance voltage divider circuit , and a parallel circuit of the resistance elements r 23 - r 25 constitutes the lower arm . in addition , since the resistance values of the resistance elements r 21 - r 25 are determined to be in the ratio based on powers of 2 with respect to a lowest value among these resistance values , the resistance voltage dividing ratio may take values in the fifth power of 2 (= 32 ) ways depending on the combination of the ports p 21 - p 25 in high level or low level . the horizontal axis in fig4 may also be referred to as 5 - bit values from the ports p 21 - p 25 . similarly , the vertical axis may also be referred to as a voltage ratio to the source voltage . fig5 is a sectional view of a main portion of the variable capacitance element 14 . in fig5 , a substrate si is an si substrate over which an sio 2 film is provided . ferroelectric films and pt films are provided alternately over the substrate si in an order of a ferroelectric film fs 1 , capacitor electrodes pt 1 , a ferroelectric film fs 2 , capacitor electrodes pt 2 , and a ferroelectric film fs 3 to define a capacitor unit . a film stack of the ferroelectric films fs 1 , fs 2 , and fs 3 and the capacitor electrodes pt 1 and pt 2 is covered by a moisture - resistant protective film pc 1 . an organic protective film pc 2 is further provided over the moisture - resistant protective film pc 1 . a wiring film ti 1 is provided over the organic protective film pc 2 . further , the wiring film ti 1 is connected to predetermined portions of the capacitor electrodes pt 1 and pt 2 through contact holes . moreover , the wiring film ti 1 is provided so as to surround the moisture - resistant protective film pc 1 and the organic protective film pc 2 . an interlayer insulation film sr 1 is provided over a surface of the wiring film ti 1 . over a surface of the interlayer insulation film sr 1 , a resistive film pattern re 1 is provided . a surface of the resistive film pattern re 1 is covered by an interlayer insulation film sr 2 , and a resistive film pattern re 2 is provided over a surface of the interlayer insulation film sr 2 . a surface of the resistive film pattern re 2 is covered by an interlayer insulation film sr 3 . resistive films of the resistive film pattern re 1 and re 2 are preferably formed by the thin film process ( process utilizing photolithography and the etching technique ) or the thick film process ( process utilizing the printing technique such as screen printing ), for example . the resistance values of the resistance elements are determined based on width , length , and thickness of the resistive film patterns . a wiring film 112 is provided on a surface of the interlayer insulation film sr 3 . further , the wiring film 112 is connected to the wiring film ti 1 via contact holes provided through the interlayer insulation films sr 1 , sr 2 , and sr 3 . a surface of the interlayer insulation film sr 3 is covered by a solder resist film sr 4 . then , externally - connected electrodes ee is provided in an opening in the solder resist film sr 4 and over a surface of the wiring film ti 2 . the ferroelectric film fs 1 is an insulation film for close contact to and non - proliferation against the substrate si and the moisture - resistant protective film pc 1 . further , the ferroelectric film fs 3 is an insulation film for close contact to the moisture - resistant protective film pc 1 . examples of a conductive material used for the capacitor electrodes pt 1 and pt 2 include high - melting precious metal materials having favorable conductivity and excellent oxidation resistance , such as pt and au . further , examples of a thin - film material used for the ferroelectric films fs 1 , fs 2 , and fs 3 include a dielectric material having a high dielectric constant . specifically , materials such as a perovskite compound such as ( ba , sr ) tio 3 ( bst ), srtio 3 , batio 3 , and pb ( zr , ti ) o 3 , and a bismuth - layered compound such as srbi 4 ti 4 o 25 may be used . moreover , each of the wiring films ti 1 and 112 preferably includes three layers of ti , cu , and ti , in which a ti layer is about 100 nm and a cu layer is about 1000 nm in thickness , for example . furthermore , the externally - connected electrodes ee preferably include two layers of au and ni , in which an ni layer as a first layer is about 2000 nm and an au layer as a second layer is about 200 nm in thickness , for example . the moisture - resistant protective film pc 1 prevents moisture from the organic protective film pc 2 from intruding into the capacitor unit . examples of the moisture - resistant protective film pc 1 that may be used include sinx , sio 2 , al 2 o 3 , tio 2 , and the like . further , the organic protective film pc 2 absorbs an external mechanical stress . examples of the organic protective film pc 2 that may be used include a pbo ( polybenzoxazole ) resin , a polyimide resin , an epoxy resin , and the like . a resistive material of the resistive film patterns re 1 and re 2 is nichrome , for example . a non - limiting example of a method of manufacturing the variable capacitance element 14 shown in fig5 is as follows . first , the si substrate is subject to a thermal oxidation treatment to form an oxide layer of 700 nm thick sio 2 . the thickness of the oxide layer is not particularly limited as long as a desired insulation property is ensured , but preferably set to a range from about 500 nm to about 1000 nm , for example . then , the 50 nm thick ferroelectric film fs 1 for close contact and non - proliferation is formed over the oxide layer using a chemical solution deposition ( chemical solution deposition , hereinafter referred to as “ csd ”) method . the thickness of the ferroelectric film fs 1 is not particularly limited as long as a desired degree of contact and a desired degree of non - proliferation are ensured , but preferably set to a range from about 10 nm to about 100 nm , for example . the examples of the material that may be used as the ferroelectric film fs 1 are as listed above , but it is desirable to use the same material as that of the ferroelectric film fs 2 for the capacitor . for example , when forming a bst film , a film formation material solution in which ba , sr , and ti are blended in a molar ratio such as ba : sr : ti = 7 : 3 : 10 is prepared . then , the film formation material solution is applied over an oxide layer 1 , dried on a hot plate at 400 degrees celsius , and is heat - treated for 30 minutes at 600 degrees celsius to be crystallized , and thus a bst film is formed . the temperature of the hot plate is not particularly limited as long as a desired degree of drying property is achieved , but preferably set to a range from about 300 degrees celsius to about 400 degrees celsius , for example . further , the temperature of the heat treatment is not particularly limited as long as a desired degree of crystallization is achieved , but preferably set to a range from about 600 degrees celsius to about 700 degrees celsius , for example . in addition , duration of the heat treatment is not particularly limited as long as a desired degree of crystallization is achieved , but preferably set to a range from about 10 minutes to about 60 minutes , for example . next , the capacitor electrodes pt 1 , the ferroelectric film fs 2 , the capacitor electrodes pt 2 , and the ferroelectric film fs 3 are sequentially formed . specifically , the 250 nm thick capacitor electrodes pt 1 made of pt or au is formed using an rf magnetron sputtering method , the 100 nm thick ferroelectric film fs 2 made of bst or the like is formed using the csd method , and then the 250 nm thick capacitor electrodes pt 2 made of pt or au is formed using the rf magnetron sputtering method . further , the 100 nm thick ferroelectric film fs 3 made of bst or the like is formed using the csd method . the thickness of the capacitor electrodes pt 1 and pt 2 is not particularly limited as long as a desired low resistivity is ensured , but preferably set to a range from about 100 nm to about 500 nm , for example . further , the thickness of the ferroelectric film fs 2 is not particularly limited as long as a desired electrostatic capacitance is ensured , but preferably set to a range from about 80 nm to about 150 nm , for example . in addition , the thickness of the ferroelectric film fs 3 is not particularly limited as long as a desired degree of contact is ensured , but preferably set to a range from about 80 nm to about 150 nm , for example . thereafter , each layer of the capacitor unit is patterned using a photolithography technique and a dry etching method ( reactive ion etching ( rie ) method ). specifically , a photoresist is applied and pre - baked , the photoresist is irradiated with ultraviolet light through a photo mask , and exposure , development , post - baking are performed to transfer a photo mask pattern to a resist pattern . then , the exposed part is dry - etched using ar gas or chf 3 gas . subsequently , the capacitor unit is heat - treated for 30 minutes at 800 degrees celsius . the temperature of the heat treatment is not particularly limited as long as a desired degree of heat treatment property is achieved , but preferably set to a range from about 800 degrees celsius to about 900 degrees celsius , for example . in addition , duration of the heat treatment is not particularly limited as long as a desired degree of heat treatment property is achieved , but preferably set to a range from about 10 minutes to about 60 minutes , for example . next , the 600 nm thick moisture - resistant protective film pc 1 made of an inorganic material is formed so as to cover an upper surface and side surfaces of the capacitor unit as well as the ferroelectric film fs 1 using a spattering method . then , a pbo ( polybenzoxazole ) film made of a photopolymer material is applied so as to cover the moisture - resistant protective film pc 1 using a spin coating method . thereafter , heating for 5 minutes at 125 degrees celsius , an exposure process , a development process , and heating for about an hour at 350 degrees celsius are performed , and thus the 6000 nm thick organic protective film pc 2 of a predetermined pattern is formed . the thickness of the moisture - resistant protective film pc 1 is not particularly limited as long as a desired moisture resistance is ensured , but preferably set to a range from about 200 nm to about 1000 nm , for example . further , the thickness of the organic protective film pc 2 is not particularly limited as long as a desired property of mechanical stress absorption is ensured , but preferably set to a range from about 2000 nm to about 10000 nm , for example . then , using the organic protective film pc 2 as a mask and using a chf 3 gas , the organic protective film pc 2 , the moisture - resistant protective film pc 1 , and the ferroelectric film fs 2 are dry - etched and patterned to define contact holes ( not depicted ) reaching the capacitor electrodes pt 1 , and the organic protective film pc 2 , the moisture - resistant protective film pc 1 , and the ferroelectric film fs 3 are dry - etched and patterned to define the contact holes reaching the capacitor electrodes pt 2 . next , three metallic layers to constitute the wiring film ti 1 are formed using the rf magnetron sputtering method , and the wiring film ti 1 is patterned by wet etching . then , the interlayer insulation film sr 1 is spin - coated , a resistive film to be a resistance element 14 b of the variable capacitance element unit is formed using the thin film process such as sputtering or electron beam evaporation , or using the thick film process by an application of a paste , and this resistive film is patterned using a liftoff method to form the resistive film pattern re 1 . next , the interlayer insulation film sr 2 is spin - coated , a resistive film to be the control voltage application circuit 14 r is formed using the thin film process such as sputtering or electron beam evaporation , or using the thick film process by an application of a paste , and this resistive film is patterned using the liftoff method to form the resistive film pattern re 2 . thereafter , the interlayer insulation film sr 3 is spin - coated , and the contact holes reaching the wiring film ti 1 are defined . next , three metallic layers to constitute the wiring film ti 2 are formed using the rf magnetron sputtering method , and the wiring film ti 2 is formed as an power supply film and then patterned by wet etching . subsequently , openings are defined at predetermined positions by spin coating the solder resist film sr 4 , and the externally - connected electrodes ee are formed by electrolytic plating . in this manner , since ferroelectric capacitors are used as the variable capacitance elements , and since a plurality of resistance patterns having different resistance values are used for a bias voltage application circuit , it is possible to configure a small passive device having excellent frequency characteristics (= a variable capacitance element having a control voltage application circuit ). it should be appreciated that the present invention is not limited to the above - described preferred embodiment . the thickness of the layers , the formation methods , and the formation conditions are mere examples , and may be altered optionally as long as desired functions of a thin - film capacitor are achieved . further , while the description of the above preferred embodiments refers to the capacitor unit including a single layer structure with one capacitance generating unit , it should be appreciated that the present invention may similarly be applied to a multi - layer structure including two or more capacitance generating units . fig6 a illustrates a resistive film pattern of the resistance element 14 b of the variable capacitance element unit , and fig6 b illustrates a resistive film pattern of the control voltage application circuit 14 r of the variable capacitance element unit . ports p 11 - p 14 and resistive film patterns r 11 - r 17 shown in fig6 a correspond to the ports p 11 - p 14 and the rf resistance elements r 11 - r 17 shown in fig3 . further , ports p 21 - p 25 and resistive film patterns r 21 - r 25 shown in fig6 b correspond to the ports p 21 - p 25 and the resistance elements r 21 - r 25 shown in fig3 . as illustrated in fig5 and fig6 a to 6b , the variable capacitance elements and the control voltage application circuit are preferably formed by the thin film process on a semiconductor substrate . specifically , the variable capacitance element unit and the control voltage application circuit unit are preferably formed monolithically on the same substrate . in particular , the plurality of resistance elements that constitute the control voltage application circuit are preferably provided in the same layer by the process . therefore , it is possible to significantly reduce or prevent variation in the ratio between the resistance values itself even if the resistance values of the resistance elements are different from a desired resistance value , and thus it is possible to reproducibly control output voltages . on the other hand , while the variable capacitance elements preferably include a plurality of rf resistance elements parallely connected to both ends of the respective ferroelectric capacitors , these rf resistance elements are provided in a layer different from the plurality of resistance patterns that constitute the control voltage application circuit , and the rf resistance elements are also provided in the same layer by the same process . fig7 is a three - view drawing of the variable - capacitance - element built - in rfic 110 . as illustrated in fig5 , the variable - capacitance - element built - in rfic 110 preferably is a bare chip separated from a wafer . the externally - connected electrodes ( pads ) ee of the ic is provided with solder balls sb . a high - frequency device is configured by mounting the variable - capacitance - element built - in rfic 110 on a substrate on which the antenna coil 13 ( see fig1 ) is disposed . fig8 is a sectional view of a state in which the variable - capacitance - element built - in rfic 110 is mounted on a rewiring board 20 used for mounting . on a lower surface of the rewiring board 20 , terminals used for mounting 22 are provided , and on an upper surface , electrodes used to mount the variable - capacitance - element built - in rfic 110 are provided . further , rewiring electrodes 21 are provided within the rewiring board 20 . in this manner , a module in which the variable - capacitance - element built - in rfic 110 is mounted on the rewiring board 20 may be applied to a printed wiring board . while specific preferred embodiments of the present invention have been described , the present invention is not limited to such examples . for example , the variable capacitance element may be independently connected to the antenna coil in parallel , or a capacitor may be inserted in series to the variable capacitance element . alternatively , the variable capacitance element may be independently connected to the antenna coil in series . further , a high - frequency device according to various preferred embodiments of the present invention is not limited to a reader / writer of rfids , and may be constituted as an rfid tag , for example . while preferred embodiments of the present invention have been described above , it is to be understood that variations and modifications will be apparent to those skilled in the art without departing from the scope and spirit of the present invention . the scope of the present invention , therefore , is to be determined solely by the following claims . | 6 |
