Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
for a better understanding of the present invention , together with other and further features and advantages thereof , reference is made to the following description , taken in conjunction with the accompanying drawings , and the scope of the invention will be pointed out in the appended claims . it will be readily understood that the components of the present invention , as generally described and illustrated in the figures herein , may be arranged and designed in a wide variety of different configurations . thus , the following more detailed description of the embodiments of the apparatus , system , and method of the present invention , as represented in fig1 through 3 , is not intended to limit the scope of the invention , as claimed , but is merely representative of selected embodiments of the invention . reference throughout this specification to “ one embodiment ” or “ an embodiment ” ( or the like ) means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention . thus , appearances of the phrases “ in one embodiment ” or “ in an embodiment ” in various places throughout this specification are not necessarily all referring to the same embodiment . furthermore , the described features , structures , or characteristics may be combined in any suitable manner in one or more embodiments . in the following description , numerous specific details are provided , such as examples of programming , software modules , user selections , network transactions , database queries , database structures , hardware modules , hardware circuits , hardware chips , etc ., to provide a thorough understanding of embodiments of the invention . one skilled in the relevant art will recognize , however , that the invention can be practiced without one or more of the specific details , or with other methods , components , materials , etc . in other instances , well - known structures , materials , or operations are not shown or described in detail to avoid obscuring aspects of the invention . the illustrated embodiments of the invention will be best understood by reference to the drawings , wherein like parts are designated by like numerals or other labels throughout . the following description is intended only by way of example , and simply illustrates certain selected embodiments of devices , systems , and processes that are consistent with the invention as claimed herein . referring now to fig1 , there is depicted a block diagram of an illustrative embodiment of a computer system 12 . the illustrative embodiment depicted in fig1 may be a notebook computer system , such as one of the thinkpad ® series of personal computers sold by lenovo ( us ) inc . of morrisville , n . c ., however , as will become apparent from the following description , the present invention is applicable to any data processing system . notebook computers may alternatively be referred to as “ notebooks ”, “ laptops ”, “ laptop computers ” or “ mobile computers ” herein , and these terms should be understood as being essentially interchangeable with one another . as shown in fig1 , computer system 12 includes at least one system processor 42 , which is coupled to a read - only memory ( rom ) 40 and a system memory 46 by a processor bus 44 . system processor 42 , which may comprise one of the amd ™ line of processors produced by amd corporation or a processor produced by intel corporation , is a general - purpose processor that executes boot code 41 stored within rom 40 at power - on and thereafter processes data under the control of operating system and application software stored in system memory 46 . system processor 42 is coupled via processor bus 44 and host bridge 48 to peripheral component interconnect ( pci ) local bus 50 . pci local bus 50 supports the attachment of a number of devices , including adapters and bridges . among these devices is network adapter 66 , which interfaces computer system 12 to a lan , and graphics adapter 68 , which interfaces computer system 12 to display 69 . communication on pci local bus 50 is governed by local pci controller 52 , which is in turn coupled to non - volatile random access memory ( nvram ) 56 via memory bus 54 . local pci controller 52 can be coupled to additional buses and devices via a second host bridge 60 . computer system 12 further includes industry standard architecture ( isa ) bus 62 , which is coupled to pci local bus 50 by isa bridge 64 . coupled to isa bus 62 is an input / output ( i / o ) controller 70 , which controls communication between computer system 12 and attached peripheral devices such as a keyboard and mouse . in addition , i / o controller 70 supports external communication by computer system 12 via serial and parallel ports . a disk controller 72 is in communication with a disk drive 200 . of course , it should be appreciated that the system 12 may be built with different chip sets and a different bus structure , as well as with any other suitable substitute components , while providing comparable or analogous functions to those discussed above . indicated at 202 is a me ( management engine ) which may be employed in accordance with at least one presently preferred embodiment of the present invention . me &# 39 ; s , as currently evolving ( examples of which are being manufactured by intel ), are inclusive of several useful components that previously were operationally segregated . by integrating such components operationally , they can be more readily and flexibly managed to address contingent problems such as shutting down at least portions of a computer when the computer is in the hands of an unauthorized user . with regard to the system 12 shown in fig1 , the me may be located on the isa bus 62 as shown . it should be understood that the system 12 of fig1 provides but one illustrative and non - restrictive example among a very wide variety of systems that can employ an me in accordance with embodiments of the present invention . as shown schematically in fig2 , me 202 may preferably include a trusted platform module ( tpm ) 204 , active management technology ( amt ) 206 ( which preferably is embodied by intel amt , or iamt ) and one or more security - based components 208 such as ( but of course not limited to ) fingerprint matching software . it will be noted , for the purposes of ongoing discussion herein , that those amt &# 39 ; s ( and related software ) and tpm &# 39 ; s as manufactured by intel are often referred to as “ iamt ” and “ itpm ” background information regarding amt may be found at www . intel . com / software . amt2 , while background information regarding tpm &# 39 ; s may be found at the trusted computing group website , www . trustedcomputinggroup . org . background information on fingerprint readers and software may be found at http :// www . pc . ibm . com / us / security / fingerintreader . html . it should be appreciated an amt enabled computer , such as iamt enabled computer , will contain a management engine ( me ) which comprises a service processor , dedicated firmware for the service processor , and logic in an ethernet and / or 802 . 11 and / or wan controller to allow the me to talk to other locations across the internet even when the system is off , as these parts will always have power ( i . e ., very little power is required ). accordingly , one may send items to the me 202 , and it can process and return items irrespective of whether the main operating system ( os ) is running or not running . thus , me 202 enables contact with a network even when the system is technically off . preferably , me 202 is configured to disable one or more critical components of system 12 responsive to commands received from a network 210 ( e . g ., from a “ mother ” computer or system connected into network 210 ). the network interface can be realized directly or indirectly via essentially any suitable arrangement , e . g ., a network adapter such as that indicated at 66 in fig1 . as such , and as alluded to hereinabove , me 202 will preferably be in a position to activate or deactivate any of several security arrangements which themselves have hitherto been functionally segregated . accordingly , me 202 preferably is configured to disable either or both of the following : an authorization key 212 associated with tpm 204 and the functionality of security - based component 208 ( e . g ., fingerprint matching software , which interacts with a fingerprint reader to enable some level of access to system 12 , e . g ., via release of a hard - disk password responsive to a positive fingerprint match ). other types of security - based components could include , but certainly are not limited to , iris readers and power - on passwords . as such , me 202 facilitates the communication with a network that would enable commands to be received to disable either or both of tpm 204 and security - based component 208 as just described , and also applies such commands within the me 202 to carry out the disabling action itself . preferably , the authorization key 212 associated with tpm 204 is a storage root key ( srk ), itself well - known and described in detail at the above - referenced trusted computing group website . as is known , an srk is a critical encryption key that controls and enables all other encryption keys associated with a tpm ; accordingly , by shutting down any functionality of srk 212 , it will not be possible for an unauthorized user to decrypt any other keys ( herein , indicated at 212 a ) of tpm 204 . ( essentially , the srk 212 serves as a “ private ” portion of a “ public / private ” key pair , wherein the “ public ” portion is a function - specific key also contained within the tpm 204 . the non - srk keys 212 a of the tpm 204 will thus be rendered completely useless [ preferably through action of iamt 206 ] if not able to be paired with the srk 212 by whatever means that an unauthorized user might attempt .) likewise , security - based component 208 can be suitably disabled by amt 206 me 202 in response to a command received by amt 206 over network 210 . as such , for example , amt 206 can shut down any fingerprint matching or authorization software to avert the possibility that an authorized user &# 39 ; s genuine fingerprint ( s ) were unknowingly expropriated to help an unauthorized user gain access to system 12 . it will be appreciated from the foregoing that , in accordance with at least one presently preferred embodiment of the present invention , there is broadly contemplated the selective remote disabling of a computer system when the computer system is connected to a network . ( the network connection , for its part , could conceivably be hard - wired or wireless .) this disabling takes place without the need to boot the system ( i . e ., without the system &# 39 ; s full processing power ). fig3 schematically illustrates a process for undertaking the actions described hereinabove . the process starts when , after theft or inadvertent removal or misplacement , a system is connected to a network ( 320 ). at a “ mother ” computer or system , a singular call or periodic calls ( 322 ) are sent out ( via known arrangements ) to ascertain that the system is indeed connected . if ( 324 ) indeed a connection ( or interface ) of the sought system is detected , then a command is sent to the system to disable one or more critical components as discussed heretofore ( 326 ). finally , the system will preferably send a return signal ( 328 ) to confirm that the disablement is complete . by way of further elaboration and clarification , it is conceivable to disable one critical component , more than one critical component , or all available critical components via methods and arrangements as broadly contemplated herein . thus , drawing on the example of fig2 , a srk 212 could be disabled , a security - based component 208 ( such as fingerprint matching software ) could be disabled , or both could be disabled ( possibly in addition to one or more other critical components that might be disabled ). by way of further background information , software which enables a computer system to make itself known to a network once connected to a network is well known ; for example , absolute software manufactures “ computrace ” software for this purpose . “ computrace ” also requires a bios to boot , however , whereas solutions in accordance with at least one embodiment of the present invention do not require bios and can work with the system being off as long as the iamt system is running . this is software that is difficult to remove from a system but , once the system is connected into a network , nonetheless enables contact with a “ mother ” computer or system on the network without the need for system booting . it is to be understood that the present invention , in accordance with at least one presently preferred embodiment , includes elements that may be implemented on at least one general - purpose computer running suitable software programs . these may also be implemented on at least one integrated circuit or part of at least one integrated circuit . thus , it is to be understood that the invention may be implemented in hardware , software , or a combination of both . if not otherwise stated herein , it is to be assumed that all patents , patent applications , patent publications and other publications ( including web - based publications ) mentioned and cited herein are hereby fully incorporated by reference herein as if set forth in their entirety herein . although illustrative embodiments of the present invention have been described herein with reference to the accompanying drawings , it is to be understood that the invention is not limited to those precise embodiments , and that various other changes and modifications may be affected therein by one skilled in the art without departing from the scope or spirit of the invention .	6
referring to the figures , wherein like numerals indicate like parts throughout the several views , a piling assembly for a building is shown generally at 100 . the piling assembly 100 comprises a lower piling 112 hingedly connected to an upper piling 130 . the lower piling has a first and a second end 114 , 116 with a first longitudinal axis 118 extending therethrough . the upper piling 130 has a column 132 with a second longitudinal axis 134 extending therethrough . a reinforcing cage 120 extends between the ends 114 , 116 and concrete 122 encases the cage 120 . many types of reinforcing cages 120 are known in the area of pilings . one type of reinforcing cage 120 is shown in fig1 a . here , a plurality of vertically extending reinforcing rods 123 defines the perimeter of the reinforcing cage 120 . a plurality of reinforcing hoops 121 , formed from wire or rods , are rigidly connected to the vertically extending reinforcing rods 123 at the inside of the perimeter of the reinforcing cage 120 to provide additional reinforcement . the rods 123 are rigidly connected to a plurality of horizontally placed rods 125 to form a footing 127 . in one aspect of the present invention , shown in fig1 b , the lower piling 112 is pre - cast off - site and transported to the job site . a plurality of thru - holes 133 can be pre - cast into the concrete 122 to attach various framing pieces f , concrete anchors , etc . to the lower piling 112 . typically , a hole is dug into the earth for receiving a portion of the lower piling 112 . following excavation of the hole , the second end 116 , and a portion of the lower piling 112 , is buried below ground . finally , the hole is back filled with dirt , concrete or any other suitable material . to provide an attachment scheme for the upper piling 130 , a lower hinge 124 extends from the first end 114 and defines at least one lower first hole 126 on a first axis 128 that is spaced from the first end 114 . the upper piling 130 has a column 132 and a second longitudinal axis 134 extending therethrough . typically , the column 132 is comprised of wood , steel , aluminum or a composite . the upper hinge 136 extends from the column 132 and defines at least one upper first hole 138 on the first axis 128 . the lower hinge 124 also defines a lower second hole 148 , on a second axis 150 which is spaced transversely across the lower piling 112 from the lower first hole 126 and spaced from the first end 114 . the upper hinge 136 also defines an upper second hole 152 , on the second axis 150 , which is spaced transversely across the upper piling 130 from the upper first hole 138 . in the early stages of building construction , the upper and lower hinges 136 , 124 are partially interleaved , as shown in fig2 , such that only a first pin 144 connects the upper hinge 136 to the lower hinge 124 , along the first axis 128 , and the second longitudinal axis 134 , for the upper piling 130 , is at an angle to the first longitudinal axis 118 , for the lower piling 112 . as a result , the columns 132 for the building can set tilted onto the ground . this position allows wall girts g to be connected to the columns 132 to facilitate the framing of an entire wall , or at least a portion of a wall , at ground level . once the framing with the wall girts g is completed , the upper pilings 130 that form an entire wall , or a portion of a wall , are hoisted upward as a single unit , pivoting about the first pin 144 on the first axis 128 . then , the upper pilings 130 are hoisted upward , about the first axis 128 , until the upper and lower hinges 136 , 124 are completely interleaved with one another and the second axes 150 , for the upper and lower second holes 152 , 148 , are aligned . when the hinges 136 , 124 are completely interleaved , the first pin 144 is extending through the upper and lower first holes 126 , 138 , on the first axis 128 , to engage and support the hinges 136 , 124 . likewise , a second pin 154 is extending through the upper and lower second holes 152 , 148 , on the second axis 150 , to engage and support the hinges 136 , 124 when the longitudinal axes 118 , 134 are aligned , as shown in fig3 . each of the upper and lower hinges 136 , 124 include a first plurality of hinge knuckles 146 , disposed about the first pin 144 , where the knuckles 146 of the upper hinge 136 are interleaved with the knuckles 146 of the lower hinge 124 . the knuckles 146 hold the first pin 144 in spaced relationship to the upper and lower pilings 130 , 112 to transmit longitudinal forces between the pilings 130 , 112 through the first pin 144 . these forces include the loads resulting from the weight of the wall girts g , the roof , various other building materials and environmental factors . similarly , the hinges 136 , 124 include a second plurality of locking knuckles 156 that are disposed about the second pin 154 with the locking knuckles 156 of the upper hinge 136 interleaved with the locking knuckles 156 of the lower hinge 124 . the locking knuckles 156 hold the second pin 154 in spaced relationship to the pilings 130 , 112 to transmit longitudinal forces between the pilings 130 , 112 totally through the first and second pins 144 , 154 . therefore , the pins 144 , 154 support the entire load provided by the upper pilings 130 , wall girts g , the roof , various other building materials and environmental factors . each of the hinges 136 , 124 includes a plurality of plates 158 that are in spaced and parallel relationship . a gap 169 is defined between each of the plates 158 to facilitate the upper hinge 136 interleaving with the lower hinge 124 . the first hole 126 or 138 is defined through each of the plates 158 , along the first axis 128 . the second hole 148 or 152 is also defined through each of the plates 158 , along the second axis 150 , and spaced transversely across each of the plates 158 from the first hole 126 or 138 respectively . furthermore , the plates 158 define a bottom edge 162 and end edges 164 . the lower hinge 124 is attached to the lower piling 112 at the bottom edge 162 and the holes 126 , 148 are in spaced relationship from the lower piling 112 . the upper hinge 136 includes a bottom 166 and a pair of opposing walls 168 that extend upward from the bottom 166 , along the column 132 . the bottom edge 162 of each of the plates 158 are attached to the bottom 166 of the upper hinge 136 and the end edges 164 of each of the plates 158 are attached to the opposing walls 168 . furthermore , the bottom 166 and the opposing walls 168 define a plurality of grooves 170 that extend in spaced and parallel relationship across the bottom 166 and into a portion of the walls 168 , between each of the plates 158 . the grooves 170 allow the hinge plates 158 of the lower hinge 124 to interleave with the plates 158 of the upper hinge 136 . another embodiment of the piling assembly 200 , shown in fig4 a - e , comprises a lower piling 212 hingedly connected to an upper piling 230 . the lower piling 212 has a first and a second end 214 , 216 and a first longitudinal axis 218 extending therethrough . the upper piling 230 has a column 232 and a second longitudinal axis 234 extending therethrough . a reinforcing cage 220 , as shown in fig4 a , extends between the ends 214 , 216 and concrete 222 encases the cage 220 . this embodiment of the lower piling 212 discloses another type of reinforcing cage that can be pre - cast off - site . the reinforcing cage 220 has four vertically extending rods 223 that define an outer perimeter of the reinforcing cage 220 . the rods 223 curve outward at the second end 216 and are attached to a hooped rod 225 to define a footing 227 . corrugated support rods 221 are disposed between each pair of adjacent vertical rods 223 along the outer perimeter of the reinforcing cage 220 , to provide additional reinforcement to the reinforcing cage 220 . a plurality of thru - holes 233 , for attaching various framing pieces f to the lower piling 212 , can also be pre - cast into the lower piling 212 , as shown in fig4 b . to provide an attaching scheme , a lower hinge 224 extends from the first end 214 and defines at least one lower first hole 226 on a first axis 228 that is spaced from the first end 214 . similarly , the upper piling 230 has an upper hinge 236 that extends from the column 232 and defines at least one upper first hole 238 on the first axis 228 . the lower hinge 224 also defines a lower second hole 248 , on a second axis 250 , and is spaced transversely across the lower piling 212 from the lower first hole 226 and spaced from the first end 214 . likewise , the upper hinge 236 defines an upper second hole 252 , on the second axis 250 , and is spaced transversely across the upper piling 230 from the upper first hole 238 . in the early stages of building construction , the upper and lower hinges 236 , 224 are partially interleaved such that only a first pin 244 connects the upper hinge 236 to the lower hinge 224 , along the first axis 228 , and the second longitudinal axis 234 , for the upper piling 230 , is at an angle to the first longitudinal axis 218 , for the lower piling 212 . as a result , the columns 232 for the building can set tilted onto the ground . this position allows wall girts g to be connected to the columns 232 to facilitate the framing of an entire wall , or a partial wall , at ground level . once the framing with the wall girts g is completed , the upper pilings 230 that form an entire wall , or a partial wall , are hoisted upward as a single unit , pivoting about the first pin 244 on the first axis 228 . then , the upper pilings 230 are hoisted upward , about the first axis 228 , until the upper and lower hinges 236 , 224 are completely interleaved with one another and the second axes 250 , for the upper and lower second holes 252 , 248 are aligned . when the hinges 236 , 224 are completely interleaved , the first pin 244 extends through the upper and lower first holes 236 , 226 on the first axis 228 to engage and support the hinges 236 , 224 . likewise , a second pin 254 extends through the upper and lower second holes 252 , 248 on the second axis 250 to engage and support the hinges 236 , 224 when the longitudinal axes 218 , 234 are aligned , as shown in fig4 c . the hinges 236 , 224 include a first plurality of hinge knuckles 246 that are disposed about the first pin 244 , where the knuckles 246 of the upper hinge 236 are interleaved with the knuckles 246 of the lower hinge 224 . the knuckles 246 hold the first pin 244 in spaced relationship to the pilings 212 , 230 to transmit longitudinal forces between the pilings 212 , 230 through the first pin 244 . these forces include those resulting from the wall girts g , the roof of the building structure , and various other building materials and environmental factors . the hinges 236 , 224 also include a second plurality of locking knuckles 256 that are disposed about the second pin 254 with the locking knuckles 256 of the upper hinge 236 interleaved with the locking knuckles 256 of the lower hinge 224 . the locking knuckles 256 hold the second pin 254 in spaced relationship to the pilings 230 , 212 for transmitting forces between the pilings 230 , 212 through the first and second pins 244 , 254 . each of the knuckles 246 , 256 on each of the hinges 236 , 224 comprise a plurality of straps 272 that define a pin pocket 274 for encompassing at least a portion of the circumference of one of the pins 244 , 254 extending therethrough . the pin pocket 274 defines the first hole 238 , 226 in one of the knuckles 246 along the first axis 228 . the pin pocket also defines the second hole 252 , 248 in another one of the locking knuckles 256 along the second axis 250 which is spaced transversely across one of the hinges 236 , 224 from the first hole 238 , 226 . grooves 270 are defined between each of the straps 272 of one hinge 236 , 224 for interleaving of the upper and lower hinges 236 , 224 . additionally , the upper hinge 236 includes a bottom 266 and a pair of opposing walls 268 that extend from the bottom 266 and across the upper pilings 230 . the first and locking knuckles 246 , 256 are disposed between the walls 268 and the bottom 266 . in the upper piling 230 , the knuckles 246 , 256 are disposed in spaced relationship on the upper hinges 236 across the upper piling 230 and are also in spaced relationship to the column 232 . similarly , the lower hinge 224 is attached to the lower piling 212 at the walls 268 . the lower holes 226 , 248 are in spaced relationship to the first end 214 of the lower piling 212 . in yet another embodiment , as shown in fig5 - 11 , the piling assembly 300 comprises a height - adjustable lower piling 312 hingedly connected to an upper piling 330 . the lower piling has a first and a second end 314 , 316 with a first longitudinal axis 318 extending therethrough . the upper piling 330 has a column 332 with a second longitudinal axis 334 extending therethrough . another type of reinforcing cage 320 is shown in fig6 . here , the reinforcing cage 320 is pre - cast in concrete 322 . within the reinforcing cage 320 are a plurality of two - piece vertical reinforcing rods 323 , attached to a plurality of horizontally placed rods 325 that form a footing ( not shown ). each of the two - piece vertical reinforcing rods 323 are comprised of a lower vertical reinforcing tube 329 , which is internally threaded and integral to the reinforcing cage 320 , and an upper vertical reinforcing rod 331 , which has a lower threaded end for threaded engagement of the lower tube 329 . to provide additional support to the reinforcing cage 320 , a plurality of vertically fixed reinforcing rods 319 and a plurality of vertically spaced hoops 321 form a square perimeter . the lower piling 312 is pre - cast about the reinforcing cage 320 with vertical holes ( not shown ) that extend from the first end 314 to the lower vertical reinforcing tube 329 . on the job site , a portion of the lower piling 312 can be cut off to a preferred height . this allows flexibility to level the lower pilings 312 once they are inserted into the ground , prior to connection to the upper pilings 330 . after the pilings 312 are trimmed to the desired height at the job site , upper vertical reinforcing rods 331 are inserted through holes 313 in a lower hinge 324 , into the vertical holes and then threaded into the lower vertical reinforcing tubes 329 . additionally , a plurality of thru - holes 333 can be pre - cast into the concrete 322 to facilitate attachment of various framing pieces f , concrete anchors , etc . to the lower piling 312 . typically , a hole is dug into the earth for receiving a portion of the lower piling 312 . following excavation of the hole , the second end 316 , and a portion of the concrete 322 , is buried below ground . finally , the hole is back filled with dirt , concrete or any other suitable material . to provide an attachment scheme for the upper piling 330 , the lower hinge 324 extends from the first end 314 and defines at least one lower first hole 326 on a first axis 328 that is spaced from the first end 314 . the upper piling 330 has a column 332 and a second longitudinal axis 334 extending therethrough . typically , the column 332 is comprised of wood , steel , aluminum or a composite . the upper hinge 336 extends from the column 332 and defines at least one upper first hole 338 on the first axis 328 . the lower hinge 324 also defines a lower second hole 348 , on a second axis 350 which is spaced transversely across the lower piling 312 from the lower first hole 326 and spaced from the first end 314 . the upper hinge 336 also defines an upper second hole 352 , on the second axis 350 , which is spaced transversely across the upper piling 330 from the upper first hole 338 . in the early stages of building construction , the upper and lower hinges 336 , 324 are partially interleaved , as shown in fig1 , such that only a first pin 344 connects the upper hinge 336 to the lower hinge 324 , along the first axis 328 , and the second longitudinal axis 334 , for the upper piling 330 , is at an angle to the first longitudinal axis 318 , for the lower piling 312 . as a result , the columns 332 for the building can set tilted onto the ground . this position allows wall girts g to be connected to the columns 332 to facilitate the framing of an entire wall , or at least a portion of a wall , at ground level . once the framing with the wall girts g is completed , the upper pilings 330 that form an entire wall , or a portion of a wall , are hoisted upward as a single unit , pivoting about the first pin 344 on the first axis 328 . then , the upper pilings 330 are hoisted upward , about the first axis 328 , until the upper and lower hinges 336 , 324 are completely interleaved with one another and the second axes 350 , for the upper and lower second holes 252 , 248 , are aligned . when the hinges 336 , 324 are completely interleaved , the first pin 344 is extending through the upper and lower first holes 326 , 338 , on the first axis 328 , to engage and support the hinges 336 , 324 . likewise , a second pin 354 is extending through the upper and lower second holes 352 , 348 , on the second axis 350 , to engage and support the hinges 336 , 324 when the longitudinal axes 318 , 334 are aligned , as shown in fig1 . each of the upper and lower hinges 336 , 324 include a first plurality of hinge knuckles 346 , disposed about the first pin 344 , where the knuckles 346 of the upper hinge 336 are interleaved with the knuckles 346 of the lower hinge 324 . the knuckles 346 hold the first pin 344 in spaced relationship to the upper and lower pilings 330 , 312 to transmit longitudinal forces between the pilings 330 , 312 through the first pin 344 . these forces include the loads resulting from the weight of the wall girts g , the roof , various other building materials and environmental factors . similarly , the hinges 336 , 324 include a second plurality of locking knuckles 356 that are disposed about the second pin 354 with the locking knuckles 356 of the upper hinge 336 interleaved with the locking knuckles 356 of the lower hinge 324 . the locking knuckles 356 hold the second pin 354 in spaced relationship to the pilings 330 , 312 to transmit longitudinal forces between the pilings 330 , 312 totally through the first and second pins 344 , 354 . therefore , the pins 344 , 354 support the entire load provided by the upper pilings 330 , wall girts g , the roof , various other building materials and environmental factors . each of the hinges 336 , 324 includes a plurality of plates 358 that are in spaced and parallel relationship . a gap 369 is defined between each of the plates 358 to facilitate the upper hinge 336 interleaving with the lower hinge 324 . the first hole 326 or 338 is defined through each of the plates 358 , along the first axis 328 . the second hole 348 or 352 is also defined through each of the plates 358 , along the second axis 350 , and spaced transversely across each of the plates 358 from the first hole 326 or 338 respectively . furthermore , the plates 358 define a bottom edge 362 and end edges 364 . the lower hinge 324 is attached to the reinforcing cage 320 of the lower piling 312 along the bottom edge 362 and the lower holes 326 , 348 are in spaced relationship from the lower piling 312 . the upper hinge 336 includes a bottom 366 and a pair of opposing walls 368 that extend upward from the bottom 366 , along the column 332 . the bottom edge 362 of each of the plates 358 are attached to the bottom 366 of the lower hinge 324 and the end edges 364 of each of the plates 358 are attached to the opposing walls 368 . furthermore , the bottom 366 and the opposing walls 368 define a plurality of grooves 370 that extend in spaced and parallel relationship across the bottom 366 and into a portion of the walls 368 , between each of the plates 358 . the grooves 370 allow the plates 358 of the lower hinge 324 to interleave with the plates 358 of the upper hinge 336 . another embodiment of a piling assembly 400 , shown in fig1 - 18 , comprises a height adjustable lower piling 412 hingedly connected to an upper piling 430 . the lower piling 412 has a first and a second end 414 , 416 with a first longitudinal axis 418 extending therethrough . the upper piling 430 has a column 432 with a second longitudinal axis 434 extending therethrough . another type of reinforcing cage 420 is shown in fig1 . here , a plurality of vertically extending reinforcing rods 423 defines the perimeter of the reinforcing cage 420 . additionally , vertically spaced wire 221 encircles the outer perimeter of the vertically extending rods 423 to provide additional reinforcement for the reinforcing cage 420 . the vertical rods 423 flare outward at the second end 416 to form a footing 427 . the vertical rods extend beyond the pre - cast concrete 422 at the first end 414 , terminating at threaded ends 415 . the lower piling 412 is pre - cast off - site and a plurality of thru - holes 433 can be pre - cast into the concrete 422 to attach various framing pieces f , concrete anchors , etc . to the lower piling 412 . typically , a hole is dug into the earth for receiving a portion of the lower piling 412 . following excavation of the hole , the second end 416 , and a portion of the lower piling 412 , is buried below ground . finally , the hole is back filled with dirt , concrete or any other suitable material . to level the first ends 414 of the lower pilings 412 , once the lower pilings 412 are set in the ground , shims 435 are placed over the threaded ends 414 . once the proper height is achieved , a lower hinge 424 is also placed over the threaded ends 414 and fastened in place with nuts 437 . to provide an attachment scheme for the upper piling 430 , the lower hinge 424 extends from the first end 414 and defines at least one lower first hole 426 on a first axis 428 that is spaced from the first end 414 . the upper piling 430 has a column 432 and a second longitudinal axis 434 extending therethrough . typically , the column 432 is comprised of wood , steel , aluminum or a composite . the upper hinge 436 extends from the column 432 and defines at least one upper first hole 438 on the first axis 428 . the lower hinge 424 also defines a lower second hole 448 , on a second axis 450 which is spaced transversely across the lower piling 412 from the lower first hole 426 and spaced from the first end 414 . the upper hinge 436 also defines an upper second hole 452 , on the second axis 450 , which is spaced transversely across the upper piling 430 from the upper first hole 438 . in the early stages of building construction , the upper and lower hinges 436 , 424 are partially interleaved , as shown in fig1 , such that only a first pin 444 connects the upper hinge 436 to the lower hinge 424 , along the first axis 428 , and the second longitudinal axis 434 , for the upper piling 430 , is at an angle to the first longitudinal axis 418 , for the lower piling 412 . as a result , the columns 432 for the building can set tilted onto the ground . this position allows wall girts g to be connected to the columns 432 to facilitate the framing of an entire wall , or at least a portion of a wall , at ground level . once the framing with the wall girts g is completed , the upper pilings 430 that form an entire wall , or a portion of a wall , are hoisted upward as a single unit , pivoting about the first pin 444 on the first axis 428 . then , the upper pilings 430 are hoisted upward , about the first axis 428 , until the upper and lower hinges 436 , 424 are completely interleaved with one another and the second axes 450 , for the upper and lower second holes 452 , 448 , are aligned . when the hinges 436 , 424 are completely interleaved , the first pin 444 is extending through the upper and lower first holes 426 , 438 , on the first axis 428 , to engage and support the hinges 436 , 424 . likewise , a second pin 454 is extending through the upper and lower second holes 452 , 448 , on the second axis 450 , to engage and support the hinges 436 , 424 when the longitudinal axes 418 , 434 are aligned , as shown in fig1 . each of the upper and lower hinges 436 , 424 include a first plurality of hinge knuckles 446 , disposed about the first pin 444 , where the knuckles 446 of the upper hinge 436 are interleaved with the knuckles 446 of the lower hinge 424 . the knuckles 446 hold the first pin 444 in spaced relationship to the upper and lower pilings 430 , 412 to transmit longitudinal forces between the pilings 430 , 412 through the first pin 444 . these forces include the loads resulting from the weight of the wall girts g , the roof , various other building materials and environmental factors . similarly , the hinges 436 , 424 include a second plurality of locking knuckles 456 that are disposed about the second pin 454 with the locking knuckles 456 of the upper hinge 436 interleaved with the locking knuckles 456 of the lower hinge 424 . the locking knuckles 456 hold the second pin 454 in spaced relationship to the pilings 430 , 412 to transmit longitudinal forces between the pilings 430 , 412 totally through the first and second pins 444 , 454 . therefore , the pins 444 , 454 support the entire load provided by the upper pilings 430 , wall girts g , the roof , various other building materials and environmental factors . each of the hinges 436 , 424 includes a plurality of plates 458 that are in spaced and parallel relationship . a gap 469 is defined between each of the plates 458 to facilitate the upper hinge 436 interleaving with the lower hinge 424 . the first hole 426 or 438 is defined through each of the plates 458 , along the first axis 428 . the second hole 448 or 452 is also defined through each of the plates 458 , along the second axis 450 , and spaced transversely across each of the plates 458 from the first hole 426 or 438 respectively . furthermore , the plates 458 define a bottom edge 462 and end edges 464 . the lower hinge 424 is attached to the reinforcing cage 420 of the lower piling 412 along the bottom edge 462 and the holes 426 , 448 are in spaced relationship from the lower piling 412 . the upper hinge 436 includes a bottom 466 and a pair of opposing walls 468 that extend upward from the bottom 466 , along the column 432 . the bottom edge 462 of each of the plates 458 are attached to the bottom 466 of the lower hinge 424 and the end edges 464 of each of the plates 458 are attached to the opposing walls 468 . furthermore , the bottom 466 and the opposing walls 468 define a plurality of grooves 470 that extend in spaced and parallel relationship across the bottom 466 and into a portion of the walls 468 , between each of the plates 458 . the grooves 470 allow the plates 458 of the lower hinge 424 to interleave with the plates 458 of the upper hinge 436 . the next embodiment of the piling assembly 500 , shown in fig1 - 30 , comprises another type of height adjustable lower piling 512 hingedly connected to an upper piling 530 . the lower piling has a first and a second end 514 , 516 with a first longitudinal axis 518 extending therethrough . the upper piling 530 has a column 532 with a second longitudinal axis 534 extending therethrough . in this type of height adjustable reinforcing cage 520 , as shown in fig1 , concrete 522 is pre - cast into the shape of a lower piling 512 with a plurality of vertically extending holes ( not shown ), extending between the first and second end 514 , 516 , are also cast into the concrete 522 . these holes can be lined with cast - in - place plastic tubing 521 which allows for the insertion and removal of vertical height adjusting rods 523 to facilitate height adjustment of the lower piling 512 . additionally , a vertical hole ( not shown ) is cast into center of the concrete 522 , extending between the first and second ends 514 , 516 and along the first longitudinal axis 518 . prior to shipment to the job site , the vertically threaded post tensioning rods 523 are inserted through each of a plurality of vertically extending holes ( not shown ) in an upper hinge 536 , at the first end 514 , and extend through the vertical holes in the lower piling 512 . additionally , the post tensioning rods 523 extend out of , and beyond , the second end 516 and are threaded through corresponding holes on the base plate 537 , each terminating at a flanged nut 539 . the flanged nuts 539 are in spaced relationship to the base plate 537 and the second end 516 and serve to anchor the lower piling 512 in concrete that is poured into the ground hole , around the lower piling 512 . alternative to threading the rods 523 through holes in the base plate , the holes in the base plate 537 can be oversized and additional nuts ( not shown ) can be used to secure the base plate 537 against the second end 516 of the lower piling 512 . at the job site , if the height of the lower piling 512 needs to be reduced , the post tensioning rods 523 , lower hinge 524 and base plate 537 are initially removed and the concrete 522 is cut to the desired height . following trimming of the lower piling 512 , the rods 523 , lower hinge 524 and base plate 537 are reassembled to the lower piling 512 . additionally , the vertical push rod 525 is attached to a bearing plate 541 to create a push rod assembly 561 , as shown in fig2 . the vertical push rod 525 , with the bearing plate 541 attached , is inserted through the center hole of the lower piling 512 , from the second end 516 , along the first longitudinal axis 518 . next , a hole is dug into the earth for receiving a portion of the lower piling 512 . following excavation of the hole , the second end 516 , and a portion of the lower piling 512 along with the bearing plate 541 , is inserted into the ground , resting on the bearing plate 541 . in the ground , the flanged nuts 539 are initially resting on the bearing plate 541 . to set the overall height of the lower piling 512 , a threaded height adjustment mechanism 551 is threadedly inserted through a center hole in the first end 514 at a threaded hole 543 in the lower hinge 524 . as the mechanism 551 is threaded into the lower piling 512 , it pushes against the push rod 525 of the push rod assembly 561 , forcing the lower piling 512 , and thus the flanged nuts 539 , to move upward and away from the bearing plate 541 . once the desired height for the lower piling 512 is attained , concrete is poured into hole , stopping at least two inches above the base plate 537 to prevent the base plate 537 from corroding . once the concrete in the hole is adequately set , the height adjustment mechanism 551 is unthreaded and removed from the center hole in the lower piling 512 . finally , the hole is back filled with dirt , concrete or any other suitable material . to provide an attachment scheme for the upper piling 530 , the lower hinge 524 extends from the first end 514 and defines at least one lower first hole 526 on a first axis 528 that is spaced from the first end 514 . the upper piling 530 has a column 532 and a second longitudinal axis 534 extending therethrough . typically , the column 532 is comprised of wood , steel , aluminum or a composite . the upper hinge 536 extends from the column 532 and defines at least one upper first hole 538 on the first axis 528 . the lower hinge 524 also defines a lower second hole 548 , on a second axis 550 which is spaced transversely across the lower piling 512 from the lower first hole 526 and spaced from the first end 514 . the upper hinge 536 also defines an upper second hole 552 , on the second axis 550 , which is spaced transversely across the upper piling 530 from the upper first hole 538 . in the early stages of building construction , the upper and lower hinges 536 , 524 are partially interleaved , as shown in fig2 , such that only a first pin 544 connects the upper hinge 536 to the lower hinge 524 , along the first axis 528 , and the second longitudinal axis 534 , for the upper piling 530 , is at an angle to the first longitudinal axis 518 , for the lower piling 512 . as a result , the columns 532 for the building can set tilted onto the ground . this position allows wall girts g to be connected to the columns 532 to facilitate the framing of an entire wall , or at least a portion of a wall , at ground level . once the framing with the wall girts g is completed , the upper pilings 530 that form an entire wall , or a portion of a wall , are hoisted upward as a single unit , pivoting about the first pin 544 on the first axis 528 . then , the upper pilings 530 are hoisted upward , about the first axis 528 , until the upper and lower hinges 536 , 524 are completely interleaved with one another and the second axes 550 , for the upper and lower second holes 552 , 548 , are aligned . when the hinges 536 , 524 are completely interleaved , the first pin 544 is extending through the upper and lower first holes 526 , 538 , on the first axis 528 , to engage and support the hinges 536 , 524 . likewise , a second pin 554 is extending through the upper and lower second holes 552 , 548 , on the second axis 550 , to engage and support the hinges 536 , 524 when the longitudinal axes 518 , 534 are aligned , as shown in fig3 . each of the upper and lower hinges 536 , 524 include a first plurality of hinge knuckles 546 , disposed about the first pin 544 , where the knuckles 546 of the upper hinge 536 are interleaved with the knuckles 546 of the lower hinge 524 . the knuckles 546 hold the first pin 544 in spaced relationship to the upper and lower pilings 530 , 512 to transmit longitudinal forces between the pilings 530 , 512 through the first pin 544 . these forces include the loads resulting from the weight of the wall girts g , the roof , various other building materials and environmental factors . similarly , the hinges 536 , 524 include a second plurality of locking knuckles 556 that are disposed about the second pin 554 with the locking knuckles 556 of the upper hinge 536 interleaved with the locking knuckles 556 of the lower hinge 524 . the locking knuckles 556 hold the second pin 554 in spaced relationship to the pilings 530 , 512 to transmit longitudinal forces between the pilings 530 , 512 totally through the first and second pins 544 , 554 . therefore , the pins 544 , 554 support the entire load provided by the upper pilings 530 , wall girts g , the roof , various other building materials and environmental factors . each of the hinges 536 , 524 includes a plurality of plates 558 that are in spaced and parallel relationship . a gap 569 is defined between each of the plates 558 to facilitate the upper hinge 536 interleaving with the lower hinge 524 . the first hole 526 or 538 is defined through each of the plates 558 , along the first axis 528 . the second hole 548 or 552 is also defined through each of the plates 558 , along the second axis 550 , and spaced transversely across each of the plates 558 from the first hole 526 or 538 respectively . furthermore , the plates 558 define a bottom edge 562 and end edges 564 . the lower hinge 524 is attached to the lower piling 512 at the bottom edge 562 and the holes 526 , 548 are in spaced relationship from the lower piling 512 . the upper hinge 536 includes a bottom 566 and a pair of opposing walls 568 that extend upward from the bottom 566 , along the column 532 . the bottom edge 562 of each of the plates 558 are attached to the bottom 566 of the upper hinge 536 and the end edges 564 of each of the plates 558 are attached to the opposing walls 568 . furthermore , the bottom 566 and the opposing walls 568 define a plurality of grooves 570 that extend in spaced and parallel relationship across the bottom 566 and into a portion of the walls 568 , between each of the plates 558 . the grooves 570 allow the plates 558 of the lower hinge 524 to interleave with the plates 558 of the upper hinge 536 . obviously , many modifications and variations of the present invention are possible in light of the above teachings . in addition , the reference numerals in the claims are merely for convenience and are not to be read in any way as limiting .	4
reference is made to fig1 and 2 for illustrating a wireless user terminal or mobile station 10 , such as but not limited to a cellular radiotelephone , that is suitable for practicing this invention . the mobile station 10 includes an antenna 12 for transmitting signals to and for receiving signals from a base site or base station 30 . the base station 30 is a part of a cellular network comprising the bmi 32 that includes a mobile switching center ( msc ) 34 . the msc 34 provides a connection to landline trunks when the mobile station 10 is registered with the network , such as the public switched telephone network ( pstn ) 36 and / or private and residential networks . in fig2 the pstn 36 is assumed to be connected to telephones 38 that can be called from the mobile station 10 . for the purposes of this invention the bmi 32 is assumed to include a queue 40 wherein are stored telephone numbers , and related information , which are originated by paca - subscribing mobile stations 10 . each mobile station may have one or more pending calls in the queue 40 . the queue 40 has 1 - n locations ( e . g ., 15 entries ) for storing up to n queued calls ( qc ), and is shown for convenience as being connected to the msc 34 . in the case of multiple pending calls , the bmi 32 connects the first call which does not have a busy status . the mobile station 10 includes a modulator ( mod ) 14a , a transmitter 14 , a receiver 16 , a demodulator ( demod ) 16a , and a controller 18 that provides signals to and receives signals from the transmitter 14 and receiver 16 , respectively . these signals include signalling information in accordance with the air interface standard of the applicable cellular system , and also user speech and / or user generated data . the air interface standard is assumed for this invention to include a paca or paca - like feature of a type that was described above , and that is further augmented , as described below , in accordance with this invention . it should be noted , however , that the teaching of this invention is not intended to be limited for use only with an is - 136 compatible mobile station , or for use only in tdma type systems . a user interface includes a conventional earphone or speaker 17 , a conventional microphone 19 , a display 20 , and a user input device , typically a keypad 22 , all of which are coupled to the controller 18 . the keypad 22 includes the conventional numeric ( 0 - 9 ) and related keys (#,*) 22a , and other keys 22b used for operating the mobile station 10 . these other keys 22b may include , by example , a send key , various menu scrolling and soft keys , and a pwr key . the mobile station 10 also includes various memories , shown collectively as the memory 24 , wherein are stored a plurality of constants and variables that are used by the controller 18 during the operation of the mobile station . for example , the memory 24 stores the values of various cellular system parameters and the number assignment module ( nam ). an operating program for controlling the operation of controller 18 is also stored in the memory 24 ( typically in a rom device ). the memory 24 may also store data , including user messages , that is received from the bmi 32 prior to the display of the messages to the user . the mobile station 10 also includes a battery 26 for powering the various circuits that are required to operate the station . it should be understood that the mobile station 10 can be a vehicle mounted or a handheld device . it should further be appreciated that the mobile station 10 can be capable of operating with one or more air interface standards , modulation types , and access types . by example , the mobile station may be capable of operating with any of a number of standards , such as the above - mentioned is - 136 . 1 , or with gsm , or eia / tia 627 , or is - 95 ( cdma ). narrow - band amps ( namps ), as well as tacs , mobile stations may also benefit from the teaching of this invention . it should thus be clear that the teaching of this invention is not to be construed to be limited to any one particular type of mobile station or air interface standard . the operating program in the memory 24 includes routines to present messages and message - related functions to the user on the display 20 , typically as various menu items . the memory 24 also includes routines for implementing the method described below in relation to fig4 . it is also assumed that a controller in the bmi 32 , such as a controller ( cntl ) 34a in the msc 34 , is also operable for implementing the bmi portion of the method of this invention . the teaching of this invention will be described in the context of the is - 136 standard , and reference can be had to the following sections for describing various features of is - 136 ( rev . a , feb . 12 , 1996 ) that relate either directly or indirectly to paca : section 6 . 2 . 3 dcch camping state ; section 6 . 2 . 5 origination proceeding ; section 6 . 2 . 6 waiting for order ; section 6 . 3 . 4 termination ; section 6 . 3 . 5 origination ; section 6 . 3 . 10 registration success ; section 6 . 3 . 11 registration reject procedure ; section 6 . 4 . 3 . 24 queue disconnect ack ; section 6 . 4 . 3 . 25 queue update ; and section 6 . 4 . 4 . 19 queue disconnect . in a presently preferred embodiment of this invention the enhanced paca technique is implemented by modifying the protocol described in section 6 . 4 . 3 . 25 , queue update , as described below . reference is now made to fig4 for illustrating a presently preferred , but not limiting , embodiment of this invention . at block a the paca feature is considered to be active for a given one of the mobile stations 10 . at block b the bmi 32 determines the call status for a queued call . the status can be determined periodically or triggered by a change in status of the target telephone . at block c a determination is made if the call can be completed . that is , if the status change enables the phone call to be completed . for example , if the line is busy but a call waiting feature allows the phone to be notified , then the call is made possible . it should be noted that in a regular voice call the call waiting is indicated by an audio tone , whereas in the case of paca this is not avaialble . a following information message ( block d ) is sent to the mobile station only if the call is not possible ( line busy or network congested ). in this case the caller makes a decision as to whether to cancel paca or set the bmi 32 until the target telephone is reachable . as such , if no at block c the bmi 32 sends a message to the mobile station 10 ( block d ). this message contains line status information for the mobile station . based on the line status the bmi 32 may automatically choose to cancel the paca , or the user may be allowed to set the bmi 32 into a monitoring mode for the target line . when the target line is available , the system automatically resumes the paca or automatically activates the waiting call . at block e is illustrated a loop wherein the bmi 32 waits for a response to the message sent at block e . in this response , the mobile station 10 may choose either to cancel paca or request the bmi 32 to monitor the target line . this response is only required if the user can actually choose one of the two following responses . the first response is to accept an incoming call in the event there is a vacant voice / traffic channel available . the system may be implemented such that the availability of a voice / traffic channel triggers the target line check by the bmi 32 . also , in some embodiments the bmi 32 may optionally continuously scan the target number for availability . in the second response the user cancels the paca service because , for example , the user anticipates that the busy status will last too long . if the user of the mobile station 10 chooses not to cancel the paca , the bmi 32 starts to monitor the target line and once it is reachable , the regular paca is resumed ( i . e ., the user is put back into the paca queue ). as such , at block f a determination is made if a traffic channel ( tch ) is required . if no , a determination is made at block g if the call is to remain queued . if no , control passes to block h where the call is removed from the queue , and then at block i the paca is completed for this user . if yes at block g , control passes back to block a to maintain the paca active for this user . if yes at block f , or if yes at block c , control passes to block k where a determination is made if a traffic channel is available . if no , control passes to block a to maintain the paca active for this user . if yes at block k , control passes to block l where the bmi 32 assigns the available traffic channel to the mobile station 10 , thereby completing the queued call . control then passes to block i to terminate the paca for this call . referring again to block d , in a presently preferred embodiment of this invention the message is sent on a forward signalling channel , specifically the sms point - to - point , paging and access response channel ( spach ) ( is - 136 . 1 , sections 2 . 3 . 2 and 6 . 4 . 3 ). more particularly , the message is sent from the bmi 32 to the mobile station 10 on the access response channel ( arch ) subchannel using the queue update message ( is - 136 . 1 , section 6 . 4 . 3 . 25 ). the queue update message is currently specified to be used to inform the mobile station 10 that its originated call attempt has been queued by the bmi , or to provide a currently queued mobile station with updated queue information ( i . e ., queue position , such as first in queue , second in queue , . . . , 15th in queue ). in accordance with an aspect of this invention the queue update message is modified to include a line status parameter field which is coded as follows : ______________________________________value function______________________________________0000 line readyxxx1 line busy / reorder / interceptxx1x call waiting : xx10 line ready / call waiting xx11 line busy / call waiting01xx - reserved11xx______________________________________ at block e the bmi 32 waits for a response to the queue update message if one is expected ( one response may be a queue disconnect message which is sent by the mobile station 10 to request that its queued call attempt be disconnected ), otherwise at block f the bmi 32 makes a determination if a traffic channel needs to be assigned . that is , if the line status shows that line is ready ( i . e ., the call to the queued number indicates that the called phone is not busy ) or that an incoming call is waiting for the mobile station 10 , then at block k a determination is made if a traffic channel is available and , if so , the channel is assigned at block l . if no at block f ( a traffic channel is not required , for example the line status field indicates that the line was busy ) the bmi 32 determines at block g if the queued call should be maintained . for example , after one or some larger predetermined number of queued call attempts the bmi 32 may automatically remove the queued call , or the mobile station may have indicated that the queued call should be disconnected . if the queued call is not to be retained the call is removed from the queue 40 at block h , and the paca procedure terminates . it can be appreciated that the method illustrated in fig4 does not unnecessarily assign a traffic channel to the mobile station 10 for the case where the called number is busy or otherwise unobtainable . furthermore , the user can be alerted by the mobile station 10 in response to the receipt of the queue update message on the spach , and the user can be informed that the queued call has been attempted but cannot be completed . this can be achieved by a special alerting tone and the display of a suitable message to the user on the display 20 . this can also be achieved by a special alerting tone either alone or in combination with the generation of a busy tone by the mobile station 10 . in this latter case the user is alerted that the previously queued call has been placed , and then hears a busy tone , all without a traffic channel ever having been assigned to the mobile station 10 . it will be remembered that the mobile station 10 is considered to be busy while a call is queued in the queue 40 . that is , an incoming caller to the mobile station 10 will receive a busy tone . this is to insure that the mobile station 10 will be available to take the queued call when a traffic channel becomes available . in accordance with a further aspect of this invention the above - described line status field can be used to inform the mobile station 10 , when it has a currently queued call , that an incoming call has been received . this can occur under three different circumstances . in a first circumstance the queued call has not yet been attempted ( e . g ., a traffic channel is not yet available ). in this case the bmi 32 detects an incoming call to the mobile station 10 and sends the queue update message with the line status field set to xx1x ( call waiting ). in response , the mobile station 10 is enabled to send a queue disconnect message ( is - 136 . 1 , section 6 . 4 . 4 . 19 ) on the reverse access control channel ( rach ). this message causes the queued call to be disconnected , thereby removing the mobile station &# 39 ; s busy status and enabling the mobile station 10 to accept the incoming call . the queue disconnect message may be sent automatically ( e . g ., by the user programming the mobile station 10 to always cancel a queued call when an incoming call is received ), or on a call - by - call basis by alerting the user to the incoming call , with a special alerting tone and / or a displayed message , and then waiting for the user to decide whether to accept the incoming call . if the user decides to accept the incoming call , which can be indicated by depressing a specified one of the keys 22a , then the mobile station 10 composes and transmits the queue disconnect message to the bmi 32 . the voice announcement or line busy or queue tone indication could be used to inform the wireline caller that the line is &# 34 ; busy &# 34 ;, if the user prefers to wait to be assigned an available channel for the originated call . in case the mobile station originated target line is busy , the bmi 32 automatically prefer the incoming mobile terminated call , which is sent to the queue 40 instead of the previous call attempted by the mobile station user . in case the mobile station terminated call is activated , the mobile station originated call could be sent to the queue 40 until the mobile station terminated call has been completed . this queue management is performed automatically by the bmi 32 . if the original call is waiting in the queue 40 , and one or more additional voice channels becomes available , the cellular switch preferably delays the mobile station originated call until the mobile station terminated call has been completed , and thus the mobile station 10 is again capable of handling the delayed call . in a second circumstance the queued call has been attempted and the called line is found to available when the incoming call is received . in this case the bmi 32 sends the queue update message with the line status field set to xx10 ( line ready / call waiting ). in response , the mobile station 10 is enabled to send the queue disconnect message which causes the queued call to be disconnected , thereby removing the mobile station &# 39 ; s busy status and enabling the mobile station to accept the incoming call . alternately , the mobile station 10 can ignore the incoming call ( which is signalled to the caller as the mobile station 10 being busy ) and take the queued call . in a third circumstance the queued call has been attempted and the called line is found to be unavailable ( e . g ., busy ) when the incoming call is received . in this case the bmi 32 sends the queue update message with the line status field set to xx11 ( line busy / call waiting ). in response , the mobile station 10 may send the queue disconnect message which causes the queued call to be disconnected , thereby removing the mobile station &# 39 ; s busy status and enabling the mobile station 10 to accept the incoming call . alternately , the mobile station 10 can ignore the incoming call ( which is again signalled to the caller as the mobile station 10 being busy ) and thereby leave the queued call pending in the queue 40 . in all of these various cases it is within the scope of the invention to display to the user the telephone number from which the incoming call has been made ( and / or to display a preprogrammed alphanumeric string identifying the number ) to aid the user in determining whether to accept or reject the incoming call . although described above in the context of modifications made to the queue update message to facilitate the additional signalling from the bmi 32 to the mobile station 10 , it is also within the scope of this invention to modify the queue disconnect message to facilitate the signalling between the mobile station 10 and the bmi 32 . for example , the queue disconnect message can be modified to include a field for specifying the following : ______________________________________value function______________________________________0000 disconnect queued call0001 accept incoming call , leave queued call pending0010 accept incoming call , disconnect queued call0011 - 1111 reserved______________________________________ it is also within the scope of this invention , if a traffic channel is available , to send the call waiting indication on a paging channel . although described above primarily in the context of allocating a digital voice channel to the mobile station 10 , it should be realized that the mobile station 10 may have requested and be waiting for a free data packet channel . as such , the term &# 34 ; traffic channel &# 34 ; should be read to encompass both voice and data channels . it should further be realized that although this invention has been described in the context of preferred embodiments , a number of modifications to these teachings may occur to those skilled in the art . by example , the various message fields could be encoded differently , or separate messages could be defined for conveying each of the various signalling conditions between the bmi 32 and the mobile station 10 ( e . g ., five separate types of queue update messages and / or three separate types of queue disconnect messages could be defined for use ). thus , while the invention has been particularly shown and described with respect to preferred embodiments thereof , it will be understood by those skilled in the art that changes in form and details may be made therein without departing from the scope and spirit of the invention .	7
the present invention provides a stereoselective synthesis of ( s )- pregabalin according to the following scheme : this process allows for obtaining ( s )- pregabalin with a relatively high enantiomeric purity . wherein ar is a c 6 - 10 aromatic group and r is a straight or branched c 1 - 4 alkyl , ester , or carboxylic acid . preferably , the c 6 - 10 aromatic group is naphthyl , phenyl , substituted phenyl , or substituted naphthyl , more preferably phenyl . preferably , the substituted phenyl is a phenyl group substituted with at least one of alkoxy , halogen , alkyl , carboxylic acid , or ester . a preferred alkoxy phenyl is methoxyphenyl . preferred halogenated phenyls are chlorobenzene , bromobenzene , and fluorobenzene . preferred alkylated phenyls are either toluene or ethylbenzene . preferably , the carboxylic acid substituent is — coon , — ch 2 cooh , — ch ( ch 3 ) cooh or — c ( ch 3 ) 2 cooh . preferably the ester substituent is a methylester , ethylester , isopropylester , n - butylester , isobutyl , or t - butyl derivative of one of the above - listed carboxylic acid substituents . preferably , the c 1 - 4 alkyl is methyl , ethyl , isopropyl , n - butyl , isobutyl or t - butyl , more preferably , methyl . when ar is phenyl and r is methyl , the compound of formula 24 is ( 3s )- 5 - methyl - 3 -( 2 - oxo - 2 {[( 1s )- 1 - phenylmethyl ] amino } ethyl ) hexanoic acid 24a which may be characterized by data selected from : a 13 c - nmr ( cdcl 3 , 300 mhz ) spectrum having carbon chemical shifts at about 21 . 74 , 22 . 19 , 22 . 66 , 24 . 95 , 29 . 44 , 30 . 89 , 36 . 73 , 38 . 15 , 40 . 55 , 43 . 45 , 48 . 92 , 125 . 41 , 126 . 06 , 127 . 29 , 128 . 57 ; 143 . 01 , 171 . 92 and 176 . 71 ppm ; a 1 h - nmr ( cdcl 3 , 75 mhz ) spectrum having hydrogen chemical shifts at about 0 . 77 , 1 . 18 , 1 . 38 , 1 . 56 , 2 . 22 , 5 . 03 , 6 . 59 - 6 . 62 , 7 . 11 - 7 . 22 and 10 . 88 ppm ; and an ir spectrum having peaks at about 3321 . 39 , 2955 . 91 , 1693 . 33 , 1617 . 43 , 1561 . 07 and 698 . 24 cm − 1 . the invention also encompasses isolated ( 3s )- 5 - methyl - 3 -( 2 - oxo - 2 {[( 1s )- 1 - phenylmethyl ] amino } ethyl ) hexanoic acid 24a , preferably in crystalline form . the crystalline form of 24a may be characterized by a powder x - ray diffraction pattern having peaks at about 4 . 3 °, 6 . 9 °, 7 . 2 °, and 7 . 7 ° 2θ ± 0 . 2 ° 2θ . the crystalline form of 24a may be further characterized by x - ray powder diffraction peaks at about 6 . 3 °, 8 . 1 °, 9 . 7 °, 10 . 3 °, 11 . 3 °, 12 . 9 °, 13 . 9 °, 15 . 1 °, 15 . 7 °, 17 . 5 °, 18 . 6 °, 19 . 1 °, 20 . 5 °, 20 . 9 °, 21 . 8 °, 22 . 3 °, 23 . 3 °, and 23 . 8 ° 2θ ± 0 . 2 ° 2θ . moreover , the crystalline form of 24a may have a melting range of about 95 ° c . to about 98 ° c . the invention also encompasses isolated ( 3s )- 5 - methyl - 3 -( 2 - oxo - 2 {[( 1s )- 1 - phenylmethyl ] amino } ethyl ) hexanoic acid 24a having an optical purity of at least about 80 % area by hplc , preferably of at least about 93 % area by hplc , more preferably , of about 98 % to about 100 % area by hplc , most preferably , of about 99 % to about 100 % area by hplc . wherein ar is a c 6 - 10 aromatic group , and r is a straight or branched c 1 - 4 alkyl , ester , or carboxylic acid . where ar is phenyl and r is methyl , the compound of formula 25 is ( r )- 3 - isobutylpentanedioic acid amide -(( s )- 1 - phenylmethyl ) amide 25a . the invention further encompasses ( s )- 4 - methyl - 2 -{[(( s )- 1 - aryl - alkyl - carbamoyl )- methyl ] pentyl } carbamic acid methyl esters of formula 26 , wherein ar and r are as defined above for formula 24 . when ar is phenyl and r and is methyl , the compound of formula 26 is ( s )- 4 - methyl - 2 -[(( s )- 1 - aryl - alkyl - carbamoyl )- methyl ] pentyl } carbamic acid methyl ester 26a . the invention also encompasses ( s )- 2 - carbamoylmethyl - 4 - methylpentyl ) carbamic acid alkyl esters of formula 27 , wherein r ′ is a straight or branched c 1 - 5 alkyl , preferably , methyl . when r ′ is methyl , the compound of formula 27 is ( s )- 2 - carbamoylmethyl - 4 - methylpentyl ) carbamic acid methyl ester 27a . further , the invention encompasses a process for the preparation of ( s )- pregabalin via the intermediate compound of formula 24 . the process comprises preparing the intermediate of formula 24 , converting the intermediate compound of formula 24 into the diamide of formula 25 , converting the diamide of formula 25 into the chiral carbamate of formula 26 , converting the chiral carbamate into the compound of formula 27 , and converting the compound of formula 27 into ( s )- pregabalin . although each of the compounds of formula 24 , formula 25 , formula 26 , and formula 27 can be isolated prior to conversion , isolation of the compounds of formula 26 and formula 27 is not required . therefore , once the compound of formula 25 has been prepared and isolated , the preparation of the compound of formula 27 from the compound of formula 25 or the compound of formula 26 and the preparation of ( s )- pregabalin from the compound of formula 25 or the compound of formula 26 does not require isolation of any of the intermediate compounds . thus , once the compound of formula 25 has been prepared and isolated , ( s )- pregabalin can be prepared in a one - pot process without the isolation of either of the compounds of formula 26 or formula 27 . the intermediate compound of formula 24 may be prepared by combining a chiral amine of formula 23 , an organic solvent selected from at least one of c 6 - 10 aromatic hydrocarbons , substituted aromatic hydrocarbons , c 2 - 8 ethers , halogenated hydrocarbons , straight or branched c 1 - 4 alcohols , c 3 - 8 esters , straight , branched or cyclic c 1 - 6 alkanes , or c 3 - 8 ketones , and at least one base , to obtain a mixture , cooling the mixture , and adding 3 - isobutyl glutaric anhydride of formula 22 the 3 - isobutyl glutaric anhydride of formula 22 may be prepared according to the process disclosed in u . s . pat . no . 5 , 616 , 793 . the chiral amine of formula 23 is commercially available , and is used as a chiral auxiliary is a primary amine or a chiral amino acid derivative , wherein ar and r are as defined above for the compound of formula 24 . preferably , the chiral amine of formula 23 is methylbenzylamine , and more preferably the chiral amine of formula 23 is ( s )- methylbenzylamine . preferably , the aromatic group is toluene . the preferred ether is selected from tert - butyl methyl ether , tetrahydrofuran , diisopropyl ether , and diethyl ether . preferably , the halogenated hydrocarbon is dichloromethane . preferred c 1 - 4 alcohols are isopropyl alcohol , ethanol , methanol , or n - butanol . preferably , the ester is selected from ethyl acetate , isopropyl acetate , and isobutyl acetate . a preferred straight , branched or cyclic c 1 - 6 alkane is either hexane or cyclohexane . preferred ketones are selected from acetone , methyl isobutyl ketone , and methyl ethyl ketone . the more preferred organic solvent is toluene . preferably , the base is an organic base selected from diethyl amine , triethyl amine , di - n - propyl amine , di - isopropyl amine , tertbutylamine , morpholine , piperidine , pyridine , and 4 - dimethyl aminopyridine . the most preferred base is 4 - dimethyl aminopyridine . preferably , the mixture is cooled to a temperature of about − 70 ° c . to about 10 ° c . before adding the 3 - isobutyl glutaric anhydride . preferably , the mixture is maintained at a temperature of about − 70 ° c . to about 10 ° c ., more preferably of about 0 ° c . to about − 50 ° c . and most preferably of about − 40 ° c . to − 30 ° c ., before recovering the compound of formula 24 . preferably , the mixture is maintained for at least about one hour , more preferably about one hour to about six hours , most preferably , about one hour to about two hours , before recovering the compound of formula 24 . the order of combining the reacting substances when preparing the compound of formula 24 may influence the purity and the yield of the final product . preferably , the chiral amine of formula 23 is combined with the base , followed by the addition of the 3 - isobutylglutaric anhydride of formula 22 . the compound of formula 24 may be recovered by any method known in the art , such as extracting the organic phase with an aqueous basic solution to convert the acidic product to a salt , and acidifying the aqueous phase with a mineral acid to obtain back the acid product . the compound of formula 24 may optionally be further purified by a crystallization from an organic solvent selected from at least one of esters , nitriles , ethers , c 4 - 6 straight , branched , or cyclic hydrocarbons , and c 6 - 10 substituted aromatic hydrocarbons . a preferred ester is ethyl acetate . preferably , the nitrile is acetonitrile . a preferred ether is methyl t - butyl ether . a preferred c 6 - 8 substituted aromatic group is either toluene or xylene . preferred mixtures are that of xylene and ethyl acetate , hexane and ethyl acetate , cyclohexane and ethyl acetate , and toluene and ethyl acetate . the most preferred mixture is that of toluene and ethyl acetate . the compound of formula 24 obtained by the above - described process has an optical purity of at least about 80 % area by hplc , preferably of at least about 93 % area by hplc , more preferably of about 98 % to about 100 % area by hplc , and most preferably of about 99 % to about 100 % area by hplc . the recovered compound of formula 24 is then converted to the diamide of formula 25 , in a process comprising combining a mixture of the compound of formula 24 and at least one organic solvent selected from substituted aromatic hydrocarbons , c 6 - 10 aliphatic hydrocarbons , halogenated carbons , ethers and ketones , an amidation reagent selected from c 1 - 4 alkyl and c 6 - 8 aryl haloformates , and acid halides , and at least one base , and adding ammonia to obtain the compound of formula 25 , which is then recovered . preferably , the ammonia is provided in an aqueous solution , i . e ., ammonium hydroxide . preferably , the c 1 - 4 alkyl halo formate is a ethyl or methyl derivative of a chloro or bromoformate . preferably , the c 6 - 8 aryl halo formate is a benzyl chloro or bromoformate . preferred acid halides are acetyl , pivaloyl , oxaloyl or benzoyl chlorides and bromides . the most preferred haloformate is either ethylchloroformate or methylchloroformate . the more preferred acid halide is acetyl , pivaloyl , oxaloyl , or benzoyl chlorides . the most preferred amidation reagent is either ethylchloroformate or methylchloroformate . preferably , the substituted aromatic hydrocarbon is either toluene or xylene . a preferred c 6 - 10 aliphatic hydrocarbon is either hexane or heptane . preferred ketones are acetone , methyl ethyl ketone , or methyl isobutyl ketone . preferably , the ether is diethyl ether , diisopropyl ether , or tert - butyl methyl ether . preferably , the halogenated hydrocarbon is dichloromethane . the more preferred organic solvent is either acetone or dichloromethane . preferably , the base is an organic base selected from diethyl amine , triethyl amine , di - n - propyl amine , di - isopropyl amine , tri - n - butyl amine , morpholine , piperidine , pyridine , and 4 - dimethyl aminopyridine . the preferred base is either 4 - dimethyl aminopyridine or triethyl amine . preferably , the mixture of the compound of formula 24 and an organic solvent is combined with the amidation reagent and the base at a temperature of about 20 ° c . to about − 30 ° c ., more preferably , of about − 10 ° c . to about − 20 ° c . preferably , the compound of formula 24 is compound 24a . preferably , the mixture is maintained at a temperature of about − 10 ° c . to about − 20 ° c . before the addition of ammonia . preferably , the mixture is maintained for about one hour to about two hours before the addition of ammonia . the compound of formula 25 may be recovered by known methods in the art , such as , filtering and drying . the compound of formula 25 is obtained by the above process having a purity of at least about 80 % area by hplc , more preferably of at least about 95 % area by hplc . then , the recovered compound of formula 25 is reacted with bromine in a hoffman reaction under basic conditions . the process comprises combining a solution of a compound of formula 25 in at least one straight or branched alkyl alcohol with bromine , in a presence of at least one base , to obtain a basic mixture , and warming the basic mixture to obtain the chiral carbamate of formula 26 , preferably the combining step is performed at a temperature of about − 25 ° c . to about − 45 ° c . preferably , the base is a metal alkoxide selected from sodium ethoxide , sodium methoxide , potassium methoxide , potassium ethoxide , and potassium tert - butoxide . the more preferred base is either sodium ethoxide or sodium methoxide . preferably , the basic mixture is warmed to a temperature of about 50 ° c . to about 70 ° c ., more preferably to a temperature of about 55 ° c . to about 60 ° c . preferably , the straight or branched alkyl alcohol is methyl , ethyl , isopropyl , n - butyl , isobutyl , or t - butyl alcohol , more preferably methanol or ethanol . preferably , the basic mixture is warmed for about 1 hour to about 4 hours before recovering the compound of formula 26 . the compound of formula 26 may be recovered by evaporating the solvent and further extracting with a solvent selected from dichloromethane , ethylacetate and toluene , followed by drying over a drying agent , such as , magnesium sulfate , followed by evaporating the solvent . the recovered compound of formula 26 may be purified by crystallization from at least one of an ether , ester , hydrocarbone , substituted hydrocarbon , or alcohol . preferably , the compound of formula 26 is crystallized from at least one of diisopropyl ether , ethyl acetate , cyclohexane , dichloromethane , or methanol . the compound of formula 26 is obtained by the above process having a purity of at least about 80 % area by hplc , preferably of about 90 % to about 100 %, area by hplc , more preferably of about 92 % to about 100 % area by hplc , and most preferably , of about 95 % to about 100 % area by hplc . the amide moiety of the recovered compound of formula 26 is then converted to a primary amide moiety , to give the compound of formula 27 in a process comprising combining the compound of formula 26 and a mixture of water and an ether to obtain a mixture , combining the mixture with ammonia and an alkali metal to obtain a reaction mixture , and evaporating the excess of ammonia to obtain the compound of formula 27 . preferably , the mixture containing the compound of formula 26 and a mixture of water and ether is combined with ammonia and an alkali metal at a temperature of about − 30 ° c . to about − 60 ° c ., more preferably at a temperature of about − 40 ° c . to about − 30 ° c . preferably , the excess ammonia is evaporated by maintaining the reaction mixture for about 4 to about 10 hours . the compound of formula 27 may be recovered by any known method in the art , such as , extraction and drying over anhydrous sodium sulfate . the compound of formula 27 may optionally be purified by crystallization from ether , preferably , diisopropyl ether . the compound of formula 27 is then converted to ( s )- pregabalin in a process comprising combining the compound of formula 27 with an acid to obtain a mixture and recovering ( s )- pregabalin from the mixture . preferably , the acid is a strong mineral acid , more preferably either hydrochloric acid or sulfuric acid . preferably , the mixture is maintained at a temperature of about 60 ° c . to about 130 ° c ., more preferably of about 80 ° c . to about 110 ° c ., before recovering the ( s )- pregabalin . preferably , the mixture is maintained for about 5 to about 30 hours before recovering the ( s )- pregabalin . preferably , the mixture is maintained for about 18 to about 30 hours , when the mineral acid is hydrochloric acid and for about 5 to about 10 hours , when the mineral acid is sulfuric acid , before recovering the ( s )- pregabalin . ( s )- pregabalin may be recovered by adjusting the ph of the mixture to about 3 to about 1 , preferably by addition of a strong base ; extracting a solution of ( s )- pregabalin from the mixture with an alcohol ; adjusting the ph of the solution to about 4 to about 7 , preferably with an inorganic or an organic base , to induce the precipitation of ( s )- pregabalin ; and recovering the precipitated ( s )- pregabalin . ( s )- pregabalin obtained by the above process has at least about 80 % enantiomeric purity by area hplc , preferably at least about 93 % area by hplc , more preferably , about 98 % to about 100 % area by hplc , even more preferably , about 99 % to about 100 % area by hplc , and most preferably of about 99 . 9 % to about 100 % area by hplc . in an alternative process , the chiral carbamate compound of formula 26 may be converted directly to ( s )- pregabalin . the process comprises combining the compound of formula 26 with an acid to obtain a mixture and maintaining the obtained mixture at a temperature of about 60 ° c . to about 130 ° c ., for about 3 hours to about 30 hours , to obtain ( s )- pregabalin , which is then recovered . preferably , the acid is a strong mineral acid . preferably , the strong mineral acid is selected from a group consisting of hydrochloric acid , hydrobromic acid , and sulfuric acid . preferably , the mixture is maintained at temperature of about 80 ° c . to about 125 ° c . preferably , the mixture is maintained for about 10 to about 30 hours when the mineral acid is hydrochloric acid , for about 5 to about 10 hours when the mineral acid is sulfuric acid , and for about 3 hours when the mineral acid is hydrobromic acid . ( s )- pregabalin may be recovered by the same method described for the reaction of converting the compound of formula 27 to ( s )- pregabalin . further , 3 - isobutyl glutaric anhydride of formula 22 can be regenerated by a process comprising the steps of combining the filtrate obtained from the crystallization process of compound of formula 24a with an acid to form a first mixture , recovering 3 - isobutyl glutaric acid of the following formula 28 from the first mixture , combining the 3 - isobutyl glutaric acid with acetic anhydride to obtain a second mixture , and recovering 3 - isobutyl glutaric anhydride of formula 22 from the second mixture , which may then be reused . preferably , the acid is a strong mineral acid , more preferably either a 4 n to 12 n hydrochloric acid or 20 percent to 80 percent sulfuric acid . preferably the first mixture is maintained at a temperature of about 60 ° c . to about 130 ° c . before recovering the 3 - isobutyl glutaric acid . preferably , when the mineral acid is hydrochloric acid , the first mixture is maintained at temperature of about 100 ° c . to about 110 ° c . before recovering the 3 - isobutyl glutaric acid . preferably , when the mineral acid is sulfuric acid , the first mixture is maintained at a temperature of about 60 ° c . to about 130 ° c . before recovering the 3 - isobutyl glutaric acid . preferably , the second mixture is heated to a temperature of about 125 ° c . to about 145 ° c ., more preferably , of about 130 ° c . to about 140 ° c ., before recovering the 3 - isobutyl glutaric anhydride . the 3 - isobutyl glutaric anhydride may be recovered by any method known in the art , such as , distilling the excess of acetic anhydride and cooling . in yet another embodiment , the present invention provides pharmaceutical compositions comprising enantiomerically pure ( s )- pregabalin and at least one pharmaceutically acceptable excipient . such ( s )- pregabalin has at least about 80 % enantiomeric purity , preferably of at least about 93 % area by hplc , more preferably , of about 98 % to about 100 % area by hplc , even more preferably , of about 99 % to about 100 % area by hplc , and most preferably of about 99 . 9 % to about 100 % area by hplc . such pharmaceutical composition can be prepared by combining ( s )- pregabalin with one or more excipients or adjuvants . selection of excipients and the amounts to use may be readily determined by the formulation scientist based upon experience and consideration of standard procedures and reference works in the field . diluents increase the bulk of a solid pharmaceutical composition , and may make a pharmaceutical dosage form containing the composition easier for the patient and care giver to handle . diluents for solid compositions include , for example , microcrystalline cellulose ( e . g . avicel ®), microfine cellulose , lactose , starch , pregelitinized starch , calcium carbonate , calcium sulfate , sugar , dextrates , dextrin , dextrose , dibasic calcium phosphate dihydrate , tribasic calcium phosphate , kaolin , magnesium carbonate , magnesium oxide , maltodextrin , mannitol , polymethacrylates ( e . g . eudragit ®), potassium chloride , powdered cellulose , sodium chloride , sorbitol , and talc . solid pharmaceutical compositions that are compacted into a dosage form , such as a tablet , may include excipients whose functions include helping to bind the active ingredient and other excipients together after compression . binders for solid pharmaceutical compositions include acacia , alginic acid , carbomer ( e . g . carbopol ), carboxymethylcellulose sodium , dextrin , ethyl cellulose , gelatin , guar gum , hydrogenated vegetable oil , hydroxyethyl cellulose , hydroxypropyl cellulose ( e . g . klucel ®), hydroxypropyl methyl cellulose ( e . g . methocel ®), liquid glucose , magnesium aluminum silicate , maltodextrin , methylcellulose , polymethacrylates , povidone ( e . g . kollidon ®, plasdone ), pregelatinized starch , sodium alginate , and starch . the dissolution rate of a compacted solid pharmaceutical composition in the patient &# 39 ; s stomach may be increased by the addition of a disintegrant to the composition . disintegrants include alginic acid , carboxymethylcellulose calcium , carboxymethylcellulose sodium ( e . g . ac - di - sol ®, primellose ®), colloidal silicon dioxide , croscarmellose sodium , crospovidone ( e . g . kollidon ®, polyplasdone ®), guar gum , magnesium aluminum silicate , methyl cellulose , microcrystalline cellulose , polacrilin potassium , powdered cellulose , pregelatinized starch , sodium alginate , sodium starch glycolate ( e . g . explotab ®), and starch . glidants can be added to improve the flowability of a non - compacted solid composition and to improve the accuracy of dosing . excipients that may function as glidants include colloidal silicon dioxide , magnesium trisilicate , powdered cellulose , starch , talc , and tribasic calcium phosphate . when a dosage form such as a tablet is made by the compaction of a powdered composition , the composition is subjected to pressure from a punch and die . some excipients and active ingredients have a tendency to adhere to the surfaces of the punch and die , which can cause the product to have pitting and other surface irregularities . a lubricant can be added to the composition to reduce adhesion and ease the release of the product from the die . lubricants include magnesium stearate , calcium stearate , glyceryl monostearate , glyceryl palmitostearate , hydrogenated castor oil , hydrogenated vegetable oil , mineral oil , polyethylene glycol , sodium benzoate , sodium lauryl sulfate , sodium stearyl fumarate , stearic acid , talc , and zinc stearate . flavoring agents and flavor enhancers make the dosage form more palatable to the patient . common flavoring agents and flavor enhancers for pharmaceutical products that may be included in the composition of the present invention include maltol , vanillin , ethyl vanillin , menthol , citric acid , fumaric acid , ethyl maltol , and tartaric acid . solid and liquid compositions may also be died using any pharmaceutically acceptable colorant to improve their appearance and / or facilitate patient identification of the product and unit dosage level . in liquid pharmaceutical compositions of the present invention , the active ingredient and any other solid excipients are suspended in a liquid carrier such as water , vegetable oil , alcohol , polyethylene glycol , propylene glycol or glycerin . liquid pharmaceutical compositions may contain emulsifying agents to disperse uniformly throughout the composition an active ingredient or other excipient that is not soluble in the liquid carrier . emulsifying agents that may be useful in liquid compositions of the present invention include , for example , gelatin , egg yolk , casein , cholesterol , acacia , tragacanth , chondrus , pectin , methyl cellulose , carbomer , cetostearyl alcohol , and cetyl alcohol . liquid pharmaceutical compositions of the present invention may also contain a viscosity enhancing agent to improve the mouth - feel of the product and / or coat the lining of the gastrointestinal tract . such agents include acacia , alginic acid bentonite , carbomer , carboxymethylcellulose calcium or sodium , cetostearyl alcohol , methyl cellulose , ethylcellulose , gelatin guar gum , hydroxyethyl cellulose , hydroxypropyl cellulose , hydroxypropyl methyl cellulose , maltodextrin , polyvinyl alcohol , povidone , propylene carbonate , propylene glycol alginate , sodium alginate , sodium starch glycolate , starch tragacanth , and xanthan gum . sweetening agents such as sorbitol , saccharin , sodium saccharin , sucrose , aspartame , fructose , mannitol , and invert sugar may be added to improve the taste . preservatives and chelating agents such as alcohol , sodium benzoate , butylated hydroxy toluene , butylated hydroxyanisole , and ethylenediamine tetraacetic acid may be added at levels safe for ingestion to improve storage stability . according to the present invention , a liquid composition may also contain a buffer such as gluconic acid , lactic acid , citric acid or acetic acid , sodium gluconate , sodium lactate , sodium citrate , or sodium acetate . selection of excipients and the amounts used may be readily determined by the formulation scientist based upon experience and consideration of standard procedures and reference works in the field . the solid compositions of the present invention include powders , granulates , aggregates , and compacted compositions . the dosages include dosages suitable for oral , buccal , rectal , parenteral ( including subcutaneous , intramuscular , and intravenous ), inhalant , and ophthalmic administration . although the most suitable administration in any given case will depend on the nature and severity of the condition being treated , the most preferred route of the present invention is oral . the dosages may be conveniently presented in unit dosage form and prepared by any of the methods well known in the pharmaceutical arts . dosage forms include solid dosage forms like tablets , powders , capsules , suppositories , sachets , troches , and losenges , as well as liquid syrups , suspensions , and elixirs . the dosage form of the present invention may be a capsule containing the composition , preferably a powdered or granulated solid composition of the invention , within either a hard or soft shell . the shell may be made from gelatin , and , optionally , contain a plasticizer such as glycerin and sorbitol , and an opacifying agent or colorant . the active ingredient and excipients may be formulated into compositions and dosage forms according to methods known in the art . a composition for tableting or capsule filling can be prepared by wet granulation . in wet granulation , some or all of the active ingredients and excipients in powder form are blended , and then further mixed in the presence of a liquid , typically water , that causes the powders to clump into granules . the granulate is screened and / or milled , dried , and then screened and / or milled to the desired particle size . the granulate may then be tableted or other excipients may be added prior to tableting , such as a glidant and / or a lubricant . a tableting composition can be prepared conventionally by dry blending . for example , the blended composition of the actives and excipients may be compacted into a slug or a sheet , and then comminuted into compacted granules . the compacted granules may subsequently be compressed into a tablet . as an alternative to dry granulation , a blended composition may be compressed directly into a compacted dosage form using direct compression techniques . direct compression produces a more uniform tablet without granules . excipients that are particularly well suited for direct compression tableting include microcrystalline cellulose , spray dried lactose , dicalcium phosphate dihydrate and colloidal silica . the proper use of these and other excipients in direct compression tableting is known to those in the art with experience and skill in particular formulation challenges of direct compression tableting . a capsule filling of the present invention may comprise any of the aforementioned blends and granulates that were described with reference to tableting , however , they are not subjected to a final tableting step . in another embodiment , the present invention provides a method of treating a patient comprising administering to a patient in need thereof a therapeutically effective amount of the above crystalline form of o - desmethylvenlafaxine . preferably , the patient suffers from a condition which may be treated with a norepinephrine or a serotonin re - uptake inhibitor . such patient may be suffering from depression . the following non - limiting examples are merely illustrative of the preferred embodiments of the present invention , and are not to be construed as limiting the invention , the scope of which is defined by the appended claims . a three - necked flask equipped with an addition funnel , thermometer pocket , drying tube and a mechanical stirrer , was charged with toluene ( 400 ml ), ( s )-(−)- phenylethylamine ( 142 . 35 g , 1 . 1764 mole ), and 4 - dimethylaminopyridine ( 0 . 7176 g , 0 . 0059 mole ). the mixture was cooled to a temperature of − 10 ° c . to − 15 ° c ., followed by addition of a solution of 3 - isobutyl glutaric anhydride ( 100 g , 0 . 59 mole ) in toluene ( 100 ml ), over a period of 45 - 60 minutes , and stirring for additional 1 . 5 - 2 hours , at a temperature of − 10 ° c . to − 15 ° c . the mixture was then extracted with 10 % aqueous solution of naoh ( 500 ml ), and the aqueous phase was washed with toluene ( 1 × 250 ml ). the ph of the aqueous phase was adjusted to 2 - 2 . 5 by adding a solution of hydrochloric acid ( 1 - 12 n ). the aqueous phase was further extracted with toluene ( 1 × 800 ml ) at a temperature of 70 - 80 ° c . the toluene layer was washed with 10 % sodium chloride solution { 700 ml ) at a temperature of 70 - 80 ° c . followed by crystallization to get 125 g ( 73 . 0 % yield ) of a white solid of ( 3s )- 5 - methyl - 3 -( 2 - oxo - 2 -{[( 1s )- 1 - phenylethyl ] amino } ethyl ) hexanoic acid with an optical purity of 99 . 75 %, as measured by chiral hplc . a three - necked flask equipped with an addition funnel , thermometer pocket , drying tube and a mechanical stirrer , was charged with toluene ( 400 ml ), ( s )-(−)- phenylethylamine ( 38 . 59 g , 0 . 0 . 319 mole ), and 4 - dimethylaminopyridine ( 0 . 358 g , 0 . 0029 mole ). the mixture was cooled to a temperature of − 40 ° c . to − 50 ° c ., followed by addition of a solution of 3 - isobutyl glutaric anhydride ( 50 g , 0 . 294 mole ) in toluene ( 100 ml ), over a period of 45 - 60 minutes , and stirring for additional 1 . 5 - 2 hours , at a temperature of − 40 ° c . to − 50 ° c . the mixture was then extracted with 3 . 5 - 4 . 0 % aqueous solution of naoh ( 1000 ml ), and the aqueous phase was washed with toluene ( 1 × 250 ml ). the ph of the aqueous phase was adjusted to 2 - 2 . 5 by adding a solution of hydrochloric acid ( 1 - 12 n ). the aqueous phase was further extracted with ethyl acetate ( 1 × 300 ml and 1 × 100 ml ), followed by drying the combined ethyl acetates extracts over anhydrous sodium sulphate , and stripping off the solvents to obtain a residue . the residue was crystallized from ethyl acetate and toluene mixture to get 60 . 7 g ( 71 . 0 % yield ) of a white solid of ( 3s )- 5 - methyl - 3 -( 2 - oxo - 2 -{[( 1s )- 1 - phenylethyl ] amino } ethyl ) hexanoic acid with an optical purity of 99 . 75 %, as measured by , chiral hplc . a three - necked flask equipped with an addition funnel , thermometer pocket , drying tube and a mechanical stirrer , was charged with toluene ( 1000 ml ), ( s )-(−)- phenylethylamine ( 266 . 9 g , 2 . 206 mole ), and 4 - dimethylaminopyridine ( 1 . 79 g , 0 . 0147 mole ). the mixture was cooled to a temperature of − 40 ° c . to − 50 ° c ., followed by addition of a solution of 3 - isobutyl glutaric anhydride ( 250 g , 1 . 471 mole ) in toluene ( 250 ml ), over a period of 45 - 60 minutes , and stirring for additional 1 . 5 - 2 hours , at a temperature of − 40 ° c . to − 50 ° c . the mixture was then extracted with 3 . 5 - 4 . 0 % aqueous solution of naoh ( 2350 ml ), and the aqueous phase was washed with toluene ( 1 × 250 ml ). the ph of the aqueous phase was adjusted to 2 - 2 . 5 by adding a solution of hydrochloric acid ( 1 - 12 n ). the aqueous phase was further extracted with ethyl acetate ( 1 × 1250 ml and 1 × 500 ml ), followed by drying the combined ethyl acetates extracts over anhydrous sodium sulphate , and stripping off the solvents to obtain a residue . the residue was crystallized from toluene to get 344 g ( 80 . 5 % yield ) of a white solid of ( 3s )- 5 - methyl - 3 -( 2 - oxo - 2 -{[( 1s )- 1 - phenylethyl ] amino } ethyl ) hexanoic acid with an optical purity of 98 . 69 %, as measured by chiral hplc . a three - necked flask equipped with an addition funnel , thermometer pocket , drying tube and a mechanical stirrer , was charged with methylene dichloride ( 1000 ml ), ( 3s )- 5 - methyl - 3 -( 2 - oxo - 2 {[( 1s )- 1 - phenylethyl ] amino } ethyl ) hexanoic acid compound ( 24 ) ( 200 g , 0 . 687 mole ), and with triethylamine ( 7 . 65 g , 0 . 756 mole ), and cooled to 0 °- 5 ° c . followed by addition of ethyl chloroformate ( 90 g , 0 . 825 mole ). the mixture was stirred for 1 - 2 hours at a temperature of 20 ° c . to 25 ° c ., followed by quenching with 25 % aqueous ammonia ( 1000 ml ). the resulted slurry was filtered and washed with water and dried to get 140 g ( 70 . 0 % yield ) of a white solid of ( r )- 3 - isobutylpentanedioic acid amide -(( s )- 1 - phenylethyl ) amide of formula 25a , with a purity of 95 %, as measured by hplc . a three - necked flask equipped with an addition funnel , thermometer pocket , drying tube and a mechanical stirrer , was charged with methylene dichloride ( 500 ml ), ( 3s )- 5 - methyl - 3 -( 2 - oxo - 2 {[( 1s )- 1 - phenylethyl ] amino } ethyl ) hexanoic acid compound ( 24 ) ( 100 g , 0 . 343 mole ), and with triethylamine ( 41 . 67 g , 0 . 412 mole ), and cooled to − 15 ° c . to − 20 ° c . followed by addition of ethyl chloroformate ( 39 . 1 g , 0 . 36 mole ). the mixture was stirred for 1 - 2 hours at a temperature of − 15 ° c . to − 20 ° c ., followed by quenching over a solution of 20 % aqueous ammonia ( 280 ml ). the dichloromethane was distilled out from the mass followed by filtering the resulted slurry , washed with water and dried to get 87 g ( 87 % yield ) of a white solid of ( r )- 3 - isobutylpentanedioic acid amide (( s )- 1 - phenylethyl ) amide of formula 25a , with a purity of 98 %, as measured by hplc . a three - necked flask equipped with an addition funnel , thermometer pocket , drying tube and a mechanical stirrer , was charged with methylene dichloride ( 125 ml ), ( 3s )- 5 - methyl - 3 -( 2 - oxo - 2 {[( 1s )- 1 - phenylethyl ] amino } ethyl ) hexanoic acid compound ( 24 ) ( 25 g , 0 . 086 mole ), triethyl amine ( 10 . 43 g , 0 . 129 mole ), and cooled to 0 °- 5 ° c . followed by addition of pivaloyl chloride ( 12 . 43 g , 0 . 103 mole ). the mixture was stirred for 1 - 2 hours at a temperature of 20 ° c . to 25 ° c ., followed by quenching with 20 % aqueous ammonia ( 250 ml ). the resulted slurry was filtered and washed with water and dried to get 152 g ( 61 % yield ) of a white solid of ( r )- 3 - isobutylpentanedioic acid amide (( s )- 1 - phenylethyl ) amide of formula 25a , with a purity of 95 %, as measured by hplc . a three - necked flask equipped with an addition funnel , thermometer pocket , drying tube and a mechanical stirrer , was charged with acetone ( 125 ml ), ( 3s )- 5 - methyl - 3 -( 2 - oxo - 2 {[( 1s )- 1 - phenylethyl ] amino } ethyl ) hexanoic acid compound ( 24 ) ( 25 g , 0 . 086 mole ), triethyl amine ( 10 . 43 g , 0 . 129 mole ), and cooled to 0 - 5 ° c . followed by addition of pivaloyl chloride ( 12 . 43 g , 0 . 103 mole ). the mixture was stirred for 1 - 2 hours at a temperature of 20 ° c . to 25 ° c ., followed by quenching with 20 % aqueous ammonia ( 250 ml ). the resulted slurry was filtered and washed with water and dried to get 10 . 68 g ( 43 . 4 % yield ) of a white solid of ( r )- 3 - isobutylpentanedioic acid amide -(( s )- 1 - phenylethyl ) amide of formula 25 , with a purity of 95 . 4 %, as measured by hplc . a three - necked flask equipped with an addition funnel , thermometer pocket , drying tube and a mechanical stirrer , was charged with methanol ( 1400 ml ), and cooled to − 40 ° to − 45 ° c . followed by addition of sodium methoxide ( 130 g , 2 . 413 mole ). a solution of bromine ( 154 . 48 g , 0 . 965 mole ) in methanol ( 300 ml ) was slowly added at about − 40 to − 45 ° c . followed by addition of ( r )- 3 - isobutylpentanedioic acid amide -(( s )- 1 - phenylethyl ) amide , of formula 25 ( 140 g , 0 . 48 mole ), in methanol ( 560 ml ). the mixture was gradually warmed to a temperature of 0 ° c . and then to 55 - 60 ° c ., followed by stirring for 2 to 3 hours . the solvent was then stripped off and water was added to the mass . the resulted slurry was further extracted with methylene dichloride ( 1 × 500 ml and 1 × 250 ml ), followed by drying the combined methylene dichloride extracts over anhydrous sodium sulphate , and stripping off the solvents to obtain a residue . the residue was crystallized from diisopropyl ether to get 115 g ( 74 . 2 . 0 % yield ) of a white solid of {( s )- 4 - methyl - 2 -[(( s )- 1 - phenylethylcarbamoyl )- methyl ] pentyl } carbamic acid methyl ester ( 26 ) with a purity of 92 %, as measured by hplc . a three - necked flask equipped with an addition funnel , thermometer pocket , drying tube and a mechanical stirrer , was charged with methanol ( 2000 ml ), and cooled to − 15 ° to − 20 ° c ., ( r )- 3 - isobutylpentanedioic acid amide -(( s )- 1 - phenylethyl ) amide , of formula 25 ( 100 g , 0 . 344 mole ) followed by addition of sodium methoxide ( 74 . 5 g , 1 . 38 mole ). bromine ( 82 . 56 g , 0 . 516 mole ) was slowly added at about − 15 to − 20 ° c . the mixture was gradually warmed to a temperature of 0 ° c . and then to 55 - 60 ° c ., followed by stirring for 2 to 3 hours . the solvent was then stripped off and water was added to the mass . the resulted slurry was further extracted with methylene dichloride ( 1 × 500 ml ), followed by washing the methylene dichloride extract with water and brine solution . the solvent was stripped off and the residue was crystallized from a mixture of methylene dichloride and cyclohexane to get 95 g ( 85 . 8 . 0 % yield ) of a white solid of {( s )- 4 - methyl - 2 -[(( s )- 1 - phenylethylcarbamoyl )- methyl ] pentyl } carbamic acid methyl ester ( 26 ) with a purity of 93 %, as measured by hplc . a 2 1 , four - necked flask , equipped with a mechanical stirrer , thermometer pocket and a liquid ammonia inlet , was charged with {( s )- 4 - methyl - 2 -[(( s )- 1 - phenylethylcarbamoyl )- methyl ] pentyl } carbamic acid methyl ester ( 26 ) ( 25 g , 0 . 078 mole ), tetrahydrofuran ( 175 ml ), and water ( 25 ml ). the reaction mixture was cooled to − 40 ° to − 60 ° c . and liquid ammonia ( 1000 ml ) was added followed by addition of small pieces of sodium metal ( 7 . 2 g ). the resultant reaction mixture was stirred vigorously for 4 - 10 hours until the ammonia had evaporated . water ( 100 ml ) was added to the reaction mass under n 2 atmosphere at 5 °- 10 ° c ., followed by separating the phases . the organic layer was separated and dried over anhydrous sodium sulphate and the solvent was stripped off . the residue was crystallized from diisopropyl ether to get 10 . 2 g ( 60 % yield ) of {( s )- 2 - carbamoylmethyl - 4 - methylpentyl ) carbamic acid methyl ester with purity of 73 % as measured by hplc . a 31 four - necked flask , equipped with a mechanical stirrer , thermometer pocket , and condenser , was charged with a residue after crystallization of compound 24a , ( 250 g ) from examples 1 and 2 , and 70 % sulfuric acid ( 2500 g ). the reaction mixture was refluxed at 115 °- 125 ° c . for 5 - 10 hours , and then cooled to 20 °- 25 ° c . and diluted with water . the aqueous layer was extracted with toluene ( 1 × 1000 ml and 1 × 500 ml ). the combined organic phase was extracted with 5 % sodium hydroxide solution ( 1500 ml ), and the ph of the aqueous layer was adjusted to 1 . 5 - 2 with concentrated hydrochloric acid , followed by extractions with toluene ( 1 × 600 ml and 1 × 400 ml ). the combined organic layers were dried over anhydrous sodium sulphate and the solvent was stripped off to obtain 3 - isobutyl glutaric acid ( 128 g ) in purity of 94 % as measured by gc . 2 . 1 h nmr ( cdcl3 ): δ 0 . 89 - 0 . 92 ( d , 6h ), 1 . 25 ( t , 2h ), 1 . 6 - 1 . 69 ( septet , 1h ), 2 . 42 ( s , 4h ), 11 . 96 ( s , 2h ). 3 . 13 c nmr ( cdcl 3 ): δ 22 . 39 , 25 . 06 , 28 . 11 , 29 . 50 , 38 . 45 , 43 . 38 , 179 . 17 , 203 . a 1 1 , four - necked flask equipped with a mechanical stirrer , thermometer pocket and condenser , was charged with 3 - isobutyl glutaric acid ( 500 g ) and acetic anhydride ( 326 g ). the reaction mixture was refluxed at 135 °- 1450 ° c . for 2 . 5 - 3 hours , followed by distilling out the unreacted acetic anhydride at 147 °- 155 ° c ., and then the distillation was continued under vacuum to ensure removal of traces of unreacted acetic anhydride . the residue was cooled to 25 °- 30 ° c . to obtain 445 g of 3 - isobutylglutaric anhydride . a 0 . 2 1 reactor was loaded with 6n hydrochloric acid ( 100 ml ) containing compound 27 ( 12 g , 0 . 055 mole ), and was heated to 100 °- 110 ° c . for 12 - 24 , hours , and then cooled to room temperature , i . e ., about 20 ° to about 25 ° c . an aqueous 40 % sodium hydroxide solution was added in an amount sufficient to provide a ph of 1 . the solution was then extracted with 37 ml of iso - butanol , the organic layer was separated , and bu 3 n was added in an amount sufficient to provide a ph of 4 . the ( s )- pregabalin was precipitated , filtered , and washed with 10 ml of iso - butanol . after drying at 55 ° c . under vacuum , ( s )- pregabalin was obtained as white crystals in a 21 . 5 % yield . purity : 99 . 9 % area by hplc . a 0 . 2 1 reactor was loaded with 70 % sulfuric acid ( 200 g ) containing compound 26 ( 10 g , 0 . 031 mole ), and was heated to 115 - 120 ° c . for 5 - 10 hours , and then cooled to room temperature , i . e ., about 20 ° to about 25 ° c . an aqueous 40 % sodium hydroxide solution was added in an amount sufficient to provide a ph of 1 . the solution was then extracted with 35 ml of iso - butanol , the organic layer was separated , and bu 3 n was added in an amount sufficient to provide a ph of 4 . the ( s )- pregabalin was precipitated , filtered , and washed with 10 ml of iso - butanol . after drying at 55 ° c . under vacuum , ( s )- pregabalin was obtained as white crystals in a 40 . 4 % yield . purity : 99 . 95 % area by hplc . a 0 . 2 1 reactor was loaded with 70 % sulfuric acid ( 200 g ) containing compound 26 ( 10 g , 0 . 031 mole ), and was heated to 115 - 120 ° c . for 5 - 10 hours , and then cooled to room temperature , i . e ., about 20 ° to about 25 ° c . an aqueous 40 % sodium hydroxide solution was added in an amount sufficient to provide a ph of 1 . the solution was then extracted with 50 ml of isopropanol , the organic layer was separated , and nh 4 oh was added in an amount sufficient to provide a ph of 4 . the ( s )- pregabalin was precipitated , filtered , and washed with 10 ml of isobutanol . after drying at 55 ° c . under vacuum , ( s )- pregabalin was obtained as white crystals in a 50 . 4 % yield . purity : 99 . 05 % area by hplc . a flask was loaded with 47 % hbr ( 12 ml ), water ( 6 ml ), and compound 26 ( 6 g ), and then was heated to reflux for 3 hours . the solution was cooled to room temperature , and water ( 12 ml ) was added . an aqueous 47 % sodium hydroxide solution was added to obtain ph of 3 . the solution was then extracted twice with isobutanol ( 15 ml ), the combined organic layers were evaporated and fresh isobutanol was added ( 15 ml ). bu 3 n ( 3 . 8 g ) was added . the mixture was cooled to 2 ° c . for 1 hour , then ( s )- pregabalin was filtered , and washed with of iso - butanol ( 3 ml ). after drying at 55 ° c . under vacuum , ( s )- pregabalin was obtained as white crystals in a 90 % yield . a flask was loaded with 47 % hbr ( 30 ml ), water ( 15 ml ), and compound 26 ( 15 g ), and then was heated to reflux for 3 hours . the solution was cooled to room temperature and water ( 30 ml ) was added . an aqueous 47 % sodium hydroxide solution was added to obtain ph of 3 . the solution was then extracted twice with iso - butanol ( 37 . 5 ml ). the organic layers were combined and bu 3 n ( 9 . 5 g ) was added . the mixture was cooled to 2 ° c . for 1 hour , then ( s )- pregabalin was filtered , and washed with of iso - butanol ( 10 ml ). after drying at 55 ° c . under vacuum , ( s )- pregabalin was obtained as white crystals in a 51 % yield . while it is apparent that the invention disclosed herein is well calculated to fulfill the objects stated above , it will be appreciated that numerous modifications and embodiments may be devised by those skilled in the art . therefore , it is intended that the appended claims cover all such modifications and embodiments as falling within the true spirit and scope of the present invention .	2