referring to fig1 and 2 , it is seen that that the top tab layers 11 and 21 are slightly narrower than the middle tab layers 12 and 22 , which in turn are slightly narrower than the bottom tab layers 13 and 23 . it is also seen in fig1 that the underlying affixation layer 14 is approximately equal in width to that of the “ day tab ” portion of the top 11 , middle 12 and bottom 13 tab layers , including a day indicator for the day ( e . g ., number of the day or day of the week , etc . ), while in fig2 , the underlying affixation layer 24 is approximately equal in width to that of the “ day tab ” portion of the top 21 , middle 22 and bottom 23 tab layers , excluding the day indicator , ( e . g ., number of the day , day of the week ). note that affixation layer 14 in the fig1 embodiment is preferably wider than narrower affixation layer 24 in the fig2 embodiment , as will be elaborated below . affixation layers 14 and 24 adhere on both sides ( preferably , beneath 14 and 24 is a peel - off protective sheet ), and the adhesive on the underside of 14 and 24 is used to adhere these to a mounting location , e . g ., the medicine container , box , etc . ( packaging ). for the multidose - per - day embodiment of fig1 , there is a tearable perforation line 15 between the day portion of the tab including the day indicator , and the dose portion of the tab . for the single - dose - per day embodiment of fig2 , there is a tearable perforation 25 between the word “ day ” and the day indicator so that when an upper 21 or middle 22 tab is removed , the day indicator on the middle 22 or bottom 23 tab , respectively , is readily revealed to visual inspection . the dimensions of the tab system may readily be varied . for illustration , and not limitation , in a preferred embodiment the top - to - bottom length of the entire system is approximately 2 3 / 16 ″. similarly , it is preferred , but not at all limiting , for the top layers 11 and 21 to be 13 / 16 ″ in width , for the middle layers 12 and 22 to be 15 / 16 ″ in width , and for the bottom layers 13 and 23 to be 1 1 / 16 ″ in width , all approximately . for the fig1 system , which illustrates multiple doses per day ( and in this specific , non - limiting illustration , three doses per day for each of ten days ), perforation 15 is preferably approximately 7 / 16 ″ from the left edge of each layer ( and wider affixation layer 14 correspondingly , is preferably approximately 7 / 16 ″ in width ), and between each tab , there are horizontal cuts 16 . for the fig2 system , which illustrates a single dose per day ( and in this specific , non - limiting illustration , one dose per day for each of thirty days ), perforation 25 is preferably approximately 4 / 16 ″ from the left edge of each layer ( and narrower affixation layer 24 correspondingly , is preferably 4 / 16 ″ in width ). between each tab , again , are horizontal cuts 26 . because perforation 15 in the fig1 embodiment is between the day / day indicator and the dose number , when a tab is removed from this system , the day indicator remains intact . because perforation 25 in the fig2 embodiment is between the word “ day ” and the day indicator , when a tab is removed from this system , the day indicator is also removed , so that a different day indicator just beneath becomes exposed to view . fig3 and 4 illustrate the same as fig1 and 2 respectively , except that here the tabs are shown in a right - to - left placement for comparison of how the vertical elements align , whereas fig1 and 2 illustrate the horizontal alignment . fig5 and 6 similarly illustrate the way in which the layers are overlaid , resulting in the configuration of fig7 and 8 . in relation to the illustrative embodiment of fig1 , 5 , and 7 , top layer 11 is adhered to middle layer 12 beneath where the word “ day ” ( or a similar suitable indicator for a day ) as well as beneath the day indicator ; middle layer 12 is adhered to bottom layer 13 also beneath where the word “ day ” and the day indicator ; and bottom layer 13 is adhered to wider affixation layer 14 , also beneath where the word “ day ” and the day indicator . all of these are adhered with sufficient strength such that , when a dose is taken and the dose tab is torn along perforation 15 , the word “ day ” and the day indicator both remain intact as an indicator “ residue .” in this way , the user can keep track both that a dose has been taken together with what dose needs to be taken next . for example , as illustrated in fig7 , once the “ dose 1 ” and “ dose 2 ” tabs are torn at perforation 15 , the user visually sees only “ day 1 , dose 3 ” remaining . this tells the user not only that day 1 , dose 3 is the next dose , but also , by virtue of the day 1 residue which contains an affirmative indicator which was formerly part of ( a residue from ) the indictor from dose that has now been consumed , that the first two doses from day 1 have already been consumed . note , this “ residue ” is more than just the tape or glue or the nub from a removed tab , which can be inconclusive in its meaning . this residue , again , contains an affirmative remaining ( unremoved ) indicator which was earlier associated with a dose that has now been consumed . thus , the indicators which are displayed to visual inspection once doses have been taken relate to and originate from both doses which have already been taken as well as doses which still need to be taken . in relation to fig2 , 6 , and 8 , top layer 21 is adhered to middle layer 22 beneath the word “ day ,” but not beneath the day indicator . middle layer 22 is adhered to bottom layer 23 also beneath the word “ day ” but not beneath the day indicator ; and bottom layer 23 is adhered to wider affixation layer 24 , also beneath the word “ day ” but not the day indicator . all of these are adhered with sufficient strength such that , when a dose is taken and the dose tab is torn along perforation 25 , the word “ day ” remains intact , again , as a “ residue .” but , in contrast to fig1 , 5 , and 7 , the day indicator from the next lower layer is exposed . again , this enables the user to keep track both that a dose has been taken together with what dose needs to be taken next , by maintaining an affirmative visual indicator — more than tape or glue or nub — from doses already taken as well as doses still to be taken . for example , as illustrated in fig8 , when the “ 1 ” from day 1 is torn away along perforation 25 together with the dose 1 indicator , the “ 11 ” for day 11 is exposed . it is clear to the user from both the day 1 residue ( here , the word “ day ”) as well as the now - visible “ 11 ” that the day 1 dose has been consumed , and that the day 2 dose is next to be consumed . when all of the dosages for days 1 through 10 are completed , the user will see all of day indicators 11 through 20 exposed , and will begin to cycle through the second layer 22 , see fig1 and 5 . completion of the second layer cycle then leaves the third layer 23 for days 21 through 30 , again , see fig1 and 5 . the directions for using the tab system , for the example of a medication that is taken three times per day for 10 days , would be as follows : on day 1 , consumer takes dose 1 of medication from the bottle or box , then lifts and tears off the tab for dose 1 adjacent to day 1 , at the perforation line 15 . later on day 1 , consumer takes dose 2 of medication from the bottle or box , then lifts and tears off the tab for dose 2 adjacent to day 1 , again at the perforation line 15 . consumer continues this medication schedule , tearing off all dose tabs from top 11 , middle 12 , and bottom 13 layers , for the prescribed 10 days , until the medication is taken in its entirety . for the example of one dose per day for 30 days , the consumer removes tabs so as to cycle through the first 10 days , which exposes days 11 through 20 . then , the consumer cycles through and removes tabs for the next 10 days , exposing days 21 through 30 . finally , the consumer cycles through and removes tabs for the final 10 days . in all cases , there is never any doubt whether a dose has been taken , nor is there any doubt which dose needs to be taken next . while the examples used here are for ten days at three doses per day and thirty days at one dose per day , this is exemplary and not limiting . for one week of medication taken four times per day , one would have seven tabs per layer , and four layers . for two weeks of medication taken twice a day , one might have seven tabs per layer and four layers , but differently marked so that when the day 1 dose 1 is taken , a day 1 dose 2 tab is exposed , and when that is taken a day 8 dose 1 tab is next exposed , followed by a day 8 dose 2 tab . whether one elongates the top - to - bottom length of this system and thus uses more tab per layer , or adds additional layers , will depend on the particulars of the dosage schedule to be represented , as well as how much physical space is expected to be available on the mounting surface to which the system is to be mounted . other combinations will become readily apparent to someone of ordinary skill , and are envisioned to be within the scope of this disclosure and its associated claims . similarly , the use of “ day 1 ,” “ day 2 ” etc , is illustrative , but not limiting . for example , not limitation , the days can simply be represented by calendar numbers , e . g ., 1 through 31 . or , by days of the week such as “ sunday ” through “ saturday ” which may employ a seven - tab - per - layer embodiment . then , if the user starts consuming medication on , e . g ., a wednesday , the first tear - off will occur for the wednesday tab in the middle of top layer of the tab system , and will cycle back to the tuesday tab also in the middle of the first layer , before staring the second layer on its wednesday tab . for a 30 - day calendar month , for example , one might have 30 distinct embodiments , so that if a medication is begun on the 23 rd of the month , the number “ 23 ” appears as the first tab , the top layer contains all of 23 through 30 and 1 and 2 ( ten tabs per layer ), the middle layer contains all of 3 through 12 , and the bottom layer all of 13 through 22 . in sum , the day indicator designations may comprise a sequence of numbers beginning at 1 , or a sequence of numbers representing days on a calendar , or a sequence of markings representing days of the week , or any other suitable representation of specific days . again , other variations of this nature will become apparent to someone of ordinary skill based on this disclosure , and are regarded to be within the scope of this disclosure and its associated claims . as a more detailed example of use , consider the example of amoxicillin , prescribed to be taken three times a day , for ten days . the consumer receives the amoxicillin from the pharmacy , then affixes the med - sked ™ tab system to the medication package / container . the consumer takes the first dose of amoxicillin , then tears off the dose 1 tab ( adjacent to the day 1 tab ). the remaining dose 2 and dose 3 tabs , along with the corresponding day 1 tab is left adhered to the medication package / container to indicate that the user has taken dose 1 , but has yet to take dose 2 and dose 3 for the remaining day 1 . the user then takes the second dose of amoxicillin , according to the medication schedule , and tears off the dose 2 tab adjacent to the day 1 tab . the remaining dose 3 tab , along with the day 1 tab is left adhered to the medication package / container to indicate that the user has taken dose 2 , but has yet to take dose 3 for the remaining day 1 schedule . the user then takes the third and final dose of amoxicillin for day 1 . the user tears of the dose 3 tab . there are no more dose tabs left for day 1 , which indicates that the user has taken all 3 doses for day 1 . the day 1 tab is left adhered to the package / container as a residue to act as confirmation that all doses for day 1 were taken according to the medication schedule . the above procedure is repeated for ( but not limited to ) the 10 day medication schedule . to manufacture the embodiments described above for use by a consumer , one first cuts and prints / marks a plurality of tab layers along the lines of fig1 - 4 . this includes making horizontal cuts 16 , 26 , as well as , e . g ., scoring the perforations 15 , 25 . then , the top layers 11 , 21 are adhered to the middle layers 12 , 22 , the middle layers 12 , 22 are adhered to the bottom layers 13 , 23 , and the bottom layers 13 , 23 are adhered to the “ top ” side of the affixation layers 14 and 24 . all of this is done such that the tabs will tear properly along the perforation lines and leave the required residues through which the consumer can be reminded what doses have been taken and what doses need to next be taken . as noted above , affixation layers 14 and 24 also contain , for example , an adhesive on their underside , protected , for example , by a peel - off protective sheet . when manufactured , the protective sheet remains adhered . the consumer peels off this sheet to expose the underside adhesive , and uses this to affix the entire med - sked ™ system to the mounting surface , e . g ., medication packaging . frequently , when a consumer begins a prescription for a medication that is taken two or more times per day , not all of the daily doses are consumed on the first day , and this will leave extra doses to be consumed following the last day . for example , for the three - dose - per - day , ten - day prescription ( 30 doses total ) illustrated in fig1 , 5 and 7 , the consumer may pick up the prescription from the pharmacy on the afternoon of the first day and so skip the morning dose for that day . or , the consumer may pick up the prescription from the pharmacy on the evening of the first day and so skip both the morning and afternoon doses for that day . in the former case the consumer takes two doses ( afternoon and evening ) the first day , and has one dose left over which will actually need to be consumed on the morning of the 11 th day . in the latter case , the consumer takes only one dose ( evening ) the first day , and so has two doses left over which will need to be consumed on the morning and afternoon of the 11 th day . fig9 and 10 illustrate an example of how to employ the med - sked ™ to deal with this type of situation . fundamentally , one addresses this situation by redesignating the “ day 1 / dose 3 ” tabs , and possibly the “ day 1 / dose 2 ” tabs , respectively , into next - to - last - dose and last - dose tabs . for example , if the consumer only takes two doses the first day , then the unused day “ day 1 / dose 3 ” tab is redesignated into a “ last dose ” tab . if the consumer only takes one dose the first day , then the unused “ day 1 / dose 3 ” tab is redesignated into a “ last dose ” tab , and in addition , the unused “ day 1 / dose 2 ” tab is redesignated into a “ next - to - last dose ” tab . if there are more than three doses per day , then one would need to further redesignate others of the day 1 tabs into “ third - from - last dose ,” “ fourth - from - last dose ,” etc . a particular embodiment for managing this redesignation is illustrated , for example but not limitation , in fig9 and 10 . in this embodiment , the med - sked ™ system comprises two extra redesignation tabs ( for three doses per day ) with adhesive backing ( and a removable protective layer over the adhesive ) which can be adhered to the “ day 1 / dose 2 ” and the “ day 1 / dose 3 ” tabs as needed , to redesignate the meaning of these tabs as just discussed . one of these redesignation tabs is a “ next - to - last dose ” tab 91 . the other is a “ last dose ” tab 92 . for n doses per day , a total of n − 1 such redesignation tabs are provided . however , one can employ other devices and methods for doing this as well . the consumer , for example , might simply use a marking pen or pencil to redesignate these tabs . the “ day 1 / dose 2 ” and the “ day 1 / dose 3 ” tabs might be manufactured wider ( left - to - right in the drawings ) than all of the other tabs , with a scoring line along which they may be reduced by tearing down to their original , illustrated widths . by leaving these tabs elongated , that would mean that these are to be regarded as “ last dose ” and “ next - to - last dose ” tabs . by removing the extra width before use , this would mean that these continue to be first day dose tabs . other methods that may become apparent of ordinary skill for redesignating certain tabs from one indication to another indication are considered to be within the scope of this disclosure and its associated claims . while fig2 , 6 , and 8 all illustrate “ day ,” the “ day indicator ,” and the “ dose number ,” it is recognized that the dose number tab may actually be superfluous and thus omitted , because this is a one - dose - per - day system and the dose taken on any given day will always be “ dose 1 ,” and indeed the only dose , for that day . the presence of the “ dose 11 ” tab section illustrated in fig2 , 6 , and 8 , therefore , serves to elongate the tab to make it easier to pull , but this printed matter can also be omitted and the tab simply provided in elongated form to facilitate pulling and separation . what is most important for this one - dose - per - day embodiment , is the tearing between the “ day ” and the “ day indicator ,” so as to expose the underlying day indicator , that is , for example , to tear off the “ 1 ” of day 1 so as to expose the “ 11 ” of day 11 , again , see fig8 . it is not strictly necessary , but is preferred , that this system be mounted on a mounting location on the medication packaging 110 as illustrated in fig1 . a consumer might wish , for example , not limitation , to affix the med - sked ™ system to a counter space , or a sheet of paper , or to a wall ( in which case a post - it ® type of adhesive backing is preferred for affixation layers 14 and 24 ), or to a refrigerator ( in which case a magnetic backing is suitable ), or to an automobile dashboard or visor , or to any other mounting location that suits the consumer &# 39 ; s convenience . irrespective of the exact mode of affixation , or what mounting location the consumer chooses to affix the med - sked ™ to based on personal preference and convenience , it is understood that the means is provided for the consumer to affix the med - sked ™ to a suitable location that will often be the medicine packaging . and , it is understood that affixation means which employ other than glue or tape may alternatively be provided within the scope of this disclosure and its associated claims . while the tabs illustrated here use the word “ day ” together with a day indicator , and the word “ dose ” together with a dose number , to remind the user of what medication have been taken and still need to be taken , it will be understood by someone of ordinary skill that other words or indicators may be used . any word , coloration , marking , shape , or other visual indicator which the user understands to mean “ day ,” and / or “ dose ,” with or without the actual words “ day ” and / or “ dose ” or synonyms therefore , is understood to fall within the scope of this disclosure and its associated claims . similarly , while the ends of the tabs are all shown to be squared off , these can also be rounded , or have some other shape . that is , the particular squared shape illustrated in the various drawings is to be understood as exemplary , and not limiting . further , while the bottom layers 13 and 23 are illustrated to be the widest , and the top layers 11 and 21 are illustrated to be the narrowest , this is exemplary , not limiting . for example , it is possible to have a reverse scheme in which the top layers are the widest and the bottom layers narrowest . also , for example , it is possible for all of the widths to be substantially the same . also , it is possible for the widths to be varied in any other way consistent with space requirements , ease of removing tabs , and reliability of the indication that a does has been or still needs to be consumed . while only certain preferred features of the invention have been illustrated and described , many modifications , changes and substitutions will occur to those skilled in the art . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention . | 8 |
with reference to fig1 an emergency detector 10 may be a smoke detector , a heat detector , a carbon monoxide detector , a burglar alarm , a motion sensor , a water detector to detect flooding , or any other similar emergency detection device either known or to be developed in the future . the one common feature of such emergency alarm detectors is that they provide an audible indication of an emergency condition . this audio alert is detected by unit 8 . on unit 8 , a microphone 12 which continually monitors ambient sound detects the loud alarm sound . an optional sound level switch ( physical or embedded in electronic logic or software ) 14 may set a threshold detection level . a “ switch ” includes any fixed or programmable device set by the user , allowing sensitivity control . sound detection may be set at a certain sensitivity level . sound exceeding this threshold triggers activation of the rest of the system . the audio signal passes through a sound level filter 16 . if this signal meets or exceeds a pre - determined volume level , the signal may be sent to a tone range filter 18 to be used to distinguish or filter out tones or background noise not within the normal audio alarm frequencies ( e . g ., dog barking , loud music , etc .). this may all be integrated through a processor 42 ( e . g ., a microprocessor ), or a logic controller component . processor 42 may analyze the sound level and tone range from sound level filter 16 and tone range filter 18 or directly from the microphone 12 and note the duration of the audio signal . if the duration exceeds a threshold , the processor 42 considers this an alarm condition and may store a recording of audio signal in memory 20 . this signal may be either filtered or unfiltered sound . as soon as an alarm condition is identified by the processor 42 , a phone dialer 44 ( operating through a phone jack 46 and connected to a household phone jack 50 by a wire ) allows the unit 8 to contact server 52 . this may be done using standard pots service , voip service or any other means of telecommunication including but not limited to wireless or cellular communications . if the service center is busy the processor may be instructed to either dial an alternative number and / or retry multiple times . once connected to the server 52 , the detector unit 8 transmits a unique identification sequence to the server 52 . the identification may include the type of alarm that is being transmitted . the server 52 , using automated database , identifies the specific detector unit which is transmitting . the server 52 may send back a confirmation tone or tone sequence acknowledgment sent to confirm that the unique identification has either been accepted or rejected by the server . if the identification is rejected or a time interval passes ( e . g ., for example , 30 seconds or greater timeout ) the emergency notification device terminates transmission and retries additional times before resetting . upon authentication of the emergency detection device 8 , the emergency detection device then either sends the audio file saved in a buffer memory or sends a direct audio data / track transmission from sound monitor 12 to server 52 . this may be sent as uncompressed or compressed audio data , including but not limited to , for example , an mp3 audio data file . in the situation of the direct connection of microphone 12 to server 52 on an open phone line , then near real time ambient sounds ( filtered or not ) are transmitted , representing sounds occurring at the location surrounding the emergency detection unit 8 , and an audio file is created at the service center . the server 52 may then take one of a number of actions . a call may be sent to a phone 54 associated with the unique identification of emergency detection unit 8 . this may be a cell phone of property owners , a phone of a property caretaker or neighbor , or other designated party . this person reviews the audio file and decides what action should be taken , i . e ., whether the audio file represents a real or a false alarm . optionally , server 52 could also send the alert data and optionally the audio file to staffed or automated monitoring center 56 . this monitoring center 56 will allow the potential review of the audio file by an agent . the agent at the monitoring center 56 may call the property location in an attempt to verify an alert , call alternative numbers to verify the emergency , or contact a third party , fire department , police department , property manager , or other first responder after review of the audio file and determining that a true emergency situation exists . as shown in fig1 , the device may have a number of optional features . a plug 70 may be used to power the device . alternatively ( or in addition ) a battery 22 may provide the unit power or auxiliary power . the power is fed through power management module 21 which provides power to the elements of the system . the phone line may also power the device . the phone jack 46 may also be linked to secondary phone jack 32 . a phone 30 may be plugged into phone jack 32 . the use of this two - jack system on the device 8 allows the device to be used without requiring a separate wall phone jack . alternative configurations may allow the device 8 to communicate over a computer network or be a wireless device that communicates via cellular , wireless data networks to the server or directly with a personal computer , cell phone , or other wireless technology . the present embodiment can hear an audio detector alarm up to 100 feet or more away . in particular , it is able to detect standard approved smoke detector . the basic components of the invention are adaptable to analog phone lines , voip phone lines , wireless cellular phone communication , or any other type of data communication protocols including ieee 802 . 11 wi - fi protocols , ethernet and others . the user can subscribe to various levels of protection . in one level of protection , a fully automated protection plan would be provided by the server 52 . when the server 52 detects an alarm , a transmission of notifications may be sent . these could be automated phone calls with a recorded message and a recording of sound from the microphone of the device . alternatively , or in addition , the server 52 may send out an electronic message , such as email , sms , mms , text message , or other electronic notification to a secondary device . in another level of protection , a staffed or automated monitoring center could also respond to the alert . with reference to fig2 , the device is shown having a registered phone plug 72 attached by a wire to the body of the emergency detection device . an indicator light 70 allows indication that the device is working . this may be a very low power led light . buttons 74 , 76 may be pressed to test and reset the device , respectively , or could be combined . reset button 76 may be used for false alarms to reset the server 52 of fig1 . test button 74 may serve two functions . first , this may be used to calibrate the server 52 . in addition , it may also serve to ensure that the alarm is properly functioning . with reference to fig3 , a flow chart shows operation of the basic system in which sound is continuously monitored ( block 100 ). an initial filter determines if monitored sound exceeds a given threshold ( block 102 ). a user may be able to set this threshold . the device may include a switch in which a user selects the sound threshold ( e . g ., high , medium , low ), setting device sensitivity . if the sound does not exceed the threshold the device simply continues to monitor the ambient sound ( block 100 ). if the threshold is exceeded , the device determines if the tone measured is within a selected range ( block 104 ). if the tone is consistent with an alarm , the sound data is sent to a processor . ( the term “ processor ” should be understood to mean either a microprocessor , a microcontroller or a logic device such as a pld .) if not , the device continues to monitor the ambient sound ( block 100 ). the processor analyzes the sound data ( block 106 ). this may include determining the duration of the sound signal for example , or any other type of alarm sound signature , such as , for example , its cadence , its frequency or its sound envelope . if the sound data is consistent with an alarm , the device will transmit the device identification and audio verification , potentially as a sound audio file ( e . g ., mp3 file , wav file , audio data or other digital or analog electronic audio information with signals representing sounds captured by the microphone and filtered by the processor , to the server .) blocks 100 - 108 may occur at the audio detection device or in a central unit . at the server , the server device attempts to authenticate the detection device id ( block 110 ). if the device is not authenticated a failure notice is sent ( block 112 ) to the audio transmission device , which would attempt again to contact the server ( block 108 ). if the device is authenticated , the device either unpacks the audio file in a message sent by the transmission component or creates an audio file with sounds captured by the microphone in the case of a direct connection to the microphone . the server then looks up in a database the user contact data ( block 111 ), and then send an alert to using the contact data ( block 114 ). most commonly , this will be a replay of the captured audio and a created or recorded message to one or more phone numbers . the property owner may request to have a number of phones or mobile devices contacted by the server at the same time . the user who receives the alert may determine whether the sound is a false alarm and then may have the option of summoning a responder ( by calling the police department , fire department , 911 , etc .). alternatively , the user may be able to simply reset the alarm . ( return to block 100 ). if a higher class of service is set up the audio file and alert data would be sent to a staffed or automated monitoring center ( block 118 ). here an operator could listen to the audio data and take an appropriate action , such as calling the phone number of the address where the alarm is located ( block 120 ) or calling a first responder ( block 122 ). one of skill in the art will understand that the various embodiments could be characterized in different ways . in addition , various substitutions and alterations are possible . a single audio monitoring device could monitor a number of different household alarms , such as a fire alarm , water detection alarm , motion detector , and burglar alarms . if these alarms produce a different tone , the audio monitoring device could distinguish each tone and the server could correspondingly be programmed to respond to each tone with a customized message and potentially different alerts . the transmission device may be a phone land line , a cellular phone connection , an internet data connection ( including cable , satellite , dsl , etc . ), a wireless data communication protocol ( such as bluetooth ®, ieee 802 . 11 wi - fi 802 . 16 wimax and others ), wireline data communication protocols such as ethernet , a networked device , etc . the processor may have programming or components that allow the processor to perform a number of the screening functions , including sound and tone screening , length of alarm screening , or other audio screening . alternatively these may be performed by components other than a processor . the alarm detector may , in addition to the audio sound , send a signal to the monitoring device , via a transmission method such as a wireless connection . the monitoring device may in some embodiments , be manufactured as part of an audio warning device , such as a smoke detector having this component integrated into the detector . the audio alarm device may include a number of additional features . in the illustrated embodiment , the audio detection component 8 is shown linked by wires to a telephone input and output . the device could also be configured to have a wireless communication transmitter , such that the communication component is a wireless link that communicates to a network . this could use any of a number of wireless communication protocols . the processor 42 and / or the configuration of the filters could be configured to allow a training mode . in the training mode the device could “ learn ” to recognize both an alarm , and a number of background noises . for example , if a “ train ” button / function were activated and then an emergency alarm activated , the sound level filters and tone range filters and / or the processor could adjust to ensure that the alarm could be detected . such adjustment could include , but are not limited to , adjustment as to tones detected , recognition of patterns , adjustment of gain settings , and other setting adjustments . in addition or alternatively , a training mode could be used to recognize background noises , either with or without the additional audio contribution from the alarm . another feature could be a translator . for the purposes of this document , “ translate ” means to convert an audio sound into any different sort of data that is more easily sent over a telephone line . any component which is a “ translator ” is one able to translate , as defined herein . translating a signal could be detecting an alarm , and having the frequency altered so that the signal could be sent over a bandwidth - limited phone line . alternatively , the translation could be converting the detected alarm into a different signal , such as a voice simulation of the time and / or location and / or duration of the alarm . alternatively , the translator could produce a tone signal , recognized by a server as indicative of the alarm . in fig1 , the translator 17 received the audio signal from the sound level filter and passes the sound signal to the tone level filter . alternative configurations are possible , as all configurations illustrated are exemplary . another feature that may be added is a temperature sensor , such as element 11 in fig1 . this temperature sensor could allow the system to be activated if the temperature exceeds or falls below a threshold . low temperature could indicate a broken furnace or loss of structure integrity during cold weather . high temperature could indicate a fire , and be used in addition to the audio monitoring to provide additional information during an emergency event . temperature sensor 11 may be connected to the processor to allow production of a signal indicating that the temperature has moved above or below a high or low threshold . in addition a power monitoring feature could be included , as shown with element 23 on device 8 in fig1 . this could monitor the power to the alarm detection unit itself from any power source , including the power line , the phone line or the battery , or it could be wired to detect power interruption to the building . this could be just a simple plug , allowing communication through a phone line ( which would remain working during a blackout ) that power to a structure has been interrupted . the audio detector could also be configured to detect the “ chirp ” or other audio indicator from an audio alarm that sound to note that a battery is low . this could be detected and transmitted to the server . the audio detection unit may be a single , standalone unit . alternatively , the audio detection unit could be one of a plurality of independent or linked units . some structures have multiple rooms separated by both distance and sound obstructions ( such as doors , elevation changes , corners and other structural features that reduce sound travel ). a number of audio detection units may be used in such a structure . these could either each be linked to a communication component that communicates with a server , or could all be linked ( either through hard wiring or could have wireless communication ) with a central unit . this is shown in fig4 . the method to link the units can include , as an example , power line networking or wireless technologies . in fig4 , the audio detection unit 300 sends signal to a central unit 310 . central unit 310 is configured to receive monitoring signals from any one of the audio detection units . if any of the audio detection units relay a signal indicative of an alarm sounding or other detection of an emergency condition , a signal is sent ( through either wireless or telephone or other wired signal sending means ) to the server 312 . an “ emergency condition alarm ” may be either a device within a structure that produces an audio signal if a condition exists ( e . g ., water detector , smoke detector , burglar alarm , temperature detector , carbon monoxide detector , heat detector , etc .). in addition , the emergency condition alarm can also be a whistle or tone generator activated by an individual in an emergency situation . for example , if a fall occurs and an occupant is unable to get up , a tone generator worn about the neck can be used to provide a signaling tone to alert the system that help is required . | 6 |
in referring to the drawings , fig1 shows the present invention installed about the teeth of the upper or maxillary jaw of a person . the present invention comprises a mouthpiece 1 generally arcuate in shape made of a polymer material , often transparent . the mouthpiece has two wings 2 , left 2 a and right 2 b , that join at the midpoint 1 a of the mouthpiece . a wing begins where it fits over a molar 3 and then curves and narrows forward toward where it fits over an incisor 4 . the mouthpiece fits snugly upon the outside of the teeth . the mouthpiece has preprogrammed features that contact the teeth to straighten them as done with the invisalign ® series of mouthpieces . the wings have a generally u shape in cross section that is sized to fit snugly upon the various teeth in the jaw . the wings are modeled with computer programs for precise fit and sizing . the mouthpiece using the wings straightens teeth and moves them into a desired arcuate form . however , the wings of existing mouthpieces do not provide for lateral expansion of the arch by spacing apart the molars . within the wings shown in fig1 , the present invention has an expander 5 as originally shown in my previous application , ser . no . 10 / 439 , 638 and which is incorporated herein by reference . the expander has a housing 6 with an advancing member 7 telescoping axially from within the housing . the housing joins to the left wing 2 a shown in fig1 proximate to where the left wing fits over the molars 3 . the housing has a generally rectangular shape in cross section that extends across the width of at least two molars . the housing has side walls , a top 8 , a bottom , a back 9 and an open front 10 . a channel 11 extends rearward from the front edge of the outer housing . a threaded rod 12 extends forwardly from the housing back wall 9 to the front 10 . the threaded rod extends along the center of the housing and rotates axially within the channel 11 . then an advancing member 7 is slidably received within the housing 6 . opposite the housing , the advancing member joins to the right wing 2 b of the mouthpiece . the member also has side walls , a bottom , a top , and a front wall 13 though of slightly less dimensions than the counterparts in the housing to permit fitting within the housing . a channel extends partially along the center of the top and cooperates with the channel in the housing to permit access therethrough to the threaded rod 12 within the housing . next , an internally threaded activation nut 14 operates upon the housing &# 39 ; s threaded rod . the nut has a size so that its peripheral edge is accessible through the channels 11 of the housing and the advancing member . the nut has a plurality of radial holes 15 spaced upon in its periphery . the holes are also accessible through the channels using a key , or tool , ( not shown ) to rotate the nut thus moving it along the rod . the nut advances an activation wing ( not shown ) within the housing and towards the advancing member . the activation wing is located in front of the activation nut 14 for movement by it . the wing is journaled about the threaded rod and extends laterally to provide support for a spring 16 upon each end of the wing . the springs extend from the wing to the front wall of the advancing member . the springs provide an expansive force that moves the advancing member outwards and away from the housing . as can be appreciated , the springs supply their expansive force as the activation nut turns upon the rod . turning of the nut 14 advances it along the rod 12 generally towards the center of the expander . the nut then moves the wing along with it , urging the springs to expand upon the advancing member . in doing so , the advancing member 7 and housing 6 impart lateral outward forces upon the molars 3 on each side of the maxillary jaw . over time , the lateral forces widen the jaw as prescribed by the orthodontist . viewing the present invention from the side in fig2 , the mouthpiece has an apparent rectangular shape with rounded edges . the mouthpiece fits over the teeth of the maxillary jaw with the upper edge of the mouthpiece approaching the gum tissue . here the left wing 2 a of the mouthpiece is shown , extending from the incisors or midpoint 1 a to the molars 3 . the transparent mouthpiece shows the housing joined to the inner surface of the mouthpiece in the vicinity of the molars . the housing 6 has a generally rectangular cross section as previously described with the perimeter of the housing joining to the mouthpiece . the advancing member 7 nests within the housing and moves outward upon the wing as the nut turns upon the rod 12 . the housing