fig1 shows schematically a substrate 100 containing a region of interest 110 . a gas - injection system ( not shown ) has laid down a stress - buffer layer 120 over the region of interest 110 . fig1 also shows optional alignment marks 130 that may be milled into the surface of the substrate 100 or the stress - buffer layer 120 , or both . the material for the stress - buffer layer should be chosen based on its having sufficient mechanical properties to reduce mechanical stresses applied to the sample during nano - manipulation operations . in contrast , the standard energetic beam - assisted cvd protective layers that are deposited are chosen based primarily on properties of having low ion sputtering rates so as to serve as hard masks protecting the sample during ion milling , and secondarily , based on material properties providing sufficient imaging contrast to the sample in the tem and having suitable properties of amorphous or very fine crystalline structure to reduce curtaining artifacts . the deposited material used for the stress - buffer layer should be a material that does not fracture in a brittle manner when a crack is present , since this could result in the catastrophic loss of the sample ( assuming perfect bonds between the stress - buffer layer and the sample surface ). no matter how high the fracture strength of a brittle attachment material , the likelihood of very high leveraged stresses at the point of contact between the probe tip and sample , and the risk of damaging mechanical shock and vibration from the microscope and environment , make the selection of a brittle material unwise . lift - out failures causing sample damage or loss are typically due to mechanical stresses transmitted at the contact point between the end - effector and the sample . often the fail site occurs at the vicinity of the weld between the end effector and sample . therefore the ideal stress - buffer material would deform at a lower stress level than that sufficient to cause the weld to fail . it should possess the desired mechanical property of high fracture toughness . materials with high fracture toughness absorb a larger amount of energy before failing and are more likely to fail by ductile fracture . although plastic deformation of the stress - buffer material may result in some misalignment of the sample , this would be preferred to the loss of the sample . as long as the misalignment is not too severe , it can most likely be corrected for , either by reorientation of the sample or by mechanical realignment . the selection of the stress - buffer material should provide for sufficient fracture toughness with an appropriate stiffness ( resistance to deformation ). a material such as a cvd conductive polymer would likely be a good candidate for this application . other suitable materials include pure metals , such as au and pt , as well as high fracture strength brittle materials that behave elastically in thin films and that are not heavily contaminated with byproducts of the deposition process . it may be necessary to perform tests of deposited cvd materials to determine the actual mechanical properties of these films for suitability to their role as a stress - buffer layer in this application . pure metals may be deposited by methods known in the art , such as those described in : roberts , nicholas a . et al . “ enhanced material purity and resolution via synchronized laser assisted electron beam induced deposition of platinum ,” nanoscale 5 . 1 ( 2013 ): 408 - 415 . it should be noted that the desired stress - buffer layer 120 may in some cases be provided by the conventional practice of depositing a protective layer over the region of interest 110 . the purpose of the protective layer is to protect the sample surface from erosion by the energetic beam during sample processing and imaging . typically this protective layer is platinum , deposited by a precursor from a gas - injection system ( not shown ). carbon and oxide protective layers are often used , but would not have sufficient ductility for stress mitigation . we can take advantage of a platinum protective layer itself as a stress - buffer layer 120 by extending it in at least one dimension beyond the area that will be extracted during lift - out , or by applying it in addition to a protective layer such as carbon . we have found that a stress - buffer layer 120 should be approximately 2 to 3 μm thick for best results with the methods disclosed here . fig1 shows the stress - buffer layer as parallelepiped , but it may be any suitable arbitrary shape , so long as it extends over both the region of interest 110 and the substrate 100 in at least one dimension after the desired sample 170 is isolated , as next described . after laying - down of the stress - buffer layer 120 , a first trench 140 is formed in the front side of the region of interest 110 , and a second trench 150 is formed on the back side of the region of interest , as shown in fig2 . the first trench 140 and the second trench 150 may be formed by milling with the focused ion - beam 160 , as is known in the art . the substrate 100 may be tilted in the fib as necessary to accomplish the milling of the trenches 140 , 150 . the milled trenches 140 , 150 on either side of the stress - buffer layer 120 do not need to be equal in size . however , one side needs to be large enough to access the desired area for cutting out the sample 170 , as shown in fig3 . fig3 shows the next milling operation completed , where the sample 170 containing the region of interest 110 is isolated from the substrate 100 by an isolating cut 180 , so that the sample 170 is completely isolated from the bulk substrate 100 , although still attached to the stress - buffer layer 120 . in this way , attachment of an end - effector , illustrated hereafter by the probe 190 of a nano - manipulator , is made only on the stress - buffer layer 120 , and not the sample 170 itself . the reader should note that the region of interest 110 depicted schematically in the drawings may actually include the entire sample 170 , and is not necessarily restricted to a small area within the sample 170 , as suggested by the drawings . fig4 a through 4 show schematically embodiments of the isolating cut 180 operation , isolating the sample 170 from the substrate 100 . fig4 a shows the isolating cut 180 isolating a sample 170 held on one side to the substrate 100 by the stress - buffer layer 120 . fig4 b shows a stress - buffer layer 120 extending over both edges of an isolated sample 170 . fig4 c shows the same configuration as 4 b , but here the isolating cut 180 has removed some material from the stress - butter layer 120 . fig4 d shows the same configuration as fig4 c , but here the isolating cut 180 has released one side of the stress - buffer layer 120 . fig4 e represents a stress - buffer layer 120 on either side of the isolating cut 180 , and illustrates that a different protective layer 200 , such as carbon , not suitable for stress - buffering , may be formed over the region of interest 110 , so long as an appropriate stress - buffer layer 120 bridges the gap between the sample 170 and the substrate 100 . fig4 f shows a sample 170 without a protective layer or any stress - buffer layer 120 directly over the region of interest 110 . in the foregoing illustrations , the isolating cut 180 is shown as u - shaped , but any arbitrary shape may be used , so long as it isolates the sample 170 from the substrate 100 as shown . also , the reader should note that the stress - buffer layer 120 may be laid down after a cut is made to partially isolate the sample 170 , but before completing the isolating cut 180 to completely isolate the sample 170 . fig5 a through 5b shown possible attachments of an end - effector , in this case a probe 190 , to an exemplary stress - buffer layer 120 ; respectively , from one side , or the center , or the opposing side of the stress - buffer layer 120 , depending on the sensitivity of the substrate 100 material to tensile versus mixed - mode stresses , or depending on geometric access of the probe 190 to the sample 170 . for clarity , the region of interest 110 in the sample 170 is not shown in these drawings . fig6 shows lift - out of the isolated sample 170 from the substrate 100 after cutting of the stress - buffer layer 120 with an energetic beam 160 . note that the cutting of the stress - buffer layer 120 has left a remnant 125 of the stress - buffer layer 120 still attached to the substrate 100 , as would typically be the case . in fig6 , the probe 190 is shown attached to the stress - buffer layer 120 by cvd welding 210 , although other methods known in the art may be used . lift - out from the vicinity of the substrate 100 may be accomplished in conventional ways , such as by lowering the stage supporting the substrate 100 . fig7 a and 7b illustrate a different embodiment , where a wedge - shaped sample 175 is isolated from the substrate 100 with a first cut 220 and a second cut 230 . a stress - buffer layer 120 , shown in the shape of a bar here , and having a known minimum height , is laid down at least partially over the area of the sample 175 to be extracted , before the second cut 230 . the second cut 230 is the isolating cut , where the wedge - shaped sample 175 comprising the region of interest 110 is freed from the substrate 100 , but still attached to the stress - buffer layer 120 . the first cut 220 is made at substantially normal incidence to the plane of the substrate . the second cut 230 is made at an angle of less than 90 degrees , preferably about 45 - 60 degrees , to the plane of the substrate . the second cut 230 thus undercuts the sample 175 and isolates it from the substrate 100 , but is calculated so as to cut into , but not through , the stress - buffer layer 120 . techniques for the release of a wedge - shaped sample 175 by such cuts are disclosed in u . s . pat . no . 6 , 570 , 170 , titled “ total release method for sample extraction from a charged - particle instrument ,” which patent is incorporated by reference in its entirety into the present application . fig8 shows a particular method for conveniently calculating the dimensions of the second cut 230 , so that the sample 175 is freed from the substrate 100 , but the second cut 230 is not made completely through the stress - buffer layer 120 , thus leaving a connecting portion 260 that is severed when the sample 175 is lifted - out , as described previously . the ion - beam view 240 and the electron - beam view 250 in the energetic - beam instrument are shown . in fig8 , the projected width of the connecting portion 260 of the stress - relief buffer 120 after the second cut 230 is calculated from the following parameters : w = width of the stress - relief buffer 120 h = height of stress - relief buffer 120 w = width of connecting portion 260 of stress - relief buffer after second cut 230 θ = angle between e - beam axis and ion - beam axis minus stage - tilt angle q = projected width of w from the ion - beam view 240 , thus q = h sin ( θ ) fig9 is an exemplary illustration of attachment of the sample 170 to a holder 270 , such as a tem grid , for further thinning or analysis . the sample 170 ( including the just - described wedge sample 175 ) may have been extracted from the substrate 100 by any of the embodiments shown previously . in fig9 , the attachment to the holder 270 is shown by cvd welding 210 , although other methods known in the art could be used . only the stress - buffer layer 120 should be attached to the holder 220 before the probe 190 is cut free , so that stresses on the sample 170 are greatly reduced . none of the description in this application should be read as implying that any particular element , step , or function is an essential element which must be included in the claim scope ; the scope of patented subject matter is defined only by the allowed claims . moreover , none of these claims are intended to invoke paragraph six of 35 u . s . c . section 112 unless the exact words “ means for ” are used , followed by a gerund . the claims as filed are intended to be as comprehensive as possible , and no subject matter is intentionally relinquished , dedicated , or abandoned .	7
as will be appreciated by one skilled in the art , the present invention may be embodied as a method , system , or computer program product . accordingly , the present invention may take the form of an entirely hardware embodiment , an entirely software embodiment ( including firmware , resident software , micro - code , etc .) or an embodiment combining software and hardware aspects that may all generally be referred to herein as a “ circuit ,” “ module ” or “ system .” furthermore , the present invention may take the form of a computer program product on a computer - usable storage medium having computer - usable program code embodied in the medium . any suitable computer usable or computer readable medium may be utilized . the computer - usable or computer - readable medium may be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples ( a non - exhaustive list ) of the computer - readable medium would include the following : an electrical connection having one or more wires , a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), an optical fiber , a portable compact disc read - only memory ( cd - rom ), an optical storage device , a transmission media such as those supporting the internet or an intranet , or a magnetic storage device . note that the computer - usable or computer - readable medium could even be paper or another suitable medium upon which the program is printed , as the program can be electronically captured , via , for instance , optical scanning of the paper or other medium , then compiled , interpreted , or otherwise processed in a suitable manner , if necessary , and then stored in a computer memory . in the context of this document , a computer - usable or computer - readable medium may be any medium that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the computer - usable medium may include a propagated data signal with the computer - usable program code embodied therewith , either in baseband or as part of a carrier wave . the computer usable program code may be transmitted using any appropriate medium , including but not limited to the internet , wireline , optical fiber cable , rf , etc . computer program code for carrying out operations of the present invention may be written in an object oriented programming language such as java , smalltalk , c ++ or the like . however , the computer program code for carrying out operations of the present invention may also be written in conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the program code may execute entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). the present invention is described below with reference to flowchart illustrations and / or block diagrams of methods , apparatuses ( systems ) and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer program instructions . these computer program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which execute via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer program instructions may also be stored in a computer - readable memory that can direct a computer or other programmable data processing apparatus to function in a particular manner , such that the instructions stored in the computer - readable memory produce an article of manufacture including instruction means which implement the function / act specified in the flowchart and / or block diagram block or blocks . the computer program instructions may also be loaded onto a computer or other programmable data processing apparatus to cause a series of operational steps to be performed on the computer or other programmable apparatus to produce a computer implemented process such that the instructions which execute on the computer or other programmable apparatus provide steps for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . with reference now to fig1 , there is depicted a block diagram of an exemplary computer 100 , with which the present invention may be utilized . computer 100 is used by a software provider , which provides software , updates , service and / or support to a customer &# 39 ; s computer 152 . computer 100 includes a processor unit 104 that is coupled to a system bus 106 . a video adapter 108 , which drives / supports a display 110 , is also coupled to system bus 106 . system bus 106 is coupled via a bus bridge 112 to an input / output ( i / o ) bus 114 . an i / o interface 116 is coupled to i / o bus 114 . i / o interface 116 affords communication with various i / o devices , including a keyboard 118 , a mouse 120 , a compact disk - read only memory ( cd - rom ) drive 122 , and a flash memory drive 126 . the format of the ports connected to i / o interface 116 may be any known to those skilled in the art of computer architecture , including but not limited to universal serial bus ( usb ) ports . computer 100 is able to communicate with a server 150 and the customer &# 39 ; s computer 152 via a network 128 using a network interface 130 , which is coupled to system bus 106 . the customized instructions described below are provided to the customer &# 39 ; s computer 152 by computer 100 ( which may be operated by a software supplier / manager / updater service ). the administration console 154 monitors which devices and software have been selected for software installation / management . network 128 may be an external network such as the internet , or an internal network such as an ethernet or a virtual private network ( vpn ). server 150 , customer &# 39 ; s computer 152 and / or administration console 154 may be architecturally configured in the manner depicted for computer 100 . a hard drive interface 132 is also coupled to system bus 106 . hard drive interface 132 interfaces with a hard drive 134 . in one embodiment , hard drive 134 populates a system memory 136 , which is also coupled to system bus 106 . system memory 136 is defined as a lowest level of volatile memory in computer 100 . this volatile memory may include additional higher levels of volatile memory ( not shown ), including , but not limited to , cache memory , registers , and buffers . code that populates system memory 136 includes an operating system ( os ) 138 and application programs 144 . os 138 includes a shell 140 , for providing transparent user access to resources such as application programs 144 . generally , shell 140 ( as it is called in unix ®) is a program that provides an interpreter and an interface between the user and the operating system . shell 140 provides a system prompt , interprets commands entered by keyboard 118 , mouse 120 , or other user input media , and sends the interpreted command ( s ) to the appropriate lower levels of the operating system ( e . g ., kernel 142 ) for processing . as depicted , os 138 also includes kernel 142 , which includes lower levels of functionality for os 138 . kernel 142 provides essential services required by other parts of os 138 and application programs 144 . the services provided by kernel 142 include memory management , process and task management , disk management , and i / o device management . application programs 144 include a browser 146 . browser 146 includes program modules and instructions enabling a world wide web ( www ) client ( i . e ., computer 100 ) to send and receive network messages to the internet . computer 100 may utilize hypertext transfer protocol ( http ) messaging to enable communication with server 150 . application programs 144 in system memory 136 also include an instruction customization program ( icp ) 148 . icp 148 performs the functions described below in fig2 - 3 . the hardware elements depicted in computer 100 are not intended to be exhaustive , but rather represent and / or highlight certain components that may be utilized to practice the present invention . for instance , computer 100 may include alternate memory storage devices such as magnetic cassettes , digital versatile disks ( dvds ), bernoulli cartridges , and the like . these and other variations are intended to be within the spirit and scope of the present invention . with reference now to fig2 , a flow - chart of exemplary steps taken to customize instructions is presented . note that the “ instructions ” being customized are not computer - executable instructions , but rather are human language instructions utilized by a customer to install , maintain , update , or otherwise manage software or hardware that is provided to the customer &# 39 ; s computer 152 ( depicted in fig1 ). thus , the customer may see a customized instruction such as “ install program a in server a ”. this instruction is not computer executable , but rather provides the customer with guideline instructions for installing “ program a ” onto “ server a .” in a preferred embodiment , the customized instruction provides more direction than the simple instruction to “ install program a in server b ,” but rather provides a detailed step - by - step set of instructions for performing this installation task . in one embodiment , instead of providing the customer with only written instructions for the customer , these instructions may include links to webpages , hot - links to macros , or any other automatic or semi - automatic aid to the installation task . still referring to fig2 , after initiator block 202 , which may be initiated by a customer deciding to install or otherwise manage software or hardware in the customer &# 39 ; s computer system , a software service ( using a computer such as computer 100 shown above in fig1 ) collects computer system information ( block 204 ) about the customer &# 39 ; s computer system ( e . g ., customer &# 39 ; s computer 152 shown in fig1 ). this data may include the types of software and hardware used in the customer &# 39 ; s computer system , the names given ( either initially by a vendor or later by the customer ) to each piece of software and / or hardware , and a description of each sub - system in the customer &# 39 ; s computer system . for example , as shown in fig3 , a customer &# 39 ; s computer system 302 ( analogous to customer &# 39 ; s computer 152 shown in fig1 ) is made up of multiple computer sub - systems , shown in an exemplary manner as sub - system 306 and sub - system 308 . within each sub - system are multiple devices ( e . g ., devices 310 a - c and devices 312 a - c for respective sub - systems 306 and 308 ). examples of such devices are servers , personal computers , storage devices , memories , processors , busses , networks , etc . each device may or may not be operating system ( os ) specific / dependent . each device may or may not be authorized to run a particular software application . returning to fig2 , after the software service has collected information about the customer &# 39 ; s computer system , the software service provides the customer with a choice of options , including the exemplary choice of which software the customer would like to install ( block 206 ). this selection may be provided in a graphical user interface ( gui ), which allows the customer to view options that are available to him for software ( and / or hardware ) management . the software service receives the customer &# 39 ; s selection ( block 208 ). thus , returning to fig3 , assume for exemplary purposes that sub - system 306 is for the customer &# 39 ; s accounting department , while sub - system 308 is for the customer &# 39 ; s payroll department . ( these examples are illustrative only . the sub - systems may be for different clients of the customer , different operating systems , or any other business or architecture division created by the customer .) the customer may know that he wants “ program a ” installed in his payroll department ( sub - system 308 ). using the present invention , the customer does not need to know which device ( e . g ., which server ) actually should install “ program a .” because of the system information collected earlier , the software service knows that this program , if selected , is to be installed on device 312 a . if the user has selected a program that is not os - compatible or otherwise not available for that customer and / or that sub - system ( e . g ., is not authorized for financial , security or other reasons ), the software service can either send the customer an error message , or can automatically or semi - automatically ( with a prompt to the customer ) provide an alternate program that is authorized and compatible with the sub - system in which the customer wants to install the program . alternatively , the software service can automatically or semi - automatically install the selected program on another sub - system that the software service has deemed appropriate based on the earlier collected system information . returning now to fig2 , the software service provides the customer with options for which sub - system is to receive the new software ( block 210 ). the customer sends the software service his selection ( block 212 ). note that in an alternative embodiment , the administration console 154 shown in fig1 can create a rule that identifies devices within different sub - systems of the customer &# 39 ; s computer as being functionally related . that is , one server may be for creating paychecks while another server is for tracking vacation time while another server is for tracking income tax , but all are functionally related as being for “ payroll .” thus , the collected computer system information ( collected in block 204 ) is utilized with this rule to identify these three servers as being functionally related , and thus the software selected by the user should be installed on all three servers , preferably in an automatic manner . that is , even if the user only selected one of the servers , the administration console or service provider will automatically install it on other servers . the same concept applies if the three servers discussed for payroll have the same functionality and software , but are simply backup / redundant systems . the customer - selected software will still be automatically installed on any backup / redundant server . at run time , the customer receives customized instructions for installing “ program a ” on sub - system 308 . as shown by instructions 314 in fig3 , the customer is provided a reference link ( which may be a “ hot link ”) for installing the user - selected “ program a ” on the appropriate device ( device 312 a ) in sub - system 308 . note that the only instructions in the gui 304 are those that are specific for the user - selected program and the user - selected sub - system . as noted above , the user does not need to decide which device is to receive the program , since this has been automatically performed by the software service . furthermore , the customer sees only germane instructions ( those related to installing the selected program ), thus avoiding confusion and wasted time / resources that irrelevant instructions would cause . note that while the present invention has been described as providing customized software installation instructions , the same process ( including collecting computer system information ) can be utilized to create customized ( and narrowly tailored ) instructions for software maintenance , hardware installation , etc . for example , by knowing what type of hardware architecture is being used in a customer &# 39 ; s computer system , instructions for installing new hardware can be tailored for the exact system , thus avoiding problems that would result if the installation did not follow specific installation guidelines for that new hardware in that particular existing architecture . the present invention thus presents a mashup between product documentation and the software configuration data which results in a clear set of instructions based on the details of the systems being manipulated and the task that is being performed . elements of the mashup include removal of information that is not relevant to the configuration , populating the documentation with values ( for example , host names ) retrieved from the configuration , and pre - filling forms and worksheets with actual configuration values so that they will be directly usable on the systems . thus , as described herein , the present invention provides for both variable replacement as well as instruction filtering based on components discovered during a survey of a computer system . that is , after surveying the computer system , the administration ( e . g ., installation , maintenance , etc .) instructions are worded to be germane to only the relevant components discovered during the survey of the system . furthermore , the administration instructions are filtered such that only instructions that are germane to the system are presented to the user . note that the flowchart and block diagrams in the figures illustrate the architecture , functionality , and operation of possible implementations of systems , methods and computer program products according to various embodiments of the present invention . in this regard , each block in the flowchart or block diagrams may represent a module , segment , or portion of code , which comprises one or more executable instructions for implementing the specified logical function ( s ). it should also be noted that , in some alternative implementations , the functions noted in the block may occur out of the order noted in the figures . for example , two blocks shown in succession may , in fact , be executed substantially concurrently , or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . it will also be noted that each block of the block diagrams and / or flowchart illustration , and combinations of blocks in the block diagrams and / or flowchart illustration , can be implemented by special purpose hardware - based systems that perform the specified functions or acts , or combinations of special purpose hardware and computer instructions . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . the corresponding structures , materials , acts , and equivalents of all means or step plus function elements in the claims below are intended to include any structure , material , or act for performing the function in combination with other claimed elements as specifically claimed . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . the embodiment was chosen and described in order to best explain the principles of the invention and the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated . having thus described the invention of the present application in detail and by reference to preferred embodiments thereof , it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims .	6
the motor 10 shown in fig1 to 3 is an electric motor having a body 10a and an output shaft 12 extending from one end of the body . an annular skirt 14 is provided on body 10a , this extending in coaxial relationship around shaft 12 and being positioned at one end of the body 10a . skirt 14 is externally threaded and receives thereon an internally threaded cup shaped end member 16 , the latter being tightly threaded onto the skirt 14 to be substantially irrotational relative thereto in use . also coaxial with shaft 12 is an inner annular skirt 17 which is interposed between shaft 12 and skirt 14 so as to present an annular space 18 between skirts 14 and 17 and an annular space 20 between shaft 12 and skirt 17 . skirt 17 is formed integrally with body 10a . a one - way bearing unit 22 is carried by shaft 12 . bearing unit 22 has an inner part 22a which is irrotationally received on shaft 12 and an outer part 22b which is mounted to part 22a in a fashion such that it can rotate only in one direction relative to part 22a . as shown in fig4 unit 22 may be of conventional form employing rollers 23 received in cavities 25 in an inner bore of the part 22b , which cavities are closed by the outer periphery of part 22a . the cavities 25 are shaped in a tapered fashion so as to trap the rollers during rotation of the outer part 22b in a first direction (&# 34 ; a &# 34 ; in fig4 ) relative to part 22a , by virtue of a wedging action then occurring between the rollers and opposed surfaces of the cavities and part 22a whereby to lock the two parts together , but such as to permit the rollers to freely move in the cavities under rotation in the opposite direction (&# 34 ; b &# 34 ; in fig4 ) whereby driving interconnection between the parts 22a , 22b does not prevail . in order to prevent part 22b from moving off the end of the shaft , it is locked in position by use of a circlip 24 received in a groove 26 on the shaft 12 , a washer 29 being interposed between the circlip and one end face of part 22b . part 22b has an axial end portion 27 thereof furthest away from motor body 10a formed of a non - circular configuration , being square as shown . a circular clutch plate 28 has a central opening 30 which is of square cross - section complementary to the form of end portion 27 of part 22b and fits on end portion 27 so that the clutch plate is irrotational on end portion 27 , but still capable of axial movement relative to part 22b . clutch plate 28 is positioned with its outermost transverse surface 28a directly opposed to the inner face 32 of a transverse end wall 16a of end member 16 . this wall 16a , and the plate 28 , together form part of a clutch in the sense that , by axial movement of the plate 28 away from body 10a the surface 28a can be brought into engagement with face 32 in such a fashion as to lock the plate 28 to the wall 16a by frictional coupling between face 32 and surface 28a . this clutch is designated generally by reference numeral 35 in fig2 and 3 . an annular steel or iron plate 34 is coaxially mounted relative to the axis of shaft 12 and is interposed between body 10a and plate 28 . the outer diameter of plate 34 is somewhat greater than the outer diameter of skirt 17 , whilst the inner diameter of plate 34 is such as to provide clearance with respect to the outer surface of part 22b which is immediately therewithin . an annular electromagnet coil 38 is positioned within the space 18 between skirts 17 and 14 and is affixed therein . a helical compression spring 40 is positioned within the space 20 and acts against plate 34 and an end surface 10b of body 10a to resiliently bias the plate 34 against plate 28 and thence to resiliently bias the plate 28 into engagement with wall 16a of end member 16 to effect engagement of clutch 35 . the plate 34 is , however , movable axially away from wall 16a and against bias of spring 40 under influence of energization of the coil 38 to thereby release pressure on the plate 28 and to disengage clutch 35 by releasing the clutching coupling between the surface 32 and plate 28 . in order to minimize wear on plate 34 , it is confined against rotation by two spigots 44 which extend from skirt 17 and which are slidably received in complementary apertures 46 in plate 34 . spigots 44 also assist in maintaining axial alignment of the plate 34 . by making body 10a of steel or iron the electromagnetic attraction of the plate 34 under energization of the coil 38 is enhanced . the electric motor 10 is useful , as mentioned above , in sliding door assembly where the motor 10 normally drives the door for opening and closing by operation of the shaft 26 in opposite directions . such an assembly 200 is shown in fig8 . assembly 200 includes a door 202 supported for sliding movement adjacent to wall 204 , between the open position shown , at which access is possible through a doorway 206 in a wall 204 , to a closed position ( not shown ) at which doorway 206 is closed . door 202 is supported from a wheeled carriage 208 which runs on a track 210 above the doorway 206 . the motor 10 previously described is arranged with its output shaft 12 connected to a sprocket 214 . a chain 218 is connected to carriage 208 and runs in a loop around sprocket 214 and a further freely rotatable sprocket 216 . sprockets 214 , 216 are at opposed ends of track 210 and , by operating motor 10 , it is possible to drive chain 218 so that the carriage 208 is moved back and forth along track 210 for opening and closing of door 202 . the arrangement is such that closing movements of the door 202 require turning of shaft 12 in the direction &# 34 ; a &# 34 ; in fig4 and 8 whilst opening movenemts require movement of the shaft 12 in the direction &# 34 ; b &# 34 ; in fig4 and 8 . the assembly 200 is fitted with a stored energy &# 34 ; failsafe &# 34 ; device generally designated by reference numeral 220 . this device may be of the form particularly described in the specification of australian pat . no . 467 , 591 and is shown only diagrammatically in fig8 as having a steel runner member 222 mounted for free sliding movement along a lengthwise extending slide 224 running parallel to track 210 . device 200 further includes a helical tension spring 226 fixed at one end to the end of slide 224 remote from motor 10 and fixed at the other end to runner member 222 . the carriage 208 carries an engagement member 228 which is positioned to so engage the runner member 222 during a first closing movement of the door occurring after application of electric supply to the door assembly 200 to carry the runner member with the carriage so that it is moved to be engaged and held by an electromagnet 230 disposed adjacent the motor 10 . this movement of the runner member 222 causes tensioning of the spring 226 , the spring thence being retained in its tensioned condition by virtue of the holding of the runner member 222 . thereafter , normal operation of the assembly 200 can occur with the motor 10 simply driving the door 202 back and forth without engagement between the members 228 and 222 . under an emergency condition , as next described , the electromagnet 230 is de - energized and the member 222 released whereby , under action of the spring 226 the runner member is moved to the end of the slide 224 remote from motor 10 thereby engaging the member 228 and moving the carriage 208 on track 210 to open the door 202 if the door were not already so positioned . in fig9 a control circuit 240 for controlling motor 10 is shown diagrammatically as being supplied by electric current from a rectifier 242 supplied from an alternating current supply 244 , when a main control switch 246 is closed . circuit 240 is of conventional form being , for example , operable to move the door 202 between open and closed positions in response to control signals generated therein . for example , as is well known , the door assembly may be provided with a sensor for detecting approach of a person to the door 202 to condition the control circuit 240 so that the motor 10 is operated first to open the door and thence to close the door after passage of a person through the door . the electric winding 230a of the electromagnet 230 is so connected to control circuit 240 that it receives electric supply from rectifier 242 whenever switch 246 is closed and supply to 244 is operating . that is to say whenever the door is conditioned so that the motor 10 is capable of being operated from the control circuit 240 , then the winding 230a is energized . on interruption of supply to the control circuit 240 such as by opening of switch 246 , or more particularly under an emergency condition where supply 244 is interrupted , the winding 230a is de - energized whereby to effect the aforementioned release of the member 222 and thus to effect operation of the failsafe device 220 . on restoration of power , the winding 230a is again energized whereby , on a first occurring closing movement of the door after the emergency condition has been rectified , loading of the failsafe device will occur as described . the coil 38 of motor 10 is also arranged to be operated and energized whenever the supply 244 is effective to apply electric potential via rectifier 242 to circuit 240 . as shown , for example , coil 38 may be connected for energization via a diode 246 from the same points 243 , 245 of current supply from circuit 240 as winding 230a . however , a capacitor 248 is connected across coil 238 so that in the event of interruption of supply to the aforementioned supply points for the coil 38 and winding 230a , the coil 38 remains energized for a short period after such interruption , being supplied by stored energy from the capacitor 248 . however , the winding 230a is more or less immediately de - energized following such interruption , the diode 246 serving to prevent backfeed of current from the capacitor 248 to the winding 230a . it will be appreciated that , when the coil 38 is energized , the shaft 12 of motor 10 can as previously described , rotate freely either in the direction &# 34 ; a &# 34 ; or the direction &# 34 ; b &# 34 ; shown in fig8 . however , on de - energization of coil 38 , shaft 12 can rotate only in the direction &# 34 ; b &# 34 ; shown in fig8 that is to say only in a direction corresponding to the direction for closing movement of the door 202 . thus , if coil 38 were de - energized immediately on supply interruption , it is likely that the clutch 35 of the motor 10 would operate to lock up the shaft 12 against rotation in the direction &# 34 ; b &# 34 ; before the failsafe device 220 had been effective to open the door 202 . in such a case , the door 202 may not complete an opening movement . however , the capacitor 248 is made of sufficient size so that the coil 38 remains energized for a sufficient period to enable the failsafe device 220 to move the door 202 to its fully open position . in practice , it is usually sufficient to size capacitor 248 such as to give about four seconds continued energization after supply interruption . after such operation of the failsafe device and movement of the door 202 to its open position , the capacitor 248 is discharged to a sufficiently low level so that the clutch 35 of the motor 10 operates to prevent further rotation of the shaft 12 in the direction &# 34 ; b &# 34 ; of fig8 . then , although the door 202 can subsequently be closed , such as by manually moving the door 202 so that the chain 208 is moved around its loop and the sprocket 214 is turned to turn shaft 12 in direction &# 34 ; a &# 34 ;, re - opening of the door 202 cannot occur until reinstatement of electric supply and subsequent re - energization of the coil 38 . that is to say , any such opening movement would require movement of chain 218 in the direction tending to cause shaft 12 to turn in the direction &# 34 ; b &# 34 ;, which as described is then precluded . the above arrangement has the particular advantage in that it ensures that , while the failsafe device 220 can always safely operate on interruption of electric supply to open the door 202 , whereby to prevent persons who might otherwise come , for example , to be trapped , to pass through the doorway 206 , it is still possible , after all persons affected have been safely cleared through the doorway 206 for a person such as a supervisor in charge of the door to subsequently close the door 202 to prevent further access through the doorway . this is particularly important in , for example , cases where the doorway 206 is an exterior doorway to a public building where , whilst it is important to permit persons to be able to surely leave the building in the event of an emergency involving power failure , it may be undesirable to thereafter leave the door open for possible unauthorized access by persons later , and before reinstatement of supply permits the door to return to normal functioning . fig1 shows a modification where in addition to the capacitor 248 , a second capacitor 250 is provided . here , the diode 246 is connected between the supply point 243 and one end of the coil 38 , as previously described . however , the capacitor 248 instead of being directly connected across the coil 38 is connected thereacross via two series connected switches 252 , 254 . when the switches 252 are in the switch positions &# 34 ; a &# 34 ; shown , the capacitor 248 can charge via diode 246 for operation of the capacitor 248 exactly in the manner previously described . that is to say under interruption of supply , the coil 38 will be energized from the capacitor 248 for a period of time for the purpose mentioned . capacitor 250 is connected in series with a diode 256 and the series circuit comprising the diode and capacitor are connected together across coil 38 . the arrangement is such that under normal conditions , capacitor 250 charges via diode 246 and diode 256 . under the condition described where switches 252 , 254 are at the positions &# 34 ; a &# 34 ;, the capacitor 250 , although charged , plays no part in the operation of the electric circuit , being isolated from discharge by the diode 256 . switch 252 does , however , have a position &# 34 ; b &# 34 ; at which the diode 256 is short circuited and at the same time the capacitor 248 is isolated from coupling across the coil 38 . under this condition the capacitor 250 can discharge through the coil 38 . thus , in the event of power interruption with switches 252 , 254 at the &# 34 ; a &# 34 ; position and where the failsafe device has operated as described , accompanied by discharge of the capacitor 248 , and where thereafter , the door 202 is moved to the closed position , it would still be possible , by movement of the switch 252 to its &# 34 ; b &# 34 ; position , to energize the coil 38 from the capacitor 250 to release clutch 35 for a time period sufficient to enable a person to thereafter again open the door 202 such as manually . switch 254 has two further positions &# 34 ; b &# 34 ; and &# 34 ; c &# 34 ;. at position &# 34 ; b &# 34 ;, capacitor 248 is isolated from discharge independent of whether switch 252 is in position &# 34 ; a &# 34 ; or position &# 34 ; b &# 34 ;. when the switch 254 is in the position &# 34 ; b &# 34 ;, operation of the failsafe mechanism under emergency condition is inhibited . at the position &# 34 ; c &# 34 ; of switch 254 , capacitor 248 is again isolated and a discharge path for capacitor 250 to coil 38 is established via switch 254 and via switch 252 , when the switch 252 is at the position &# 34 ; a &# 34 ;. the arrangement of fig1 is envisaged as being applicable , for example , where the door assembly 200 is used to control access through an exterior door to a building . the switch 252 could , in that case , be provided on the interior of the building , such as adjacent doorway 206 and be of a kind readily hand operable by persons inside the building . the switch 254 would be positioned either outside the building or in a location accessible only to authorized persons . more particularly , the switch 254 would normally be a key actuated switch which could only be manipulated by a person having a key . it should be noted that even though a caretaker or otherwise authorized person having a key for switch 254 is capable of conditioning the switch 254 to conditions at which the door assembly 200 in its operation are effected in different ways . it is always possible , on power interruption occurring , for a person at the inside of the door to effect a manual opening of the door provided one of the capacitors 248 , 250 is charged . thus , even if switch 254 is conditioned by the authorized person so that the failsafe device 220 does not operate , that is to say if switch 254 is at the position &# 34 ; b &# 34 ;, a person inside the building can nevertheless condition the door to permit it to be manually opened by moving the switch 252 to the position &# 34 ; b &# 34 ; to supply coil 38 via capacitor 250 . of course , if the switch 252 were already at position &# 34 ; b &# 34 ; prior to an interruption of supply , the failsafe mechanism would forthwith operate to effect door opening on power interruption , coil 38 being held energized from capacitor 250 for a period after interruption . on the other hand , a caretaker of the building can use the switch 254 firstly to condition the door to inhibit operation of the failsafe mechanism as described , i . e . positioning it at position &# 34 ; b &# 34 ;, or can use the switch to effect subsequent openings of the door even after operation of the failsafe mechanism and any subsequent closing of the door which might occur in the meantime . thus , assuming the switch 252 to be in position &# 34 ; a &# 34 ;, the failsafe device to have operated , and the door to have been subsequently closed manually , turning the switch 254 to position &# 34 ; c &# 34 ; will energize the coil 38 from the capacitor 250 period sufficient to enable a manual opening of the door to be effected . the number of times for which the door may be so opened after operation of the failsafe mechanism accompanied by discharge of capacitor 248 is of course determined by the size of capacitor 250 , but generally speaking it is possible to make the capacitor large enough to effect at least two or three such operations if the switch 254 is moved back to the position &# 34 ; b &# 34 ; immediately after each such opening . the motor of fig1 to 4 is one in which power interruption to the coil 38 causes lock up of the motor shaft to prevent rotation in one direction . of course , it would be possible to arrange the motor so that energization of the coil 38 brough about lock up . this could be effected by , for example , positioning the spring 40 to normally bias the plate 28 away from the wall 16a and to position the coil 38 so that operation thereof attracts the plate 34 in a direction towards the wall 16a . the motor 110 shown in fig5 to 7 is an electric motor having a body 110a and an output shaft 112 extending from one end of the body . an annular skirt 114 is provided on body 110a , this extending in coaxial relationship around shaft 112 and being positioned at one end of the body 110a . skirt 114 is externally threaded and receives thereon an internally threaded cup shaped end member 116 the latter being tightly threaded on to the skirt 114 to be substantially irrotational relative thereto in use . also coaxial with shaft 112 is an inner annular skirt 117 which is interposed between shaft 112 and skirt 114 so as to present an annular space 118 between skirts 114 and 117 and an annular space 120 between shaft 112 and skirt 117 . skirt 117 is formed integrally with body 110a . an annular electromagnet coil 138 is positioned within space 118 between skirts 117 and 114 and is affixed therein . end member 116 defines therewithin a space 127 ( fig6 and 7 ) within which are housed components of a clutch mechanism 135 . mechanism 135 includes an annular member 125 having an axial boss 125a and an outstanding peripheral flange 125b . member 125 is affixed to shaft 112 for rotation therewith , the shaft extending through a central opening in the member and the member being locked in position by a roll pin 131 extending through aligned diametral openings in boss 125a and shaft 112 . flange 125b presents a generally planar end surface 121 which extends transversely of the axis of shaft 112 and which faces the end of body 110a . between the end of the body 110a and surface 121 there is interposed an annular disc 134 which is slidably mounted on shaft 112 so as to be movable thereon between the two positions shown in fig6 and 7 . disc 134 is mounted for rotation together with shaft 112 , being provided with two diametrally opposed spigots 137 , which spigots extend from the disc in directions parallel to the axis of shaft 112 and through aligned openings 161 in flange 125b of member 125 . spigots 137 are threaded and the ends thereof which extend through the flange 125b to the side of the flange opposite disc 134 have locknuts 139 threadedly engaged thereon . interposed between the locknuts 139 and the flange 125b there are provided , on each spigot 137 , a plane washer 141 adjacent the respective nut 139 and two wave washers 140 between the respective washer 141 and flange 125b . normally , the wave washers 140 , bearing on the one hand against the flange 125b and on the other hand against the washers 141 , bias the spigots 137 and the disc 134 to an extreme right hand position shown in fig6 at which disc 134 abuts flange 125b . in this condition , there is a small gap designated &# 34 ; d &# 34 ; in fig6 between the face 163 of disc 134 closest to the end of motor body 110a and the motor body end . thus , during operation of the motor to turn shaft 112 , the clutch mechanism 135 normally has no effect , the disc 134 and member 125 simply turning with the shaft 112 . however , by energizing coil 138 , the disc 134 , which is made of magnetically attractable material such as soft iron , is attracted to the left as viewed in fig6 and 7 to assume the position shown in fig7 at which the face 163 abuts against the end of the motor body 110a . in this condition there is a frictional engagement between the motor body 110a and the disc 134 which acts to tightly lock the shaft 112 against rotation . the locking actuation of the disc 134 described above is accompanied by compression of the wave washers 140 between the washers 141 and the flange 125b so that on de - energization of coil 138 the wave washers apply a resilient bias against the washers 141 to revert the disc 134 to the position shown in fig6 thus releasing the locking of the shaft 112 .	4
a system is provided that matches senders of items with independent couriers . the system creates a forum for senders and couriers to meet , thereby establishing an alternative means to delivery packages worldwide . the system also facilitates the selection of available couriers by displaying a peer - generated reliability rating for each user , and also assists the payment of couriers by senders . in one aspect , users can use the site to find a courier to deliver a package to its destination . for example , referring to fig1 , a flowchart for the matching process , a sender of a package (“ sender ”) sees a tcc advertisement ( see fig1 ) and visits the website ( see fig1 ). sender registers 101 as a user of the website by recording sender &# 39 ; s personal contact details 104 . sender &# 39 ; s personalized “ mytcc ” screen is then displayed 105 ( see also fig1 ). next , sender clicks a service that he requires . referring to fig1 , the services available may include : find a courier 1111 , take a package 1112 , container sharing 1113 , airsitter 1114 , or mail - order 1115 . for example , sender chooses a new shipment delivery by casual courier 1111 . referring back to fig1 , after sender registers a new shipment 107 , the system automatically searches the databases 108 for a user that meets the sender &# 39 ; s criteria to carry out the request . when a courier is found 109 the sender can view general characteristics about the courier 111 , including , courier identification number , peer - generated reliability rating score , point of departure / arrival , date of departure / arrival ( see also fig1 ). the sender reviews the matching couriers 113 and selects the most appropriate couriers to take his package . the sender selects the most appropriate courier based on proximity to the sender , and courier rating score ( see fig1 ). the sender invites his selected courier ( s ) to deliver the package for an independently determined fee offered by the sender 113 . the system automatically sends an email message 114 to the selected courier ( s ) requesting confirmation of couriers &# 39 ; desire to deliver a package for sender . when the courier ( s ) receive the email invitation to deliver a package 115 the courier ( s ) may immediately accept the invitation 117 thereby notifying the sender via email of the couriers &# 39 ; acceptance 121 . the courier ( s ) may also renegotiate the payment for his services 116 by clicking the “ suggest different fee ” option located on his email invitation . at that point , the system sends email to the sender with the new suggested fee 118 . the sender may then accept or reject the couriers &# 39 ; renegotiated fee . when a courier ultimately accepts the sender &# 39 ; s invitation 121 , the courier &# 39 ; s status on the sender &# 39 ; s mytcc screen is updated 121 from “ invited ” to “ accepted ”. “ accepted ” status 117 indicates that the specific courier has accepted the sender &# 39 ; s invitation , confirmed his travel itinerary and agrees to fee determined by the sender . “ declined ” status 120 indicates that the specific courier has not accepted the sender &# 39 ; s invitation , usually because the courier has already accepted another sender &# 39 ; s invitation , or changed his travel itinerary . when one or more courier accepts the sender &# 39 ; s invitation , the courier may purchase the contact information of any accepted courier 123 . a billing screen appears 125 informing the sender that a matchmaking fee will be charged for providing the contact information . the sender is charged a “ matchmaking fee ” for revealing the courier &# 39 ; s contact information 125 to the sender . the site &# 39 ; s billing screen also provides the sender with the option to hold the courier &# 39 ; s fee in a secure escrow account until the package is safely delivered to its recipient . referring to fig1 , a flowchart of the escrow payment process , upon requesting tcc &# 39 ; s escrow service 1307 , the system charges the sender &# 39 ; s credit card for the full courier fee agreed upon 1309 , and sends a confirmation email to the courier 1311 noting that the fee was paid by the sender and being held in escrow . a confirmation email is also sent to the sender 1310 which summarizes the transaction and records the total courier fee that is being held in escrow . the confirmation email to the sender also contains a unique payment code 1315 . upon successful delivery of the package 1314 , the sender forwards the payment code to the courier 1315 . ( in the event that the package is not delivered , the sender may request a refund from the website 1305 ). the courier then logs on to the website 1316 and enters the pass code when prompted . the system then transfers the funds , minus a commission , to the courier &# 39 ; s private money account 1317 ( e . g ., bank account , credit card , paypal , etc .). users may choose to negotiate the payment terms of the transaction without employing the escrow feature . in this scenario , the sender simply deselects the escrow feature from the billing screen 1307 and purchases the contact information of the courier 1308 . the system then sends an automated email message to the courier 1311 notifying the courier that a sender purchased his contact information and will contact him shortly 1311 . referring back to fig1 , after verifying sender &# 39 ; s payment transaction information 125 ( e . g ., credit card information ), the contact information of the selected courier is revealed to the sender 127 . contact information may include : email address , phone number , geographic location and postal address 127 . the sender then independently contacts the courier 129 and arranges a meeting to transfer possession of the package 129 . prior to the meeting between the sender and the courier 129 , the parties review tcc &# 39 ; s suggested safety policies , available on the website , and arrange the meeting to take place in a well - lit , public location . the sender downloads and completes the “ courier service agreement ” (“ csa ”) ( see fig1 ), attesting to the true contents of the package that he is sending , and affirming that there are no dangerous or illegal items contained therein . both parties photocopy their picture identification documents ( e . g ., passport , drivers license ). during the meeting 129 between the courier and the sender , the courier examines the package to thoroughly in the presence of the sender , making sure that the contents match the sender &# 39 ; s declaration listed on the csa . the parties then exchange photocopies of their identification documents , and review the terms of the transaction 131 . the courier takes possession of the sender &# 39 ; s package , and delivers it 132 to its destination . in one aspect , where the sender deposited the courier &# 39 ; s fee in escrow with tcc 130 , the courier will inform the sender of successful delivery of the package . after verifying successful delivery , the sender forwards the courier an electronic pass code to retrieve payment for his services 133 . referring to fig1 , the courier requests payment by entering the pass code on his mytcc 1316 screen . the system then updates the database 1318 and transfers funds , either manually or automatically , to the monetary account specified by the courier ( e . g ., credit card , bank account or paypal ). finally , referring to fig9 , overall website structure , the site sends an electronic survey to the courier 932 and sender 933 requesting the parties to rate one another for reliability and proficiency of service . the information is stored on the site &# 39 ; s databases and accessible by future site users 925 . in another aspect , referring to fig7 , world map , users can more quickly and more effortlessly review the number of available couriers 702 and senders 704 around the world by selecting a general destination on the world map 703 , or choosing a country name from a drop - down menu . various statistics about available delivery options will appear per destination ( see also fig7 a ). in a further aspect , for example , referring to fig3 , timeline of the matching process , users are rated by other users 17 for reliability and performance . after all delivery transactions , users are sent an email survey form 16 and asked to rate the courier or sender 17 . referring back to fig1 , flowchart of the matching process , this peer - generated reliability rating score is used by future users 121 to help determine which courier or sender is the most appropriate match for their needs . this data often influences which matching user will be invited to participate in a delivery 123 . in another aspect , referring to fig1 , the user may employ the system to receive a mail - order product 1115 from a company that does not ship to the users &# 39 ; locale or will only ship for very expensive delivery fees . for example , a sender registers on the website 1110 and selects the mail - order service 1115 , indicating that he wishes to purchase a mail - order product delivered by casual courier . after completing the online registration form 1121 , the system will identify available couriers 1126 . the user selects a courier from his mytcc screen 1130 , and invites the courier to receive a mail - order package on his behalf . after the courier accepts the invitation , the user may purchase the contact information of the accepted courier . then , when purchasing a product online or from a mail - order catalogue , the user provides the courier &# 39 ; s mailing address to the company shipping the mail - order product . upon receipt of the mail - order product , the courier delivers the product to the recipient , as set forth above . in another aspect , the user may employ the system to receive share a shipping container 1113 when sending large cargo items via boat , truck or train . for example , a sender registers on the website 1110 and selects the container sharing service 1113 , indicating that he wishes to rent space in another user &# 39 ; s container . ( users may also offer space to rent out in his container ). after completing the online registration form 1121 , the system will identify available users 1126 who are offering space for rent in their containers . the user then selects an available container from his mytcc screen 1130 , and offers the owner of the container a fee for renting the space . after the container owner accepts the invitation , the user may purchase the contact information of the container owner . then , the user may contact the container owner , and independently arrange delivery , as set forth above . in another aspect , the user may employ the system to find an airsitter 1114 to provide care for travelers who are young , old , or have special needs . for example , a mother traveling alone with young children registers on the website 1110 and selects the airsitter service 1114 , indicating that she wishes to find an airsitter help watch over her children during her airline flight . ( users may also offer there services to care for travelers ). after completing the online registration form 1121 , the system will identify available airsitters 1126 who are offering the service to care for travelers . an airsitter will usually be matched with a user if their existing travel itineraries are similar . the mother then selects an available airsitter from her mytcc screen 1130 , and offers the airsitter a fee for the service . the airsitter &# 39 ; s fee can be arranged privately by the parties , or kept in escrow by tcc , as set forth above . the system shown in fig1 - 17 , and described in - depth herein , has a number of significant benefits and advantages . for example , referring to fig5 , quick - search match , users can enter the site 500 via the quick - search feature and find matching users more quickly and efficiently than the traditional matching means . by indicating a few details ( namely , the service required , point of departure , point of destination , and date required ), users can quickly and easily locate a brief , general listing of the couriers and senders that are currently available within a particular delivery route 502 . an additional advantage of the system is to allow users the ability to send packages domestically and internationally for lower costs , with faster delivery times , and with a high degree of reliability . in other words , by negotiating delivery with independent couriers , who are already enroute to a desired destination , users can drastically reduce the cost of delivery , while simultaneously improving speed and dependability . a further benefit of the system is to allow hand - delivery of fragile , precious , important , time - sensitive , and valuable items to be delivered in a much more cost effective manner than traditional courier hand - delivery . by privately contracting independent travelers will to be casual couriers , the cost for hand delivery is drastically reduced . a further benefit of the system is to allow users in locations where mail - order deliveries will not send to users , or will only send to users for prohibitively high delivery fees , the ability to receive mail - order and catalogue products via casual courier ( i . e ., hand - delivery ). this will expand the market of online and catalogue mail - order sales worldwide . a further benefit of the system is to allow users to find airsitters and thereby allow travelers with children , children traveling alone , travelers with special needs , and elderly passengers to receive in - flight or in - transit care and assistance while traveling . a computer system for implementing the system of fig1 typically includes at least one main unit connected to both an output device which displays information to a user and an input device which receives input from a user . the main unity may include a processor connected to a memory system via an interconnection mechanism . the input device and output device are also connected to the processor and memory system via the interconnection mechanism . it should be understood that one or more output devices may be connected to the computer system . example output devices include cathode ray tubes ( crt ) display , liquid crystal displays ( lcd ) and other video output devices , printers , communications devices such as modem , storage devices such as a disk or tape and audio output . it should also be understood that one or more input devices may be connected to the computer system . example input devices include a keyboard , keypad , mouse , pen and tablet , communication device , and date input device such as audio and video capture devices . it should also be understood that the invention is not limited to the particular input or output devices used in combination with the computer system or to those described herein . the computer system may be a general purpose computer system which is programmable using a computer programming language such as c ++, java , or other language , such as a scripting language or assembly language . the computer system may also include specially programmed , special purpose hardware . in a general purpose computer system , the processor is typically a commercially available processor , of which the series x86 , celeron , and pentium processors , available from intel , and similar devices from amd and cyrix , the 680x0 series microprocessors available from motorola , the powerpc microprocessors available from ibm and the alpha - series processors fro digital equipment corporation , are examples . many other processors are available . such a microprocessor executes a program called an operating system , of which windows nt , windows xp , linux , unix , dos , vms , os8 are examples , which controls the execution of other computer programs and provides scheduling , debugging , input / output control , accounting , compilation , storage assignment , data management , and communication control and related services . the processor and operating system define a computer platform for which application programs in high - level programming languages are written . a memory system typically includes a computer readable and writeable nonvolatile recording medium , of which magnetic disk , a flash memory and tape are examples . the disk may be removable , know as a floppy disk , or permanent , known hard drive . a disk has a number of tracks in which signal are stored , typically in binary form , i . e ., a form interpreted as a sequence of one and zeros . such signals may define an application program to be executed by the processor , or information stored on the disk to be processed by the application program . typically , in operation , the processor causes data to be read from the nonvolatile recording medium into an integrated circuit memory element , which is typically a volatile , random access memory element , such as a dynamic random access memory ( dram ) or static memory ( sram ). the integrated circuit memory element allows for faster access to the information by the processor than does the disk . the processor generally manipulates the data within the integrated circuit memory and then copies the data to the disk when processing is completed . a variety of mechanisms are known for managing data movement between the disk and the integrated circuit memory element , and the invention is not limited thereto . it should also be understood that the invention is not limited to a particular memory system . the invention is not limited to a particular computer platform , particular processor , or particular high - level programming language . additionally , the computer system may be a multiprocessor computer system or may include multiple computers connected over a computer network . the email system may be embodied a separate computer programs . such modules may be operable on separate computers . data may be stored in a memory system or transmitted between computer systems . the invention is not limited to any particular implementation using software or hardware or firmware , or any combination thereof . the various elements of the system , either individually or in combination , may be implemented as computer program product tangibly embodied in a machine - readable storage device for execution by a computer processor . various steps of the process may be performed by a computer processor executing a program tangibly embodied on a computer - readable medium to perform functions by operating on input and generating output . computer programming languages suitable for implementing such a system include procedural programming languages , object - oriented programming languages , and combinations of the two . while illustrative embodiments of various aspects of the invention have been described , the invention is not limited to the embodiments described . many alternatives , modifications and variations of the embodiments described will be apparent to those skilled in the art . accordingly , embodiments of the invention as set forth herein are illustrative and not limiting . the invention is limited only by the following claims and equivalents thereto .	6
fig1 shows a simplified schematic of a conventional inductive dc / dc converter . generally , a dc / dc converter , as the one shown in fig1 , produces a higher or lower dc output voltage on pin out from a constant voltage source like a battery or the like , being coupled to the input pin in . there are numerous different concepts for dc / dc conversion one of which is the inductive dc / dc converter shown in fig1 . the converter shown in fig1 is an inductive up / down - converter which is a combination of an inductive up - converter ( right hand side ) and an inductive down - converter ( left hand side ). the inductor l 1 is usually implemented externally to an integrated circuit , which includes the switches s 1 to s 4 . accordingly , l 1 is coupled between the pins lxa and lxb . the switches s 1 to s 4 in combination with the capacitors c 1 , c 2 and the diodes d 1 , d 2 provide a predetermined output voltage at output pin out . the output voltage at out can be varied in a wide range from values smaller than the input voltage to values greater than the input voltage at pin in . the different output voltages are adjusted by the switching sequences of s 1 to s 4 , which is produced by digital or analog circuitry . the parts to be integrated on a semiconductor substrate as an integrated circuit are the switches s 1 to s 4 being for example mos transistors . however , other technologies are also conceivable for the transistors . in the up - mode , the typical switching sequence is as follows : the cycle starts with a first phase , where s 1 and s 3 are closed ( conducting ). in a second phase , s 3 opens ( not conducting ) and s 4 starts conducting . in down - mode , the cycle starts with a first phase where s 4 and si are conducting . in the second phase , s 1 opens and s 2 closes . the control signals are either pulse width modulated ( pwm ) or pulse frequency modulated ( pfm ). for pfm , the sequence varies slightly , but the basic functionality is the same . in pwm mode , the switching frequency is fixed . the switches s 1 and s 4 are typically pmos transistors . pmos is suitable to pass a clean vdd or high potential , i . e . without any threshold voltage drops across the transistor . as nmos can pass a clean gnd potential , s 2 and s 3 are implemented by nmos transistors . the conversion principle will not further be addressed in more detail in this description . fig2 shows a simplified schematic of a circuitry according to an embodiment of the present invention . the components shown in fig2 are typically integrated on a semiconductor substrate in a cmos process . the input pin designated by in provides a connection to a voltage source which might be every kind of power supply , typically a battery . an inductor ( an inductive coil or the like as indicated by l 1 in fig1 ) must be coupled between the pins designated by lxa and lxb for the typical application of the circuitry . the circuit of fig2 includes two major parts , the down converting part down_c and the up converting part up_c . the up - or down - converted output voltage is provided on output pin out . the pins in , out , lxa , lxb might be exposed to excess voltage or excess current during manufacturing , assembly or operation due to electrostatic discharge ( esd ). accordingly , an effective esd protection is necessary to prevent excess voltage or excess current to propagate to the integrated electronic devices , in particular to the mos transistors used as switches , and to destroy these transistors . mos transistors mn 1 and mp 1 are used as integrated switches for the up converting part . the transistors mn 2 and mp 2 are the respective switches of the down converting part of the dc / dc converter . the transistors mn 1 , mn 2 , mp 1 , mp 2 are coupled by their respective gates to digital control signals which are pulse width modulated ( pwm ) or pulse frequency modulated ( pfm ). the switching signals for mp 1 , mp 2 are not shown . typically , the control signals are generated by an on - chip digital circuitry being programmable by external commands . additionally , the width of mn 1 is determined by the on resistance value required . the width of mp 1 is determined based on the width of mn 1 . the channel width of mp 1 is typically chosen 2 . 5 times or 3 times greater than the channel width of mn 1 . the design procedure is the same for mn 2 and mp 2 . the on resistance of the switching transistors is predetermined by the efficiency of the converter and is a design parameter . further , the circuit shown in fig2 includes four diodes d 1 , d 2 , d 3 , and d 4 . in addition to the components needed for dc / dc conversion , the embodiment shown in fig2 includes two clamp transistors mnc 1 and mnc 2 and integrated circuitries tc 1 , tc 2 . the logic circuit tc 1 provides signals t 1 and a 1 to control the clamp transistors mnc 1 , mnc 2 and the switching transistors mn 1 and mn 2 as will be explained below . further , the back - gate diodes bgd 1 and bgd 2 of switching pmos transistors mp 1 and mp 2 are indicated in fig2 . the back - gate diodes bgd 1 and bgd 2 are parasitic diodes due to technological properties of the cmos process . however , as will be explained below , these rather parasitic devices are also exploited in a useful way for an aspect of the present invention . according to an aspect of the invention , the control circuits tc 1 , tc 2 activate the nmos transistors mn 1 , mn 2 , mnc 1 , mnc 2 of the circuit shown in fig2 to fig5 in response to an esd event occurring at any of the pins in , out , lxa , lxb . the over - voltage at the respective pins is reduced rapidly via different electrical paths as will be explained with respect to fig3 to fig5 . an important aspect of the invention is the connection of tc 1 to in and tc 2 to out . therefore , this connection is additionally denoted by vs 1 and vs 2 , respectively . the voltage on pins lxa and lxb switches during normal operation . the logic circuitry in tc 1 and tc 2 needs a somehow stable supply voltage to operate correctly . the two pins in and out have stable voltages during normal operation . a higher voltage level occurs at the connection of tc 1 , i . e . at vs 1 , during an esd event on pin in . during an esd event on lxa , voltage is coupled to in through back gate diode bgd 1 . the increased voltage level is sufficient to turn both transistors , mn 1 and mnc 1 , on . consequently , the channels of mn 1 and mnc 1 provide low resistance paths to the esd currents . the circuits tc 1 and tc 2 consume minimal current during an esd event , as they present very high impedance compared to the channels of mn 1 and mnc 1 . the same considerations apply for the other half of the circuit shown in fig2 . the right hand side of fig2 , showing the up conversion part , includes respective transistors mn 2 and mnc 2 which operate in a similar manner as described above , for esd events occurring on pins lxb and out . it is to be mentioned that the circuit shown in fig2 is suitable to protect against any esd events ( e . g . during manufacture or assembly ). during normal operation ( i . e . not an esd event ), the power to the trigger circuit tc 1 ( fig2 ) is provided by a battery or a voltage source on pin in . the power to the trigger circuit tc 2 ( fig2 ) is provided by the voltage on out pin . during an esd event on pin in , the esd pulse experienced at pin in is used to supply or at least to support the operation of tc 1 . additionally , during an esd event on lxa , the voltage supplied via bgd 1 also supports the operation of tc 1 . it is to be noted that tc 2 does not operate during the above two events . however , the above considerations are valid for lxb and out respectively as the right hand side circuit up_c is considered a mirrored version of left half part down_c of the circuit by replacing lxa by lxb and in by out . fig3 . to fig5 are mere illustrations useful to understand important aspects of the invention . there are at least 12 esd combinations and hence 12 current path combinations that may occur in the circuit shown in fig2 . not all current paths and combinations of current paths are shown , but they are apparent from the described examples for those skilled in the art . for example esd events from lxb to out , from lxb to in , and from out to in are not separately shown , yet the invention is equally functional and beneficial for those esd events . fig3 shows a current distribution in response to a first esd event for the circuitry of fig2 . accordingly , fig3 shows a situation where pin lxa experiences an esd event with respect to the input pin in . the voltage difference between lxa and in is supposed to be at maximum . a flash at pin lxa indicates the esd event . the input pin is supposed to be on a much lower voltage level , typically on ground level , as indicated by the ground symbol . in this situation the back - gate diode bgd 1 of pmos transistor mp 1 is driven forward and provides an esd current to the trigger circuit tc 1 . in response to the current through the back - gate diode bgd 1 , the trigger circuit tc 1 activates clamp transistor mnc 1 via signal t 1 . further , tc 1 also activates switching transistors mn 1 via activating signal a 1 . one part of the esd current flows through both transistors mn 1 and mnc 1 and further through the diode d 1 towards the ground potential at input pin in . bold arrows indicate this current path . it is to be noted that a part of the esd current also flows directly to grounded pin in . but the majority of the current flows through mnc 1 and d 1 since mnc 1 is turned on by tc 1 . for a given gate to source voltage ( sufficient to turn on the transistor ) and width of the transistor the transistor has to conduct a specific amount of current . as the pmos transistor mp 1 is larger ( i . e . mp 1 has a greater channel width ) than the nmos transistor mn 1 , the back gate diode bgd 1 of mp 1 can handle large amounts of current and also protect mp 1 from destruction during an esd event on pin lxa and respective grounding on either of the pins in , lxb and out . a current at the drain of mn 1 is distributed through bgd 1 and mn 1 . current through d 1 is the current through mn 1 and current from mnc 1 . a current through bgd 1 will consequently be seen at the drain of mnc 1 . however , the current at the drain of mnc 1 is again distributed , while a small part of it runs directly to ground ; the other part goes through mnc 1 . conventionally , only a single transistor mn 1 , which is suitable to handle all the esd current was provided . the conventional switching transistor needed a large channel width as it was implemented by special layout techniques . according to the present invention , a further transistor mnc 1 is included , which eases the requirements for mn 1 . accordingly , the width of mn 1 is reduced and special layout techniques are dispensable . the combined width of mn 1 and mnc 1 , using conventional layout techniques , is still less than esd protection according to the prior art using special layout techniques for nmos devices as described above with respect to the known techniques . the same considerations are applicable , if the input pin lxb is stressed with respect to a grounded output pin out . in this situation , a current through back - gate diode bgd 2 of mp 2 activates the control circuit tc 2 . the clamp transistor mnc 2 and the switching transistor mn 2 are activated by signals t 2 and a 2 and provide the respective current paths to discharge lxb . fig4 shows a current distribution in response to a second esd event for the circuitry of fig2 . according to the second esd configuration , the pin lxb is supposed to be on ground potential and the excess voltage , indicated by the flash , occurs still at pin lxa . accordingly , the over current propagates from pin lxa through the back - gate diode bgd 1 to control circuit tc 1 prompting thereby the control circuit tc 1 to activate transistors mnc 1 and mn 1 by signals t 1 , a 1 . consequently , the esd current flows through two transistors mnc 1 and mn 1 to ground and finally through forward driven diode d 3 to pin lxb . fig5 shows a current distribution in response to a third esd event for the circuitry of fig2 . fig5 shows a configuration of the worst - case situation of an esd event . the worst - case situation occurs when the input pin in is stressed and the output pin out is supposed to be at ground potential . this situation is equivalent to an esd event where the output pin out experiences an esd event with respect to the input pin in at ground . this is the worst - case situation as the transistors mn 1 and mn 2 cannot contribute to esd protection . in these cases , the pmos devices mp 1 and mp 2 can be destroyed by an esd event . the transistors mnc 1 and mnc 2 prevent the destruction of mp 1 and mp 2 , respectively . accordingly , the entire dc / dc converter — including the up conversion and the down conversion part — is efficiently protected against all combinations of esd events . in fact , the lateral parasitic npn combination of clamp transistor mnc 1 is exposed to the esd excess voltage . the dimensions of the clamp transistor mnc 1 ( and also for the reverse situation mnc 2 ) have to be chosen accordingly . the dimensioning of transistor mnc 1 under the above considerations will be explained with respect to fig7 and 8 . fig6 shows a simplified schematic of a control circuit according to an embodiment of the present invention . it is to be understood that the circuit shown in fig6 is included in tc 1 and tc 2 as shown in fig2 to fig5 . accordingly , although the following explanations relate only to the left side down_c of the circuit shown in fig2 and to tc 1 , all pins and reference signs can be replaced by their counterparts of the right hand part up_c of the circuit . the circuit is supplied by vs 1 , which is usually coupled to a stable supply voltage source via input pin in . the pins en and psw are not shown in fig2 to 5 as they are coupled externally to the circuit tc 1 . under normal operating conditions the enable signal en , which is provided by additional control circuitry , is logic high . accordingly , the capacitor c is charged via nmos transistor mn 3 . a high potential on the capacitor c turns pmos transistor mp 3 off . as the inverter inv produces a low output potential on the gate of mn 4 , mn 4 is also turned off . if mp 3 is turned off , the output signal t 1 is tied to ground potential gnd by resistor r 2 . t 1 is also the input of or gate . the other input signal of the or gate is psw , and , as mn 4 is turned off and t 1 is low , psw — which is the switching signal for mn 1 from external logic circuitry — alone determines the output signal a 1 of the or gate . t 1 is to be coupled to the gate of clamp transistors mnc 1 . accordingly , the clamp transistor mnc 1 is switched off . the output signal a 1 of or 1 is coupled to switching transistor mn 1 . accordingly , under normal operating conditions , the output signal a 1 is defined by psw . psw provides the switching signal for mn 1 necessary to carry out the required dc / dc conversion operation . if an esd event occurs , mn 3 is switched off as there is no voltage ( ground level ) on en and capacitor c is charged through r 1 . initially , as there is no charge on capacitor c , the potential across c is zero . consequently inv produces a high output signal and mn 4 is switched on . psw is tied to ground via mn 4 and the output signal a 1 of the or gate is defined by t 1 . however , t 1 is now pulled to vs 1 as mp 3 is turned on . this results in a high voltage level for t 1 and a 1 . the clamp transistor mnc 1 and the switching transistors mn 1 are turned on in order to provide the required esd protection as described with respect to fig3 to fig5 . after some time which is determined by the time constant of r 1 and c , c is charged to a voltage greater than the switching voltage of inv , such that inv switches from high to low . mn 4 is switched off . psw is issued by the external circuitry and during an esd event , psw is turned off ( i . e . is low ) or experiences no event . t 1 is still pulled to vs 1 as mp 3 is still on . this results in a high voltage level for t 1 and a 1 . the clamp transistor mnc 1 and the switching transistor mn 1 are both turned on in order to provide the required esd protection as described with respect to fig3 to 5 . after a certain time , which is also determined by the time constant implemented by r 1 and c , capacitor c is charged completely to a voltage level , at which mp 3 is turned off . t 1 is now low and a 1 is also low . mn 1 and mnc 1 are now turned off . however , at this time , all the esd current is discharged via mn 1 and mnc 1 and the esd event is overcome . it will be appreciated by those skilled in the art that the control circuits tc 1 and tc 2 can have identical properties and behavior . accordingly , the above explanations are also applicable to tc 2 except that vs 1 , t 1 , and a 1 are to be replaced by their equivalents vs 2 , t 2 , and a 2 . further , the circuits tc 1 and tc 2 as shown in fig2 to fig5 can be implemented as one single control circuit for all transistors , such that multiple transistors are activated by the same signals , i . e . t 1 is equal to t 2 and a 1 is equal to a 2 and at the same time . further , as appreciated by those skilled in the art , although the operation of the esd protection according to the present invention is explained by way of example with respect to the three fig3 to 5 , the esd protection concept and the respective embodiments cover all kinds of combinations of the shown examples . accordingly , an excess voltage may occur on two or more pins simultaneously and two or more pins may be grounded . further , as the integrated circuits used for dc / dc conversion usually provide more than one external pin as in , out , lxa and lxb , it is to be understood that the present invention covers all cases where the described signals are split over plural pins . fig7 shows a graph indicating the drain - source voltage of the clamp transistor mnc 1 versus the channel width of the clamp transistor mnc 1 for the third esd event of fig5 . as could be derived from the shown graph , the clamp transistors mnc 1 must have a minimum channel width to reduce the drain - source voltage below a specific value . the channel width relates directly to the required chip area for the devices . although the channel of the clamp transistors must be chosen considerably wide , the overall area savings are still preserved . this advantage is indicated in fig9 . the values shown in fig7 relate to an exemplary process . they may vary for other processes or technologies . the example shown in fig7 applies equally to transistor mnc 2 shown in fig2 to 5 and the corresponding esd event . fig8 shows the drain source voltage of the switching transistor mn 1 versus the channel width of the clamp transistor mnc 1 for different values of the channel width of the switching transistor for an exemplary manufacturing process . the shown example relates to the 200 v machine model . curve b 1 shows the relation for a channel width of mn 1 of 500 μm . b 2 relates to a channel width of mn 1 of 5 mm and b 3 to a channel width of mn 1 of 20 mm . the same graph could be considered for mn 2 and mnc 2 . the graphs of fig7 and 8 could be used to determine an appropriate channel width for clamp transistors mnc 1 , mnc 2 and the switching transistors mn 1 and mn 2 . in a first step , the required channel width of the clamp transistor mnc 1 or mnc 2 is determined by use of fig7 under the constraint that a certain maximum drain - source voltage is admissible . for the clamp transistor mnc 1 or mnc 2 having the determined channel width , the channel width of the corresponding switching transistor mn 1 or mn 2 is determined based on the graph in fig8 . fig9 shows a graph indicating the surface areas consumed on a semiconductor substrate by different esd protection concepts compared to the solution provided by the present invention for an exemplary technology . the curve c 1 is the surface area to be consumed for the esd protection according to the present invention for a specific process . curve c 2 relates to a concept where ballasting resistors used as esd protection means . curve c 3 is an estimation for the silicide principle as explained in the introductory portion of this description . it will be appreciated that the present invention provides reduced area consumption and therefore reduced costs with respect to these prior art solutions . according to this aspect of the present invention , the combined width of mn 1 and mnc 1 shown in fig2 to 5 is still less than a single nmos implemented according to the special layout techniques which are used by the prior art . while the invention has been illustrated and described in detail in the drawings and foregoing description , such illustrations and description are to be considered illustrative or exemplary and not restrictive ; the invention is not limited to the disclosed embodiments . other variations to the disclosed embodiments can be understood and effected by those skilled in the art in practicing the claimed invention , from a study of the drawings , the disclosure , and the appended claims . in the claims , the word “ comprising ” does not exclude other elements or steps , and the indefinite article “ a ” or “ an ” does not exclude a plurality . a plurality of pins , transistors or other units may fulfill the functions of one item recited in the claims , and vice versa . the mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these measures cannot be used to advantage . any reference signs in the claims should not be construed as limiting the scope .	7