and the advancing member join to the mouthpiece by fusing to existing aligners by heating or chemical welding . the operations of the present invention in cooperation with a mouthpiece 1 are shown via a rear view of the mouthpiece in fig3 . as previously described , the mouthpiece has a generally u shaped cross section so the left wing 2 a and the right wing 2 b fit over the teeth . the mouthpiece fits over the biting edge of the teeth and extends towards the gums . the housing joins to the left wing and the advancing member joins to the right wing , both proximate to the rear molars 3 . the advancing member fits snugly within the housing . springs 16 engage the advancing member outwards to expand the jaw . the springs extend into the expander onto a wing 17 . the wing 17 as previously described is ahead of the activation nut 14 . the nut 14 is turned upon the rod . in turning the nut , the expander converts the rotation of the nut into an axial expansive force transferred through the housing and the advancing member to expand the maxillary arch laterally . an alternate embodiment of the expander is shown attached to the palate of a patient in fig4 , as an alternative to mounting the expander upon a mouthpiece . the maxillary jaw has teeth arranged in a generally arcuate shape with molars 3 towards the rear of the jaw and incisors 4 towards the front . the teeth are generally arranged symmetrically about a line 4 a extending from between the two incisors to half way between the molars . this line follows the palate 4 b , or upper roof of the mouth , of a patient . the palate is made of bone and is an integral part of the patient &# 39 ; s skull . in younger patients and over longer durations in adult patients , bone can grow or be moved . the alternate embodiment utilizes the housing 6 and advancing member 7 along with internal hardware of rod 12 , wing 17 , activation nut 14 , and springs 16 as previously described . the housing and advancing member each have a grommet 18 in the alternate embodiment . each grommet has a generally round shape joined tangent to the back of the housing and the advancing member respectively . the plane of the grommet is generally parallel to the plane of the housing . each grommet has a center hole 19 that seats a screw 20 . alternatively , the grommet is bent to conform to the surface of the patient &# 39 ; s palate . fig5 shows the components of the alternate embodiment of the expander in a partially exploded view . the housing has a partially circular grommet joined to the back wall and the advancing member also has a partially circular grommet joined to its respective back wall . each grommet has a rounded hole therethrough into which a screw turns for securement into the palatal bone during usage as later described . the grommets have a cross section along their circumference to permit snug seating of the screw upon the grommet thus reducing contamination by food and injury to the tongue by rough edges . in use , the alternate embodiment is positioned by the oral surgeon , or orthodontist , between the molars with the channel facing towards the tongue . with the patient sedated , the channel of the assembled expander is oriented perpendicular to the molars and the expander is centered within the palate . the grommets provide a template for drilling pilot holes into the bone of the palate . the pilot holes are then cleaned and prepared to receive surgical grade screws . the grommets are then positioned over the pilot holes and the screws are installed singly until the grommets are snug upon the palate . once the patient awakens , the patient is instructed on operating the expander and proper oral hygiene to keep the expander clean and to reduce the incidence of infection . variations or modifications to the subject matter of this development may occur to those skilled in the art upon review of the invention as described herein . such variations , if within the spirit of this development , are intended to be encompassed within the scope of the invention as explained . the description of the preferred embodiment and as shown in the drawings , are set forth for illustrative purposes only to show the principle of this maxillary arch expander not attached to a patient &# 39 ; s teeth . | 0 |
in this specification , the terms vertical and horizontal are used as references to the direction of the cut and the anti - bounce device is described in relation to a saw mill where it is bounce in the direction of the cut ( both horizontal and vertical ) that is to be avoided . the following description and reference to a saw mill suitable for use with the anti bounce device of the invention is intended for illustration purposes only and is not intended to be limiting of the features of the saw mill to which the invention is applicable . the invention is particularly applicable to saw mills having a pair of rails or tracks and a carriage mounted on the rails or tracks for movement therealong . the carriage comprises a saw blade mount from which a driven saw blade is adapted to cut material as the carriage moves along the rails or tracks . referring first to fig6 , an embodiment of a preferred form of portable saw mill 10 can be seen including end pieces 12 , 13 , and tracks 14 , 15 extending longitudinally therebetween . carriage 16 extends transversely and is engaged to tracks 14 , 15 such that it is movable towards and away from the end pieces . carriage 16 carries a saw 18 and the anti - bounce device 100 of the present invention . movement of carriage 16 along the tracks 14 , 15 allows for movement of the saw 18 along the material to be sawn 20 ( in this case a log ). the engagement means 40 of the anti - bounce device 100 also moves along the surface of beam 20 . the anti - bounce device 100 is shown in more detail in fig1 to 5 . in fig1 , the assembled anti - bounce device 100 is shown . engagement means 40 includes a wheel 41 attached to a first tubular member 50 of strut 60 . the wheel includes ridge 42 . the first tubular member 50 is slidingly engaged with second tubular member 51 of strut 60 . resilient member 52 of strut 60 is disposed within first tubular member 50 and second tubular member 51 . the relationship between resilient member 52 , first tubular member 50 and second tubular member 51 is best seen in fig2 . the wheel 41 is attached to first tubular member 50 by a nut and bolt combination as shown in fig5 . a bearing 43 engages in the centre of the wheel 41 . the end of the inner race of the bearing 43 is engaged against a nut 44 , with a washer 45 being therebetween . when bolt 46 in first tubular member 50 is engaged through opening 47 it can be adjusted in and out and locked against the wall of the first tubular member 50 with lock nut 48 ( fig1 ). resilient member 52 , which in this embodiment is a gas spring , has a rod 53 with a nut 54 fitted thereto . the rod 53 is engaged , when the anti - bounce device 100 is assembled , in the first tubular member 50 so that the bolt 46 for attaching the wheel passes through nut 54 to thereby anchor the rod 53 . the body 55 of the shock absorber device 52 is received in the second tubular member 51 . the end of the body 55 has a nut 56 into which a grub screw 57 can be engaged . the nut 56 is , when the anti - bounce device 100 is assembled , aligned with opening 58 in the second tubular member 51 and the grub screw 57 screwed in to thereby anchor the body 55 in the second tubular member 51 . the first tubular member 50 and second tubular member 51 are thereby coupled together by the resilient member 52 to form the strut 60 . the first tubular member 50 is dimensionally smaller but of similar cross sectional shape to the second tubular member 51 so it can fit , optionally with clearance , in second tubular member 51 . due to the angular cross sectional shape of the arrangement substantially no twisting of the first tubular member 50 with respect to the second tubular member 51 can occur . the connection means are best illustrated in fig1 and 3 . here , a first component 70 ( referred to as a strut mount 70 ) and a second component 80 ( referred to as a carriage mount 80 ) are shown . the strut mount 70 is adapted to encompass second tubular member 51 and provides for vertical adjustment of the anti - bounce device 100 relative to the saw 18 . the carriage mount 80 is adapted to encompass a portion of the strut mount 70 and engage the carriage 16 and provides for horizontal adjustment of the anti - bounce device 100 relative to the saw 18 . the strut mount 70 has a tongue 71 which extends transverse to a tubular section 72 which has a longitudinal slot 73 cut in one wall . the slot 73 forms a clearance for the head of the grub screw 57 which protrudes from second tubular member 51 , as well as allowing for compression of the tubular section 72 to provide a clamping action on the second tubular member 51 . the tubular section 72 carries on opposed walls flanges 74 , 75 . one flange 74 has fastened thereto a nut 76 which is opposite an opening 77 in the other flange 75 . a fastener 78 of the t - bolt type illustrated in fig4 is engaged though opening 77 and into nut 76 as is shown in assembled form in fig1 . thus with the second tubular member 51 slidingly received in tubular section 72 of the strut mount 70 , the position of the strut 60 ( and engagement means 40 ) can be adjusted vertically before the fastener 78 is tightened to cause the tubular section 72 to clamp the strut mount 70 in place . the carriage mount 80 is of a similar construction as the strut mount 70 . in place of the tongue 71 of the strut mount 70 , the carriage mount 80 has a mounting plate 81 . this mounting plate 81 permits the carriage mount 80 to be fixed in place on the carriage 16 of the saw mill 10 . in this embodiment the carriage mount is positioned such that the engagement means is in alignment with the saw blade and the direction of the intended cut . as well , the carriage mount 80 shown is of the un - adjustable kind , but the skilled person would understand how to make this mount adjustable . the mounting plate 81 is connected to a tubular section 82 which has a longitudinal slot 83 cut in one wall . the slot allows for compression of the tubular section 82 to provide a clamping action on the tongue 71 of the strut mount 70 , which is received therein . the tubular section 82 carries on opposed walls flanges , 84 , 85 . one flange 84 has fastened thereto a nut 86 which is opposite an opening 87 in the other flange 85 . a fastener 88 of the t - bolt type illustrated in fig4 is engaged though opening 87 into nut 86 as is shown in assembled form in fig1 . thus with the tongue 71 of the strut mount 70 slidingly received in tubular section 82 of the strut mount 70 , the position of the strut 60 ( and engagement means 40 ) can be adjusted horizontally before the fastener 88 is tightened to cause the tubular section 82 to clamp the strut mount 70 in place . in use , the wooden beam 20 is position beneath the path of carriage 16 and saw blade 18 . the horizontal position of the strut 60 and engagement means 40 relative to the saw blade is adjusted so that free movement of the saw blade is allowed . the vertical position of the strut 60 and engagement means 40 relative to the surface of beam 20 along which the engagement means 40 runs is adjusted so that before the engagement means 40 actually engages the beam 20 it is lower than the surface . thus , as the carriage 16 is moved towards an end of the beam 20 , the resilient member 52 in strut 60 must be compressed to a stressed state to allow the engagement means 40 to move up onto the surface of beam 20 . the resilient member 52 will remain in a stressed state as carriage 16 and saw blade 18 moves along the remainder of the beam 20 making the cut . any bouncing of the carriage 16 will be lessened / dampened by the presence of the anti - bounce device 100 in a stressed state . the skilled person will appreciate the mechanism by which this lessening occurs . the effect of the anti - bounce device 100 is better shown in fig7 . referring to fig7 , as the saw blade 18 progresses in the z direction into and out of the page the carriage is prone to bouncing ( which are also in the z direction ). as in fig7 a , if a vertical cut is being made ( ie the saw blade 18 is in a vertical position ), the anti - bounce device 100 ( not shown in fig7 a ) lessens movement of the saw blade up and down vertically in the x direction as the carriage and track bounces . the saw blade less often comes off the floor of the vertical cut 19 , which reduces stress on the teeth of the saw blade and results in the depth of the cut being more even . as in fig7 b , if a horizontal cut is being made ( ie the saw blade 18 is in a horizontal position ), the anti - bounce device 100 lessens movement of the saw blade in the y direction ( left and right ). horizontal movement of the saw blade in the y direction is lessened due to positioning ridge 42 of engagement means 40 within the cut 19 . the anti - bounce device can be connected to the carriage at any position that allows it to travel along the surface of the material to be sawn at the same time as the blade moves through the material as it is sawn . that is , the anti - bounce device , or more particularly the engagement means , need not be in longitudinal alignment with the saw blade , and thus need not travel the same path on the material being sawn . for instance , the anti - bounce device can be offset from the saw blade . importantly , the transverse displacement of the engagement means from the saw blade must not be such that one or the other does not contact the material being sawn when in use . more preferably , the transverse positioning of the anti - bounce device is adjustable by having the connection means movable across the transverse direction of the carriage . in the embodiment shown in fig2 and 3 , a guide 49 is shown disposed adjacent the engagement means 40 and as part of first tubular member 50 . the guide 49 is positioned vertically above the level of the engagement means that engages the surface of the material to be sawn . with the anti - bounce device 100 fixed to the carriage 16 the strut 60 , and thus guide 49 , is vertically adjustable . accordingly , when the saw 18 is arranged to proceed with cutting , the strut 60 is lowered so that the guide 49 touches the top of the beam 20 . when the cut of beam 20 commences the engagement means 40 must then ‘ step up ’ onto the log , which pushes the first end of the strut 50 , 54 towards the second end of the strut 51 , 56 , thus compressing the resilient member 52 therebetween . this establishes a restorative force in the strut 60 that acts on the engagement means 40 and to dampen up and down bounce of the saw blade 18 . it will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings . all of these different combinations constitute various alternative aspects of the invention . | 8 |
while this invention is susceptible of embodiments in many different forms , there is shown in the drawings and will herein be described in detail a preferred embodiment of the invention with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the broad aspect of the invention to the embodiment illustrated . an embodiment of a business transaction utilizing a receivable clearinghouse 10 in accordance with the present invention is shown in fig2 and 3 . preferably , the clearinghouse 10 is internet ( i . e ., decentralized global computer network ) based and capable of interacting with several participants including suppliers , purchasers , and finance providers . specifically , the participants share data related to trade obligations created during the transaction of business to business commerce , and changes or corrections to the trade obligations . the participants enter into contractual relationships with regard to the actual settlement and financing of these obligations . preferably , these agreements are standard between the clearinghouse and all other participants including finance providers and prospective investors in trade receivables . turning to fig3 , the clearinghouse 10 preferably includes a funds settlement apparatus 12 , such as a receivable trust , utilized by the clearinghouse and all its participants . cash settlements between the clearinghouse 10 and its participants preferably occurs daily . in an embodiment , several types of participants utilize the clearinghouse 10 such as receivable owners , receivable debtors , and financial providers . the receivable owner , e . g ., supplier 14 , agrees to provide summary data on its receivables and settle certain of its trade receivables through the clearinghouse 10 . similarly , the receivable debtor , e . g ., purchaser 16 , has agreed to provide summary data on its payables and settle its trade obligations via the clearinghouse 10 . as shown in fig2 , two additional participants can include the supplier &# 39 ; s finance provider 18 and the purchaser &# 39 ; s finance provider 20 . in an embodiment , besides providing financing to the supplier 14 , the supplier &# 39 ; s finance provider 18 is a financial institution that agrees to take on the performance risk of the receivable owner 14 for certain representations and warrants for which it agreed to when becoming a clearinghouse participant . in addition , the supplier &# 39 ; s finance provider 18 may act as the representative of the receivable owner 14 when the receivable owner trades through a clearinghouse trade receivable marketplace 22 . likewise , in an embodiment , the purchaser &# 39 ; s finance provider 20 is a financial institution that , along with providing financing , agrees to take on the performance risk of the receivable debtor 16 for certain representations and warrants for which it agreed to when becoming a clearinghouse participant . moreover , the purchaser &# 39 ; s finance provider debtor sponsor 20 may act as the representative of the receivable debtor 16 when the receivable debtor executes a trade through the clearinghouse trade receivable marketplace 22 . in an embodiment , one or more other financial institutions 24 may offer to provide financing to the receivable owner 14 , as well as coordinate cashflow to and from the clearinghouse 10 on behalf of the participants . such financing can be provided , for example , through the purchase of the debt obligations of the purchaser 16 owing to the supplier 14 , or through the lending of funds to the purchaser or subsequent owner secured by the purchaser obligations . they may also provide currency exchange products and services . the financial institutions 24 preferably agree to the legally binding transfer of ownership and assignments of security interests as reflected in the records of the clearinghouse 10 . the clearinghouse trade receivable marketplace 22 provides a forum within the clearinghouse 10 that allows financial institutions 24 , on their own behalf as well as on behalf of the current owner of a receivable , to buy or sell an obligation of the purchaser 16 to make a payment under a specific receivable to other clearinghouse participants . preferably , a contractual relationship is a prerequisite to a participant &# 39 ; s participation within the clearinghouse 10 . participants agree to resolve receivable and payable disputes through the clearinghouse 10 , track their resolution , and be bound by execution of a digital signature . the participants further agree to follow predetermine reporting and funding procedures . these procedures can include : summary information on receivables to be settled through the clearinghouse 10 ; notification of receivable ownership / interest changes ; and , notification of debit / credit balances in the funds settlement apparatus 12 . in an embodiment , each participant acknowledges the ability of the clearinghouse to track and grant security interests in receivables and the funds in settlement apparatus 12 on behalf of