the particulars shown herein are by way of example and for purposes of illustrative discussion of the embodiments of the present invention only and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the present invention . in this regard , no attempt is made to show details of the present invention in more detail than is necessary for the fundamental understanding of the present invention , the description in combination with the drawings making apparent to those of skill in the art how the several forms of the present invention may be embodied in practice . fig1 shows the basic structure of a device for respiration ( 1 ). a breathing gas pump is arranged in a device interior in the region of a device housing having an operating panel ( 10 ) and display ( 11 ). a connecting hose is connected via a coupling ( 14 ). an additional pressure measuring hose can extend along the connecting hose , which is connectable via a pressure inlet nozzle to the device housing . the device housing has at least one interface ( 12 , 13 ) to enable a data transmission . an operating element ( 15 ) is arranged in the region of the device housing , to be able to manually predefine a dynamic mode of the respirator . the operating element ( 15 ) can be arranged in the region of the operating panel or can be embodied as an external or separate operating element . to avoid drying out of the airways , it has proven to be advantageous in particular during longer respiration phases to carry out humidification of the breathing air . such humidification of the breathing air can also be implemented in other applications . a breathing air humidifier is laterally adapted for the humidification . it is possible that the control device is suitable and designed for the purpose of monitoring a flow signal and / or a pressure signal and evaluating them on the basis of at least one algorithm , to classify an event . the flow signal and / or the pressure signal are provided in this case by at least one sensor element associated with the control device . the sensor element is provided in this case for detecting at least one flow property and / or at least one pressure property of the air flow for the respiration . the evaluation of flow signals and / or pressure signals enables a reliable recognition and classification of events of the respiration . the control device is particularly preferably also suitable and designed to register at least one respiration parameter on the basis of the flow signal and / or the pressure signal , for example , the breathing frequency , the breath volume , the respiratory minute volume , the inspiration flow and / or the inspiration pressure and / or the airway resistance . the control device can additionally be suitable and designed for the purpose of applying an oscillating control signal to the flow generator . the flow generator thereupon generates a breathing gas flow having a modulated pressure oscillation , which is preferably in the range of 1 - 20 hz , particularly preferably 2 - 10 hz , or also about 4 hz , and causes a pressure stroke of 0 . 1 - 1 cm h 2 o , preferably about 0 . 4 cm h 2 o . this pressure stroke also induces an oscillating flow . the control device can be suitable and designed to output a corresponding notification to a user in the event of registered breathing events . for example , the notification can be visually and / or acoustically indicated by means of a display device . the notification can also be output , for example , by means of an interface to at least one external data processing device . such a notification is particularly advantageous , because the respiration treatment can be adapted accordingly in awareness of the events . on the other hand , if the notification does not occur , a corresponding success of the respiration treatment can be established . the respirator can be adapted dynamically and in particular depending on the breathing phase of the user . for example , a breathing phase change can be recognized on the basis of the control device , so that a higher or lower pressure can be provided depending on the breathing phase . for example , the respirator can be designed as a cpap or apap device . the respirator 1 can also be designed as a bilevel device . for example , the respirator 1 reacts to determined breathing events , for example , snoring , breath flattening , and / or obstructive pressure peaks , with corresponding settings of the respiration parameters . using the respirator 1 shown here , events which occur in the breathing or during the respiration are recognized and classified . for this purpose , the sensor means detects one or more respiration parameters such as pressure and / or flow and / or ods signal and supplies corresponding signals to the control device 7 . the control device 7 analyzes the signals by means of suitable algorithms , so that characteristic signal curves can be recognized and classified as an event . in this case , for example , a parameter extraction can be used with reference to levels and amplitude values , time intervals , envelope curves , zero crossings , and slopes . in the case of an analysis with regard to time features , for example , periodicities and frequencies are used during a parameter extraction . an obstructive apnea ( oa ) is recognized if a greatly reduced flow volume is recognized and / or an ods increase occurs for at least two breaths . an obstructive hypopnea ( oh ) is shown , for example , by way of a reduced flow volume for two successive inspirations or by obstructive flattening ( a typical flattening of the breathing curve ) of the flow signal . obstructive snoring ( os ) is recognized by cumulative snoring over at least two consecutive inspirations accompanied by obstructions or flattening . obstructive flattening ( of ) is recognized by cumulative flattening over at least three inspirations , and at least one increase of the inspirational ods signal . an obstructive event ( oe ) is recognized by a significant cumulative inspirational increase of the ods signal . snoring ( s ) is recognized by cumulative snoring ( at least 3 cumulative inspirations ) without inspirational ods increase . nonspecific flattening ( nf ) is recognized by cumulative flattening ( at least 3 inspirations ). a central apnea ( ca ) is recognized via a strongly reduced flow volume for 10 seconds without ods increase or flattening . a central hypopnea ( ch ) is recognized by a reduced flow volume ( 2 consecutive inspirations ) without ods increase . a leak in the region of the patient interface or a mouth and mask leak is recognized in that the target pressure cannot be reached and / or the leak flow is greater than 0 . 6 l / sec . the recognized events can then be stored in the storage device and used for a respiration statistic . one advantage of the event recognition is that an adaptation of the respiration can be performed on the basis of the classified events , for example , an automatic pressure increase in the event of an obstructive apnea . in addition , a diagnosis of determined respiratory disturbances can be performed to a certain extent . a special advantage of the respirator 1 shown here is the control device 7 , which further analyzes the recognized events and also registers cheyne - stokes breathing on the basis of a characteristic occurrence of the events . such an event analysis is sketched by way of example in fig2 . fig2 shows a schematic block diagram to explain a part of an internal construction of the device corresponding to fig1 . a pump device ( 13 ), which is designed as a blower , is provided for conveying the flow volume of breathing gas . the pump device ( 13 ) is driven by a motor ( 14 ). a sensor ( 15 ), which is connected to a control unit ( 16 ), is used to detect a speed of the motor ( 14 ). a sensor ( 18 ) for detecting a pressure is arranged in the region of a line ( 17 ), which is fed by the pump device ( 13 ), for the flow volume . the sensor ( 18 ) is also connected to the controller ( 16 ). a computer unit ( 19 ) is implemented in the region of the control unit ( 16 ), which performs a computed linkage of the measured values for the pressure and the speed and computes a present volume flow therefrom . if the control unit ( 16 ) is designed as a digital computer , for example a microprocessor , it is possible to implement the computer unit ( 19 ) as part of the sequence programming of the control unit ( 16 ). in the case of an analog design of the control unit ( 16 ), the intention is also to implement the computer unit ( 19 ) via components having linear or nonlinear electrical behavior . fig3 illustrates a characteristic map , which reflects the dependence of the flow volume on the respective pressure for a respiration system selected by way of example . it can be seen in particular that different characteristic curve profiles result at different speeds of the motor ( 14 ). the respective characteristic curves consist of approximately parabolic subregions , which are connected in the surroundings of the pressure axis by approximately linear curves . fig4 compares a measured curve ( 20 ) of the flow volume and a curve ( 21 ) computed by the control unit ( 16 ). the flow volume is indicated in this case in l / sec . it can be seen that there is a very extensive correspondence . fig5 a and fig5 b show experimentally obtained pressure and flow oscillation curves for obstructed and open airways respectively . the treatment pressure in both cases was 4 hpa ( without leakage ). for an implementation of the method according to the invention and in a construction of the device according to the invention , the characteristic map is determined metrologically according to fig3 . for different motor speeds , the respective characteristic curve is determined in this case for the entirety of motor ( 14 ), pump device ( 13 ), line ( 17 ), and sensor ( 18 ). for the individual characteristic curves k for each speed , the pressure p results in this case as a function of the volume flow f according to the equation p k ( f )= a k2 * f 2 + a k1 * f + a k0 the above equation represents an approximation of the actual curve , but it has been shown that this approximation has a good correspondence to the actual characteristic curve profile . each of the secondary coefficients a ki with i = 0 to 2 is dependent on the respective speed . the above equation may therefore also be represented in the form p ( f )= a 2 ( n )* f 2 + a 1 ( n )* f + a 0 ( n ). it has been shown that the secondary coefficients a ki can also be determined in a good approximation from the respective speed using a quadratic equation . a corresponding equation approach reads a i = b i2 * n 2 + b i1 * n + b i0 . the primary coefficients b ik represent here the mechanical and electrical properties of the overall system and can be determined metrologically . in consideration of the quadratic approaches for the dependence between the pressure and the volume flow and the secondary coefficients a ik of the primary coefficients b ik , a total of nine coefficients b ik are to be determined metrologically . the simple equation structure enables the secondary coefficients a k ( n ) to be recalculated from the known primary coefficients b i before each value for the volume flow to be recalculated . the actual value for the volume flow is then ascertained via the inverse function of the equation listed first .	0
vehicular traffic prediction (“ traffic prediction ”) is a useful tool to assist in the management of vehicular traffic . accurate traffic predictions can improve traffic conditions , reduce travel delays , and make roadways more efficient . the traffic data is typically generated by traffic sensors , embedded in a road , that are capable of measuring traffic flow for many road segments , or links , in a transportation network . embodiments of the present invention seek to auto - calibrate road traffic prediction , so that the tunable parameters implemented in the overall traffic prediction model are configured to the optimal values , without human intervention . the present invention will now be described in detail with reference to the figures . fig1 is a functional block diagram illustrating an environment , generally designated 100 , in accordance with one embodiment of the present invention . modifications to environment 100 may be made by those skilled in the art without departing from the scope of the invention as recited by the claims . environment 100 includes traffic predicting server 120 and traffic management server 130 , all interconnected over network 110 . network 110 can be , for example , a local area network ( lan ), a wide area network ( wan ) such as the internet , or a combination of the two , and can include wired , wireless , or fiber optic connections . in general , network 110 can be any combination of connections and protocols that will support communication between traffic predicting server 120 and traffic management server 130 . traffic predicting server 120 and traffic management server 130 may be a management server , a web server , or any other electronic device or computing system capable of receiving and sending data . in other embodiments , traffic predicting server 120 and traffic management server 130 can be a laptop computer , a tablet computer , a netbook computer , a personal computer ( pc ), a desktop computer , a personal digital assistant ( pda ), a smart phone , or any programmable electronic device capable of communicating with another server , via network 110 , and with various components and devices within distributed data processing environment 100 . traffic predicting server 120 and traffic management server 130 may include internal and external hardware components , as depicted and described in further detail with respect to fig4 . traffic management server 130 includes exemplary information storage 132 , which is an information repository that contains traffic sensor data files 134 and spatial data files 136 . traffic management server 130 is a computing device that aggregates vehicular traffic data , real - time and / or historic , generated by vehicular traffic sensors . traffic management server 130 can receive , via network 110 , traffic data generated by a traffic sensor . traffic management server 130 can store data files used to calculate the traffic prediction parameters , such as traffic data files generated by the department of transportation . in an embodiment of the present invention , traffic management server 130 can represent a computing system utilizing clustered computers and components to act as a single pool of seamless resources when accessed through a network . traffic sensor data files 134 contain the data recorded for the historic traffic conditions , while spatial data files 136 contain the information for the links in the road network . exemplary information storage 132 stores the spatial and sensory parameter information as traffic sensor data files 134 and spatial data files 136 , used in calibration calculations by traffic prediction calibrating program 124 . traffic predicting server 120 includes traffic predicting tool 121 , exemplary information store 122 , traffic parameter calibrating program 124 , and exemplary information storage 126 , in accordance with an embodiment of the present invention . traffic predicting server 120 is a computing device that predicts road traffic conditions . traffic predicting server 120 can generate road traffic predictions . traffic predicting tool 121 can receive real - time and / or historic traffic data from traffic sensor data files 123 and spatial data files 125 . traffic predicting tool 121 can predict road traffic conditions . traffic predicting tool 121 can receive instructions from traffic parameter calibrating program 124 . exemplary information storage 122 is an information repository that stores the sensory and spatial parameter information as traffic sensor data files 123 and spatial data files 125 . traffic sensor data files 123 contain historic traffic data , while spatial data files 125 contain information reflective of links , or road segments , in the transportation network that is associated with traffic sensor data files 123 . traffic parameter calibrating program 124 is software that improves the accuracy of traffic predicting calculations , in accordance with an embodiment of the present invention . traffic parameter calibrating program 124 can determine a subnet of links . subnets are predetermined groupings of links that represent roadways for a given system . traffic parameter calibrating program 124 can determine links that have the least accuracy . the accuracy of a prediction is calculated as the difference between predicted values and observed values , which is determined after the actual values are available via feeds from the road network . for example , traffic parameter calibrating program 124 retrieves link information from spatial data files 125 and determines subnet 1 of fig3 . traffic parameter calibrating program 124 can receive parameters and the results of parameter configuration from parameter files 128 and parameter prediction results files 127 . traffic parameter calibrating program 124 can calibrate the parameters used to predict road traffic . traffic parameter calibrating program 124 can communicate with traffic predicting tool 121 . exemplary information storage 126 is an information repository that stores the parameter and parameter prediction results information as parameter files 128 and parameter prediction results files 127 . parameter files 128 include information reflective of the tunable parameters ( discussed below ) used in optimization calculations , such as those performed by traffic parameter calibrating program 124 ( discussed below ). parameter prediction results files 127 include information reflective of optimized parameters , such as the optimized parameters generated by traffic parameter calibrating program 124 . parameter prediction results files 127 can be retrieved and implemented by traffic predicting tool 121 through traffic parameter calibrating program 124 . fig2 a is a flowchart depicting operational steps of traffic parameter calibrating program 124 , in accordance with an embodiment of the present invention . the discussion of fig2 a will be discussed in conjunction with fig3 . traffic parameter calibrating program 124 determines a subnet of links ( step 202 ). for example , traffic parameter calibrating program 124 determines a subnet of links from city roadway information compiled by the department of transportation for that particular city and generates subnet 1 of fig3 . traffic parameter calibrating program 124 determines the link with the least accuracy ( step 204 ). traffic parameter calibrating program 124 calculates prediction accuracy on each of the links in subnet 1 of fig3 and traffic parameter calibrating program 124 determines the link included in subset 1 of fig3 with the lowest accuracy . in one embodiment , the level of accuracy for each link is dependent on the conditions and geographical layout of the city roadways that are calculated and determined prior to invoking traffic parameter calibrating program 124 . for example , poor , moderate , and good link accuracy can be defined as being less than 50 % accurate , between 50 % and 80 % accurate , and greater than 80 % accurate , respectively , as depicted in fig3 . traffic parameter calibrating program 124 increases the number of hops by a preconfigured number of steps ( for example , one ) and generates a new subnet ( step 206 ). for example , as depicted in fig3 , traffic parameter calibrating program 124 generates a new subnet , subnet 101 , from subnet 1 which includes all links that are within 2 ( denoted as beta ) hops from the lowest accuracy link , l5 . in an embodiment , the beta value is a set of detectors included in the relationship vector ; a number within a predetermined range , determined based on data compiled from the road networks and the traffic administrator that is associated with a given road network environment . traffic parameter calibrating program 124 optimizes the link parameters of the new subnet ( step 208 ). for example , traffic parameter calibrating program 124 can perform a continuous optimization calculation to achieve improved traffic predicting accuracy . in an embodiment , traffic parameter calibrating program 124 invokes the linear programming algorithm of fig2 b ( discussed below ) to iteratively calculate the optimum configuration for the links within subnet 101 and determine which parameters provide the best prediction accuracy , as depicted in fig3 , subnet 101 optimized . traffic parameter calibrating program 124 determines whether the parameters are optimized to the highest accuracy ( decision block 210 ). for example , if traffic parameter calibrating program 124 determines that a change in the parameters results in a higher accuracy calculation , then traffic parameter calibrating program 124 will continue to run the linear program algorithm to optimize the parameters , until the parameters that yield the highest accuracy are achieved ( decision block 210 , no branch ). if traffic parameter calibrating program 124 determines that a change in the parameters does not yield a higher accuracy calculation ( decision block 210 , yes branch ), traffic parameter calibrating program 124 saves the parameters as the optimal parameters for the given subset of links , and applies the optimal parameters to the subnets that contain the subset of links to calculate the accuracy ( step 212 ). traffic parameter calibrating program 124 applies the optimized parameters to the subnets and calculates the accuracy ( step 212 ). for example , traffic parameter calibrating program 124 applies the optimized set of parameters for subnet 101 to all subnets that contain the optimized subnet 101 set of links . traffic parameter calibrating program 124 then calculates the accuracy of the entire subnet with the new configuration parameters for subnet 101 applied to the subnet . in an embodiment , traffic parameter calibrating program 124 iteratively runs prediction calculations until a user predetermined target accuracy value is achieved , or a closest accuracy value to the target accuracy value is achieved . traffic parameter calibrating program 124 determines whether the overall accuracy value is higher than the previously calculated accuracy value ( decision block 214 ). for example , if the overall prediction accuracy value is not higher than the previous accuracy value ( decision block 214 , no branch ), then traffic parameter calibrating program 124 does not save the new configuration data ( step 216 ). in the same example , if traffic parameter calibrating program 124 determines that the overall prediction accuracy value is higher than the previous accuracy value for each set of links ( decision block 214 , yes branch ), then traffic parameter calibrating program 124 saves the new configuration data ( step 218 ). the new configuration data is stored as permanent , as the optimum parameter data , as parameter files 128 in exemplary information storage 126 . traffic parameter calibrating program 124 applies the new configuration data to the next defined subnet and runs the algorithm calculations for that subnet ( step 220 ). for example , traffic parameter calibrating program 124 applies the configuration data to all of the next defined subnet , subnet 2 , in the network . the number of subnets on which to execute optimization calculations is a configurable parameter , which predefines a maximum number of subnets for manageability . traffic parameter calibrating program 124 runs the algorithm configuration optimization calculations on the links in subnet 2 , starting at operational step 204 . traffic parameter calibrating program 124 determines whether the new configuration data yields more accurate prediction results ( decision block 222 ). for example , if the configuration data calculated for subnet 2 does not give a higher accuracy value of prediction results than the prediction accuracy value for subnet 1 ( decision block 222 , no branch ), then traffic parameter calibrating program 124 stores the subnet 1 configuration data for future calculations ( step 224 ). in the same example , if the configuration data calculated for subnet 2 yields a higher accuracy value of prediction results than the prediction accuracy value for subnet 1 ( decision block 222 , yes branch ), then traffic parameter calibrating program 124 applies the subnet 2 set of parameters to all of the defined subnets ( step 226 ). fig2 b is a flowchart depicting additional operational steps of traffic parameter calibrating program 124 , in accordance with an embodiment of the present invention . the subnet of links on which to perform the parameter optimization calculations is the set of links that has been determined by traffic parameter calibrating program 124 as the set of links with the least accuracy , as generated in step 206 of fig2 a . traffic parameter calibrating program 124 increases the value of the number of hops ( denoted as beta ) by one step within a given range ( step 203 ). for example , the value of beta , or the number of hops , is increased from 2 to 3 , where the range of beta is 1 - 5 . the ranges of the beta parameter are predetermined and tunable values . traffic parameter calibrating program 124 executes an estimate calculation and a prediction calculation ( step 205 ). for example , responsive to increasing the value of beta , traffic parameter calibrating program 124 runs an estimate calculation of the traffic of each link , which determines how the traffic on a particular link is affected by the preceding links , followed by a traffic prediction calculation of the new subnet . traffic parameter calibrating program 124 increases the alpha value by one step ( step 207 ). the alpha parameter is used in computing the historical mean value and determines how much weight is put on the recent past versus the more distant past . for example , the value of alpha is increased one step from 0 . 8 to 0 . 9 , where the range of alpha is 0 . 5 to 1 . 0 for each value of beta . the ranges of the alpha parameter are predetermined and tunable values . traffic parameter calibrating program 124 executes a mean calculation , an estimate calculation , and a prediction calculation ( step 209 ). for example , traffic parameter calibrating program 124 runs a mean calculation to determine the historical mean value , followed by an estimate calculation of the traffic of each link , and a prediction calculation of the new subnet , after the value of alpha is increased . traffic parameter calibrating program 124 increases the gamma and zeta values by one step ( step 211 ). the gamma parameter is the number of weeks of historical data to use in a mean calculation , while the zeta parameter is the number of weeks of historical data to use in an estimate calculation . for example , the values of gamma and zeta are increased by one step , where the range of gamma and zeta is 8 to 12 , for each value of alpha . the ranges of the gamma and zeta parameters are predetermined and tunable , and the values of gamma and zeta are kept equal . traffic parameter calibrating program 124 runs a mean calculation , an estimate calculation , and a prediction calculation ( step 213 ). for example , traffic parameter calibrating program 124 runs a mean calculation to determine the historical mean value , followed by an estimate calculation of the traffic of each link , and a prediction calculation of the new subnet , after the values of gamma and zeta are increased . traffic parameter calibrating program 124 increases the delta value by one step ( step 215 ). the value of delta , the number of data points from a real time sensor network feed , is changed by one step within the given range for each value of gamma and zeta . the ranges of the delta parameter are predetermined and tunable values . traffic parameter calibrating program 124 executes a prediction calculation ( step 217 ). for example , traffic parameter calibrating program 124 runs a prediction calculation of the new subnet after the value of delta is increased . traffic parameter calibrating program 124 determines whether the value of the calculated accuracy is greater than the previous determined accuracy value ( decision block 219 ). if traffic parameter calibrating program 124 determines that the calculated accuracy is not greater than the previous accuracy ( decision block 219 , no branch ), traffic parameter calibrating program 124 does not save the accuracy and parameters ( step 221 ). if traffic parameter calibrating program 124 determines that the calculated accuracy is greater than the previous accuracy ( decision block 219 , yes branch ), traffic parameter calibrating program 124 stores the accuracy and parameters as the best configuration ( step 223 ). the best configuration parameters are stored as parameter prediction results files 127 on exemplary information storage 126 , and may be retrieved by traffic predicting tool 121 for future calculations . traffic parameter calibrating program 124 selects a new set of links ( step 225 ). for example , traffic parameter calibrating program 124 selects a new set of links containing moderate accuracy and good accuracy , and invokes the linear programming algorithm for obtaining the optimum configuration for the new set of selected links . in step 227 , the subroutine returns to step 212 in fig2 a . as depicted in subnet 101 optimized in fig3 , the accuracy of each link in subnet 101 has increased after traffic parameter calibrating program 124 performs parameter optimization calculations on each of the links . fig4 depicts a block diagram of components of traffic predicting server 120 and traffic management server 130 , in accordance with an illustrative embodiment of the present invention . it should be appreciated that fig4 provides only an illustration of one implementation and does not imply any limitations with regard to the environments in which different embodiments may be implemented . many modifications to the depicted environment may be made . traffic predicting server 120 and traffic management server 130 each include communications fabric 402 , which provides communications between computer processor ( s ) 404 , memory 406 , persistent storage 408 , communications unit 410 , and input / output ( i / o ) interface ( s ) 412 . communications fabric 402 can be implemented with any architecture designed for passing data and / or control information between processors ( such as microprocessors , communications and network processors , etc . ), system memory , peripheral devices , and any other hardware components within a system . for example , communications fabric 402 can be implemented with one or more buses . memory 406 and persistent storage 408 are computer readable storage media . in this embodiment , memory 406 includes random access memory ( ram ) 414 and cache memory 416 . in general , memory 406 can include any suitable volatile or non - volatile computer readable storage media . traffic predicting tool 121 , traffic parameter calibrating program 124 , traffic sensor data files 123 and 134 , spatial data files 125 and 136 , parameter prediction results files 127 , and parameter files 128 are stored in persistent storage 408 for execution and / or access by one or more of the respective computer processors 404 via one or more memories of memory 406 . in this embodiment , persistent storage 408 includes a magnetic hard disk drive . alternatively , or in addition to a magnetic hard disk drive , persistent storage 408 can include a solid state hard drive , a semiconductor storage device , read - only memory ( rom ), erasable programmable read - only memory ( eprom ), flash memory , or any other computer readable storage media that is capable of storing program instructions or digital information . the media used by persistent storage 408 may also be removable . for example , a removable hard drive may be used for persistent storage 408 . other examples include optical and magnetic disks , thumb drives , and smart cards that are inserted into a drive for transfer onto another computer readable storage medium that is also part of persistent storage 408 . communications unit 410 , in these examples , provides for communications with other data processing systems or devices , including between traffic predicting server 120 and traffic management server 130 . in these examples , communications unit 410 includes one or more network interface cards . communications unit 410 may provide communications through the use of either or both physical and wireless communications links . traffic predicting tool 121 and traffic parameter calibrating program 124 may be downloaded to persistent storage 408 through communications unit 410 . i / o interface ( s ) 412 allows for input and output of data with other devices that may be connected to client computing device 120 . for example , i / o interface 412 may provide a connection to external devices 418 such as a keyboard , keypad , a touch screen , and / or some other suitable input device . external devices 418 can also include portable computer readable storage media such as , for example , thumb drives , portable optical or magnetic disks , and memory cards . software and data used to practice embodiments of the present invention , e . g ., traffic predicting tool 121 and traffic parameter calibrating program 124 can be stored on such portable computer readable storage media and can be loaded onto persistent storage 408 via i / o interface ( s ) 412 . i / o interface ( s ) 412 also connect to a display 420 . display 420 provides a mechanism to display data to a user and may be , for example , a computer monitor or an incorporated display screen , such as is used in tablet computers and smart phones . the programs described herein are identified based upon the application for which they are implemented in a specific embodiment of the invention . however , it should be appreciated that any particular program nomenclature herein is used merely for convenience and thus , the invention should not be limited to use solely in any specific application identified and / or implied by such nomenclature . the present invention may be a system , a method , and / or a computer program product . the computer program product may include a computer readable storage medium ( or media ) having computer readable program instructions thereon for causing a processor to carry out aspects of the present invention . the computer readable storage medium can be a tangible device that can retain and store instructions for use by an instruction execution device . the computer readable storage medium may be , for example , but is not limited to , an electronic storage device , a magnetic storage device , an optical storage device , an electromagnetic storage device , a semiconductor storage device , or any suitable combination of the foregoing . a non - exhaustive list of more specific examples of the computer readable storage medium includes the following : a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), a static random access memory ( sram ), a portable compact disc read - only memory ( cd - rom ), a digital versatile disk ( dvd ), a memory stick , a floppy disk , a mechanically encoded device such as punch - cards or raised structures in a groove having instructions recorded thereon , and any suitable combination of the foregoing . a computer readable storage medium , as used herein , is not to be construed as being transitory signals per se , such as radio waves or other freely propagating electromagnetic waves , electromagnetic waves propagating through a waveguide or other transmission media ( e . g ., light pulses passing through a fiber - optic cable ), or electrical signals transmitted through a wire . computer readable program instructions described herein can be downloaded to respective computing / processing devices from a computer readable storage medium or to an external computer or external storage device via a network , for example , the internet , a local area network ( lan ), a wide area network ( wan ), and / or a wireless network . the network may comprise copper transmission cables , optical transmission fibers , wireless transmission , routers , firewalls , switches , gateway computers , and / or edge servers . a network adapter card or network interface in each computing / processing device receives computer readable program instructions from the network and forwards the computer readable program instructions for storage in a computer readable storage medium within the respective computing / processing device . computer readable program instructions for carrying out operations of the present invention may be assembler instructions , instruction - set - architecture ( isa ) instructions , machine instructions , machine dependent instructions , microcode , firmware instructions , state - setting data , or either source code or object code written in any combination of one or more programming languages , including an object oriented programming language such as smalltalk , c ++ or the like , and conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the computer readable program instructions may execute entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through any type of network , including a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). in some embodiments , electronic circuitry including , for example , programmable logic circuitry , field - programmable gate arrays ( fpga ), or programmable logic arrays ( pla ) may execute the computer readable program instructions by utilizing state information of the computer readable program instructions to personalize the electronic circuitry , in order to perform aspects of the present invention . aspects of the present invention are described herein with reference to flowchart illustrations and / or block diagrams of methods , apparatus ( systems ), and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer readable program instructions . these computer readable program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which execute via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer readable program instructions may also be stored in a computer readable storage medium that can direct a computer , a programmable data processing apparatus , and / or other devices to function in a particular manner , such that the computer readable storage medium having instructions stored therein comprises an article of manufacture including instructions which implement aspects of the function / act specified in the flowchart and / or block diagram block or blocks . the computer readable program instructions may also be loaded onto a computer , other programmable data processing apparatus , or other device to cause a series of operational steps to be performed on the computer , other programmable apparatus , or other device to produce a computer implemented process , such that the instructions which execute on the computer , other programmable apparatus , or other device implement the functions / acts specified in the flowchart and / or block diagram block or blocks . the flowchart and block diagrams in the figures illustrate the architecture , functionality , and operation of possible implementations of systems , methods , and computer program products according to various embodiments of the present invention . in this regard , each block in the flowchart or block diagrams may represent a module , segment , or portion of instructions , which comprises one or more executable instructions for implementing the specified logical function ( s ). in some alternative implementations , the functions noted in the block may occur out of the order noted in the figures . for example , two blocks shown in succession may , in fact , be executed substantially concurrently , or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . it will also be noted that each block of the block diagrams and / or flowchart illustration , and combinations of blocks in the block diagrams and / or flowchart illustration , can be implemented by special purpose hardware - based systems that perform the specified functions or acts or carry out combinations of special purpose hardware and computer instructions .	6
the drawing shows a dispenser 11 in an only partly represented medium container 12 , which can store a medium to be discharged . the medium to be discharged can be in the form of liquids , which can have different viscosities and which can range from highly viscous to very thin liquids , such as alcohol - based solutions . in addition , the media to be stored usually contain a pharmaceutical substance . the discharge means 13 is inserted in the medium container opening 12 a . the discharge means 13 , which in the represented embodiment is a plunger pump , is sealingly mounted by means of the sealing ring 30 on the opening 12 a ( e . g . an atomizer nozzle ) and is held firmly on the medium container 12 by the fixing screw 31 . in the manner shown in the embodiment , the discharge means 13 can e . g . be a plunger pump , which with a suction hose 32 sucks medium from the lowest point of the medium container 12 and delivers the medium through the riser 33 to the discharge opening . the discharge means 13 is operated by operating the operating element 14 . for this purpose the operating element 14 carries contact surfaces 17 , where the user can apply his fingers and a discharge stroke of the plunger pump can be brought about by pressing down the operating element 14 towards the medium container 12 . the thumb can e . g . act on the underside of the medium container for producing the corresponding opposing force . during each discharge stroke there is a discharge of medium through the discharge opening 19 . for this purpose the operating element 14 is constructed in such a way that it acts by means of the riser 33 on the plunger of the plunger pump serving as the discharge means 13 . the operating element can be displaced by the plunger height of lift relative to the discharge means and therefore relative to the medium container . in order to bring about a reliable relative position between the operating element 14 and medium container 12 , it is also possible to provide a radial guide between the fixing screw 31 or medium container 12 and the operating element 14 . this can in particular be created in that the fixing screw 31 has a non - circular outer contour and the shape of the operating element 14 is adapted thereto . however , it is also possible to provide guide rails , guide grooves and guide surfaces . it is also possible for the fixing screw 31 to be part of a housing surrounding the medium container 12 or for it to be shaped as part thereof . to protect the discharge opening 19 against dirtying when the dispenser 11 is not in use and also to secure the dispenser against undesired operation during non - use , a protective cap 18 can be placed on the operating element 14 and covers the discharge opening 19 . the operating element has a detecting device 20 , which is used to indicate operations of the operating element 14 which have taken place . the detecting device 20 comprises the switching element 26 , which is located on the side of the operating element 4 and the switching surface 27 formed on the fixing screw side . as soon as the switching element 26 engages with the switching surface 27 , a counting signal is generated , which is transmitted to the counting mechanism 21 . as a function of the number of detected counting signals , a numerical value is determined at the counting mechanism 21 . in the simplest case the numerical value can be the total number of operations of the operating element . however , it can also be the number of operations which have taken place within a given time , e . g . within an hour or a day . alternatively or additionally the numerical value can be the number of still remaining operations leading to a discharge of medium . this is e . g . of interest if the medium container contains a precisely dosed medium quantity and the user wishes to know how often a dose can be administered before the container is completely emptied . the detecting device 20 with its switching element 26 and switching surface 27 consequently forms a sensor for the performance of a complete operation of the operating element 14 . on the operating element 14 is also provided an idle path switch 24 , which detects an operation of the operating element 14 in the vicinity of the idle path , i . e . without discharging medium . this idle path switch 24 , which can be in the form of a push - button switch , transmits a corresponding switching signal at the start of any operation of the operating element 14 . as a result of a switching signal of the idle path switch 24 the display element 22 can be controlled and in particular switched on . in addition , a protective cap switch 25 , which can also be a push - button switch , is positioned outside the movement path of the container 12 and the fixing screw 31 on the operating element 14 . it is possible to detect by means of the protective cap switch 25 , it is possible to detect whether the protective cap 18 is placed on the discharge means 11 , particularly on the operating element 14 . for operating the protective cap switch 25 can in particular be used a latch 18 a of the protective cap 18 projecting into the interior of the operating element 14 and which serves to maintain the cap 18 on the element 14 . the switching state of the protective cap switch then represents the two states “ protective cap fitted ” and “ protective cap not fitted ”. a corresponding signal is supplied to the display element 22 . the display element 22 can in particular comprise a lcd display 23 , a small colour screen and control electronics , which can also be called an evaluating unit 40 . the control electronics and the counting mechanism 21 are preferably constructed as a common electronic component . the lcd display 23 can also be directly fitted to said electronic component . the energy supply of the display element and the counting mechanism 21 is provided through the energy storage means 16 , e . g . a battery or button cell . for receiving the counting mechanism 21 , the display control , including evaluating unit 40 , and the display element 22 , a chamber 28 is provided on the operating element 14 and is closed by means of the lid 29 . the display element 22 , e . g . the lcd screen , forms the corresponding termination of an opening in the chamber 28 towards the user or observer . the lid 29 can be placed both detachably , non - detachably and in sealing manner or in non - hermetically terminating manner on the operating element 14 . the operation of the device according to the invention will now be described . if the protective cap 18 is removed from the operating element 14 , there is change to the switching state of the protective cap switch 25 . the change to the switching state of the protective cap switch 25 is detected as a signal in the evaluating unit 40 and counting mechanism 21 and the display element 22 is activated . on the lcd screen 23 is then displayed a counting signal , e . g . the number of operations to the operating element 14 which have already taken place . if there is no operation of the operating element 14 , then the display is switched off again for specific , predetermined time , e . g . approximately 30 seconds to 1 minute . a renewed switching on of the display can take place in that there is a slight operation of the operating element 14 and consequently a switching of the idle path switch 24 . this also leads to an activation of the screen , at least for a given time period . on operating the operating element 14 , which only activates the idle path switch 24 , no medium is discharged from the discharge opening 19 . if the user operates the operating element 14 , when medium is discharged from the discharge opening 19 and for which purpose the operating element constructed in this area as an applicator is introduced with the discharge opening 19 at the application location , e . g . into the nose or mouth , the operating element 14 is moved relative to the fixing screw 31 until the switching element 26 engages with the switching surface 27 . as a result an electric counting signal is generated and supplied to the counting mechanism 21 . due to the counting signal the counting mechanism now knows that a further operation of the dispenser 11 has taken place . a corresponding change as a result of the determined count value , which has now changed , is henceforth displayed . the display is extinguished either at the end of a preset time , e . g . a time interval of 30 seconds to 1 minute , or if the protective cap 18 is again placed on the operating element 14 and consequently there is again a change to the switching state of the protective cap switch 25 . however , there can also be a certain overtravel following the fitting of the protective cap 18 and as a result the display of the lcd display element 23 can appear for a preset time following the fitting of the cap 18 . it can e . g . be a time period of less than 1 minute , e . g . 10 to 30 seconds . the individual time intervals for switching off ( transition of the display to the “ non - activatable ” state ) can also take place in parallel and it is possible for the actual switching off to take place with the termination of the last finishing interval and for switching off to take place with the end of the first finishing interval .	0
in a first embodiment , a method of compensation for the temperature varying relative displacement of adjacent print head segments is provided by the utilization of a digital processing mechanism which adjusts for the overlap between adjacent segments . in a print head covering an a4 page width there may be 10 segments having 9 overlapping portions arranged in a repeating sequence of staggered pairs . initial alignment of segments can be made within 10 microns using techniques well known in the art of monolithic fabrication techniques . the width of a segment for a 6 colour ink arrangement would be approximately 225 microns assuming the nozzles of a segment are arranged on 16 micron centres in a zig - zag pattern longitudinally . in this embodiment , a temperature sensor is placed on each print head segment so as to provide for a measure of the current temperature characteristics of each print head segment . the current temperature measurement can then be utilized to determine the amount of overlap between adjacent print head segments . alternatively , only a single temperature sensor can be used if it can be assumed that the segments of the print head are sufficiently similar to one another in physical characteristics and performance and that the ambient milieu of each pair of overlapped segment is substantially the same . the degree of overlap is then used to provide a mechanism for controlling the half toning between adjacent print head segments . it is assumed that outputting of an image in the instant invention is by means of digital half toning employing any method or technique well known in the art . many different half toning techniques can be utilized and reference is made to the text by ulichney entitled “ digital half toning ” published by mit press . as shown in fig1 adjacent print head segments 2 , 3 overlap in the respective regions 12 , 13 . the overlap region may extend approximately 40 thou (˜ 1 mm .) providing an overlap of 64 nozzles spaced at 16 microns for 1600 dpi resolution . a temperature sensor 16 is placed on each print head segment 2 , 3 so as to provide for a measure of the current temperature characteristics of each print head segment 2 , 3 . the current temperature measurement can then be utilized to determine the amount of overlap between adjacent print head segments . alternatively , fiduciary strips 100 , 101 on each overlapped segment 102 , 103 , as shown in fig7 , may be used to measure the degree of relative displacement of the segments 102 , 103 by an interferometric technique . in the region 10 of the segment 2 the nozzles of this segment are used exclusively for the ejection of ink . similarly in the region 11 of the segment 3 the nozzles of this segment are used exclusively for the ejection of ink . in the overlapping regions 12 , 13 a “ blend ” is provided between the two print head segments 2 , 3 such that along the edge 14 of the print head segment 2 nozzles are used exclusively in the region 12 to print and similarly along the edge 15 , the nozzles of the segment 3 are used almost exclusively for printing . in between , an interpolation , which can be linear or otherwise , is provided between these two extreme positions . hence , as shown in fig2 , when printing a full colour output on a page the area on the side 17 is printed exclusively by the print head segment 10 while the area 18 is printed exclusively by the print head segment 11 ( as illustrated by the black dots ) with the area 19 comprising a blend between the nozzles of the two segments . the printing process utilizes any well known half toning matrix such as disclosed in the aforementioned references . while a known half toning matrix is utilized , the actual print head segment utilized will depend upon the blending ratio provided by the measure of overlap between the overlapping segments . one such method is illustrated in fig3 where a linear interpolation within the overlapped regions is shown . in the region corresponding to the overlapped section 12 at the edge 14 there is 100 % utilization of the nozzles of print head segment 2 , whereas in the equivalent region , edge 7 , of the print head segment 3 there is zero output . as the distance of the overlap region from the line 14 of the segment 2 is increased towards the line 15 of the segment 3 the proportion of utilization of the nozzles of the section 12 is gradually decreased ( linearly ), being zero at edge 9 while the utilization of the nozzles of the section 13 is progressively increased to unity by the time the edge 15 is reached . in a first embodiment , where there is an increased overlap between nozzles , the half toning thresholds utilized are increased in the overlap region . this reduces the number of dots printed in the blend region . conversely , if there is a reduced overlap with the print head segments being spaced apart slightly more than normally acceptable , the dot frequency can be increased by reducing the half toning threshold . an overall general half toning arrangement can be provided as shown in fig4 with a dither matrix 25 outputting a current dither value 26 to a summation means 27 with summation means 27 having another input 28 , an overlap signal , which varies in either a positive or a negative sense depending on the degree of overlap between the adjacent segments . the output value 29 of summation means or adder 27 is compared to the input continuous tone data 32 via a comparator 30 so as to output half tone data 31 . an alternative arrangement allows that the data value 28 can be subtracted from the continuous tone data 29 before dithering is applied producing similar results . this arrangement is shown in fig5 . as shown in fig5 , a halftone data output 52 can be generated by combining the output 42 of dither matrix 40 in an adder 46 with the overlap signal 44 , and then taking the difference of the output 54 of adder 46 and the continuous tone data 48 in subtracter 50 . this is an equivalent arrangement to that of fig4 . through the utilization of an arrangement such as described above with respect to fig3 and 4 , a degree of control of the overlap blending can be provided so as to reduce the production of streak artifacts between adjacent print head segments . as each overlap signal 28 can be multiplied by a calibration factor and added to a calibration offset factor , the degree of accuracy of placement of adjacent print head segments can also be dramatically reduced . hence , adjacent print head segments can be roughly aligned during manufacture with one another . test patterns can then be printed out at known temperatures to determine the degree of overlap between nozzles of adjacent segments . once a degree of overlap has been determined for a particular temperature range a series of corresponding values can be written to a programmable rom storage device so as to provide full offset values on demand which are individually factored to the print head segment overlap . a further embodiment of the invention involves the use of a software solution for reducing the production of artifacts between overlapped segments of the print heads . a full software implementation of a dither matrix including the implementation of an algorithm for adjusting variable overlap between print head segments is attached as appendix a . the program is written in the programming language c . the algorithm may be written in some other code mutatis mutandis within the knowledge of a person skilled in the art . the basis of the algorithm is explained as follows . a dispersed dot stochastic dithering is used to reproduce the continuous tone pixel values using bi - level dots . dispersed dot dithering reproduces high spatial frequency , that is , image detail , almost to the limits of the dot resolution , while simultaneously reproducing lower spatial frequencies to their full intensity depth when spatially integrated by the eye . a stochastic dither matrix is designed to be free of objectionable low frequency patterns when tiled across the page . dot overlap can be modelled using dot gain techniques . dot gain refers to any increase from the ideal intensity of a pattern of dots to the actual intensity produced when the pattern is printed . in ink jet printing , dot gain is caused mainly by ink bleed . bleed is itself a function of the characteristics of the ink and the printing medium . pigmented inks can bleed on the surface but do not diffuse far inside the medium . dye based inks can diffuse along cellulose fibres inside the medium . surface coatings can be used to reduce bleed . because the effect of dot overlap is sensitive to the distribution of the dots in the same way that dot gain is , it is useful to model the ideal dot as perfectly tiling the page with no overlap . while an actual ink jet dot is approximately round and overlaps its neighbours , the ideal dot can be modelled by a square . the ideal and actual dot shapes thus become dot gain parameters . dot gain is an edge effect , that is it is an effect which manifests itself along edges between printed dots and adjacent unprinted areas . dot gain is proportional to the ratio between the edge links of a dot pattern and the area of the dot pattern . two techniques for dealing with dot gain are dispersed dot dithering and clustered dot dithering . in dispersed dot dithering the dot is distributed uniformly over an area , for example for a dot of 50 % intensity a chequer board pattern is used . in clustered dot dithering the dot is represented with a single central “ coloured ” area and an “ uncoloured ” border with the ratio of the area of “ coloured ” to “ uncoloured ” equalling the intensity of the dot to be printed . dispersed dot dithering is therefore more sensitive to dot gain than clustered dot dithering . two adjacent print head segments have a number of overlapping nozzles . in general , there will not be perfect registration between corresponding nozzles in adjacent segments . at a local level there can be a misregistration of plus or minus half the nozzle spacing , that is plus or minus about 8 microns at 1600 dpi . at a higher level , the number of overlapping nozzles can actually vary . the first approach to smoothly blending the output across the overlap bridge and from one segment to the next consists of blending the continuous tone input to the two segments from one to the other across the overlap region . as output proceeds across the overlap region , the second segment receives an increasing proportion of the input continuous tone value and the first segment receives a correspondingly decreasing proportion as described above with respect to fig3 . a linear or higher order interpolation can be used . the dither matrices used to dither the output through the two segments are then registered at the nozzle level . the first approach has two drawbacks . firstly , if the dither threshold at a particular dot location is lower than both segments &# 39 ; interpolated continuous tone values then both segments will produce a dot for that location . since the two dots will overlap , the intensities promised by the two dither matrices will be only partially reproduced , leading to a loss of overall intensity . this can be remedied by ensuring that corresponding nozzles never both produce a dot . this can also be achieved by using the inverse of the dither matrix for alternating segments , or dithering the continuous tone value through a single dither matrix and then assigning the output dot to one or the other nozzle stochastically , according to a probability given by the current interpolation factor . secondly , adjacent dots printed by different segments will overlap again leading to a loss of overall intensity . as shown in fig6 , the value for each overlapped segment is plotted along the horizontal axes 60 , 62 as v a and v b respectively between the values of 0 . 0 and 1 . 0 . the calculated output 66 is plotted with respect to the vertical axis 64 as a function , i a + b , for values ranging from 0 . 0 to 1 . 0 . a contour plane 68 shows the resultant values for i a + b = 0 . 5 . fig6 shows the qualitative shape of the three dimensional function linking the two segments &# 39 ; input continuous tone values v a and v b to the observed output intensity i a + b . for the first approach , an input continuous tone value v and an interpolation factor f together yield v a =( 1 − f ) v and v b = fv . the closer the interpolation factor is to 0 . 5 the greater the difference between the input continuous tone value and the observed output intensity . for v = 1 . 0 , this is illustrated in fig6 by the curve 200 on the vertical v a + v b = 1 . 0 plane . by definition this curve lies on the function surface . fig6 indicates that when any kind of mixing occurs , that is 0 . 0 & lt ; f & lt ; 1 . 0 , the output intensity is attenuated , and to achieve the desired output intensity the sum of the two segments &# 39 ; input values must exceed the desired output value , that is v a + v b & gt ; v . this forms the basis for the algorithm in appendix a . the function shows a linear response when only one segment contributes to the output , that is f = 0 . 0 or f = 1 . 0 . this assumes of course that the dither matrix includes the effects of dot gain . the foregoing description has been limited to specific embodiments of this invention . it will be apparent , however , that variations and modifications may be made to the invention , with the attainment of some or all of the advantages of the invention . for example , it will be appreciated that the invention may be embodied in either hardware or software in a suitably programmed digital data processing system , both of which are readily accomplished by those of ordinary skill in the respective arts . therefore , it is the object of the appended claims to cover all such variations and modifications as come within the true spirit and scope of the invention .	1
fig1 illustrates a knockdown chair c in its assembled state in accordance with the present invention . the assembled chair c includes a frame f and fabric seat and back panels s and b , respectively , which are mounted thereto . generally , the frame f is made up of a series of elongated tubular members which are interconnectable by way of quick release couplings which will be described in details hereinafter . more particularly , the frame f includes two identical vertical front tubular members 10a and 10b and two identical vertical rear tubular members 12a and 12b . the front and rear tubular members 10a , 10b , 12a and 12b are joined at first , second and third horizontal levels 14 , 16 and 18 , respectively , by identical tubular members , as described hereinbelow . the first and second horizontal levels 14 and 16 each includes four tubular members 14a , 14b , 14c and 14d , and 16a , 16b , 16c and 16d , respectively . the third horizontal level 18 includes three tubular members 18a , 18b and 18c . the horizontal tubular members having the suffix &# 34 ; a &# 34 ; or &# 34 ; c &# 34 ; are side members , whereas the horizontal tubular members having the suffix &# 34 ; b &# 34 ; and &# 34 ; d &# 34 ; are respectively rear and front members , as best seen in fig1 . referring to fig1 to 3 , the front vertical tubular members 10a and 10b each includes a respective upper elbow 20a and 20b , a respective pair of horizontal perpendicular middle side arms 22a and 24a and 22b and 24b , and a respective pair of horizontal perpendicular lower side arms 26a and 28a and 26b and 28b . the rear vertical tubular members 12a and 12b each include a respective pair of horizontal perpendicular upper side arms 30a and 32a and 30b and 32b , a respective pair of horizontal perpendicular middle side arms 34a and 36a and 34b and 36b , and a respective pair of horizontal perpendicular lower side arms 38a and 40a and 38b and 40b . each of the above upper front elbows 20a and 20b , upper rear side arms 30a , 30b , 32a and 32b , middle front side arms 22a , 22b , 24a and 24b , middle rear side arms 34a , 34b , 36a and 36b , lower front side arms 26a , 26b , 28a and 28b , and lower rear side arms 38a , 38b , 40a and 40b each project an identical tubular male terminal portion 42 , as described in details hereinafter . identical tubular male terminal portions 42 also project vertically upwards from the top ends of the rear vertical tubular members 12a and 12b , as seen in fig2 and downwards from the lower ends of the front and rear vertical tubular members 10a , 10b , 12a and 12b . as best seen in fig1 the frame f is completed with two upper vertical tubular members 44a and 44b which basically constitute upward extensions of the rear vertical tubular members 12a and 12b , respectively . also , four lower vertical tubular members 46a , 46b , 48a and 48b extend respectively downwards from the front and rear vertical tubular members 10a , 10b , 12a and 12b . these upper and lower vertical tubular members 44a , 44b , 46a , 46b , 48a and 48b are of equal length and each include at one end a tapered tubular female terminal portion slidable over a respective one of the male terminal portions 42 . the horizontal tubular members 14a , 14b , 14c , 14d , 16a , 16b , 16c , 16d , 18a , 18b and 18c are also of equal length but are twice as long as the previous upper and lower tubular members 44a , 44b , 46a , 46b , 48a and 48b . the horizontal tubular members 14a , 14b , 14c , 14d , 16a , 16b , 16c , 16d , 18a , 18b and 18c are each provided at both their ends with a tubular tapered female terminal portion slidable over the male terminal portions 42 . each of the female terminal portions of the tubular members 14a , 14b , 14c , 14d , 16a , 16b , 16c , 16d , 18a , 18b , 18c , 44a , 44b , 46a , 46b , 48a and 48b includes a retractable locking sleeve 66 which constitutes a coupling between each corresponding male and female terminal portions , and which will be described in details hereinbelow . the back panel b defines a pair of sewn end sleeves 50a and 50b which , in the assembled state of the chair c of fig1 are slidably engaged over the upper vertical tubular members 44a and 44b . similarly , the seat panel s also defines a pair of sewn end sleeves 52a and 52b which are slidably engaged on the horizontal tubular members 16b and 16d of the third horizontal level 16 of the frame f . fig2 a , 2 and 3 illustrate various stages of the chair c in its dismantled state . fig2 a shows an underside 54 of the seat panel s provided with four similar pockets 56a , 56b , 56c and 56d which are disposed side by side and which extend between the seat sleeves 52a and 52b at right angles thereto . side edges 58a and 58b of the seat panel s which are parallel to the pockets 56a , 56b , 56c and 56d are provided with complementary cooperating zipper portions 60a and 60b for forming a zipper 60 . now referring to fig2 each one of the four pockets 56a , 56b , 56c and 56d can accommodate a respective one of the front and rear vertical tubular members 10a , 10b , 12a and 12b . also , in the illustrated embodiment , each one of the pockets 56b , 56c and 56d accommodates three tubular members of the eleven horizontal tubular members 14a , 14b , 14c , 14d , 16a , 16b , 16c , 16d , 18a , 18b and 18c , whereas the pocket 56a receives the remaining two horizontal members and also the two upper vertical tubular members 44a and 44b which are disposed coaxially therein . the back panel b is positioned to overlie the seat panel s . as seen in fig3 the seat panel s can be wrapped to form a sleeve or a pouch enclosing the pockets 56a , 56b , 56c and 56d and their respective tubular members and secured in that position by way of the zipper 60 . the remaining four members , that is the four lower vertical tubular members 46a , 46b , 48a and 48b , are aligned two by two and maintained in the middle of the formed sleeve and , more particularly , in the cavity 62 formed between the pockets . the back panel b is also to be contained in the cavity 62 . the pockets 56a , 56b , 56c and 56d although they can be sewn or mounted with buttons or snaps to the seat panel s are detachably mounted thereto in the illustrated embodiment by way of a fastening material 64 such as &# 34 ; velcro &# 34 ;] ( registered trademark ). as best seen in fig1 and 2 , both ends of the horizontal tubular members 14a , 14b , 14c , 14d , 16a , 16b , 16c , 16d , 18a , 18b and 18c and appropriate single ends of short vertical upper and lower tubular members 44a , 44b , 46a , 46b , 48a and 48b define female terminal portions provided with the aforementioned identical disengageable locking sleeves 66 . other ends of the tubular members 44a , 44b , 46a , 46b , 48a and 48b are provided with end caps 68 ( see fig1 and 6 ). each combination of a male terminal portion 42 and a locking sleeve 66 constitutes a quick release coupling for detachably securing the various above tubular members one to the other to form the assembled chair c of fig1 . a typical connection of the male and female terminal portions with a sleeve 66 of , for example , the middle side arm 24b of the front vertical tubular member 10b with the middle horizontal tubular member 16c is illustrated in details in fig4 and 5 . the male terminal portion 42 defines an annular rib 70 . the locking sleeve 66 is disposed around the end of the tubular member 16c which defines a circumferential recess 72 having a radial wall 74 and a sloped wall 76 . the tubular member 16c includes a flange 78 near its end . the locking sleeve 66 includes four identical nose portions 80 which project radially inwardly therefrom . each nose portion 80 has a ( sloped wall 82 and a radial wall 84 . a washer 86 projects radially inwards from the locking sleeve 66 . a coil spring 88 is disposed transversely between the tubular member 16c and the locking sleeve 66 , and longitudinally between the flange 78 and the washer 86 . four identical spring clips 90 are disposed in respective slots 92 defined in the end of the tubular member 16c . each spring clip 90 which has an outward plane surface in abutment with the plane surface of the nose portion 80 is held laterally in place by pairs of spaced apart parallel flanges 94 disposed on each side thereof , as best seen in fig5 . therefore , when the locking sleeve 66 is in its position shown in full lines on fig4 the spring clips 90 remain engaged in the slots 92 by way of the nose portions 80 which prevent any outward movement thereof , whereby the spring clips 90 contact the male terminal portion 42 with the rib 70 thereof preventing the male and female terminal portions from being slidably disengaged . the coil spring 88 biases the locking sleeve 66 in its longitudinally forward locking position . to separate the male and female terminal portions and thus the tubular members 16c and 10b , the locking sleeve 66 is displaced rearward along arrows 96 against the coil spring 88 , thereby allowing the spring clips 90 to displace radially outwards as they slide along the sloped walls 82 of the locking sleeve 66 as shown by arrows 98 and the phantom lines of fig4 . upon reaching the surfaces 100 of the locking sleeve 66 , the spring clips 90 cease to prevent the sliding movement of the rib 70 of the male terminal portion 42 along the inside of the end of the tubular member 16c , whereby the male and female terminal portions can be separated ( see arrow 102 ). it is easily understood from the above that quick release couplings allow for easy assembly and dismantling of the present knockdown chair c . all of the elbows , side arms and couplings are integral to a main tubular member , thereby eliminating any small loose parts . the tubular members can all be enclosed in the pouch or sleeve formed by the seat panel s ( see fig3 ) and in the pockets 66a , 66b , 66c and 66d provided therein . therefore , when the chair c is assembled , there is no separate storage bag to put aside . the above construction provides for a quick assembly , compact and easy storage of a knockdown furniture . this construction is very useful for articles which are not always in use and need to be stored or transported ( e . g . camping furniture , summer furniture ). in a further construction embodying the present invention , but which is not herein illustrated , one of the flexible seat or back panels forms a pouch closed along three of its sides . the pouch can be slid over the appropriate elongated members of the frame which results in the supporting panel having two spaced apart plies . in the dismantled state of the furniture , all of the elongated members and the remaining flexible support panel can be introduced in the flexible panel forming this pouch . other than a chair c , the present invention can be used to produce beds , lawn chairs , wheel chairs , cribs , emergency beds , tables ( in which case the extended fabric panel can be used as a support surface ), etc .	8
in the following detailed description , certain specific terminology will be employed for the sake of clarity and a particular embodiment described in accordance with the requirements of 35 usc 112 , but it is to be understood that the same is not intended to be limiting and should not be so construed inasmuch as the invention is capable of taking many forms and variations within the scope of the appended claims . referring to fig1 and 2 , a prior art torque limiter 10 of the type which the present invention is concerned is shown . one or more of such torque limiters may be installed circumferentially spaced about the axis of a pair of interfit rotary parts 12 and 14 other arrangements of such torque limiters are well known . one interfit rotary part 12 is secured to a drive ( or driven ) member 16 and the other rotary part 14 is secured to a driven ( or drive ) member 18 . a drive ball 20 is normally seated within a detent pocket 22 fixed in rotary member 14 and a bushing 24 fixed within a housing 26 is secured to rotary member 12 . the drive ball 20 creates a rotational connection so that the rotary members 12 and 14 normally rotate together . upon the development of a transmitted torque of a predetermined level , the drive ball 20 begins to ride up the sloping sides of the detent pocket 22 and to thereby push up a plunger 28 which has radiused pocket 21 ( fig1 ) at its lower end in contact with the drive ball 20 . when there is a torque lower than the predetermined level , plunger 28 is urged downwardly by the effect of a stiff spring 36 engaging the underside of the thrust ring 34 and urging it upwardly . the sloping surface 35 acts on balls 30 to force them inwardly against a shoulder 29 on the upper end of the plunger 28 , urging the plunger 28 down and into engagement with drive ball 30 . the spring 36 exerts axial pressure on lower thrust race 34 to urge the locking 30 radially inward to resist outward movement of the small locking balls 30 which are urged radially outwardly by engagement therewith of a rounded shoulder surface 29 on the upper end of the plunger 28 , the drive ball 20 urging the plunger 28 upwardly when the drive ball 20 is transmitting a torque . any axial movement of the plunger 28 is resisted by the constraining effect resisting radially outward movement of the balls 30 exerted by upper thrust race 32 and the lower thrust race 34 being urged together by the preloaded spring 36 applying an axial force to lower thrust race 34 with the sloping surfaces 33 , 35 urging the balls 30 radially inward and countering the outward force exerted by the plunger surface 29 when the drive ball 20 urges the plunger 28 upwardly . an adjusting nut 37 allows setting of the spring preload . if the transmitted torque level reaches a predetermined release value , the spring force described is overcome to allow the locking balls 30 to be moved radially out by the engagement of the plunger shoulder 29 driven up by the drive ball 20 moving the lower race 34 down and thereby allowing the locking balls 30 to move out radially sufficiently to move onto the outer diameter 27 of the plunger 28 . this allows the plunger 28 to move up axially sufficiently to allow the drive ball 20 to move out of the pocket 22 and interrupt the driving connection . at this point , the drive ball 20 has moved up into the interior bore of the bushing . a snap ring 38 then holds the ball 20 up and out of engagement with the detent pocket 22 , allowing interfit parts 12 , 14 to freely rotate , relative each other , supported by rotary bearings 40 ( fig2 ). the torque limiter 10 can be reset by striking the upper end 42 of the plunger 28 with sufficient force in the well know manner . in order to keep grease on the torque limiter rotating wear parts , a grease fitting 44 is normally provided which allows injection of grease into an axial central passage 46 in the plunger 28 which passes down to the top of the drive ball 20 which normally prevents any further grease flow . two ( or more ) pairs of cross passages 48 and 50 branch off from the central plunger passage 46 . the upper pair of passages lubricate the races 32 , 34 and locking balls 30 . the lower pair of feed cross passages 50 reach the bottom of the bushing and theoretically reach the detent pocket 22 and drive ball 20 via a clearance and small grooves . however , little or no grease will reach the lower components as a practical matter due to the slight clearances . grease will only exit the lower end of the passage 46 when the torque limiter 10 has been released by movement of the plunger 28 . additionally , the bearings 40 can only effectively be greased during routine maintenance when the torque limiter is tripped . this is almost impossible to do manually due to very high torque limit settings often used in some applications . since the bearings 40 are typically heavily preloaded and do not rotate while the torque limiter remains locked , heavy wear can result as the grease over time tends to migrate out due to rotation of the assembly and consequently the bearings 40 become dry . referring to fig3 and 4 , a torque limiter 54 according to the invention is shown which has the same basic driving parts as the prior art torque limiter described above . however , the torque limiter 54 has a housing 56 which has a threaded extension 58 which receives a disconnect nut 60 which engages a plunger shroud 66 threaded to the upper end 64 of the plunger 62 . a recess 68 in the plunger shroud 66 receives a grease fitting 70 . an axial central lengthwise grease passage 72 is provided in the plunger 62 , which terminates short of the radiused pocket 73 and the drive ball 74 . instead , there are two cross passages 76 which connect with two pairs of offset longitudinal passages 78 that extend to an annular clearance space 80 adjacent the drive ball 74 . the brushing 81 has a bore 83 ( fig6 ) which slidably receives the lower end of the plunger 62 has two cross passages 84 , each receiving grease from the annular space 80 and direct the grease into the same out through down passages 86 through the bushing 82 so that grease can reach the detent pocket 88 . the cross passages 76 have ends 76 a which extend to the inside diameter of the bushing 82 to provide additional grease flow . thus , the set of grease passages described are able to effectively direct grease to the wearing components without releasing the torque limiter . a second aspect of the invention involves the disconnect nut 60 and plunger shroud 66 . the disconnect nut 60 has a series of wrenching flats 90 ( fig3 ) thereon so that a wrench ( not shown ) can be used to turn the same on the external threads on the housing extension 58 and thereby advance the disconnect nut 60 up as viewed in fig4 . the powerful mechanical advantage exerted by of the threaded engagement of the disconnect nut 60 enables the balls 96 to be forced out until the torque limiter 54 becomes disconnected , even if the torque release level is set to be very high . once released , the bearings 40 can be rotated and greased as a part of a regular maintenance regime . in addition , flow of grease to the torque limiter wear components as described above is enhanced .	5
the compounds of formula ( i ) of the present invention can be prepared by the following steps ( as shown in scheme a or b ), wherein r , r ′, r 1 , r 2 , r 3 , r 4 and r 5 are defined as the above . wherein r , r ′ r 1 , r 2 , r 3 , r 4 and r 5 are defined as the above . more detailed examples are used to illustrate the present invention , and these examples are used to explain the present invention . the examples below , which are given simply by way of illustration , must not be taken to limit the scope of the invention . dcc ( n , n ′- dicyclohexyl carbodimide ) ( 0 . 2 g , 0 . 001 mole ) and dichloromethane ( 5 ml ) were added into a reaction bottle , and the temperature thereof was cooled to 0 - 5 ° c . by ice bath . benzyl carbamidoacetate ( 0 . 42 g , 0 . 002 mole ) was then added and stirred at low temperature for 30 minutes to form acid anhydride and white precipitate of dcu . then 1 - amino anthraquinone ( 0 . 22 g , 0 . 001 mole ) was added at room temperature and stirred overnight . from hplc analysis , it was known that the reaction was complete . the insoluble dcu was removed by filtering and the residue was washed by dichloromethane and acetone . a dark solid was obtained after the filtrate was concentrated through a rotary evaporator . after purified through silica gel chromatography with eluent consisted of n - hexane and ethyl acetate , 0 . 37 g of yellow needlelike crystal ( 75 %) was obtained , 200m 1 h nmr ( cdcl 3 ) δ64 . 2 ( d , 2h ), 5 . 2 ( s , 2h ), 5 . 6 ( b , 1h ), 7 . 2 - 8 . 3 ( m , 12h ), 9 . 1 ( d , 1h ). dcc ( 1 . 03 g , 0 . 005 mole ) was added into a reaction bottle and the bottle was sealed immediately . dcc was dissolved therein . guanidoacetic acid hydrochloride ( 0 . 765 g , 0 . 005 mole ) was then added and stirred to get a precipitate . 1 , 4 - diarino anthraquinone ( 0 . 49 g , 0 . 0025 mole ) was then added and stirred at room temperature for 10 hours . from the hplc analysis , it was known that the product yield was about 91 %. proper amount of dcc was supplemented and stirred until the yield was constant . dma ( 100 ml ) was added into the concentrate for dissolving product , wherein insoluble dcu was removed by filtering . the filtrate was concentrated under reduced pressure at 95 ° c . to remove dma . water ( 400 ml ) was added into the concentrate for dissolving product , wherein insoluble dcu was removed by filtering . acetone ( 100 ml ) was then added to dissolve the residual 1 - amino anthraquinone followed by filtrating . after recrystalizing in methanol and drying under vacuumn at 80 ° c ., 0 . 36 g of red - brown 4 - amino - 1 - guanido acetamidoanthraquinone crystal was obtained , 200m 1 h nmr δ 6 4 . 2 ( s , 2h ), 7 . 2 - 8 . 4 ( m , 10h ), 8 . 7 ( d , 1h ), 12 . 6 ( s , 1h ). dcc ( 1 . 03 g , 0 . 005 mole ) and dma ( 10 ml ) were added into a reaction bottle and stirred until fully dissolving . guanidoacetic acid hydrochloride ( 0 . 765 g , 0 . 005 mole ) was added and stirred to get a precipitate . 1 . 5 - diamino anthraquinone ( 0 . 49 g , 0 . 0025 mole ) was then added and stirred at room temperature for 10 hours . proper amount of dcc was supplemented and stirred until the yield was constant . from the hplc analysis , it was known that the product yield was about 69 %. the solution was concentrated under reduced pressure at 95 ° c . to remove dma . water ( 400 ml ) was added to dissolve the product , and the insoluble dcu was removed by filtering . acetone ( 100 ml ) was then added to dissolve the residual anthraquinone followed by filtrating . after recrystalizing in methanol and drying under vacuumn at 80 ° c ., 0 . 28 g of red - brown 5 - amino - 1 - guanido acetamidoanthraquinone crystal was obtained , 200m 1 h nmr δ 4 . 3 ( s , 2h ), 7 . 2 - 8 . 4 ( m , 10h ), 8 . 9 ( d , 1h ), 12 . 4 ( s , 1h ). dcc ( 1 . 03 g , 0 . 005 mole ) and dma ( 10 ml ) were added into a reaction bottle and stirred until fuilly dissolving . guanidoacetic acid hydrochloride ( 0 . 765 g 0 . 005 mole ) was added and stirred to get a precipitate . 2 - amino anthraquinone ( 0 . 45 g , 0 . 0025 mole ) was then added and stirred at room temperature for 10 hours . from the hplc analysis , it was known that the product yield was about 94 . 5 %. dma ( 100 ml ) was added to dissolve the product , and the insoluble dcu was removed by filtering . acetone ( 100 ml ) was then added to dissolve the residual anthraquinone . after recrystalizing in methanol and drying under vacuumn at 80 ° c ., 0 . 4 g of red - brown 2 - guanido acetamidoanthraquinone crystal was obtained , 200m 1 h nmr δ ( d 6 - dmso ), 4 . 2 ( s , 2h ), 5 . 6 ( d , 1h ), 7 . 2 - 8 . 3 ( m , 11h ), 8 . 5 ( s , 1h ). cl example 5 dcc ( 0 . 2 g , 0 . 001 mole ) and dichloromethane ( 5 ml ) were added into a reaction bottle , and the temperature thereof was cooled to 0 - 5 ° c . by ice bath . benzyl carbamidoacetate ( 0 . 42 g , 0 . 002 mole ) was then added and stirred at low temperature . for 30 minutes to form acid anhydride and white precipitate of dcu . then 1 , 4 - diamino anthraquinone ( 0 . 23 g , 0 . 001 mole ) was added at room temperature and stirred overnight . from hplc analysis , it was known that the reaction was complete . the insoluble dcu was removed by filtering . the filtrate was washed by dichloromethane and acetone . a dark solid was obtained as after filtrate was concentrated through a rotary evaporator . after purified through silica gel chromatography with eluent consisted of n - hexane and ethyl acetate , 0 . 37 g of yellow needlelike crystal ( 86 %) was obtained , 200m 1 h nmr δ ( cdcl 3 ) 4 . 1 ( d , 2h ), 5 . 3 ( s , 2h ), 7 . 3 - 8 . 5 ( m , 13h ), 9 . 1 ( d , 1h ), 13 . 1 ( s , 1h ). dcc ( 1 . 03 g , 0 . 005 mole ) was added into a reaction bottle and the bottle was sealed immediately . dma ( 10 ml ) was dissolved therein . guanidoacetic acid hydrochloride ( 0 . 765 g , 0 . 005 mole ) was then added and stirred to get a precipitate . 1 , 2 - diamino anthraquinone ( 0 . 49 g , 0 . 0025 mole ) was then added and stirred at room temperature for 10 hours . from the hplc analysis , it was known that the product yield was about 85 %. proper amount of dcc was supplemented and stirred until the yield was constant . the solution was concentrated under reduced pressure at 95 ° c . to remove dma . water ( 300 ml ) was added into the concentrate for dissolving product , wherein insoluble dcu was removed by filtering . the water was then removed under reduced pressure . by recrystalizing in methanol and drying under vacuumn at 80 ° c ., 0 . 06 g of red - brown 1 - amino - 2 - guanido acetamidoanthraquinone crystal was obtained , 200m 1 h nmr δ ( d 6 - dmso ), 4 . 2 ( s , 2h ), 7 . 2 - 8 . 3 ( m , 9h ), 10 ( b , 1h ). dcc ( 1 . 03 g , 0 . 005 mole ) and dma ( 10 ml ) were added into a reaction bottle and stirred until fuilly dissolving . guanidoacetic acid hydrochloride ( 0 . 765 g , 0 . 005 mole ) was added and stirred to get a precipitate . 2 , 6 - diamino anthraquinone ( 0 . 49 g , 0 . 0025 mole ) was then added and stirred at room temperature for 10 hours . from the hplc analysis . it was known that the product yield was about 87 %. proper amount of dcc was added and stirred until the yield is constant . dma was removed under reduced pressure at 95 ° c . water ( 400 ml ) was added to dissolve the product , and the insoluble dcu was removed by filtering . after removing water by evaporizing , recrystalizing in methanol , and drying under vacuumn at 80 ° c ., 0 . 1 g of dark red 6 - amino - 2 - guanido acetamidoanthraquinone crystal was obtained . dcc ( 2 . 06 g , 0 . 01 mole ) and dma ( 10 ml ) were added into a reaction bottle and stirred until fully dissolving . guanido acetic acid hydrochloride ( 1 . 53 g , 0 . 01 mole ) was added and stirred to get a precipitate . 2 , 6 - diamino anthraquinone ( 0 . 49 g , 0 . 0025 mole ) was then added and stirred at room temperature for 10 hours . proper amount of dcc was supplemented and stirred until the product yield was constant known from the hplc analysis . then dma was removed under reduced pressure at 95 ° c . water ( 400 ml ) was added to dissolve the product , and insoluble dcu was removed by filtering . after recrystalizing in methanol and drying under vacuum at 80 ° c ., 0 . 1 g of dark red 2 , 6 - di ( guanidino acetamido ) anthraquinone crystal was obtained . dcc ( 0 . 2 g , 0 . 001 mole ) and dichloromethane ( 5 ml ) were added into a reaction bottle , and the temperature thereof was reduced to 0 - 5 ° c . by ice bath . benzyl carbamidoacetate ( 0 . 42 g , 0 . 002 mole ) was then added and stirred at low temperature for 30 minutes to form acid anhydride and white dcu precipitate . 2 - amino anthraquinone ( 0 . 22 g , 0 . 001 mole ) was added at room temperature and stirred overnight . from the hplc analysis , it was known that the reaction was complete . the insoluble dcu was removed by filtrating , and the residue was washed by dichloromethane and acetone . the filtrate was concentrated by rotary evaporator to get dark solid . after purified by silica gel chromatography with eluent consisted of n - hexane and ethyl acetate , 0 . 27 g of yellow - brown neddlelike crystal was obtained ( 65 %), 200m 1 h nmr δ ( cdcl 3 ) 4 . 1 ( d , 2h ), 5 . 2 ( s , 2h ), 6 . 5 ( b , 1h ), 7 . 2 - 8 . 3 ( m , 12h ), 10 . 2 ( s , 1h ). dcc ( 2 . 06 g , 0 . 01 mole ) and dma ( 10 ml ) were added into a reaction bottle and stirred until fully dissolving . guanidoacetic acid hydrochloride ( 1 . 53 g , 0 . 01 mole ) was added and stirred to get a precipitate . 1 , 2 - diamino anthraquinone ( 0 . 49 g , 0 . 0025 mole ) was then added and stirred at room temperature for 10 hours . proper amount of dcc was supplemented and stirred until the yield was constant known from hplc analysis . dma was then removed under reduced pressure at 95 ° c . water ( 400 ml ) was added to dissolve product , and insoluble dcu was removed by filtering . after recrystalizing in methanol and dried under vacuum at 80 ° c ., 0 . 06 g of red - brown 1 , 2 - di ( guanidino acetamido ) anthraquinone crystal was obtained . the compounds were further screened on 60 human cancer cell lines by developmental therapeutics program human tumor cell line screen set up by the national cancer institute of the u . s . a . the screening procedures are described briefly hereinafter . cell suspensions that were diluted according to the particular cell type and the expected target cell density ( 5000 - 40 , 000 cells per well based on cell growth characteristics ) were added by pipet ( 100 μl ) into 96 - well microtiterplates . inoculates were allowed a preincubation period of 24 hours at 37 ° c . for stabilization . dilutions at twice the intended test concentration were added in 100 μl aliquots to the microtiter plate wells at time zero . usually , test compounds were evaluated at five 10 - fold dilutions . in routine testing , the highest well concentration was 10 − 4 m , but for the standard agents the highest well concentration used depended on the agent . incubations lasted for 48 hours in 5 % co 2 atmosphere and 100 % humidity . the cells were assayed by using the sulforhodamine b assay . a plate reader was used to read the optical densities , and a microcomputer processed the optical densities into the special concentration parameters . the results of these tests with representative compounds of the present invention appear in table 1 and 2 according to table 1 , the compounds of formula ( i ) in the present invention are medically effective to many human cancer cell lines and show significant cytotoxic activity at lower concentrations . particularly , the compounds of examples 2 , 3 , 4 , 6 , 7 , 8 and 10 with a guanido group were more effective to most cancer cell lines . therefore , the compounds of formula ( i ) in the present invention indeed had cytotoxic activity to human cancer cell lines . furthermore , according to table 2 , the compounds of formula ( i ) with guanido groups such as compounds of example 2 , 3 , 4 , 6 , 7 and 10 show excellent effect on activity inhibition at the concentration of 200 μg / ml , and ic 50 thereof were quite low . as for the compounds of example 1 , 5 and 9 with benzylureido group , they also show anti - virus ability but not so strong as the others . the novel formula ( i ) compound of the present invention is effective for inhibiting human cancer cells . the pharmaceutical compositions contain the formula ( i ) compound and a pharmaceutically acceptable carrier is potentially effective for curing lung cancer , leukemia or brain cancer or aids . from the foregoing description , one skilled in the art can easily ascertain the essential characteristics of this invention , and without departing from the scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions . thus , other embodiments are also within the claims .	0
viewing fig1 and 3 jointly , an automatic lance changeover device in accordance with the present invention is shown . the lance changeover device includes a lance carriage 10 ( indicated by thin solid lines ). rigidly fixed to carriage 10 is a coupling head 4 into which , in the exemplary embodiment illustrated , a primary oxygen line 6 , a secondary oxygen line 8 and a cooling water line 9 discharge . the cooling water is discharged via a line 12 . the automatic lance changeover device has two identical hook actuating mechanisms 14 , 14 &# 39 ; attached on each side of coupling head 4 . of these , there can be seen in fig1 receiving hooks 16 , 16 &# 39 ; ( 16 obscured by 16 &# 39 ;) on which lances ( not shown ) are suspended by means of supporting pins . a drive motor 18 includes a downstream step - down gear 20 which in each case drives vertical shaft 22 , 22 &# 39 ;. above each hook 16 , 16 &# 39 ; and , for each hook , a connecting rod 24 , 24 &# 39 ; ( 24 not visible in fig1 ) is pivotably articulated by its upper end 26 , 26 &# 39 ; to coupling head 4 and by its lower end 28 , 28 &# 39 ; ( both rotatably and eccentrically by means of an eccentric pin 29 , 29 &# 39 ;) to bearing pin 30 , 30 having an axis of rotation 31 of hook 16 , 16 &# 39 ;, which is mounted for fast rotation on this bearing pin . each of shafts 22 , 22 &# 39 ; drives a lifting spindle system 43 which is described in detail below with reference to fig2 and by means of which a vertical relative movement with respect to coupling head 4 and lance carriage 10 can be imparted to the hooks 16 , 16 &# 39 ;. it can be clearly seen in fig1 that , when supporting pin 30 &# 39 ; is displaced downwards together with hook 16 &# 39 ; relative to the coupling head 4 , connecting rod 24 &# 39 ; imparts an anticlockwise pivoting movement to hook 16 &# 39 ;. this pivoting movement is limited by a limit switch 32 which stops drive motor 18 . when hook 16 &# 39 ; is upwardly displaced , it naturally pivots in the opposite direction and finally returns to the position shown in fig1 . these movements take place synchronously for both hooks 16 , 16 &# 39 ;. details of the two identical hook actuating mechanisms 14 , 14 &# 39 ; will now be described in greater detail for both hooks 16 , 16 &# 39 ;. referring to fig2 bearing pin 30 of hook 16 is rotatably mounted on a bifurcated double eye 34 ( eye 34 &# 39 ; for hook 16 &# 39 ;), which eyes are welded on each side of central axis 0 of coupling head 4 to a vertically displaceable supporting ring 36 . for the purpose of vertical displacement , this supporting ring 36 has a conical - abutment surface 74 for a correspondingly contoured counter - abutment surface 79 , 80 on the upper part 78 of lance 77 ( fig3 a ) for introducing lance 77 into the coupling head 4 . the vertical or axial displacement of ring 36 is accomplished by means of a lifting spindle system 43 which is well known per se . this is formed by an external thread 42 on the lower end of shaft 22 and by a corresponding internal thread 44 on an essentially cylindrical thrust piece 46 . thrust piece 46 must be secured against rotation . in the drawing , this is accomplished by a locking ring 48 which interacts with a flat portion 50 on thrust piece 46 and is fixed for rapid rotation on ring 36 . screw connection 52 between the lower end of the thrust piece 46 and ring 36 is thereby secured at the same time . shaft 22 together with all the parts which adjoin it towards the bottom , such as lifting spindle system 43 , supporting ring 36 , supporting eye 34 and the associated hook 16 , are supported by a tapered roller bearing 54 to define an angular bearing . in order to reduce the axial play of the hook actuating mechanism 14 to a minimum , angular bearing 54 is axially preloaded . as can be seen from fig2 this is achieved by means of a ball bearing 56 preloaded vertically downwards , the preloading being produced by a bearing block 58 for ball bearing 56 , which can be pressed with any desired force against bearing 56 by means of stud bolts 60 and interposed annular springs 62 . a very important feature of hook actuating mechanism 14 is a load cell 64 by means of which the force acting on hook 16 can be continuously measured , the measurement values displayed also including of course the dead weight of the system as well as the above mentioned preloading of the bearing ; these factors can of course be taken into account by corresponding calibration at zero load . the actual purpose of load cell 46 will emerge from the description of fig3 a to 3g given below . two further important features of the present invention are to be found on connecting rod 24 . an upper clearance 66 can be seen between wrist pin 68 for the upper end 26 of connecting rod 24 and its associated bore 70 . this clearance 66 can be obtained , for example , simply by making the bore larger by an appropriate amount than the diameter of pin 68 ( see fig3 a to 3g ) or by making this &# 34 ; bore &# 34 ; as an elongated hole . it can furthermore be seen from fig2 that connecting rod 24 comprises two parts 24a , 24b , inserted one in the other , between which there acts a compression spring 72 . the purpose of these two features of the invention is likewise explained in the description of fig3 a to 3b . it will be appreciated that the preceding statements with respect to the hook actuating mechanism 14 also apply in analogous fashion to the identical mechanism 14 &# 39 ;. attention is also drawn to the design of the coupling surfaces for the channel transition between coupling head 4 and the upper part 78 of the lance ( fig3 a ) as flat surfaces 74 , 80 which are perforated by the various channels 76 . it will be appreciated that sealing may be provided between these channels by , for example , o - rings ( not shown ). fig3 a to 3g show the various sequences gone through during the attachment of a new lance to coupling head 4 and to the lance carriage 10 ( this carriage itself is not indicated in fig3 a to 3g ). in fig3 a , a new lance 77 is brought into a first position in front of coupling head 4 by means of a lance transfer car , for example of the type described in u . s . pat . no . 4 , 533 , 125 described at the outset on which a bifurcated , pivotable double carrying lever 82 is provided on which lance 77 is suspended by means of two transfer supporting pins 84 , 84 &# 39 ; the transfer supporting pins 84 , 84 &# 39 ; are located on an axially displaceable sleeve 86 which during lance transfer and during the raising of lance 77 presses against a fixed stop 88 on the lance itself . in fig3 a , hooks 16 , 16 &# 39 ; are in the opened position , this being achieved , as explained above , by lowering ring 36 relative to coupling head 4 by means of hook actuating mechanisms 14 , 14 &# 39 ; ( see fig2 ). since hooks 16 , 16 &# 39 ; move in synchronous fashion , only those of hook 16 &# 39 ; and those of connecting rod 24 &# 39 ; associated with it will be described below for the sake of simplicity . connecting rod 24 &# 39 ;, which comprises parts 24a &# 39 ; and 24b &# 39 ;, which can be displaced to a limited extent one within the other , is at its maximum length in fig3 a . by virtue of the lowering of the ring 36 , the radial play mentioned between wrist pin 68 &# 39 ; and the upper bore of the connecting rod manifests itself here as lower clearance 90 ( corresponding to the upper clearance 66 in fig2 ). in fig3 b , lance 77 is brought into a second position by a combined pivoting and translational movement of double carrying lever 82 ( as described in greater detail in u . s . pat . no . 4 , 533 , 125 ,) under coupling head 4 ; axis 0 of the coupling head being in alignment with axis q of the lance . simultaneously therewith , lance 77 has become inserted into a stabilizing cradle 92 provided on the lance carriage ( not shown ). in fig3 c , double carrying lever 82 has maintained its position but lance carriage 82 , together with coupling head 4 has been lowered by a certain amount , to an extent such that there is still a certain predetermined gap of , for example , 20 mm between the two flat coupling surfaces 74 ( see also fig2 ) and 80 . in fig3 d , the lance carriage , with coupling head 4 , has maintained its position while lance 77 has been raised to define a gap of , for example , 20 mm by means of double carrying lever 82 . the two coupling surfaces 74 and 80 thereby come into sealing contact and the conical surfaces 41 ( see fig2 ) and 79 on coupling head 4 and on the upper part 78 of the lance respectively likewise come to lie against on another . in this position of lance 77 , its head 78 should now be firmly locked to coupling head 4 . for this purpose , ring 36 is displaced upwards relative to coupling head 4 by means of the hook actuating mechanisms 14 , 14 &# 39 ;, as is thereby also bearing pin 30 &# 39 ; of hook 16 &# 39 ;. clearance 90 below upper wrist pin 68 &# 39 ; of the connecting rod thereby disappears in a first phase so that in a second phase , as ring 36 continues to be raised , connecting rod 24 &# 39 ; from now on presses against eccentric bolt 29 &# 39 ;, principally with the force of the compression spring 72 &# 39 ; ( not shown , but see in this connection spring 72 in fig2 ) associated with the lever , hook 16 &# 39 ; thereby pivoting clockwise about and surrounding the supporting pin 96 &# 39 ;. as far as the lance coupling operation shown in fig3 a to 3g is concerned , the task of connecting rod 24 &# 39 ; has thus been fulfilled . as ring 36 is raised further , in a third phase , hook 16 &# 39 ; can no longer execute a pivoting movement since it now rests against pin 96 &# 39 ; with the result that during this further raising of ring 36 and hence of hook 16 &# 39 ;, the latter presses the upper part 78 of the lance with great force against coupling head 4 . this contact pressure is given an exactly predetermined value , upon the reaching of which the load cells ( see also in this connection , load cell 64 in fig2 ) of hook actuating mechanisms 14 , 14 &# 39 ; stop drive motor 18 ( fig1 ) of the latter . this end position is illustrated in fig3 e . on comparing fig3 d and 3e , it can be seen that ring 36 in fig3 e occupies a higher position relative to coupling head 4 than in fig3 d . it is during this relative shift of ring 36 with respect to head 4 that the three phases described above occur . in fig3 e , it can furthermore be seen that clearance 90 at underside of pin 68 &# 39 ; ( fig3 d ), which disappeared in the first phase described above , has now reappeared as clearance 90 &# 39 ; above this pin 68 &# 39 ;. if therefore , connecting rods 24 , 24 &# 39 ; were designed as rigid , one - piece elements instead of part connecting rods displaceable one within the other and having an interposed compression spring ( see also in this connection 24 , 24a , 24b , 72 in fig2 ), a rigid connecting rod of this kind might experience an excessive compression load and be bent . fig3 f shows the additional anchoring of lance 77 at stabilizing cradle 92 provided on lance carriage 10 ( fig1 ), which is not shown . for this purpose , carriage 10 is displaced upwards with coupling head 4 of lance 77 while double carrying arm 28 with axially displaceable sleeve 86 remains in the same position . in the end phase of this lance movement , outwardly conical upper part 98 of stabilizing cradle 92 pushes into inwardly conical lower part 100 ( fig3 e ) of the sleeve 86 ; lance 77 is then rigidly connected to carriage 10 , both by the coupling of lance head 78 at coupling head 4 and on the other hand by the interaction of sleeve 86 on the lance with cradle 92 on the carriage . double carrying arm 82 of the lance transfer car can thereupon be released . this operation is illustrated in fig3 g . the removal of a worn - out lance 77 is of course effected in analogous fashion and with the order of sequential movements shown in fig3 a to 3g reversed . a relevant position in this context corresponds to the position in fig3 e , from which , when lance 77 is removed , hook 16 &# 39 ; must release supporting pin 96 &# 39 ;. to make it possible for hook 16 &# 39 ; to be pivoted around in the counterclockwise direction at all , it must first of all , with the upper part 78 of lance 77 remaining in the same position , be initially displaced downward without a pivoting movement . this is accomplished by the lowering of ring 36 by means of hook actuating mechanisms 14 , 14 &# 39 ;. in a first phase of this procedure , hook 16 does not execute a pivoting movement since , for as long as a clearance 90 &# 39 ; is present , connecting rod 24 &# 39 ; cannot exert any force on eccentric bolt 29 &# 39 ; on hook supporting pin 30 &# 39 ;. this clearance 90 &# 39 ; is dimensioned such that when , during the lowering of ring 36 , it has completely disappeared ( and appears as clearance 90 , fig3 d ), hook 16 &# 39 ; has released supporting pin 96 &# 39 ; to such an extent that a pivoting movement has been completed in fig3 d . the purpose of the presence of such a clearance 90 or 90 &# 39 ; ( or 66 in fig2 ) has thus been explained . while preferred embodiments have been shown and described , various modifications and substitutions may be made there to without departing from the spirit and scope of the invention . accordingly , it is to be understood that the present invention has been described by way of illustrations and not limitation .	2
example 1 below demonstrates the prior art and details the neuroprotective properties of cbd in two different models . it is demonstrated that the cbd enables repair of brain tissue after an hi injury . example 2 demonstrates the synergistic neuroprotective effect of cbd with therapeutic hypothermia . a piglet model of hi was used as described in ( alvarez et al . 2008 ). briefly , an hi insult is induced in anesthetized 1 - 3 day - old piglets by occluding both carotid arteries and decreasing inspired oxygen from 21 to 10 % for 30 min . thirty minutes after the recovery of hi the test compound was administered via the i . v . route . the test compounds were : cbd ( 1 mg / kg ) plus am630 which is a cb2 antagonist ( 1 mg / kg ); cbd ( 1 mg / kg ) plus way100635 which is a 5ht1a antagonist ( 0 . 1 mg / kg ); or cbd ( 1 mg / kg ) plus caffeine which is a non - specific adenosine receptor antagonist ( 10 mg / kg ). hemodynamic parameters ( cardiac output , blood pressure , heart rate and extravascular lung water content ), temperature , respiratory parameters ( lung compliance , airway resistance , oxygenation index ) were recorded for 6 hours from the end of hi . blood samples were obtained hourly and urine was collected . brain activity was recorded by amplitude - integrated eeg . at the end of the experiment , piglets are euthanized and the brain removed ; one hemisphere was immediately frozen and stored at − 80 ° c . whereas the other one was preserved in 4 % paraformaldehide . a sample of frozen brain was obtained to perform a proton magnetic resonance spectroscopy ( h +- mrs ). similarly managed piglets but without hi served as controls . blood samples from cbd - treated piglets were used to determine serum cbd concentration . a rat model of hi was used as described by ( fernández - lópez et al ., 2007 ). briefly , an hi insult is induced in 7 - 10 day - old wistar rats by electro - coagulating the left carotid artery under anaesthesia following by the exposure to 10 % oxygen for 120 min . after the end of hi , pups were treated with 0 . 1 ml s . c . of vehicle or cbd ( 1 mg / kg ) in a single dose . sham operated pups without hypoxia served as controls , and were treated with vehicle or cbd as indicated . the pups were then returned to their dams . at day 35 rats underwent neurobehavioral tests : rotarod ( to test coordination ), cylinder ( to test unilateral deficits ) and novel object preference ( to test memory impairments ). rats were then euthanized and the brain removed and stored in 4 % paraformaldehide . magnetic resonance imaging was performed on the brains to evaluate the damaged area . in some rats , mri was performed 7 days after hi . fig1 a ) and b ) shows the brain tissue obtained 6 h after the end of hypoxia - ischemia ( hi ). fig1 a ) compares nissi staining of brain slices from sham piglets to those exposed to hi and treated with vehicle or cbd 1 mg / kg i . v ., alone or with the cb2 antagonist am630 ( am ), the 5ht1 a antagonist way100630 ( way ) or the adenosine antagonist caffeine ( caf ). as can be seen cbd reduces the percentage of necrotic tissue in both the cortex and the hippocampus . the cbd - induced reduction of neuronal death is blunted by either am or way , but not by caffeine . fig1 b ) shows the concentration of interleukin 1 in brain tissue determined by microarrays . again cbd reduces the production of il - 1 , which is blunted by am but not by way or caffeine . fig2 demonstrate the magnetic resonance imaging ( mri ) of the rat brains , these revealed that the volume of lesion was similar in hi + veh and hi + cbd 7 days after hi , suggesting that the severity of brain damage was similarly strong in both groups . one month later ( p37 ), the brain volume remained similar in hi + veh but was significantly reduced by cbd . fig3 demonstrates the protective effect of cbd included not only the volume of lesion but also the neurobehavioral performance of the rat . cbd administration led to the normalization of motor ( cylinder rear test ), coordination ( rotarod ) and memory ( novel object recognition ) tests , whereas the untreated rats performed poorly in the neurobehavioral tests . the piglet model showed that the cbd was able to reduce the amount of necrotic areas in the brain caused by hi . the rat model showed that cbd is neuroprotective and in addition to this effect a reduction of brain damage was observed after a month . the cannabinoid cbd is stimulating neuro - repair . synergistic administration of cannabidiol ( cbd ) with therapeutic hypothermia following hypdxic - ischemica ( hi ) sedated and ventilated piglets ( 1 - 2 day - old ) underwent hi brain damage ( hypoxia — fio2 10 %+ bilateral carotid artery compression for 30 min ). normothermic ( nt ) piglets were maintained at 37 - 38 ° c . using a warmed air blanket . hypothermic ( ht ) piglets were cooled by a cool water mattress to 33 - 34 ° c . thirty min after hi piglets received via the i . v . route either vehicle ( veh ) or cbd ( 1 mg / kg ). hi brains were obtained for histological studies quantifying the number of neurons ( nissi ), astrocytes ( gfap ) and microglial cells ( mgc ) ( iba - 1 ) in parietal cortex 6 hours after hi injury . by dividing the area percentage of gfap - or iba - 1 - immunoreactive processes and cell bodies ( imagej ) by the number of cells , a mean size of astrocytes or mgc was obtained . similarly studied animals without hi insult served as controls ( sham , shm ). neuronal protection was found to be best in the cbd plus hypothermia treated animals , ( p & lt ; 0 . 05 ). cbd prevented the hi - induced reduction in the number of astrocytes , particularly in the hypothermia treated animals . cbd also enhanced astrocyte activity ( increased processes equals an increased mean size ), particularly in cbd plus hypothermia . hypothermic treatment reduced the number of microglial cells , with no differences between the vehicle treated animals and those treated with cbd . table 2 . 1 demonstrates the mean size of the microglial cells after hi injury as can be seen from the table above the microglial cells were activated after hi , increasing their size , this is demonstrated in the normothermic plus vehicle treated animals where the size of pixels increased from 102 to 134 pixels a rise of 32 pixels . treatment with cbd and hypothermia produced the smallest increase 164 to 176 pixels a rise of just 12 pixels , compared to cbd alone ( 102 to 127 pixels , a rise of 25 pixels ) and hypothermia alone ( 164 to 219 pixels , a rise of 55 pixels ) table 2 . 2 below details the percentage of necrotic neurons found in the cortex of the test animals . as can be seen treatment with a combination of hypothermia and cbd produced the lowest percentage of necrotic neurons ( 4 . 5 %) compared to hypothermia alone ( 13 . 2 %) and treatment with cbd alone ( 8 . 4 %). cbd administration after hi protects neurons and astrocytes and modulates microglial activation . moreover cbd is slightly more effective than hypothermia , but when both therapies are used in combination statistically significant neuroprotective effects occur . this synergy provides a useful treatment option in newborns suffering from nhie . in addition such treatments could be used effectively in the treatment of other human patients suffering from hypoxic ischemic events or diseases such as stroke or cardiac arrest . cilio and ferriero , synergistic neuroprotective therapies with hypothermia , semin fetal neonatal med . october 2010 ; 15 ( 5 ): 293 - 298 .	0
refer now to fig3 - 5 , there is shown an embodiment of the bond pad structure of this invention . fig3 shows a cross section view of the bond pad structure of this embodiment . as shown in fig3 a first metal pad 34 , a second metal pad 32 , and a third metal pad 30 are formed in a dielectric . a first number , between about 70 and 110 , of first via plugs 38 are formed between the first metal pad 34 and the second metal pad 32 . a second number , between about 85 and 135 , of second via plugs 36 are formed between the second metal pad 32 and the third metal pad 30 . the first number of first via plugs 38 are shown as dashed lines in fig3 since the first via plugs are not in the same plane as the second via plugs 36 and are covered by dielectric material 44 . the third metal pad 30 is formed from a material such as alcu / tin , has a thickness of between about 6400 and 10 , 000 angstroms , a length of between about 80 and 120 microns , and a width of between about 80 and 120 microns . the second metal pad 32 is formed from a material such as alcu / tin , has a thickness of between about 4000 and 7000 angstroms , a length of between about 80 and 120 microns , and a width of between about 80 and 120 microns . the first metal pad 34 is formed from a material such as alcu / tin , has a thickness of between about 4000 and 7000 angstroms , a length of between about 80 and 120 microns , and a width of between about 80 and 120 microns . the second via plugs 36 are formed of a material such as tungsten , have a square cross section of between about 0 . 4 and 0 . 8 microns by between about 0 . 4 and 0 . 8 microns , and have a length of between about 0 . 4 and 0 . 8 microns . the first via plugs 38 are formed of a material such as tungsten , have a square cross section of between about 0 . 4 and 0 . 8 microns by between about 0 . 4 and 0 . 8 microns , and have a length of between about 0 . 4 and 0 . 8 microns . the first metal pad 34 is formed on a first dielectric layer 40 . a second dielectric layer 44 is formed over the first metal pad 34 between the first metal pad 34 and the second metal pad 32 and has a thickness of between about 6000 and 10 , 000 angstroms . the second metal pad 32 is formed on the second dielectric layer 44 . the first via plugs 38 are formed in the second dielectric layer 44 and make contact with the first metal pad 34 and the second metal pad 32 . a third dielectric layer 48 having a thickness of between about 6000 and 10 , 000 angstroms is formed between the second metal pad 32 and the third metal pad 30 . the third metal pad 30 is formed on the third dielectric layer 48 . a fourth dielectric layer 52 having a thickness of between about 8000 and 12 , 000 angstroms is formed on the third dielectric layer 48 after the formation of the third metal pad 30 so that the fourth dielectric layer surrounds and overlaps the edges of the third metal pad 30 . the second via plugs 36 are formed in the third dielectric layer 48 and make contact with the second metal pad 32 and the third metal pad 30 . fig3 shows a test fixture 20 bonded to the first metal pad 30 . either tensile forces 22 or shear forces 24 can be applied to the test fixture 20 . the first , second , third , and fourth dielectric layers are formed of a material such as silicon dioxide formed using plasma enhanced deposition of tetraethyl orthosilicate . fig4 shows a plan view of the bond pad structure along the line 4 - 4 &# 39 ; of fig3 . fig4 shows the second via plugs 36 formed in the third dielectric layer 48 . the second metal pad 32 is shown using a dashed line since it is covered by the third dielectric layer 48 . the second via plugs 36 are square having a width of between about 0 . 6 and 0 . 8 microns . the second via plugs 36 are arranged in a diamond shape when compared to the second metal pad 32 . the periphery of the first via plugs forms a square rotated 45 ° with respect to the second metal pad 32 . the first metal pad , second metal pad , and third metal pad are squares having the same orientation . fig5 shows a plan view of the bond pad structure along the line 5 - 5 &# 39 ; of fig3 . fig5 shows the first via plugs 38 formed in the second dielectric layer 44 . the first metal pad 34 is shown using a dashed line since it is covered by the second dielectric layer 44 . the first via plugs 38 are square having a width of between about 0 . 6 and 0 . 8 microns . the first via plugs 38 are arranged as a diamond shape when compared to the first metal pad 34 . the periphery of the first via plugs forms a square rotated 45 ° with respect to the first metal pad 34 . the first metal pad , second metal pad , and third metal pad are squares having the same orientation . the second via plugs 36 are not located directly above the first via plugs 38 , see fig3 but are located directly over the spaces between the first via plugs 38 . this arrangement of three metal pads , first via plug array , and second via plug array provides improved strength and reliability for the bond pad . as shown in fig3 a test fixture 20 can be bonded to the third metal pad 30 . either tensile forces 22 or shear forces 24 can be applied to the test fixture 20 . for the bond pad described in this embodiment 0 . 01 % of the bond pads fail with tensile forces up to 5 grams and 0 . 1 % of the bond pads fail with shear forces up to 35 grams . almost none of these failures are due to bond pad peeling . refer now to fig3 there is shown an embodiment of a method of forming the bond pad structure of this invention . a first dielectric layer 40 having a thickness of between about 8000 and 12 , 000 angstroms is formed of a material such as boron / phosphorus doped silicon dioxide using deposition of tetraethyl orthosilicate . a first metal pad 34 , formed of a material such as alcu / tin having a length of between about 80 and 120 microns , a width of between about 80 and 120 microns , and a thickness of between about 4000 and 7000 angstroms , is formed on the first dielectric layer 40 . a second dielectric layer 44 having a thickness of between about 8000 and 10 , 000 angstroms is formed of a material such as silicon dioxide using plasma enhanced deposition of tetraethyl orthosilicate on the first dielectric layer 40 covering the first metal pad 34 . openings for the first via plugs 38 , having a square cross section of between about 0 . 4 and 0 . 8 microns by between about 0 . 4 and 0 . 8 microns , are formed in the second dielectric layer 44 and filled with a metal such as tungsten thereby forming the first via plugs 38 . a second metal pad 32 , formed of a material such as alcu / tin having a length of between about 80 and 120 microns , a width of between about 80 and 120 microns , and a thickness of between about 4000 and 7000 angstroms , is formed on the second dielectric layer 44 forming contact with the first via plugs 38 . a third dielectric layer 48 having a thickness of between about 6000 and 10 , 000 angstroms is formed of a material such as silicon dioxide using plasma enhanced deposition of tetraethyl orthosilicate on the second dielectric layer 44 covering the second metal pad 32 . openings for the second via plugs 36 , having a square cross section of between about 0 . 4 and 0 . 8 microns by between about 0 . 4 and 0 . 8 microns , are formed in the third dielectric layer 48 and filled with a metal such as tungsten thereby forming the second via plugs 36 . a third metal pad 30 , formed of a material such as alcu / tin having a length of between about 80 and 120 microns , a width of between about 80 and 120 microns , and a thickness of between about 7000 and 10 , 000 angstroms , is formed on the third dielectric layer 48 forming contact with the second via plugs 36 . a fourth dielectric layer 52 having a thickness of between about 8000 and 12 , 000 angstroms is formed of a material such as silicon dioxide using plasma enhanced deposition of tetraethyl orthosilicate on the third dielectric layer 48 covering the third metal pad 30 . most of that part of the fourth dielectric layer directly over the third metal pad 30 is then etched away leaving some of the fourth dielectric layer 52 overlapping the edges of the third metal pad 30 . while the invention has been particularly shown and described with reference to the preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made without departing from the spirit and scope of the invention .	7
in the following description , reference is made to the accompanying drawings , which form a part hereof , and in which is shown by way of illustration specific embodiments in which the invention may be practiced . it is to be understood that other embodiments may be utilized as structural changes without departing from the scope and inventive concepts of the present disclosure . accordingly embodiments of the present invention relate , generally , to continuous backup systems implemented on any computing platform . however , for the purposes of simplifying this disclosure , preferred embodiments are described herein with relation to backups performed for workstations connected to a network . this exemplary embodiment is chosen as an example likely to be familiar to those skilled in the art , but is not intended to limit the invention to the example embodiment . those skilled in the art will recognize the wide applicability of the inventive aspects disclosed herein . accordingly , the examples disclosed are intended to illustrate the inventive aspects of this disclosure , and not to limit them to a particular form or implementation . fig1 is a block diagram illustrating an example of a prior art backup system . in fig1 , a workstation 101 is backed up using network 127 . an application running on workstation 101 performs writes 105 that will be recorded on the mass storage device of the workstation , in the present example disk 117 . the application 103 writes 105 are accepted by the operating system 107 . the operating system changes the application writes into sector writes 109 , each of which comprise a sector address 111 and data 113 . the sector writes are communicated to a disk controller 115 , which then performs the actual sector writes to the disk 117 . at a designated period , for example once per day or on command , a backup is performed . the backup communicates copies of the files on disk 117 , which have been changed since the last backup , to a network interface card ( nic ) 119 . in the present exemplary embodiment the network interface card 119 comprises an ethernet card . the card is connected to an ethernet cable 121 , which is then further connected to a server 123 . the server receives the communications from the network interface card 119 across the ethernet 121 and writes the communications to the mass storage 125 . in this way any files that are changed on disk 117 during a particular day will be copied to the mass storage 125 , to preserve them in case of catastrophic failure within the workstation . fig2 represents a workstation according to one embodiment of the present invention . the workstation 201 runs an application 103 , which proceeds to issue application writes 105 , as described above . the writes 105 are accepted by an operating system 107 and converted into sector writes 109 . the sector writes each comprise a sector address 111 and sector data 113 . in the present example items 103 through 113 , in the illustrative embodiments of fig2 , may be identical to the similarly numbered items in fig1 , the prior art system . sector writes 109 are communicated to a log - assisted disk lad 203 . the log - assisted disk system 203 accumulates the sector writes 109 and time stamps sector writes with a workstation clock 205 time . at predetermined times , which may be when a log assisted disk queue is nearly full , at pre - determined time intervals , or when there is minimal traffic on the network , the new data structure comprising the sector writes 109 which have been time stamped by the workstation clock 205 are provided to the network interface card 119 . the network interface card 119 , illustratively an ethernet card , couples the sector writes time stamped by the workstation clock into the ethernet 121 and further to the server 123 then to a mass storage 125 . in the present example , however , instead of mass storage containing changed files the mass storage contains a log of the sector writes to the disk . the sector writes also have been time stamped by the workstation clock 205 so that the time when each was generated by the operating system is known . additionally , since the log assisted disk system may write to a mass storage through the network many times per day , for example during periods in which the network traffic is low , the need for a fixed backup period can be eliminated . in a further embodiment , the lad 203 may be controlled to write to mass storage 125 through the network 127 as the writes occur . in this manner , if a catastrophic event should befall the workstation 201 , minimal or no data is lost because all writes are effectively being continuously recorded in the mass storage 125 . an additional advantage provided over the periodic backup is that the original system data can be recreated with a fine granularity . this means that the most data which can be lost is that waiting to be written to the network from the lad . the latency period between writes of the log assisted disk system 203 to the mass storage of the network 125 may be made as short as desired . if the period were made to equal five minutes then the most data that a catastrophic failure at the workstation 201 could cause would be the data that had occurred in writes of five minutes since the last log assisted disk transmission . additionally , since the mass storage contains a log of events on , as opposed to a simple recording of the last updated version of each file , the workstation disk 117 can be re - created up to any given time within the log . the ability to recreate the workstation disk can be very useful if an application for example were to cause a catastrophic failure at the workstation 201 . the writes of the application could then be traced through the log - assisted disk and a new disk could be created that mirrored the old workstation disk 117 . the new disk record could be recreated up to any point in time within the log , including the point for example when the application causing the catastrophic failure was initiated . because the disk can be recreated as it existed at any time up until the failure the backup system provides great flexibility . fig3 is a more detailed description of the operation of a log - assisted disk system according to an example embodiment of the invention . sector writes 109 containing a sector address 111 and sector data 113 are communicated to the log - assisted disk ( lad ) 203 . the sector writes 109 are also communicated from the lad to a disk controller 115 , as needed for recording on the workstation disk 117 . the sector writes 109 are also time stamped 303 by the workstation clock 205 , or other source of time information , and then passed into the log assisted disk queue 305 . the log queue 305 queues the sector writes along with their time stamp until such time as they are to be written to the network . when it is time for the lad queue to be written to the network , the queue is communicated to the network interface card 119 , in the illustrated example an ethernet card , and then to the ethernet 121 and further to server 123 and the mass storage unit 125 . fig4 is an example of a backup system within a workstation according to a further embodiment of the invention . as in the previous fig1 , 2 and 3 , sector writes 109 containing sector addresses 111 and data 113 are accepted by the log - assisted disk system 403 . the sector writes are then provided by the log - assisted disk system 403 to the disk controller 115 , which writes the sector addresses and data to the disk 117 utilizing normal disk writes 407 . in addition , the sector writes are time stamped by workstation clock 205 and are queued within the log assisted disk 403 so as not to interfere with the normal disk writes 407 . the time stamped sector writes are then written into a log file 405 and onto disk 117 by the disk controller 115 . other embodiments , instead of using a workstation clock , may use other sources of time . time may come from a network clock , an independent time source — such as one synchronized to a particular time standard , or a variety of other sources . in a multi - disk system , the log file 405 may be written to a second physical disk that is different from the disk being used to record normal disk writes 407 . if the first disk to which the normal disk writes 407 were occurring fails , the log file on the second disk could be used to recreate the state of the first disk prior to the failure of the first disk . utilizing this system of two disks , one containing a lad system , also provides a sophisticated “ undo ” capability . so , for example , if an operator of the workstation decided that they needed to undo several hours of work they could use the log file to recreate the state of the disk as it was several hours previously . in addition , the log file 405 would be generating , in effect , a continuous backup of the normal disk writes 407 . the examples of storage devices herein are illustrated herein with respect to hard disk drives . those skilled in the art will recognize that any storage medium or device can be used with the inventive techniques disclosed herein . the hard disk has been chosen as the illustrative device only because it is an example likely to be familiar to those skilled in the art because of its widespread popularity . no limitations on the inventive techniques should be inferred because a hard disk has been chosen as the illustrative memory device . devices such as removable media , tape , writable cd - roms , worm ( write once read many ) flash memory , eeprom ( electrically erasable programmable read only memory ) as well as other storage devices may be used . the inventive techniques disclosed herein are applicable to storage devices , combinations of storage devices and systems in general . fig5 is an illustration of example log assisted disk data structures . since the log - assisted disk system is , effectively , a change record , it must have a point in time with which to reference the change . ideally , the log - assisted disk is started when the hard disk drive is first put into use and therefore any intermediate state of the hard disk may be recreated upon a failure . if the hard disk is already in use , a snapshot of the disk 501 can be taken , for example , as part of the initial operation of the log assisted disk system . a snapshot of the disk is a copy of all the written sectors of the disk . the snapshot of the disk is set to correspond , for example , to time zero and copied onto a backup unit , such as the mass storage unit 125 . once the snapshot of the disk has been stored on the mass storage 125 , the log assisted disk system has ascertained a beginning point and can record any subsequent change to the snapshot image . changes comprise the time of the sector writes , the actual sector being written , and the sector data 507 . the disk can be then recreated to a time end 509 by taking the snapshot of the disk 501 and performing the data writes 507 to the sectors 505 that exist between time zero and time n . of course any intermediate state of the disk within the log can also be recreated . alternatively a particular write can be ascertained . the log assisted disk system may also be used to ascertain various metrics regarding the changes in a computer system . for example , a computer system controlling a process or recording data events could use a log assisted disk in order to determine the time at which events happened , periodic activity in a system , profiles of and volume of events within a system . in essence the history of activity in a system would be captured and that history could be mined for any inherent data present within that history of activity . fig6 is an illustration of an operation of a log assisted disk system to produce a backup with a minimum of sector writes . at time one in fig6 , sector ( n − 1 ) and ( n + 1 ) are displayed . at time one the data of sector ( n − 1 ) has data ( 1 ), the data of sector n has data ( 1 ) and the data of sector ( n + 1 ) has data ( 1 ). at time two , sector n has data ( 2 ) and sector ( n + 1 ) has data ( 2 ) written to it . at time three , data ( 3 ) is written into sector ( n − 1 ), data ( 3 ) is written into sector n and nothing is written into sector ( n + 1 ) so data ( 2 ) still exists within sector ( n + 1 ). as can be seen from the illustration in fig6 , by implementing a smart log assisted disk , data ( 2 ) in sector n , i . e . 601 , need never be written to the backup . this is because sector n started with data ( 1 ), had data ( 2 ) written to it and then was overwritten by data ( 3 ). therefore , data ( 2 ), i . e . 601 , is only an intermediate state of the disk to be destroyed by a future write in normal disk operations . by maintaining a smart sector map such as illustrated in fig6 , intermediate values of the sectors need not be written as a backup . only final values of a sector during any time period need be written as a backup . this of course would eliminate the ability to recreate a data disk at any point in time . however , in networks with heavy traffic this embodiment might be an acceptable compromise in order to minimize network traffic . if the smart disk technology were applied only between successive writes of the lad system to the network , then at most the data that could be lost would be data in the time between successive lad system writes to the network backup system . this period could be limited to a short period of minutes or even seconds . many operating systems control sector writes to blocks of a hard disk using various types of algorithms . for example , storage blocks might be arranged into a queue and the least recently used block used by the operating system . such operating system embodiments of log assisted disks might be changed so that the most recently used blocks of a hard disk are reused whenever possible . by placing the emphasis of reusing blocks in a hard disk system , a smart log assisted disk can eliminate a larger number of sector writes and thereby further minimize the network traffic necessary to backup a system using a log assisted disk . a log - assisted disk system can provide a flexibility within computer systems that was previously unknown in backup systems . a log - assisted disk system could also be used for creating parallel or mirror sites at different locations . using a log assisted disk system , data could be posted , for example , as it occurred , to a number of sites that were interested in the same data . each remotely computed site would then have a hard disk copy of the data that was used to create the initial site . and applications such as remote databases could be continuously kept up to date while , in effect , providing a backup for the original data disk . the log assisted disk system can provide backup for personal computers as well as workstations connected to a network , as for example shown in fig3 . the network interface card 119 coupled to an ethernet connection is merely one example of interconnection that the lad system might employ . the nic could also provide connection via a phone line , digital subscriber line ( dsl ), cable modem , or other connection to the internet . the internet can then provide the connection through a server 123 connected to the internet to a remote mass storage 125 . additionally the nic 119 need not even connect to a network . the nic 119 can , for example , connect via a phone line or dedicated line to a remote backup facility designed to accept log entries and return log entries on request . additionally log entries could be written directly to a local mass storage device , such as a tape drive , without any network connection of any type required . the foregoing descriptions of exemplary embodiments of the present disclosure have been presented for the purpose of illustration and description . it is not intended to be exhaustive nor to limit the inventive concepts to the embodiments disclosed . many modifications and variations are possible in light of the above teaching . it is intended that the scope of the invention be limited not within this detailed description , but rather by the claims appended hereto , which appear below .	6
referring now to fig1 of the attached drawings wherein is shown a first embodiment of the present invention , a vertical boiling vessel 2 is mounted on a foundation frame 1 , a cover plate 3 having generally a circular shape closing the open top end of vessel 2 , cover plate 3 being separated along a cord so as to appear as two parts having a different dimension , whereby the one having a smaller dimension is fixedly secured to vessel 2 and the one having a larger dimension is hinged to the former along the chord , and on the part having a smaller dimension is sealingly secured an upstanding open - topped cylinder 4 . see fig4 . the lower outer periphery of vessel 2 is surrounded by an outer wall 5 at a distance so that a heating chamber 7 is formed between it and the bottom portion 6 of vessel 2 . thus , outer wall 5 and the bottom portion 6 constitue a double bottom for vessel 2 . an annular heating steam supply pipe 8 is arranged horizontally within vessel 2 above bottom portion 6 , said pipe 8 provided with a number of steam nozzles 9 , each directed obliquely downwards . steam pipes 10 leading to heating chamber 7 and steam supply pipe 8 are each provided with parallel pipes 11 and 12 , each pipe being respectively provided with a solenoid valve 13 or 14 , and at least pipe 12 of the two pipes 11 , 12 is additionally provided with a flow regulating valve 15 . alternatively , it may be possible to manually operate solenoid valve 14 by the combined use of flow regulating valve 15 . within vessel 2 is a floating disc 16 mounted so as to be freely movable up and down following the level of the slurry contained in vessel 2 . as shown in fig5 and 6 floating disc 16 is constituted as a hollow , float circular disc . alternatively , it may have the form of a circular disc with a central mesh 17 or a central perforation 17 &# 39 ; as shown in fig7 and 8 or fig9 and 10 at 16 , or as shown in fig1 and 12 it may be a circular disc 16 with a central funnel 19 on its upper surface for supplying the slurry therethrough . further , in fig1 the reference numeral 20 shows a safety valve , 21 is a pressure gauge , 22 is a thermometer , all being provided on cover plate 3 , 23 is a supply pipe for the slurry opened to vessel 2 at its lower portion , slurry supply pipe 23 being connected to a slurry accumulation tank not shown , 24 is a steam pipe connected to slurry supply pipe 23 so as to constitute an ejector therein , 26 is a heated slurry discharge orfice opened in bottom 5 of vessel 2 centrally thereof , 27 is a motor - driven valve for discharging the heated slurry in communication with discharge orifice 26 , 28 is a pump for conveying the heated slurry in communication with motor - driven valve 27 , 29 is a discharge pipe for the heated slurry to convey it to a next station , 30 is a steam trap connected to steam chamber 7 via a pipe , 31 is a rinse water discharge cock connected to boiled slurry discharge orifice 26 , 32 are rest fittings secured to the inside of vessel 2 at the lower part to rest thereon floating disc 16 , 33 is a handle secured to the larger dimension part of cover 3 at its peripheral portion . a boiler 34 is separately provided for supplying steam to vessel 2 . see fig3 . further , as shown in fig2 a control panel 35 is provided in cooperation with pressure gauge 21 and thermometer 22 , 36 representing solenoid valves 13 , 14 , and motor - driven valve , 27 and also connected to panel 35 is a temperature sensor 37 which is located within vessel 2 above fittings 32 . the manner of operation of the apparatus described above and shown in fig1 to 12 is as follows : assuming that boiler 34 is fired to generate steam to supply it to vessel 2 , etc . through pipes 10 and 24 . firstly , when solenoid valve 38 is opened to supply the steam from boiler 34 through pipe 24 to ejector 25 it operates to eject the steam into raw slurry supply pipe 23 , thereby the raw slurry is injected into vessel 2 by the steam ejection action . when the raw slurry is filled within vessel 2 to a predetermined level solenoid valve 38 is closed , and also raising floating disc 16 which floats on top of the rising raw slurry . at this state , on one hand , in connection with vessel 2 valve 13 of one of the parallel pipes 11 is opened , whereas valve 14 of the other of parallel pipes 12 is closed so that the steam is supplied into vessel 2 from pipe 10 via pipe 11 , and on the other hand , in connection with heating chamber 7 , steam chamber 7 is at the same time filled with steam under pressure similarly supplied from steam pipe 10 through another set of valves , i . e . one valve 13 being opened with the other walve 14 being closed . thus , the raw slurry within vessel 2 is directly boiled by the steam injected through nozzles 9 of annular steam supply pipe 8 and at same time indirectly heated through the wall of vessel 2 by the surrounding heating chamber 7 . in this case , the heating temperature is 100 ° c . or thereabouts and the raw slurry is boiled at this temperature . the bubbles from the boiling of the slurry are suppressed by floating disc 16 , preventing boil over and consequently preventing the loss of bean protein . thus , after a predetermined time the first step is completed . upon completion of the first step , in connection with both vessel 2 and heating chamber 7 valve 13 of one of parallel pipes 11 is closed , valve 14 of the other of parallel pipes 12 is opened , whereby flow regulating valve 15 of one of parallel pipes 12 is throttled so that about one tenth of the heating steam which has been supplied through the other of parallel pipes 11 is supplied within vessel 2 and heating chamber 7 through valve 15 so that the slurry within vessel 2 is steamed by steam supply pipe 8 and steam chamber 7 with less steam than in the first step for a predetermined time , completing the second step . thereafter , both parallel pipes 11 and 12 are closed by solenoid valves 13 and 14 , and motor - driven valve 27 for the heating slurry is opened , pump 28 begins to operate and the slurry is discharged through discharge pipe 29 to the next station . a second embodiment of the present invention is shown in fig1 with the parts corresponding to those in the first embodiment shown in fig1 to 12 being represented by the similar reference numerals which the latter parts bear . as apparent from the comparison of fig1 with fig1 the principal differences of the second embodiment from the first one reside in the constitution of a heating chamber 107 . that is , in the second embodiment heating chamber 107 contains therein an annular heating steam pipe 106 having a constitution to similar heating steam pipe 8 contained within vessel 2 with a number of steam injection nozzles 122 each directed obliquely downwards , heating steam pipe 106 being adapted to be supplied with steam from steam pipe 10 through parallel connected pipes 11 and 12 as in the first embodiment although in the latter parallel pipes 11 and 12 are adapted to supply the steam directly into heating steam chamber 7 . additionally , in the second embodiment , heating chamber 107 is equipped with a water gauge 133 at its upper portion , and a safety valve 125 is provided on its top wall , a feed water pipe 108 being connected to heating chamber 107 at its bottom so as to be opened therein . in operation , when valve 38 of steam pipe 24 is opened the steam is fed to ejector 25 so that by the action of ejector 25 the raw slurry is delivered through raw slurry supply pipe 23 into vessel 2 . in this state the steam is injected into vessel 2 and heating chamber 107 through heating steam supply pipes 8 and 106 from steam pipes 10 , respectively , through parallel pipes 11 and 12 associated therewith . at the same time water is fed into heating chamber 107 through feed water pipe 108 so that heating chamber 107 is filled with hot water as a result of the heating of the feed water by the steam injected therein from heating steam supply pipe 106 through injection nozzles 122 . thus , the raw slurry within vessel 2 becomes well boiled by the steam injected from heating steam supply pipe 8 through injection nozzles 9 as well as the hot water filled in heating chamber 107 . thereafter , the slurry within vessel 2 is steamed mainly indirectly by heating chamber 107 . thus , upon production of the boiled and steamed slurry , it can be discharged from vessel 2 through opened valve 27 and conveyed by pump 28 to the next station via heated slurry discharge pipe 29 . if necessary , heating chamber 107 may be heated only by steam without the supply of water through pipe 108 . thus , in this embodiment , as in the first embodiment , since there is provided a heating chamber 107 around vessel 2 comprising double walls 5 , 6 , and since heating steam supply pipes 8 and 106 are provided within vessel 2 at its lower portion and heating chamber 107 , respectively , and since raw slurry injection pipe 23 opens into vessel 2 and feed water supply pipe 108 is opened into heating chamber 107 , heating chamber 107 can be filled with hot water or steam as desired . therefore , the raw slurry contained within vessel 2 can be boiled by steam directly and / or steam or hot water indirectly , making the boiling of the raw slurry contained within vessel 2 to be regulated and at the same time also allowing the quality of the bean curd to be regulated . a third embodiment of the present invention is illustrated in fig1 and 15 . in this embodiment , as shown in the drawings a horizontal open - topped vessel 202 has generally a round bottomed rectangular shape in cross section and generally a rectangular configuration in plan view with both ends being closed by a pair of opposite end - plates . vessel 202 is surrounded at its lower part by an outer wall 205 so that it forms a sealed heating chamber 207 around vessel 202 . a rotary screw 239 is disposed axially within vessel 202 so that its center axis coincides with the center of the curvature of the rounded bottom of vessel 202 . a pump 240 is mounted to one of the end plates of vessel 202 by a pipe 223 to forcedly deliver the raw slurry into vessel 202 . a number of pipes 208 are axially secured to the bottom 206 of vessel 202 so as to be fed with steam from a steam pipe 210 through branch pipes , each pipe 208 being provided with a plurality of steam injection nozzles 209 opened into vessel 202 , and further steam pipes 211 are opened into heating chamber 207 to fill therein with pressurized steam . as an example , the length of vessel 202 is about 4 m and the raw slurry is fed into vessel 202 at a flow rate of about 10 to 15 m 3 / min . the boiled slurry is successively transferred from the one end plate side to the other end - plate side of vessel 202 by the rotating screw 239 . in this case , as shown in fig1 , since each of steam supply pipes 208 are provided with steam injection nozzles 209 such that the distance between adjoining nozzles become greater the nearer they get to the other end - plate of vessel 202 away from the raw slurry inlet end - plate , the amount of steam injected into the slurry becomes smaller as it approaches said other end - plate of vessel 202 . thus the heating of the slurry is converted gradually from the boiling process into the steaming process . the finally heated slurry is continuously discharged from said other end - plate of vessel 202 through a discharge pipe 226 opened thereto by the action of the rotating screw . vessel 202 is closed at opened top by a cover 203 which is proviced with a number of opened upstanding cylindrical pipe 204 . and further temperature sensors 237 are provided through outer wall 205 and the wall of vessel 202 to detect the temperature of the slurry at different portions , a steam trap 244 being also provided at the lower portion of outer wall 205 . finally a fourth embodiment of the present invention is shown in fig1 to 20 . as shown in fig1 a vertical hollow cylindrical vessel 302 is surrounded by a cylindrical wall 305 so as to form a heating chamber 307 therebetween with both ends sealingly closed by end - plates . further , heating chamber 307 is separated into two chambers , i . e . a lower and an upper heating chamber 307 1 and 307 2 , respectively , by a partition wall 350 provided substantially in the upper half of vessel 302 . the raw slurry is adapted to be continuously fed into vessel 302 from the lower endplate by a pump 340 through a pipe 323 secured thereto . steam is adapted to be injected into vessel 302 by a number of steam supply pipes 308 arranged orthogonally to the axis of vessel 302 through a plurality of steam injection nozzles 309 formed around pipes 308 , steam supply pipes 308 being divided into two groups so as to be located near lower and upper heating chambers 307 1 , 307 2 , respectively , and each group is adapted to be supplied with steam by a common steam pipe 310 1 and 310 2 , respectively , each pipe being equipped with a solenoid valve 314 and a manual valve 315 . heating chambers 307 1 , 307 2 are arranged to be supplied with steam through steam pipes 311 , respectively opened into them through outer wall 305 . the spaces between adjoining steam supply pipes 308 are such that they are greater in the group near upper heating chamber 307 2 than those that are in chamber 307 1 . see fig1 . thus , upon supply of the raw slurry from the lower end - plate of vessel 302 through pipe 323 by the action of pump 340 , the slurry is forcedly moved upwards , whereby it is heated directly by steam injected from steam supply pipes 308 through injection nozzles 309 as well as indirectly by heating chambers 307 1 , 307 2 . in this case , since the spaces between adjoining steam supply pipes 308 become greater as the slurry approaches the upper end - plate of vessel 302 , the amount of the steam injected into the slurry becomes less so that the heating takes place in the form of boiling in the first step and thereafer it is converted from boiling into the form of steaming as the second step . the finally steamed slurry is continuously discharged from a discharge pipe 329 opened to the upper end - plate vessel 302 . it should be noted that as shown in fig1 a circular disc 342 is located within vessel 302 near the lower end - plate to prevent the raw slurry supplied thereinto from directly passing through vessel 302 axially , but instead disperses it radially , and an arcuate disc 343 is located at the upper portion as a baffle to more positively separate the inside of vessel 2 into a boiling zone and a steaming zone . see fig1 and 20 . also there are provided temperature sensors 337 to detect the temperatures of the slurry at the lower portion or so - called boiling zone and at the upper portion or so - called steaming zone of vessel 2 as shown in fig1 , 19 and 20 , and finally there are also steam traps 344 being provided in outer cylinder 305 near the lower end - plate and partition wall 350 . while in the foregoing specification a detailed explanation of certain embodiments of the invention were set forth for the purpose of illustration , it will be understood that many of the details hereingiven may be varied considerably by those skilled in the art without departing from the spirit and scope of the invention .	0
referring now to the drawings , fig1 is a left perspective view of the speculum 2 of the present invention . fig2 is a rear elevation view , while fig3 is a left elevation view of the speculum 2 shown in fig1 . in general , the speculum 2 is comprised of a forward handle 4 which is interconnected to a rearward handle 6 with a biasing spring 20 . the biasing spring serves to keep the forward handle 4 and rearward handle 6 in a spaced apart relationship when not in use . in this position of non - use , the front ends 14 of the blades 12 are oriented in a closed position . on the upper end of the forward handle 4 is a traveling ring 10 which serves to open a plurality of pivoting blades 12 as will be discussed in greater detail below . the rearward handle 6 is interconnected to a stationary ring 8 on the upper portion which serves to support the plurality of pivoting blades 12 . the pivoting blades 12 generally have a front end 14 , a hook end 16 and a blade sleeve 18 positioned therebetween . a tail 44 is also positioned between the blade sleeve 18 and hook end 16 for engagement with the traveling ring 10 when pressure is removed from the handle . the blade sleeve 18 is used to pivotally interconnect the pivoting blades 12 to the stationary ring 8 . by creating a close tolerance between the internal diameter of the pivoting blade sleeve 18 and an outer diameter of the stationary ring 8 , the pivoting blades 12 may be selectively removed for sterilization purposes , or to interconnect smaller or larger blades dependent on the needs of the patient and the attending physician . the pivoting blade hook end 16 is designed to be in operable engagement with the traveling ring 10 , which again is interconnected to an upper portion of the forward handle 4 . as seen in fig1 - 3 , the blade hook end 16 is not permanently interconnected to the traveling ring i 0 to facilitate quick and easy removal of the pivoting blade 12 as necessary . positioned below the plurality of pivoting blades 12 is a sliding blade 22 which is slidingly engaged to the rearward handle 6 . by the use of a sliding blade ratchet assembly 24 or other means commonly known in the art , the sliding blade 22 may be selectively moved in a vertical direction with respect to the plurality of pivoting blades 12 . thus , the sliding blade 22 does not move outwardly with respect to the pivoting blades 12 when the forward handle 4 is squeezed with respect to the rearward handle 6 . as additionally seen in fig1 - 3 , a locking assembly 26 may be provided to maintain the speculum 2 in an open position during use . more specifically , when the forward handle 4 and rearward handle 6 are squeezed , the traveling ring 10 moves away from the stationary ring 8 which in turn provides a force on the blade hook end 16 which moves the blade front end 14 outward . when the blade front end 14 is opened for examination purposes , it is often beneficial for an attending physician to have one hand free for examination purposes or to use other instruments . to facilitate one handed use , the locking assembly 26 may be implemented by turning the head 28 in a clockwise direction which is threadingly engaged with a shaft 30 to a threaded sleeve 32 , which is in turn interconnected to the traveling ring 10 . when the speculum 2 is in an open position , the head 28 is simply turned to engage the shaft 30 of the locking assembly 26 with the stationary ring 8 to keep the speculum in an open position . when it is desired to close the speculum 2 , the head 28 is turned in a counterclockwise position to gradually bring the traveling ring and stationary ring 8 in a position proximate one another which in turn brings the pivoting blades 12 back together . as additionally seen in fig2 the sight “ window ” provided to the physician is significantly improved over typical speculums as the pivoting blades 12 are expanded . the sight window is defined herein as the minimum diameter of the traveling or stationary ring positioned in front of the pivoting blades 12 . preferably , and as provided herein with the present invention , the sight window is at least about 1 . 75 inches and preferably 2 . 0 inches . this dimension represents the internal diameter of the stationary ring 8 , which provides a very wide field of view for the physician . referring now to fig4 a right elevation view of the speculum shown in fig1 is provided herein . in this drawing , the speculum is shown in a partially opened position . further , it is apparent that the pivoting blades 12 have been moved apart from one another as the forward handle 4 and rearward handle 6 are squeezed together . in operation , as the handles are squeezed together , pressure is applied to the blade hook end 16 of the pivoting blades 12 , which makes each of the plurality of pivoting blades 12 rotate about the stationary ring 8 at the point of interconnection at the blade sleeve 18 . thus , the closer the forward handle 4 and rearward handle 6 are brought together , the further the traveling ring 10 travels away from the stationary ring 8 , thus applying an inward force on the pivoting blade hook ends 16 . referring now to fig5 the speculum 2 can be seen in a fully opened position with the forward handle 4 and rearward handle 6 in proximate relationship thereto . as seen in this drawing , when the traveling ring 10 is positioned at the rearward end of the blade hook end 16 , the resulting force opens the pivoting blade front ends 14 to a maximum open position . this is a results of the geometry of the pivoting blades , in combination with the arcuate travel of the stationary ring 8 with respect to the traveling ring 10 . thus , the traveling ring 10 and stationary ring 8 do not move in a strictly linear fashion with respect to one another due to the geometry of the forward handle 4 , rearward handle 6 , and the biasing spring 20 which interconnects these components near the bottom interior edges . as appreciated by one skilled in the art , by varying the shape and angle of the pivoting blades 12 , including the hook ends and tail 44 , as well as the geometric configuration of the forward handle 4 and rearward handle 6 , the degree of opening and relevant movement of the pivoting blades 12 can be modified as necessary for the required medical application . further , the shape of the pivoting blades 12 has a non - linear , arcuate shape which deflects outwardly as the blades approach the stationary ring 8 . this pronounced bend or scalloped shape substantially reduces pressure being applied to the patient &# 39 ; s bladder , and allows the blade ends 14 to be opened to a greater degree after insertion in the vagina without causing significant pain to the patient . the deflection and angle ø of the pivoting blades 12 can be seen in fig4 and 6 , and is preferable between about 140 ° and 170 °. further , the angle of deflection of the pivoting blades 12 can be easily modified if necessary during manufacturing to facilitate the medical procedure or application . as additionally seen in fig5 the sliding blade 22 has been moved downward from the plurality of pivoting blades 12 by use of a sliding blade rachet assembly 24 . the rachet assembly generally permits the attending physician to move the sliding blade 22 in an upward and downward direction relative to the pivoting blades 12 by applying thumb pressure to the sliding blade rachet assembly 24 . the sliding blade rachet assembly 24 is generally comprised of a spring biased rachet mechanism which when depressed allows the sliding blade 22 to move and when pressure is released to lock the sliding blade 22 in place with a plurality of ratcheting teeth 40 . in a preferred embodiment the ratcheting teeth 40 are integrally formed in the rearward handle 6 . alternatively , a separate racheting mechanism may be constructed and attached to the rearward handle 6 . as appreciated by one skilled in the art , the sliding blade rachet assembly 24 may be substituted with many other types of hardware such as screw and wing nut assembly , or other mechanisms which preferably can be operated with one hand for convenience purposes . referring now to fig6 and 7 , a front elevation view and a top plan view of an alternative type of a pivoting blade 12 is provided herein . in this particular diagram , a smoke tube 34 and / or a light tube 36 , is provided to facilitate removing smoke from the vagina during surgical procedures . the light tube facilitates a fiber optic light or other light means to provide improved visualization for the physician . preferably , the smoke tube 34 and / or light tube 36 extends along a longitudinal axis of the pivoting blade 12 and terminates on an interior surface of the pivoting blade 12 in a non - obstructing position to maintain an open viewing window . the smoke tube 34 and / or light tube 36 is designed to be used on one or more blades , and may be used in various combinations as necessary . referring now to fig8 - 10 , a front elevation view , left elevation view and a bottom perspective view , respectively are shown of the rearward handle 6 and associated stationary ring 8 . as shown in fig8 additional detail of the ratcheting assembly 24 is provided , and which additionally shows the attachment hardware 38 such as screws or rivets , which are used to interconnect the biasing spring 20 to the interior surface of the rearward handle 6 and forward handle 4 . as additionally seen in fig8 the diameter of the stationary ring 8 varies from the diameter of the pivot housing 42 , which is designed to matingly engage the blade sleeve 18 . further , and as clearly seen in fig1 - 3 , the traveling ring 10 has a larger diameter than the stationary ring 8 . this size difference creates a moment arm around the pivot housing 42 and additionally forces the blade ends 14 to close as the traveling ring 10 engages the blade tail 44 . referring now to fig1 - 13 , a front elevation view , side elevation view and rear 10 perspective view , respectively is shown of the forward handle 4 and associated traveling ring 10 . further , the threaded sleeve 32 is shown which in one embodiment is integrally interconnected to the traveling ring 10 , and which provides threading engagement for the locking assembly shaft 30 . although the threaded sleeve 32 is shown positioned on the left - hand side , it can also be attached on the right - hand side to facilitate convenience . referring now to fig1 , a typical embodiment of the biasing spring 20 is shown herein . the biasing spring 20 is used to pivotally interconnect the forward handle 4 and the rearward handle 6 as shown in fig1 . preferably , the biasing spring 20 is comprised of a metallic material such as stainless steel , although other materials such as bendable plastics and / or fiberglass or other materials commonly known in the art may be used for the same purpose . the speculum 2 and associated pivoting blades 12 and sliding blade 22 are preferably comprised of a metallic material such as stainless steel to facilitate sterilization after use . alternatively , the pivoting blades 12 and sliding blade 22 may be comprised of plastic materials and / or preferably see through plastic materials to improve the comfort of the patient and facilitate better viewing for the examining physician . the pivoting blades and sliding blade 22 may additionally be made of disposable materials to alleviate the time and expense of sterilization . other materials commonly known in the medical arts such as various rubbers , polyethylene , polypropylene and other materials may additionally be used , as well as rubber and plastic coatings on top of metallic materials . however , non - conductive materials which can be used during electrosurgical procedures are preferred . the operation and mechanics of the speculum is generally described herein . a forward handle 4 is provided which allows the traveling ring 10 to be withdrawn relative to the rearward handle 6 , which allows the stationary ring to travel in a controlled fashion . once the traveling ring 10 is withdrawn and the speculum 2 is opened , a simple flip of the thumb causes the head 28 of the locking assembly 26 to rotate the shaft 30 within the threaded sleeve 32 . this motion directs the shaft 30 forward to apply a force on the back side of the stationary ring 8 , resisting the speculum &# 39 ; s tendency to return to the resting position with the elastic recoil of the vagina . a simple spin in the opposite direction frees the traveling ring to return to the resting position . a detachable inferior sliding blade 22 is provided which slides up and down along the rearward handle 6 to permit inferior , or posterior , expansion of the vagina . the interim sliding blade 22 is interconnected in a preferred embodiment with a sliding blade rachet assembly 24 which permits the sliding blade 22 to be moved in a variety of different positions dependent on the patient and medical condition . additionally , interchangeable blades of varying lengths may be quickly interconnected to the stationary ring 8 in any variety of combinations . these blades have two points of articulation . the first is the blade sleeve 18 , creating a secure fulcrum so that a lever effected moment of the traveling ring 10 along the sloping blade hook ends 16 of the pivoting blades 12 causes the blade front ends 14 to be withdrawn radially , or tangentially from one another . simple lever mechanics dictates that only a few millimeters of travel must be enacted through the blade hook ends 16 to effect a far greater amount of travel at the blade front ends 14 , which rests several centimeters from the point of rotation at the blade sleeve 18 . a simple system of articulation with the blade sleeve 18 allows the blades to be positioned and removed with ease . once snapped into place with either a lock and key fixture , or alternatively a “ press - fit ” arrangement as shown in the drawings , the locking mechanism will keep the blades 12 from inadvertently falling off the pivot housing 42 of the statutory ring 8 . the natural recoil of the biasing spring 20 of the handle returns the traveling ring 10 to its relaxed state , and holding the pivoting blades 12 securely in place . as additionally seen in the drawings , the pivoting blade hook ends 16 additionally have a blade tail 44 which is designed to engage the traveling ring 10 as the traveling ring 10 travels toward the stationary ring 8 . upon engagement , the force of the traveling ring 10 upon the blade tail 44 pushes the pivoting blades 12 together at the distal end . in an alterative embodiment not shown in the drawings , the second point of attachment of the pivoting blades 12 is with one another . a tongue - in - groove of the sliding blade 22 may allow the two pivoting blades 12 to be seated within these grooves to provide a smaller diameter distal end of the blades . since the sliding blade 22 ascribes approximately 120 ° of an arc , this plus the approximately 80 ° contained in each ofthe three interchangeable blades 12 will together form a circular apparatus . this arrangement roughly creates a cylinder or tube , permitting a more ergonomic placement into the vagina . the three pivoting blades 12 may be positioned on any of the three pivot housings 42 situated on the stationary ring 8 . the two defined points of contact are conserved throughout all possible arrangements of blades . should one to three longer or shorter blades be necessitated to optimize an exam , they can be easily replaced regardless ofthe preexisting arrangement , as all blades , regardless of ultimate length , articulate in the same two places . alternatively , and as previously discussed , a smoke evacuator tube 34 and fiber - optics tube 36 may be provided . these attachments will be available to optimize the visualization and safety of electrosurgical procedures . a special interchangeable blade will be modeled to accept a vacuum device to remove smoke and potential aerosolized pathogens from the operative field during procedures . another optional blade will provide a conduit or tube for a small fiberoptic light with an external power source as seen in fig6 and 7 , although the exact positioning of either the fiber optic light source or smoke evacuation tube may vary dictated by the medical procedure and as appreciated by one skilled in the art . thus , the present invention provides a speculum with improved visualization , one handed operation , interchangeable blades , an ergonomic design and the option of having smoke evacuator and fiberoptic light accessories . additionally , the speculum provides an ergonomic design which is more efficient for the care giver and enhances the comfort level of the patient . for clarity purposes , the following list of components and associated numbering is provided herein : the foregoing description of the present invention has been presented for purposes of illustration and description . furthermore , the description is not intended to limit the invention to the form disclosed herein . consequently , variations and modifications commensurate with the above teachings , and skill and knowledge of the relevant art , are within the scope of the present invention . the embodiments described herein above are further intended to explain best modes known in practicing the invention and to enable others skilled in the art to utilize the invention in such , or other embodiments with various modifications required by the particular application ( s ) or use ( s ) of the present invention . it is intended the appended claims be construed to include alternative embodiments to the extent permitted by the prior art .	0
referring to fig1 and 2 , the preferred embodiment of this invention is constructed in the following stepwise procedure : 1 . if the roof is not insulated and insulation is desirable , a layer of insulation 10 may be applied to the roof 14 . polystyrene plastic insulation 10 , anchored to the roof with roofing nails having large washers 12 , has been found to be satisfactory . 2 . a layer of roofing felt 16 is laid on the roof 14 ( or insulation 10 ), to be used as a slip sheet . in the preferred embodiment , 15 pounds per 100 square feet roofing felt , 36 inches wide is laid out , with 2 to 3 inches overlap 18 between adjacent sheets . 3 . the laps 18 in the roofing felt are adheredsealed with elastomeric polymer , to form a continuous layer of roofing felt covering the roof . 4 . a first layer of extensible reinforcing fabric 20 is laid over the roofing felt 16 . polyester fabric , 36 inches wide , weighing from 1 to 6 pounds per 100 square feet has been found to be desirable . however , cotton fiber or fiber glass fabrics could also be used . as with the roofing felt , each sheet of fabric overlaps adjacent sheets by 2 to 3 inches , as indicated at 22 . each sheet of fabric is positioned so that the fabric laps 22 are directly over the felt laps 18 . 5 . the overlaps 22 of the fabric 20 are securely sealed and adhered with elastomeric polymer . this is done by coating the leading edge of the bottom sheet under the overlap with elastomeric polymer . 6 . while the elastomeric polymer applied to the fabric laps 22 is still wet , the laps are anchored to the roof with fasteners 24 . the fasteners 24 may be any common mechanical anchor , such as nails , or may be a spot of adhesive or spot hot melt of elastomeric polymer . large headed aluminum nails having neoprene gaskets have been found to work well . the fasteners 24 are arranged in rows , with the fasteners being spaced at approximately 9 inch intervals in each row . one row of fasteners 24 is installed along each lap 22 in the fabric 20 . additional rows of fasteners 24 are also installed at the midpoint and quarterpoints of the fabric 20 with approximately 9 inch spacing between rows . the fasteners 24 in each row are staggered in relationship to the fasteners 24 in the adjacent rows , so as to provide a triangular hold - down pattern , as illustrated in fig1 . 7 . immediately after the fasteners are installed , the top of the laps 22 in the fabric 20 are coated with elastomeric polymer which is worked into the fabric to completely seal the laps 22 . 8 . a starve coat 30 of elastomeric polymer is applied to the first fabric layer 20 in sufficient quantity to starve - fill the voids in the fabric , in order to increase the tear resistance of the fabric . the polymer is worked into the fabric 20 with the aid of squeegees and rollers to remove all residual air bubbles . the starve coating 30 is then allowed to thoroughly dry for 4 to 24 hours , depending on drying conditions . the elastomeric polymer may be any of the many commonly known elastomeric polymers , such as acrylic latex , asphaltic latex , coal tar latex , rubber modified latex and acrylic resins . latex emulsions and dispersions have been found to work particularly well , especially acrylic latex , asphaltic latex and coal tar latex polymers . for ease of application , liquid polymers , water or solvent based , are most desirable . however , normally solid or plastic polymers applied in &# 34 ; hot melt &# 34 ; liquid form may also be used . 9 . the first layer of fabric 20 is then recoated with a first full coat 32 of elastomeric polymer at a rate in the order of about 1 gallon per 100 square feet . 10 . while the first full coat 32 is still wet , a second fabric sheet 34 is laid over the wet polymer 32 in a position that centers each sheet of the second layer of fabric 34 over the laps 22 of the first layer of fabric 20 , so that the laps 36 of the second fabric layer 34 are staggered in relation to the laps 22 in the first fabric layer 20 . this second layer of fabric 34 is then rolled and pushed into the polymer 32 to provide complete anchorage and bonding to the first layer of fabric 20 . the first full coat 32 of polymer is then allowed to dry for 4 to 8 hours , depending on drying conditions . 11 . a second full coat 38 of elastomeric polymer is applied over the second layer of fabric 34 at a rate which will completely fill the voids in the second layer of fabric . this coating is then allowed to thoroughly dry . 12 . a final finish coat 40 of elastomeric polymer is then applied to leave a smooth , continuous and weatherproof coating . the membrane , constructed by the foregoing steps , is preferably extended to the cant strip 26 of the roof , up the parapet wall 28 and over the top of the parapet 28 to completely cup the parapet , as shown in fig2 . in the preferred embodiment , the roofing felt 16 is extended partially up the parapet wall , thereby covering only the lower portion of the parapet 28 . thus , the coats of elastomeric polymer 30 and 32 will bond , continuously adhere and seal the membrane to the upper portion of the parapet 28 , thereby protecting the parapet 28 and preventing seepage of water under the membrane . the foregoing procedure for sealing the parapet can also be used for sealing around roof penetrations and projections , regardless of shape , thus eliminating the need for sheet metal flashing . essentially , the roofing membrane of this invention will conform to any roof shape , flat or sloping , in such a manner to produce a continuous weatherproof membrane . in the preferred step by step of construction above described , two layers of reinforcing fabric are utilized . however , it is to be understood that additional fabric layers may be utilized if desired , provided that at least the bottom layer , but not the top layer , is spot anchored to the roof . in the foregoing steps 8 , 9 , 11 and 12 , four coats of elastomeric polymer are applied , namely a starve coat , a first full coat , a second full coat and a finish coat . the starve coat is desirable , but not strictly required , as its function is to increase the tensile strength of the first fabric layer . likewise , the finish coat is not strictly necessary as its primary function is to provide a smooth finish to the membrane . the waterproofing and bonding functions of the two full coats could be accomplished with one heavy coat . however , it has been found desirable to apply several thin coats as disclosed to reduce the required drying time , prevent cracking that can occur with a heavy coat and to insure total film curing . finally , while the preferred embodiments of the roofing membrane and the method of constructing the same have been illustrated and described herein , it is to be appreciated that changes , modifications and variations may be made therein without departing from the scope of the invention as defined by the appended claims .	8
in the following , an embodiment of this invention will be explained by referring to the drawings . [ 0038 ] fig1 is a block diagram showing the structure of an electronic camera according to this embodiment of the invention . in fig1 the image sensing system 1 including a photographing lens and an image sensing device such as a ccd sensor converts an image of a photographic object into image data and outputs them , on the basis of a drive signal from the user interface 3 including a release switch etc . the outputted image data are once stored in the memory 5 temporarily , and then , after they are subjected to compression processing and gradation correction in the image processing means 2 , they are supposed to be stored as stored in the memory medium 4 such as a memory card . in addition , in this embodiment , the image processing means 2 is also used as the recording means for performing the data recording in the memory medium 4 . next , the method of image data processing in an electronic camera of this embodiment will be explained . fig2 is a drawing showing an example of an image photographed by an electronic camera , and fig3 is a flow chart showing the operation practiced in the image processing means 2 . first , it is assumed that image data are obtained by the image sensing system 1 and stored in the memory 5 . such image data are divided into a plurality of blocks by the image processing means 2 for the convenience of processing in it . in the step s 101 in fig3 the image processing means 2 starts compression processing on the basis of the preset quantization table . because the image data are arranged in lines from the upper left portion of the image g in fig2 toward the right direction in such a manner as to connect the lines to one another , compression processing is carried out in this order . after the compression processing for the first block ( 1 ) is finished ( step s 102 ), the image processing means 2 judges , in the step s 103 , whether the file size of the block ( 1 ) which has been just compression - processed exceeds the specified file size or not . in the above statement , the specified file size means a target file size in the case where all the blocks of the image g , for example , are subjected to compression processing . if the image processing means 2 judges that the file size of the compression - processed block ( 1 ) does not exceeds the specified file size , it continues to carry out compression processing on and after the succeeding block ( 2 ). on the other hand , if it judges that the file size of the block ( 1 ) exceeds the specified file size , it alters the quantization table to make the ratio of compression higher ( step s 104 ). [ 0043 ] fig4 ( a )- 1 to fig4 ( c )- 4 are drawings showing the examples of the relation between quantization tables and file sizes . the scene ( 1 ) shown in fig4 ( a ) is a high frequency image , the scene ( 3 ) is a low frequency image , and the scene ( 2 ) is an image having a frequency intermediate between the scene ( 1 ) and scene ( 3 ). the results presenting the file sizes after compression processing when compression processing using the quantization tables ( 1 ) to ( 4 ) shown in fig4 ( c )- 1 to fig4 ( c )- 4 respectively is applied to the image data obtained by photographing these images are shown in fig4 ( b ). the quantization tables shown in fig4 ( c )- 1 to fig4 ( c )- 4 give compression ratio which are made larger in the order from ( 1 ) to ( 4 ). moreover , as clearly understood from fig4 ( b ), the file size after compression processing becomes smaller the higher compression ratio is raised , and the file size after compression processing becomes larger the higher the frequency of the image data becomes . [ 0045 ] fig5 ( a ) and fig5 ( b ) are drawings showing the quantization table before alteration and the quantization table after alteration in comparison . the quantization table to be set after n - th alteration is determined on the basis of the following expression : where αn denotes an arbitrary coefficient . further , it is preferable that the n - th quantization table is expressed by the following equation by substituting (( number of total blocks )/( number of processed blocks ))×( n - th coefficient ) for αn : n - th quantization table =( quantization table determined by ( n − 1 ) th alteration )×(( number of total blocks )/( number of processed blocks ))×( n - th coefficient ). in the above expression , when n = 1 , the “ quantization table determined by ( n − 1 ) th alteration ” means the specified quantization table that has been stored . further , the “ number of total blocks ” means the total number of divisional blocks when the image data are divided into blocks , and the “ number of processed blocks ” means the cumulative number of blocks to which compression processing has been applied by using the quantization table before the alteration of the quantization table . to take the value of the last element in the quantization table , in the example shown in fig5 ( a ) and fig5 ( b ), for example , in the case where the number of total blocks is 7500 and the number of processed blocks is 5200 , after n - th coefficient is made 2 , the values are substituted for the terms in the right - hand side of the above expression ; then , 10 ( the last element value in the quantization table before alteration )× 7500 / 5200 × 2 = 28 ( the last element value in the quantization table after alteration ) can be obtained . it is preferable that the n - th coefficient is a value that increases in accordance with the number of times of alteration of the quantization table . if this is made to be constant , in the case where the file size of image data after compression processing is considerably large , it becomes necessary to alter the quantization table several times until the file size becomes the specified file size or under , and a long time is estimated for the procedure . therefore , it is judged that the file size becomes larger the more the number of times of alteration becomes , and unnecessary compression processing can be avoided by making the n - th coefficient variable to increase in accordance with the number of times of alteration ( for example , to make it power of n ). further , for the technique of determining the n - th coefficient , it can be also considered to make it a value that is proportional to the difference between the file size of the block before compression processing and the specified file size . as explained in the foregoing , the operation such that the sum of the file sizes of the blocks which have been compression - processed block by block is successively compared with the specified file size is continued until the last block ( step s 105 ); then , if the file size after compression processing does not exceed the specified file size , the image processing means 2 completes compression processing , and the image data that have been compression - processed are stored in the memory medium 4 . the method of image data processing of this embodiment is practically effective in a use to be described in the following . that is , the maximum file sizes in the respective image quality modes of an electronic camera are made to be 800 kb ( superfine mode ), 400 kb ( fine mode ), and 100 kb ( normal mode ), and only image data that exceeds the above size concerned are to be subjected to compression processing . by doing this way , it is understood that , in the case where image data are stored in a memory medium of 8 mb , 10 image frames and more ( in superfine mode ), 20 image frames and more ( in fine mode ), and 80 image frames and more ( in normal mode ) can be sensed without fail . further , when the remaining capacity of the memory medium becomes small , 700 kb for example , in the case where image sensing is done in the superfine mode , by changing the specified file size to 700 kb , the remaining number of frames for photographing can be exactly displayed as one frame for example . in this case , it can also be considered to change the above - mentioned n - th coefficient . on the other hand , in the case where image sensing is done in the fine mode , by making the image data of the first frame 400 kb or under and the image data of the second frame 300 kb , the remaining number of frames to be photographed can be exactly displayed as two frames , and this can be actualized ; therefore , an electronic camera that is more friendly to users can be provided . according to the method of processing image data of this embodiment , a pre - processing which has been necessary for a conventional compression processing of fixed length is not required , it is also unnecessary to take the trouble to make image data having small file size large , and it is possible to secure the number of image frames to be stored in a memory medium of constant memory capacity by applying compression processing to image data having a large file size only . up to now , this invention has been explained by referring to an embodiment , but this invention should not be construed as limited to the above - mentioned embodiment , and it is a matter of course that the invention can be suitably altered and improved . according to this invention , it is possible to provide an image data processing method and an electronic camera which is capable of securing the number of image frames of the image data to be stored in the memory medium while supressing the processing time for image data .	7