the supplier 14 , or the current receivable owner , if different . the transfer of ownership in the receivables and payment obligations , and the granting of security interests are authorized by the execution of an electronic signature . the supplier 14 and purchaser 16 are preferably bound to provide predetermined information on receivables and payables to each other through the clearinghouse 10 . the receivables and payables information are matched and tracked through the clearinghouse 10 , preferably via the data management and reporting module 28 . the supplier 14 , or subsequent owner of the receivables , agrees to accept payment for the receivables through the funds settlement apparatus 12 , e . g ., the receivable trustee transfers funds from the receivable debtor 16 designated accounts to the receivable owners designated accounts at the receivable trust 12 . similarly , the receivable debtor 16 will make a payment of all of its payables to a designated account at the receivable trust 12 . the supplier 14 ( receivable owner ) and purchaser 16 ( receivable debtor ) electronically communicate with the clearinghouse 10 the status of receivables and payables . preferably , these electronic communications to and from the clearinghouse 10 are legally binding contractual obligations . the status of a clearinghouse item may be : no - match , match , approved release date , confirmed ( i . e ., receivable debtor will pay the stated amount on the stated date ), re - confirmed ( i . e ., the receivable debtor &# 39 ; s obligation is backed or guaranteed by a financial institution ), etc . in an embodiment , the payment date is the actual date payment is made . preferably , the funds settlement trust 12 has the ability to net payments of a participant &# 39 ; s receivable and payable accounts . these net payments are preferably executed on a daily basis . upon the confirmation of an invoice amount ( when the receivable debtor 16 specifically agrees to pay a certain amount on a certain date ), the receivable debtor agrees that the obligation thereafter is absolute , binding , with no rights of set - off . in addition , the receivable debtor 16 acknowledges that the receivable owner 14 may sell , assign , pledge , and transfer ownership within the receivable clearinghouse 10 without the consent or knowledge of the receivable debtor . the supplier 14 , or a subsequent receivable owner , can offer the cashflow obligations of the receivable debtor 16 to other participants of the clearinghouse 10 on a confidential “ double - blind ” basis , i . e ., confidential regarding underlying business transaction as well as the supplier 14 and the prospective receivables purchaser , or receivable owner , through the receivable trading apparatus 22 . the receivable owner 14 and financial provider 18 utilize standard documents for financing receivables . the receivables are financed by the purchase of the receivables , the purchase of an ownership interest in the receivables or a pool of receivables , or the pledging of a security interest . both the receivable owner 14 and the financial provider 18 agree to accept the risk of clearinghouse bookkeeping regarding ownership and security interest issues . all payments for financing are accepted through book entry debits and credits with the funds apparatus 12 based on the reporting of the clearinghouse 10 . in an embodiment , the receivable owner 14 grants access , via the clearinghouse 10 , to finance providers , with respect to information pertaining to any receivable for which the financial provider 18 is interested . information pertaining to the receivables and payment data is transmitted between the participants and the clearinghouse 10 , preferably via data management and reporting 28 , on a daily basis . the type of information transmitted depends on the participants involved . the supplier 14 sends information on new and existing receivables to the clearinghouse 10 . the information sent regarding new receivables may include the purchaser 16 , amount , invoice number and date due . the information sent pertaining to existing receivables may involve any of the following : changes requested by the purchaser 16 and accepted or modified ; new or revised clearinghouse terms ; or , confirmation of the sale of a receivable through the trade receivable marketplace 22 . the supplier 14 or a subsequent receivable owner 14 also sends confirmation of settlement to the clearinghouse 10 wherein deposit or withdrawal from the funds apparatus 12 is confirmed . the receivable owner ( whether the original supplier 14 or a subsequent receivable owner ) can accesses the clearinghouse marketplace 22 via a trading web - page . at the web - page , the receivable owner can search for receivables to purchase ; post receivables to sell ; and , inform the clearinghouse 10 of an offer . the information sent or made available by the clearinghouse 10 to a receivable owner 14 , such as the supplier 14 , can include : projected future clearinghouse credits ; receivable status , i . e ., no - match , match , approved , release - date ; and , confirmations , reconfirmations , and changes noted or requested by the purchaser 16 related to the current owner or sponsor . the clearinghouse 10 sends or makes available the receivable owner 14 a daily settlement report . the report contains an itemized net payment due to or from receivables and payables , and the sale of any receivables ; and , cash delivery failures on past settlements . the clearinghouse 10 sends or makes available to the receivable debtor 16 information on new invoices which the clearinghouse received from receivable owners 14 , e . g ., seller , amount , purchase order , product description , terms , clearinghouse terms ( discounts offered for affirmations , confirmations , and reconfirmations ). in an embodiment , the receivable debtor 16 compares electronically this information with its own accounting system information regarding payables . the receivable debtor 16 sends to the clearinghouse 10 information on existing payables invoices , such as : affirmations ( full or partial ); confirmations ; and requests for reconfirmation ( by receivable debtor sponsor or a specific financial provider ). also sent is information related to changes noted or requested by receivable debtor 16 , the current owner or sponsor . similar to the information sent or made available to the receivable owner , the clearinghouse 10 sends or makes available the receivable debtor 16 daily settlement reports . the report contains an itemized net payment due on its payables , net of any awards it is to collect if it is also a receivable owner 14 , and cash delivery failures on past settlements . the receivable debtor also sends information pertaining to the confirmation of settlement to confirm payments from the funds apparatus 12 . the clearinghouse makes available daily listings of invoices and information or receivable debtor obligations for those the receivable owner 14 had provided access to the financial provider 24 . these listings are categorized by receivable owner 14 , receivable debtor 16 , and any type of ownership interest guaranteed to the finance provider . the listing by receivable owner is further defined by existing ( by type of clearinghouse terms ), new additions , and changes to existing invoices . in an embodiment , information such as listings can be made available by the clearinghouse on a global basis by using , for example , the internet . the financial provider 24 notifies the clearinghouse 10 of settlement deposit instructions , such as , payment instructions on receivable payments and loan payment instructions to the funds apparatus 12 . the financial provider 24 can access the clearinghouse marketplace 22 via a web page for trading receivables . at the web page , the financial provider 24 can search for receivables to purchase , post offers to sell certain receivables , notify clearinghouse of offers and the acceptance of offers . the financial provider 24 also receives a daily settlement report issued by the clearinghouse 10 . the clearinghouse 10 provides a daily report to the receivable debtor sponsor 20 and the receivable owner sponsor 18 . both sponsors are provided information concerning discrepancies relating to the receivable owner or receivable debtor for which it sponsors . the receivable debtor sponsor is further provided with information concerning reconfirmation requests . in an embodiment , the present invention provides an internet based clearing center 10 (“ rclearing . com ”) for tracking , funding , trading and settlement for account receivables , both domestic and international . fig2 and 3 . the internet based clearing center 10 creates an environment for account payable and receivable processes that significantly lowers traditional processing costs , and allows for more efficient and cost effective financing programs . preferably , upon the receipt and initial processing of a purchase order ( manually or via internet , ultimately ), and shipping of the goods , the supplier 14 sends new invoice data to rclearing . com 10 electronically on a daily basis . the invoice information is received by a data repository 26 and rclearing . com 10 makes available the invoice information to the purchaser 16 on behalf of the supplier 14 via the internet ( email or / and through access to rclearing . com homepage ). terms of payment are provided in the data , with all payment instructions stating that all payments must be made to “ rclearing . com , inc .”, as nominee for the owner of the receivable ( initially supplier 14 ) via rclearing &# 39 ; s receivable trust account ( preferred ) ach / direct debit ( recommended ), wire transfer or check ( to a lockbox owned by rclearing , inc .). the purchaser 16 has previously agreed that the payments due under “ rclearing . com payables ” may be ( or have been ) assigned to a third party . but in any case , all payments by the purchaser 16 are to be made to rclearing . com 10 . in addition , within the electronic data the purchaser 16 may be given the option for a discount or extended payment terms , to confirm the exact dollar amount and date of payment , and waive all rights to additional adjustments or set - off . the size of the discount given by the supplier 14 to the purchaser 16 is negotiable , depending upon the dollar amount of the invoice , the date of payment , as well as the credit quality of the confirming entity ( if someone in addition to the purchaser 16 confirms the payment as well , i . e ., receivable debtor sponsor 20 ). the purchaser 16 , individually or with a third party ( bank or insurance company ), has the option of confirming the invoiced amount , and agreeing to the payment terms ( date and amount ) in order to receive the agreed upon discount or payment terms on the payment amount . the supplier 14 may continue to pledge or assign its account receivable , whether or not the purchaser 16 accepts the terms of the “ confirmation discount .” with the payments from the purchaser 16 required to go through rclearing . com 10 , and with the ability to easily create a confirmation process for some or all of the invoiced amounts , the supplier 14 will , most likely , receive better terms on its financing from suppliers finance provider 18 . under this process , payments are less volatile , and cash receipts are easily segregated away from the supplier 14 , if necessary . all payable and receivable information is transferred directly to / from the seller &# 39 ; s ( supplier 14 ) and the buyer &# 39 ; s ( purchaser 16 ) mis systems ( including accounts payable and accounts receivable systems ) to rclearing . com 10 . rclearing . com will provide standard interface apparatus for all major vendors of accounting systems . a large or small company may join rclearing . com 10 , as either a “ receivable participant ,” ( receivable owner 14 ) a “ payable participant ,” ( receivable debtor 16 ), or a “ full participant ” ( both receivable owner and receivable debtor ). the participant will access the rclearing . com website , and , via a password , allow the transfer of data to and from rclearing . com and the participant &# 39 ; s own systems . as a “ full ” or “ receivable ” participant , all invoicing is done through rclearing . com 10 , via the internet or through traditional means ( if the invoiced entity is not yet internet friendly ). rclearing . com also collects and reports all confirmations received on invoices ( if any ). all payments received on receivables ( electronic or via lockbox - prior to convincing payer that participation in rclearing or electronic payments is more beneficial ) are through rclearing . com . rclearing . com credits the participants receivable trust account 12 , ( funds settlement apparatus ) or forwards funds to the participant on a daily basis . if it is a “ full ” participant , the amount credited to its funds settlement apparatus 12 will be netted against amount owed on payables . as a “ full ” or “ payable ” participant , all invoices received from suppliers 14 , as well as all other payable information is electronically forwarded to rclearing . com 10 ( indirectly from the participant as it receives it , or directly from invoicing company — if it is also a “ receivable ” participant ). the payable is acknowledged , and possibly confirmed , by the participant to rclearing . com giving rclearing . com payment instructions . upon availability of funds in the settlement apparatus 12 , rclearing . com will make payments ( preferably electronically ) to the appropriate party , per the terms of the invoice and confirmation . daily net settlements and reporting is done between the participants and rclearing . com . “ funding participants ,” 18 , 20 , and 24 , who may also be full participants , have the ability to purchase or receive security interests in the receivables held by rclearing . com as nominee . disclosure arrangements are predetermined between the funding participants and specific other participants . upon the request of the participant owning the receivable , confirmed and unconfirmed receivables may be offered by the receivable owner , or its receivable owner sponsor to financial participants 24 for funding prior to payment date via the receivable trading apparatus 22 . predetermined arrangements , as well as independent “ blind ” offers may be extended by the owner of the receivable via rclearing . com , and if accepted , funded through rclearing . com , and the settlement apparatus 12 , the next day . the funding scenarios are many . a funding participant 24 may commit to another participant in the form of a loan or purchase arrangement , may purchase receivables as part of building or owning a portfolio of receivables , or may offer to purchase only discrete receivables , from time to time . all full participants may offer to buy discrete receivables using its sponsor through rclearing . com on a confidential , no - name basis ( blind seller , blind buyer ). standard legal documentation is preferably executed and binding upon any type of participant ( including funding participant 24 , supplier finance provider 18 , and purchaser finance provider 20 ) for all receivable sales or transfers , and funding arrangements , as a part of becoming a participant of the clearinghouse 10 ( both the customer and participating funding providers ). this , in itself , may reduce or eliminate significant legal costs for many funding arrangements . while the specific embodiment has been illustrated and described , numerous modifications come to mind without significantly departing from the spirit of the invention , and the scope of protection is only limited by the scope of the accompanying claims . | 6 |
the prior - art integrated suspension unit 100 of fig1 and 2 will be described first , in order to provide a point of departure for better understanding the improvements of the preferred embodiments , which will be described further on . the typical prior - art integrated suspension unit 100 as shown in fig1 and 2 is manufactured by fox racing shox . it is to be understood , of course , that this specific prior - art embodiment is representative only , and that the present air spring arrangement can be applied to other types of suspension units . additionally , the present air spring arrangement can be applied as a separate air spring unit , not integrated with a damper . in fig1 and 2 the integrated suspension unit 100 is comprised of an air spring assembly 110 and a damper assembly 190 . the integration is seamless , with several of the components such as an upper eyelet housing 116 and seal head 194 shared by both assemblies and performing dual functional roles . for example , as part of the damper assembly 190 , the seal head 194 closes and seals off one end of the shock body 197 . at the same time , as part of the air spring assembly 110 , the seal head 194 also seals off the open end of the air cylinder 126 . still referring to fig1 and 2 , the ends of the integrated suspension unit 100 , the upper eyelet 114 and the lower eyelet 198 , are connected to the sprung and unsprung portions of the vehicle ( not shown ) in a conventional manner . the air pressure in the positive air chamber 128 creates a force tending to lengthen the suspension unit 100 , while pressure in the negative air chamber 136 tends to shorten it . as is well - known in the art , the net effect of these opposing forces is to create a desirable air spring curve (“ force vs . travel curve ”), especially in that portion of the travel regime where the suspension unit 100 is near full extension . in particular , it is well - known that without the counteracting force produced by the negative air chamber 136 , which rapidly increases as the shock absorber approaches full extension and the volume of the negative air chamber 136 rapidly decreases , the initial portion of the spring curve (“ spring preload ”) would be quite stiff . thus , an undesirably large beginning force would be required to initiate the first portion of travel from full extension . typical spring curves produced with and without the negative air chamber 136 are illustrated in fig3 . curve “ a ” shows a force versus travel spring curve that would be produced by the embodiment of fig2 which includes the negative air chamber 136 . in contrast , curve “ b ” shows the spring curve that would result if the negative air chamber 136 was removed ( not shown ). on a bicycle , or other vehicle , spring curve “ b ” would generally produce an undesirably harsh ride due to the large initial force required to initiate travel from full extension . the positive air chamber 128 is pressurized via the air valve 112 . as is typical , an air passage ( not shown ) is drilled in the upper eyelet housing 116 , and leads from the air valve 112 to the positive air chamber 128 . the negative air chamber 136 is pressurized via a transfer port 132 . transfer occurs at that pre - determined point near the beginning of suspension travel where the transfer port 132 bridges the positive / negative seal assembly 130 , as depicted in fig2 . this air transfer feature provides an effective and simple means for properly balancing the pressures of the positive air chamber 128 and the negative air chamber 136 , and is more fully described in u . s . pat . no . 