referring to fig1 , a preferred embodiment of apparatus is disclosed . the invention comprises an engine 1 connected to a transmission 4 . the engine 1 may be connected through a clutch or may be connected through fixed gears or shafting . a first motor / generator 2 is connected to the shaft either on the engine 1 or the transmission 4 side of the engine / transmission interface . the transmission 4 transfers power from the engine 1 and first motor / generator 2 through the transmission 4 to the driveshaft 15 , differential 9 , and then the axle 10 and the wheels 11 . a second motor / generator 3 is connected to the transmission 4 at a point in the transmission 4 closer to the output . the drivetrain may use zero , one , two , or three clutches to selectively disengage the engine 1 or an individual motor / generator 2 , 3 . the drivetrain comprises the driveshaft 15 and differential 9 , which both may be part of the transmission 4 or separate from it , and the axle 10 or split shaft . the motor / generators 2 , 3 may be mounted in - line with the drive train or may be connected to the drivetrain through gears , belts or chains , or hydraulics . the battery 7 preferentially uses lithium chemistry but may also use nimh , nicad , or pb : acid . the fast energy storage device 8 may comprise a flywheel , a capacitor , or a high power battery . preferentially , the flywheel uses a high - speed rotor housed in an evacuated chamber and integral electronics to drive the flywheel . alternatively , the flywheel may be of any type that incorporates a rotor and built in motor / generator so that energy may be stored and retrieved electrically . the capacitor may be of any type including super capacitors , ultra capacitors and electrolytic capacitors . the fast energy storage device 8 may have an energy storage capacity that is considerably smaller than the capacity of the battery 7 . in the preferred embodiment , the engine 1 is a small piston engine 1 fueled with gasoline . alternatively , the engine 1 may be an internal combustion engine 1 fueled with gasoline , ethanol , flex - fuel , diesel fuel , bio - diesel , natural gas , propane , or hydrogen . a fast energy storage device 8 and a battery 7 are connected to a power converter and controller 6 . the power converter and controller 6 directs the flow of energy between the flywheel or capacitor 8 , the battery 7 , the first motor / generator 2 and the second motor / generator 3 . all the elements that store or use electricity ( 2 , 3 , 7 , and 8 ) may either source or sink electricity . the power converter and controller 6 may comprise a single assembly or subassemblies . the subassemblies may be collocated within a single module or they may be housed as separate modules . they may be located together or dispersed throughout the vehicle . the interface between the vehicle and the grid may comprise a plug and receptacle 12 where ac power to the vehicle is converted to dc power on - board . the ac supply may by 110v , 220v , 480v single or three phase or other commercially supplied ac electricity . alternatively , a stationary v2g interface 13 that has bi - directional power handling capability may provide v2g service . the stationary v2g interface 13 may communicate with a utility in order to dispatch the v2g resource or to allow isolation by the utility . the stationary v2g interface 13 may connect to the vehicle through a dc or ac link and a plug / receptacle 12 . operation of the invention involves driving in a number of different modes of operation . in the first driving mode , the engine 1 supplies motive power to the wheels 11 and the first motor / generator 2 and the second motor / generator 3 are free to rotate but are not energized . in the second driving mode of operation , the engine 1 is turned off and all motive power is provided using either the first motor / generator 2 or the second motor / generator 3 or both . this mode is referred to as ev mode . in this mode , electrical energy is supplied by either the fast energy storage device 8 and the battery 7 in a combination determined by the power converter and controller 6 . in the third driving mode of operation , motive power is provided by both the engine 1 and either the first motor / generator 2 , the second motor / generator 3 or both motor / generators . in this mode , electrical energy is supplied by either the fast energy storage device 8 and / or the battery 7 in a combination determined by the power converter and controller 6 . in the fourth driving mode of operation , the vehicle is decelerating or descending on a grade and energy is recovered regeneratively . in this mode of operation , retarding torque is applied to the transmission 4 by either the first motor / generator 2 , the second motor / generator 3 or both motor / generators . in this mode of operation , one or both motor / generators functions as generators and convert recovered kinetic energy of the vehicle into electricity . the electricity is delivered to either the fast energy storage device 8 or the battery 7 . the flow of electricity to the energy storage devices is directed by the power converter and controller 6 . in this mode of operation , the engine 1 may be rotating or not rotating . in the fifth driving mode of operation , the engine 1 drives the first motor / generator 2 so that it produces electricity to charge the battery 7 or the fast energy storage device 8 or both in a combination determined by the power converter and controller 6 . in this mode , the vehicle may be either stopped or moving . in the first v2g mode of operation , the grid sources energy through the stationary v2g interface 13 to the plug / receptacle 12 and subsequently the power converter and controller 6 . the controller 6 uses this energy to charge either the fast energy storage device 8 or the battery 7 or both . in the second v2g mode of operation , energy from the fast energy storage device 8 is extracted by the power converter and controller 6 and supplied to the grid 14 via the plug / receptacle 12 and the stationary v2g interface 13 . in the third v2g mode of operation , energy from battery 7 is extracted by the power converter and controller 6 and supplied to the grid 14 via the plug / receptacle 12 and the stationary v2g interface 13 . in the fourth v2g mode of operation , energy from engine 1 is converted to electricity by either or both of the motor generators 2 and 3 and is then extracted by the power converter and controller 6 and supplied to the grid 14 via the plug / receptacle 12 and the stationary v2g interface 13 . any of the modes of v2g operation may be commanded automatically by software residing in the vehicle or may be commanded by an outside entity such as a utility , an independent system operator , an aggregator of services , or any other end user . the fast energy storage device 8 is tolerant of frequent cycling and high power operation while the battery 7 is not . in all modes of operation , the power converter and controller 6 typically directs the flow of energy such that the number of charge and discharge events experienced by the battery 7 is minimized . additionally , the fast energy storage device 8 is operated to minimize the magnitude and extent of high power operation of the battery 7 . by protecting the battery 7 from excessive cycling and excessive high power operation , several benefits accrue . the durability of the combined energy storage system is improved compared to using a battery 7 without a fast energy storage device 8 . the battery 7 may be operated over a deeper depth of discharge than would otherwise be possible without the protection of the fast energy storage device 8 . thus a given all - electric range of travel can be attained with a much smaller battery 7 than would be possible without the protection of a fast energy storage device 8 . many other modes are possible where the functions of the five defined modes are used in combination . many variations of the invention will occur to those skilled in the art . referring to fig2 , the first variation uses one or more clutches 5 to selectively disengage the engine 1 , the first motor / generator 2 or the second motor / generator 3 . referring to fig3 , a second variation is the parallel configuration in which only one motor / generator ( the first motor / generator 2 ) is used . the transmission 4 may be an automatic or manual transmission that may include zero , one , or two clutches 5 . in either the first variation or the second variation , the transmission 4 may support two - wheel drive as shown . alternatively , the transmission 4 may be capable of full time or part time four - wheel drive . referring to fig4 , the third variation eliminates the transmission 4 entirely . in this case , the first motor / generator 2 is connected directly to the engine 1 . the first motor / generator 2 functions primarily as a generator but may also function as a motor that could be used to start the engine 1 . the second motor / generator 3 powers the wheels 11 directly or indirectly . the second motor / generator 3 is connected to the differential 9 , the driveshaft , or the wheels 11 directly . the second motor / generator 3 may be connected through fixed gearing or other compact and limited drivetrain components or subassemblies . all motive power is transmitted from a point of point of generation or storage to the drive motor electrically . this configuration is a series plug - in hybrid or a series hybrid . referring to fig5 , a fourth variation uses multiple drive motors instead of a single second motor / generator 3 . referring to fig6 , a fifth variation uses the series hybrid configuration from above and uses a fuel cell to generate electricity . the fuel cell replaces the engine 1 and the first motor / generator 2 . in this variation , a fast energy storage device 8 and a battery 7 are connected to a power converter and controller 6 . the power converter and controller 6 directs the flow of power between the fast energy storage device 8 , the battery 7 , and the second motor / generator 3 . all the elements that store or use electricity ( 3 , 7 , and 8 ) may either source or sink electricity . in this variation the fast energy storage device 8 protects the battery 7 from severe or frequent charge and discharge events . additionally , in this configuration , the fast energy storage device 8 protects the fuel cell 16 by providing immediate power for acceleration where the fuel cell has poor throttle response and could be damaged by such an event . fig7 and 9 disclose the details of the power converter and controller 6 . fig7 shows nomenclature for a switch 17 comprising a diode 29 and a solid - state switching device 30 . preferentially , the solid - state switching device 30 is an insulated gate bipolar transistor ( igbt ) although other switching devices may be used . the switch 29 is commanded to open or close through signals from the controller to the gate drive 27 . fig8 and 9 indicate the controller 28 that issues commands to each switch 29 in the system . for clarity , only a few representative connections are shown . in practice , all switches 29 receive input from the controller 28 . additionally , the controller 28 may receive information from each switch 29 including temperature , state ( open or closed ), and fault condition ( clear , warning , fault ). each switch 29 is switched open or closed in response to a command from the controller 28 . switching is conducted to energize or disable components or subsystems , for commutation , chopping , or to synthesize an ac waveform . the power ratings of the attached devices vary . the corresponding power ratings of the associated switches 15 may also vary in order to allow minimization of the overall size , weight and cost of the power converter and controller 6 . the power converter and controller 6 has a dc bus with one bus bar 18 at elevated potential and a second bus 19 at a common potential . an h - bridge leg comprises two switches 29 connected in series where the pair of switches 29 connect the two bus bars of the dc bus 18 , 19 and the point between the switches connects to one phase leg of the connected ac device . a dc bus capacitor 20 serves several purposes individually or simultaneously . mainly , the bus capacitor 20 provides dynamic energy storage necessary for the motor drive and buck - boost functions conducted by the inverter legs . a single dc bus capacitor 20 serves all of the phase legs in the power converter and controller 6 . the power converter and controller 6 sources or sinks power from the motor / generators , 2 , 3 , 31 flywheel fast energy storage 26 , and the charging port 24 in ac format . the h - bridge legs of the power converter and controller can operate as a rectifier , an active rectifier , a motor drive , or an ac inverter in order to interface with these devices . the h - bridge legs may also function as a chopper , or perform any other power processing accomplished by switching , such as those used for dc - dc conversion . these configurations are used for the interface to the battery 7 and the fast energy storage capacitor 8 . inductance is required for buck - boost functions and as part of the motor drive circuitry . motors have non - negligible inductance that may be sufficient for this purpose . for devices with low inherent inductance such as batteries 7 or energy storage capacitors 8 , an inductor 21 may be incorporated in the circuit . for motors mg 1 2 , mg 2 3 , mgr 31 , and the motor / generator in the flywheel 26 , portions of the power converter and controller 6 function as a bi - directional motor drive . three - phase drive is typical but other numbers of phases may be used as well . fig3 and 4 show 3 - phase drive configurations . to produce torque , a number of control strategies may be implemented including pulse width modulation ( pwm ), space vector control , and simple commutation . buck / boost converters perform dc to dc voltage conversion by using high frequency switching to cause dynamic response in an inductance . a capacitor 20 smooths out transients associated with the switching frequency of the converter . an inductor 21 or inherent inductance , a capacitor 20 , and a switch 15 are required to perform either a buck or boost function . fig8 and 9 show buck / boost circuits for the battery 7 . fig8 shows a buck / boost circuit for the fast energy capacitor 8 . in these examples , the use of two switches 17 for each buck / boost stage allows the inductor 21 and the capacitor 20 to be used for either buck or boost operation without reconfiguration . buck / boost converters are used for dc - dc conversion for higher power attached devices . an ac link 23 and transformers 22 are used for ac voltage conversion to the charger port 24 . an internal ac link 23 is used to allow transformation to a lower voltage so that a separate inverter subassembly can provide lower voltage output ( 12v , 42v ) at the dc supply ports 25 . the charger port 24 is shown as a single - phase system but a 3 - phase system may be used as well . when the vehicle is at rest and connected to a utility grid , the charger circuitry may deliver energy to the dc bus 18 , 19 and from there to any of the attached devices . during v2g operation , energy from the battery 7 , fast energy system 8 , 26 or engine 1 via mg 1 2 may be delivered to the grid . the dc output ports 25 are energized by a small active rectifier that operates at a voltage that is different from the voltage of the principal dc bus 18 , 19 . this active rectifier uses switches 17 of the type used throughout the power converter and controller 6 and communicate with the controller 28 . the configuration shown in fig8 and 9 can source low power dc at two voltages , preferentially 12v and 42v . all such variations are intended to be within the scope and spirit of the invention .	8
the present invention provides improved wall panels and improved methods for manufacturing the same . the panels of the invention comprise multiple layers , each designed to impart the panel a particular functionality and / or benefit , while the method of the invention for fabricating the multi - layer panel as one integral unit with no mechanical fasteners between elements , further imparts the panel structural stability and enhanced flatness and smoothness . in accordance with the novel method of the invention , the different layers of the panel are bonded to each other under pressure by one compression step rather than being fastened to each other by mechanical fasteners such as screws and bolts . besides enhancing stability and appearance , this allows for manufacturing extra large panels which significantly reduces the number of joints and consequently reduces site work and cost as well as the amount of defects that might be introduced during joints assembling . referring to the fig1 - 4 , there is shown a wall panel , generally designated 10 , in accordance with one embodiment of the invention . wall 10 comprises a core layer 20 , an interior insulating and utility installation layer 30 , an exterior sheet 40 and an interior sheet 50 . layers 20 , 30 , 40 and 50 are bonded to each other to form one integral panel having two opposite smooth planar surfaces defined by the outward faces of sheets 40 and 50 . panel 10 further comprises a top frame member 64 and a bottom frame member 62 which together with members 25 of core layer 20 form a peripheral metal frame 60 that encompasses panel 10 to enhance the panel structural stability and to allow weld - joining to adjacent panels as well as to ceiling and floor . frame 60 is illustrated in fig5 . core layer 20 comprises at least two rectangular , preferably square , tubular metal members 25 extending about the full length l of panel 10 and one or more interior sandwich panels 22 extending between members 25 and in contact therewith to fill the space therebetween . members 25 and panels 22 are of the same length and thickness so as to form a mattress - like layer having two opposite flat faces , a flat top edge and a flat bottom edge . the outward sides 26 of members 25 define the side edges of layer 20 . members 25 constitute the main load - bearing construction elements of panel 10 and therefore should be distributed at appropriate intervals . thus , depending on the size of panel 10 and on the total construction requirements , one or more additional members 25 may be incorporated into layer 20 between panels 22 . in practice , frame members 62 and 64 are welded to members 25 to form structural metal frame 60 , which is incorporated into panel 10 at the manufacturing process as explained below . interior panels 22 are sandwich panels comprising an insulating core material 24 sandwiched between opposite skins 26 and 28 . preferably , skins 26 and 28 are metal sheets , preferably 0 . 2 - 0 . 8 mm thick steel sheets . skins 26 and 28 serve as vapor barrier between the interior and exterior of panel 10 . insulating material 24 may be any insulating material and may be in the form of prefabricated blocks or as a bulk material . possible materials for insulator 24 include mineral wool , expanded or extruded polymer foam or polymer fibers , timber blocks or wood fibers and the like . preferably , insulator 24 is mineral wool of 100 - 140 kg / m 3 density . however , insulator 24 may be selected in accordance to the thermal and acoustic insulation requirements at the particular location where the building is to be built . thus , for rough weather conditions where thermal insulation is crucial , insulator 24 is preferably polyurethane or polystyrene foam while under milder weather conditions insulator 24 is preferably mineral wool , being a better acoustic insulator . sandwich panels 22 may be prefabricated off - the - shelf panels or may be especially fabricated to suit particular insulation and dimensional requirements . alternatively , when insulating material 24 is in the form of blocks , panels 22 may be formed during the manufacturing process of panel 10 . the width ( horizontal dimension ) of panels 22 can vary and is mainly determined by the width of available metal sheets . when layer 20 comprises more than one panel 22 , panels 22 are abutted against each other to form continuous insulating layer between the two metal skins . fig6 a and 6b illustrate two possible embodiments for abutting and joining sandwich panels 22 to each other to form a continuous layer . according to the embodiment illustrated in fig6 a , the exterior skins 26 and 28 of panel 22 a extend to some extent 26 a and 28 a , respectively , beyond insulator 24 so that when the panels are abutted against each other , portion 26 a overlap skin 26 of adjacent panel and portion 28 a overlap skin 28 of adjacent panel , in a slate - like manner . according to the embodiment illustrated in fig6 b , additional skins 23 are placed against both skins 28 and 26 along the seam line between adjacent panels 22 b . in accordance with both embodiments , the continuous overlapping exterior contact between adjacent panels reinforces layer 20 and enhances its structural stability . it will be realized that since the metal skins of panels 22 are only a fraction of a millimeter thick , the double - skin overlapping areas at the vicinity of seam lines do not affect the face smoothness of layer 20 to any significant extent . next to core layer 20 toward the interior face of panel 10 , is insulating and utility installation layer 30 . in accordance with the embodiment illustrated in fig1 - 7 , the interior insulating layer 30 comprises a plurality of spaced - apart elongated insulating blocks 32 , preferably of a rectangular cross section , disposed between core layer 20 and interior sheet 40 . blocks 32 are preferably made of a water - proof closed - cell polymer foam such as expanded polystyrene . however , at areas where additional strength is required , such as for example where cupboards are to be suspended from the wall , polymer blocks may be replaced by structured wood blocks in metal profiles for enhancing anchoring force of cupboard to wall . elongated blocks 32 of length li extend longitudinally between bottom frame member 62 and horizontal beam 67 of top frame member 64 . length li corresponds to the interior height of the building . blocks 32 , preferably about 40 to 100 mm thick and about 100 to 300 mm wide , are equally spaced , leaving elongated channels 33 therebetween . channels 33 are of preferably narrower dimensions than that of blocks 32 so that layer 30 comprises of about 75 % solid and about 25 % space . channels 33 allow for installation of utility lines such as electrical wiring , plumbing pipes , communication lines etc ., as best seen in fig7 . a plurality of openings 65 a and 65 b provided at bottom frame 62 and beam 67 , respectively , in alignment with channels 33 allow for threading the utility lines through the frame for connection to utility hubs installed under floor and / or above ceiling . the interior faces of blocks 32 , opposite the faces in contact with panels 22 , are covered by interior sheet 50 of length li . interior sheet 50 may be of any building material suitable as interior wall including a gypsum board , a cement board , a timber board and the like . preferably sheet 50 is an off - the - shelf gypsum board of 9 to 32 mm thickness . it will be appreciated that panel 10 requires no further finishing on the interior side of the building as it is well known in the art to cover inner surfaces with gypsum boards . exterior sheet 40 , of length l , bonded on the outward surface of core layer 20 may be of any durable building material suitable for withstanding the climate conditions where the building is to be located , including cement , timber , metal , reinforces polymer sheets and the like . preferably , sheet 40 is a cement board of 7 . 5 to 20 mm thick . it will be appreciated that although not necessary , any type of cladding ( i . e . siding , stucco , eifs , brick , stone ) may be applied to the interior and / or exterior faces of the panel similar to traditional construction methods . the cladding may be applied at the manufacturing site or may be applied later at the construction site after the building is erected . it will be appreciated that the structure of wall 10 is designed such that there is minimum continuous metal thermal conductive path from one face of the wall to opposite face . it will be further appreciated that the interior sandwich panel of the core layer serve as vapor barrier between inside and outside . referring to fig5 , there is illustrated metal frame 60 that encompasses the peripheral edges of layers 20 and 30 of panel 10 . layers 40 and 50 are bonded to the opposite outermost surfaces of frame 60 as best seen in fig4 and 7 . frame 60 comprises a bottom frame member 62 , an upper frame member 64 and two vertical load - bearing members 25 . frame members 62 and 64 extend the full width of panel 10 and are each having a profile comprising of vertical and horizontal sections configured to receive the layers of panel 10 and to allow metal welding to corresponding metal frames in floor and ceiling . thus , top member 64 comprises upper and lower l - shaped profile sections 66 and 67 , respectively , directed at opposite directions and connected by vertical section 61 . similarly , bottom frame member 62 comprises two l - shaped profile sections 63 and 68 connected by vertical section 69 . core layer 20 of length l is accommodated between the horizontal sections of sections 66 and 63 while blocks 32 of layer 30 , having length li , are inserted between l - shaped sections 67 and 68 and are positioned between openings 65 a and 65 b to provide openings into the channels 33 that are formed between the blocks as best seen in fig1 . the overall combined thickness t of panel 10 is preferably in the range of 120 to 300 mm , where the core layer 20 is about 80 - 140 mm thick , the interior insulating layer 30 is about 40 - 100 mm thick , the interior sheet 50 is about 9 - 32 mm thick and the exterior sheet is about 7 . 5 to 20 mm thick . the vertical dimensions of panel 10 , l and li , correspond to the exterior and interior heights of the building , respectively , and are determined according to construction plan . preferably , l is in the range of 3 to 4 m , while li is 20 to 60 cm shorter . the horizontal dimension of panel 10 can be of up to 15 m , meaning that for some buildings , depending on the building size , a complete wall can be prefabricated as one integral piece having continuous smooth flat surfaces . it will be appreciated that the possibility to provide an extra - large multi - layer wall panel significantly reduces assembling work and cost . it will be also appreciated that as no mechanical fasteners are required for joining the multiple layers to each other or for joining adjacent portions of the same layer in order to form a larger component , the structural integrity and stability of the panel as well as surface flatness and smoothness , are significantly enhanced compared with prior art panels . furthermore , the unique multi - later structure of panel 10 provides high level of thermal and acoustic insulation , vapor barrier properties , easiness of installation of utility lines and enhanced flexibility in tailoring the wall panels to fit specific construction requirements . referring to fig7 , there is depicted a vertical cut through a building having walls made of panels 10 , showing panel 10 joined to floor 80 and roof 90 . as can be seen bottom profile 62 of panel 10 is welded to foundation frame 82 , which also supports the floor reinforcing beams 84 . at its upper end , panel 10 is welded to reinforcing roof beams 92 . a utility line , designated 70 , running through channel 33 of layer 30 , may connect to a central utility line 71 that runs under the flooring 86 through opening 65 b in frame 60 and / or to utility line 72 running above ceiling 96 through opening 65 a . utility line 70 may be an electrical wiring , a water or a heating pipe , a communication line such as an optic fiber or a telephone line , etc . it will be appreciated that panel structure allows for easy installation of such utility lines to be connected to central utility hubs under floor or above ceiling , by providing prefabricated infrastructure channels at a relatively high density . layer 30 further facilitates guiding the utility lines and keeping them separated from each other . an alternative embodiment of panel 10 , generally designated 110 , is illustrated in fig8 - 10 . in accordance with this embodiment , the insulating utility - installation layer 30 of panel 10 is replaced by layer 130 . layer 130 comprises a solid body 131 of insulating material provided with a plurality of prefabricated utility channels 132 that run the full length of body 131 between top and bottom edges , extending between top openings 135 and bottom openings ( not shown ). layer 130 is preferably made of expanded polystyrene . channels 132 are preferably of oval cross section and are located closer to the inner face of layer 130 . the other layers of panel 110 are similar to layers 20 , 40 and 50 described above in association with fig1 - 6 . however , in accordance with this embodiment , upper and lower frame members 164 and 162 are simpler in shape than frame members 62 and 64 of panel 10 and do not include openings . referring to fig1 , unlike frame members 62 and 64 , frame members 162 and 164 end toward the interior face of the panel with horizontal sections 161 and 163 , respectively , and do not include a vertical section . sections 161 and 163 extend up to openings 135 in layer 130 so as not to cover the openings . it will be realized that since layer 130 comprises one integral piece , there is no need to provide further vertical elements in frames 162 and 164 . embodiment 110 has the advantage of reducing panel assembling time as compared with panel 10 since layer 130 is placed as one piece instead of placing a plurality of separated blocks . layer 130 also has the advantage of continuous and larger contact surfaces with adjacent layer , thus increasing the panel structural stability . furthermore , in accordance with the structure of panel 110 , sheet 50 is supported by layer 30 only and is not in contact with metal frame 60 , such that there is no metal continuity between outer and inner sheets 40 and 50 . this prevents any thermal conductivity between interior and exterior faces and provides higher level of thermal isolation . turning now to fig1 , the present invention provides a novel method for fabricating multi - layer building panels by forming a horizontal stack of the multiple layers with intermediate layers of adhesive therebetween , and subjecting the stack to pressure , thereby bonding the layers to each other in a single operation . compression may be applied either mechanically by a compression plate or by means of a vacuum device . in either case , the panels are uniformly pressurized . fig1 demonstrate the fabrication process of a panel in accordance with embodiment 10 . it will be easily realized that the fabrication of a modified panel , such as panel 110 , is performed in a similar manner . in accordance with the panel fabrication method of the invention , the multiple layers are orderly placed horizontally on a working table 200 comprising a horizontal working plate 205 supported on legs 204 . the layers are placed one above the other wherein the yet - free upper surface of each layer is sprayed to be covered by a layer of adhesive before the next layer is placed over it . the steel frame , consisting of the two tubular columns and the top and bottom frame members , is incorporated into the panel at the appropriate stage in accordance with the specific structure of the panel in hand . thus , referring to fig1 , demonstrating fabrication of panel 10 , the first layer to be placed on working surface 205 is interior sheet 50 . the sheet is sprayed with adhesive layer and frame 60 is placed over its periphery . two vertical supporting beams 208 and 210 configured to conform with the dimensions and with the upper and lower profiles of the multi - layer panel , are mounted along opposite sides of table 200 to support the panel during fabrication process and to facilitate alignment of the layers . beams 208 and 210 are preferably removably mounted to plate 205 such as to allow the selection of beams in accordance with the panel in hand . after frame 60 is appropriately placed over sheet 50 , supported on beams 208 and 210 , the plurality of insulating blocks 32 are placed over sheet 50 to form insulating layer 30 . blocks 32 are inserted between sections 68 and 67 of frame 60 which guide appropriate placing and help to align the blocks . next , blocks 32 are sprayed by adhesive and core layer 20 is placed over layer 30 and over sections 61 and 69 of frame 60 . the upper surface of layer 30 is then sprayed to be coated by an additional adhesive layer and exterior sheet 40 is placed over layer 20 , peripherally supported on and in alignment with the outermost surface of frame 60 . a pressure p is then uniformly applied on the multiple layers until the adhesive is cured for reinforcing bonding between layers , forming one integral piece . preferably the pressure applied is in the range of 0 . 2 to 0 . 6 kg / cm 2 . it will be easily realized that a panel of structure 110 is similarly fabricated with the exception of mounting frame 160 onto layer 30 after the later is already placed over sheet 50 . it will be also realized that layers 20 , 40 and 50 , as well as layer 130 in case of embodiment 110 , may consist of one piece or may consist of a number of portions abutted against each other to form a continuous layer when placed over table 200 . it will be appreciated that the dimensions of such portions is mainly determined by market availability . the adhesive used to bond the layers to each other is preferably sprayable one - component or tow - component polyurethane adhesive such as polyurethane adhesives distributed by sika ag . as mentioned above , pressure p may be applied by a compression plate 125 pressed from above , as illustrated in fig1 , or alternatively may be applied by means of a vacuum manifold ( not shown ) coupled to table 200 . in the later case , the vacuum manifold may be coupled to peripheral channels that circumferences plate 205 and open inwardly . a flexible air - impermeable cover is then used for entirely covering the table , including the table channels and the pre - assembled layers laying on the table , in an air - tight manner . as the vacuum manifold is activated , the cover is evacuated to form sub - atmospheric pressure under the cover to apply uniform pressure on the pre - assembled panel . it will be appreciated that the method of the invention allows for enhanced flexibility in designing a wall panel in terms of the panel dimensions and the panel specific structure , to be tailored to specific requirements depending on location of the building and the location of the specific panel in relation to the building . it will be further realized that the fact that during assembling , the layers of the panel are horizontally displayed one following the other , enhances the easiness by which different materials may be selected for specific zones within the same panel in order to optimize the panel functionality . for example , when knowing in advance where cupboards are to be installed , the insulator material of interior insulating layer 30 ( or 130 ) at the known locations may be specifically selected as wood blocks , instead of the polystyrene foam , for enhancing connection strength between cupboard and wall . further , threading of utility lines may be performed while the panel is still in horizontal position or even before completion of the assembling process . fig1 illustrates a wall panel provided with a prefabricated opening adapted to receive a window frame . panel 310 is a composite panel of substantially the same multi - layered structure as of panel 10 or panel 110 described above . portions of core layer 20 and insulating layer 30 ( or 130 ) are cut - out to form an opening 350 . two vertical metal studs 328 extending the full length of the panel are added to metal frame 360 for reinforcing the panel around the opening . it will be realized that the portions of layers 20 and 30 need not actually being cut out but instead layers portions of appropriate size may be placed above and below the opening during fabrication . a window frame 352 is already incorporated into the panel . in order to protect frame 352 during transportation , inner and outer sheets 50 and 40 fully cover the panel when fabricated . after installation of the panels at the construction site , portions 41 and 51 ( shown in broken lines in fig1 b ) are cut out to expose the opening and for mounting the window on window frame 352 . it will be easily realized that the particular size and location of the window opening may varied and that a door opening may be similarly pre - prepared . fig1 a and 13b are horizontal cuts through a wall and a wall corner , respectively , of a building made of the panels of the invention , showing the joints between panels . panels 10 a and 110 b and 110 b are joined to each other by welding tubular members 25 a and 25 b of adjacent panels either in a parallel for forming a continuous wall or perpendicularly for forming a corner . during fabrication , core layer 20 at the vicinity of tubular members 25 as well as members 25 themselves , is left exposed , namely it is not covered by the other layers , in order to allow accessibility of the welding device to members 25 during weld - joining . after the panels are joined , complementary layer pieces 38 , 48 , and 58 for a continuous wall joint and pairs 34 , 44 and 54 for a corner joint , are added for covering the joints . it will be appreciated by persons skilled in the art that the present invention is not limited to what has been particularly shown and described hereinabove . rather the scope of the present invention is defined only by the claims which follow .	4
referring now in detail to the drawing figures , wherein like reference numerals represent like parts throughout the several views , fig . i shows a staged rotisserie apparatus 10 according to a preferred form of the invention . the staged rotisserie apparatus 10 includes a housing 11 having an inlet end 12 and an outlet end 13 opposite thereto . the housing also includes an inlet 14 covered by an inlet door 16 generally adjacent the inlet end 12 of the housing . the inlet door 16 is pivotally mounted to the housing 11 at a hinge 17 . in this way , the inlet door 16 can be moved between a lowered position for admitting spits manually through the door and a raised position for closing off the inlet end of the housing . adjacent the outlet 13 of the housing 11 , a similar outlet 18 is defined including an outlet door 19 pivotally mounted to the inlet end 13 of the housing 11 by a hinge 21 . the housing 11 is a compact unit that preferably includes unshown viewing windows in the sides and / or in the top for allowing an operator or a customer to view the cooking of poultry within the housing . while a totally enclosed housing with sides and a top is depicted in the drawings , in some instances it may be desirable to eliminate or remove one or more of the sides or the top to provide better visibility and improved access . it is pointed out that the invention has ready application in restaurants serving poultry and that it has additional application in factories preparing prepared ( cooked ) poultry . within the housing 11 the poultry are maintained on spits or skewers s and are moved from the inlet end 12 toward the outlet end 13 . the housing contains mechanisms for heating the poultry in individual heating stations , for rotating the poultry in the heating stations by rotating the spits , and for advancing the spits containing the poultry from one station to the next in sequential fashion . the housing also includes an inlet staging area 20 for containing a queue of poultry spits waiting to be passed to a first cooking station or stage and a warming output station 30 where fully cooked poultry is held in a warm condition until it is retrieved through the outlet door 19 . still referring to fig1 it can be seen that the housing 11 contains six ( 6 ) discrete heating stages or stations for cooking poultry on spits . while six such discrete cooking stages or stations are depicted in the drawing figures , those skilled in the art will recognize that fewer or greater numbers of heating stages can be employed . also , by making the cooking stages discrete from one another , they can be individually controlled to expose the poultry to different temperatures at different points during the cooking process . each cooking station or stage can accommodate one spit s having one or more poultry p mounted thereon . for example , the first cooking stage 31 houses a spit s3 having mounted thereon poultry p . the other cooking stations 32 - 36 are similar . each cooking station includes a pair of burners or heating elements , such as heating elements 22 and 23 associated with the first cooking station 31 . those skilled in the art will recognize that the cooking stations can include briquettes to provide even heating . the heating elements are positioned on either side of the poultry and face the poultry at a slight angle relative to vertical . in this way , the heating elements provide good heat against the sides and bottom of the poultry . as the poultry rotates , all of the surface of the poultry is heated evenly and effectively . the bottom of the heating elements are kept from beneath the poultry so that drippings do not fall onto the heating elements , thereby avoiding flame flare - ups within the rotisserie . also , the tops of the heating elements are shrouded by covers , such as covers 24 and 25 , to prevent drippings from falling onto the heating elements as the poultry and the spits are moved from one cooking station to a sequential cooking station . the other cooking stations 32 - 36 are similarly arranged with pairs of heating elements and covers for the heating elements ( the covers may each cover two heating elements , as shown ). thus , the apparatus 10 includes heating elements 41 - 50 and covers 51 - 55 . as the individual spits s are held within the discrete heating stations or cooking stations 31 - 36 , the spits are continuously rotated by an endless chain 57 driven by an unshown electric motor . the endless chain 57 engages sprockets mounted on the spits . in this way , as chain 57 is driven in rotation by the unshown motor , all of the spits resting atop the endless chain 57 are rotated accordingly . in a lower portion of the housing 11 , a series of drip pans 61 - 70 are arranged . each of the drip pans extends across the width of the housing beneath the various cooking stations , the inlet staging area , and the outlet staging area . these drip pans collect drippings from the poultry to allow the drippings to be collected and removed . the drip pans are placed side - by - side and the space between the drip pans is protected by inverted v - shaped diverters , such as diverter 71 . a cam mechanism generally indicated at 72 is positioned above the drip pans 61 - 70 for raising and lowering the spits . the cam mechanism 72 includes a hydraulic or pneumatic cylinder 73 driving a pushrod 74 for pushing and pulling a cam bank 76 . mounted to the cam bank 76 are a series of identical cams 81 - 86 . each of the cams 81 - 86 engages a cam roller mounted at the bottom end of a cam follower or lifter 91 - 96 . each of the lifters 91 - 96 has an upper end which engages one of the spits when the lifter is raised by operation of the cam block 76 . the upper end or tip of the lifters 91 - 96 is slightly inclined to match the angle of incline of the endless chain 57 . the upper end 97 of lifter 91 is different from the upper end of the other lifters and includes a portion residing beyond the guides and which is generally flag - shaped for cooperating with an inlet control mechanism for triggering the admission of one additional spit into the first cooking station . as shown in the figure , the lifters 91 - 96 are guided by guide surfaces such that back and forth motion of the cam block 76 ( and therefore of the cams 81 - 86 ) in the lateral direction of direction arrow 98 is translated into simultaneous vertical up and down motion of the lifters 91 - 96 in the direction of direction arrow 99 . both fig1 and fig1 a show the inlet control mechanism 100 , with fig1 a showing it in more detail . as shown in fig1 a , the inlet control mechanism comprises a generally f - shaped linkage mechanism 101 . the f - shaped linkage mechanism includes a short f - shaped link 102 and a pivot link 103 . the f - shaped link 102 pivots about a pivot axle 104 , while the pivot link 103 pivots about a pivot axle 106 . two links are coupled to each other by a pin and slot arrangement 107 , with the slot being formed in the bottom leg portion of the f - shaped link 102 , and the pin being attached to the end of pivot link 103 . in this way , motion of the pivot link 103 from its blocking position ( shown in solid line ) to its admission position ( shown in shadow line in fig1 a ) causes the f - shaped link to pivot in a clockwise direction about pivot axle 104 to assume the position shown in shadow in fig1 a . thus , the right - most tine of the f - shaped link 102 ( as seen from the view in fig1 a ) dips below the ramp surface 108 and allows a spit s2 to be admitted past the f - shaped link 102 and to roll or slide down the ramp 108 and fall into the slot of the first cooking station . while the right - most tine allows spit s2 to advance , the other tine of the f - shaped link 102 continues to hold spit si in position . to allow spit si to advance to the position of s2 in fig1 a , the f - shaped link is rotated in the opposite ( counter - clockwise ) direction by an unshown portion of the cam mechanism . fig2 shows the internal workings of the staged rotisserie of fig1 shown from inside the housing and looking down from above . fig2 shows the progression of spits having poultry mounted thereon from the inlet staging area 20 to the outlet staging area 30 in the direction of direction arrow 109 . in particular , fig2 shows the startup of cooking operations and shows a first spit s5 which has progressed about half - way through the staged rotisserie and is in the third cooking station . the first spit s5 is followed by second and third spits s4 and s3 that are in the second and first cooking stations , respectively . the next spit that would be introduced into the first cooking station would be the spit s2 , currently held in the inlet staging area 20 . that would be followed by the fifth spit si and so on . as the spits , such as spit s3 - s5 , are positioned and held in the individual discrete cooking stations , they are rotated continuously by operation of the endless chain 57 . to move the spits from one discrete cooking station to the next , the push rod 74 is retracted by the cylinder 73 to pull all of the cams 81 - 86 toward the cylinder 73 . this has the effect of raising the individual lifters 91 - 96 . the top surfaces of the lifters 91 - 96 engage the underside of the spits , thereby raising the spits with them . once the spits have cleared the top surface of the inclined ramp 111 ( see fig1 ), they roll downwardly along the ramp 111 toward the next discrete cooking station . the cylinder 73 is then operated to extend the push rod 74 , thereby lowering the lifters 91 - 96 . therefore , when each spit reaches the next cooking station , the spit drops into the slot between the guides and the sprockets on the spits once again are engaged by the endless chain 57 . during this lifting of the spits , the flag - shaped end 97 of the first lifter 91 engages the pivot link 103 of the inlet control mechanism to trigger the inlet control mechanism to admit one more spit . this spit takes the place of the spit that has evacuated from the first cooking station . in this way , the spits are held in a cooking station for a controlled length of time and then are advanced to a sequential next one of the cooking stations and sequenced through the discrete cooking stations from the inlet end toward the outlet end of the staged rotisserie . alternatively , rather than lifting the spits off of the endless drive chain 57 , the endless drive chain 57 can be lifted by the lifters , thereby taking the spits upwardly as well . once the spits breach the upper surface of the ramp , they all begin to roll downwardly down the ramp toward the next cooking station , whereupon the drive chain 57 is lowered once again by the cam mechanism . while the invention has been shown in preferred forms , it will be apparent to those skilled in the art that many modifications , additions , and deletions can be made therein without departing from the spirit and scope of the invention as set forth in the following claims .	0
it is to be understood that components or parts of the present invention which are similar to a previously described component or part will be given the same number with the addition of a prime (&# 39 ;). referring now to fig1 a , a plan view of one embodiment of the present invention is shown . an ic package shown generally at 10 is comprised of a substrate 11 having outer leads 12 emanating therefrom . disposed on the substrate 11 is a seal ring 14 with inner leads 16 disposed around the integrated circuit chip 18 . data leads 20 interconnect the inner leads 16 to the appropriate portions of the integrated circuit chip 18 . a power bus 22 and a ground bus 24 are disposed therearound for supplying the appropriate electrical power to the integrated circuit chip 18 . referring now to fig1 b , it can be seen that almost all details are exactly the same with the exception that the outer leads 12 &# 39 ; are disposed on top of the substrate 11 &# 39 ; as opposed to under the substrate 11 as shown in the embodiment of fig1 a and which is more readily apparent in fig2 a through 3b . this difference in lead patterns is merely to illustrate an accommodation of different pin - out pattern preferences where the outer leads 12 , 12 &# 39 ; emanate from the package 10 , 10 &# 39 ; in different manners . in this approach , leaded or leadless chip carrier packages with the leads on the side of the chip or underside may be made . referring now to fig2 a , there is shown a cross - sectional view taken through fig1 illustrating the construction of the present invention . shown is a ceramic cap 26 which is attached to a sealing skirt 30 which together form a rigid diaphragm 27 . shown also is how the outer leads 12 are interconnected with the inner lead 16 . this is accomplished by a lead pedestal 32 which is disposed in a &# 34 ; via &# 34 ; or duct 34 . shown also is a capacitor 36 which is normally used for transient suppression but may be omitted without departing from the spirit and scope of the present invention . similarly in fig2 b , the connection between the inner and outer leads 12 &# 39 ;, 16 &# 39 ;, are accomplished in the same manner . however , as can be seen here , the outer lead 12 &# 39 ; is disposed underneath the substrate 11 &# 39 ; and is then brought through the substrate 11 &# 39 ; to the top of the substrate through use of a lead pedestal 32 &# 39 ; and a via 34 &# 39 ;. also of a different nature in fig2 b is the use of a membrane 38 in conjunction with a ceramic ring 28 which are then attached to the sealing skirt 30 &# 39 ; which together form a flexible or resilient diaphragm 27 &# 39 ;. the vias or ducts 34 in the preferred embodiment of the present invention are manufactured by first forming or drilling holes in the substrate 11 , 11 &# 39 ;. these holes in the substrate 11 , 11 &# 39 ; thereby form vias 34 which when filled with metal facilitate the flow of electrical current therethrough . in the preferred embodiment of the present invention , this is accomplished by the use of small beads of metal ( not shown ) which are appropriately placed over the vias and through heating are allowed to melt and thereby completely fill the via 34 , 34 &# 39 ; so as to form a lead pedestal 32 , 32 &# 39 ;. however , a number of different metals as well as methods for the deposition of the pedestals may be utilized for the vias 34 , 34 &# 39 ; without departing from the spirit and scope of the present invention . these may include filling the vias by a copper - copper oxide eutectic , filling the vias using copper fluoride - copper film , filling the vias by casting , mechanical pressing or with copper clad invar type wires comprised of a steel - nickel alloy having a low coefficient of expansion . therafter the lead patterns 12 , 16 as well as the power and ground buses 22 , 24 and the sealing ring 14 are bonded to the substrate . it is to be understood that although the seal ring 14 as well as the leads 12 , 16 and buses 22 , 24 are copper which is diffusion bonded to the substrate 11 , other metals and methods of bonding can and may be utilized without departing from the spirit and scope of the present invention . referring now to fig3 a , there is shown a cross sectional view of the present invention in an assembled form . here it can be seen that the sealing skirt 30 is bonded to the seal ring 14 which may be done in a number of ways known to one skilled in the art such as soldering , laser welding , electron beam welding or resistance welding . in this manner , a diaphragm 27 is formed which thereby hermetically seals the ic chip 18 therein . similarly , in referring to fig3 b , the same type of bond is formed between the seal skirt 30 &# 39 ; and the sealer ring 14 &# 39 ; thereby exhibiting a joint seal area 40 , 40 &# 39 ;. this joint seal area 40 , 40 &# 39 ; forms a copper interface which is significantly more ductile and compliant than traditional glass seals and provides a higher degree of reliability in thermal cycling situations . further , sealing may be accomplished under a variety of different conditions , such as sealing in a vacuum , sealing at elevated pressures , or sealing with the use of gasses such as nitrogen with a 8 - 15 % hydrogen mixture . the diaphragm 27 &# 39 ; of fig2 b differs from that of fig2 a to show those situations where it is desirable to have an integral indicator of the integrity of the hermetic properties of the package . in this manner , this membrane 38 may consist of a copper or other metal membrane which would thereby permit welding of the seal skirt 30 &# 39 ; in an atmosphere of elevated pressure thereby forcing the membrane 38 to assume a shape similar to that of a balloon or in a vacuum thereby collapsing the membrane 38 . therefore , in the event the integrity of the hermetic seal is violated , the membrane 38 will collapse , deform or pop - up thereby giving an indication of its defective condition . additionally , this would also allow for the position of the diaphragm to be sensed electrically by a number of methods such as capacitive or electrical contact apparatus which may or may not be internal to the diaphragm 27 , 27 thereby providing verifiable hermeticity status . further , a number of different types of diaphragms 27 , 27 &# 39 ; may be utilized such as completely metal membranes or the use of glass or crystal windows . accordingly , the use of the vias 34 and the lead pedestals 32 allows the seal ring 14 to completely encapsulate the ic chip 18 and all connections , be them power or data , therein . since the seal ring 14 , 14 &# 39 ; or the substrate 11 , 11 &# 39 ; need not accommodate for the thickness of the outer leads 12 , 12 &# 39 ; as well as deformations which may occur , direct bonding of the seal ring 14 , 14 &# 39 ; to the substrate 11 , 11 &# 39 ; may be accomplished in a reliably consistent and accurate manner . further , the sealing ring 14 , 14 &# 39 ; may be a compliant member and may be extended to the perimeter of the substrate 11 , 11 &# 39 ; thereby providing a reference ground plane so as to reduce cross - talk on signal lines as well as balancing mechanical stresses which may be in the package 10 , 10 &# 39 ;. it is to be understood that many departures from the disclosure as cited may be accomplished without departing from the spirit and scope of the present invention . for example , the lead pedestals may be formed from shapes other than beads and may be pressed into place as opposed to melting and thereby flowing into the vias . further , the inner and outer leads as well as the lead pedestal and the buses together with the seal ring may be formed all at the same time . also a number of different types of substrate materials may be utilized such as ceramic or glass without departing from the spirit and scope of the present invention . additionally , different methods of diaphragms or covers may be utilized as well as different lead patterns which may therefore provide for a leadless or a leaded ic package . therefore , in addition to the above numerated advantages , the disclosed invention produces a device which is relatively easy to manufacture , providing a high degree of reliability and which is relatively inexpensive .	7
in fig1 there is shown a wheelchair 1 having a quadrilateral frame 2 securely mounted to the side frame members 3 , 4 of the wheelchair 1 . frame 2 supports a central post mount 5 ( as seen more clearly in fig2 ). a docking arm 6 ( seen most clearly in fig3 ) is securely mounted in post mount 5 in any conventional manner such as screwing or clamping . arm 6 is provided with a hammer headed like foot having a sloping leading edge 7 and a squared trailing face 8 and is of sufficient length to provide normal ground clearance but to engage a floor docking shoe 9 which is securely bolted , at any selected position on the floor of a vehicular conveyance ( not shown ), by means of bolts 16 . shoe 9 is provided with a flared and sloped entry 10 at one end thereof for sliding engagement with the leading edge 7 of arm 6 when the wheelchair is positioned thereabove . edge 7 then rides over a spring loaded wedge shaped member 11 thereby compressing spring 12 ( fig5 ) and allowing the arm to fully enter the shoe 9 until the front 13 thereof abuts the face of the docking shoe 9 , as seen in fig6 , whereupon the arm 6 clears wedge member 11 and allows spring 12 to extend and drive wedge member 11 upwardly so that the vertical face 14 thereof abuts the rear face 8 of arm 6 , thereby locking the arm and shoe together and securely fastening the wheelchair in the vehicle without any possibility of the wheelchair swiveling or twisting about the central axis thereof and without any need to tighten or adjust restraining straps and the like by either the wheelchair occupant or the attendant . in order to release the wheelchair from the locked position it is merely necessary to raise the free end of the lever 15 , pivotally mounted about a fulcrum 16 and engaging with wedge member 11 , from the locked position shown in fig6 to the unlocked position shown in fig5 . this may be accomplished manually if necessary but it will be appreciated that this is impossible for a wheelchair occupant and somewhat awkward and inconvenient for the attendant . it is preferred , therefore , that the release be effected by the attendant from a central location such as the driver &# 39 ; s seat . to facilitate release , a conventional solenoid switch 17 is mounted beneath end of lever 15 with the end of plunger 18 thereof in contact with lever 15 . upon activation of solenoid 17 , plunger 18 extends from the retracted position shown in fig6 to the extended position shown in fig5 , thereby forcing wedge member 11 down to the unlocked position shown in fig5 and releasing arm 6 . power for solenoid 17 may be provided in any conventional manner such as wires from the control position and the vehicle battery , or from an internal power source which may be actuated by any conventional remote control system such as a radio signal . it will be appreciated that the floor docking shoe 9 may equally well be mounted on the quadrilateral frame 2 on wheelchair 1 and the post mount 5 and arm 6 may be mounted on the floor of the vehicle . this arrangement has the advantage that the arm 6 is in the vehicle at a fixed position and this facilitates accurate location of a plurality of wheelchairs in the vehicle . it also allows for somewhat greater ground clearance for the wheelchair when it is not in the vehicle . power to actuate solenoid 17 , now located on wheelchair 1 , may be provided from the wheelchair power supply if so equipped , an internal power supply or by leads passing internally through arm 6 and contact shoes ( not shown ) on docking shoe 9 . in a third embodiment , docking shoes 9 may be provided on both the floor of the vehicle and on the quadrilateral frame on the wheelchair so as to provide for maximum ground clearance for the wheelchair and an uncluttered floor in the vehicle . in this embodiment it is , of course , necessary to modify the arm 6 to provide a sloped leading edge 7 and a squared trailing face 8 at each end thereof , as seen in fig7 , so that the arm 6 can be detached from both the wheelchair and the floor . it will be appreciated that many modifications may be made without departing from the spirit and scope of the present invention . for example , numerous variations of the docking shoe are possible and one such variation is illustrated in fig8 and 9 , which show a docking shoe 19 , having a flared and sloped entry ramp 20 , similar to entry 10 , which may be secured to the floor of the vehicle or to the wheelchair as described above . a circular pin 21 , having a circular flange 22 , is mounted vertically on shoe 19 and is provided with an axial , spring loaded , locking pin 23 , which may be electrically actuated from a central location by the driver or by the wheelchair occupant , by a solenoid switch . vertical locator pins 25 , 26 may also be mounted on shoe 19 and positioned so as to permit limited rotation of arm 6 or to prevent any rotation of arm 6 , as described in more detail below . in order to cooperate with the modified shoe 19 , the end of arm 6 must similarly be modified to provide a part - circular button 27 having a top 28 secured to arm 6 and a lower flange 29 , the top surface of which is adapted to slidably engage the lower surface of flange 22 ( as seen in fig1 ). when fully engaged , spring loaded pin 23 extends through the axial bore so as to releasably lock button 27 and arm 6 to the docking shoe 19 . it will be appreciated that the position of pins 25 , 26 is a matter of choice so as to either permit limited rotation of arm 6 and hence of the wheelchair , or to preclude angular rotation when pins 25 , 26 abut flat face 30 of button 27 . in order to release the wheelchair , the pin 23 is retracted by actuation of solenoid switch , either by the wheelchair occupant or by the attendant . in order to facilitate smooth mating of button 27 with flange 22 , the edge 30 of button 27 and the circumferential rim of flange 22 are preferably bevelled . it will , of course , also be appreciated that the docking shoe 19 may equally well be mounted on the wheelchair and the arm 6 mounted on the floor , as previously described with reference to the previous embodiment . or , docking shoe 19 may be provided on both the floor and the wheelchair and a double - ended arm 6 having a button 27 at each end thereof , similar to fig7 may be provided . as noted hereinbefore , in certain circumstances a wheelchair occupant may be the driver of the vehicle in which the docking system is installed adjacent and immediately behind the steering wheel . usually , in such circumstance the vehicle is provided with hand controls and the regular driver &# 39 ; s seat is removed . a docking shoe 31 , similar in concept to the docking shoe 19 previously described herein , is mounted on the vehicle floor in a suitable position rearwardly of the vehicle steering wheel ( not shown ), as seen in fig1 . as seen more clearly in fig1 and 13 , shoe 31 is slideably mounted on a base plate 32 for movement between a forward position as seen in fig1 and a rearward position as seen in fig1 , when a lock ( not shown ) located between shoe 31 and base plate 32 is actuated by adjustment lever 33 , generally but not essentially , located on the dashboard or sidewall of the vehicle and accessible to the wheelchair occupant . lever 33 is generally operatively connected to the lock by actuating cable 34 . it will be appreciated that some wheelchairs have very little ground clearance and frequently catch on obstructions on the floor . for this reason , it is preferred that the docking shoes 19 and 31 are provided with sloping top covers so as to facilitate the wheelchair riding smoothly thereover . in operation , the wheelchair occupant docks the wheelchair into the docking shoe and a green light 38 , on dash console 36 ( fig1 ) lights . when the green light is on , the occupant may either prepare to drive or may adjust his position relative to the steering wheel . in order to adjust position , the adjust lever 33 is depressed to temporarily disengage shoe 31 from base 32 . this deactivates green light 38 and activates flashing amber light 39 , to indicate that the wheelchair is not disengaged from the locking shoe but is not fully locked in position either . the wheelchair occupant can then either slide the shoe forwards or backwards by about 2 ″– 4 ″ from a neutral central position so as to attain a desired and comfortable driving position . when the desired position is located , the adjust lever 33 is raised and the shoe 31 and base 32 are locked together . the amber light 39 will cease to flash and the green light 38 will relight . in order to disengage the wheelchair and occupant from the docking shoe completely , the occupant may press the release button 35 on console 36 so as to release the docking arm 6 from the shoe 31 . upon pressing button 35 , red light 40 will flash and upon release of arm 6 , will remain on constantly to indicate that the wheelchair is not secured . while this embodiment has been described thus far with reference to placement of the wheelchair adjacent the driving position , it will be appreciated that the invention is not limited thereto . the docking shoe may equally well be placed at any one or more of the seating positions in the vehicle , both front and rear . it will be further appreciated that the adjustable feature of this invention has been described with reference to forward and rearward motion when the wheelchair is in the operative position . however , there may be situations when limited lateral movement or vertical movement of the docking shoe is desired . lateral movement can be easily achieved by loosening the securing bolts of the slide mechanism in elongated boltholes so as to effect the required adjustment and retightening by the installation technician . similarly , vertical movement can be achieved by careful placement of shims or by adjustment of lifting bolts .	0
the present fluoroelastomer contains 65 to 100 wt % of vdf and hfp units and 35 to 0 wt % of tfe units , and the weight ratio of vdf to hfp units is in the range of 80 : 20 to 50 : 50 . when the amount of tfe units is higher than the above , the product loses its elastomeric property and shows a plastic property similar to the conventional elastomer . when the amount of hfp units is higher than the above , it is difficult to obtain a fluoroelastomer having the higher molecular weight which is an object of the present invention and , when the hfp amount is lower , the product becomes plastic rather than elastic . a preferable weight ratio of vdf to hfp units , in the case of a copolymer of vdf and hfp units , is in the range of 55 : 45 to 70 : 30 . in the case of preferable terpolymers of vdf , hfp and tfe units , the weight ratio of vdf and hfp units to tfe units is in the range of 70 : 30 to 90 : 10 , and the weight ratio of vdf units to hfp units is 75 : 25 to 50 : 50 . the present fluoroelastomer has an extremely high intrinsic viscosity ( ml / g ) ( denoted as [ η ] hereinafter ) of 250 to 500 , preferably 250 to 450 , more preferably 250 to 300 . in general , the [ η ] of conventional fluoroelastomers is controlled to below 100 in due consideration of processability . the higher the value of [ η ], the harder the conventional fluoroelastomer becomes , resulting in more difficult banding of the fluoroelastomer on the mixing - roll . in fact , it is substantially impossible to roll - mix a fluoroelastomer having an [ η ] of 220 or more . in conventional fluoroelastomers , mooney viscosity , which is a measure of processability , increases in proportion to [ η ]. on the other hand , the present fluoroelastomer has a high [ η ] of 250 or more , shows a constant mooney viscosity of about 70 to 120 ( ml 1 + 10 121 ° c .) which is not in proportion to [ η ], and yet does not show tackiness to the mixing - roll . the present fluoroelastomer , therefore , shows excellent processability in banding on the mixing roll without showing tackiness and in incorporating components such as carbon black , an acid acceptor and the like . in other words , the present fluoroelastomer shows good processability in spite of the high molecular weight . in the present invention , when the value of [ η ] is lower than 250 , even if the other requirements are satisfied , the improvement in mechanical properties , compression set and dynamic properties is inadequate . the value of compression set changes sharply with an inflection point at an [ η ] of 250 . as described above , the present fluoroelastomer simultaneously has excellent properties in both compression set and elongation . compression set values for the present fluoroelastomer are superior to the conventional marketed copolymer . when the value of [ η ] is higher than 500 , good processability is lost and it is difficult to use the fluoroelastomer . molecular weight distribution is generally expressed by the ratio ( mw / mn ) of a weight average molecular weight ( mw ) to a number average molecular weight ( mn ). the ratio ( mw / mn ) of the present fluoroelastomer is in the relatively narrow range of 2 to 12 in spite of a biomodal molecular weight distribution . the preferable ratio is in the range of 4 to 12 and the more preferable ratio is from 4 to 10 . the present fluoroelastomer has a bimodal molecular weight distribution which is composed of a higher molecular weight component and a lower molecular weight component . the weight average molecular weights ( mw ) of these two components are in the range of 50 - 250 × 10 4 and 5 - 50 × 10 4 corresponding to the higher molecular weight component and the lower molecular weight component , respectively . the feature of the bimodal distribution of the present fluoroelastomer is shown in fig1 which is a chart of gel permeation chromatography . in fig1 two peaks ( h 2 ) and ( h 1 ) correspond to the higher molecular weight component and the lower molecular weight component , respectively . the ratio ( h 2 / h 1 ) of the two peak - heights is in the range of 0 . 8 to 4 . 0 , preferably 1 . 2 to 2 . 4 and this ratio is an important factor in the present invention because , in addition to [ η ], the ratio h 2 / h 1 affects the balance of processability , mechanical properties , compression set and resistance to the formation and growth of cracks . the value of [ η ] in the present invention is measured using a methylethylketone solution of the fluoroelastomer with a capillary viscometer at 35 ° c . according to the provisions of jis k2283 ( astm d445 ). the values of mw , mn , h 2 , h 1 and h 2 / h 1 are measured and calculated from the chart of gel permeation chromatography ( gpc ). the gpc measurements are carried out under the following conditions and apparatus : ______________________________________liquid chromatograph : lc - 3a type ( shimadzu corporation , japan ) column : kf - 80m ( two columns ) kf - 800p ( precolumn ) ( showa denko k . k ., japan ) detector : erc - 7510s ( erma inc ., japan ) integrator : 7000a ( division volume 0 . 1 mm ) ( system instruments co ., ltd .) developing solvent : tetrahydrofuraneconcentration : 0 . 1 weight % temp . : 35 ° c . standard polymer for : highly homogeneous polystylenesa calibration curve (-- mw /-- mn ≦ 1 . 2 ( max ) ( toyo soda manufacturing co ., ltd . japan ) ______________________________________ for preparing a fluoroelastomer , emulsion , suspension and solution polymerization methods are known . among these methods , the preferable one to prepare the present fluoroelastomer is the suspension polymerization method which can prepare the fluoroelastomer in one step . it is also possible to prepare the present fluoroelastomer by mechanical blending of high and lower molecular weight components which are prepared by suitable methods , respectively . the suspension polymerization method employed in the present invention is illustrated in more detail below . a liquid monomer mixture or monomer mixture dissolved in an inactive organic solvent is dispersed in water containing a suspension stabilizer . if necessary , a chain transfer agent may be added to the inactive organic solvent . polymerization is initiated by the addition of an oil - soluble catalyst under 1 - 100 kg / cm 2 - g at 0 °- 130 ° c . during the polymerization , additional monomer mixtures are charged to the polymerization system to maintain a constant pressure . it is also possible and desirable to conduct partition - additions of the catalyst during the polymerization . it is preferable that the amount of the catalyst be reduced smoothly or step by step at every addition . the polymerization is preferably carried out under the conditions of 50 ° to 70 ° c . and 5 to 50 kg / cm 2 - g . the composition of the monomer units in the final product fluoroelastomer is arranged by the proportion of monomers in the monomer mixtures employed at the start of the polymerization and during the polymerization procedure . the proportion of monomers and the component of each of the monomer units are analyzed using gas chromatography and 19 f nmr , respectively . as an inactive organic solvent , one having no carbon - hydrogen bond which easily induces a chain transfer may be utilized . preferable compounds are perfluorocarbons such as perfluorocyclobutane , perfluorodimethylcyclobutane and perfluorokerosene , and chlorofluorocarbons such as 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane , 1 , 2 - dichloro - 1 , 1 , 2 , 2 - tetrafluoroethane , trichlorofluoromethane and dichlorodifluoromethane . as the suspension stabilizer , there may be used methylcellulose , starch , polyvinylalcohol , carboxymethylcellulose , bentonite , talc and the like . as an oil - soluble catalyst , preferred are dialkylperoxydicarbonates such as diisopropyl peroxydicarbonate and di - n - propyl - peroxydicarbonate , peroxyester compounds such as t - butylperoxyisobutylate and t - butylperoxypivalate , diacylperoxides such as dipropionylperoxide and di [ perfluoro ( or chlorofluoro ) acyl ] peroxides such as di ( perfluoropropionyl ) peroxide , di ( perfluorobutylyl ) peroxide and di ( trichlorooctafluorohexanoyl ) peroxide . the di [ perfluoro ( or chlorofluoro ) acyl ] peroxides are preferable because the obtained fluoroelastomer shows more excellent heat resistance . it is also possible to use a chain transfer agent such as methanol , ethanol , isopentane , diethylmaronate carbontetrachloride and the like in order to arrange the molecular weight . the present fluoroelastomer can be cured by using an ordinary curing method such as a diamine , peroxide or polyol method . as the polyol curing method is generally conducted in the field of sheets such as o - rings and diaphragms which demanded excellent compression set , the polyol method is illustrated below as one example . the present fluoroelastomer is mixed by an open roll mill or a banbury mixer together with an acid - acceptor , a polyhydroxy compound , a curing accelerator and , if necessary , a filler and then is cured . as an acid - acceptor , there may be used a divalent metal oxide or hydroxide such as an oxide or hydroxide of calcium , magnesium , zinc or lead . the amount of the acid - acceptor used is in the range of 2 to 30 parts by weight per 100 parts by weight of the fluoroelastomer . as a polyhydroxide compound , there may be used hydroquinone , bisphenol a , bisphenol af , 4 , 4 &# 39 ;- dihydroxydiphenylmethane , 2 , 2 - bis ( 4 - hydroxyphenyl ) butane and the like , used in an amount of 0 . 5 to 5 parts by weight per 100 parts by weight of the fluoroelastomer . as a curing accelerator , preferred are tert - onium salt compounds such as tetramethyl , tetraethyl , tetrapropyl or tetrabutylammonium chloride , tetrabutylammonium bromide and tetrabutyl , benzyltriphenyl or benzyltrioctylphosphonium chloride and the like , used in an amount of 0 . 2 to 10 parts by weight per 100 parts by weight of the fluoroelastomer . as a filler , there may be used , for example , carbon black , silica , clay , talc and the like , if necessary . a press curing operation may be conducted under 100 ° to 200 ° c ., 20 to 100 kg / cm 2 - g and 10 to 180 minutes . the post - curing operation may be conducted under conditions of 150 ° to 300 ° c . and 0 to 30 hours . the present fluoroelastomer has advantages such as a excellent heat resistance , solvent resistance and chemical resistance as with the conventional fluoroelastomer , and further shows excellent characteristics in mechanical properties such as tensile strength and elongation , compression set , processability , and resistance to the formation and growth of cracks . the present invention is more specifically described and explained by the following examples which , however , are not intended to limit the scope of the invention . in the examples , all parts and percent (%) are by weight except as otherwise noted . the fluoroelastomer is cured by the standard polyol curing method under the following conditions . ______________________________________a fluoroelastomer : 100 partsmagnesium oxide : 3 partscalcium hydroxide : 6 partsbisphenol af : 2 partsbenzyltriphenylphosphonium 0 . 6 partchloride : m . t . carbon black : 30 partsmixing : two roll - millfirst press - curing : 177 ° c . × 10 min . post oven - curing : 232 ° c . × 24 hours______________________________________ tensile strength and elongation are measured with dumbell test pieces ( no . 3 ) with a thickness of 2 mm prepared from the samples of a cured sheet obtained from the above curing using a universal tensile tester ( toyo seiki seisaku - sho , ltd . japan ) at a rate of 50 cm / min . according to the provisions of jis k6301 . compression set is measured with an o - ring ( no . p - 24 type ) that is maintained at 200 ° c . under a deflection of 25 % for 72 hours followed by standing at a room temperature for 30 minutes , using a thickness gauge ( kyoto kobunshi keiki co ., ltd . japan ) according to the provisions of jis k6301 . resistance to the formation and growth of cracks is measured with a sample according to the provisions of jis k6301 using a de mattia machine , and shown by the number of 90 ° flexings required to produce a crack with a length of 10 mm . rebound resilience is measured with a sample ( 8 × 8 × 4mm ) according to the provisions bs903 at 23 ° c . using the resilience testor ( toyo seiki seisaku - sho , ltd . japan ). a fifty liter autoclave provided with a mechanical stirrer is thoroughly replaced with n 2 gas and then evacuated . after repeating the replacing evacuation procedure three times , the autoclave is evacuated as fully as possible , and then charged with 18 . 56 kg of pure water purged with n 2 gas , 8 . 33 , kg of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluorethane ( noted as r - 113 hereinafter ) and 6 . 2 g of methyl cellulose as a suspension stabilizer , and kept at 50 ° c . with 476 r . p . m . of agitation . the inner pressure of the autoclave becomes 16 . 4 kg / cm 2 - g by the charge of a monomer mixture of 26 . 5 % of vdf , 66 . 9 % of hfp and 6 . 6 % of tfe . polymerization is initiated and progressed by partition - additions of a catalyst solution ( denoted as fpo hereinafter ) prepared by dissolving 5 % of di ( perfluorobutylyl ) peroxide in r - 113 . details of the addition are shown by ○ a in fig2 . when the inner pressure is reduced to 16 . 0 kg / cm 2 - g by the progress of the reaction , and additional monomer mixture of 44 . 7 % vdf , 31 . 7 % hfp and 23 . 6 % tfe is charged to return to the initial pressure . after a reaction time of 14 hours , residual monomer mixtures are removed and the obtained suspension is dehydrated with a centrifugal separator , washed thoroughly and vacuum - dried at 100 ° c . the yield of the fluoroelastomer is 10 . 4 kg . the obtained fluoroelastomer has 52 . 6 % vdf units , 24 . 6 % hfp units and 22 . 8 % tfe units ( by the analysis of 19f nmr ), [ η ] of 268 , h 2 / h 1 of 1 . 77 and mw / mn of 6 . 5 . the fluoroelastomer is subjected to a polyol - curing under standard conditions as described hereinbefore . the obtained fluorelastomer shows excellent processability in banding on the mixing roll without showing tackiness and in incorporation of components such as carbon black , magnesium oxide , calcium hydroxide and the like . the polymerization reaction is conducted for 13 . 25 hours by using the same method as in example 1 except that methylcellulose is employed in an amount of 8 . 4 g instead of 6 . 2 g , the initial inner pressure is arranged to 16 . 0 kg / cm 2 - g by initially charging a monomer mixture of 26 . 4 % vdf , 67 . 1 % hfp and 6 . 5 % tfe , the partition - additions of fpo are conducted by the method of ○ b in fig2 instead of ○ a and the inner pressure is maintained by charging an additional monomer mixture of 45 . 7 % vdf , 32 . 0 % hfp and 22 . 3 % tfe when the inner pressure reduces to 15 . 5 kg / cm 2 - g . the yield is 13 . 9 kg . the fluoroelastomer has 52 . 6 % vdf units , 24 . 1 % hfp units and 23 . 3 % tfe units , [ η ] of 247 , h 2 / h 1 of 2 . 07 and mw / mn of 8 . 9 , and has excellent rolling properties similar to the product of example 1 . the other properties are shown in table 1 . polymerization similar to example 1 is repeated for 9 hours and 30 minutes except that 8 , 54 kg of r - 113 and 18 . 6 g of methylcellulose are used , the initial inner pressure is arranged to 15 kg / cm 2 - g by charging a monomer mixture of 28 . 0 % vdf , 65 . 7 % hfp and 6 . 3 % tfe , 85 . 4 g of a catalyst solution ( devoted as ipp hereinafter ) prepared by dissolving 5 % of diisopropylperoxydicarbonate in r - 113 is charged collectively and the inner pressure is maintained by charging an additional monomer mixture of 44 . 3 % vdf , 32 . 4 % hfp and 23 . 4 % tfe at a pressure of 14 . 5 kg / cm 2 - g . the yield of the fluoroelastomer is 4 . 5 kg . the other results are shown in table 1 . polymerization similar to example 3 is carried out for 4 . 5 hours except that 18 . 6 g instead of 9 . 3 g of methylcellulose is used a suspension stabilizer , 341 . 6 g instead of 85 . 4 g of ipp is used , the initial monomer mixture is composed of 27 . 5 % vdf , 66 . 7 % hfp and 5 . 8 % tfe , and the additional monomer mixture is composed of 45 . 0 % vdf , 32 . 1 % hfp and 22 . 9 % tfe . the yield of fluoroelastomer is 8 kg . the other results are shown in table 1 . polymerization similar to example 1 is carried out for 3 . 5 hours except that 8 , 54 kg instead of 8 . 33 kg of r - 113 is used , methylcellulose is used in an amount of 9 . 3 g instead of 6 . 2 g , the initial inner pressure is arranged to 17 kg / cm 2 - g by charging an initial monomer mixture of 24 . 5 % vdf , 69 . 6 % hfp and 5 . 9 % tfe , a catalyst comprising 170 . 8 g of ipp is collectively charged , and the inner pressure is maintained by charging an additional monomer mixture of 50 . 5 % vdf , 28 . 1 % hfp and 21 . 4 % tfe at an inner pressure of 16 . 5 kg / cm 2 - g . the yield of fluoroelastomer is 4 . 4 kg . the other results are shown in table 1 . table 1__________________________________________________________________________fluoroelastomer properties ex . 1 ex . 2 ex . 3 ex . 4 ex . 5__________________________________________________________________________composition of the fluoroelastomervdf units (%) 52 . 6 52 . 6 53 . 3 56 . 1 55 . 5hfp units (%) 24 . 6 24 . 1 20 . 0 20 . 4 25 . 2tfe units (%) 22 . 8 23 . 3 26 . 7 23 . 5 19 . 3 ( η ) 268 250 365 279 255h . sub . 2 / h . sub . 1 1 . 77 2 . 07 3 . 65 2 . 45 1 . 48 -- mw /-- mn 6 . 5 8 . 9 5 . 3 2 . 8 3 . 1mooney viscosity 117 100 72 80 92 ( ml . sub . 1 + 10 121 ° c .) mechanical propertiestensile strength ( kg / cm . sup . 2 ) 175 164 204 167 175elongation (%) 280 240 240 260 250compression set (%) 17 19 17 21 19resistance to the formation and 9 , 000 10 , 000 7 , 000 8 , 000 9 , 000growth of cracks ( number of90 ° flexes ) processability in banding , tackiness excellent excellent good excellent excellentand incorporation of componentson the mixing roll__________________________________________________________________________ a fifteen liter autoclave provided with a mechanical stirrer is thoroughly replaced with nitrogen gas and then evacuated . after repeating the replacing - evacuation procedure three times , the autoclave is evacuated as fully as possible , and then charged with 5800 g of pure water purged with nitrogen gas , 2670 g of r - 113 and 2 . 9 g of methylcellulose as a suspension - stabilizer , and then maintained at 50 ° c . with 500 rpm of agitation . a monomer mixture consisting of 27 . 2 % of vdf , 66 . 7 % of hfp and 6 . 1 % of tfe is charged into the autoclave . the inner - pressure of the autoclave reaches 15 . 3 kg / cm 2 - g by the charging procedure . polymerization is initiated by the addition of 8 g of fpo . when the inner pressure is reduced to 14 . 8 kg / cm 2 - g by progress of the polymerization , an additional monomer mixture of 45 . 7 % of vdf , 30 . 5 % of hfp and 23 . 8 % of tfe is charged in order to return the pressure to 15 . 3 kg / cm 2 - g . this additional charge is repeated during the polymerization . on the other hand , ten grams of fpo is supplied at 30 minute intervals . fpo is used in a total amount of 218 grams during the 11 hours polymerization . after polymerization , the residual monomer mixture is removed and the polymerization is stopped . the obtained suspension is dehydrated with a centrifugal separator , washed thoroughly and vacuum - dried at 100 ° c . to obtain 2 . 5 kg of fluoroelastomer . the obtained fluoroelastomer has 52 . 2 % of vdf units 23 . 2 % of hfp units and 24 . 6 % of tfe units ( by the analysis of 19 fnmr ), [ η ] of 300 , h 2 / h 1 of 1 . 8 and mw / mn of 4 . 8 . the fluoroelastomer is subjected to a polyol - curing under the standard conditions described hereinbefore . the fluoroelastomer shows excellent processability in tackiness on the mixing roll and in incorporation of components such as carbon black , magnesium oxide and calcium hydroxide , etc ., and has a mooney viscosity ( ml 1 + 10 121 ° c .) of 100 . the other properties are shown in table 2 . polymerization is conducted for 6 hours by using the same method described in example 6 except that the initially charged monomer mixture consists of 24 . 4 % of vdf , 70 . 0 % hfp and 5 . 6 % of tfe , 160 g of fpo is collectively charged , the additionally charged monomer mixture consists of 45 . 5 % of vdf , 30 . 5 % of hfp and 24 . 0 % of tfe , and a polymerization temperature of 25 ° c . is employed instead of 50 ° c . one kg of the fluoroelastomer is obtained by this method . the fluoroelastomer obtained consists of 53 . 4 % vdf units , 24 . 8 % hfp units and 21 . 8 % tfe units , and shows [ η ] of 200 , h 2 / h 1 of 0 . 8 and mw / mn of 7 . 1 . the fluoroelastomer is cured by the same method as in example 6 and shows a mooney viscosity ( ml 1 + 10 121 ° c .) of 85 . the other properties are shown in table 2 . a fifteen liter autoclave provided with a mechanical stirrer is thoroughly replaced with nitrogen gas and then evacuated . after repeating the replacement / evacuation procedure three times , the autoclave is evacuated as fully as possible , and then charged with 7500 g of pure - water purged with nitrogen gas , 22 . 5 g of ammonium persulfate and 22 . 5 g of ammonium perfluorooctanoate as an emulsifier , and maintained at 85 ° c . a monomer mixture of 38 . 4 % vdf , 39 . 2 % hfp and 22 . 4 % tfe is charged into the autoclave . the inner - pressure of the autoclave becomes 8 kg / cm 2 - g by this charging procedure . when the inner - pressure is reduced to 7 kg / cm 2 - g by progress of the polymerization , an additional monomer mixture of 43 . 4 % vdf , 33 . 0 % hfp and 23 . 6 % tfe is charged in order to maintain the inner - pressure at 8 kg / cm 2 - g . after this additional charge is repeated for 1 hour , the residual monomers are removed and the polymerization is stopped . the fluoroelastomer is obtained from the resultant emulsion by salting - out with the addition of a solution of magnesium chloride , washed thoroughly , vaccuum - dried at 100 ° c . the yield of fluoroelastomer is about 1 . 3 kg . the fluoroelastomer has 45 . 9 % vdf units , 32 . 7 % hfp units and 21 . 4 % tfe units ( by the analysis of 19 nmr ), shows [ η ] of 80 and mw / mn of 27 . 4 and does not show a bimodal molecular weight distribution . the fluoroelastomer cured by the same method as example 6 shows a mooney viscosity ( ml 1 + 10 121 ° c .) of 80 . the other properties are shown in table 2 . the procedure in comparative example 2 is repeated except that a monomer mixture of 39 . 9 % vdf and 60 . 1 % hfp and a monomer mixture of 55 . 6 % vdf and 44 . 4 % hfp are used as the initially charged monomer and the additionally charged monomer , respectively , and reaction conditions of 70 ° c . for 3 hours are employed instead of 85 ° c . and 1 hour . the yield of the fluoroelastomer is 1 . 9 kg . the fluoroelastomer has 52 . 9 % vdf units and 47 . 1 % hfp units by 19 fnmr analysis , shows [ η ] of 70 and mw / e , ovs / m / n of 7 . 9 and does not show the bimodal molecular weight distribution . the other properties of the cured elastomer are shown in table 2 . table 2__________________________________________________________________________fluoroelastomer properties resistance to the mooney viscosity tensile strength elongation compression set formation of cracks ( ml . sub . 1 + 10 121 ° c .) [ kg / cm . sup . 2 ] [%] [%] ( number of flexes ) __________________________________________________________________________example 6 100 185 250 18 10 , 000comp . ex . 1 85 170 260 22 9 , 000comp . ex . 2 80 175 280 36 2 , 000comp . ex . 3 46 170 210 21 2 , 000__________________________________________________________________________ a procedure similar to that of example 6 is repeated employing the monomer mixture and polymerization conditions shown in table 3 . the results are also shown in table 3 . table 3______________________________________ vdf hfp tfe______________________________________compositioninitial monomer ( wt %) 27 . 2 66 . 7 6 . 1additional monomer ( wt %) 45 . 7 30 . 5 23 . 8obtained elastomer ( wt %) 51 . 6 23 . 8 24 . 6polymerization conditiontemp . (° c .) 50pure water ( g ) 5800r - 113 ( g ) ( g ) 2670catalyst ( g ) fpo 163 ( additional charge ) pressure ( kg / cm . sup . 2 - g ) 15 . 9 ⃡ 15 . 4time ( hrs ) 7 . 5yield of elastomer ( kg ) 2 . 7properties [ η ] ( ml / g ) 270h . sub . 2 / h . sub . 1 1 . 9 -- mw /-- mn 5 . 9mooney viscosity ( ml . sub . 1 + 10 90121 ° c .) tensile strength ( kg / cm . sup . 2 ) 185elongation (%) 260compression set (%) 19resistance to the 9000formation and growthof cracks ( number offlexes ) ______________________________________ polymerization similar to example 6 is repeated for 18 hours except that methylcellulose is used in an amount of 5 . 8 g instead of 2 . 9 g , the initial inner pressure is arranged to 15 . 5 kg / cm 2 - g by charging a monomer mixture of 20 . 8 % vdf and 79 . 2 % hfp , the inner pressure is maintained at 15 . 5 kg / cm 2 - g by charging an additional monomer mixture of 58 . 7 % vdf and 41 . 3 % hfp reducing the pressure to 15 . 0 kg / cm 2 - g and the total amount of fpo charged during the 18 hours of polymerization is 358 g instead of 218 g . the yield of the fluoroelastomer is 1 . 3 kg . the other results are shown in table 4 . polymerization similar to example 8 is carried out for 10 hours except that as a catalyst , 106 . 8 g of ipp are used collectively , the initial monomer mixture is composed of 26 . 8 % vdf and 73 . 2 % hfp , and the additional monomer mixture has a composition of 58 . 5 % vdf and 41 . 5 % hfp . the yield of fluoroelastomer is 1 . 6 kg . the results are shown in table 4 . table 4______________________________________ ex . 8 ex . 9 ex . 10______________________________________composition of the fluoroelastomervdf units (%) 58 . 8 63 . 9 59 . 5hfp units (%) 41 . 2 36 . 1 40 . 5 [ η ] 350 300 400h . sub . 2 / h . sub . 1 2 . 45 1 . 65 2 . 68 -- mw /-- mn 8 . 3 8 . 7 9 . 7mooney viscosity ( ml . sub . 1 + 10 121 ° c .) 100 95 120mechanical propertiestensile strength ( kg / cm . sup . 2 ) 182 193 186elongation (%) 250 250 260compression set (%) 13 14 12rebound resilience (%) 23 24 26processability in banding , tackiness good excellent goodand incorporation of componentson the mixing roll______________________________________ polymerization similar to that of example 8 is carried out for 20 hours except that fpo is charged in an amount of 320 g by partition - additions in which the amount of the catalyst is smoothly reduced at every addition similar with ○ a in fig2 . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	2
referring now to the drawings in detail , the container dispensing unit 10 constructed in accordance with the present invention is illustrated . as shown in fig1 to 3 , the dispensing unit 10 includes a housing 12 having a front face 14 , a rear face 16 , a top 18 , a bottom 20 , a right side 22 and a left side 24 ( see fig6 ). front face 14 of housing 12 includes an inlet or entrance 26 and an outlet or exit 30 . an inlet and receiving door 28 is hinged to the container so as to selectively cover and expose inlet 26 . housing 12 is of a modular design and includes a series of interlocking plugs 36 disposed on top face 18 and complementary interlocking receptacles 38 disposed on or formed in bottom face 20 . in addition , a pair of interlocking grooves and projections 40 , 40 ′ are disposed on right side 22 and complementary grooves and projections 42 , 42 ′ are disposed to extend along left side 24 . with these interlocking features , several dispensing units 10 can be securely stacked one on top of another with interlocking recesses 38 of a lower dispenser unit engaging interlocking projections 36 of an upper dispenser unit . similarly , several dispensing units 10 can be securely engaged side - by - side with interlocking grooves and projections 40 , 40 ′ of one unit engaging interlocking grooves and projections 42 , 42 ′ of an adjacent unit . due to this modular design , several dispensing units can be arranged in various shapes and sizes in order to fully utilize available floor space . in addition , because each unit 10 can store different brands of containers , if several units are stacked one upon the other then multiple brands can be dispensed in a single column . referring to fig3 a multi - level conveyance path or track 13 for conveying horizontally - disposed containers is located internally of housing 12 . the conveyance track 13 includes an upper ramp 44 and a lower ramp 46 , each of which is slightly wider than the height of a typical container . ramps 44 and 46 have a slope β ; ramp 44 is angled downwardly toward the rear of dispensing unit 10 and ramp 46 in angled downwardly away from the rear of dispensing unit 10 . the slope β can be any desired angle to effect gravitational feed of the containers . however , if the slope β is too great the containers will roll too fast and if too small they may stall . preferably the slope β ranges from 3 to 10 °. the containers are gravitationally fed down upper ramp 44 to lower ramp 46 by way of a u - turn section 48 . u - turn section 48 preferably forms a ceiling of conveyance track 13 above upper ramp 44 and is contiguous with lower ramp 46 . a bottom surface 45 of upper ramp 44 forms the ceiling of the conveyance track above lower ramp 46 . with the u - turn configuration of conveyance path 13 , numerous containers can be stored in a compact space . in a preferred embodiment , the track and housing are dimensioned to hold 12 two - liter bottles , for example . ramps 44 , 46 and u - turn section 48 can be integrally formed with housing 12 . alternatively , any one of the foregoing elements can be formed as an individual component and be assembled within the housing . housing 12 , ramps 44 , 46 and u - turn section 48 are preferably formed of a lightweight yet sturdy material . for example , they can be formed of injection - molded polypropylene or polyethylene . other rigid materials such as cardboard and metal are also within the scope of this invention . it is preferred that each dispenser unit 10 be sturdy enough to support the weight of several other fully - loaded units stacked on it . in use , containers such as two - liter bottles 34 are individually fed into inlet 26 in a horizontal position and roll down upper ramp 44 toward the rear of housing 12 , then the bottles reverse direction at u - turn section 48 and roll down lower ramp 46 toward the front of housing 12 to outlet 30 . it is important , however , that the bottles 34 are not skewed as they roll in the conveyance path 13 so they do not jam and block the smooth dispensing flow of the bottles . this is prevented by maintaining the bottles in their proper orientation throughout their travel . that is , the longitudinal axes of the bottles 34 should always be substantially orthogonal to the conveyance direction along conveyance path 13 . to accomplish this , the display unit of the present invention is provided with several anti - skewing features . when stocking dispensing unit 10 , it is important that the containers be inserted into inlet 26 in their proper orientation to prevent such skewing . this is assisted by a combination of receiving door 28 and a contoured surface 50 of upper ramp 44 , which are disposed at an inlet section of housing 12 adjacent inlet 26 . as shown in more detail in fig4 a and 5 , receiving door 28 is hinged or pivotally mounted on housing 12 at pivot points 27 . it has a concave receiving face 28 a and is swingable between a closed position ( shown in phantom in fig5 ) to a fully open position ( shown in solid in fig5 ). the fully open position is limited by the rear surface 28 b of receiving door 28 abutting a face of a recess 51 a of housing 12 . in the fully open position , receiving face 28 a forms the ceiling of conveyance path 13 at the inlet section . housing 12 also has a transition edge 51 b to transition the ceiling of conveyance path 13 from receiving face 28 a to the ceiling of u - turn section 48 . contoured surface 50 of upper ramp 44 includes a first concave section 50 a , a convex section or protrusion 50 b and a concave transition section 50 c in the order of conveyance . each of the sections of contoured surface 50 preferably extends the full width of the upper ramp 44 . as a bottle 34 or other container is inserted in inlet 26 , it will first roll on concave section 50 a and be momentarily stopped by convex protrusion 50 b . the minimum distance between convex protrusion 50 b and concave face 28 a of receiving door 28 ( when in its fully open position ) is slightly greater than the typical diameter of a container to be stocked ( e . g ., the typical diameter of a two - liter beverage bottle ). as the container 34 is further urged over convex protrusion 50 b , its central axis must be substantially orthogonal to the conveyance direction or else it will not fit between convex protrusion 50 b and concave face 28 a . in other words , the container must be substantially parallel to protrusion 50 b . this ensures that the user properly orients each container when stocking . after each container is urged over protrusion 50 b , it rolls down transition section 50 c and continues down upper ramp 44 . even if containers 34 are properly oriented upon insertion , they may still tend to skew as they travel down the ramps , especially if an end of a container rubs against an inner sidewall of housing 12 . this is especially true when the neck end of a bottle comes into contact with a sidewall . to counter this tendency , another anti - skewing feature of the present invention maintains the supplied containers or bottles in the desired orientation throughout conveyance . as shown more clearly in fig6 the upper surfaces of both top ramp 44 and bottom ramp 46 not only are sloped toward or away from the rear of dispenser unit 10 at a slope β , but they are also canted or tilted toward one side of housing 12 . in the illustrated embodiment , the ramps are canted downwardly toward right side 22 of housing 12 at an angle α . in one embodiment , this canting is continuous throughout conveyance path 13 , including u - turn section 48 . that is , an imaginary central axis of curvature of u - turn section 48 is also canted at the angle α . alternatively , u - turn section can be formed without being canted or can be formed in a partially - conical shape . with this construction , as containers roll down ramp 44 , around u - turn section 48 and down ramp 46 , they will be urged by gravity not only in the conveyance direction , but also toward the right side of the housing . thus , the right ends of the containers are urged against the right sidewall of conveyance path 13 . although angle α can be of any sufficient angle to urge the containers toward the right , an angle too great would cause too much friction between the right ends of the containers and the sidewall , thus preventing the containers from rolling . an insufficient angle α would not be effective in urging the containers toward the right side . preferably , α ranges from 3 to 10 °. in the event that bottles are placed in the dispensing unit , their bottoms are preferably disposed toward right side 22 of the housing with their neck ends toward left side 24 . this will prevent the neck ends from coming into contact with the side of the housing as the bottles roll down conveyance path 13 , thus assisting in preventing skewing of the bottles during conveyance . in order to aid in loading the bottles consistently with their neck ends toward the left side , a label or other indicia depicting the desired bottle orientation can be positioned near inlet 26 of housing 12 for reference by a user . alternatively , the desired orientation can be ensured by positioning a key at inlet 26 . as shown in fig4 b , the key can be in the form of a plate 26 a with a cutout 26 b having a shape and size slightly larger than the bottles to be stocked . it can be secured in the inlet in any convenient manner . thus , the bottles can only be inserted in inlet 26 in one orientation : horizontally with their neck end facing the left side of housing 12 . it is also important during conveyance of containers to minimize shocks or impacts , which can damage the containers and cause the contents of carbonated beverage containers to over - pressurize . accordingly , it is preferred that there be a smooth transition as the containers roll from top ramp 44 to bottom ramp 46 . thus , u - turn section 48 is designed to have a semi - circular surface having a radius of curvature slightly larger than the typical diameter of the container to be dispensed . as noted previously , the central axis of u - turn section 48 is canted at the angle α to maintain the containers in their proper orientation throughout the u - turn and aid in the smooth transition . in addition , at its closest , the distance between edge 44 a of top ramp 44 and u - turn section 48 is slightly larger than the typical diameter of the containers . thus , as a bottle or container 34 rolls down upper ramp 44 , it will transition into contact with u - turn section 48 a and smoothly roll onto lower ramp 46 . that is , the containers will not drop from upper ramp 44 directly onto lower ramp 46 . referring to fig7 a , 7 b and 8 , the outlet section of dispensing unit 10 now will be described . stocked containers are dispensed one at a time out of dispensing unit 10 by a metering mechanism 52 . metering mechanism 52 comprises a cradle 54 and gate 56 , which can be formed integrally . metering mechanism 52 is hinged to housing 12 at outlet 30 by integral pivot pins 58 at its opposite ends . cradle 54 has longer moment arm about pivots 58 than that of gate 56 . as containers 38 emerge from outlet 30 , they come to rest on cradle 54 , which holds and displays one container at a time in a horizontal position for the consumer . as described below , when a bottle is resting on cradle 54 , gate 56 prevents the force from the weight of the remaining containers in conveyance path 13 from pressing against the displayed container and forcing the displayed container out of cradle 54 . when no containers are in display unit 10 , metering mechanism 52 is in a rest position shown in solid lines in fig8 because of the longer moment arm of cradle 54 . after an inserted container rolls down lower ramp 46 near outlet 30 , it rolls onto gate 56 , forcing it downward , thus rotating the metering mechanism to the dotted line position . the container then rolls over gate 56 and onto cradle 54 . the weight of the container on cradle 54 pivots the cradle downwardly back to the solid line position thereby returning gate 56 to its original position . when the next container in line rolls down ramp 46 , it cannot roll over gate 56 because it cannot overcome the weight of the displayed container acting on the longer effective moment arm of cradle 54 . thus , the next container in line is stopped by gate 56 and will not impact against the displayed container in cradle 54 . when the container in cradle 54 is removed , the next bottle in line can then force gate 56 downwardly and roll over the gate onto cradle 54 . with the above arrangement , bottles or containers to be displayed can be inserted into the dispensing unit in a proper orientation and can be conveyed through the dispensing unit without skewing . also , the containers smoothly roll through the dispensing unit with minimal shock or impact . further , the containers can be metered out one at a time without displayed containers being forced out of the cradle . although illustrative embodiments of the present invention have been described herein in connection with the accompanying drawings , it is to be understood that this invention is not limited to those precise embodiments and that various changes and modifications may be effected therein by those skilled in the art without departing from the spirit of the invention .	0
it should be understood that the currently preferred piezoelectric crystal assembly construction chosen for illustrating the apparatus aspect of the invention could manifestly be fabricated and assembled in a more conventional manner not utilizing the improved method aspects of the invention nor fully realizing the benefits of the latter with respect to more efficient mass - production . conversely , it should also be understood that at least a number of significant aspects of the improved method explained herein with reference to an illustrative currently preferred embodiment thereof applied to the manufacture of the preferred form of crystal assemblies also would have advantageous applicability in connection with the manufacture of piezoelectric crystal assemblies involving specifically different details of construction . accordingly , although the improved method of the invention is the best manner now known in which to mass - produce the improved apparatus of the invention , it will be appropriate to consider certain aspects of each separately . the improved apparatus provided by the invention will be considered first . referring initially , therefore , particularly to fig1 and 3 , the currently preferred embodiment of the improved piezoelectric crystal assembly is generally designated 30 . as shown in fig1 and 3 , the assembly 30 externally manifests only an outer encapsulation cover 32 and a pair of electrical connection leads 34 and 36 protruding therefrom , the entire assembly 30 being of about the size and having about the same general external configuration as a small ceramic capacitor . as shown in fig2 and 3 , the assembly 30 internally includes a disc - like piezoelectric crystal element 40 , electrode structures 42 and 44 respectively affixed to the opposed major faces of the crystal element 40 , and a pair of peripherally interconnected cover members 46 and 48 enclosing the crystal element 40 in supported relationship therebetween . those parts , together with the leads 34 and 36 and the outer cover 32 , comprise the sole primary components of the improved assembly 30 , further details of which will next be discussed . the crystal element 40 is circular , is preferably quartz , is preferably of the &# 34 ; at - cut &# 34 ;, &# 34 ; bt - cut &# 34 ;, &# 34 ; sc - cut &# 34 ; or similar type adapted to vibrate piezoelectrically in a high frequency thickness shear mode , and may typically be of a diameter of about 0 . 4 inch and of a thickness of the order of 0 . 015 inch ( depending upon the resonance frequency desired ). if desired to adapt the assembly 30 for use in higher power circuit applications , the diameters of the element 40 and the other parts may be appropriately increased , in which event a marginal portion of both major faces of the element 40 adjacent the circumferential edge thereof will preferably be bevelled in the conventional manner to assure that the element 40 is engaged by the members 46 and 48 only at areas which are sufficiently nodal as not to significantly interfere with or damp the desired mode of piezoelectric vibrations . the electrode structures 42 and 44 are conventionally formed upon and affixed to the opposite major faces of the element 40 by vacuum deposition or other known techniques and may be of silver or other electrically conductive metals commonly employed for such purpose . each of the electrode structures 42 and 44 includes a circular central portion 50 covering the piezoelectrically most active central area of the corresponding face of the element 40 and a connection tab portion 52 extending outwardly from the central portion onto a minor segment of the outer annular zone of such face of the element 40 , in the manner that has now become common practice and is best shown in fig2 it being noted that the tab portions 52 of the electrode structures 42 and 44 are angularly displaced from each other to facilitate connection of the leads 36 and 34 therewith in the manner hereinafter more fully described . the structures 42 and 44 are , of course , very thin , typically of the order of less than 0 . 001 inch . the leads 34 and 36 are formed of electrically conductive wire , such as 26 gauge copper bus wire , and are provided at the end thereof to be connected to the element 40 with bifurcated clamps having opposed clamping fingers as at 54 and 56 , which may be fabricated by flattening an end portion of the lead as at 58 and then stamping and bending same to provide the fingers 54 and 56 . as best shown in fig2 the clamping fingers 54 and 56 of each lead 34 and 36 extend from the edge of the element 40 into positions of opposed engagement with parts of the outer zone of the opposite major faces of the element 40 and , more particularly , the clamping fingers of each of the leads 34 and 36 engage those minor segments of such zone which are covered by the tab 52 of the corresponding electrode structure 42 or 44 so as to effect electrical connection with the latter as well as physical connection with the element 40 . an electrically conductive paste will preferably be applied to each of such connections of the leads 34 and 36 with the element 40 and then heat cured to assure that such connections are effective and permanent . the cover members 46 and 48 are preferably both formed of aluminum foil about 0 . 0025 inch thick and are anodized with conventional techniques after shaping . when such material is anodized , all of the exposed surfaces thereof are covered with a layer of aluminum oxide , which is both extremely inert and exhibits very effective electrical insulating properties to conductors touching the same and carrying electrical signals of the type and magnitude normally associated with the operation of the assemblies 30 . shaping of the members 46 and 48 is most conveniently accomplished by die stamping , and , as subsequently noted in connection with the improved method , a plurality of such members may be efficiently stamped in strips of the above - mentioned foil material . the cover member 46 , which may be thought of as the &# 34 ; top &# 34 ; cover member , is of generally pie - pan - like configuration and includes a flat circular central portion 60 , a laterally angled annular intermediate portion 62 , and a planar outwardly extending annular portion 64 , an inner annular part of the latter being in engagement with the outermost annular part of the face of the element 40 carrying the electrode structure 42 . the cover member 48 , which may be thought of as the &# 34 ; bottom &# 34 ; cover member , is generally similar to cover member 46 and includes a flat circular central portion 66 , a laterally angled annular intermediate portion 68 , and a planar outwardly extending annular portion 70 , but also includes a laterally extending annular flange portion 72 ( of which the distal margin 74 is crimped or otherwise bent inwardly back over a part of the outwardly extending portion 64 of the member 46 to interconnect the members 46 and 48 with the element 40 therebetween ). when the members 46 and 48 are thus assembled , it will be seen that the element 40 is positively supported by opposite engagement of an outermost annular part of each of its major faces with an annular inner part of the portion 64 of the member 46 and of the portion 70 of the member 48 between which it is disposed and held . with a crystal element 40 of the previously mentioned dimensions , the member 46 may have an outer diameter of about 0 . 455 inch with a lateral offset between the planes of its portions 60 and 64 of about 0 . 012 inch and a radial width for its portion 64 of about 0 . 040 inch ; and the member 48 may have an outer diameter of about 0 . 460 inch , the same lateral offset for its portions 66 and 70 as for the portions 60 and 64 of the member 46 , the same width for its portion 70 as for the portion 64 of the member 46 , and a width for its flange 72 - 74 of about 0 . 030 inch . the flange 72 - 74 is preferably notched as at 76 and 78 to provide clearance for the leads 34 and 36 . the spaces between the element 40 and each of the central portions 60 and 66 of the members 46 and 48 present thin chambers 80 and 82 , which may preferably be filled with a very inert gas such as nitrogen ( or with air if desired ) by assembling the cover members 46 and 48 within an appropriate atmosphere . the outer protective encapsulation covering 32 upon the assembly 30 , although conceivably optional for some applications , is preferably utilized and may be formed by preheating the other parts of the assembly 30 to about 300 ° f ., dipping the same in an epoxy powder such as type epu - 42 available on the market from the morton company , and then curing the same at about 250 ° f . for about one hour . when thus fabricated and assembled , the piezoelectric crystal assembly 30 is believed to be a significant improvement over anything heretofore available for the same purposes . as should now have become clear , its advantages are attributable not only to the nature and arrangement of the structures it employs , but also to the structures they render it feasible to omit , while still realizing enhanced results . turning attention now to the improved method of making piezoelectric crystal assemblies , such as , but not limited to , those just above described , reference is made to fig4 through 22 . fig4 shows an improved manner of preforming pairs of connecting leads 134 and 136 for crystal assemblies as an integral loop having an interconnecting bight 135 , which can be cut away when no longer needed . such initial construction of the lead pair as a unit assembly 134 - 135 - 136 facilitates handling of such leads , maintaining them in a desired relationship to each other during interconnection thereof to a crystal element , and supporting a plurality of same upon a carrier 101 common thereto , as illustrated in fig5 . although fig5 through 8 , 11 through 14 , and 20 through 22 illustrate pluralities of only three of the involved types of items , it should be understood that such items would preferably be handled in significantly larger groups . thus , the carrier 101 appearing in fig5 would typically be dimensioned to support a considerably larger number of the lead units 134 - 135 - 136 that depicted . the carrier 101 may be formed from an upper strip 103 of plastic material that will not &# 34 ; out gas &# 34 ; in a vacuum detachably mounted as by screws 105 atop a base strip 107 ( see fig9 ) of similar material and preferably provided with transverse grooves ( not shown ) in its upper surface for the purpose of receiving the leads 134 and 136 of the units 134 - 135 - 136 in predetermined locations . the upper strip 103 is preferably provided with apertures 109 above each of the mentioned grooves in the base strip 107 to facilitate making electrical connections with the leads 134 and 136 during a subsequent phase of the manufacturing process . the base strip 107 may also be provided with a series of holes ( not shown ) for use in accurately locating or indexing the carrier 101 relative to stations where processing operations are to be performed . once the carrier 101 is assembled with a plurality of the lead units 134 - 135 - 136 arranged as illustrated , such units will remain positively supported in their predetermined relationships to each other and the carrier 101 until the latter is disassembled to release them . fig6 illustrates the step of placing the carrier 101 supporting a plurality of the units 134 - 135 - 136 into juxtaposition with a vessel 111 containing a conductive bonding paste 113 , such as silver powder mixed in heat curable epoxy material , to immerse and coat the distal clamping finger structures 155 of the leads 134 and 136 with such paste 113 . fig7 depicts the manner in which a plurality of crystal elements 140 , preformed with electrode structures 143 thereon , are temporarily supported by a pair of masking strips 115 ( of which only the proximate one is shown ) on either side thereof and to which the elements 140 are adhesively attached at predetermined intervals , and the way in which the elements 140 may thus be moved as a group into juxtaposition with the carrier 101 for aligning each of the elements 140 and the electrode structures 143 thereon with the clamping fingers 155 of a corresponding pair of the leads 134 and 136 , which are coated with the conductive paste material 113 . actually , fig7 also suggests how the electrode structures 143 , and particularly the tab portions 151 thereof may be accurately positioned in the elements 140 during preforming , in that , the masking strips 115 are provided with a series of accurately located and appropriately shaped notches 117 through which the electrode materials may be deposited upon the faces of a plurality of the elements 140 during preforming thereof . alternatively , if the elements 140 are available with the electrode structures 143 already preformed thereon , only a single support strip 115 may be used , to which such elements 140 will be temporarily adhered in appropriate predetermined positions . fig8 shows the carrier 101 , the masking strips 115 and the leads 134 , 136 and elements 140 respectively supported thereby being processed in above noted juxtaposition thereof within a tunnel oven 119 to cure the paste 113 , thereby permanently physically connecting each element 140 with a corresponding lead unit 134 - 135 - 136 and electrically coupling each of the leads 134 and 136 with the tab portion 151 of a corresponding electrode structure 143 , after which the masking strips 115 are removed from the elements 140 ( which are then supported by the carrier 101 ). before frequency testing and adjustment may be carried out on the elements 140 , it is necessary that the electrical coupling between the leads 134 and 136 theretofore inherent in the presence of the bight 135 must be eliminated . this is shown in fig9 as being accomplished by a shear 121 and cooperating shear block 123 for concurrently cutting away the bights 135 associated with the elements 140 being supported by the carrier 101 . fig1 depicts frequency , testing and adjustment being carried out within a vacuum box 125 , with test lead probes 127 and 129 shown as coupled with the leads 134 and 136 via the apertures 109 provided for that purpose in the upper carrier strip 103 ( see : fig5 ), and with conventional heating means 131 and metallic ( or iodine ) source material 133 disposed for depositing sufficient additional material upon one of the electrodes 143 of the elements 140 for adjusting the resonance frequency thereof to the desired value in accordance with known techniques . fig1 depicts in elevation an aluminum foil strip 161 in which a plurality of top cover members 147 have been formed at predetermined intervals , as by die stamping , and also depicts a similar strip 163 in which a plurality of bottom cover members 149 have been similarly formed . the strip 163 is also shown in plan view in fig1 , from which it may be noted that , although the peripheries of the formed members 149 are largely severed from the strip 163 , attachment bridges are left as at 165 for temporarily retaining the members 149 on the strip 163 ; and the members 147 are similarly temporarily retained on the strip 161 . fig1 shows the strips 161 and 163 being immersed in a tank 165 containing a solution 167 for anodizing the members 147 and 149 . fig1 and 15 depict a plurality of the elements 140 supported by a common carrier 101 being respectively juxtaposed between corresponding pairs of members 147 and 149 respectively carried by strips 161 and 163 , all in further aligned juxtaposition with and between an upper plural cavity die 181 and a lower plural cavity die 183 that will be used in further forming and assembly operations . the die 183 is provided with shears 185 for completing the severance of the members 147 and 149 from the strips 161 and 163 respectively when the dies 181 and 183 are closed . fig1 depicts the dies 181 and 183 closed to precisely align the members 147 and 149 in the cavities 187 and 189 thereof and the shears 185 being operated to fully separate the members 147 and 149 from the strips 161 and 163 . fig1 and 18 depict the successive employment of upper crimping dies 191 and 193 to successively bend and firmly crimp the flange portion 172 of the members 149 into overlying engaging relationship with the annular outer portion 164 of the members 147 , thereby interconnecting each pair of members 147 and 149 with a corresponding element 140 supported and held therebetween adjacent its nodal margin . fig1 depicts the completion of these operations with the die 193 withdrawn , it being understood that the plurality of sets of associated elements 140 and members 147 and 149 thus far assembled will still be supported by the carrier 101 common thereto , with the pairs of leads 134 and 136 respectively associated therewith extending away from the viewer in the direction of the carrier 101 ( which , to avoid undue cluttering , is not shown in the background of fig1 through 19 ). fig2 shows a plurality of the thus far completed assemblies 192 supported by the carrier 101 and being preheated in an oven 194 prior to dipping of the assemblies 191 into epoxy encapsulating material 195 within a container 197 , as shown in fig2 . fig2 shows the carrier 101 and the assemblies 192 supported thereby , to the latter of which epoxy encapsulating material 197 is adhering , disposed within a curing oven 199 for curing the material 195 into a hardened encapsulation covering the entirety of the assemblies 192 except for the leads 134 and 136 protruding therefrom . with the processing thus completed , the fully manufactured products thus produced will be of the nature previously described with reference to the preferred form of piezoelectric crystal assembly 30 ( or of such differing nature as may result from changes made by the user in the construction of the crystal assembly to whose fabrication and assembly the method of the invention is applied ). it will be perceived that the improved method provided by the invention presents many advantages from the standpoint of efficiency and economy , as well as uniformity of the products manufactured therewith , as compared with conventional prior techniques for making piezoelectric crystal assemblies . it will be understood by those skilled in the art , however , that various minor modifications could be made from the preferred embodiments of the improved apparatus and method provided by this invention , without significantly departing from the gist and essence of the invention . accordingly , the invention should be deemed limited only by the fair scope of the claims which follow when construed to encompass manifest mechanical equivalents .	7
a wheel speed sensor 10 is coupled to the wheel of a vehicle . such sensors or transducers , typically , are magnetic transducers which provide sine wave output signals upon passage of ferromagnetic elements in front of a pick - up coil . other types of transducers may be used . the output signal of the vehicle rotation transducer is used in the automatic anti brake - lock control unit ( abs ) 13 to derive from the signals from the transducers other signals representative of slip , speed , acceleration or deceleration of the respective wheel . further signals can be derived therefrom , for example by averaging , and modifying , in accordance with known criteria , wheel speed signals in order to derive a vehicle speed signal . the various signals are processed -- as well known -- in the control unit 13 to provide output signals representative of control action , and if the control unit 13 should respond at all . each one of the wheel transducers 10 is connected to a low - pass filter 11 , as known . the customary inductive - type speed sensors provide output signals which increase with increasing wheel speed . the low - pass filter 11 , connected to the transducer 10 , dampens frequencies at higher range , so that the signal obtained from the filter 11 is essentially linear . the low - pass filter 10 , however , also suppresses disturbance signals so that threshold circuits , customarily included within the control unit 13 , will not respond . under certain operating conditions , and particularly under the influence of out - of - round conditions within the transducer system of which the transducer 10 is a part , vibration , and the like , the transducer 10 and the low - pass filter 11 may form a resonance system . this is particularly so if the sensor or transducer 10 is periodically mechanically disturbed , for example due to vibration or other similar periodically recurring conditions . resonance systems , as well known , cause substantial signal level increases . under such conditions , thus , disturbance signals may be unduly enhanced , and may cause erroneous response of a threshold circuit within the control unit system 13 . in accordance with a feature of the invention , a high - pass filter 12 is connected to the low - pass filter 11 , and selectively connectable in circuit with the low - pass filter 11 and the control unit 13 . of course , the control unit 13 will have similar signals applied thereto from the other wheels of the vehicle , as indicated by the broken connecting lines with the arrows leading to the control unit 13 . switch 14 is provided for selective connection or disconnection of the high - pass filter 12 . switch 14 is operated in dependence on the output from an or - gate 15 . the or - gate 15 is controlled by two output lines 16 , 17 connected to the control unit 13 . the output line 16 carries a signal derived from vehicle speed , and , if the speed drops below a predetermined minimum speed , or - gate 15 is enabled to close switch 14 . line 17 carries a signal which is representative of response of the control unit 13 , which may occur , for example , if one of the wheels of the vehicle is about to block , which may lead to skidding , as sensed by the control unit 13 . if at least one of these two signals is present on lines 16 , 17 , or - gate 15 is enabled and switch 14 will close . under those conditions , then , the high - pass filter 12 is bridged , so that it will no longer influence signal processing from the transducer 10 and the filter 11 in the control unit 13 . thus , the high - pass filter 12 will be excluded from influencing the signal if the speed of the respective wheel , or vehicle speed -- in dependence on the nature of the signal on the line 16 -- is below a predetermined reference level ; or if the abs unit 13 has responded . the reason for bridging the high - pass filter 12 is this : at low vehicle or wheel speeds , the output signals from the transducer 10 are low , and no additional attenuation by further circuit components of the signal should result ; further , at low wheel or vehicle speeds , disturbance signals with relevant amplitude at the relevant frequency are not expected . further , such disturbance signals usually do not occur during the time that the control unit of the anti - skid or anti brake - lock system has responded ; any disturbance signals which occur during response of the control unit 13 , can be suppressed by signal processing within the control unit , as well known . fig1 illustrates the simplest case in which the high - pass filter 12 is merely bridged or shunted by the switch 14 . other switching arrangements may be used and , of course , the switch 14 may be replaced by an electronic switch , such as a controlled semiconductor . further , of course , the shunting circuit formed by switch 14 need not be of the on / off type ; rather , the effectiveness of the filter 12 can be decreased with decrease of vehicle or wheel speed , for example by attenuating the effect of the filter 12 by including in the parallel circuit a variable resistor which , in a limiting case , forms a continuous conductor , such as a transistor which provides a shunting path to the filter 12 of variable resistance , changing in dependence on the level of a control signal applied through an analog or - gate 15 between a high or essentially blocked value , intermediate levels , to an essentially zero resistance or entirely conductive level . fig2 illustrates an embodiment in which the speed transducer 10 is connected to a low - pass filter formed by the series circuit of a resistor 20 and a capacitor 21 . this low - pass filter is connected to a high - pass filter formed by a capacitor 22 and resistor 23 . switch 14 is provided to change the characteristics of the high - pass filter by , selectively , connecting a further resistor 24 in parallel to resistor 23 upon closing of switch 14 . of course , similar effects can be obtained by switching the capacitor 22 . switch 14 is shown only in symbolic representation and , of course , can be replaced by an electronic switch of the on / off type , or of the gradually increasing resistance type , for example a transistor . the output from the filter circuits 20 , 21 and 22 , 23 , with or without connection of resistor 24 , provides the filtered utilization signal , which is applied to an evaluation circuit 25 . the output of the evaluation circuit 25 is connected to two threshold circuits k 1 , k 2 connected as comparators . the output from evaluation circuit 25 , thus , is connected to the direct input of an operational amplifier forming comparator k 1 and the inverting input of a second , and preferably similar operational amplifier forming comparator k 2 . the output signal u s is , additionally , connected to a peak detector 26 . the output from the peak detector 26 is connected to the inverting input of the first comparator k 1 and , further , through an inverter 27 to the direct input of the other comparator k 2 . the outputs of the comparators k 1 , k 2 are connected to the set and reset inputs of a flip - flop ff , respectively , as shown in fig2 . operation , with reference to fig3 : the filtered sensor voltage u s , derived from the evaluation circuit 25 , is shown in the top graph of fig3 . the states of the comparators k 1 , k 2 are shown in the next subsequent graphs , and the state of the flip - flop ff in the last line of the graphs of fig3 . the circuit including components 26 , 27 , k 1 , k 2 and ff is used to provide output signals representative of a threshold which changes with increasing signal amplitude . in order to obtain such a changing threshold , the peak value of the signal u s at the output of the evaluation circuit 25 , as determined by the peak signal circuit 26 , is sensed and stored for one signal undulation , as clearly seen in fig3 see top graph u s . the output signal of the peak value circuit 26 is shown at 31 . this signal is connected to a weighting circuit , for example a voltage divider , which forms a weighted signal of somewhat smaller or lower value , to determine a threshold level which varies with the overall level or peak value of the signal being applied thereto , so that the threshold will change as a function of the peak value . the weighted signal is shown by broken line 32 . the weighting of signal 31 to obtain signal 32 can be carried out directly within the peak value detector 26 or , separately , by suitable adjustment setting or biassing of the comparators k 1 , k 2 . the graphs of fig3 show input signals 30 of increasing amplitude , and hence an increasing threshold level . of course , as the signals decrease , the threshold level likewise will decrease . the comparators k 1 , k 2 compare the weighted peak value of u s -- see broken line 32 -- with the instantaneous peak value of the signals , see chain - dotted line 31 . referring to fig3 : after the first undulation or period of u s , the weighted value , line 32 , is applied to comparator k 1 . at time t 1 , the second undulation reaches the value of line 32 , causing the flip - flop ff to be set . the flip - flop ff is reset when the negative threshold in the second comparator k 2 is reached . this negative threshold , illustrated by a broken - line curve , is the inverse of the curve 32 . as can be clearly seen , the curve 32 , at time t 2 , is at a greater difference level from zero or null than the curve 31 was at time t 1 . thus , the reset time of the thresold t 2 now has considered the increase in signal amplitude of the second undulation above the peak value 30 of the first undulation . the signal voltage , prior to reaching the negative portion of the output signal , has passed through a maximum so that , in the time after t 1 , the weighted value 32 has shifted , thus shifting the response value of the second comparator k 2 . thus , with response of the comparator k 2 at time t 2 , the flip - flop ff is reset . the cycles will repeat between the times t 3 / t 4 and t 5 / t 6 , respectively . as is clearly apparent from the graphs , the switching threshold of the comparators k 1 , k 2 follows the signal voltage 30 , and increases with increasing signal voltage level . any interference or disturbance or noise voltages , thus , are increasingly suppressed as the signal voltage increases , so that malfunction or erroneous response of the control unit 13 is thereby prevented . the output signal from the flip - flop ff is connected to the control unit 13 , the circuit portion between the evaluation circuit 25 and the flip - flop ff being , for example , connected just in advance of the control unit 13 . various changes and modifications may be made , and features described in connection with one of the embodiments may be used with the other , within the scope of the inventive concept . the control unit 13 is well known in the literature and in industry , and could , for example , take the form described in u . s . pat . no . 3 , 620 , 437 . the evaluation circuit 25 comprises dc - blocking means and potentiometer means for adjusting the trigger level of comparators k 1 and k 2 .	8
referring to the accompanying drawings , there is illustrated a cooler device generally indicated by reference numeral 10 . the device 10 is particularly suited for receiving a pair of can drinks 12 slidably therein for cooling the drinks or maintaining the drinks in a cooled condition . the device 10 includes a housing 14 having an inner shell 16 and an outer shell 18 . the inner shell 16 comprises a tubular member having an open top end 20 and an enclosed bottom end 22 . the inner walls of the inner shell are cylindrical and have dimensions near to the exterior dimensions of conventional ; aluminium drink cans for slidably receiving the cans therein . the housing has a suitable length so that a pair of the cans 12 maybe received therein in stacking arrangement while receiving one or more cooling discs 24 therebetween . each cooling disc 24 comprises a cylindrical member shorter in height than its radial dimensions . the top and bottom surfaces include a raised central portion 26 having a plateau shape for fitting within the rim of a conventional aluminium can . the outer shell of the disc 24 receives refrigerant material therein so that the disc can be pre - chilled in a freezer or refrigerator prior to being stacked in series with aluminium cans within the housing of the device for cooling the cans or maintaining the cans in a cooled condition . the inner shell 16 of the housing is surrounded by insulating material which spans between the inner and outer shells . the outer shell 18 includes an exterior surface 28 which is suitably shaped and coloured to resemble a perched bird , for example a toucan in which a long beak 30 extends down the front 32 of the exterior surface . eyes are formed in the outer surface 28 which receive the top potion of the beak 30 therebetween so that a continuous seam is formed along the top edge of the outer shell across both eyes and the top of the beak . a lid 38 is pivotally supported on the top edge of the housing adjacent the rear side 40 thereof . the lid similarly includes an inner core 42 supporting an outer shell 44 thereon in which the exterior surface of the outer shell 44 is configured to be concealed within the shaped appearance of the outer shell of the housing 14 . in particular , the lid is in the form of a smooth doomed surface having a bottom edge configured to match the profile of the eyes 34 and the beak therebetween along the top edge of the housing so that the lid represents a forehead of the bird which meets with the housing in a closed position along a seam formed between the eyes and beak and the forehead for concealing the lid within the design of the housing . the lid includes a hinge 46 integrally moulded with the inner core 42 thereof and which is suitably configured to bias the lid into an open position in relation to the housing . the lid is thus pivotal between the open position in which drink cans 12 can be slidably received through the open top end of the housing and a closed position in which the lid spans the open top end to enclose the housing . a catch mechanism 48 is provided on the lid for selectively retaining the lid in the closed position . the catch mechanism includes a slot formed in the top edge of the inner shell 16 at the front side of the housing . the slot 50 includes an internal shoulder 52 formed therein in the front wall of the slot in which the slot is enlarged in internal dimension below the shoulder . a wall portion 54 of the front wall forming the slot directly below the shoulder 52 is separated along the top and both sides thereof so as to be only anchored to the inner shell 16 of the housing along the bottom edge of the defined wall portion 54 . the wall portion 54 is thus movable relative to the internal shoulder 52 by flexing movement thereof from a relaxed position in which the internal shoulder 52 includes a lateral extent and a flexed position in which the wall portion overlaps the shoulder 52 so that the front wall of the slot 50 is flush and free of any edges for retaining a catch member thereon . a radial arm 56 is integrally formed on the wall portion 54 which in turn is integrally moulded with the rim about the top end of the inner shell 16 . the radial arm projects radially outward from the front side of the inner shell so that when pushed inwardly from an outer end thereof , the wall portion is flexed inwardly into a release position . the nose portion defining the beak 30 of the exterior surface is floatably supported within the remaining outer shell to permit some free floating movement of the beak in relation to the housing . the nose portion forming the beak 30 is anchored to the free end of the radial arm 56 so that depressing the beak 30 inwardly in relation to the surrounding housing permits the wall portion to be flexed inwardly as well . the catch member 58 of the catch mechanism , is supported on the lid 38 . the catch member includes a hook 60 formed at a free end thereof by a forward protrusion which is suitably positioned and sized for being retained on the internal shoulder 52 of the slot within the housing in a locked position . a free end of the hook 60 is sloped to define a camming face which causes the hook 60 to be deflected rearwardly upon closing when the camming face engages the outer peripheral edge of the slot 50 in the top edge . the catch member 58 thus flexes rearwardly when closing until the hook 60 is received below the internal shoulder 52 at which point flexing of the catch member is released so that the hook member 60 is again deflected forwardly into the relaxed position held beneath the internal shoulder 52 in the locked position . pushing the beak 30 inwardly causes the radial arm to flex the wall portion 54 which is thus moved in relation to the internal shoulder to slide along the shoulder and push the hook 60 rearwardly into a disengaged position with the shoulder 52 . the hinge thus biases the lid into the open position as the catch member 58 is released from the slot 50 . in further embodiments the external surface may be configured into various other shapes representative of objects or animals . in each instance the lid is disguised as potion of the object being represented as is the actuator and release button 30 supported at the free end of the radial arm 56 . when the external surface resembles an animal for instance , the button 30 typically comprises a nose of the animal while the lid comprises a portion of the head , specifically a forehead which meets the nose and eyes of the animal along the seam between the lid and the housing to conceal the seam at an intersection of the facial features of the animal . while one embodiment of the present invention has been described in the foregoing , it is to be understood that other embodiments are possible within the scope of the invention . the invention is to be considered limited solely by the scope of the appended claims .	5
an embodiment of the present invention will now be explained with reference to the drawings . fig1 is a plan view of a substrate joining apparatus for implementing a substrate joining method of the present invention , and fig2 is a front view thereof . as shown in fig4 , the substrate joining apparatus according to the present embodiment is configured to join a reinforcing substrate w 2 formed of glass plate serving as a second substrate on a semiconductor wafer ( hereinafter , simply referred to as “ wafer ”) w 1 serving as a first substrate . basically , as shown in fig1 and 2 , a stage frame 4 is disposed on the upper face of a base frame 1 equipped with caster wheels 2 for movement and stands 3 for fixing , and a joining mechanism 5 and an openable / closable decompression chamber 6 accommodating the same are disposed on the stage frame 4 . the joining mechanism 5 includes a holding table 7 of vacuum adsorption type on which the wafer w 1 is horizontally mounted and held , a pair of right and left side latch claws 8 and a center latch claw 9 that latch and hold the periphery of the reinforcing substrate w 2 at three points , a joining roller 10 that is horizontally hung in the right and left direction and moves fore - and - aft direction , and driving means for these . concrete structures of each part will be explained below . as shown in fig3 , the side latch claws 8 are bolted to a holder 11 in a detachable manner , and are formed stepwise at their tip ends with a latch portion 8 a of a partial arc shape that receives and latches a right and left opposing portion in the periphery of the reinforcing substrate w 2 from beneath . this latch portion 8 a is formed over a certain range in the circumferential direction from right and left diagonal positions passing through the center of the substrate to a starting end side of the joining ( lower side in fig3 ). the holder 11 itself is born on a bearing bracket 12 so as to be able to oscillate about a horizontal lateral axial center x 1 passing through the center of the substrate in plane view , and a supporting axis 13 rotatably supported by the bearing bracket 12 is connected to an air - driven rotary actuator 15 via an electromagnetic valve 14 . the holder 11 is allowed to oscillate only from the horizontal posture to the front down posture , and when the electromagnetic valve 14 is in a neutral position “ n ” as illustrated , the rotary actuator 15 can freely rotate . when the electromagnetic valve 14 is switched to a first position p 1 , the rotary actuator 15 drives the holder 11 into the front rising direction , so that the holder 11 and the side latch claws 8 attached thereto are forcedly held in the horizontal posture which is an oscillation limit in the front rising direction . again referring to fig1 and 2 , the bearing bracket 12 bearing the holder 11 of either right or left side latch claw 8 and the rotary actuator 15 are mounted on a supporting stage 16 , and the supporting stage 16 is designed to be laterally movable in the horizontal direction via a linear lateral driving mechanism 17 driven in a screw feeding manner by an air cylinder or a pulse motor . in other words , the right and left side latch claws 8 are reciprocable between the substrate holding position and the retracted position retracted outside the substrate . furthermore , the linear lateral driving mechanism 17 itself is mounted on an elevator stage 19 which is able to move up and down along a rail 18 erected on the stage frame 4 , and by moving up and down the elevator stage 19 in a screw feeding manner by means of a pulse motor 20 , it is possible to move up and down the right and the left side latch claws 8 respectively as desired . the center latch claw 9 is also bolted to a holder 21 in a detachable manner as shown in fig3 , and formed stepwise at its tip end with a latch portion 9 a of a partial arc shape that receives and latches an edge end on the joining end side of the reinforcing substrate w 2 from beneath over a certain range in the circumferential direction . the holder 21 itself is born on a bearing bracket 22 so as to be able to oscillate about a horizontal lateral axial center x 2 in plane view , and a supporting axis 23 rotatably supported by the bearing bracket 22 is connected to an air - driven rotary actuator 25 via an electromagnetic valve 24 . the holder 21 is allowed to oscillate only from the horizontal posture to the front down position . when the electromagnetic valve 24 is in a neutral position “ n ” as illustrated , the rotary actuator 25 can freely rotate , and when the electromagnetic valve 24 is switched to a first position p 1 , the rotary actuator 25 drives the holder 21 into the front rising direction , so that the holder 21 and the center latch claw 9 attached thereto are forcedly held in the horizontal posture which is the oscillation limit in the front rising direction . the bearing bracket 22 bearing the holder 21 of the center latch claw 9 and the rotary actuator 25 are also mounted on a supporting stage 26 , and the supporting stage 26 is designed to be movable in the fore - and - aft direction via a linear fore - and - aft driving mechanism ( not shown ) driven in a screw feeding manner by an air cylinder or a pulse motor . in other words , the center latch claw 9 is reciprocable between the substrate holding position and the retracted position retracted outside the substrate . furthermore , as seen from fig2 , the linear fore - and - aft driving mechanism itself is mounted on an elevator stage 28 which is able to move up and down along a rail 27 erected on the stage frame 4 , and by moving up and down the elevator stage 28 in a screw feeding manner by means of a pulse motor 29 , it is possible to move up and down the center latch claw 9 as desired . the decompression chamber 6 is made up of a fixed peripheral wall 30 of rectangular cylinder shape provided on the stage frame 4 and a cover case 31 attached to the fixed peripheral wall 30 via a hinge ( not shown ) so as to be able to open / close by oscillation in the vertical direction . thus , the internal pressure of the decompression chamber 6 can be reduced by actuating a vacuum pump ( not shown ). the entire circumference of the upper end of the fixed peripheral wall 30 is attached with a seal 32 for ensuring closeness of the interior by close contact with the entire circumference of the lower end of the closed cover case 31 . the joining roller 10 is provided in the cover case 31 so as to be movable in the fore - and - aft direction and in the up and down direction . to be more specific , the cover case 31 is attached with an elevator frame 35 which is slidable in the up and down direction via four guide axes 33 and is driven to move up and down by the air cylinder 34 . that is , as to the joining roller 10 , a movable stage 37 is attached so as to be movable in the fore - and - aft direction along a pair of right and left guide axes 36 that are hung by elevator frame 35 horizontally in the fore - and - aft direction ; and the joining roller 10 is rotatably supported horizontally in the right and left direction by a holder 38 that is connected by bolting to the bottom face of the movable stage 37 in a detachable manner . on the right and left sides of the elevator frame 35 , a non - slip type belt 41 that is to be rotationally driven by the motor 40 is horizontally wound in the fore - and - aft direction . to this belt 41 is connected the movable stage 37 , and by driving the movable stage 37 to move horizontally in the fore - and - aft direction by rotating the belt 41 forward or backward , the joining roller 10 is moved horizontally in the fore - and - aft direction . the holder 38 of the joining roller 10 is provided with a motor 42 for driving the joining roller 10 , the motor 42 auto - rotating while moving the joining roller 10 in the fore - and - aft direction . joining operations of the substrate joining apparatus having the above configurations will be explained below based on fig4 to 9 . ( 1 ) first , the decompression chamber 6 is opened by lifting the cover case 31 , a wafer w 1 before subjected to back grinding is aligned and held by adsorption on the holding table 7 in such a posture that the surface is upside . on the surface of the wafer w 1 , a separable adhesive sheet which will lose its adhesiveness upon heating is preliminarily stuck together with a separator . when the mounting of the substrate to the holding table 7 completes , the separator on the surface is separated to make the adhesive surface exposed . at this point of time , the joining roller 10 is on standby at the starting point located upside and front side , while the side latch claws 8 and the center latch claw 9 are on standby in horizontal posture at the height of the starting point where they are retracted outside the substrate at a predetermined height . ( 2 ) next , the side latch claws 8 and the center latch claw 9 are caused to move horizontally to predetermined positions on the center side of the substrate that are determined based on preliminarily input information in accordance with the diameter of the reinforcing substrate w 2 , where the reinforcing substrate w 2 is horizontally latched and held , supported at three points along the widths of the latch portions 8 a , 9 a of the side latch claws 8 and the center latch claw 9 . ( 3 ) upon completion of the substrate mounting process as described above , the cover case 31 is closed to seal the decompression chamber 6 , after which the air is discharged to reduce the internal pressure to not more than 65 kpa ( 500 mmhg ). ( 4 ) upon completion of the decompression , a joining starting instruction is issued to start a joining operation . ( 5 ) in response to the joining instruction , the side latch claws 8 and the center latch claw 9 are moved down so that the latched and held reinforcing substrate w 2 is moved down until a distance t with the wafer w 1 reaches a predetermined amount ( for example , 1 mm ), as shown in fig4 . ( 6 ) next , as shown in fig5 , the joining roller 10 is moved down so as to push down the front end of the reinforcing substrate w 2 until it comes into contact with the front end of the wafer w 1 . ( 7 ) thereafter , as shown in fig6 , by moving the joining roller 10 frontward on the reinforcing substrate w 2 while driven to rotate at the same height , the reinforcing substrate w 2 is gradually joined to the wafer w 1 from its front end while being deformed to bend . in this case , the driving speed of rotation is controlled so that the circumferential velocity of the joining roller 10 which is driven to rotate coincides with the forward movement velocity of the roller , so that the trailing force toward the surface direction is prevented from acting on the reinforcing substrate w 2 . in addition , as the joining roller 10 moves forward , the side latch claws 8 and the center latch claw 9 are controlled to gradually move down based on a program designated in advance , and the bend of the reinforcing substrate w 2 is kept within an acceptable range . ( 8 ) in an early stage of the joining , the rotary actuators 15 and 25 for controlling postures of the latch claws are supplied with air to forcedly hold the side latch claws 8 and the center latch claw 9 in the horizontal posture which is the oscillation limit . however , as the joining roller 10 moves forward to reach a predetermined position , the electromagnetic valves 14 and 24 are switched from the first position p 1 to the neutral position n to allow the rotary actuators 15 and 25 freely rotate . in this condition , under the influence of the external forces exerted from the bending and inclining reinforcing substrate w 2 to the side latch claws 8 and the center latch claw 9 , the side latch claws 8 and the center latch claw 9 oscillate about the fulcrums x 1 and x 2 so as to conform with the inclination of the reinforcing substrate w 2 . accordingly , it is possible to prevent the stress from concentrating at the latch points of the reinforcing substrate w 2 to inflict damage . however , as shown in fig3 , in the air discharge path from the rotary actuators 15 and 25 when the side latch claws 8 and the center latch claw 9 oscillate in a manner to conform with the inclination of the substrate , a variable diaphragm 43 utilizing a needle valve is incorporated so that appropriate resistance are exerted on the air discharge . therefore , immediately after the electromagnetic valves 14 and 24 are switched from the first position p 1 to the neutral position n , the inertia rotation when the rotary actuators 15 , 25 rotate by external forces is suppressed . therefore , it is possible to prevent occurrence of the situation that the side latch claws 8 and the center latch claw 9 oscillate more than necessary and damage the latch portions of the substrate . ( 9 ) as shown in fig7 and 11 , when the joining roller 10 moves to a predetermined position which is close to the side latch claw 8 , the side latch claw 8 retracts outside the substrate so as not to inhibit movement of the joining roller 10 . ( 10 ) as the joining proceeds near the end of the termination of the substrate , as shown in fig9 , also the center latch claw 9 retracts outside the substrate to allow the joining roller 10 to move toward the termination of the substrate to complete the joining . ( 11 ) upon completion of the joining , the joining roller 10 moves up and returns to the original position , the decompression chamber 6 is ventilated to the atmospheric pressure , thereafter , the cover case 31 is opened and the wafer w 1 to which the reinforcing substrate w 2 is joined is taken out . this is the end of the one cycle of joining operation . the cycle of operation is then repeated . in the above joining apparatus , if the diameter of the substrate changes , the holding table 7 , the side latch claws 8 , the center latch claw 9 and the joining roller 10 are also replaced by suitable ones . although the forward movement velocity of the joining roller 10 may be usually constant , the area where the roller moves may be separated into a plurality of sections , and the forward movement velocity may be changed for each section . in the above embodiment , the case where the reinforcing substrate w 2 having the same diameter as the wafer w 1 is joined was taken as an example , the same operation applies to the case where a reinforcing substrate w 2 having a slightly smaller diameter than the wafer w 1 is joined . also a reinforcing substrate w 2 having a larger diameter than the wafer w 1 may be joined and , in this case , the side latch claws 8 and the center latch claw 9 may be moved down so as to sink into notch recesses 7 a , 7 b formed near the circumference of the holding table 7 rather than retracting the side latch claws 8 and the center latch claw 9 outside the substrate . not limited to the above embodiment , the present invention may be practiced in the following variants . ( 1 ) as a reinforcing substrate w 2 to be joined to the wafer w 1 , any materials having large rigidity such as stainless sheet can be used besides the glass substrate . furthermore , the present invention may be applied to not only the semiconductor wafer but also to various kinds of work to be subjected to thinning process . ( 2 ) in the above embodiment , the reinforcing substrate w 2 was held by the center and the side latch claws 8 and 9 . however , in addition to this , the surface of the reinforcing substrate w 2 may be held by adsorption by a plurality of adsorption nozzles . in this case , the adsorption nozzles may be intermittently or continuously moved down to a predetermined position in accordance with the bend of the wafer w 1 generated with the movement of the joining roller 10 and may be retracted above the reinforcing substrate w 2 as is necessary . ( 3 ) in the above embodiment , the joining roller 10 is auto - rotated by the motor 42 . however , the joining roller 10 may roll on the surface of the reinforcing substrate w 2 following the fore - and - aft horizontal movement of the movable stage 37 of the reinforcing substrate w 2 without driven by auto - rotation of the motor 42 . ( 4 ) an adhesive sheet may be adhered in advance to the reinforcing substrate w 2 to be joined . the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof and , accordingly , reference should be made to the appended claims , rather than to the foregoing specification , as indicating the scope of the invention .	7
referring to fig1 and 2 , an opener is shown as a handle 10 in the form of a rectangular tube . a first end 10a of handle 10 has a v - shaped notch 12 . the notch 12 has pair of opposing banks , namely a proximal bank 12a and distal bank 12b . since handle 10 has a hollow in the region of notch 12 , each of these two banks are in the form of a pair of parallel edges . the distal bank 12b is higher since first end 10a is higher . preferably , the main body of handle 10 is a square tube having an outside dimension of 0 . 637 inch ( 1 . 62 cm ) and a wall thickness of 0 . 094 inch ( 0 . 24 cm ). first end 10a has the same width and wall thickness but has a greater height , namely , 0 . 712 inch ( 1 . 8 cm ). the overall length of handle 10 is 4 . 07 inches ( 10 . 34 cm ). it will be appreciated that all of the foregoing dimensions are exemplary , and that in other embodiments these dimensions can be altered depending upon the desired size , strength , structural rigidity , etc . also , while a square or rectangular tube is illustrated , in some embodiments the tube perimeter may be polygonal , cylindrical , or some other shape . furthermore in some embodiments , the handle need not be hollow or need only be partly hollow . referring to fig1 - 5 , a pair of longitudinal slots 14 and 16 are formed in opposite interior walls of handle 10 . slots 14 and 16 run from the proximal bank 12a into the handle 10 a distance of 0 . 625 inch ( 1 . 6 cm ), although other dimensions are contemplated . a span of the handle lying between slots 14 and 16 is removed to provide a window opening 18 along approximately 60 percent of the length of slots 14 and 16 . still , in some embodiments , window 18 may be of a different size or may be eliminated altogether . fig1 shows a tab 20 underneath window 18 and mounted in slots 14 and 16 ( fig3 ). tab 20 is preferably a thin steel plate , about 0 . 03 inch ( 0 . 08 cm ) thick , although other thicknesses are contemplated for other embodiments . tab 20 is designed to fit in the slots 14 and 16 and extend into the notch 12 about 1 mm . accordingly , tab 20 will be about 0 . 49 inch ( 1 . 24 cm ) wide and 0 . 63 inch ( 1 . 6 cm ) long . as explained further hereinafter , tab 20 is sized to project into notch 12 an amount sufficient to allow tab 20 to catch the underside of a container cap such as a bottle cap . in other embodiments , tab 20 can be secured inside handle 10 in alternate fashions such as by glueing , riveting , by means of internal support brackets or by other means . also , in some embodiments where the material of handle 10 is sufficiently strong , the tab may be replaced with an integral lip that is formed integrally with the handle ( although use of a discrete tab is preferred to avoid the expense of making the entire handle as strong as the tab ). in this preferred embodiment , handle 10 is formed of a molded plastic . a pair of grooves 22 and 24 are formed on opposing interior walls at end 10a of handle 10 . grooves 22 and 24 align with longitudinal slots 14 and 16 , respectively . accordingly , tab 20 ( fig1 ) can be installed by sliding the tab along grooves 22 and 24 and then into slots 14 and 16 . in other embodiments , the size of the opening in end 10a can simply be increased to provide clearance for the passage of tab 20 . alternatively , if notch 12 is sufficiently large or the tab 20 is sufficiently short , tab 20 can be inserted into longitudinal slots 14 and 16 by insertion directly through notch 12 . a helical device is shown herein as a corkscrew 26 attached to a shank having a square prismatic section 28 ( also referred to as a matching polygonal or square prism ), integrally connected to cylindrical section 30 . section 28 is capped by a square flange 32 . corkscrew 26 is preferably a pointed steel rod that has been coiled into a spiral having three turns ; although a different number of turns may be used in alternate embodiments . in fig1 corkscrew 26 is shown sheathed inside handle 10 . the outside dimensions of section 28 match the inside dimensions of handle 10 so that the device snugly fits inside the handle . flange 32 prevents shank section 28 from slipping entirely inside handle 10 , which would impede deployment . shank sections 28 and 30 as well as flange 32 are integrally molded , with the corkscrew element 26 being embedded in the cylindrical shank section 30 . handle 10 has a transverse bore in the form of a pair of opposing square holes 34a and 34b formed on opposing spans of the handle 10 . since holes 34a and 34b are aligned and appropriately sized , the square shank 28 fits in holes 34a and 34b without the ability to rotate . thus corkscrew 26 can be removed from the position shown in fig1 and installed transversely to handle 10 in the position shown in fig6 . to facilitate an understanding of the principles associated with the foregoing apparatus , its operation will be briefly described . the opener may be assembled as shown in fig1 with tab 20 in place and the cork - screw 26 sheathed inside handle 10 by being inserted through end 10b . in this condition , the device can be readily used to open a container b as shown in fig7 . container b may be a conventional bottle sealed with a bottle cap c . notch 12 may be positioned as shown around the edge of cap c with the projecting tab 20 catching the rim of cap c . in this position , the handle 10 may be lifted , that is , rotated clockwise as indicated in fig7 . accordingly , handle 10 is then a lever , which is used to pry open cap c to remove the cap from bottle b . in embodiments employing corkscrew 26 , the handle 10 can also open bottles sealed with a cork . for this purpose , corkscrew 26 is removed from end 10b of handle 10 and is inserted through the holes 34a and 34b ( fig2 ) to produce the t - shaped structure shown in fig6 . accordingly , the user may grip the handle 10 and twist the corkscrew 26 in the usual fashion to thread it into a cork ( not shown ) of a bottle . once the corkscrew 26 is thus embedded , the user may pull on the handle 10 . flange 32 keeps the corkscrew 26 secured to handle 10 . thus , the cork can be readily pulled from the bottle and the bottle can be uncorked . thereafter , the cork can be removed from the corkscrew 26 . then the corkscrew can be removed from the transverse position illustrated in fig6 and returned to the stored position shown in fig1 . it is to be appreciated that various modifications may be implemented with respect to the above described preferred embodiments . in some embodiments , the corkscrew feature may be absent , in which case the transverse bore is unnecessary . in other embodiments the metal tab can be positioned differently and secured differently or in some instances eliminated and formed as an integral tab in the handle body . moreover , the various dimensions of the handle , the corkscrew and other elements of the opener may be altered depending upon the expected size of the caps and containers , as well as on the desired size , strength and reliability of the opener . furthermore , while a v - shaped notch is shown in one end of the handle , in other embodiments the notch may be rounded , undercut or exhibit another shape . while the handle body is preferably formed of molded plastic , in other embodiments metal , ceramic or other materials can be used instead . also , in some embodiments the handle may be formed from interlocking or telescoping parts that are attached together by various means in order to simplify the molding or manufacturing of the handle . obviously , many modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described .	1
reference will now be made in detail to the present embodiments , examples of which are illustrated in the accompanying drawings . when practical , the same or similar reference numerals are used throughout the drawings to refer to the same or like parts . fig1 is a cross section of a cable 10 according to a first embodiment . fig2 illustrates an end of the cable 10 . referring to fig1 and 2 , the cable 10 has at least one optical fiber 12 , a tight buffer layer 14 surrounding the optical fiber 12 , an inner jacket 16 surrounding the tight buffer layer 14 , and an outer jacket 18 surrounding the inner jacket 16 . an inner strength element layer 20 can be disposed between the tight buffer layer 14 and the inner jacket 16 , and an outer strength element layer 22 can be disposed between the inner jacket 16 and the outer jacket 18 . the dual jackets and dual strength element layers provide the cable 10 with the necessary ruggedness for ease of installation , and the versatility to be routed in confined spaces , while also being capable of termination using existing parts and methods . the optical fiber 12 can be , for example , a bend - insensitive optical fiber , such as fibers sold under the name clearcurve ™, available from corning incorporated . other bend - insensitive fibers and conventional optical fibers can also be used . the inner jacket 16 and the outer jacket 18 can be polymeric and can include materials , such as , for example , flame - retardant polymers conforming to nec ® ofnr and csa ofn ft - 4 for riser rated cables . the terms “ polymer ” and “ polymeric ” as used in this specification allow for the presence of additives , such as are commonly used in flame - rated jacket materials . any suitable jacket material may be used for the inner jacket 16 and the outer jacket 18 , such as , for example , polyurethanes ( pu ), polyvinylchloride ( pvc ), polyethylenes ( pe ), polyproplyenes ( pp ), uv - curable materials , and other polymer materials . the inner strength element layer 20 and the outer strength element layer 22 provide tensile strength to the cable 10 . the strength element layers 20 , 22 can be comprised of high tensile strength fibers aligned generally along the length of the cable 10 . the fibers can be aramid or para - aramid synthetic fibers such as , for example , kevlar ™, though other suitable materials may include fiberglass , polyester , high tensile polypropylene , and the like . the use of a layer of discrete tensile fibers provides tensile strength to the cable while also providing high flexibility for the cable 10 . the outer strength element layer 22 can be arranged so that some of the tensile fibers in the layer 22 contact the exterior of the inner jacket 16 and so that some of the tensile fibers contact the interior of the outer jacket 18 . optical fibers used in the present embodiments may be coated with the tubular tight buffer layer 14 , which can be polymeric . in the illustrated example , a single optical fiber 12 is a bend - insensitive clearcurve ™ fiber capable of bending to a 5 mm radius without appreciable attenuation , and the tight buffer layer 14 is a 900 μm thick layer of flame - retardant pvc material . other buffer layer thicknesses , such as 500 μm are also possible . the inner strength element layer 20 can be arranged so that some of the tensile fibers in the layer 20 contact the tight buffer layer 14 and so that some of the fibers contact the interior of the inner jacket 16 . as shown in fig1 , the cable 10 , and accordingly the outer jacket 18 , have an average or optimal diameter d 2 . the inner jacket 16 , inner strength element layer 20 , and the buffered optical fiber 12 form an inner cable 24 having an average or optimal outside diameter d 1 that is smaller than d 2 . the diameters d 1 and d 2 should be considered average diameters for the illustrated cross - section because some ovality and other defects may occur in manufacturing that cause the jackets to be non - circular to some degree . the diameter d 1 may be , for example , 80 % or less of the diameter d 2 . in the illustrated embodiment , the diameter d 1 is 70 % or less of the diameter d 2 . to manufacture the cable 10 , the tight - buffered optical fiber 12 is paid out through a non - stranded layer of tensile aramid yarn fibers that form the inner strength element layer 20 . flame - retardant polymer material is then pressure - extruded over the inner strength element layer 20 to form the inner jacket 16 . the inner jacket 16 , inner strength element layer 20 , and the buffered optical fiber 12 form the inner cable 24 . in the exemplary embodiment , the nominal diameter d 1 is 2 . 9 mm . the land length of the extrusion die used to extrude the polymer material for the inner jacket 16 is controlled to achieve a reasonable bonding force of the aramid yarns of the inner strength element layer 20 to the inner jacket 16 . bonding force can be determined by measuring the force required to remove a 10 inch section of the inner jacket 16 from the inner strength element layer 20 . according to one embodiment , the force can be in the range of 5 to 15 lbs ( 22 - 66 newtons ). the 2 . 9 mm diameter inner cable 24 is paid out through a helically stranded layer of tensile fibers to form the outer strength element layer 22 . in the illustrated embodiment , the fibers are aramid yarns of kevlar ™. the inner drop cable 24 with helically stranded outer strength element layer 22 may then be passed through an applicator where a layer of mineral particulates ( such as talc ) is applied . the polymer outer jacket 18 is then extruded over the outer strength element layer 22 . in the exemplary embodiment , the outer jacket 18 has an outer diameter d 2 of 4 . 8 mm . the amount of mineral particulates applied and the amount of pressure in the extrusion die can be controlled to provide a moderate stripping force of the outer jacket 18 from the outer strength element layer 22 . the stripping force can be in the range of 5 to 40 lbs ( 22 - 178 newtons ) for the removal of a 10 inch section of outer jacket 18 . fig2 shows an end 28 of the cable 10 ready for processing steps such as connectorization and / or optical coupling to another fiber , either within the factory or in the field . according to the present invention , the dual jackets 16 , 18 and dual strength element layers 20 , 22 provide the cable 10 with the necessary ruggedness for installation in relatively harsh conditions . the inner cable 24 can be separated from the exterior remainder of the cable 10 by stripping away an end portion of the outer jacket 18 and layer 22 . the exposed portion of the inner cable 24 may then be routed through smaller , relatively confined spaces , where the additional ruggedness of the jacket 18 and layer 22 may not be required . further , the inner cable 24 can be configured for connectorization using known parts and procedures , and is suitable for interface housings for multiple dwelling units ( mdu ). for example , the reduced diameter inner cable 24 can be installed in a housing , such as an optisheath ® mdu terminal available from corning cable systems , llc . the ruggedness of the cable 10 also mitigates or eliminates the effects of wavy fiber in the cable 10 . the cable therefore provides the installer with the installation advantages of heavier cables and the routing , connectorization , and other processing advantages of smaller cables . an exemplary method of processing the cable 10 is described below with reference to fig3 - 5 . fig3 shows an end portion 30 of the outer jacket 18 stripped away intact . the end portion 30 can be stripped away using a ring cut , using a commercially available wire stripper . a length of 24 inches to 48 inches of the end of the outer jacket 18 may be removed . mineral particulate applied on the outer strength element layer 22 and the controlled extrusion of the outer jacket 18 can be selected to obtain a desired coupling strength . the coupling strength , or , the force required to pull the outer jacket 18 off of the inner jacket 16 and the outer strength element layer 22 can be selected so that is it less than the force required to elastically deform the inner jacket 16 . elastic deformation of the inner jacket 16 may have the adverse effect of decoupling the bond between the inner layer of strength elements 20 and the inner jacket 16 . referring to fig4 , after removal of the end portion 30 of the outer jacket 18 , an end portion ( not shown ) of the inner jacket 16 is removed in the same manner as the end portion 30 to expose a sufficient length of tightly buffered layer 14 and fiber 12 . the tensile strength fibers of the inner and outer strength element layers 20 , 22 can be trimmed and laid back along the respective inner and outer jackets , 16 and 18 , as shown in fig4 . referring to fig5 , prior to connectorizing the cable 10 , one or more transition elements can be secured to the furcated end 36 of the cable . the transition elements , which include an outer transition element 40 and an inner transition element 60 in the illustrated embodiment , can be included for strain relief . strain relief can be advantageous at locations such as at the point where the cable 10 enters an mdu and is abruptly of reduced diameter . the exemplary outer transition element 40 is a machined metallic piece with an interior threaded bore 44 . the threaded bore 44 can be threaded over the laid back fibers of the outer strength element layer 22 and the outer jacket 18 so that it is firmly secured to the jacket 18 . similarly , the inner transition element 60 can be a crimp ring tightened around the laid back fibers of the inner strength element layer 20 and the inner jacket 16 so that it is secured to the jacket 16 . in the exemplary embodiment , the outer transition element 40 transitions the cable 10 from the 4 . 8 mm diameter outer jacket 18 to the 2 . 9 diameter inner jacket 16 . the inner transition element 60 can be part of the connectorization of the inner cable 24 of 2 . 9 mm diameter inner jacket 16 with a connector ( shown in fig1 ). with the transition elements attached , the fiber 12 can now be optically connected to a connector , such as connecting to a pigtailed connector , or , for directly connectorizing to a standard connector such as an sc connector , or to a field installable connector such as unicam ™ sc , st and lc available from corning cable systems , llc . connectorization can take place , for example , in a connection enclosure . fig6 - 9 illustrate alternative configurations and arrangements for the outer transition element . fig6 illustrates an outer transition element 90 in the form of plastic clip - on piece . referring also to fig4 , opposing sections 92 , 94 of the transition element 90 can be crimped over the tensile fibers of the outer strength element layer 22 and over the outer jacket 18 . the opposing halves 92 , 94 fold about a living hinge 96 and attach to one another through engagement of projections 102 with apertures 104 . fig7 illustrates an outer transition element 110 in the form of a metallic u - clip . referring also to fig4 , the transition element 110 can be crimped over the tensile fibers of the outer strength element layer 22 and over the outer jacket 18 . fig8 illustrates an outer transition element 130 in the form of a cable tie . referring also to fig4 , the transition element 130 can be tightened around the tensile fibers of the outer strength element layer 22 and over the outer jacket 18 . as an alternative to securing the tensile fibers of the outer strength element layer 22 to the outer jacket 18 , the fibers can be secured to an exterior element . fig9 , for example , illustrates the tensile fibers of the outer strength element 22 secured under a screw terminal 150 . a cable 10 as illustrated in fig1 - 2 is installed to optically connect a fiber connection enclosure such as a fiber distribution terminal ( fdt ) to an apartment unit in an mdu . the cable 10 is pulled between the fdt and an apartment unit using conventional means . the cable 10 is prepared for connectorization as shown in fig3 - 5 . the fdt can be of conventional design , having a housing enclosing hardware , and an entry point through which cables are connected to the fdt . at the entry point , the outer transition element is secured to a holding device ( e . g ., a crimp holder ) at the entry point to the fdt . any of the transition elements disclosed in this specification are suitable for securing the cable at the entry point . the smaller diameter inner cable 24 is then routed through the interior of the fdt . the inner cable 24 is terminated using an optisnap ™ connector using crimp bands . fig1 - 11 illustrate the resistance of the cable 10 to the wavy fiber phenomenon . fig1 illustrates the cable 10 ready for installation , such as for pulling through ductwork , etc ., when installing the cable 10 in a structure . a holding device such as a pressure clamp or a kellum &# 39 ; s grip can be used to securely couple to the outer jacket 18 , which enables the installer to exert the necessary force to pull the cable 10 through narrow openings or ducts . the presence of dual jackets 16 , 18 and strength element layers 20 , 22 provides high tensile strength and durability to the cable 10 during such installations . initially , the cut end face of the cable 10 is substantially flush in the plane defined by axes x and y . referring to fig1 , as the cable 10 is subjected to tensile pulling forces fp during installation , the elastic outer jacket 18 generally does not transfer excessive tensile loads to the inner jacket 16 . the outer jacket 18 may therefore elongate and extend past the inner jacket 16 and the optical fiber 12 by a distance δl . according to one aspect , when the outer jacket 18 retracts to its original length , little or none of the compressive load is transmitted to the inner jacket 16 , thereby inhibiting or precluding the creation of wavy fiber in the cable 10 . in other words , the outer jacket 18 bears most or all of the positive and negative tensile loads of installation such that fiber ( s ) in the inner cable 24 is not subject to the wavy fiber phenomenon . the limited space within the cable jacket also inhibits buckling of the fiber 12 . fig1 illustrates the cable 10 of fig1 as part of a cable assembly 200 . the cable assembly 200 has an sc connector assembly 210 connected at the end of the cable 10 . many modifications and other embodiments of the present invention , within the scope of the claims will be apparent to those skilled in the art . for instance , the concepts of the present invention can be used with any suitable composite cable designs and / or optical stub fitting assemblies . thus , it is intended that this invention covers these modifications and embodiments as well those also apparent to those skilled in the art .	6
in accordance with the present invention , the movement of an air mass is monitored by introducing a quantity of bacillus thurengiensis into the atmosphere at one or more given locations and positioning sampling equipment one or more points of interest to collect all of the material present in the ambient air . the collection equipment is usually placed downwind of the release point , but may also be in other locations to determine if there are any unexplained or unexpected movement of the air . frequently , a plurality of collection points forming a more or less regular grid pattern is established in order to achieve a more complete plot of the air &# 39 ; s movement . bacillus thurengiensis is a widely used entomopathogen . it was originally isolated from natural epizootics in susceptible lepidopteria in japan and germany . various formulations of bacillus thurengiensis have been commercially available for use in agriculture since the mid - 1950s . a potent strain was introduced commercially in the 1970s under the trademark dipel . in 1977 , a further strain named bacillus thurengiensis var israelensis was isolated in a stagnant pool in a river bed in the negev desert and later designated as bacillus thurengiensis , serotype h - 14 . the world health organization has developed a standard preparation of serotype h - 14 under the designation ips - 78 . bacillus thurengiensis is a spore forming , very hardy bacterium which is safe for warmblooded animals including humans . as a practical matter , the bacterium is an insecticide only for caterpillars and mosquitoes and it is not persistant in the environment . these characteristics make the bacillus thurengiensis particularly useful in the present invention . in order to trace the movement of an air mass , the bacterium is released into the atmosphere as a cloud of wet or dry particles generally , but not necessarily , in the 2 - 5 micron range . the bacterium can be released into the atmosphere in the same manner as it is used as a selective insecticide . for example , one can use a land - based atomizer or aerial spraying can be employed . the quantity released is not critical and theoretically a single spore is all that is necessary . more practically , a quantity of about 110 - 230 grams of bacillus thurengiensis powder ( having a potency of 1000 to 2000 aedes aegypti international toxic units ) can be employed per release location but greater but lesser amounts can also be employed , if desired . any conventional method of collecting airborne bacteria can be employed at the collection point or points in the process of this invention . the basic methods which can be employed include impingement in liquids , impaction on solid surfaces , filtration , sedimentation , centrifugation , electrostatic precipitation and thermal precipitation . a wide variety of instruments are available for practicing these collection methods . an excellent survey of these sampling methods and the equipment employed therein can be found in &# 34 ; sampling microbiological aerosols &# 34 ;, public health monograph no . 60 , issued by the public health service of the u . s . department of health , education and welfare ( public health service publication no . 686 ). the airborne detrius , i . e ., the material found in the ambient air , various pollens , fungi , spores , soil bacteria , soil particles , soot and assorted man - made particles , in the collected sample or samples is cultured , i . e ., the collected fraction of particulates in the atmosphere are combined with a suitable culture medium which can support the growth of the bacterium . beyond the known safety to humans , plants , domestic animals and almost all lower life forms , and the established methods of introduction into the atmosphere , the use of bacillus thurengiensis is particularly advantageous for two reasons . first , the microbe grows at room temperature so that no complex equipment is needed . second , the bacterium is unusual in that it can metabolize the citrate ion as a source of carbon while almost all other known spore forming bacteria are not so capable . further , the inclusion of citrate in an acidic state also inhibits the growth of other microbes . these characteristics simplify the analysis procedure and provide for greater accuracy since the growth of other spore forming bacteria need not be distinguished in the medium . accordingly , while the culture can be effected in any medium capable of supporting growth , it is preferably carried out in a medium containing citrate as the sole source of assimilable carbon . any of the known citrate media which do not contain another assimilable carbon source can be employed . a particular advantageous medium is the koser citrate medium which in dehydrated form contains 1 . 5 grams of sodium ammonium phosphate , 1 gram of mono - potassium phosphate , 0 . 2 gram magnesium sulfate and 3 grams of sodium citrate . in this medium , the ammonium salt serves as the sole source of nitrogen and the sodium citrate as the sole source of carbon . to rehydrate this medium , 5 . 7 grams are dissolved in 100 ml of distilled water . another typical citrate medium is simmons citrate agar which contains 0 . 2 gram magnesium sulfate , 1 gram of monoammonium phosphate , 1 gram dipotassium phosphate , 2 grams sodium citrate , 5 grams sodium chloride , 15 grams agar and 0 . 08 gram bromthymol blue . a typical culture medium which can be used in the present invention will contain 5 . 7 grams per liter koser citrate medium , 10 grams per liter caseine enzymatic digest , 0 . 03 gram per liter mnso 4 , 0 . 02 grams per liter feso 4 , 0 . 002 gram per liter thiamine hydrochloride and 15 grams per liter agar . since only one bacillus thurengiensis spore is needed in order to detect its presence , the test of the present invention is very sensitive . the single spore grows and replicates itself many times . an example of one use of the present invention concerns an evaluation of the accusation that fluoride emissions from an aluminum plant was killing cattle located at a distance of about 10 miles from the production plant . a solution of bacillus thurengiensis spores is sprayed into the atmosphere at the plant site under various weather conditions and collection devices are installed at the location where the cattle deaths occurred . the collected material is then cultured in the selective medium to determine the presence or absence of the bacterium . since both the fluoride emissions and the bacterium will be carried away from the aluminum plant by the same air mass , the results of the culturing provides an indication of whether the fluoride may have traveled from the plant to the place of the cattle fatalities . various changes and modifications can be made in the method of this invention without departing from the spirit and scope thereof . the various embodiments which have been disclosed herein were for the purpose of further illustrating the present invention and were not intended to limit it .	2
a hydrostatic drive unit test stand , illustrated generally at 10 , is set up as shown schematically in fig1 for testing a test specimen 12 in the form of a hydrostatic drive unit which includes a variable displacement hydraulic pump 14 and a hydraulic motor 16 connected by a pair of fluid lines 18 and 20 to form a closed fluid circuit 22 . pump 14 has an input shaft 24 for driving the pump such that hydraulic fluid is directed around the circuit 22 to energize the motor and rotate motor output shaft 28 . pump 14 also includes a tiltable swashplate 26 , which , by means known to those skilled in the art , is positionable for varying the magnitude and direction of rotation of motor shaft 28 . a prime mover in the form of an electric motor 30 is drivingly connected with pump input shaft 24 through a gear reduction or increaser 32 . activation of electric motor 30 results in the geared rotation of pump input shaft 24 which , in turn , generates a hydraulic flow in the circuit 22 . as described , the flow passes through motor 16 such that output shaft 28 is , in turn , rotated . gear reduction 32 may comprise a number of interengaged toothed gears of varying diameter or , alternatively , may comprise an additional hydrostatic system having a hydraulic pump and motor arranged in a fluid circuit . with this arrangement , it should be seen that activation of electric motor 30 is effective to produce a rotational output at motor shaft 28 . the foregoing describes the manner in which test specimen 12 is driven at a single operating condition . the present invention is directed toward an apparatus for adaptively controlling the operation conditions at which the specimen is tested . specifically , test stand 10 includes a hydraulic load unit 34 having a variable displacement hydraulic pump 36 and a hydraulic motor 38 connected by a pair of fluid lines 40 and 42 to form a closed fluid circuit 44 . pump 36 has a tiltable swashplate 46 and a pump shaft 48 drivingly connected to electric motor 30 . a motor shaft 50 is fixedly joined with motor output shaft 28 of hydraulic motor 16 such that motor shafts 28 and 50 are prohibited from independent rotation . test stand 10 includes a pair of control loops 51a and 51b not shown in fig1 associated with tiltable swashplates 46 and 26 , respectively , for prescribing the angular position thereof . control loop 51a includes a pressure transducer 56 mounted within closed fluid circuit 22 which communicates with each of fluid lines 18 and 20 for determining the relative pressure difference or delta system pressure therebetween . a first proportional integral derivative ( pid ) controller 60 receives a pressure feedback signal from pressure transducer 56 by means of a signal line 62 . pid controller 60 transmits a load control signal to an electronic displacment controller ( edc ) 52 by means of a signal line 64 . pid controller 60 communicates with a set point generator 66 by means of a signal line 68 . control loop 51b includes a speed sensor 58 mounted on motor output shaft 28 . a second pid controller 70 receives a speed feedback signal from speed sensor 58 by means of a signal line 72 , and transmits a speed control signal to a second edc 54 by means of signal line 74 . pid controller 70 communicates with set point generator 66 by means of signal line 76 . operation of the test stand will now be described . initially each of tiltable swashplates 26 and 46 are configured in a neutral position such that activation of prime mover 30 results in rotation of pump shafts 24 and 48 without inducing any fluid flow in closed fluid circuits 22 and 44 , respectively . swashplate 26 of hydraulic pump 14 is then adjusted away from neutral with a speed set point change on the electronic controller by means of edc 54 and provides fluid flow to hydraulic motor 16 . flow through motor 16 tends to rotate shaft 28 . however , because of the fixed connection between motor shaft 28 and 50 , shaft 28 is resisted from rotating by the inertia of the hydraulic load unit 34 . as pump 14 to direct flow toward motor 16 , which is , in turn , resisted from rotating by the hydraulic load unit , hydraulic pressure in the drive unit 12 begins to rise . specifically , fluid pressure in line 18 increases while pressure in fluid line 20 remains relatively small . this rise in relative pressure difference between fluid lines 18 and 20 is detected by pressure transducer 56 . the pressure differential is continually monitored by electronic controller 60 and compared with a desired pressure set point retained by set point generator 66 . when the pressure differential exceeds the set point pressure , controller 60 transmits an appropriate load control signal to edc 52 , which , in turn , adjusts the position of swashplate 46 away from neutral . by adjusting swashplate 46 , a fluid flow is established within closed fluid circuit 44 . the flow passes through hydraulic motor 38 and induces rotation of motor shaft 50 . the induced rotation reduces the resistance force acting against motor output shaft 28 and thereby reduces the pressure differential in drive unit 12 . the modulated pressure differential within the drive unit is continually monitored and swashplate 46 is directed to move by edc 52 until the pressure differential is reduced to the pressure set point . test stand 10 is further operable to maintain a speed set point for output shaft 28 . speed sensor 58 continually monitors the speed of shaft 28 and relays an appropriate feedback signal to electronic controller 70 . the speed feedback signal is continuously compared with a speed set point retained within set point generator 66 . when the measured speed either exceeds or falls below the speed set point , an appropriate speed control signal is transmitted by controller 70 along signal line 74 to edc 54 , which , in turn , modulates the position of swashplate 26 . swashplate 26 is continuously adjusted to maintain a commanded speed set point . it is possible that in attaining the speed set point for hydraulic motor 16 , the pressure differential within closed fluid circuit 22 may be effected . in this event , the modified pressure differential is detected by pressure transducer 56 and appropriate action is automatically taken , as described above , to maintain the desired pressure set point . during operation of test stand 10 , hydraulic load unit 34 may operate in an energy - absorbing mode of operation while applying rotational resistance to motor output shaft 28 . in this mode , hydraulic motor 38 acts as a pump and pump 36 acts as a hydraulic motor . forced rotation of shaft 50 directs fluid within circuit 44 toward motor / pump 36 . flow through motor / pump 36 results in rotation of shaft 48 , which provides regenerated power back into the prime mover 30 . this energy is then directly applied back to the shaft 24 of pump 14 . this feature results in considerable savings and operating expense of prime mover 30 . power may be regenerated whenever motor output shaft 28 is commanded by means of flow in circuit 22 to rotate at a different rate than that which motor shaft 50 will permit , independent of the speed of motor shaft 28 . test stand 10 provides a relatively low cost , electronically controlled apparatus for automatically monitoring and commanding the motor speed and system pressure for a hydraulic test specimen . because of the flexible operation of the apparatus , it is particularly well suited to run more than one type of test on a given test stand , e . g . switch from performance testing to endurance testing , or assess uphill loading vs downhill loading , without moving to another test stand . set point generator 66 , which may take the form of a conventional personal computer , is fully programmable and can also be used to record the actual system pressure and motor speed characteristics of a hydraulic drive unit installed on a vehicle drive train undergoing actual operation . the recorded data can then be played back through the set point generator within the test stand 10 and used to recreate the actual vehicle operating profile in a simulated laboratory environment . the constant torque of an inertial load , such as a flywheel , can be conveniently simulated with the test stand . the effect of an inertial load on a drive train would be represented by small accelerations of the motor output shaft in the case of a large inertia and , alternatively , rapid acceleration rates of the motor output shaft for relatively small inertias . by using the test stand , the acceleration rate of motor output shaft 28 can be controlled by controlling the acceleration rate of motor shaft 50 , which , in turn , is controlled by the angle of swashplate 46 in variable displacement pump 36 . thus , the apparent inertia affecting test specimen 12 is controlled by controlling the acceleration rate of hydraulic motor 38 . it will be understood that the invention may be embodied in other specific forms without departing from the spirit or central characteristics thereof . the present examples and embodiments , therefore , are to be considered in all respects as illustrative and not restrictive , and the invention is not to be limited to the details given herein .	6