6 , 135 , 434 . the positive / negative seal assembly 130 provides a moving seal between the positive air chamber and the negative air chamber and seals at all times except when bridged by the transfer port 132 . the inside bore of the air cylinder 126 is burnished or otherwise finished to provide a smooth , low - friction surface which seals well . the negative chamber seal assembly 140 seals the lower side of the negative chamber on the outside of the shock body 197 , which is burnished or otherwise finished to provide a smooth , low - friction surface which seals well . the prior - art integrated suspension unit 100 of fig1 and 2 includes provisions for adjusting the internal damping by rotating a damping adjuster knob 191 which , in turn , rotates the damping adjuster rod 192 which extends down the shaft 193 into the piston assembly 195 . this basic construction , available in many conventional high - performance shock absorbers and well - known to those skilled in the art , enables external adjustability of compression damping , rebound damping , or both . although this damper construction feature is not required for application of the preferred embodiments , it is illustrated here in the prior - art and it is also included in the illustrated embodiment shown in fig6 . if this adjustable damping feature is not included , a somewhat simplified and less costly preferred embodiment , as described later and illustrated in fig1 , is made possible . the rest of the prior - art integrated suspension unit 100 , including the piston assembly 195 which creates damping as it moves thru the damping fluid 196 , are not illustrated or described in further detail since they are conventional features well - known to those skilled in the art , and are not required for an understanding of the preferred embodiments . external views of a preferred embodiment are shown in fig4 and 5 . suspension unit 200 comprises a damper assembly 190 identical to that of fig1 and an adjustable air spring assembly 210 . a manually - operable travel adjust lever 252 which extends from the upper portion of suspension unit 200 . the travel adjust lever 252 can be rotated 90 - degrees clockwise or counterclockwise between the two positions shown , the “ long - travel mode ” and the “ short - travel mode ”, as will be described more fully further on . [ 0048 ] fig6 shows a partial sectional view of the suspension unit 200 of fig4 . in comparison to the prior - art device of fig1 and 2 , the damper assembly 190 of fig6 is identical to the damper assembly 190 of fig1 and 2 ; however , the adjustable air spring assembly 210 of fig6 contains additional structure and modified structure as compared with air spring assembly 110 of fig1 and 2 . the additional and modified structure comprises an air cylinder partition 272 sealed within the air cylinder 126 which separates the divided positive air chamber 228 into a first partial volume 227 and a second partial volume 229 , and a travel adjust assembly 250 which enables these two partial volumes to be either connected or separated by rotation of the external travel adjust lever 252 . [ 0049 ] fig7 and 8 show enlarged views illustrating this additional structure and modified structure , which will now be described in detail . in fig8 and other drawings , various seals ( such as a conventional o - ring seal between the air cylinder 126 and the air cylinder partition 272 ) are included in the drawing , but are not numbered or described , since they are conventional features well - known to those skilled in the art . the detent ball assembly 260 provides a detenting effect such that , after adjustment , the travel adjust lever 252 is held in the selected position . it also provides tactile feedback to the operator to indicate attainment of a new position upon rotation . the travel adjust lever 252 is incorporated into the upper eyelet housing 216 and is secured to an actuating cam shaft 254 by a retaining screw 256 . a surface of the actuating cam shaft 254 has a ball indent 255 spaced every 90 - degrees on its outer surface near one end . a surface of a detent ball 262 , urged by a detent spring 264 which is secured by a detent set screw 266 , engages the ball indent 255 . thus , in an engaged position , the detent ball 262 engages one of the ball indents 255 and a first level of resistance to rotation of the travel adjust lever 252 is provided that , desirably , inhibits unintentional rotation of the lever 252 , while still allowing the lever 252 to be rotated by hand . in an unengaged position , the detent ball 262 contacts a surface of the cam shaft 254 between the indents 255 and , desirably , provides little or no resistance to rotation of the travel adjust lever 252 . in fig8 the retaining ring 278 serves to secure the axial location of the air cylinder partition 272 on the shaft 193 . in order to facilitate clear visualization of the interface between the upper eyelet housing 216 and the air cylinder partition 272 , fig9 shows an isometric view of the upper eyelet housing 216 , and fig1 shows an isometric view of the air cylinder partition 272 . as shown , the underside of the upper eyelet housing 216 includes a downwardly - projecting upper passage port coupler 217 which engages the upwardly - projecting lower passage port boss 273 thru which the lower passage port 274 passes . this connection is sealed by a lower passage port seal 276 as shown in fig1 . [ 0053 ] fig1 shows an enlarged partial sectional view of the travel adjust assembly 250 , which is now described in detail . as previously described , the travel adjust lever 252 is secured to the actuating cam shaft 254 by a retaining screw 256 . the actuating cam shaft 254 is retained in the upper eyelet housing 216 by a retaining screw 253 . the actuating cam shaft 254 includes a cam profile 259 . this cam profile 259 consists of 2 flats 259 a 180 - degrees apart as shown here in fig1 , and 2 deeper flats 259 b as shown in fig1 , which also are 180 - degrees apart and are at 90 - degrees from flats 259 a . these flats control the position of the cam follower 258 , as determined by the setting of the travel adjust lever 252 . cam follower 258 is sealed by cam follower seal 257 . with the travel adjust lever 252 in the position shown in fig1 , the cam follower 258 is in contact with the check ball 282 and maintains it in a position out of contact with the check ball seal 283 . as shown by the heavy flow lines drawn , this enables air flow from the first partial volume 227 ( not shown in this view ) thru the lower passage port 274 , past the check ball 282 , thru the upper passage port 219 , and into the second partial volume 229 ( not shown in this view ). this is one direction of air flow . the opposite direction of air flow is also enabled . these flows , of course , provide open communication between the first partial volume 227 and the second partial volume 229 such that their combined volume is available during compression of the suspension unit 200 . [ 0055 ] fig1 shows the travel adjust lever 252 in the closed position . the cam follower 258 , urged upward by internal air pressure , engages cam profile 259 b and , as shown , moves away from check ball 282 by a distance “ x ”, which is desirably 0 . 040 ″ or more . the check ball 282 , urged upward by the check ball spring 284 engages check ball seal 283 . this seals off any upward air flow from first partial volume 227 to second partial volume 229 . however , this does not seal off flow in the opposite direction , since check ball spring 284 is specified to produce only a small spring force , for example about 0 . 03 to 0 . 05 pounds , with the check ball 282 in the sealed position . accordingly , if the pressure from the second partial volume 229 above the check ball 282 exceeds the pressure below it from first partial volume 227 by approximately 3 to 5 psi , then this pressure differential will overcome the force of check ball spring 284 and check ball 282 will move downward away from sealing contact with check ball seal 283 . in this event , air will flow from second partial volume 229 to first partial volume 227 . this characteristic is desirable in order to prevent unintended entrapment of excess air and pressure in the second partial volume 229 . for correct function of the adjustable air spring assembly 210 , it is preferred that the pressure in second partial volume 229 does not become significantly greater than the pressure in first partial volume 227 . such a situation would result in the pressure within the first partial volume 227 being reduced from its initial , preset level , due to the finite quantity of air within the suspension unit 200 . as a result , the spring rate of the air spring 200 in its short travel mode ( i . e ., only utilizing the first partial volume 227 ) would be undesirably reduced from its initial setting . rather , according to the preferred embodiments , the pressure in the second partial volume 229 preferably remains approximately equal to or less than the pressure in first partial volume 227 , since the check ball spring 284 creates only a small preload force . although the above - described valve assembly is preferred for its simplicity , reliability and low manufacturing cost , other valve arrangements may also be employed . for example , a needle - type valve body may be used in place of the check ball 282 . in an alternative arrangement , the cam surface 259 may directly contact the valve body ( e . g ., the check ball 282 ) and the cam follower 258 may be omitted . further , the above - described functions of the valve assembly do not necessarily have to be performed by a single valve arrangement . for example , a first valve arrangement may selectively connect and disconnect the first partial volume 227 and second partial volume 229 , while another valve arrangement provides the check valve function of preventing the pressure of the second partial volume 229 from becoming substantially greater than the pressure of the first partial volume 227 . [ 0059 ] fig1 illustrates a typical full - travel position of suspension unit 200 when travel adjust lever 252 is set in the long - travel mode , such that first partial volume 227 and second partial volume 229 are in full communication . similarly , fig1 illustrates a typical full - travel position of suspension unit 200 when travel adjust lever 252 is set in the short - travel mode , such that first partial volume 227 and second partial volume 229 are in not in communication . note that the overall compressed lengths of suspension unit 200 are different , with the length l 1 in fig1 being shorter than the length l 2 in fig1 . this will be explained with reference to fig1 . [ 0062 ] fig1 illustrates an example of the force - versus - travel relationships provided by suspension unit 200 in the two different selectable modes : the short - travel mode and the long - travel mode . in the long - travel mode , as shown by curve “ b ”, the force rises more gradually and reaches , in this example , a value of 750 pounds at a stroke distance of about 1 . 75 inches . in the short - travel mode , as shown by curve “ a ”, the force rises more rapidly and reaches a value of 750 pounds at a stroke distance of only about 1 . 27 inches , almost ½ inch less than the value for curve “ b ”. this relationship , of course , is the basis for describing the two modes as “ long - travel mode ” and “ short - travel mode ”. it should be explained that , although for simplicity in the above example a final external compression force of 750 pounds on the suspension unit 200 is assumed for both cases , this is only an approximation . a rigorous computer motion analysis of a specific situation , centering on the basic equation of motion f = ma ( force equals mass times acceleration ), would show some difference , but this analysis is generally quite complicated and the difference would generally be relatively small . thus , the above is a reasonably close approximation assuming that in both cases the vehicle upon which the suspension unit 200 is mounted is subjected to the same bump ( or other terrain feature ) and other conditions . additionally , it should be noted that at 1 . 27 inches of travel curve “ a ” is rising steeply . thus , even if the final force that occurs in the short - travel mode is somewhat greater than the 750 pounds used in the above example , final travel would still be significantly less than curve “ b ”. for example , even if the final force reached 1000 pounds , final travel would still only be slightly more than 1 . 40 inches . as a preferred embodiment of the present invention is as a shock absorber for a mountain bike , it is desirable that the final force is less than 3000 pounds , desirably , less than 2000 pounds and , more desirably , less than 1000 pounds . such an arrangement allows the air spring to withstand the impact forces resulting from traversing rough terrain with suspension arrangements presently incorporated on mountain bikes ( e . g ., wheel travel / shock travel ratio ). as will be appreciated by one of skill in the art , for other applications or suspension arrangements , the preferred final force may vary from the values recited above . in the context of mountain bike suspension assemblies , preferably , the first partial volume 227 is between about 1 and 8 cubic inches . desirably , the first partial volume 227 is between about 1 . 5 and 6 cubic inches and , more desirably , between about 2 and 4 cubic inches . preferably , the second partial volume 229 is between about 0 . 3 and 4 cubic inches . desirably , the second partial volume 229 is between about 0 . 4 and 3 cubic inches and , more desirably , between about 0 . 5 and 2 cubic inches . such an arrangement provides a desirable spring rate of the suspension unit 200 when utilizing only the first partial volume 227 , as well as when both the first partial volume 227 and second partial volume 299 are used to provide a spring force , for a substantial number of mountain bike applications . in at least a significant portion of mountain bike suspension applications , it is preferable that the suspension unit 200 provides between about 0 . 5 and 3 inches of suspension travel in the short travel mode ( i . e ., utilizing only the first partial volume 227 ). desirably , the suspension unit 200 provides between about 0 . 6 and 2 . 5 inches of travel and , more desirably , between about 0 . 75 and 2 inches of suspension travel in the short travel mode . further , preferably the suspension unit provides between about 0 . 6 and 5 inches of suspension travel in the long travel mode ( i . e ., utilizing both the first partial volume 227 and the second partial volume 229 ). desirably , the suspension unit 200 provides between about 0 . 8 and 4 inches of travel and , more desirably , between about 1 and 3 inches of suspension travel in the long travel mode . the range of values set forth above pertains to the relative movement between the two portions of the suspension unit 200 and the actual travel of the suspended bicycle wheel may vary from the travel of the suspension unit 200 . as described earlier , the differences between curve “ a ” and curve “ b ” result from the differences in initial chamber volume available during compression of the suspension unit 200 . with the travel adjust lever 252 set as in fig1 , the total volume of both the first partial volume 227 and the second partial volume 229 are available . with the travel adjust lever 252 set as in fig1 , only the volume of first partial volume 227 is available . these calculations are based on the well - known ideal gas law for isothermal processes , which is a good first approximation for illustrating the basic principles of the preferred embodiments . this law states that for an enclosed variable volume the internal pressure will vary with volume according to the equation : here is a simple example of this relationship . assuming the initial conditions of a sealed , variable chamber are 10 cubic inches of air at 100 psi , if the volume is then reduced to 5 cubic inches the pressure will increase to 200 psi . considered from another point of view , initial volume divided by final volume equals “ compression ratio ”. in this example the compression ratio is 10 divided by 5 , or a compression ratio of 2 . final pressure can be calculated by multiplying initial pressure times compression ratio : 100 psi times 2 = 200 psi . in the example of fig1 , 14 , and 15 , the initial first partial volume 227 of suspension unit 200 is 3 . 08 cubic inches , and the second partial volume 229 is 1 . 15 cubic inches . thus , their combined volume is 4 . 23 cubic inches , and the volume of first partial volume 227 alone is just 3 . 08 cubic inches . for the configuration of this example , volume displaced by the seal head 194 per inch of stroke is 1 . 65 cubic inches per inch . the following sample calculations are made using these values : for the configuration of fig1 , a compression ratio of 3 . 16 is reached at 1 . 75 inches of travel : for the configuration of fig1 , an almost identical compression ratio of 3 . 14 is reached at 1 . 27 inches of travel : for the configuration used in this example for suspension unit 200 , and assuming an initial pressure of 150 psi , these compression ratios translate to an air spring force in both cases of about 750 pounds . however , the actual air spring force may vary depending on the specific application . preferably , as described above , in the context of mountain bike suspension assemblies , the spring force is less than approximately 3000 pounds at a substantially fully compressed position of the air spring . this example , of course , is by way of illustration only , and a wide spectrum of desired relationships between compression ratio and travel , and of the ratio of travel achieved in the short travel mode with that achieved in the long travel mode , can be attained with the illustrated embodiments by designing a particular variable air spring with appropriate dimensional relationships . preferably , the percentage of travel achieved in the short travel mode with that achieved in the long travel mode is between about 40 and 90 percent . desirably , the percentage of travel achieved in the short travel mode with that achieved in the long travel mode is between about 50 and 85 percent and , more desirably , between about 60 and 80 percent . such a change in travel provides desirable suspension performance in both the short travel and long travel modes for at least a significant portion of typical suspension arrangements presently incorporated on mountain bikes . [ 0091 ] fig1 shows an alternate preferred embodiment . as discussed previously , this embodiment is somewhat simplified and less costly than the embodiment of fig6 . the embodiment of fig1 is possible for suspension units which are generally similar to that of fig6 but provided that no thru - shaft damping adjustment feature , such as shown in fig6 is required . as shown in fig1 , when a thru - shaft damping adjustment feature is not required , then the upper end of the shaft 393 becomes available for incorporation of the travel adjust feature . thus , the travel adjust valve in the embodiment illustrated in fig1 generally extends along a central axis a of the shock shaft 393 , which allows a simpler and more cost - effective structure . in this embodiment , the travel adjust assembly 350 uses the same travel adjust lever 252 as utilized previously . the actuating cam shaft 354 is similar to the previous actuating cam shaft 254 , but is somewhat longer . the upper eyelet housing 316 is similar to the previous upper eyelet housing 216 , but is somewhat simpler and less costly to produce due to elimination of the previously - required off - center upper passage port coupler 217 which was depicted in fig9 . the air cylinder partition 372 is similar to the previous air cylinder partition 272 , but it also is somewhat simpler and less costly to produce due in this case to elimination of the previously - required off - center lower passage port boss 273 which was depicted in fig1 . the lower passage port 374 and the upper passage port 319 , as shown , both consist of a cross - holes drilled in the shaft 393 . the upper passage port 319 further consists of drilled or milled passageways in the lower portion of the upper eyelet housing 316 which communicate with the drilled passageways in the shaft 393 . the other elements of the travel adjust assembly 350 as shown in fig1 are neither numbered nor described here since they are essentially identical to the elements numbered and described in the embodiment of fig6 . the present invention is not limited to the above embodiments and various changes may be made within the technical scope of the invention as understood by a person skilled in the art without departing from the spirit and scope thereof . | 5 |