in the following , a preferred embodiment of the present invention will be explained with reference to the drawings . the laser processing method and laser processing apparatus of an embodiment in accordance with the present invention is embodiment form a modified region by multiphoton absorption . the multiphoton absorption is a phenomenon occurring when the intensity of laser light is made very high . first , the multiphoton absorption will be explained in brief . a material becomes optically transparent when the energy hv of a photon is lower than the band gap e g of absorption of the material . therefore , the condition under which absorption occurs in the material is hv & gt ; e g . even when optically transparent , however , absorption occurs in the material under the condition of nhv & gt ; e g ( n = 2 , 3 , 4 , . . . ) when the intensity of laser light is made very high . this phenomenon is known as multiphoton absorption . in the case of pulse wave , the intensity of laser light is determined by the peak power density ( w / cm 2 ) of laser light at the light - converging point , whereas the multiphoton absorption occurs under the condition with a peak power density of at least 1 × 10 8 ( w / cm 2 ), for embodiment . the peak power density is determined by ( energy of laser light at the light - converging point per pulse )/( beam spot cross - sectional area of laser light × pulse width ). in the case of a continuous wave , the intensity of laser light is determined by the electric field intensity ( w / cm 2 ) of laser light at the light - converging point . the principle of laser processing in accordance with the embodiment utilizing such multiphoton absorption will now be explained with reference to fig1 to 6 . fig1 is a plan view of an object to be processed 1 during laser processing . fig2 is a sectional view of the object 1 shown in fig1 taken along the line ii — ii . fig3 is a plan view of the object 1 after laser processing . fig4 is a sectional view of the object 1 shown in fig3 taken along the line iv — iv . fig5 is a sectional view of the object 1 shown in fig3 taken along the line v — v . fig6 is a plan view of the cut object 1 . as shown in fig1 and 2 , the object 1 has a surface 3 with a line 5 along which the object is intended to be cut . the line 5 along which the object is intended to be cut is a linearly extending virtual line . in the laser processing of an embodiment in accordance with the present invention , the object 1 is irradiated with laser light l while locating a light - converging point p within the object 1 under a condition generating multiphoton absorption , so as to form a modified region 7 . the light - converging point refers to a location at which the laser light l is converged . by relatively moving the laser light l along the line 5 along which the object is intended to be cut ( i . e ., along the direction of arrow a ), the light - converging point p is moved along the line 5 along which the object is intended to be cut . this forms the modified region 7 along the line 5 along which the object is intended to be cut only within the object 1 as shown in fig3 to 5 . in the laser processing method in accordance with the embodiment , the modified region 7 is not formed by heating the object 1 due to the absorption of laser light l therein . the laser light l is transmitted through the object 1 , so as to generate multiphoton absorption therewithin , thereby forming the modified region 7 . therefore , the laser light l is hardly absorbed at the surface 3 of the object 1 , whereby the surface 3 of the object 1 will not melt . if a starting point exists in a part to be cut when cutting the object 1 , the object will break from the starting point , whereby the object 1 can be cut with a relatively small force as shown in fig6 . hence , the object 1 can be cut without generating unnecessary fractures in the surface 3 of the object 1 . the following two cases seem to exist in the cutting of the object to be processed using the modified region as a starting point . the first case is where , after the modified region is formed , an artificial force is applied to the object , whereby the object breaks while using the modified region as a starting point , and thus is cut . this is cutting in the case where the object to be processed has a large thickness , for embodiment . applying an artificial force includes , for embodiment , applying a bending stress or shearing stress to the object along the line along which the object is intended to be cut in the object to be processed or imparting a temperature difference to the object so as to generate a thermal stress . another case is where a modified region is formed , so that the object naturally breaks in the cross - sectional direction ( thickness direction ) of the object while using the modified region as a starting point , whereby the object is cut . this can be achieved by a single modified region when the thickness of the object is small , and by a plurality of modified regions formed in the thickness direction when the thickness of the object to be processed is large . breaking and cutting can be carried out with favorable control even in this naturally breaking case , since breaks will not reach the part formed with no modified region on the surface in the part to be cut , so that only the part formed with the modified region can be broken and cut . such a breaking and cutting method with favorable controllability is quite effective , since semiconductor wafers such as silicon wafers have recently been prone to decrease their thickness . the modified region formed by multiphoton absorption in the embodiment includes the following ( 1 ) to ( 3 ): ( 1 ) case where the modified region is a crack region including one or a plurality of cracks an object to be processed ( e . g ., glass or a piezoelectric material made of litao 3 ) is irradiated with laser light while the light - converging point is located therewithin under a condition with a peak power density of at least 1 × 10 8 ( w / cm 2 ) and a pulse width of 1 μs or less at the light - converging point . this magnitude of pulse width is a condition under which a crack region can be formed only within the object to be processed while generating multiphoton absorption without causing unnecessary damages to the surface of the object . this generates a phenomenon of optical damage caused by multiphoton absorption within the object to be processed . this optical damage induces thermal distortion within the object to be processed , thereby forming a crack region therewithin . the upper limit of electric field intensity is 1 × 10 12 ( w / cm 2 ), for embodiment the pulse width is preferably 1 ns to 200 ns , for embodiment . the forming of a crack region caused by multiphoton absorption is described , for embodiment , in “ internal marking of glass substrate by solid - state laser harmonics ”, proceedings of 45 th laser materials processing conference ( december 1998 ), pp . 23 - 28 . the inventor determined relationships between the electric field intensity and the magnitude of crack by an experiment . conditions for the experiment are as follows : ( a ) object to be processed : pyrex glass ( having a thickness of 700 μm ) ( b ) laser light source : semiconductor laser pumping nd : yag laser wavelength : 1064 nm laser light spot cross - sectional area : 3 . 14 × 10 − 8 cm 2 oscillation mode : q - switch pulse repetition frequency : 100 khz pulse width : 30 ns output : output & lt ; 1 mj / pulse laser light quality : tem 00 polarization characteristic : linear polarization ( d ) moving speed of a mounting table mounting the object to be processed : 100 mm / sec the laser light quality of tem 00 indicates that the light convergence is so high that light can be converged up to about the wavelength of laser light . fig7 is a graph showing the results of the above - mentioned experiment . the abscissa indicates peak power density . since laser light is pulse laser light , its electric field intensity is represented by the peak power density . the ordinate indicates the size of a crack part ( crack spot ) formed within the object to be processed by one pulse of laser light . an assembly of crack spots forms a crack region . the size of a crack spot refers to that of the part of dimensions of the crack spot yielding the maximum length . the data indicated by black circles in the graph refers to a case where the light - converging glass ( c ) has a magnification of × 100 and a numerical aperture ( na ) of 0 . 80 . on the other hand , the data indicated by white circles in the graph refers to a case where the light - converging glass ( c ) has a magnification of × 50 and a numerical aperture ( na ) of 0 . 55 . it is seen that crack spots begin to occur within the object to be processed when the peak power density reaches 10 11 ( w / cm 2 ), and become greater as the peak power density increases . a mechanism by which the object to be processed is cut upon formation of a crack region in the laser processing in accordance with the embodiment will now be explained with reference to fig8 to 11 . as shown in fig8 , the object to be processed 1 is irradiated with laser light l while locating the light - converging point p within the object 1 under a condition where multiphoton absorption occurs , so as to form a crack region 9 therewithin . the crack region 9 is a region including one or a plurality of cracks . as shown in fig9 , the crack further grows while using the crack region 9 as a starting point . as shown in fig1 , the crack reaches the surface 3 and rear face 21 of the object 1 . as shown in fig1 , the object 1 breaks , so as to be cut . the crack reaching the surface and rear face of the object to be processed may grow naturally or grow as a force is applied to the object . an object to be processed ( e . g ., a semiconductor material such as silicon ) is irradiated with laser light while the light - converging point is located there within under a condition with a peak power density of at least 1 × 10 8 ( w / cm 2 ) and a pulse width of 1 μs or less at the light - converging point . as a consequence , the inside of the object to be processed is locally heated by multiphoton absorption . this heating forms a molten processed region within the object to be processed . the molten processed region refers to at least one of a region once melted and then re - solidified , a region in a melted state , and a region in the process of re - solidifying from its melted state . the molten processed region may also be defined as a phase - changed region or a region having changed its crystal structure . the molten processed region may also be regarded as a region in which a certain structure has changed into another structure in monocrystal , amorphous , and polycrystal structures . namely , it refers to a region in which a monocrystal structure has changed into an amorphous structure , a region in which a monocrystal structure has changed into a polycrystal structure , and a region in which a monocrystal structure has changed into a structure including an amorphous structure and a polycrystal structure , for embodiment . when the object to be processed is a silicon monocrystal structure , the molten processed region is an amorphous silicon structure , for embodiment . the upper limit of electric field intensity is 1 × 10 12 ( w / cm 2 ), for embodiment . the pulse width is preferably 1 ns to 200 ns , for embodiment . by an experiment , the inventor has verified that a molten processed region is formed within a silicon wafer . conditions for the experiment is as follows : ( a ) object to be processed : silicon wafer ( having a thickness of 350 μm and an outer diameter of 4 inches ) ( b ) laser light source : semiconductor laser pumping nd : yag laser wavelength : 1064 nm laser light spot cross - sectional area : 3 . 14 × 10 − 8 cm 2 oscillation mode : q - switch pulse repetition frequency ; 100 khz pulse width : 30 ns output : 20 μj / pulse laser light quality : tem 00 polarization characteristic : linear polarization magnification : × 50 na : 0 . 55 transmittance with respect to laser light wavelength : 60 % ( d ) moving speed of a mounting table mounting the object to be processed : 100 mm / sec fig1 is a view showing a photograph of a cross section in a part of a silicon wafer cut by laser processing under the above - mentioned conditions . a molten processed region 13 is formed within a silicon wafer 11 . the size of the molten processed region formed under the above - mentioned conditions is about 100 μm in the thickness direction . the forming of the molten processed region 13 by multiphoton absorption will be explained . fig1 is a graph showing relationships between the wavelength of laser light and the transmittance within the silicon substrate . here , respective reflecting components on the surface and rear face sides of the silicon substrate are eliminated , whereby only the transmittance therewithin is represented . the above - mentioned relationships are shown in the cases where the thickness t of the silicon substrate is 50 μm , 100 μm , 200 μm , 500 μm , and 1000 μm , respectively . for embodiment , it is seen that laser light transmits through the silicon substrate by at least 80 % at 1064 nm , which is the wavelength of nd : yag laser , when the silicon substrate has a thickness of 500 μm or less . since the silicon wafer 11 shown in fig1 has a thickness of 350 μm , the molten processed region caused by multiphoton absorption is formed near the center of the silicon wafer , i . e ., at a part separated from the surface by 175 μm . the transmittance in this case is 90 % or greater with reference to a silicon wafer having a thickness of 200 μm , whereby the laser light is absorbed within the silicon wafer 11 only slightly and is substantially transmitted therethrough . this means that the molten processed region is not formed by laser light absorption within the silicon wafer 11 ( i . e ., not formed upon usual heating with laser light ), but by multiphoton absorption . the forming of a molten processed region by multiphoton absorption is described , for embodiment , in “ processing characteristic evaluation of silicon by picosecond pulse laser ”, preprints of the national meeting of japan welding society , no . 66 ( april 2000 ), pp . 72 - 73 . here , a fracture is generated in the cross - sectional direction while using the molten processed region as a starting point , whereby the silicon wafer is cut when the fracture reaches the surface and rear face of the silicon wafer . the fracture reaching the surface and rear face of the object to be processed may grow naturally or grow as a force is applied to the object . the fracture naturally grows from the molten processed region to the surface and rear face of the silicon wafer in one of the cases where the fracture grows from a region once melted and then re - solidified , where the fracture grows from a region in a melted state , and where the fracture grows from a region in the process of re - solidifying from a melted state . in any of these cases , the molten processed region is formed only within the cross section after cutting as shown in fig1 . when a molten processed region is formed within the object to be processed , unnecessary fractures deviating from a line along which the object is intended to be cut are hard to occur at the time of breaking and cutting , which makes it easier to control the breaking and cutting . ( 3 ) case where the modified region is a refractive index change region an object to be processed ( e . g ., glass ) is irradiated with laser light while the light - converging point is located therewithin under a condition with a peak power density of at least 1 × 10 8 ( w / cm 2 ) and a pulse width of 1 ns or less at the light - converging point . when multiphoton absorption is generated within the object to be processed with a very short pulse width , the energy caused by multiphoton absorption is not transformed into thermal energy , so that a permanent structural change such as ionic valence change , crystallization , or polarization orientation is induced within the object , whereby a refractive index change region is formed . the upper limit of electric field intensity is 1 × 10 12 ( w / cm 2 ), for embodiment . the pulse width is preferably 1 ns or less , more preferably 1 ps or less , for embodiment . the forming of a refractive index change region by multiphoton absorption is described , for embodiment , in “ formation of photoinduced structure within glass by femtosecond laser irradiation ”, proceedings of 42 th laser materials processing conference ( november 1997 ), pp . 105 - 111 . specific embodiments according to the present invention will now be explained . the laser processing method in accordance with a first embodiment of the present invention will be explained . fig1 is a schematic diagram of a laser processing apparatus 100 usable in this method . the laser processing apparatus 100 comprises a laser light source 101 for generating laser light l ; a laser light source controller 102 for controlling the laser light source 101 so as to regulate the output and pulse width of laser light l and the like ; a dichroic mirror 103 , arranged so as to change the orientation of the optical axis of laser light l by 90 %, having a function of reflecting the laser light l ; a light - converging lens 105 for converging the laser light l reflected by the dichroic mirror 103 ; a mounting table 107 for mounting an object to be processed 1 irradiated with the laser light l converged by the light - converging lens 105 ; an x - axis stage 109 for moving the mounting table 107 in the x - axis direction ; a y - axis stage 111 for moving the mounting table 107 in the y - axis direction orthogonal to the x - axis direction ; a z - axis stage 113 for moving the mounting table 107 in the z - axis direction orthogonal to x - and y - axis directions ; and a stage controller 115 for controlling the movement of these three stages 109 , 111 , 113 . the z - axis direction is a direction orthogonal to the surface 3 of the object to be processed 1 , thus becoming the direction of focal depth of laser light l incident on the object 1 . therefore , moving the z - axis stage 113 in the z - axis direction can locate the light - converging point p of laser light l within the object 1 . this movement of light - converging point p in x ( y )- axis direction is effected by moving the object 1 in the x ( y )- axis direction by the x ( y )- axis stage 109 ( 111 ). the x ( y )- axis stage 109 ( 111 ) is an embodiment of moving means . the laser light source 101 is an nd : yag laser generating pulse laser light . known as other kinds of laser usable as the laser light source 101 include nd : yvo 4 laser , nd : ylf laser , and titanium sapphire laser . for forming a crack region or molten processed region , nd : yag laser , nd : yvo 4 laser , and nd : ylf laser are used preferably . for forming a refractive index change region , titanium sapphire laser is used preferably . though pulse laser light is used for processing the object 1 in the first embodiment , continuous wave laser light may also be used as long as it can generate multiphoton absorption . in the present invention , laser light means to include laser beams . the light - converging lens 105 is an embodiment of light - converging means . the z - axis stage 113 is an embodiment of means for locating the light - converging point within the object to be processed . the light - converging point of laser light can be located within the object to be processed by relatively moving the light - converging lens 105 in the z - axis direction . the laser processing apparatus 100 further comprises an observation light source 117 for generating a visible light beam for irradiating the object to be processed 1 mounted on the mounting table 107 ; and a visible light beam splitter 119 disposed on the same optical axis as that of the dichroic mirror 103 and light - converging lens 105 . the dichroic mirror 103 is disposed between the beam splitter 119 and light - converging lens 105 . the beam splitter 119 has a function of reflecting about a half of a visual light beam and transmitting the remaining half therethrough , and is arranged so as to change the orientation of the optical axis of the visual light beam by 90 °. a half of the visible light beam generated by the observation light source 117 is reflected by the beam splitter 119 , and thus reflected visible light beam is transmitted through the dichroic mirror 103 and light - converging lens 105 , so as to illuminate the surface 3 of the object 1 including the line 5 along which the object is intended to be cut and the like . the laser processing apparatus 100 further comprises an image pickup device 121 and an imaging lens 123 disposed on the same optical axis as that of the beam splitter 119 , dichroic mirror 103 , and light - converging lens 105 . an embodiment of the image pickup device 121 is a ccd ( charge - coupled device ) camera . the reflected light of the visual light beam having illuminated the surface 3 including the line 5 along which the object is intended to be cut and the like is transmitted through the light - converging lens 105 , dichroic mirror 103 , and beam splitter 119 and forms an image by way of the imaging lens 123 , whereas thus formed image is captured by the imaging device 121 , so as to yield imaging data . the laser processing apparatus 100 further comprises an imaging data processor 125 for inputting the imaging data outputted from the imaging device 121 , an overall controller 127 for controlling the laser processing apparatus 100 as a whole , and a monitor 129 . according to the imaging data , the imaging data processor 125 calculates foal point data for locating the focal point of the visible light generated in the observation light source 117 onto the surface 3 . according to the focal point data , the stage controller 115 controls the movement of the z - axis stage 113 , so that the focal point of visible light is located on the surface 3 . hence , the imaging data processor 125 functions as an auto focus unit . also , according to the imaging data , the imaging data processor 125 calculates image data such as an enlarged image of the surface 3 . the image data is sent to the overall controller 127 , subjected to various kinds of processing , and then sent to the monitor 129 . as a consequence , an enlarged image or the like is displayed on the monitor 129 . data from the stage controller 115 , image data from the imaging data processor 125 , and the like are fed into the overall controller 127 . according to these data as well , the overall controller 127 regulates the laser light source controller 102 , observation light source 117 , and stage controller 115 , thereby controlling the laser processing apparatus 100 as a whole . thus , the overall controller 127 functions as a computer unit . with reference to fig1 and 15 , the laser processing method in accordance with a first embodiment of the embodiment will now be explained . fig1 is a flowchart for explaining this laser processing method . the object to be processed 1 is a silicon wafer . first , alight absorption characteristic of the object 1 is determined by a spectrophotometer or the like which is not depicted . according to the results of measurement , a laser light source 101 generating laser light l having a wavelength to which the object 1 is transparent or exhibits a low absorption is chosen ( s 101 ). next , the thickness of the object 1 is measured . according to the result of measurement of thickness and the refractive index of the object 1 , the amount of movement of the object 1 in the z - axis direction is determined ( s 103 ). this is an amount of movement of the object 1 in the z - axis direction with reference to the light - converging point of laser light l positioned at the surface 3 of the object 1 in order for the light - converging point p of laser light l to be positioned within the object 1 . this amount of movement is fed into the overall controller 127 . the object 1 is mounted on the mounting table 107 of the laser processing apparatus 100 . then , visible light is generated from the observation light source 117 , so as to illuminate the object 1 ( s 105 ). the illuminated surface 3 of the object 1 including the line 5 along which the object is intended to be cut is captured by the image pickup device 121 . thus obtained imaging data is sent to the imaging data processor 125 . according to the imaging data , the imaging data processor 125 calculates such focal point data that the focal point of visible light from the observation light source 117 is positioned at the surface 3 ( s 107 ). the focal point data is sent to the stage controller 115 . according to the focal point data , the stage controller 115 moves the z - axis stage 113 in the z - axis direction ( s 109 ). as a consequence , the focal point of visible light from the observation light source 117 is positioned at the surface 3 . according to the imaging data , the imaging data processor 125 calculates enlarged image data of the surface 3 of the object including the line 5 along which the object is intended to be cut . the enlarged image data is sent to the monitor 129 by way of the overall controller 127 , whereby an enlarged image of the line 5 along which the object is intended to be cut and its vicinity is displayed on the monitor 129 . movement amount data determined at step s 103 has been fed into the overall controller 127 beforehand , and is sent to the stage controller 115 . according to the movement amount data , the stage controller 115 causes the z - axis stage 113 to move the object 1 in the z - axis direction at a position where the light - converging point p of laser light l is located within the object 1 ( s 111 ). next , laser light l is generated from the laser light source 101 , so as to irradiate the line 5 along which the object is intended to be cut in the surface 3 of the object with the laser light l . since the light - converging point p of laser light is positioned within the object 1 , a molten processed region is formed only within the object 1 . subsequently , the x - axis stage 109 and y - axis stage 111 are moved along the line along which the object is intended to be cut , so as to form a molten processed region along the line 5 along which the object is intended to be cut within the object 1 ( s 113 ). then , the object 1 is bent along the line 5 along which the object is intended to be cut , and thus is cut ( s 115 ). this divides the object 1 into silicon chips . effects of the first embodiment will be explained . here , the line 5 along which the object is intended to be cut is irradiated with the pulse laser light l under a condition causing multiphoton absorption while locating the light - converging point p within the object 1 . then , the x - axis stage 109 and y - axis stage 111 are moved , so as to move the light - converging point p along the line 5 along which the object is intended to be cut . as a consequence , a modified region ( e . g ., crack region , molten processed region , or refractive index change region ) is formed within the object 1 along the line 5 along which the object is intended to be cut . when a certain starting point exists at a part to be cut in the object to be processed , the object can be cut by breaking it with a relatively small force . therefore , breaking the object 1 along the line 5 along which the object is intended to be cut while using a modified region as a starting point can cut the object 1 with a relatively small force . this can cut the object 1 without generating unnecessary fractures deviating from the line 5 along which the object is intended to be cut in the surface 3 of the object 1 . also , in the first embodiment , the object 1 is irradiated with the pulse laser light l at the line 5 along which the object is intended to be cut under a condition generating multiphoton absorption in the object 1 while locating the light - converging point p within the object 1 . therefore , the pulse laser light l is transmitted through the object 1 without substantially being absorbed at the surface 3 of the object 1 , whereby the surface 3 will not incur damages such as melting due to the forming of a modified region . as explained in the foregoing , the first embodiment can cut the object 1 without generating unnecessary fractures deviating from the line 5 along which the object is intended to be cut and melt in the surface 3 of the object . therefore , when the object is a semiconductor wafer , for embodiment , a semiconductor chip can be cut out from the semiconductor wafer without generating unnecessary fractures deviating from the line along which the object is intended to be cut and melt in the semiconductor chip . the same holds for objects to be processed whose surface is formed with electrode patterns , and those whose surface is formed with electronic devices such as piezoelectric wafers and glass substrates formed with display devices such as liquid crystals . therefore , the first embodiment can improve the yield of products ( e . g ., semiconductor chips , piezoelectric device chips , and display devices such as liquid crystal ) prepared by cutting the object to be processed . also , since the line 5 along which the object is intended to be cut in the surface 3 of the object 1 does not melt , the first embodiment can decrease the width of the line 5 along which the object is intended to be cut ( the width being the interval between regions to become semiconductor chips in the case of a semiconductor wafer , for embodiment ). this increases the number of products prepared from a single object to be processed 1 , whereby the productivity of products can be improved . since laser light is used for cutting the object 1 , the first embodiment enables processing more complicated than that obtained by dicing with a diamond cutter . for embodiment , even when the line 5 along which the object is intended to be cut has a complicated form as shown in fig1 , the first embodiment allows cutting . these effects are similarly obtained in embodiments which will be explained later . not only a single laser light source but also a plurality of laser light sources may be provided . for embodiment , fig1 is a schematic view for explaining the laser processing method in the first embodiment of the embodiment in which a plurality of laser light sources are provided . here , the object 1 is irradiated with three laser beams emitted from respective laser light sources 15 , 17 , 19 from different directions while the light - converging point p is located within the object 1 . the respective laser beams from the laser light sources 15 , 17 are made incident on the object 1 from the surface 3 thereof . the laser beam from the laser light source 19 is made incident on the object 1 from the rear face 21 thereof . since a plurality of laser light sources are used , this makes it possible for the light - converging point to have an electric field intensity with such a magnitude that multiphoton absorption occurs , even when laser light is continuous wave laser light having a power lower than that of pulse laser light . for the same reason , multiphoton absorption can be generated even without a light - converging lens . though the light - converging point p is formed by the three laser light sources 15 , 17 , 19 , the present invention is not restricted thereto as long as a plurality of laser light sources exist therein . fig1 is a schematic view for explaining another laser processing method in accordance with the first embodiment of the embodiment in which a plurality of laser light sources are provided . this embodiment comprises three array light source sections 25 , 27 , 29 each having a plurality of laser light sources 23 aligning along the line 5 along which the object is intended to be cut . among the array light source sections 25 , 27 , 29 , laser beams emitted from laser light sources 23 arranged in the same row form a single light - converging point ( e . g ., light - converging point p 1 ). this embodiment can form a plurality of light - converging points p 1 , p 2 , . . . along the line 5 along which the object is intended to be cut , whereby the processing speed can be improved . also , in this embodiment , a plurality of rows of modified regions can be formed at the same time upon laser - scanning on the surface 3 in a direction orthogonal to the line 5 along which the object is intended to be cut . a second embodiment of the present invention will now be explained . this embodiment is directed to a cutting method and cutting apparatus for a light - transmitting material . the light - transmitting material is an embodiment of the objects to be processed . in this embodiment , a piezoelectric device wafer ( substrate ) having a thickness of about 400 μm made of litao 3 is used as a light - transmitting material . the cutting apparatus in accordance with the second embodiment is constituted by the laser processing apparatus 100 shown in fig1 and the apparatus shown in fig1 and 20 . the apparatus shown in fig1 and 20 will be explained . the piezoelectric device wafer 31 is held by a wafer sheet ( film ) 33 acting as holding means . in the wafer sheet 33 , the face on the side holding the piezoelectric device wafer 31 is made of an adhesive resin tape or the like , and has an elasticity . the wafer sheet 33 is set on a mounting table 107 while being held with a sample holder 35 . as shown in fig1 , the piezoelectric device wafer 31 includes a number of piezoelectric device chips 37 which will be cut and separated later . each piezoelectric device chip 37 has a circuit section 39 . the circuit section 39 is formed on the surface of the piezoelectric device wafer 31 for each piezoelectric device chip 37 , whereas a predetermined gap α ( about 80 μm ) is formed between adjacent circuit sections 39 . fig2 shows a state where minute crack regions 9 as modified parts are formed within the piezoelectric device wafer 31 . next , with reference to fig2 , the method of cutting a light - transmitting material in accordance with the second embodiment will be explained . first , a light absorption characteristic of the light - transmitting material ( piezoelectric device wafer 31 made of litao 3 in the second embodiment ) to become a material to be cut is determined ( s 201 ). the light absorption characteristic can be measured by using a spectrophotometer or the like . once the light absorption characteristic is determined , a laser light source 101 generating laser light l having a wavelength to which the material to be cut is transparent or exhibits a low absorption is chosen according to the result of determination ( s 203 ). in the second embodiment , a yag laser of pulse wave ( pw ) type having a fundamental wave wavelength of 1064 nm is chosen . this yag laser has a pulse repetition frequency of 20 hz , a pulse width of 6 ns , and a pulse energy of 300 μj . the spot diameter of laser light l emitted from the yag laser is about 20 μm . next , the thickness of the material to be cut is measured ( s 205 ). once the thickness of the material to be cut is measured , the amount of displacement ( amount of movement ) of the light - converging point of laser light l from the surface ( entrance face for laser light l ) of the material to be cut in the optical axis direction of laser light l is determined so as to position the light - converging point of laser light l within the material to be cut according to the result of measurement ( s 207 ). for embodiment , in conformity to the thickness and refractive index of the material to be cut , the amount of displacement ( amount of movement ) of the light - converging point of laser light l is set to ½ of the thickness of the material to be cut . as shown in fig2 , due to the difference between the refractive index in the atmosphere ( e . g ., air ) surrounding the material to be cut and the refractive index of the material to be cut , the actual position of the light - converging point p of laser light is located deeper than the position of the light - converging point q of laser light l converged by the light - converging lens 105 from the surface of the material to be cut ( piezoelectric device wafer 31 ). namely , the relationship of “ amount of movement of z - axis stage 113 in the optical axis direction of laser light l × refractive index of the material to be cut = actual amount of movement of light - converging point of laser light l ” holds in the air . the amount of displacement ( amount of movement ) of the light - converging point of laser light l is set in view of the above - mentioned relationship ( between the thickness and refractive index of the material to be cut ). thereafter , the material to be cut held by the wafer sheet 33 is mounted on the mounting table 107 placed on the x - y - z - axis stage ( constituted by the x - axis stage 109 , y - axis stage 111 , and z - axis stage 113 in this embodiment ) ( s 209 ). after the mounting of the material to be cut is completed , light is emitted from the observation light source 117 , so as to irradiate the material to be cut with thus emitted light . then , according to the result of imaging at the image pickup device 121 , focus adjustment is carried out by moving the z - axis stage 113 so as to position the light - converging point of laser light l onto the surface of the material to be cut ( s 211 ). here , the surface observation image of piezoelectric device wafer 31 obtained by the observation light source 117 is captured by the image pickup device 121 , whereas the imaging data processor 125 determines the moving position of the z - axis stage 113 according to the result of imaging such that the light emitted from the observation light source 117 forms a focal point on the surface of the material to be cut , and outputs thus determined position to the stage controller 115 . according to an output signal from the imaging data processor 125 , the stage controller 115 controls the z - axis stage 113 such that the moving position of the z - axis stage 113 is located at a position for making the light emitted from the observation light source 117 form a focal point on the material to be cut , i . e ., for positioning the focal point of laser light l onto the surface of the material to be cut . after the focus adjustment of light emitted from the observation light source 117 is completed , the light - converging point of laser light l is moved to a light - converging point corresponding to the thickness and refractive index of the material to be cut ( s 213 ). here , the overall controller 127 sends an output signal to the stage controller 115 so as to move the z - axis stage 113 in the optical axis direction of laser light l by the amount of displacement of the light - converging point of laser light determined in conformity to the thickness and refractive index of the material to be cut , whereby the stage controller 115 having received the output signal regulates the moving position of the z - axis stage 113 . as mentioned above , the placement of the light - converging point of laser light l within the material to be cut is completed by moving the z - axis stage 113 in the optical axis direction of laser light l by the amount of displacement of the light - converging point of laser light l determined in conformity to the thickness and refractive index of the material to be cut ( s 215 ). after the placement of the light - converging point of laser light l within the material to be cut is completed , the material to be cut is irradiated with laser light l , and the x - axis stage 109 and the y - axis stage 111 are moved in conformity to a desirable cutting pattern ( s 217 ). as shown in fig2 , the laser light l emitted from the laser light source 101 is converged by the light - converging lens 105 such that the light - converging point p is positioned within the piezoelectric device wafer 31 facing a predetermined gap ( 80 μm as mentioned above ) formed between adjacent circuit sections 39 . the above - mentioned desirable cutting pattern is set such that the gap formed between the adjacent circuit sections 39 in order to separate a plurality of piezoelectric device chips 37 from the piezoelectric device wafer 31 is irradiated with the laser light l , whereas the laser light l is irradiated while the state of irradiation of laser light l is seen through the monitor 129 . here , as shown in fig2 , the laser light l irradiating the material to be cut is converged by the light - converging lens 105 by an angle at which the circuit sections 39 formed on the surface of the piezoelectric device wafer 31 ( the surface on which the laser light l is incident ) are not irradiated with the laser light l . converging the laser light l by an angle at which the circuit sections 39 are not irradiated with the laser light l can prevent the laser light l from entering the circuit sections 39 and protect the circuit sections 39 against the laser light l . when the laser light l emitted from the laser light source 101 is converged such that the light - converging point p is positioned within the piezoelectric device wafer 31 while the energy density of laser light l at the light - converging point p exceeds a threshold of optical damage or optical dielectric breakdown , minute crack regions 9 are formed only at the light - converging point p within the piezoelectric device wafer 31 acting as a material to be cut and its vicinity . here , the surface and rear face of the material to be cut ( piezoelectric device wafer 31 ) will not be damaged . now , with reference to fig2 to 27 , the forming of cracks by moving the light - converging point of laser light l will be explained . the material to be cut 32 ( light - transmitting material ) having a substantially rectangular parallelepiped form shown in fig2 is irradiated with laser light l such that the light - converging point of laser light l is positioned within the material to be cut 32 , whereby minute crack regions 9 are formed only at the light - converging point within the material to be cut 32 and its vicinity as shown in fig2 and 25 . the scanning of laser light l or movement of the material to be cut 32 is regulated so as to move the light - converging point of laser light l in the longitudinal direction d of material to be cut 32 intersecting the optical axis of laser light l . since the laser light l is emitted from the laser light source 101 in a pulsating manner , a plurality of crack regions 9 are formed with a gap therebetween corresponding to the scanning speed of laser light l or the moving speed of the material to be cut 32 along the longitudinal direction d of the material to be cut 32 when the laser light l is scanned or the material to be cut 32 is moved . the scanning speed of laser light l or the moving speed of material to be cut 32 may be slowed down , so as to shorten the gap between the crack regions 9 , thereby increasing the number of thus formed crack regions 9 as shown in fig2 . the scanning speed of laser light l or the moving speed of material to be cut may further be slowed down , so that the crack region 9 is continuously formed in the scanning direction of laser light l or the moving direction of material to be cut 32 , i . e ., the moving direction of the light - converging point of laser light l as shown in fig2 . adjustment of the gap between the crack regions 9 ( number of crack regions 9 to be formed ) can also be realized by changing the relationship between the repetition frequency of laser light l and the moving speed of the material to be cut 32 ( x - axis stage or y - axis stage ). also , throughput can be improved when the repetition frequency of laser light l and the moving speed of material to be cut 32 are increased . once the crack regions 9 are formed along the above - mentioned desirable cutting pattern ( s 219 ), a stress is generated due to physical external force application , environmental changes , and the like within the material to be cut , the part formed with the crack regions 9 in particular , so as to grow the crack regions 9 formed only within the material to be cut ( the light - converging point and its vicinity ), there by cutting the material to be cut at a position formed with the crack regions 9 ( s 221 ). with reference to fig2 to 32 , the cutting of the material to be cut upon physical external force application will be explained . first , the material to be cut ( piezoelectric device wafer 31 ) formed with the crack regions 9 along the desirable cutting pattern is placed in a cutting apparatus while in a state held by a wafer sheet 33 grasped by the sample holder 35 . the cutting apparatus has a suction chuck 34 , which will be explained later , a suction pump ( not depicted ) connected to the suction chuck 34 , a pressure needle 36 ( pressing member ), pressure needle driving means ( not depicted ) for moving the pressure needle 36 , and the like . usable as the pressure needle driving means is an actuator of electric , hydraulic , or other types . fig2 to 32 do not depict the circuit sections 39 . once the piezoelectric device wafer 31 is placed in the cutting apparatus , the suction chuck 34 approaches the position corresponding to the piezoelectric device chip 37 to be isolated as shown in fig2 . a suction pump apparatus is actuated while in a state where the suction chuck 34 is located closer to or abuts against the piezoelectric device chip 37 to be isolated , whereby the suction chuck 34 attracts the piezoelectric device chip 37 ( piezoelectric device wafer 31 ) to be isolated as shown in fig2 . once the suction chuck 34 attracts the piezoelectric device chip 37 ( piezoelectric device wafer 31 ) to be isolated , the pressure needle 36 is moved to the position corresponding to the piezoelectric device chip 37 to be isolated from the rear face of wafer sheet 33 ( rear face of the surface held with the piezoelectric device wafer 31 ) as shown in fig3 . when the pressure needle 36 is further moved after abutting against the rear face of the wafer sheet 33 , the wafer sheet 33 deforms , while the pressure needle 36 applies a stress to the piezoelectric device wafer 31 from the outside , whereby a stress is generated in the wafer part formed with the crack regions 9 , which grows the crack regions 9 . when the crack regions 9 grow to the surface and rear face of the piezoelectric device wafer 31 , the piezoelectric device wafer 31 is cut at an end part of the piezoelectric device chip 37 to be isolated as shown in fig3 , whereby the piezoelectric device chip 37 is isolated from the piezoelectric device wafer 31 . the wafer sheet 33 has an adhesiveness as mentioned above , thereby being able to prevent cut and separated piezoelectric device chips 37 from flying away . once the piezoelectric device chip 37 is separated from the piezoelectric device wafer 31 , the suction chuck 34 and pressure needle 36 are moved away from the wafer sheet 33 . when the suction chuck 34 and pressure needle 36 are moved , the isolated piezoelectric device chip 37 is released from the wafer sheet 33 as shown in fig3 , since the former is attracted to the suction chuck 34 . here , an ion air blow apparatus , which is not depicted , is used for sending an ion air in the direction of arrows b in fig3 , whereby the piezoelectric device chip 37 isolated and attracted to the suction chuck 34 , and the piezoelectric device wafer 31 ( surface ) held by the wafer sheet 32 are cleaned with the ion air . here , a suction apparatus may be provided in place of the ion air cleaning , such that the cut and separated piezoelectric device chips 37 and piezoelectric device wafer 31 are cleaned as dust and the like are aspirated . known as a method of cutting the material to be cut due to environmental changes is one imparting a temperature change to the material to be cut having the crack regions 9 only therewithin . when a temperature change is imparted to the material to be cut as such , a thermal distortion can occur in the material part formed with the crack regions 9 , so that the crack regions grow , whereby the material to be cut can be cut . thus , in the second embodiment , the light - converging lens 105 converges the laser light l emitted from the laser light source 101 such that its light - converging point is positioned within the light - transmitting material ( piezoelectric device wafer 31 ), whereby the energy density of laser light at the light - converging point exceeds the threshold of optical damage or optical dielectric breakdown , which forms the minute cracks 9 only at the light - converging point within the light - transmitting material and its vicinity . since the light - transmitting material is cut at the positions of thus formed crack regions 9 , the amount of dust emission is very small , whereby the possibility of dicing damages , chipping , cracks on the material surface , and the like occurring also becomes very low . since the light - transmitting material is cut along the crack regions 9 formed by the optical damages or optical dielectric breakdown of the light - transmitting material , the directional stability of cutting improves , so that cutting direction can be controlled easily . also , the dicing width can be made smaller than that attained in the dicing with a diamond cutter , whereby the number of light - transmitting materials cut out from one light - transmitting material can be increased . as a result of these , the second embodiment can cut the light - transmitting material quite easily and appropriately . also , a stress is generated within the material to be cut due to physical external force application , environmental changes , and the like , so as to grow the formed crack regions 9 to cut the light - transmitting material ( piezoelectric device wafer 31 ), whereby the light - transmitting material can reliably be cut at the positions of formed crack regions 9 . also , the pressure needle 36 is used for applying a stress to the light - transmitting material ( piezoelectric device wafer 31 ), so as to grow the formed crack regions 9 to cut the light - transmitting material ( piezoelectric device wafer 31 ), whereby the light - transmitting material can further reliably be cut at the positions of formed crack regions 9 . when the piezoelectric device wafer 31 ( light - transmitting material ) formed with a plurality of circuit sections 39 is cut and separated into individual piezoelectric device chips 37 , the light - converging lens 105 converges the laser light l such that the light - converging point is positioned within the wafer part facing the gap formed between adjacent circuit sections 39 , and forms the crack regions 9 , whereby the piezoelectric device wafer 31 can reliably be cut at the position of the gap formed between adjacent circuit sections 39 . when the light - transmitting material ( piezoelectric device wafer 31 ) is moved or laser light l is scanned so as to move the light - converging point in a direction intersecting the optical axis of laser light l , e . g ., a direction orthogonal thereto , the crack region 9 is continuously formed along the moving direction of the light - converging point , so that the directional stability of cutting further improves , which makes it possible to control the cutting direction more easily . also , in the second embodiment , dust - emitting powders hardly exist , so that no lubricating / cleaning water for preventing the dust - emitting powders from flying away is necessary , whereby dry processing can be realized in the cutting step . in the second embodiment , since the forming of a modified part ( crack region 9 ) is realized by non - contact processing with the laser light l , problems of durability of blades , their replacement frequency , and the like in the dicing caused by diamond cutters will not occur . also , since the forming of a modified part ( crack region 9 ) is realized by non - contact processing with the laser light l , the second embodiment can cut the light - transmitting material along a cutting pattern which cuts out the light - transmitting material without completely cutting the same . the present invention is not limited to the above - mentioned second embodiment . for embodiment , the light - transmitting material may be a semiconductor wafer , a glass substrate , or the like without being restricted to the piezoelectric device wafer 31 . also , the laser light source 101 can appropriately be selected in conformity to an optical absorption characteristic of the light - transmitting material to be cut . though the minute regions 9 are formed as a modified part upon irradiation with the laser light l in the second embodiment , it is not restrictive . for embodiment , using an ultra short pulse laser light source ( e . g ., femto second ( fs ) laser ) can form a modified part caused by a refractive index change ( higher refractive index ), thus being able to cut the light - transmitting material without generating the crack regions 9 by utilizing such a mechanical characteristic change . though the focus adjustment of laser light l is carried out by moving the z - axis stage 113 in the laser processing apparatus 100 , it may be effected by moving the light - converging lens 105 in the optical axis direction of is laser light l without being restricted thereto . though the x - axis stage 109 and y - axis stage 111 are moved in conformity to a desirable cutting pattern in the laser processing apparatus 100 , it is not restrictive , whereby the laser light l may be scanned in conformity to a desirable cutting pattern . though the piezoelectric device wafer 31 is cut by the pressure needle 36 after being attracted to the suction chuck 34 , it is not restrictive , whereby the piezoelectric device wafer 31 may be cut by the pressure needle 36 , and then the cut and isolated piezoelectric device chip 37 may be attracted to the suction chuck 34 . here , when the piezoelectric device wafer 31 is cut by the pressure needle 36 after the piezoelectric device wafer 31 is attracted to the suction chuck 34 , the surface of the cut and isolated piezoelectric device chip 37 is covered with the suction chuck 34 , which can prevent dust and the like from adhering to the surface of the piezoelectric device chip 37 . also , when an image pickup device 121 for infrared rays is used , focus adjustment can be carried out by utilizing reflected light of laser light l . in this case , it is necessary that a half mirror be used instead of the dichroic mirror 103 , while disposing an optical device between the half mirror and the laser light source 101 , which suppresses the return light to the laser light source 101 . here , it is preferred that the output of laser light l emitted from the laser light source 101 at the time of focus adjustment be set to an energy level lower than that of the output for forming cracks , such that the laser light l for carrying out focus adjustment does not damage the material to be cut . characteristic features of the present invention will now be explained from the viewpoints of the second embodiment . the method of cutting a light - transmitting material in accordance with an aspect of the present invention comprises a modified part forming step of converging laser light emitted from a laser light source such that its light - converging point is positioned within the light - transmitting material , so as to form a modified part only at the light - converging point within the light - transmitting material and its vicinity ; and a cutting step of cutting the light - transmitting material at the position of thus formed modified part . in the method of cutting a light - transmitting material in accordance with this aspect of the present invention , the laser light is converged such that the light - converging point of laser light is positioned within the light - transmitting material in the modified part forming step , whereby the modified part is formed only at the light - converging point within the light - transmitting material and its vicinity . in the cutting step , the light - transmitting material is cut at the position of thus formed modified part , so that the amount of dust emission is very small , whereby the possibility of dicing damages , chipping , cracks on the material surface , and the like occurring also becomes very low . since the light - transmitting material is cut at the position of thus formed modified part , the directional stability of cutting improves , so that cutting direction can be controlled easily . also , the dicing width can be made smaller than that attained in the dicing with a diamond cutter , whereby the number of light - transmitting materials cut out from one light - transmitting material can be increased . as a result of these , the present invention can cut the light - transmitting material quite easily and appropriately . also , in the method of cutting a light - transmitting material in accordance with this aspect of the present invention , dust - emitting powders hardly exist , so that no lubricating / cleaning water for preventing the dust - emitting powders from flying away is necessary , whereby dry processing can be realized in the cutting step . in the method of cutting a light - transmitting material in accordance with this aspect of the present invention , since the forming of a modified part is realized by non - contact processing with laser light , problems of durability of blades , their replacement frequency , and the like in the dicing caused by diamond cutters will not occur . also , since the forming of a modified part is realized by non - contact processing with the laser light , the method of cutting a light - transmitting material in accordance with this aspect of the present invention can cut the light - transmitting material along a cutting pattern which cuts out the light - transmitting material without completely cutting the same . preferably , the light - transmitting material is formed with a plurality of circuit sections , whereas laser light is converged such that the light - converging point is positioned within the light - transmitting material part facing the gap formed between adjacent circuit sections in the modified part forming step , so as to form the modified part . with such a configuration , the light - transmitting material can reliably be cut at the position of the gap formed between adjacent circuit sections . when irradiating the light - transmitting material with laser light in the modified part forming step , it is preferred that the laser light be converged by an angle at which the circuit sections are not irradiated with the laser light . converging the laser light by an angle at which the circuit sections are not irradiated with the laser light when irradiating the light - transmitting material with the laser light in the modified part forming step as such can prevent the laser light from entering the circuit sections and protect the circuit sections against the laser light . preferably , in the modified part forming step , the light - converging point is moved in a direction intersecting the optical axis of laser light , so as to form a modified part continuously along the moving direction of the light - converging point . when the light - converging point is moved in a direction intersecting the optical axis of laser light in the modified part forming step as such , so as to form the modified part continuously along the moving direction of the light - converging point , the directional stability of cutting further improves , which makes it further easier to control the cutting direction . the method of cutting a light - transmitting material in accordance with an aspect of the present invention comprises a crack forming step of converging laser light emitted from a laser light source such that its light - converging point is positioned within the light - transmitting material , so as to form a crack only at the light - converging point within the light - transmitting material and its vicinity ; and a cutting step of cutting the light - transmitting material at the position of thus formed crack . in the method of cutting a light - transmitting material in accordance with this aspect of the present invention , laser light is converged such that the light - converging point of laser light is positioned within the light - transmitting material , so that the energy density of laser light at the light - converging point exceeds a threshold of optical damage or optical dielectric breakdown of the light - transmitting material , whereby a crack is formed only at the light - converging point within the light - transmitting material and its vicinity . in the cutting step , the light - transmitting material is cut at the position of thus formed crack , so that the amount of dust emission is very small , whereby the possibility of dicing damages , chipping , cracks on the material surface , and the like occurring also becomes very low . since the light - transmitting material is cut at the position of the crack formed by an optical damage or optical dielectric breakdown , the directional stability of cutting improves , so that cutting direction can be controlled easily . also , the dicing width can be made smaller than that attained in the dicing with a diamond cutter , whereby the number of light - transmitting materials cut out from one light - transmitting material can be increased . as a result of these , the present invention can cut the light - transmitting material quite easily and appropriately . also , in the method of cutting a light - transmitting material in accordance with this aspect of the present invention , dust - emitting powders hardly exist , so that no lubricating / cleaning water for preventing the dust - emitting powders from flying away is necessary , whereby dry processing can be realized in the cutting step . in the method of cutting a light - transmitting material in accordance with this aspect of the present invention , since the forming of a crack is realized by non - contact processing with laser light , problems of durability of blades , their replacement frequency , and the like in the dicing caused by diamond cutters will not occur . also , since the forming of a crack is realized by non - contact processing with the laser light , the method of cutting a light - transmitting material in accordance with this aspect of the present invention can cut the light - transmitting material along a cutting pattern which cuts out the light - transmitting material without completely cutting the same . preferably , in the cutting step , the light - transmitting material is cut by growing the formed crack . cutting the light - transmitting material by growing the formed crack in the cutting step as such can reliably cut the light - transmitting material at the position of the formed crack . preferably , in the cutting step , a stress is applied to the light - transmitting material by using a pressing member , so as to grow a crack , thereby cutting the light - transmitting material . when a stress is applied to the light - transmitting material in the cutting step by using a pressing member as such , so as to grow a crack , thereby cutting the light - transmitting material , the light - transmitting material can further reliably be cut at the position of the crack . the apparatus for cutting a light - transmitting material in accordance with an aspect of the present invention comprises a laser light source ; holding means for holding the light - transmitting material ; an optical device for converging the laser light emitted from the laser light source such that a light - converging point thereof is positioned within the light - transmitting material ; and cutting means for cutting the light - transmitting material at the position of a modified part formed only at the light - converging point of laser light within the light - transmitting material and its vicinity . in the apparatus for cutting a light - transmitting material in accordance with this aspect of the present invention , the optical device converges laser light such that the light - converging point of laser light is positioned within the light - transmitting material , whereby a modified part is formed only at the light - converging point within the light - transmitting material and its vicinity . then , the cutting means cuts the light - transmitting material at the position of the modified part formed only at the light - converging point within the light - transmitting material and its vicinity , whereby the light - transmitting material is reliably cut along thus formed modified part . as a consequence , the amount of dust emission is very small , whereas the possibility of dicing damages , chipping , cracks on the material surface , and the like occurring also becomes very low . also , since the light - transmitting material is cut along the modified part , the directional stability of cutting improves , whereby the cutting direction can be controlled easily . also , the dicing width can be made smaller than that attained in the dicing with a diamond cutter , whereby the number of light - transmitting materials cut out from one light - transmitting material can be increased . as a result of these , the present invention can cut the light - transmitting material quite easily and appropriately . also , in the apparatus for cutting a light - transmitting material in accordance with this aspect of the present invention , dust - emitting powders hardly exist , so that no lubricating / cleaning water for preventing the dust - emitting powders from flying away is necessary , whereby dry processing can be realized in the cutting step . in the apparatus for cutting a light - transmitting material in accordance with this aspect of the present invention , since the modified part is formed by non - contact processing with laser light , problems of durability of blades , their replacement frequency , and the like in the dicing caused by diamond cutters will not occur as in the conventional techniques . also , since the modified part is formed by non - contact processing with the laser light as mentioned above , the apparatus for cutting a light - transmitting material in accordance with this aspect of the present invention can cut the light - transmitting material along a cutting pattern which cuts out the light - transmitting material without completely cutting the same . the apparatus for cutting a light - transmitting material in accordance with an aspect of the present invention comprises a laser light source ; holding means for holding the light - transmitting material ; an optical device for converging laser light emitted from the laser light source such that a light - converging point thereof is positioned within the light - transmitting material ; and cutting means for cutting the light - transmitting material by growing a crack formed only at the light - converging point of laser light within the light - transmitting material and its vicinity . in the apparatus for cutting a light - transmitting material in accordance with this aspect of the present invention , the optical device converges laser light such that the light - converging point of laser light is positioned within the light - transmitting material , so that the energy density of laser light at the light - converging point exceeds a threshold of optical damage or optical dielectric breakdown of the light - transmitting material , whereby a crack is formed only at the light - converging point within the light - transmitting material and its vicinity . then , the cutting means cuts the light - transmitting material by growing the crack formed only at the light - converging point within the light - transmitting material and its vicinity , whereby the light - transmitting material is reliably cut along the crack formed by an optical damage or optical dielectric breakdown of the light - transmitting material . as a consequence , the amount of dust emission is very small , whereas the possibility of dicing damages , chipping , cracks on the material surface , and the like occurring also becomes very low . since the light - transmitting material is cut along the crack , the directional stability of cutting improves , so that cutting direction can be controlled easily . also , the dicing width can be made smaller than that attained in the dicing with a diamond cutter , whereby the number of light - transmitting materials cut out from one light - transmitting material can be increased . as a result of these , the present invention can cut the light - transmitting material quite easily and appropriately . also , in the apparatus for cutting a light - transmitting material in accordance with this aspect of the present invention , dust - emitting powders hardly exist , so that no lubricating / cleaning water for preventing the dust - emitting powders from flying away is necessary , whereby dry processing can be realized in the cutting step . in the apparatus for cutting a light - transmitting material in accordance with this aspect of the present invention , since the crack is formed by non - contact processing with laser light , problems of durability of blades , their replacement frequency , and the like in the dicing caused by diamond cutters will not occur as in the conventional techniques . also , since the crack is formed by non - contact processing with the laser light as mentioned above , the method of cutting a light - transmitting material in accordance with this aspect of the present invention can cut the light - transmitting material along a cutting pattern which cuts out the light - transmitting material without completely cutting the same . preferably , the cutting means has a pressing member for applying a stress to the light - transmitting material . when the cutting means has a pressing member for applying a stress to the light - transmitting material as such , a stress can be applied to the light - transmitting material by using the pressing member , so as to grow a crack , whereby the light - transmitting material can further reliably be cut at the position of the crack formed . preferably , the light - transmitting material is one whose surface is formed with a plurality of circuit sections , whereas the optical device converges the laser light such that the light - converging point is positioned within the light - transmitting material part facing the gap formed between adjacent circuit sections . with such a configuration , the light - transmitting material can reliably be cut at the position of the gap formed between adjacent circuit sections . preferably , the optical device converges laser light by an angle at which the circuit sections are not irradiated with the laser light . when the optical device converges the laser light by an angle at which the circuit sections are not irradiated with the laser light as such , it can prevent the laser light from entering the circuit sections and protect the circuit sections against the laser light . preferably , the apparatus further comprises light - converging point moving means for moving the light - converging point in a direction intersecting the optical axis of laser light . when the apparatus further comprises light - converging point moving means for moving the light - converging point in a direction intersecting the optical axis of laser light as such , a crack can continuously be formed along the moving direction of the light - converging point , so that the directional stability of cutting further improves , whereby the direction of cutting can be controlled further easily . a third embodiment of the present invention will be explained . in the third embodiment and a fourth embodiment which will be explained later , an object to be processed is irradiated with laser light such that the direction of linear polarization of linearly polarized laser light extends along a line along which the object is intended to be cut in the object to be processed , whereby a modified region is formed in the object to be processed . as a consequence , in the modified spot formed with a single pulse of shot ( i . e ., a single pulse of laser irradiation ), the size in the direction extending along the line along which the object is intended to be cut can be made relatively large when the laser light is pulse laser light . the inventor has confirmed it by an experiment . conditions for the experiment are as follows : ( a ) object to be processed : pyrex glass wafer ( having a thickness of 700 μm and an outer diameter of 4 inches ) ( b ) laser light source : semiconductor laser pumping nd : yag laser wavelength : 1064 nm laser light spot cross - sectional area : 3 . 14 × 10 − 8 cm 2 oscillation mode : q - switch pulse repetition frequency : 100 khz pulse width : 30 ns output : output & lt ; 1 mj / pulse laser light quality : tem 00 polarization characteristic : linear polarization magnification : × 50 na : 0 . 55 transmittance with respect to laser light wavelength : 60 % ( d ) moving speed of a mounting table mounting the object to be processed : 100 mm / sec each of samples 1 , 2 , which was an object to be processed , was exposed to a single pulse shot of pulse laser light while the light - converging point is located within the object to be processed , whereby a crack region caused by multiphoton absorption is formed within the object to be processed . sample 1 was irradiated with linearly polarized pulse laser light , whereas sample 2 was irradiated with circularly polarized pulse laser light . fig3 is a view showing a photograph of sample 1 in plan , whereas fig3 is a view showing a photograph of sample 2 in plan . these planes are an entrance face 209 of pulse laser light . letters lp and cp schematically indicate linear polarization and circular polarization , respectively . fig3 is a view schematically showing a cross section of sample 1 shown in fig3 taken along the line xxxv — xxxv . fig3 is a view schematically showing a cross section of sample 1 shown in fig3 taken along the line xxxvi — xxxvi . a crack spot 90 is formed within a glass wafer 211 which is the object to be processed . in the case where pulse laser light is linearly polarized light , as shown in fig3 , the size of crack spot 90 formed by a single pulse shot is relatively large in the direction aligning with the direction of linear polarization . this indicates that the forming of the crack spot 90 is accelerated in this direction . when the pulse laser light is circularly polarized light , by contrast , the size of the crack spot 90 formed by a single pulse shot will not become greater in any specific direction as shown in fig3 . the size of the crack spot 90 in the direction yielding the maximum length is greater in sample 1 than in sample 2 . the fact that a crack region extending along a line along which the object is intended to be cut can be formed efficiently will be explained from these results of experiment . fig3 and 38 are plan views of crack regions each formed along a line along which the object is intended to be cut in an object to be processed . a number of crack spots 90 , each formed by a single pulse shot , are formed along a line 5 along which the object is intended to be cut , whereby a crack region 9 extending along the line 5 along which the object is intended to be cut is formed . fig3 shows the crack region 9 formed upon irradiation with pulse laser light such that the direction of linear polarization of pulse laser light aligns with the line 5 along which the object is intended to be cut . the forming of crack spots 9 is accelerated along the direction of the line 5 along which the object is intended to be cut , whereby their size is relatively large in this direction . therefore , the crack region 9 extending along the line 5 along which the object is intended to be cut can be formed by a smaller number of shots . on the other hand , fig3 shows the crack region 9 formed upon irradiation with pulse laser light such that the direction of linear polarization of pulse laser light is orthogonal to the line 5 along which the object is intended to be cut . since the size of crack spot 90 in the direction of the line 5 along which the object is intended to be cut is relatively small , the number of shots required for forming the crack region 9 becomes greater than that in the case of fig3 . therefore , the method of forming a crack region in accordance with this embodiment shown in fig3 can form the crack region more efficiently than the method shown in fig3 does . also , since pulse laser light is irradiated while the direction of linear polarization of pulse laser light is orthogonal to the line 5 along which the object is intended to be cut , the forming of the crack spot 90 formed at the shot is accelerated in the width direction of the line 5 along which the object is intended to be cut . therefore , when the crack spot 90 extends in the width direction of the line 5 along which the object is intended to be cut too much , the object to be processed cannot precisely be cut along the line 5 along which the object is intended to be cut . by contrast , the crack spot 90 formed at the shot does not extend much in directions other than the direction aligning with the line 5 along which the object is intended to be cut in the method in accordance with this embodiment shown in fig3 , whereby the object to be processed can be cut precisely . though making the size in a predetermined direction relatively large among the sizes of a modified region has been explained in the case of linear polarization , the same holds in elliptical polarization as well . namely , as shown in fig3 , the forming of the crack spot 90 is accelerated in the direction of major axis b of an ellipse representing elliptical polarization ep of laser light , whereby the crack spot 90 having a relatively large size along this direction can be formed . hence , when a crack region is formed such that the major axis of an ellipse indicative of the elliptical polarization of laser elliptically polarized with an ellipticity of other than 1 aligns with a line along which the object is intended to be cut in the object to be processed , effects similar to those in the case of linear polarization occur . here , the ellipticity is half the length of minor axis a / half the length of major axis b . as the ellipticity is smaller , the size of the crack spot 90 along the direction of major axis b becomes greater . linearly polarized light is elliptically polarized light with an ellipticity of zero . circularly polarized light is obtained when the ellipticity is 1 , which can not make the size of the crack region relatively large in a predetermined direction . therefore , this embodiment does not encompass the case where the ellipticity is 1 . though making the size in a predetermined direction relatively large among the sizes of a modified region has been explained in the case of a crack region , the same holds in molten processed regions and refractive index change regions as well . also , though pulse laser light is explained , the same holds in continuous wave laser light as well . the foregoing also hold in a fourth embodiment which will be explained later . the laser processing apparatus in accordance with the third embodiment of the present invention will now be explained . fig4 is a schematic diagram of this laser processing apparatus . the laser processing apparatus 200 will be explained mainly in terms of its differences from the laser processing apparatus 100 in accordance with the first embodiment shown in fig1 . the laser processing apparatus 200 comprises an ellipticity regulator 201 for adjusting the ellipticity of polarization of laser light l emitted from a laser light source 101 , and a 90 ° rotation regulator 203 for adjusting the rotation of polarization of the laser light l emitted from the ellipticity regulator 201 by about 90 °. the ellipticity regulator 201 includes a quarter wave plate 207 shown in fig4 . the quarter wave plate 207 can adjust the ellipticity of elliptically polarized light by changing the angle of direction θ . namely , when light with linear polarization lp is made incident on the quarter wave plate 207 , the transmitted light attains elliptical polarization ep with a predetermined ellipticity . the angle of direction is an angle formed between the major axis of the ellipse and the x axis . as mentioned above , a number other than 1 is employed as the ellipticity in this embodiment . the ellipticity regulator 201 can make the polarization of laser light l become elliptically polarized light ep having a desirable ellipticity . the ellipticity is adjusted in view of the thickness and material of the object to be processed 1 , and the like . when irradiating the object to be processed 1 with laser light l having linear polarization lp , the laser light l emitted from the laser light source 101 is linearly polarized light lp , whereby the ellipticity regulator 201 adjusts the angle of direction θ of the quarter wave plate 207 such that the laser light l passes through the quarter wave plate while being the linearly polarized light lp . also , the laser light source 101 emits linearly polarized laser light l , whereby the ellipticity regulator 201 is unnecessary when only laser light of linear polarization lp is utilized for irradiating the object to be processed with laser . the 90 ° rotation regulator 203 includes a half wave plate 205 as shown in fig4 . the half wave plate 205 is a wavelength plate for making polarization orthogonal to linearly polarized incident light . namely , when linearly polarized light lp 1 with an angle of direction of 45 ° is incident on the half wave plate 205 , for embodiment , transmitted light becomes linearly polarized light lp 2 rotated by 90 ° with respect to the incident light lp 1 . when rotating the polarization of laser light l emitted from the ellipticity regulator 201 by 90 °, the 90 ° rotation regulator 203 operates so as to place the half wave plate 205 onto the optical axis of laser light l . when not rotating the polarization of laser light l emitted from the ellipticity regulator 201 , the 90 ° rotation regulator 203 operates so as to place the half wave plate 205 outside the optical path of laser light l ( i . e ., at a site where the laser light l does not pass through the half wave plate 205 ). the dichroic mirror 103 is disposed such that the laser light l whose rotation of polarization is regulated by 90 ° or not by the 90 ° rotation regulator 203 is incident thereon and that the direction of optical axis of laser light l is changed by 90 °. the laser processing apparatus 200 comprises a θ - axis stage 213 for rotating the x - y plane of the mounting table 107 about the thickness direction of the object to be processed 1 . the stage controller 115 regulates not only the movement of stages 109 , 111 , 113 , but also the movement of stage 213 . with reference to fig4 and 43 , the laser processing method in accordance with the third embodiment of the present invention will now be explained . fig4 is a flowchart for explaining this laser processing method . the object to be processed 1 is a silicon wafer . steps s 101 to s 111 are the same as those of the first embodiment shown in fig1 . the ellipticity regulator 201 adjusts the ellipticity of laser light l having linear polarization lp emitted from the laser light source 101 ( s 121 ). the laser light l having elliptical polarization ep with a desirable ellipticity can be obtained when the angle of direction θ of the quarter wave plate is changed in the ellipticity regulator 201 . first , for processing the object to be processed 1 along the y - axis direction , the major axis of an ellipse indicative of the elliptical polarization ep of laser light l is adjusted so as to coincide with the direction of the line 5 along which the object is intended to be cut extending in the y - axis direction of the object to be processed 1 ( s 123 ). this is achieved by rotating the θ - axis stage 213 . therefore , the θ - axis stage 213 functions as major axis adjusting means or linear polarization adjusting means . for processing the object 1 along the y - axis direction , the 90 ° rotation regulator 203 carries out adjustment which does not rotate the polarization of laser light l ( s 125 ) namely , it operates so as to place the half wave plate to the outside of the optical path of laser light l . the laser light source 101 generates laser light l , whereas the line 5 along which the object is intended to be cut extending in the y - axis direction in the surface 3 of the object to be processed 1 is irradiated with the laser light l . fig4 is a plan view of the object 1 . the object 1 is irradiated with the laser light l such that the major axis indicative of the ellipse of elliptical polarization ep of laser light extends along the rightmost line 5 along which the object is intended to be cut in the object 1 . since the light - converging point p of laser light l is positioned within the object 1 , molten processed regions are formed only within the object 1 . the y - axis stage 111 is moved along the line 5 along which the object is intended to be cut , so as to form a molten processed region within the object to be processed 1 along the line 5 along which the object is intended to be cut . then , the x - axis stage 109 is moved , so as to irradiate the neighboring line 5 along which the object is intended to be cut with laser light l , and a molten processed region is formed within the object 1 along the neighboring line 5 along which the object is intended to be cut in a manner similar to that mentioned above . by repeating this , a molten processed region is formed within the object 1 along the lines along which the object is intended to be cut successively from the right side ( s 127 ). fig4 shows the case where the object 1 is irradiated with the laser light l having linear polarization . namely , the object 1 is irradiated with laser light such that the direction of linear polarization lp of laser light extends along the line 5 along which the object is intended to be cut in the object 1 . next , the 90 ° rotation regulator 203 operates so as to place the half wave plate 205 ( fig4 ) onto the optical axis of laser light l . this carries out adjustment for rotating the polarization of laser light emitted from the ellipticity regulator 219 by 90 ° ( s 219 ). subsequently , the laser light 101 generates laser light l , whereas the line along which the object is intended to be cut extending in the x - axis direction of the surface 3 of the object 1 is irradiated with the laser light l . fig4 is a plan view of the object 1 . the object 1 is irradiated with the laser light l such that the direction of the major axis of an ellipse indicative of the elliptical polarization ep of laser light l extends along the lowest line 5 along which the object is intended to be cut extending in the x - axis direction of the object 1 . since the light - converging point p of laser light l is positioned within the object 1 , molten processed regions are formed only within the object 1 . the x - axis stage 109 is moved along the line 5 along which the object is intended to be cut , so as to form a molten processed region within the object 1 extending along the line 5 along which the object is intended to be cut . then , the y - axis stage is moved , such that the immediately upper line 5 along which the object is intended to be cut is irradiated with the laser light l , whereby a molten processed region is formed within the object 1 along the line 5 along which the object is intended to be cut in a manner similar to that mentioned above . by repeating this , respective molten processed regions are formed within the object 1 along the individual lines along which the object is intended to be cut successively from the lower side ( s 131 ). fig4 shows the case where the object 1 is irradiated with the laser light l having linear polarization lp . then , the object 1 is bent along the lines along which the object is intended to be cut 5 , whereby the object 1 is cut ( s 133 ). this divides the object 1 into silicon chips . effects of the third embodiment will be explained . according to the third embodiment , the object 1 is irradiated with pulse laser light l such that the direction of the major axis of an ellipse indicative of the elliptical polarization ep of pulse laser light l extends along the line 5 along which the object is intended to be cut as shown in fig4 and 46 . as a consequence , the size of crack spots in the direction of line 5 along which the object is intended to be cut becomes relatively large , whereby crack regions extending along lines along which the object is intended to be cut can be formed by a smaller number of shots . the third embodiment can efficiently form crack regions as such , thus being able to improve the processing speed of the object 1 . also , the crack spot formed at the shot does not extend in directions other than the direction aligning with the line 5 along which the object is intended to be cut , whereby the object 1 can be cut precisely along the line 5 along which the object is intended to be cut . these results are similar to those of the fourth embodiment which will be explained later . the fourth embodiment of the present invention will be explained mainly in terms of its differences from the third embodiment . fig4 is a schematic diagram of this laser processing apparatus 300 . among the constituents of the laser processing apparatus 300 , those identical to constituents of the laser processing apparatus 200 in accordance with the third embodiment shown in fig4 will be referred to with numerals identical thereto without repeating their overlapping explanations . the laser processing apparatus 300 is not equipped with the 90 ° rotation regulator 203 of the third embodiment . a θ - axis stage 213 can rotate the x - y plane of a mounting table 107 about the thickness direction of the object to be processed 1 . this makes the polarization of laser light l emitted from the ellipticity regulator 201 relatively rotate by 90 °. the laser processing method in accordance with the fourth embodiment of the present invention will be explained . operations of step s 101 to step s 123 in the laser processing method in accordance with the third embodiment shown in fig4 are carried out in the fourth embodiment as well . the operation of subsequent step s 125 is not carried out , since the fourth embodiment is not equipped with the 90 ° rotation regulator 203 . after step s 123 , the operation of step s 127 is carried out . the operations carried out so far process the object 1 as shown in fig4 in a manner similar to that in the third embodiment . thereafter , the stage controller 115 regulates the θ - axis stage 213 so as to rotate it by 90 °. the rotation of the θ - axis stage 213 rotates the object 1 by 90 ° in the x - y plane . consequently , as shown in fig4 , the major axis of elliptical polarization ep can be caused to align with a line along which the object is intended to be cut intersecting the line 5 along which the object is intended to be cut having already completed the modified region forming step . then , like step s 127 , the object 1 is irradiated with the laser light , whereby molten processed regions are formed within the object to be processed 1 along line 5 along which the object is intended to be cut successively from the right side . finally , as with step s 133 , the object 1 is cut , whereby the object 1 is divided into silicon chips . the third and fourth embodiments of the present invention explained in the foregoing relate to the forming of modified regions by multiphoton absorption . however , the present invention may cut the object to be processed by irradiating it with laser light while locating its light - converging point within the object so as to make the major axis direction of an ellipse indicative of elliptical polarization extend along a line along which the object is intended to be cut in the object without forming modified regions caused by multiphoton absorption . this can also cut the object along the line along which the object is intended to be cut efficiently . in a fifth embodiment of the present invention and sixth and seventh embodiments thereof , which will be explained later , sizes of modified spots are controlled by regulating the magnitude of power of pulse laser light and the size of numerical aperture of an optical system including a light - converging lens . the modified spot refers to a modified part formed by a single pulse shot of pulse laser light ( i . e ., one pulse laser irradiation ), whereas an assembly of modified spots forms a modified region . the necessity to control the sizes of modified spots will be explained with respect to crack spots by way of embodiment . when a crack spot is too large , the accuracy of cutting an object to be cut along a line along which the object is intended to be cut decreases , and the flatness of the cross section deteriorates . this will be explained with reference to fig5 to 55 . fig5 is a plan view of an object to be processed 1 in the case where crack spots are formed relatively large by using the laser processing method in accordance with this embodiment . fig5 is a sectional view taken along li — li on the line 5 along which the object is intended to be cut in fig5 . fig5 , 53 , and 54 are sectional views taken along lines lii — lii , liii — liii , and liv — liv orthogonal to the line 5 along which the object is intended to be cut in fig5 , respectively . as can be seen from these drawings , the deviation in sizes of crack spots 9 becomes greater when the crack spots 90 are too large . therefore , as shown in fig5 , the accuracy of cutting the object 1 along the line 5 along which the object is intended to be cut becomes lower . also , irregularities of cross sections 43 in the object 1 become so large that the flatness of the cross section 43 deteriorates . when crack spots 90 are formed relatively small ( e . g ., 20 μm or less ) by using the laser processing apparatus in accordance with this embodiment , by contrast , crack spots 90 can be formed uniformly and can be restrained from widening in directions deviating from that of the line along which the object is intended to be cut as shown in fig5 . therefore , as shown in fig5 , the accuracy of cutting the object 1 along the line 5 along which the object is intended to be cut and the flatness of cross sections 43 can be improved as shown in fig5 . when crack spots are too large as such , precise cutting along a line along which the object is intended to be cut and cutting for yielding a flat cross section cannot be carried out . if crack spots are extremely small with respect to an object to be processed having a large thickness , however , the object will be hard to cut . the fact that this embodiment can control sizes of crack spots will be explained . as shown in fig7 , when the peak power density is the same , the size of a crack spot in the case where the light - converging lens has a magnification of × 10 and an na of 0 . 8 is smaller than that of a crack spot in the case where the light - converging lens has a magnification of × 50 and an na of 0 . 55 . the peak power density is proportional to the energy of laser light per pulse , i . e ., the power of pulse laser light , as explained above , whereby the same peak power density means the same laser light power . when the laser light power is the same while the beam spot cross - sectional area is the same , sizes of crack spots can be regulated so as to become smaller ( greater ) as the numerical aperture of a light - converging lens is greater ( smaller ). also , even when the numerical aperture of the light - converging lens is the same , sizes of crack spots can be regulated so as to become smaller and larger when the laser light power ( peak power density ) is made lower and higher , respectively . therefore , as can be seen from the graph shown in fig7 , sizes of crack spots can be regulated so as to become smaller when the numerical aperture of a light - converging lens is made greater or the laser light power is made lower . on the contrary , sizes of crack spots can be regulated so as to become greater when the numerical aperture of a light - converging lens is made smaller or when the laser light power is made higher . the crack spot size control will further be explained with reference to the drawings . the embodiment shown in fig5 is a sectional view of an object to be processed 1 within which pulse laser light l is converged by use of a light - converging lens having a predetermined numerical aperture . regions 41 are those having yielded an electric field intensity at a threshold for causing multiphoton absorption or higher by this laser irradiation . fig5 is a sectional view of a crack spot 90 formed due to the multiphoton absorption caused by irradiation with the laser light l . on the other hand , the embodiment shown in fig6 is a sectional view of an object to be processed 1 within which pulse laser light l is converged by use of a light - converging lens having a numerical aperture greater than that in the embodiment shown in fig5 . fig6 is a sectional view of a crack spot 90 formed due to the multiphoton absorption caused by irradiation with the laser light l . the height h of crack spot 90 depends on the size of regions 41 in the thickness direction of the object 1 , whereas the width w of crack spot 90 depends on the size of regions 41 in a direction orthogonal to the thickness direction of the object 1 . namely , when these sizes of regions 41 are made smaller and greater , the height h and width w of crack spot 90 can be made smaller and greater , respectively . as can be seen when fig5 and 61 are compared with each other , in the case where the laser light power is the same , the sizes of height h and width w of crack spot 90 can be regulated so as to become smaller ( greater ) when the numerical aperture of a light - converging lens is made greater ( smaller ). the embodiment shown in fig6 is a sectional view of an object to be processed 1 within which pulse laser light l having a power lower than that in the embodiment shown in fig5 is converged . in the embodiment shown in fig6 , since the laser light power is made lower , the area of regions 41 is smaller than that of regions 41 shown in fig5 . fig6 is a sectional view of a crack spot 90 formed due to the multiphoton absorption caused by irradiation with the laser light l . as can be seen when fig5 and 63 are compared with each other , in the case where the numerical aperture of the light - converging lens is the same , the sizes of height h and width w of crack spot 90 can be regulated so as to become smaller ( greater ) when the laser light power is made lower ( higher ). the embodiment shown in fig6 is a sectional view of an object to be processed 1 within which pulse laser light l having a power lower than that in the embodiment shown in fig6 is converged . fig6 is a sectional view of a crack spot 90 formed due to the multiphoton absorption caused by irradiation with the laser light l . as can be seen when fig5 and 65 are compared with each other , the sizes of height h and width w of crack spot 90 can be regulated so as to become smaller ( greater ) when the numerical aperture of the light - converging lens is made greater ( smaller ) while the laser light power is made lower ( higher ). meanwhile , the regions 41 indicative of those yielding an electric field intensity at a threshold for electric field intensity capable of forming a crack spot or higher are restricted to the light - converging point p and its vicinity due to the following reason : since a laser light source with a high beam quality is utilized , this embodiment achieves a high convergence of laser light and can converge light up to about the wavelength of laser light . as a consequence , the beam profile of this laser light attains a gaussian distribution , whereby the electric field intensity is distributed so as to become the highest at the center of the beam and gradually lowers as the distance from the center increases . the laser light is basically converged in the state of a gaussian distribution in the process of being converged by a light - converging lens in practice as well . therefore , the regions 41 are restricted to the light - converging point p and its vicinity . as in the foregoing , this embodiment can control sizes of crack spots . sizes of crack spots are determined in view of a requirement for a degree of precise cutting , a requirement for a degree of flatness in cross sections , and the magnitude of thickness of the object to be processed . sizes of crack spots can be determined in view of the material of an object to be processed as well . this embodiment can control sizes of modified spots , thus making it possible to carry out precise cutting along a line along which the object is intended to be cut and yield a favorable flatness in cross sections by making modified spots smaller for objects to be processed having a relatively small thickness . also , by making modified spots greater , it enables cutting of objects to be processed having a relatively large thickness . there are cases where an object to be processed has respective directions easy and hard to cut due to the crystal orientation of the object , for embodiment . when cutting such an object , the size of crack spots 90 formed in the easy - to - cut direction is made greater as shown in fig5 and 57 , for embodiment . when the direction of a line along which the object is intended to be cut orthogonal to the line 5 along which the object is intended to be cut is a hard - to - cut direction , on the other hand , the size of crack spots 90 formed in this direction is made greater as shown in fig5 and 66 . here , fig6 is a sectional view of the object 1 shown in fig5 taken along lxvi — lxvi . hence , a flat cross section can be obtained in the easy - to - cut direction , while cutting is possible in the hard - to - cut direction as well . though the fact that sizes of modified spots are controllable has been explained in the case of crack spots , the same holds in melting spots and refractive index change spots . for embodiment , the power of pulse laser light can be expressed by energy per pulse ( j ), or average output ( w ) which is a value obtained by multiplying the energy per pulse by the frequency of laser light . the foregoing holds in sixth and seventh embodiments which will be explained later . the laser processing apparatus in accordance with the fifth embodiment of the present invention will be explained . fig6 is a schematic diagram of this laser processing apparatus 400 . the laser processing apparatus 400 will be explained mainly in terms of its differences from the laser processing apparatus 100 in accordance with the first embodiment shown in fig1 . the laser processing apparatus 400 comprises a power regulator 401 for adjusting the power of laser light l emitted from a laser light source 101 . the power regulator 401 comprises , for embodiment , a plurality of nd ( neutral density ) filters , and a mechanism for moving the individual nd filters to positions perpendicular to the optical axis of the laser light l and to the outside of the optical path of laser light l . an nd filter is a filter which reduces the intensity of light without changing the relative spectral distribution of energy . a plurality of nd filters have respective extinction factors different from each other . by using one of a plurality of nd filters or combining some of them , the power regulator 401 adjusts the power of laser light l emitted from the laser light source 101 . here , a plurality of nd filters may have the same extinction factor , and the power regulator 401 may change the number of nd filters to be moved to positions perpendicular to the optical axis of laser light l , so as to adjust the power of laser light l emitted from the laser light source 101 . the power regulator 401 may comprise a polarization filter disposed perpendicular to the optical axis of linearly polarized laser light l , and a mechanism for rotating the polarization filter about the optical axis of laser light l by a desirable angle . rotating the polarization filter about the optical axis by a desirable angle in the power regulator 401 adjusts the power of laser light l emitted from the laser light source 101 . here , the driving current for a pumping semiconductor laser in the laser light source 101 can be regulated by a laser light source controller 102 which is an embodiment of driving current control means , so as to regulate the power of laser light l emitted from the laser light source 101 . therefore , the power of laser light l can be adjusted by at least one of the power regulator 401 and laser light source controller 102 . if the size of a modified region can attain a desirable value due to the adjustment of power of laser light l by the laser light source controller 102 alone , the power regulator 401 is unnecessary . the power adjustment explained in the foregoing is effected when an operator of the laser processing apparatus inputs the magnitude of power into an overall controller 127 , which will be explained later , by using a keyboard or the like . the laser processing apparatus 400 further comprises a dichroic mirror 103 disposed such that the laser light l whose power is adjusted by the power regulator 401 is incident thereon whereas the orientation of the optical axis of laser light l is changed by 90 °; a lens selecting mechanism 403 including a plurality of light - converging lenses for converging the laser light l reflected by the dichroic mirror 103 ; and a lens selecting mechanism controller 405 for controlling the lens selecting mechanism 403 . the lens selecting mechanism 403 comprises light - converging lenses 105 a , 105 b , 105 c , and a support plate 407 for supporting them . the numerical apertures of respective optical systems including the light - converging lenses 105 a , 105 b , 105 c differ from each other . according to a signal from the lens selecting mechanism controller 405 , the lens selecting mechanism 403 rotates the support plate 407 , thereby causing a desirable light - converging lens among the light - converging lenses 105 a , 105 b , 105 c to be placed onto the optical axis of laser light l . namely , the lens selecting mechanism 403 is of revolver type . the number of light - converging lenses attached to the lens selecting mechanism 403 is not restricted to 3 but may be other numbers . when the operator of the laser processing apparatus inputs a size of numerical aperture or an instruction for choosing one of the light - converging lenses 105 a , 105 b , 105 c into the overall controller 127 , which will be explained later , by using a keyboard or the like , the light - converging lens is chosen , namely , the numerical aperture is chosen . mounted on the mounting table 107 of the laser processing apparatus 400 is an object to be processed 1 irradiated with the laser light l converged by one of the light - converging lenses 105 a to 105 c which is disposed on the optical axis of laser light l . the overall controller 127 is electrically connected to the power regulator 401 . fig6 does not depict it . when the magnitude of power is fed into the overall controller 127 , the latter controls the power regulator 401 , thereby adjusting the power . fig6 is a block diagram showing a part of an embodiment of the overall controller 127 . the overall controller 127 comprises a size selector 411 , a correlation storing section 413 , and an image preparing section 415 . the operator of the laser processing apparatus inputs the magnitude of power of pulse laser light or the size of numerical aperture of the optical system including the light - converging lens to the size selector 411 by using a keyboard or the like . in this embodiment , the input may choose one of the light - converging lenses 105 a , 105 b , 105 c instead of the numerical aperture size being directly inputted . in this case , the respective numerical apertures of the light - converging lenses 105 a , 105 b , 105 c are registered in the overall controller 127 beforehand , and data of the numerical aperture of the optical system including the chosen light - converging lens is automatically fed into the size selector 411 . the correlation storing section 413 has stored the correlation between the set of pulse laser power magnitude and numerical aperture size and the size of modified spot beforehand . fig6 is an embodiment of table showing this correlation . in this embodiment , respective numerical apertures of the optical systems including the light - converging lenses 105 a , 105 b , 105 c are registered in the column for numerical aperture . in the column for power , magnitudes of power attained by the power regulator 401 are registered . in the column for size , sizes of modified spots formed by combinations of powers of their corresponding sets and numerical apertures are registered . for embodiment , the modified spot formed when the power is 1 . 