fig1 depicts a system 100 including an electrical equipment rack 102 that supports a chassis 104 . the electrical equipment rack 102 includes a plurality of upright posts , such as post 106 , which are supported by a base 108 . paired roller slide assemblies 110 and 112 , form tracks that facilitate forward and rearward shifting motions shown by double headed arrow 114 . the roller slide assemblies 110 and 112 are bolted to the posts 106 at height intervals that permit installation of additional chassis above chassis 104 . as shown in fig1 chassis 104 is shifted fully forward for maintenance operations and in this position may be removed from the equipment rack 102 . full rearward motion exists when face 116 of chassis 104 is substantially even with front surface 118 of post 106 . the equipment rack 102 may have the standard dimensions and features defined by eia , or the dimensions of any other type of electrical equipment rack . the chassis 104 internally houses electrical equipment , such as a commercial or laboratory instrument , a telecommunications server or router , a computer , audio equipment , or any other form of electrical equipment . roller slide assembly 110 bolts to chassis 104 along interval 120 beneath a removable side 122 . chassis 104 does not include carry handles . there is insufficient clearance between the removable side 122 and post 106 such that , if side - protruding carry handles were installed , the handles would prevent full rearward motion of chassis 104 by abutting post 106 . fig1 a provides additional detail with respect to fig1 and the mounting of carry handle assemblies , such as carry handle assembly 124 . carry handle assembly 124 is shown in a storage position mounted on equipment rack 102 with handles 128 protruding inward . carry handle assembly 126 is shown in the process of being mounted for storage . carry handle assemblies 124 and 126 are intended for team - lifting use when mounted on a side of chassis 104 remote from side 122 . any number of carry handle assemblies 124 and 126 may be installed on chassis 104 for team lifting purposes . carry handle assemblies 124 and 126 are mounted on opposed wing brackets 132 and 134 after being telescopically adjusted to an overall length l . a shoulder screw 136 passes through a keyway 138 and fully engages slot - neck 140 with full lengthwise extension of carry handle assembly 126 to the overall length l . in this storage position , inwardly protruding handles 128 and 130 do not interfere with sliding motion of chassis 104 on roller slide assemblies 110 and 112 , for example , due to the increased width dimension afforded by front edge 142 of front post 144 . fig2 is an assembly view that depicts installation of carry handle assemblies 200 and 202 onto chassis 104 . the carry handle assemblies 200 and 202 are temporarily installed , as needed , for lifting chassis 104 onto and off of rack 102 . removable sides 122 and 204 slide rearwardly for removal from chassis 104 . a clip - mounted front panel 206 may be detached from chassis 104 by pulling the front panel 206 forward . the carry handle assemblies 202 and 204 are mirror images of one another . removal of the carry handle assemblies from chassis 104 comprises movements opposite those shown in fig2 . fig3 shows carry handle assembly 200 from a left side internal elevational perspective . carry handle assembly 200 is formed of a generally rectangular first segment 300 and a generally rectangular second segment 302 . the first segment 300 is made , for example , of sheet metal that is bent to form a pair of opposed lengthwise channels 304 and 306 , each forming a channel receptacle that receives a portion of a corresponding lengthwise shoulder 308 or 310 of the second segment 302 . thus , the second segment 302 is at least partially received in the lengthwise channels 304 and 306 to establish a telescoping interfit through which a variable overall length l of the carry handle assembly 200 can be adjusted by lengthwise shifting motion 312 of the second segment 302 within the lengthwise channels 304 and 306 . a pin 314 attached to the first segment 300 protrudes through a lengthwise slot 316 in the second segment 302 to prevent removal of the second segment 302 from the channels 304 and 306 . optional reinforcing panels 318 and 320 are respectively riveted to the corresponding first segment 300 and the second segment 302 to provide increased support for forces imparted by carry handles 322 and 324 . cross - member stiffeners 326 and 328 are riveted to the channels 304 and 306 to provide structural support between the channels 304 and 306 of first segment 300 . similarly , cross - member stiffeners 330 and 332 provide structural support between the shoulders 308 and 310 of second segment 302 . pin bolts 334 and 336 protrude forward of cross - member stiffener 326 to facilitate bolt - coupling of the first segment 300 with wing 338 of chassis 104 ( see fig1 and 2 ). a pin 340 protrudes outwardly from stiffener 332 a sufficient distance to slidingly engage raceway 343 in chassis 104 ( see fig2 ). apertures 344 and 346 are formed in the second segment 302 for receiving a spring - biased barrel bolt 348 that locks the carry handle assembly 200 into a fixed overall length l corresponding to the selective alignment of the spring - biased barrel bolt 348 with aperture 344 or aperture 346 . the capacity to vary the fixed overall length l in this manner , where the barrel bolt 348 is selectively engaged or disengaged , permits selective adjustment of the overall length l . locking the carry handle assembly 200 into the longest fixed overall length l prevents removal of the carry handle assembly from chassis 104 , as described in more detail below . the spring - biased barrel bolt 348 is biased towards insertion through one of the apertures 344 or 346 . a dogleg abutment 350 is riveted to the bottom of channel 306 to prevent installation of carry handle assembly 200 in an improper orientation with respect to chassis 104 . shoulder screws 352 and 353 engage keyways 342 and 354 in chassis 104 ( see fig2 ) at an overall length of full extension l to provide increased support for lifting operations . pin 340 protrudes a greater distance that do the shoulder screws 352 and 353 such that pin 340 engages raceway 343 prior to the insertion of shoulder screws 353 and 353 into keyways 343 and 354 . full lengthwise extension occurs with the shoulder screws 352 and 353 engaging keyways 342 and 354 while pin bolts 334 and 336 engage wing 338 , as shown in fig5 . the carry handle assembly 200 is locked into a fixed length l by the insertion of barrel bolt 348 into aperture 344 . from this position , the carry handle assembly 200 cannot be removed from chassis 104 unless the barrel bolt 348 is withdrawn from aperture 344 for telescoping contracture of segments 300 and 302 . a shorter stowage length l is produced by the insertion of barrel bolt 348 within aperture 346 , as shown for example in fig3 . fig4 shows the carry handle assembly 200 from a right side rear elevational perspective . this perspective shows external components of the barrel bolt 348 including a protruding segment 400 designed to be manually grasped . the carry handles 322 and 324 are optionally each identically formed of a central handle 402 connecting a pair of downwardly open u - brackets 404 and 406 . a pin 408 protrudes through each of the u - brackets 404 and 406 at the respective ends of handle 402 to permit pivoting motion of handle 402 along an arc 410 extending approximately 90 ° until , for example , a top surface 412 of handle 402 abuts the base 414 of u - bracket 404 to prevent further upward rotation of handle 402 along arc 410 . fig5 demonstrates the operation of dogleg abutment 350 in aligning carry handle assembly 200 with chassis 104 of fig1 . the dogleg abutment 350 drops below and passes across the lower extremity 500 of wing 338 . this feature prevents installation of carry handle assembly 200 in a backwards or upside down configuration . in operation , the carry handle assembly 200 is positioned against wing 338 . pin bolts 334 and 336 affix the first segment 300 to wing 338 , as shown in fig5 with the dogleg abutment assuring proper orientation of carry handle assembly 200 . the second section 302 is manually manipulated to slide lengthwise forming an overall length l with shoulder screw 352 positioned in slot 354 . with a plurality of carry handle assemblies , such as 124 , 126 , 200 , and 202 , installed , chassis 104 can be team - lifted from and onto the equipment rack 104 . when lifting is completed , the carry handle assemblies 124 , 126 , 200 , and 202 can be removed from chassis 104 and stowed on the equipment rack 102 , as shown in fig1 a . fig6 is a midsectional view that depicts the installation of pin - bolt 334 in stiffener 326 . the pin - bolt 334 is elongated along axis 600 in parallel the overall length l of carry handle assembly 200 . a rounded head 602 functions as a pin that may be grasped to rotate the pin - bolt 334 . a wrench may be used to turn hexagonal shoulder 604 if manual grasping of the head 602 exerts insufficient force for this rotation . the hexagonal shoulder 604 may also abut wing 338 , as shown in fig5 as the pin protrudes through wing 338 for retention of the first segment 300 on chassis 104 . a threaded base 606 is received in a press - fit nut 608 . alternatively , pin - bolts 334 and 336 may be replaced by threaded fasteners ; however , the installation described where lengthwise shifting of the carry handle assembly 200 locks the carry handle assembly in place on chassis 104 without the use of threaded fasteners is preferred for ease of use . the foregoing discussion is intended to illustrate the concepts of the invention by way of example with emphasis upon the preferred embodiments and instrumentalities . accordingly , the disclosed embodiments and instrumentalities are not exhaustive of all options or mannerisms for practicing the disclosed principles of the invention . the inventors hereby state their intention to rely upon the doctrine of equivalents in protecting the full scope and spirit of the invention . | 8 |
referring now to fig1 , a simplified crossbow 10 is provided with limbs 14 having a bow string 16 attached to the distal ends 18 of the limbs . a bolt 20 is inserted into the breach 22 of the crossbow in which bolt 20 has a nock 24 generally made of plastic which is adapted to be struck by bow string 16 when bow string 16 is released by trigger mechanism 26 , thus to project the bolt forward upon bow string release . the problem with such a nock construction is that the nock may fracture as illustrated at 30 with the slap of bow string 16 against the distal end of the nock . not only does the fracturing of the nock eliminate all loading on the bow string as it is released which can cause fracture it also can cause the bolt shown at 20 ′ to move off axis as illustrated by arrow 32 which can impact hunters or other people nearby , a clear safety problem . referring to fig2 , the problem with cross bows is that there is often a small but significant offset distance indicated by arrow 34 from the distal end 36 of nock 24 such that upon release of the bow string , the bow string rather than pushing against the nock impacts the nock in a slapping motion causing tremendous forces to be imparted to the nock which can cause nock failure and even dry fire . referring to fig3 , the dry fire situation is indicated in which a fractured nock 30 no longer provides a load on bow string 16 such that arms 14 of the crossbow may fracture as illustrated at 38 , again resulting in projectiles directed back at the hunter or archer or to individuals who may be in the immediate vicinity of the hunter . referring now to fig4 , in one embodiment a cylindrical nock support structure 40 is utilized to house a shock absorbing insert 42 . shock absorbing insert 42 in one embodiment is an injected moldable urethane in the form of a thermo polymer urethane or a thermo plastic urethane . upon slap of the bow string a force 44 is imparted to the distal end 46 of the insert which causes the insert to slightly deform as well as move as illustrated by arrow 48 in the direction of a light assembly 50 causing the light assembly to move in the direction of arrow 52 for activating a switch utilized to power the light assembly . it has been found that injection molded tpu is not permanently deformable but rather has a memory such that after impact of the bow string it moves back to its original position , in one embodiment having actuated an internally carried light source . further it is noted that support structure 40 which in one case is metal and preferably aluminum is inserted into a channel 54 in the distal end of a bolt here shown at 56 such that a unitary structure is provided with the metal support structure being inserted into channel 54 and extending aft to receive the injection molded tpu shock absorbing insert . typically a crossbow 10 shown in fig5 incorporates the mechanical advantage of a compound bow structure 60 to deliver a stress in the nock from the impact in excess of 7000 psi to the distal end of the bolt . this compound bow bowstring structure is generally indicated at 62 and is not described further other than to say that the amount of energy deliverable by the bow string of such an assembly is more than that necessary to fracture the traditional nock at the end of a bolt . referring now to fig6 , what is shown is a shock absorber 70 inserted into a cylindrical metal support structure 72 which is in turn inserted into a channel 74 in the bolt , with the bow string 76 adapted to contact an internal bow string receiving structure 78 to propel the bolt as a projectile in a forward direction when the bow string is released . as illustrated in fig7 , the injection molded portion 70 is shown having a cylindrical forward structure 80 which has projections 82 utilized to join this insert to the metalized support structure 72 of fig6 by insertion into orifices 73 in the support structure . as illustrated , the force imparted by the slap of the bow string is illustrated at 84 in terms of the arrows which impact first a transverse rib 86 which forms part of the shock absorber insert , with the force then tending towards the center of the insert as illustrated by arrows 88 . referring to fig8 , the interior of the insert moves as illustrated by double ended arrow 90 to act as a shock absorber as well as in one embodiment to activate an internally carried nock light assembly . in fig9 it can be seen that insert 70 is housed within metal support 72 such that it is able to move within this housing to provide the shock absorbing characteristics due to a flexible narrowed portion 75 . thus the shock absorbing insert is surrounded by a metal support structure to increase the structural rigidity and strength of the crossbow bolt nock . referring to fig9 , a more detailed view of the insert and nock structure is shown in which shock absorber 70 is shown carried by a metal support 72 which is inserted into a channel in bolt 20 , whereas in fig1 the resilient shock absorber 70 is shown having an overall nock structure shown by notch 96 which has internal to the notch a transverse rib 78 adapted to be struck by the bow string . referring to fig1 , the assembled structure with the resilient shock absorber insert and the metal support 72 is illustrated in which as illustrated in fig1 the resilient shock absorber insert 70 to be placed into a metal structure 72 has the aforementioned projections 82 which are adapted to lock into metal support 72 . while the present invention has been described in connection with the preferred embodiments of the various figures , it is to be understood that other similar embodiments may be used or modifications or additions may be made to the described embodiment for performing the same function of the present invention without deviating therefrom . therefore , the present invention should not be limited to any single embodiment , but rather construed in breadth and scope in accordance with the recitation of the appended claims . | 5 |
the therapeutic agent or the prophylactic agent for neuropathic pain comprises as effective ingredients a cyclohexane derivative represented by formula ( i ) below or a pharmaceutically acceptable salt thereof or a prodrug thereof , and a calcium channel α2δ ligand : wherein a is a substituent represented by formula ( iia ) or ( iib ): r 1 and r 2 are each independently a hydrogen atom , a chlorine atom , a c 1 - c 3 haloalkyl group , a c 1 - c 4 alkyl group or a c 1 - c 4 alkoxy group ; r 3 is a hydrogen atom or a chlorine atom ; r 4 is a fluorine atom , a hydroxymethyl group or a hydroxyl group ; r 5 and r 6 are each independently a hydrogen atom , a fluorine atom , a c 1 - c 3 haloalkyl group , a carboxyl group , a methoxycarbonyl group , an ethoxycarbonyl group , a c 1 - c 4 alkoxy group , a hydroxyl group or a c 2 - c 5 alkylcarbonyloxy group , or r 5 and r 6 may optionally together form an oxo group ; r 7 and r 8 are each independently a hydrogen atom or a fluorine atom ; y is an oxygen atom or a sulfur atom ; and z is a nitrogen atom or a methine group . the term “ c 1 - c 4 alkyl group ” means a linear , branched or cyclic alkyl group having 1 to 4 carbon atoms , and examples thereof include a methyl group , an ethyl group , an n - propyl group , an isopropyl group , a cyclopropyl group , a cyclopropylmethyl group , an n - butyl group , a sec - butyl group and a tert - butyl group . the term “ c 1 - c 4 alkoxy group ” means a linear , branched or cyclic alkyl - oxy group having 1 to 4 carbon atoms , and examples thereof include a methoxy group , an ethoxy group , an n - propyloxy group , an isopropyloxy group , a cyclopropyloxy group , an n - butoxy group , a sec - butoxy group and a tert - butoxy group . the term “ c 1 - c 3 haloalkyl group ” means a linear alkyl group having 1 to 3 carbon atoms wherein a part or all of the hydrogen atoms on the group are replaced by a halogen atom ( s ) ( the halogen atom means a fluorine atom , a chlorine atom , a bromine atom or an iodine atom ), and examples thereof include a monochloromethyl group , a monofluoromethyl group , a difluoro - methyl group , a trifluoromethyl group , a trichloromethyl group and a pentafluoroethyl group . examples of the “ c 2 - c 5 alkylcarbonyloxy group ” include an acetyloxy group , an ethanoyloxy group , a propanoyloxy group , an isopropanoyloxy group , a butanoyloxy group , an isobutanoyloxy group and a pivaloyloxy group . in formula ( i ), a is preferably formula ( ha ); y is preferably an oxygen atom ; and z is preferably a methine group . r 1 is preferably a hydrogen atom , a chlorine atom , a trifluoromethyl group , a methyl group , an ethyl group , an n - propyl group , an isopropyl group , a methoxy group , an ethoxy group , an n - propyloxy group or an isopropyloxy group , more preferably a trifluoromethyl group , a methyl group or a methoxy group , and still more preferably a methyl group . r 2 is preferably a hydrogen atom , a chlorine atom , a trifluoromethyl group , a methyl group , an ethyl group , an n - propyl group , an isopropyl group , a methoxy group , an ethoxy group , an n - propyloxy group or an isopropyloxy group , and more preferably a methoxy group . r 3 is preferably a hydrogen atom ; and r 4 is preferably a hydroxymethyl group or a hydroxyl group , and more preferably a hydroxyl group . r 5 is preferably a hydrogen atom , a fluorine atom , a trifluoromethyl group , a carboxyl group , a methoxy group , an ethoxy group , an n - propyloxy group , an isopropyloxy group , a hydroxyl group , an acetyloxy group , a propanoyloxy group , a butanoyloxy group or an isobutanoyloxy group , more preferably a hydrogen atom , a hydroxyl group or a carboxyl group , and still more preferably a hydroxyl group . r 6 is preferably a hydrogen atom , a fluorine atom , a trifluoromethyl group , a carboxyl group , a methoxy group , an ethoxy group , an n - propyloxy group , an isopropyloxy group , a hydroxyl group , an acetyloxy group , a propanoyloxy group , a butanoyloxy group or an isobutanoyloxy group , more preferably a hydrogen atom or a hydroxyl group , and still more preferably a hydrogen atom . r 5 and r 6 may optionally together form an oxo group . r 7 and r 8 are each preferably a hydrogen atom . among cyclohexane derivatives represented by formula ( i ) or pharmaceutically acceptable salts thereof or prodrugs thereof ( hereinafter referred to as compound ( i )), preferred specific examples are shown in table 1 , but our therapeutic agents are not so limited . examples of the calcium channel α2δ ligand to be used in combination with compound ( i ) include pregabalin ( s -(+)- 4 - amino - 3 -( 2 - methylpropyl ) butanoic acid or ( s )- 3 -( aminomethyl )- 5 -( methylhexanoic acid )) and gabapentin ( 1 -( aminomethyl )- cyclohexaneacetic acid or 2 -[ 1 -( aminomethyl ) cyclohexane ] acetic acid ), and pharmaceutically acceptable salts thereof and prodrugs thereof . pregabalin or gabapentin is preferred , and pregabalin is more preferred . examples of the “ pharmaceutically acceptable salt ” include inorganic acid salts such as hydrochloric acid salt , sulfuric acid salt , phosphoric acid salt and hydrobromic acid salt ; organic acid salts such as oxalic acid salt , malonic acid salt , citric acid salt , fumaric acid salt , lactic acid salt , malic acid salt , succinic acid salt , tartaric acid salt , acetic acid salt , trifluoroacetic acid salt , maleic acid salt , gluconic acid salt , benzoic acid salt , ascorbic acid salt , methane - sulfonic acid salt , p - toluenesulfonic acid salt and cinnamic acid salt ; inorganic base salts such as sodium salt , potassium salt , calcium salt , magnesium salt and ammonium salt ; and organic base salts such as methylamine salt , diethylamine salt , trimethylamine salt , triethylamine salt , pyridinium salt , triethanolamine salt , ethylenediamine salt and guanidine salt . further , compound ( i ) may form a hydrate or a solvate , and crystalline polymorphs are also included therein . compound ( i ) may be synthesized , for example , according to a method as described in wo 10 / 050577 . the calcium channel α2δ ligand may be synthesized , for example , according to a method as described in jp 51 - 88940 a , jp 7 - 508288 a or jp 2004 - 536873 a . a therapeutic agent or a prophylactic agent for neuropathic pain which comprises as effective ingredients compound ( i ) and a calcium channel α2δ ligand also exhibits an excellent analgesic effect when administered to a mammal other than humans . examples of mammals other than humans include mice , rats , hamsters , rabbits , cats , dogs , bovines , sheep and monkeys . examples of the “ neuropathic pain ” include cancer pain , herpetic pain , postherpetic neuralgia , aids - related neuralgia , trigeminal neuralgia and diabetic neuropathic pain . as for a mode of administration of a therapeutic agent or a prophylactic agent for neuropathic pain which comprises as effective ingredients compound ( i ) and a calcium channel α2δ ligand , a mixture of both ingredients , i . e ., a combination drug of both may be administered orally or parenterally as it is or after further combining it with a carrier which is acceptable as a pharmaceutical . alternatively , compound ( i ) and a calcium channel α2δ ligand may be individually prepared as single drugs , not as a combination drug , and then these may be administered at the same time as they are or after further combining each of them with a carrier which is acceptable as a pharmaceutical . furthermore , the individual single drugs may also be administered such that either one of the single drugs is administered after the other at an appropriate interval . in these cases , the dosage forms and the administration routes of the individual single drugs do not need to be same , and may be different from each other . the “ appropriate interval ” as mentioned above may be confirmed clinically or by animal experiments . examples of the dosage form include compound ( i ) and a calcium channel α2δ ligand orally administered as individual single drugs or as a combination drug include tablets ( including sugar coated tablets and film coated tablets ), pills , granules , powders , capsules ( including soft capsules and microcapsules ), syrups , emulsions and suspensions ; and examples of the dosage form include parenteral administration include injection solutions , impregnating agents , drops and suppositories . furthermore , it is also effective to combine the effective ingredient ( s ) with an appropriate base ( for example , a polymer of butyric acid , a polymer of glycolic acid , a copolymer of butyric acid - glycolic acid , a mixture of a polymer of butyric acid and a polymer of glycolic acid , a polyglycerol fatty acid ester or the like ) to form a sustained release formulation ( s ). preparation of single drugs or a combination drug of compound ( i ) and a calcium channel α2δ ligand in the above - mentioned dosage form may be carried out according to known production methods commonly used in the field of formulation of pharmaceuticals . in this case , the drugs may be produced such that an excipient , a binder , a lubricant , a disintegrator , a sweetener , a surfactant , a suspending agent , an emulsifier and / or the like which is ( are ) commonly used in the field of formulation of pharmaceuticals is ( are ) contained therein as required . single drugs or a combination drug of compound ( i ) and a calcium channel α2δ ligand may be prepared in the form of tablets such that an excipient , a binder , a disintegrator , a lubricant and / or the like is ( are ) contained therein ; or in the form of pills or granules such that an excipient , a binder , a disintegrator and / or the like is ( are ) contained therein . in addition , the single drugs or the combination drug may be prepared in the form of powders or capsules such that an excipient and / or the like is contained therein , in the form of syrups such that a sweetener and / or the like is contained therein , or in the form of emulsions or suspensions such that a surfactant , a suspending agent , an emulsifier and / or the like is ( are ) contained therein . examples of the above - mentioned excipient include lactose , glucose , starch , sucrose , microcrystalline cellulose , powdered glycyrrhiza , mannitol , sodium hydrogen carbonate , calcium phosphate and calcium sulfate . examples of the above - mentioned binder include a starch paste solution , a gum arabic solution , a gelatin solution , a tragacanth solution , a carboxymethylcellulose solution , a sodium alginate solution and glycerin . examples of the above - mentioned lubricant include magnesium stearate , stearic acid , calcium stearate and purified talc . examples of the above - mentioned sweetener include glucose , fructose , invert sugar , sorbitol , xylitol , glycerin and simple syrup . examples of the above - mentioned surfactant include sodium lauryl sulfate , polysorbate 80 , sorbitan monofatty acid ester and polyoxyl 40 stearate . examples of the above - mentioned suspending agent include gum arabic , sodium alginate , sodium carboxymethylcellulose , methylcellulose and bentonite . examples of the above - mentioned emulsifier include gum arabic , tragacanth , gelatin and polysorbate 80 . in addition , in the preparation of single drugs or a combination drug of compound ( i ) and a calcium channel α2δ ligand in the above - mentioned dosage form , a colorant , a preservative , an aromatic , a corrigent , a stabilizer , a thickener and / or the like which is ( are ) commonly used in the field of formulation of pharmaceuticals may be added therein . the daily dose of the formulation which comprises a calcium channel α2δ ligand varies depending on the conditions and the body weight of the patient , the type of the inhibitor , the administration route and / or the like . for example , when gabapentin is orally administered , it is preferred that administration be carried out at an amount of 10 to 3600 mg per adult ( body weight : about 60 kg ), once or up to three times dividedly and , when pregabalin is orally administered , it is preferred that administration be carried out at an amount of 5 to 600 mg per adult ( body weight : about 60 kg ), once or up to three times dividedly . with regard to the daily dose of the formulation which comprises compound ( i ), for example , when the formulation is orally administered , it is preferred that administration be carried out at an amount of 1 to 1000 mg per adult ( body weight : about 60 kg ), once or up to three times dividedly and , when the formulation is parenterally administered , it is preferred that , if the formulation is injection solution , administration be carried out at an amount of 0 . 01 to 100 mg per 1 kg of body weight by intravenous injection . our therapeutic agents will now be described more concretely by way of an example thereof . however , this disclosure is not restricted to the exampled below . combined effect of compound ( i ) and calcium channel α2δ ligand in mouse neuropathic pain model 7 to 8 male icr mice of 5 weeks old were used as one experimental group for evaluation . mouse models of neuropathic pain were prepared according to seltzer &# 39 ; s method ( seltzer et al ., pain , 1990 , vol . 43 , p . 205 ; malmberg et al ., pain , 1998 , vol . 76 , p . 215 ). that is , the sciatic nerve at the femoral region of the right hindlimb of each mouse was exposed under anesthesia , and the sciatic nerve was triply ligated tightly with silk suture of 8 - 0 ( natsume seisakusho ) under microscope so that only half thickness of the nerve was trapped in the ligature . as a test compound , 1 -( 1 -( 4 - methoxyphenyl )- 5 -( p - tolyl )- 1h - pyrazol - 3 - yl ) cyclohex - an - cis - 1 , 4 - diol ( hereinafter referred to as compound 3 ), which was represented by the following formula and included in compound ( i ), was selected . the mouse models of neuropathic pain were split into 4 groups : a group treated with vehicle ( vehicle in fig1 and fig2 ), a group treated with 3 mg / kg pregabalin alone ( pregabalin in fig1 and fig2 ), a group treated with 0 . 3 mg / kg compound 3 alone ( compound 3 in fig1 and fig2 ), and a group concomitantly treated with 3 mg / kg pregabalin and 0 . 3 mg / kg compound 3 ( pregabalin + compound 3 in fig1 and fig2 ). seven days after the above - described sciatic nerve ligation , using 0 . 5 % methylcellulose as a vehicle , mice of each group received administration of vehicle , administration of a suspension of pregabalin ( 3 mg / kg ) alone , administration of a suspension of compound 3 ( 0 . 3 mg / kg ) alone , or administration ( combined administration ) of a mixed suspension of pregabalin and compound 3 ( 3 mg / kg and 0 . 3 mg / kg , respectively ). evaluation of neuropathic pain ( hereinafter “ von frey test ”) was carried out as follows . mouse models of neuropathic pain were conditioned for at least 1 hour in an acryl cage for measurement ( natsume seisakusho ) placed on a wire net . thereafter , using a filament ( north coast medical . inc .) which exerted a pressure of 0 . 16 g , the mice were subjected to mechanical tactile stimulus by applying the filament to the plantar surface of both hindpaws 3 times , each for 3 seconds , with an interval of 3 seconds . the withdrawal response observed during each mechanical tactile stimulus was scored ( 0 , no response ; 1 , showed slow and / or slight withdrawal response in response to the stimulation ; 2 , showed quick withdrawal response without flinching ( shaking paws quickly and continuously ) nor licking ( licking paws ) in response to the stimulation ; 3 , showed quick withdrawal response with flinching and / or licking ), and the sum of the scores obtained in the triplicate trials were used as a total score . seven days after sciatic nerve ligation , a von frey test was carried out before administration of the test compound , 1 hour after administration , 2 hours after administration , and 3 hours after administration . change in the total scores from before to after administration of the test compound ( hereinafter “ δvf test score ”) was calculated by subtracting the total score obtained at each time point after administration of the test compound from the total score obtained before administration of the test compound , which was used as an indicator of analgesic effect . a theoretical total value , which was the theoretical δvf test score calculated on the assumption that combined use of compound 3 and pregabalin exhibited no more than an additive analgesic effect , was calculated based on the δvf test scores obtained when compound 3 or pregabalin was administered alone . that is , individual δvf test scores of the mice in the group treated with pregabalin alone and the mice in the group treated with compound 3 alone were sorted in ascending order , respectively , and δvf test scores of the two groups at the same rank were added , thereby obtaining a theoretical total value . results of the evaluation are shown in fig1 , fig2 - a and fig2 - b . in the figures , the vertical axis shows the δvf test score of the von frey test , and a higher score indicates a stronger analgesic effect . the horizontal axis of fig1 shows time after administration of the test compound , and that of fig2 shows how each group was treated . statistical comparison between the group treated with vehicle and the groups treated with drugs at each time point was carried out using dunnett &# 39 ; s test since interactions between group and time were found to be significant by two - way anova ( with a level of significance of less than 5 %). the symbol # in the figures indicates a significant difference (### p & lt ; 0 . 001 ) from the group treated with vehicle . statistical comparison between the group concomitantly treated with 3 mg / kg pregabalin and 0 . 3 mg / kg compound 3 ( pregabalin + compound 3 in fig2 ) and the theoretical total value was carried out using student &# 39 ; s t - test since variances were found to be equal by f - test ( with a level of significance of less than 5 %). the symbol * in the figures indicates a significant difference (* p & lt ; 0 . 05 , ** p & lt ; 0 . 01 ) from the theoretical total value . in the group treated with 3 mg / kg pregabalin alone ( pregabalin in fig1 and fig2 ), an analgesic effect was not observed at any time points of 1 hour , 2 hours and 3 hours after administration . also , in the group treated with 0 . 3 mg / kg compound 3 alone ( compound 3 in fig1 and fig2 ), an analgesic effect was not observed at any time points of 1 hour , 2 hours and 3 hours after administration . on the other hand , in the concomitant treatment group ( pregabalin + compound 3 in fig1 and fig2 ), a strong analgesic effect was observed 1 hour and 2 hours after administration with a statistical significance when compared to the vehicle treatment group ( vehicle in fig1 and fig2 ). furthermore , a statistically significant difference was found between the theoretical total value ( theoretical total value in fig2 ) and the concomitant treatment group ( pregabalin + compound 3 in fig2 ) at time points of both 1 hour and 2 hours after administration . these results clearly indicate that compound ( i ) and a calcium channel α2δ ligand synergistically enhance their analgesic effects each other when used in combination . combined effect of compound ( i ) and calcium channel α2δ ligand in mouse wheel running test 8 male ddy mice of 5 weeks old were used as one experimental group for evaluation . the test compound , grouping of mice , vehicle used and administration method were the same as in example 1 . mice were placed in a running wheel apparatus ( natsume seisakusho ) 0 . 5 hour after administration of the test compound , and the number of revolutions of the running wheel was counted for a period of 1 hour immediately thereafter to evaluate a motor inhibitory effect . results of the evaluation are shown in fig3 . the vertical axis shows the number of revolutions in the wheel running test . a higher value indicates that mice are more physically - active . the horizontal axis shows how each group was treated . statistical comparison between the vehicle treatment group ( vehicle in fig3 ) and the drug treatment groups was carried out using student &# 39 ; s t - test since variances were found to be equal by f - test ( with a level of significance of less than 5 %). no statistically - significant motor inhibitory effect was found in the group treated with 3 mg / kg pregabalin alone ( pregabalin in fig3 ) and in the group treated with 0 . 3 mg / kg compound 3 alone ( compound 3 in fig3 ). further , no statistically - significant motor inhibitory effect was found also in the group concomitantly treated with 3 mg / kg pregabalin and 0 . 3 mg / kg compound 3 ( pregabalin + compound 3 in fig3 ). these results clearly indicate that the central nervous system does not adversely affected by combined use of compound ( i ) and a calcium channel α2δ ligand each in a dose not adversely affecting the central nervous system . effect of calcium channel α2δ ligand in mouse models of neuropathic pain in the same manner as in example 1 , effects of oral administration of 1 , 3 , 10 and 30 mg / kg pregabalin alone were evaluated 1 hour after administration in mouse models of neuropathic pain . results of the evaluation are shown in fig4 . statistical comparison between the group treated with vehicle ( vehicle in fig4 ) and the groups treated with pregabalin ( pregabalin 1 mg / kg , pregabalin 3 mg / kg , pregabalin 10 mg / kg and pregabalin 30 mg / kg in fig4 ) was carried out using a williams test ( one - way ) since variances were found to be equal by a bartlett test ( with a level of significance of less than 5 %). the symbol * in the figure indicates a significant difference (* p & lt ; 0 . 025 ) from the group treated with vehicle . no analgesic effect was observed when 1 or 3 mg / kg of pregabalin was orally administered alone . on the other hand , a statistically - significant analgesic effect was observed when 10 or 30 mg / kg of pregabalin was orally administered alone . in addition , the analgesic effect of 30 mg / kg pregabalin was about the same level as that of the combined administration of 3 mg / kg pregabalin and 0 . 3 mg / kg compound 3 . effect of calcium channel α2δ ligand in mouse wheel running test in the same manner as in example 2 , motor inhibitory effects of oral administration of 30 and 100 mg / kg pregabalin were evaluated . results of evaluation are shown in fig5 . statistical comparison between the group treated with vehicle ( vehicle in fig5 ) and the groups treated with 30 and 100 mg / kg pregabalin ( pregabalin 30 mg / kg and pregabalin 100 mg / kg in fig5 , respectively ) was carried out using a williams test ( one - way ) since variances were found to be equal by a bartlett test ( with a level of significance of less than 5 %). the symbol * in the figure indicates a significant difference (* p & lt ; 0 . 025 ) from the group treated with vehicle . oral administration of 30 or 100 mg / kg pregabalin alone statistically significantly reduced the number of revolutions , thereby confirming a motor inhibitory effect . our agents include as effective ingredients compound ( i ) and a calcium channel α2δ ligand , and can be used as a pharmaceutical , especially as a therapeutic agent or a prophylactic agent for neuropathic pain . | 0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.