24 × 10 11 ( w / cm 2 ) while the numerical aperture is 0 . 55 has a size of 120 μm . the data of this correlation can be obtained by carrying out experiments explained in fig5 to 65 before laser processing , for embodiment . when the magnitude of power and numerical aperture size are fed into the size selector 411 , the latter chooses the set having their corresponding values from the correlation storing section 413 , and sends data of size corresponding to this set to the monitor 129 . as a consequence , the size of a modified spot formed at thus inputted magnitude of power and numerical aperture size is displayed on the monitor 129 . if there is no set corresponding to these values , size data corresponding to a set having the closest values is sent to the monitor 129 . the data of size corresponding to the set chosen by the size selector 411 is sent from the size selector 411 to the image preparing section 415 . according to this size data , the image preparing section 415 prepares image data of a modified spot in this size , and sends thus prepared data to the monitor 129 . as a consequence , an image of the modified spot is also displayed on the monitor 129 . hence , the size and form of modified spot can be seen before laser processing . the size of numerical aperture may be made variable while the magnitude of power is fixed . the table in this case will be as shown in fig7 . for embodiment , the modified spot formed when the numerical aperture is 0 . 55 while the power is fixed at 1 . 49 × 10 11 ( w / cm 2 ) has a size of 150 μm . alternatively , the magnitude of power may be made variable while the size of numerical aperture is fixed . the table in this case will be as shown in fig7 . for embodiment , the modified spot formed when the power is fixed at 1 . 19 × 10 11 ( w / cm 2 ) while the numerical aperture is fixed at 0 . 8 has a size of 30 μm . the laser processing method in accordance with the fifth embodiment of the present invention will now be explained with reference to fig6 . the object to be processed 1 is a silicon wafer . in the fifth embodiment , operations of steps s 101 to s 111 are carried out as in the laser processing method in accordance with the first embodiment shown in fig1 . after step s 111 , the magnitude of power and numerical aperture size are fed into the overall controller 127 as explained above . according to the data of power inputted , the power of laser light l is adjusted by the power regulator 401 . according to the data of numerical aperture inputted , the lens selecting mechanism 403 chooses a light - converging lens by way of the lens selecting mechanism controller 405 , thereby adjusting the numerical aperture . these data are also fed into the size selector 411 of the overall controller 127 ( fig6 ). as a consequence , the size and form of a melting spot formed within the object 1 upon irradiation of one pulse of laser light l are displayed on the monitor 129 . then , operations of steps s 113 to s 115 are carried out as in the laser processing method in accordance with the first embodiment shown in fig1 . this divides the object 1 into silicon chips . a sixth embodiment of the present invention will now be explained mainly in terms of its differences from the fifth embodiment . fig7 is a schematic diagram of this laser processing apparatus 500 . among the constituents of the laser processing apparatus 500 , those identical to constituents of the laser processing apparatus 400 in accordance with the fifth embodiment shown in fig6 are referred to with numerals identical thereto without repeating their overlapping explanations . in the laser processing apparatus 500 , a beam expander 501 is disposed on the optical axis of laser light l between a power regulator 401 and a dichroic mirror 103 . the beam expander 501 has a variable magnification , and is regulated by the beam expander 501 so as to increase the beam diameter of laser light l . the beam expander 501 is an embodiment of numerical aperture regulating means . the laser processing apparatus 500 is equipped with a single light - converging lens 105 instead of the lens selecting mechanism 403 . the operations of the laser processing apparatus 500 differ from those of the laser processing apparatus of the fifth embodiment in the adjustment of numerical aperture based on the magnitude of numerical aperture fed into the overall controller 127 . this will be explained in the following . the overall controller 127 is electrically connected to the beam expander 501 . fig7 does not depict this . when the size of numerical aperture is fed into the overall controller 127 , the latter carries out control for changing the magnitude of beam expander 501 . this regulates the magnification of beam diameter of the laser light l incident on the light - converging lens 105 . therefore , with only one light - converging lens 105 , adjustment for increasing the numerical aperture of the optical system including the light - converging lens 105 is possible . this will be explained with reference to fig7 and 74 . fig7 is a view showing the convergence of laser light l effected by the light - converging lens 105 when the beam expander 501 is not provided . on the other hand , fig7 is a view showing the convergence of laser light l effected by the light - converging lens 105 when the beam expander 501 is provided . as can be seen when fig7 and 74 are compared with each other , the sixth embodiment can achieve adjustment so as to increase the numerical aperture with reference to the numerical aperture of the optical system including the light - converging lens 105 in the case where the beam expander 501 is not provided . a seventh embodiment of the present invention will now be explained mainly in terms of its differences from the fifth and sixth embodiments . fig7 is a schematic diagram of this laser processing apparatus 600 . among the constituents of the laser processing apparatus 600 , those identical to constituents of the laser processing apparatus in accordance with the fifth and sixth embodiments are referred to with numerals identical thereto without repeating their overlapping explanations . in the laser processing apparatus 600 , an iris diaphragm 601 is disposed on the optical axis of laser light l instead of the beam expander 501 between a dichroic mirror 103 and a light - converging lens 105 . changing the aperture size of the iris diaphragm 601 adjusts the effective diameter of the light - converging lens 105 . the iris diaphragm 601 is an embodiment of numerical aperture regulating means . the laser processing apparatus 600 further comprises an iris diaphragm controller 603 for changing the aperture size of the iris diaphragm 601 . the iris diaphragm controller 603 is controlled by an overall controller 127 . the operations of the laser processing apparatus 600 differ from those of the laser processing apparatus of the fifth and sixth embodiments in the adjustment of numerical aperture based on the size of numerical aperture fed into the overall controller 127 . according to the inputted size of numerical aperture , the laser processing apparatus 600 changes the size of aperture of the iris diaphragm 601 , thereby carrying out adjustment for decreasing the effective diameter of the light - converging lens 105 . therefore , with only one light - converging lens 105 , adjustment for decreasing the numerical aperture of the optical system including the light - converging lens 105 is possible . this will be explained with reference to fig7 and 77 . fig7 is a view showing the convergence of laser light l effected by the light - converging lens 105 when no iris diaphragm is provided . on the other hand , fig7 is a view showing the convergence of laser light l effected by the light - converging lens 105 when the iris diaphragm 601 is provided . as can be seen when fig7 and 77 are compared with each other , the seventh embodiment can achieve adjustment so as to increase the numerical aperture with reference to the numerical aperture of the optical system including the light - converging lens 105 in the case where the iris diaphragm is not provided . modified embodiments of the fifth to seventh embodiments of the present invention will now be explained . fig7 is a block diagram of the overall controller 127 provided in a modified embodiment of the laser processing apparatus in accordance with this embodiment . the overall controller 127 comprises a power selector 417 and a correlation storing section 413 . the correlation storing section 413 has already stored the correlation data shown in fig7 . an operator of the laser processing apparatus inputs a desirable size of a modified spot to the power selector 417 by a keyboard or the like . the size of modified spot is determined in view of the thickness and material of the object to be modified and the like . according to this input , the power selector 417 chooses a power corresponding to the value of size identical to thus inputted size from the correlation storing section 413 , and sends it to the power regulator 401 . therefore , when the laser processing apparatus regulated to this magnitude of power is used for laser processing , a modified spot having a desirable size can be formed . the data concerning this magnitude of power is also sent to the monitor 129 , whereby the magnitude of power is displayed . in this embodiment , the numerical aperture is fixed while power is variable . if no size at the value identical to that of thus inputted value is stored in the correlation storing section 413 , power data corresponding to a size having the closest value is sent to the power regulator 401 and the monitor 129 . this is the same in the modified embodiments explained in the following . fig7 is a block diagram of the overall controller 127 provided in another modified embodiment of the laser processing apparatus in accordance with this embodiment . the overall controller 127 comprises a numerical aperture selector 419 and a correlation storing section 413 . it differs from the modified embodiment of fig7 in that the numerical aperture is chosen instead of the power . the correlation storing section 413 has already stored the data shown in fig7 . an operator of the laser processing apparatus inputs a desirable size of a modified spot to the numerical aperture selector 419 by using a keyboard or the like . as a consequence , the numerical aperture selector 419 chooses a numerical aperture corresponding to a size having a value identical to that of the inputted size from the correlation storing section 413 , and sends data of this numerical aperture to the lens selecting mechanism controller 405 , beam expander 501 , or iris diaphragm controller 603 . therefore , when the laser processing apparatus regulated to this size of numerical aperture is used for laser processing , a modified spot having a desirable size can be formed . the data concerning this numerical aperture is also sent to the monitor 129 , whereby the size of numerical aperture is displayed . in this embodiment , the power is fixed while numerical aperture is variable . fig8 is a block diagram of the overall controller 127 provided in still another modified embodiment of the laser processing apparatus in accordance with this embodiment . the overall controller 127 comprises a set selector 421 and a correlation storing section 413 . it differs from the embodiments of fig7 and 79 in that both power and numerical aperture are chosen . the correlation storing section 413 has stored the correlation between the set of power and numerical aperture and the size in fig6 beforehand . an operator of the laser processing apparatus inputs a desirable size of a modified spot to the set selector 421 by using a keyboard or the like . as a consequence , the set selector 421 chooses a set of power and numerical aperture corresponding to thus inputted size from the correlation storing section 413 . data of power in thus chosen set is sent to the power regulator 401 . on the other hand , data of numerical aperture in the chosen set is sent to the lens selecting mechanism controller 405 , beam expander 501 , or iris diaphragm controller 603 . therefore , when the laser processing apparatus regulated to the power and numerical aperture of this set is used for laser processing , a modified spot having a desirable size can be formed . the data concerning the magnitude of power and size of numerical aperture is also sent to the monitor 129 , whereby the magnitude of power and size of numerical aperture is displayed . these modified embodiments can control sizes of modified spots . therefore , when the size of a modified spot is made smaller , the object to be processed can precisely be cut along a line along which the object is intended to be cut therein , and a flat cross section can be obtained . when the object to be cut has a large thickness , the size of modified spot can be enhanced , whereby the object can be cut . an eighth embodiment of the present invention controls the distance between a modified spot formed by one pulse of laser light and a modified spot formed by the next one pulse of pulse laser light by regulating the magnitude of a repetition frequency of pulse laser light and the magnitude of relative moving speed of the light - converging point of pulse laser light . namely , it controls the distance between adjacent modified spots . in the following explanation , the distance is assumed to be a pitch p . the control of pitch p will be explained in terms of a crack region by way of embodiment . let f ( hz ) be the repetition frequency of pulse laser light , and v ( mm / sec ) be the moving speed of the x - axis stage or y - axis stage of the object to be processed . the moving speeds of these stages are embodiments of relative moving speed of the light - converging point of pulse laser light . the crack part formed by one shot of pulse laser light is referred to as crack spot . therefore , the number n of crack spots formed per unit length of the line 5 along which the object is intended to be cut is as follows : the reciprocal of the number n of crack spots formed per unit length corresponds to the pitch p : hence , the pitch p can be controlled when at least one of the magnitude of repetition frequency of pulse laser light and the magnitude of relative moving speed of the light - converging point is regulated . namely , the pitch p can be controlled so as to become smaller when the repetition frequency f ( hz ) is increased or when the stage moving speed v ( mm / sec ) is decreased . by contrast , the pitch p can be controlled so as to become greater when the repetition frequency f ( hz ) is decreased or when the stage moving speed v ( mm / sec ) is increased . meanwhile , there are three ways of relationship between the pitch p and crack spot size in the direction of line 5 along which the object is intended to be cut as shown in fig8 to 83 . fig8 to 83 are plan views of an object to be processed along the line 5 along which the object is intended to be cut , which is formed with a crack region by the laser processing in accordance with this embodiment . a crack spot 90 is formed by one pulse of pulse laser light . forming a plurality of crack spots 90 aligning each other along the line 5 along which the object is intended to be cut yields a crack region 9 . fig8 shows a case where the pitch p is greater than the size d . the crack region 9 is formed discontinuously along the line 5 along which the object is intended to be cut within the object to be processed . fig8 shows a case where the pitch p substantially equals the size d . the crack region 9 is formed continuously along the line 5 along which the object is intended to be cut within the object to be processed . fig8 shows a case where the pitch p is smaller than the size d . the crack region 9 is formed continuously along the line 5 along which the object is intended to be cut within the object to be processed . in fig8 , the crack region 9 is not continuous along the line 5 along which the object is intended to be cut , whereby the part of line 5 along which the object is intended to be cut keeps a strength to some extent . therefore , when carrying out a step of cutting the object to be processed after laser processing , handling of the object becomes easier . in fig8 and 83 , the crack region 9 is continuously formed along the line 5 along which the object is intended to be cut , which makes it easy to cut the object while using the crack region 9 as a starting point . the pitch p is made greater than the size d in fig8 , and substantially equals the size d in fig8 , whereby regions generating multiphoton absorption upon irradiation with pulse laser light can be prevented from being superposed on crack spots 90 which have already been formed . as a result , deviations in sizes of crack spots 90 can be made smaller . namely , the inventor has found that , when a region generating multiphoton absorption upon irradiation with pulse laser light is superposed on crack spots 90 which have already been formed , deviations in sizes of crack spots 90 formed in this region become greater . when deviations in sizes of crack spots 90 become greater , it becomes harder to cut the object along a line along which the object is intended to be cut precisely , and the flatness of cross section deteriorates . in fig8 and 82 , deviations in sizes of crack spots can be made smaller , whereby the object to be processed can be cut along the line along which the object is intended to be cut precisely , while cross sections can be made flat . as explained in the foregoing , the eighth embodiment of the present invention can control the pitch p by regulating the magnitude of repetition frequency of pulse laser light or magnitude of relative moving speed of the light - converging point of pulse laser light . this enables laser processing in conformity to the object to be processed by changing the pitch p in view of the thickness and material of the object and the like . though the fact that the pitch p can be controlled is explained in the case of crack spots , the same holds in melting spots and refractive index change spots . however , there are no problems even when melting spots and refractive index change spots are superposed on those which have already been formed . the relative movement of the light - converging point of pulse laser light may be realized by a case where the object to be processed is moved while the light - converging point of pulse laser light is fixed , a case where the light - converging point of pulse laser light is moved while the object is fixed , a case where the object and the light - converging point of pulse laser light are moved in directions opposite from each other , and a case where the object and the light - converging point of pulse laser light are moved in the same direction with their respective speeds different from each other . with reference to fig1 , the laser processing apparatus in accordance with the eighth embodiment of the present invention will be explained mainly in terms of its differences from the laser processing apparatus 100 in accordance with the first embodiment shown in fig1 . the laser light source 101 is a q - switch laser . fig8 is a schematic diagram of the q - switch laser provided in a laser light source 101 . the q - switch laser comprises mirrors 51 , 53 which are disposed with a predetermined gap therebetween , a laser medium 55 disposed between the mirrors 51 and 53 , a pumping source 57 for applying a pumping input to the laser medium 55 , and a q - switch 59 disposed between the laser medium 55 and the mirror 51 . the material of the laser medium 55 is nd : yag , for embodiment . a pumping input is applied from the pumping source 57 to the laser medium 55 in a state where the loss in a resonator is made high by utilizing the q - switch 59 , whereby the population inversion of the laser medium 55 is raised to a predetermined value . thereafter , the q - switch 59 is utilized for placing the resonator into a state with a low loss , so as to oscillate the accumulated energy instantaneously and generate pulse laser light l . a signal s ( e . g ., a change in a repetition frequency of an ultrasonic pulse ) from a laser light source controller 102 controls the q - switch 59 so as to make it attain a high state . therefore , the signal s from the laser light source controller 102 can regulate the repetition frequency of pulse laser light l emitted from the laser light source 101 . the laser light source controller 102 is an embodiment of frequency adjusting means . the repetition frequency is regulated when an operator of the laser processing apparatus inputs the magnitude of repetition frequency to an overall controller 127 , which will be explained later , by using a keyboard or the like . the foregoing are details of the laser light source 101 . during the laser processing , the object to be processed 1 is moved in the x - or y - axis direction , so as to form a modified region along a line along which the object is intended to be cut . therefore , when forming a modified region in the x - axis direction , the speed of relative movement of the light - converging point of laser light can be adjusted by regulating the moving speed of the x - axis stage 109 . when forming a modified region in the y - axis direction , on the other hand , the speed of relative movement of the light - converging point of laser light can be adjusted by regulating the moving speed of the y - axis stage 111 . the adjustment of the respective moving speeds of these stages is controlled by the stage controller 115 . the stage controller 115 is an embodiment of speed adjusting means . the speed is regulated when the operator of laser processing apparatus inputs the magnitude of speed to the overall controller 127 , which will be explained later , by using a keyboard or the like . the speed of relative movement of the light - converging point of pulse laser light can be adjusted when , while the light converging point p is made movable , its moving speed is regulated . the overall controller 127 of the laser processing apparatus in accordance with the eighth embodiment further adds other functions to the overall controller 127 of the laser processing apparatus in accordance with the first embodiment . fig8 is a block diagram showing a part of an embodiment of the overall controller 127 of the laser processing apparatus in accordance with the eighth embodiment . the overall controller 127 comprises a distance calculating section 141 , a size storing section 143 , and an image preparing section 145 . to the distance calculating section 141 , the magnitude of repetition frequency of pulse laser light and respective magnitudes of moving speeds of the stages 109 , 111 are inputted . these inputs are effected by the operator of laser processing apparatus using a keyboard or the like . the distance calculating section 141 calculates the distance ( pitch ) between adjacent spots by utilizing the above - mentioned expressions ( n = f / v , and p = 1 / n ). the distance calculating section 141 sends this distance data to the monitor 129 . as a consequence , the distance between modified spots formed at the inputted magnitudes of frequency and speed is displayed on the monitor 129 . the distance data is also sent to the image preparing section 145 . the size storing section 143 has already stored therein sizes of modified spots formed in this laser processing apparatus . according to the distance data and the size data stored in the size storing section 143 , the image preparing section 145 prepares image data of a modified region formed by the distance and size , and sends thus prepared image data to the monitor 129 . as a consequence , an image of the modified region is also displayed on the monitor 129 . hence , the distance between adjacent modified spots and the form of modified region can be seen before laser processing . though the distance calculating section 141 calculates the distance between modified spots by utilizing the expressions ( n = f / v , and p = 1 / n ), the following procedure may also be taken . first , a table having registered the relationship between the magnitude of repetition frequency , the moving speeds of stages 109 , 111 , and the distance between modified spots beforehand is prepared , and the distance calculating section 141 is caused to store data of this table . when the magnitude of repetition frequency and the magnitudes of moving speeds of stages 109 , 111 are fed into the distance calculating section 141 , the latter reads out from the above - mentioned table the distance between modified spots in the modified spots formed under the condition of these magnitude . here , the magnitudes of stage moving speeds maybe made variable while the magnitude of repetition frequency is fixed . on the contrary , the magnitude of repetition frequency may be made variable while the magnitudes of stage moving speeds are fixed . also , in these cases , the above - mentioned expressions and table are used in the distance calculating section 141 for carrying out processing for causing the monitor 129 to display the distance between modified spots and an image of the modified region . as in the foregoing , the overall controller 127 shown in fig8 inputs the magnitude of repetition frequency and the stage moving speeds , thereby calculating the distance between adjacent modified spots . alternatively , a desirable distance between adjacent modified spots may be inputted , and the magnitude of repetition frequency and magnitudes of stage moving speeds may be controlled . this procedure will be explained in the following . fig8 is a block diagram showing a part of another embodiment of the overall controller 127 provided in the eighth embodiment . the overall controller 127 comprises a frequency calculating section 147 . the operator of laser processing apparatus inputs the magnitude of distance between adjacent modified spots to the frequency calculating section 147 by using a keyboard or the like . the magnitude of distance is determined in view of the thickness and material of the object to be processed and the like . upon this input , the frequency calculating section 147 calculates a frequency for attaining this magnitude of distance according to the above - mentioned expressions and tables . in this embodiment , the stage moving speeds are fixed . the frequency calculating section 147 sends thus calculated data to the laser light source controller 102 . when the object to be processed is subjected to laser processing by the laser processing apparatus regulated to this magnitude of frequency , the distance between adjacent modified spots can attain a desirable magnitude . data of this magnitude of frequency is also sent to the monitor 129 , whereby this magnitude of frequency is displayed . fig8 is a block diagram showing a part of still another embodiment the overall controller 127 provided in the eighth embodiment . the overall controller 127 comprises a speed calculating section 149 . in a manner similar to that mentioned above , the magnitude of distance between adjacent modified spots is fed into the speed calculating section 149 . upon this input , the speed calculating section 149 calculates a stage moving speed for attaining this magnitude of distance according to the above - mentioned expressions and tables . in this embodiment , the repetition frequency is fixed . the speed calculating section 149 sends thus calculated data to the stage controller 115 . when the object to be processed is subjected to laser processing by the laser processing apparatus regulated to this magnitude of stage moving speed , the distance between adjacent modified spots can attain a desirable magnitude . data of this magnitude of stage moving speed is also sent to the monitor 129 , whereby this magnitude of stage moving speed is displayed . fig8 is a block diagram showing a part of still another embodiment of the overall controller 127 provided in the eighth embodiment . the overall controller 127 comprises a combination calculating section 151 . it differs from the cases of fig8 and 87 in that both repetition frequency and stage moving speed are calculated . in a manner similar to that mentioned above , the distance between adjacent modified spots is fed into the combination calculating section 151 . according to the above - mentioned expressions and tables , the combination calculating section 151 calculates a repetition frequency and a stage moving speed for attaining this magnitude of distance . the combination calculating section 151 sends thus calculated data to the stage controller 115 . the laser light source controller 102 adjusts the laser light source 101 so as to attain the calculated magnitude of repetition frequency . the stage controller 115 adjusts the stages 109 , 111 so as to attain the calculated magnitude of stage moving speed . when the object to be processed is subjected to laser processing by thus regulated laser processing apparatus , the distance between adjacent modified spots can attain a desirable magnitude . data of thus calculated magnitude of repetition frequency and magnitude of stage moving speed are also sent to the monitor 129 , whereby thus calculated values are displayed . the laser processing method in accordance with the eighth embodiment of the present invention will now be explained . the object to be processed 1 is a silicon wafer . in the eighth embodiment , operations from steps s 101 to s 111 are carried out in a manner similar to that of the laser processing method in accordance with the first embodiment shown in fig1 . after step s 111 , the distance between adjacent melting spots in the melting spots formed by one pulse of pulse laser , i . e ., the magnitude of pitch p , is determined . the pitch p is determined in view of the thickness and material of the object 1 and the like . the magnitude of pitch p is fed into the overall controller 127 shown in fig8 . then , in a manner similar to that of the laser processing method in accordance with the first embodiment shown in fig1 , operations of step s 113 to s 115 are carried out . this divides the object 1 into silicon chips . as explained in the foregoing , the eighth embodiment can control the distance between adjacent melting spots by regulating the magnitude of repetition frequency of pulse laser light , and regulating the magnitudes of moving speeds of x - axis stage 109 and y - axis stage 111 . changing the magnitude of distance in view of the thickness and material of the object 1 and the like enables processing in conformity to the aimed purpose . a ninth embodiment of the present invention changes the position of the light - converging point of laser light irradiating the object to be processed in the direction of incidence to the object , thereby forming a plurality of modified regions aligning in the direction of incidence . forming a plurality of modified regions will be explained in terms of a crack region by way of embodiment . fig8 is a perspective view of an object to be processed 1 formed with two crack regions 9 within the object 1 by using the laser processing method in accordance with the ninth embodiment of the present invention . a method of forming two crack regions 9 will be explained in brief . first , the object 1 is irradiated with pulse laser light l , while the light - converging point of pulse laser light l is located within the object 1 near its rear face 21 and is moved along a line 5 along which the object is intended to be cut . this forms a crack region 9 ( 9 a ) along the line 5 along which the object is intended to be cut within the object 1 near the rear face 21 . subsequently , the object 1 is irradiated with the pulse laser light l , while the light - converging point of pulse laser light l is located within the object 1 near its surface 3 and is moved along the line 5 along which the object is intended to be cut . this forms a crack region 9 ( 9 b ) along the line 5 along which the object is intended to be cut within the object 1 near the surface 3 . then , as shown in fig9 , cracks 91 naturally grow from the crack regions 9 a , 9 b . specifically , the cracks 91 naturally grow from the crack region 9 a toward the rear face 21 , from the crack region 9 a ( 9 b ) toward the crack region 9 b ( 9 a ), and from the crack region 9 b toward the surface 3 . this can form cracks 9 elongated in the thickness direction of the object in the surface of object 1 extending along the line 5 along which the object is intended to be cut , i . e ., the surface to become a cross section . hence , the object 1 can be cut along the line 5 along which the object is intended to be cut by artificially applying a relatively small force thereto or naturally without applying such a force . as in the foregoing , the ninth embodiment forms a plurality of crack regions 9 , thereby increasing the number of locations to become starting points when cutting the object 1 . as a consequence , the ninth embodiment makes it possible to cut the object 1 even in the cases where the object 1 has a relatively large thickness , the object 1 is made of a material in which cracks 91 are hard to grow after forming the crack regions 9 , and so forth . when cutting is difficult by two crack regions 9 alone , three or more crack regions 9 are formed . for embodiment , as shown in fig9 , a crack region 9 c is formed between the crack region 9 a and crack region 9 b . cutting can also be achieved in a direction orthogonal to the thickness direction of the object 1 as long as it is the direction of incidence of laser light as shown in fig9 . preferably , in the ninth embodiment of the present invention , a plurality of crack regions 9 are successively formed from the side farther from the entrance face ( e . g ., surface 3 ) of the object to be processed on which the pulse laser light l is incident . for embodiment , in fig8 , the crack region 9 a is formed first , and then the crack region 9 b is formed . if the crack regions 9 are formed successively from the side closer to the entrance face , the pulse laser l irradiated at the time of forming the crack region 9 to be formed later will be scattered by the crack region 9 formed earlier . as a consequence , deviations occur in sizes of the crack part ( crack spot ) formed by one shot of pulse laser light l constituting the crack region 9 formed later . hence , the crack region 9 formed later cannot be formed uniformly . forming the crack regions 9 successively from the side farther from the entrance face does not generate the above - mentioned scattering , whereby the crack region 9 formed later can be formed uniformly . however , the order of forming a plurality of crack regions 9 in the ninth embodiment of the present invention is not restricted to that mentioned above . they may be formed successively from the side closer to the entrance face of the object to be processed , or formed randomly . in the random forming , for embodiment in fig9 , the crack region 9 c is formed first , then the crack region 9 b , and finally the crack region 9 a is formed by reversing the direction of incidence of laser light . though the forming of a plurality of modified regions is explained in the case of crack regions , the same holds in molten processed regions and refractive index change regions . though the explanation relates to pulse laser light , the same holds for continuous wave laser light . the laser processing apparatus in accordance with the ninth embodiment of the present invention has a configuration similar to that of the laser processing apparatus 100 in accordance with the first embodiment shown in fig1 . in the ninth embodiment , the position of light - converging point p in the thickness direction of the object to be processed 1 is adjusted by the z - axis stage 113 . this can adjust the light - converging point p so as to locate it at a position closer to or farther from the entrance face ( surface 3 ) than is a half thickness position in the thickness direction of the object to be processed 1 , and at a substantially half thickness position . here , adjustment of the position of light - converging point p in the thickness direction of the object to be processed caused by the z - axis stage will be explained with reference to fig9 and 94 . in the ninth embodiment of the present invention , the position of light - converging point of laser light in the thickness direction of the object to be processed is adjusted so as to be located at a desirable position within the object with reference to the surface ( entrance face ) of the object . fig9 shows the state where the light - converging point p of laser light l is positioned at the surface 3 of the object 1 . when the z - axis stage is moved by z toward the light - converging lens 105 , the light - converging point p moves from the surface 3 to the inside of the object 1 as shown in fig9 . the amount of movement of light - converging point p within the object 1 is nz ( where n is the refractive index of the object 1 with respect to the laser light l ). hence , when the z - axis stage is moved in view of the refractive index of the object 1 with respect to the laser light l , the position of light - converging point p in the thickness direction of the object 1 can be controlled . namely , a desirable position of the light - converging point p in the thickness direction of the object 1 is defined as the distance ( nz ) from the surface 3 to the inside of the object 1 . the object 1 is moved in the thickness direction by the amount of movement ( z ) obtained by dividing the distance ( nz ) by the above - mentioned refractive index ( n ). this can locate the light - converging point p at the desirable position . as explained in the first embodiment , the stage controller 115 controls the movement of the z - axis stage 113 according to focal point data , such that the focal point of visible light is located at the surface 3 . the laser processing apparatus 1 is adjusted such that the light - converging point p of laser light l is positioned at the surface 3 at the position of z - axis stage 113 where the focal point of visible light is located at the surface 3 . data of the amount of movement ( z ) explained in fig9 and 94 is fed into and stored in the overall controller 127 . with reference to fig9 , the laser processing method in accordance with the ninth embodiment of the present invention will now be explained . fig9 is a flowchart for explaining this laser processing method . the object to be processed 1 is a silicon wafer . step s 101 is the same as step s 101 of the first embodiment shown in fig1 . subsequently , the thickness of the object 1 is measured . according to the result of measurement of thickness and the refractive index of object 1 , the amount of movement ( z ) of object 1 in the z - axis direction is determined ( s 103 ). this is the amount of movement of object 1 in the z - axis direction with reference to the light - converging point of laser light l positioned at the surface 3 of object 1 in order for the light - converging point p of laser light l to be located within the object 1 . namely , the position of light - converging point p in the thickness direction of object 1 is determined . the position of light - converging point p is determined in view of the thickness and material of object 1 and the like . in this embodiment , data of a first movement amount for positioning the light - converging point p near the rear face within the object 1 and data of a second movement amount for positioning the light - converging point p near the surface 3 within the object 1 are used . a first molten processed region to be formed is formed by using the data of first movement amount . a second molten processed region to be formed is formed by using the data of second movement amount . data of these movement amounts are fed into the overall controller 127 . steps s 105 and s 107 are the same as steps s 105 and s 107 in the first embodiment shown in fig1 . the focal point data calculated by step s 107 is sent to the stage controller 115 . according to the focal point data , the stage controller 115 moves the z - axis stage 113 in the z - axis direction ( s 109 ) this positions the focal point of visible light of the observation light source 117 at the surface 3 . at this point of z - axis stage 113 , the focal point p of pulse laser light l is positioned at the surface 3 . here , according to imaging data , the imaging data processor 125 calculates enlarged image data of the surface of object 1 including the line 5 along which the object is intended to be cut . the enlarged image data is sent to the monitor 129 by way of the overall controller 127 , whereby an enlarged image in the vicinity of the line 5 along which the object is intended to be cut is displayed on the monitor 129 . the data of first movement amount determined by step s 103 has already been inputted to the overall controller 127 , and is sent to the stage controller 115 . according to this data of movement amount , the stage controller 115 moves the object 1 in the z - axis direction by using the z - axis stage 113 to a position where the light - converging point p of laser light l is located within the object 1 ( s 111 ). this inside position is near the rear face of the object 1 . next , as in step s 113 of the first embodiment shown in fig1 , a molten processed region is formed within the object 1 so as to extend along the line 5 along which the object is intended to be cut ( s 113 ). the molten processed region is formed near the rear face within the object 1 . then , according to the data of second movement amount as instep s 111 , the object 1 is moved in the z - axis direction by the z - axis stage 113 to a position where the light - converging point p of laser light l is located within the object 1 ( s 115 ). subsequently , as in step s 113 , a molten processed region is formed within the object 1 ( s 117 ). in this step , the molten processed region is formed near the surface 3 within the object 1 . finally , the object 1 is bent along the line 5 along which the object is intended to be cut , and thus is cut ( s 119 ). this divides the object 1 into silicon chips . effects of the ninth embodiment of the present invention will be explained . the ninth embodiment forms a plurality of modified regions aligning in the direction of incidence , thereby increasing the number of locations to become starting points when cutting the object 1 . in the case where the size of object 1 in the direction of incidence of laser light is relatively large or where the object 1 is made of a material in which cracks are hard to grow from a modified region , for embodiment , the object 1 is hard to cut when only one modified region exists along the line 5 along which the object is intended to be cut . in such a case , forming a plurality of modified regions as in this embodiment can easily cut the object 1 . a tenth embodiment of the present invention controls the position of a modified region in the thickness direction of an object to be processed by adjusting the light - converging point of laser light in the thickness direction of the object . this positional control will be explained in terms of a crack region by way of embodiment . fig9 is a perspective view of an object to be processed 1 in which a crack region 9 is formed within the object 1 by using the laser processing method in accordance with the tenth embodiment of the present invention . the light - converging point of pulse laser l is located within the object 1 through the surface ( entrance face ) 3 of the object with respect to the pulse laser light l . the light - converging point is adjusted so as to be located at a substantially half thickness position in the thickness direction of the object 1 . when the object to be processed 1 is irradiated with the line 5 along which the object is intended to be cut under these conditions , a crack region 9 is formed along a line 5 along which the object is intended to be cut at a half thickness position of the object 1 and its vicinity . fig9 is a partly sectional view of the object 1 shown in fig9 . after the crack region 9 is formed , cracks 91 are naturally grown toward the surface 3 and rear face 21 . when the crack region 9 is formed at the half thickness position and its vicinity in the thickness direction of the object 1 , the distance between the naturally growing crack 91 and the surface 3 ( rear face 21 ) can be made relatively long , for embodiment , in the case where the object 1 has a relatively large thickness . therefore , apart to be cut extending along the line 5 along which the object is intended to be cut in the object 1 maintains a strength to a certain extent . therefore , when carrying out the step of cutting the object 1 after terminating the laser processing , handling the object becomes easier . fig9 is a perspective view of an object to be processed 1 including a crack region 9 formed by using the laser processing method in accordance with the tenth embodiment of the present invention as with fig9 . the crack region 9 shown in fig9 is formed when the light - converging point of pulse laser light l is adjusted so as to be located at a position closer to the surface ( entrance face ) 3 than is a half thickness position in the thickness direction of the object 1 . the crack region 9 is formed on the surface 3 side within the object 1 . fig9 is a partly sectional view of the object 1 shown in fig9 . since the crack region 9 is formed on the surface 3 side , naturally growing cracks 91 reach the surface 3 or its vicinity . hence , fractures extending along the line 5 along which the object is intended to be cut are likely to occur in the surface 3 , whereby the object 1 can be cut easily . in the case where the surface 3 of the object 1 is formed with electronic devices and electrode patterns in particular , forming the crack region 9 near the surface 3 can prevent the electronic devices and the like from being damaged when cutting the object 1 . namely , growing cracks 91 from the crack region 9 toward the surface 3 and rear face 21 of the object 1 cuts the object 1 . cutting may be achieved by the natural growth of cracks 91 alone or by artificially growing cracks 91 in addition to the natural growth of crack 91 . when the distance between the crack region 9 and the surface 3 is relatively long , the deviation in the growing direction of cracks 91 on the surface 3 side becomes greater . as a consequence , the cracks 91 may reach regions formed with electronic devices and the like , thereby damaging the electronic devices and the like . when the crack region 9 is formed near the surface 3 , the distance between the crack region 9 and the surface 3 is relatively short , whereby the deviation in growing direction of cracks 91 can be made smaller . therefore , cutting can be effected without damaging the electronic devices and the like . when the crack region 9 is formed at a location too close to the surface 3 , the crack region 9 is formed at the surface 3 . as a consequence , the random form of the crack region 9 itself appears at the surface 3 , which causes chipping , thereby deteriorating the accuracy in breaking and cutting . the crack region 9 can also be formed while the light - converging point of pulse laser light l is adjusted so as to be located at a position farther from the surface 3 than is a half thickness position in the thickness direction of the object 1 . in this case , the crack region 9 is formed on the rear face 21 side within the object 1 . as with fig9 , fig1 is a perspective view of the object 1 including crack regions formed by using the laser processing method in accordance with the tenth embodiment of the present invention . the crack region 9 in the x - axis direction shown in fig1 is formed when the light - converging point of pulse laser light l is adjusted so as to be located at a position farther from the surface ( entrance face ) 3 than is a half thickness position in the thickness direction of the object 1 . the crack region 9 in the y - axis direction is formed when the light - converging point of pulse laser light l is adjusted so as to be located at a position closer to the surface 3 than is the half thickness position in the thickness direction of the object 1 . the crack region 9 in the x - axis direction and the crack region 9 in the y - axis direction cross each other three - dimensionally . when the object 1 is a semiconductor wafer , for embodiment , a plurality of crack regions 9 are formed in parallel in each of the x - and y - axis directions . this forms the crack regions 9 like a lattice in the semiconductor wafer , whereas the latter is divided into individual chips while using the lattice - like crack regions as starting points . when the crack region 9 in the x - axis direction and the crack region 9 in the y - axis direction are located at the same position in the thickness direction of the object 1 , there occurs a location where the crack region 9 in the x - axis direction and the crack region 9 in the y - axis direction intersect each other at right angles . at the location where the crack regions 9 intersect each other at right angles , they are superposed on each other , which makes it difficult for the cross section in the x - axis direction and the cross section in the y - axis direction to intersect each other at right angles with a high accuracy . this inhibits the object 1 from being cut precisely at the intersection . when the position of the crack region 9 in the x - axis direction and the position of the crack region 9 in the y - axis direction differ from each other in the thickness direction of the object 1 as shown in fig1 , the crack region 9 in the x - axis direction and the crack region 9 in the y - axis direction can be prevented from being superposed on each other . this enables precise cutting of the object 1 . in the crack region 9 in the x - axis direction and the crack region 9 in the y - axis direction , the crack region 9 to be formed later is preferably formed closer to the surface ( entrance face ) 3 than is the crack region 9 formed earlier . if the crack region 9 to be formed later is formed closer to the rear face 21 than is the crack region 9 formed earlier , the pulse laser light l irradiated when forming the crack region 9 to be formed later is scattered by the crack region 9 formed earlier at the location where the cross section in the x - axis direction and the cross section in the y - axis direction intersect each other at right angles . this forms deviations between the size of a part formed at a position to become the above - mentioned intersecting location and the size of a part formed at another position in the crack region 9 to be formed later . therefore , the crack region 9 to be formed later cannot be formed uniformly . when the crack region 9 to be formed later is formed closer to the surface 3 than is the crack region 9 formed earlier , by contrast , scattering of the pulse laser light l does not occur at a position to become the above - mentioned intersecting location , whereby the crack region 9 to be formed later can be formed uniformly . as explained in the foregoing , the tenth embodiment of the present invention adjusts the position of light - converging point of laser light in the thickness direction of an object to be processed , thereby being able to control the position of a modified region in the thickness direction of the object . changing the position of light - converging point in view of the thickness and material of the object to be processed and the like enables laser processing in conformity to the object . though the fact that the position of a modified region can be controlled is explained in the case of a crack region , the same holds in molten processed regions and refractive index change regions . though the explanation relates to pulse laser light , the same holds for continuous wave laser light . the laser processing apparatus in accordance with the tenth embodiment of the present invention has a configuration similar to the laser processing apparatus 100 in accordance with the first embodiment shown in fig1 . in the tenth embodiment , the z - axis stage 113 adjusts the position of light - converging point p in the thickness direction of object 1 . this can adjust the light - converging point p so as to locate it at a position closer to or farther from the entrance face ( surface 3 ) than is a half thickness position in the thickness direction of the object 1 or at a substantially half thickness position , for embodiment . these adjustment operations and the placement of the light - converging point of laser light within the object can also be achieved by moving the light - converging lens 105 in the z - axis direction . since there are cases where the object 1 moves in the thickness direction thereof and where the light - converging lens 105 moves in the thickness direction of the object 1 in the present invention , the amount of movement of the object 1 in the thickness direction of the object 1 is defined as a first relative movement amount or a second relative movement amount . the adjustment of light - converging point p in the thickness direction of the object to be processed caused by the z - axis stage is the same as that in the ninth embodiment explained with reference to fig9 and fig9 . the imaging data processor 125 calculates focal point data for locating the focal point of visible light generated by the observation light source 117 on the surface 3 according to the imaging data in the tenth embodiment as well . according to this focal point data , the stage controller 115 controls the movement of the z - axis stage 113 , so as to locate the focal point of visible light at the surface 3 . the laser processing apparatus 1 is adjusted such that the light - converging point p of laser light l is located at the surface 3 at the position of z - axis stage 113 where the focal point of visible light is located at the surface 3 . hence , the focal point data is an embodiment of second relative movement amount of the object 1 in the thickness direction thereof required for locating the light - converging point p at the surface ( entrance face ) 3 . the imaging data processor 125 has a function of calculating the second relative movement amount . data of the movement amount ( z ) explained with reference to fig9 and 94 is fed into and stored in the overall controller 127 . namely , the overall controller 127 has a function of storing data of the relative movement amount of the object to be processed 1 in the thickness direction of the object 1 . the overall controller 127 , stage controller 115 , and z - axis stage 113 adjust the position of light - converging point of pulse laser light converged by the light - converging lens within the range of thickness of the object 1 . the laser processing method in accordance with the tenth embodiment will be explained with reference to the laser processing apparatus in accordance with the first embodiment shown in fig1 and the flowchart for the laser processing method in accordance with the first embodiment shown in fig1 . the object to be processed 1 is a silicon wafer . step s 101 is the same as step s 101 of the first embodiment shown in fig1 . subsequently , as in step s 103 of the first embodiment shown in fig1 , the thickness of object 1 is measured . according to the result of measurement of thickness and the refractive index , the amount of movement ( z ) in the z - axis direction of object 1 is determined ( s 103 ). this is the amount of movement of object 1 in the z - axis direction with reference to the light - converging point of laser light l positioned at the surface 3 of object 1 required for positioning the light - converging point p of laser light l within the object 1 . namely , the position of light - converging point p in the thickness direction of object 1 is determined . the amount of movement ( z ) in the z - axis direction is one embodiment of data of relative movement of the object 1 in the thickness direction thereof . the position of light - converging point p is determined in view of the thickness and material of the object 1 , effects of processing ( e . g ., easiness to handle and cut the object ), and the like . this data of movement amount is fed into the overall controller 127 . steps s 105 and s 107 are similar to steps s 105 and s 107 of the first embodiment shown in fig1 . the focal point data calculated by step s 107 is data of a second movement amount in the z - axis direction of object 1 . this focal point data is sent to the stage controller 115 . according to this focal point data , the stage controller 115 moves the z - axis stage 113 in the z - axis direction ( s 109 ) this positions the focal point of visible light of the observation light source 117 at the surface 3 . at this position of z - axis stage 113 , the light - converging point p of pulse laser light l is positioned at the surface 3 . according to imaging data , the imaging data processor 125 calculates enlarged image data of the surface of object 1 including the line 5 along which the object is intended to be cut . this enlarged image data is sent to the monitor 129 by way of the overall controller 127 , whereby an enlarged image near the line 5 along which the object is intended to be cut is displayed on the monitor 127 . data of the relative movement amount determined by step s 103 has already been inputted to the overall controller 127 , and is sent to the stage controller 115 . according to this data of movement amount , the stage controller 115 causes the z - axis stage 113 to move the object 1 in the z - axis direction at a position where the light - converging point p of laser light is located within the object 1 ( s 111 ). steps s 113 and s 115 are similar to steps s 113 and s 115 shown in fig1 . the foregoing divides the object 1 into silicon chips . effects of the tenth embodiment of the present invention will be explained . the tenth embodiment irradiates the object to be processed 1 with pulse laser light l while adjusting the position of light - converging point p in the thickness direction of object 1 , thereby forming a modified region . this can control the position of a modified region in the thickness direction of object 1 . therefore , changing the position of a modified region in the thickness direction of object 1 according to the material and thickness of object 1 , effects of processing , and the like enables cutting in conformity to the object 1 . a eleventh embodiment of the present invention will now be explained . the laser processing method in accordance with the eleventh embodiment comprises a modified region forming step ( first step ) of forming a modified region caused by multiphoton absorption within an object to be processed , and a stress step ( second step ) of generating a stress at a part where the object is cut . in the eleventh embodiment , the same laser light irradiation is carried out in the modified region forming step and stress step . therefore , a laser processing apparatus , which was explained above , emits laser light twice under the same condition in the modified region forming step and stress step , respectively . with reference to fig1 and 101 , the laser processing method in accordance with the eleventh embodiment will now be explained . fig1 is a flowchart for explaining the laser processing method . steps s 101 , s 103 , s 105 , s 107 , s 109 and s 111 shown in fig1 , are the same as theses shown in fig1 , and therefore , the detailed explanations of the steps s 101 , s 103 , s 105 , s 107 , s 109 and s 111 are omitted . after step s 111 , laser light l is generated from the laser light source 101 , so as to irradiate the line 5 along which the object is intended to be cut 5 in the surface 3 of the object 1 therewith . fig1 is a sectional view of the object 1 including a crack region 9 during laser processing in the modified region forming step . since the light - converging point p of laser light l is positioned within the object 1 as depicted , the crack region 9 is formed only within the object 1 . subsequently , the x - axis stage 109 and y - axis stage 111 are moved along the line to be cut 5 , so as to form the crack region 9 within the object 1 along the line 5 along which the object is intended to be cut ( s 1113 ). after the modified region is formed , the crack region 9 is irradiated with the laser light l having for example wavelength of 1064 nm ( yag laser ) along the line 5 along which the object is intended to be cut in the surface 3 of the object 1 again under the same condition ( i . e ., the light - converging point p is located in the crack region 9 that is a modified region ). the laser light l has a transparent characteristics to non - molten processed region of the object , that is , except for the molten processed region of the object , and a high absorption characteristics to the molten processed region comparing with the non - molten processed region . as a consequence , the absorption of laser light l due to scattering by the crack region 9 or the like or the generation of multiphoton absorption in the crack region 9 heats the object 1 along the crack region 9 , thereby generating a stress such as a thermal stress due to a temperature difference ( s 1114 ). fig1 is a sectional view of the object 1 including the crack region 9 during laser processing in the stress step . as depicted , the crack is further grown by the stress step while using the crack region 9 as a start point , so as to reach the surface 3 and rear face 21 of the object 1 , thus forming a cut section 10 in the object 1 , whereby the object 1 is cut ( s 115 ). as a consequence , the object 1 is divided into chips . though the eleventh embodiment carries out the same laser light irradiation as that of the modified region forming step in the stress step , it will be sufficient if laser light transmittable through an unmodified region which is a region not formed with a crack region in the object to be processed but more absorbable by the crack region than by the unmodified region is emitted . this is because of the fact that the laser light is hardly absorbed at the surface of the object , whereas the object is heated along the crack region , whereby a stress such as a thermal stress due to a temperature difference occurs in this case as well . though the eleventh embodiment relates to a case where a crack region is formed as the modified region , the same applies to cases where the above - mentioned molten processed region and refractive index change region are formed as the modified region , whereby a stress can occur upon irradiation with laser light in the stress step , so as to generate and grow a crack while using the molten processed region and refractive index change region as a start point and thereby cut the object . even when the crack grown by the stress step while using the modified region as a start point fails to reach the surface and rear face of the object in the case where the object has a large thickness or the like , the object can be broken and cut by applying an artificial force such as a bending stress or shearing stress thereto . this artificial force can be kept smaller , whereby unnecessary fractures deviating from the line to be cut can be prevented from occurring in the surface of the object . effects of the eleventh embodiment will now be explained . in the modified region forming step of this embodiment , the line 5 along which the object is intended to be cut is irradiated with pulse laser light l while locating the light - converging point p within the object to be processed 1 under a condition causing multiphoton absorption . also , the x - axis stage 109 and y - axis stage 111 are moved , so as to shift the light - converging point p along the line 5 along which the object is intended to be cut . this forms a modified region ( e . g ., crack region , molten processed region , or refractive index change region ) within the object 1 along the line 5 along which the object is intended to be cut . when an object to be processed has a start point in a part to be cut , the object can be broken and cut with a relatively small force . in the stress step of the eleventh embodiment , the same laser light irradiation as that of the modified region forming step is carried out in the stress step , so as to generate a stress such as a thermal stress due to a temperature difference . as a consequence , the object 1 can be cut by a relatively small force , e . g ., a stress such as a thermal stress due to a temperature difference . therefore , the object 1 can be cut without generating unnecessary fractures deviating from the line 5 along which the object is intended to be cut in the surface 3 of the object 1 . since the object 1 is irradiated with the pulse laser light l while locating the light - converging point p within the object 1 under a condition causing multiphoton absorption in the modified region forming step , the pulse laser light l is transmitted there through and is hardly absorbed at the surface 3 of the object 1 in the eleventh embodiment . in the stress step , the same laser light irradiation as that of the modified region forming step is carried out . therefore , the surface 3 does not incur damages such as melt caused by irradiation with laser light . as explained in the foregoing , the eleventh embodiment can cut the object 1 without generating unnecessary fractures deviating from the line 5 along which the object is intended to be cut or melt in the surface 3 of the object 1 . therefore , in the case where the object 1 is a semiconductor wafer , for embodiment , semiconductor chips can be cut out from the semiconductor wafer without generating unnecessary fractures deviating from lines along which the object is intended to be cut or melt in the semiconductor chips . the same holds in objects to be processed having a surface formed with electrode patterns , and those having a surface formed with electronic devices such as piezoelectric device wafers and glass substrates formed with display devices such as liquid crystals . hence , this embodiment can improve the yield of products ( e . g ., semiconductor chips , piezoelectric device chips , display devices such as liquid crystals ) made by cutting objects to be processed . also , in the eleventh embodiment , the line 5 along which the object is intended to be cut in the surface 3 of the object 1 does not melt , whereby the width of the line 5 along which the object is intended to be cut ( which is the gap between regions to become semiconductor chips in the case of a semiconductor wafer , for embodiment ) can be reduced . this can increase the number of products prepared from a single object to be processed 1 , and improve the productivity of products . since laser light is used for cutting and processing the object 1 , the eleventh embodiment enables processing more complicated than that in dicing with a diamond cutter . for the eleventh embodiment , cutting and processing can be carried out even when lines 5 along which the object 1 is intended to be cut 5 have a complex form as shown in fig1 also . the laser processing method in accordance with the eleventh embodiment according to the present invention can cut an object to be processed without generating melt or unnecessary fractures deviating from the line to be cut in the surface of the object . therefore , the yield and productivity of products ( e . g ., semiconductor chips , piezoelectric device chips , and display devices such as liquid crystals ) manufactured by cutting objects to be processed can be improved . besides , in the above eleventh embodiments , the crack which is grown from the crack region 9 in the stress step reaches the surface 3 and rear face 21 of the object 1 , but the crack which is grown from the crack region 9 in the stress step the laser light l may be grown so as not to reach the surface 3 and rear face 21 of the object . the twelve embodiment according to the present invention will now be explained . the laser processing method in accordance with the twelfth embodiment comprises a modified region forming step of forming a modified region caused by multiphoton absorption within an object to be processed , and a stress step of generating a stress at a part where the object is cut , as similar to the eleventh embodiment . a laser processing apparatus for the twelfth embodiment is the same as that of the first embodiment as shown in fig1 , and the detailed explanation of the laser processing apparatus is omitted . an absorbable laser irradiating apparatus used in the stress step of the twelfth embodiment employs the same configuration as that of the above - mentioned laser processing apparatus 100 as shown in fig1 except for the laser light source and diachronic mirror . the laser light source in the absorbable laser irradiating apparatus uses co 2 laser with a wavelength of 10 . 6 μm for generating continuous wave laser light . this is because of the fact that it is absorbable by the object 1 to be processed , which is a pyrex glass wafer . alternatively , the laser diode may be used as a light source for generating the absorbable laser light with a wavelength of 808 nm , 14 w as output power and beam size of about 200 μm . the laser light generated by such laser light source has a absorption characteristics to the object 1 and will hereinafter be referred to as “ absorbable laser light ”. here , its beam quality is tem 00 , whereas its polarization characteristic is that of linear polarization . this laser light source has an output of 10 w or less in order to attain such an intensity that the object to be processed 1 is heated but not melted thereby . the diachronic mirror of the absorbable laser irradiating apparatus has a function of reflecting the absorbable laser light , and is arranged so as to change the orientation of the optical axis of absorbable laser light by 90 °. with reference to fig1 and 104 , the laser processing method in accordance with the twelfth embodiment will now be explained . fig1 is a flowchart for explaining the laser processing method . steps s 101 , s 103 , s 105 , s 107 , s 109 and s 111 shown in fig1 , are the same as theses shown in fig1 , and therefore , the detailed explanations of the steps s 101 , s 103 , s 105 , s 107 , s 109 and s 111 are omitted . firstly , as shown in fig1 , steps s 101 and s 103 are executed and next step s 104 is executed . in the step s 104 , the object 1 is mounted on the mounting table 107 of the laser processing apparatus 100 ( s 104 ). next steps s 105 , s 107 , s 109 , and s 111 are executed . after step 111 of fig1 , laser light l is generated from the laser light source 101 , so as to irradiate the line 5 along which the object is intended to be cut in the surface 3 of the object 1 therewith . fig1 is a sectional view of the object 1 including a crack region 9 during laser processing in the modified region forming step . since the light - converging point p of laser light l is positioned within the object 1 as depicted , the crack region 9 is formed only within the object 1 . subsequently , the x - axis stage 109 and y - axis stage 111 are moved along the line 5 along which the object is intended to be cut , so as to form the crack region 9 within the object 1 along the line 5 along which the object is intended to be cut ( s 1213 ). after the modified region is formed by the laser processing apparatus 100 , the object 1 is transferred to the mounting table 107 of the absorbable laser irradiating apparatus , so as to be mounted thereon ( s 1215 ). the object 1 does not break into pieces , since the crack region 9 in the modified region forming step is formed only therewithin , and thus can easily be transferred . the object 1 is illuminated in step 1217 , focal point data for positioning the focal point of visible light from the observation light source at the surface 3 of the object 1 is calculated in step 1219 , and the object 1 is moved in the z - axis direction so as to position the focal point at the surface 3 of the object 1 in step 1221 , thereby locating the light - converging point of absorbable laser light l 2 at the surface 3 of the object . here , details of operations in the steps 1217 , 1219 , and 1221 are similar to those of steps 105 , 107 , and 109 in the above - mentioned laser processing apparatus 100 . next , absorbable laser light l 2 is generated from the laser light source of the absorbable laser irradiating apparatus , so as to irradiate the line 5 along which the object is intended to be cut in the surface 3 of the object 1 therewith . here , the vicinity of the line 5 along which the object is intended to be cut may be irradiated as well . then , the x - axis stage and y - axis stage of the absorbable laser irradiating apparatus are moved along the line 5 along which the object is intended to be cut , so as to heat the object 1 along the line 5 along which the object is intended to be cut , thereby generating a stress such as thermal stress caused by a temperature difference at a part where the object 1 is cut along the line 5 along which the object is intended to be cut ( s 1223 ). here , since the absorbable laser has such an intensity that the object 1 is heated but not melted thereby , the surface of the object does not melt . fig1 is a sectional view of the object 1 including the crack region 9 during laser processing in the stress step . as depicted , upon irradiation with absorbable laser light , the crack further grows while using the crack region 9 as a start point , so as to reach the surface 3 and rear face 21 of the object 1 , thus forming a cut section 10 in the object 1 , whereby the object 1 is cut ( s 1225 ). as a consequence , the object 1 is divided into silicon chips . though the twelfth embodiment relates to a case where a crack region is formed as the modified region , the same applies to cases where the above - mentioned molten processed region and refractive index change region are formed as the modified region , whereby a stress can occur upon irradiation with absorbable laser light , so as to generate and grow a crack while using the molten processed region and refractive index change region as a start point and thereby cut the object . even when the crack grown by the stress step while using the modified region as a start point fails to reach the surface and rear face of the object in the case where the object has a large thickness or the like , the object can be broken and cut by applying an artificial force such as a bending stress or shearing stress thereto . this artificial force can be kept smaller , whereby unnecessary fractures deviating from the line to be cut can be prevented from occurring in the surface of the object . effects of the twelfth embodiment will now be explained . in the modified region forming step of this embodiment , the line 5 along which the object is intended to be cut is irradiated with pulse laser light l while locating the light - converging point p within the object to be processed 1 under a condition causing multiphoton absorption . also , the x - axis stage 109 and y - axis stage 111 are moved , so as to shift the light - converging point p along the line 5 along which the object is intended to be cut . this forms a modified region ( e . g ., crack region , molten processed region , or refractive index change region ) within the object 1 along the line 5 along which the object is intended to be cut . when an object to be processed has a start point in a part to be cut , the object can be broken and cut with a relatively small force . in the stress step of this embodiment , the object 1 is irradiated with absorbable laser light along the line 5 along which the object is intended to be cut , so as to generate a stress such as a thermal stress due to a temperature difference . as a consequence , the object 1 can be cut by a relatively small force , e . g ., a stress such as a thermal stress due to a temperature difference . therefore , the object 1 can be cut without generating unnecessary fractures deviating from the line 5 along which the object is intended to be cut in the surface 3 of the object 1 . since the object 1 is irradiated with the pulse laser light l while locating the light - converging point p within the object 1 under a condition causing multiphoton absorption in the modified region forming step , the pulse laser light l is transmitted there through and is hardly absorbed at the surface 3 of the object 1 in this embodiment . in the stress step , the absorbable laser light has such an intensity that the object 1 is heated but not melted thereby . therefore , the surface 3 does not incur damages such as melt caused by irradiation with laser light . as explained in the foregoing , this embodiment can cut the object 1 without generating unnecessary fractures deviating from the line 5 along which the object is intended to be cut or melt in the surface 3 of the object 1 . therefore , in the case where the object 1 is a semiconductor wafer , for embodiment , semiconductor chips can be cut out from the semiconductor wafer without generating unnecessary fractures deviating from lines along which the object is intended to be cut or melt in the semiconductor chips . the same holds in objects to be processed having a surface formed with electrode patterns , and those having a surface formed with electronic devices such as piezoelectric device wafers and glass substrates formed with display devices such as liquid crystals . hence , this embodiment can improve the yield of products ( e . g ., semiconductor chips , piezoelectric device chips , display devices such as liquid crystals ) made by cutting objects to be processed . also , in this embodiment , the line 5 along which the object is intended to be cut in the surface 3 of the object 1 does not melt , whereby the width of the line 5 along which the object is intended to be cut ( which is the gap between regions to become semiconductor chips in the case of a semiconductor wafer , for embodiment ) can be reduced . this can increase the number of products prepared from a single object to be processed 1 , and improve the productivity of products . since laser light is used for cutting and processing the object 1 , this embodiment enables processing more complicated than that in dicing with a diamond cutter . for embodiment , cutting and processing can be carried out even when line 5 along which the object is intended to be cut have a complex form as shown in fig1 . the laser processing method of the twelfth embodiment according to the present invention can cut an object to be processed without generating melt or unnecessary fractures deviating from the line to be cut in the surface of the object . therefore , the yield and productivity of products ( e . g ., semiconductor chips , piezoelectric device chips , and display devices such as liquid crystals ) manufactured by cutting objects to be processed can be improved . besides , in the above eleventh embodiments , the crack which is grown from the crack region 9 in the stress step reaches the surface 3 and rear face 21 of the object 1 , but the crack which is grown from the crack region 9 in the stress step the laser light l may be grown so as not to reach the surface 3 and rear face 21 of the object . the thirteenth embodiment according to the present invention will now be explained . the laser processing method in accordance with the thirteenth embodiment comprises attaching step of adhesively attaching an object to be processed to an adhesive and expansive sheet , a modified region forming step of forming a modified region in the object , and cutting / separation step of cutting the object at the modified region thereof and separating the cut parts of the object so as to make the space there between . the above modified region forming step of the thirteenth embodiments may be any one of the first to twelfth embodiments stated above . further , in the modified region forming step , the object may be cut at the modified region . in this case that the object is cut at the modified region in the modified region forming step , in the separation step , the cut parts of the object are spaced to each other by a predetermined distance by expansion of the adhesive and expansion sheet . alternatively , when in the modified region forming step , although the modified region is formed in the body as a molten processed region , the object is not cut , in the separation step , the object is cut and the cut parts of the object are separated to each other with a predetermined space therebetween . fig1 shows a film expansion apparatus 200 and the apparatus 200 has a ring shape holder 201 and a column like expander 203 . the adhesive and expansive sheet on which the object to be cut is attached is set to the ring shape holder 201 . after setting of the adhesive and expansive sheet 204 on the ring shape holder 201 at peripheral edge of the sheet , the modified region is formed in the object along a line along which the object is intended to be cut . after the formation of the modified region in the object , the column like expander 203 is moved up against the adhesive and expansive sheet 204 so that a part of the sheet is pushed upward as shown in fig1 . the movement of the part of the sheet 204 causes the expansion of the sheet along a lateral direction thereof so that the sheet 204 is expanded as shown in fig1 . as the result of the expansion of the sheet 204 , the parts of the object which is cut in the modified region forming step are separated to each other with a predetermined space therebetween . so , the pick up of the parts of the object from the adhesive and expansive sheet 204 is performed easily and surely . when the object is not cut in the modified region formation step , the expansion of the sheet 204 caused by the upward movement of the expander 203 causes the separation of the object into parts of the object in the modified region and thereafter the cut parts of the object are separated to each other with a predetermined space therebetween . the laser processing method and apparatus in accordance with the present invention can cut an object to be processed without generating melt or fractures deviating from lines along which the object is intended to be cut on a surface of the object . therefore , the yield and productivity of products ( e . g ., semiconductor chips , piezoelectric device chips , and display devices such as liquid crystal ) prepared by cutting objects to be processed can be improved . the basic japanese application no . 2000 - 278306 filed on sep . 13 , 2000 and no . 2001 - 278768 filed on sep . 13 , 2001 and pct application no . pct / jp01 / 07954 filed on sep . 13 , 2001 are hereby incorporated by reference . from the invention thus described , it will be obvious that the embodiments of the invention may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended for inclusion within the scope of the following claims .	8
the present invention relates to a flexible hard pipe which can extremely easily and surely achieve the above - mentioned object . referring to fig1 through 4 illustrating an embodiment of the present invention , the hard pipe according to the present invention is provided with two main inner and outer parts , that is , an inner pipe wall b made of a soft synthetic resin material and an outer pipe wall a constituted by a helically round belt or belt - like member 1 made of a hard material . the outer pipe wall a is helically wound on an outer periphery of the inner pipe wall b and is integrally fused with the inner pipe wall b . the hard belt - like material 1 , as shown in fig3 has such a cross - sectional shape that is composed of a substantially linear base portion 2 , an upward or radially outward extending portion 3 continuing from one side edge of the base portion 2 , and a downwardly or radially inward opening , substantially u - shaped portion 4 . the downward opened substantially u - shaped portion 4 is composed of another upward or radially outward extending portion 41 continued from the other side edge portion of the base portion 2 , a linear ceiling portion 42 , and a downward or radially inward extending portion 43 . the belt - like member 1 is in contact and fused with the outer periphery of the inner pipe wall b only at a lower surface of the base portion 2 of the hard belt - like material 1 . the the illustrated embodiment of fig1 - 4 ( as well as the other embodiments ) the helical wound belt 1 is configured to produce linked helical turns with each helical turn in transverse cross section having oppositely radially directed openings . further , the helical turns are edge overlapped such that the first radially outward extending portion 3 and the radially inward extending portion 43 of a given helical turn are respectively positioned within the opening of the helical turns immediately adjacent thereto to link the wrapped helical turns of the hard , outer pipe wall a . the hard pipe having such a structure as described above can be arranged in a building or in a factory , or embedded underground , or can be used fluid flow through the pipe , or for enclosing wires or the like passing through the pipe . referring to the drawings , specific embodiments of the present invention will be described hereunder . first , materials to be used will be described . synthetic rubber , a mixture of synthetic resin and synthetic rubber , synthetic resin materials or the like in a group of vinyl chloride , a group of polyolefin such as polyethylene , polypropylene , etc ., are selectively used as a synthetic resin material for forming both the soft inner and the hand outer pipe walls a and b in accordance with the purpose of use . further , the hardness of each of the hard and soft materials is suitably selected by adjusting the plasticizer or the like . for example , with respect to the pipes arranged in a factory for use for transporting chemicals or the like , consideration is made such that a chemical - proof resin to be used as the synthetic resin material for forming an inner pipe wall b is selected in accordance with the kind of chemicals to be conveyed . a weatherproof resin which is resistant against deterioration owing to changes of external weather , temperature , or the like , is used as the synthetic resin material for the outer pipe wall a ( or as a coating pipe wall c in embodiments as illustrates in fig6 through 15 which will be described later ). as illustrated in the embodiment shown in fig6 through 8 , a resin - coated metal belt - like member 1 , which is made by coating a metal band 11 with a synthetic resin 12 , may be used as the hard belt - like member for forming the outer pipe wall a . steel plates , stainless steel plates , iron plates , and other metal plates are desirably selectively used as a material for such a metal band member 11 in accordance with the use of the pipes to be formed . then plates having a thickness within a range of about 0 . 3 to 3 mm are suitably selected taking into consideration the diameter of the pipes to be formed , the externally and internally applied pressure to be withstood by the pipes , the purpose and place of use of the pipes , and so on . further , the metal band member 11 may be not only a flat belt - like one but a punched metal one in which a number of small holes are bored . further , a bandage - like belt member made by knitting metal wires in the form of a net may be used as the metal band member 11 . fig1 through 4 are views showing an embodiment according to the present invention . although the outline of the arrangement shown in fig1 through 4 has been described in the above introductory paragraph , the arrangement will be further described hereunder . as shown in fig3 an inner pipe wall b is formed such that a soft synthetic resin belt - like member b 1 forming the inner pipe wall b is extruded in the form of a belt from a not - shown extruder under the condition of a temperature not lower than a softening pont but not higher than a melting point of the synthetic resin . the belt - like member b 1 is helically wound on a mandrel so as to be superimposed at its opposite side edge portions on succeeding wraps . the superimposed portions are pressed from their upper surfaces , as required , by a pressing roller so as to be fused and to be stuck to each other . then , an outer pipe wall a is formed from a hard synthetic resin belt - like member 1 composed in cross - section of a substantially linear base portion 2 , an upward extending portion 3 continuing from the base portion 2 at its right side of the drawing , and a downwardly opened , substantially u - shaped portion 4 including another upward extending portion 41 continued from the base portion 2 at is left side in the drawing , a ceiling portion 42 horizontally extending left from the upward extending portion 41 , and a downward extending portion 43 extending downwardly from the left end of the ceiling portion 42 . the belt - like member 1 is separately formed and then successively wound in a helix onto an outer peripheral surface of the prepared inner pipe wall b . only the lower surface of the base portion 2 is caused to abut on and to be fused with the outer peripheral surface of the inner pipe wall b . furthermore , the belt - like member 1 is wound at a pitch such that an upper portion of the upwardly extending portion 3 of the preceding wrap of the belt - like member 1 is covered by the downwardly opened u - shaped portion 4 of the succeeding wrap of the belt - like member 1 . as shown in fig4 the structure of the hard belt - like member 1 forming the outer pipe wall a as illustrated in the embodiment is featured in that its cross - section has the following properties . ( 1 ) the width w 1 between the upwardly extending portion 41 and the downwardly extending portion 43 and the width w 2 between the upwardly extending portion 3 and the upward extending portion 41 of the hard belt - like member 1 are set to have a relationship in that w 1 approximately equals w 2 . ( 2 ) the height h 1 between the lower surface of the base portion 2 and the upper surface of the ceiling portion 42 , the length h 2 of the downwardly extending portion 43 , and the height h 3 of the upwardly extending portion 3 of the belt - like member 1 , are set to have relationships that h 1 is greater than h 2 and h 2 is approximately equal to h 3 . ( 3 ) the height h 1 , the length h 2 and the thickness t 2 of the base portion 2 , of the hard belt - like member 1 , are set to have a relationship that h 1 is equal to or greater than the sum of h 2 and t 2 . ( 4 ) the height h 1 , the height h 3 and the thickness t 1 of the ceiling portion 42 , of the hard belt - like member 1 , are set to have a similar relationship that h 1 is equal to or greater than the sum of h 3 and t 1 . it is not necessary that the downwardly opened u - shaped portion 4 of the hard belt - like member is u - shaped , but may be such a downwardly opened semi - circular form , as shown in fig1 , or other various kinds of forms as required . as is easily understood from fig1 , in the relationship between the width w 1 between the upward extending portion 41 and the downward extending portion 43 and the width w 2 between the upward extending portion 3 and the upward extending portion 41 of the hard belt - like member 1 , it is not always necessary that w 1 be approximately equal to w 2 . instead w 1 may be less than or greater than w 2 . fig5 is a view showing another embodiment which is arranged such that the upward extending portion 3 , the upward extending portion 41 , and the downward extending portion 43 of the hard belt - like member 1 shown in the above - mentioned embodiment are slanted in one direction ( to the left in the drawing in this embodiment ). next , referring to fig6 through 15 , description will be made as to various embodiments each having such an arrangement that a coating pipe wall c is formed on the outer peripheral surface of an outer pipe wall a to cover the outer pipe wall a . according to the present invention , however , it is not fundamentally necessary to provide the coating pipe wall c as shown in the above - mentioned embodiments . therefore , it will be appreciated that the description of various embodiments which will be made herunder apply as well to corresponding embodiments having no coating pipe wall c . in the embodiment shown in fig6 through 8 , the hard belt - like member 1 forming the outer pipe wall a is formed substantially in the same shape as that of the hard belt - like member 1 shown in the embodiment illustrated in fig1 through 4 . as mentioned previously , the hard belt - like member 1 is formed by coating a metal band member 11 with synthetic resin 12 . in the same manner as in the embodiment illustrated in fig1 through 4 , the outer pipe wall a is formed such that the hard - belt like member 1 is successively wound as a helix on the outer peripheral surface of the inner pipe wall b formed by helically winding a soft synthetic belt - like member b 1 . the winding of the outer pipe wall a is such that the base portion 2 is brought into contact and fused with the outer peripheral surface of the inner pipe wall b only at the lower surface of the base portion 2 . a flat soft synthetic resin belt - like member c 1 for forming a coating pipe wall c is separately extruded from a not - shown extruder and is helically wound on the outer periphery of the outer pipe wall a such that the opposite edge portions of the belt - like member c 1 are superimposed one on the other . depending upon requirements , the superimposed portions may be pressed by a pressing roller to be fused with each other as well as to the outer peripheral surface of the ceiling portion 42 of the hard belt - like member 1 . fig9 shows another embodiment in which a hard belt - like member 1 is made only of a hard synthetic resin material and is arranged such that an upper end of an upwardly extending portion 3 and a lower end of a downward extending portion 43 are respectively bent toward each other and to respective upward extending portions 41 . fig1 shows a further embodiment having such an arrangement that the upwardly extending portion 3 , the upward extending portion 41 , and the downwardly extending portion 3 , the upwardly extending portion 41 , are all slanted in one direction ( to the left in the drawing ). fig1 through 12 show other embodiments in which the upwardly extending portion 3 and the downwardly extending portion portion 43 are shaped to be hollow triangles ( fig1 ), or in which each of an upwardly extending portion 3 and a downwardly extending portion 43 is shaped as an inverted triangle or an inverted trapezoid ( fig1 ). in the embodiment of fig1 , the upwardly extending portion 41 is slanted right in the drawing . fig1 and 14 show further embodiments in each of which an upwardly extending portion 41 is slanted to left , and an upwardly extending portion 3 and a downwardly extending portion 43 are also slanted in the same direction as the upward extending of the upward extending portion 41 , similarly to the embodiments shown in fig5 and 10 . also , in these embodiments , the respective ends of the upward extending portions 3 and the downward extending portions 43 rounded ( fig1 ) or square ( fig1 ) respectively . in the embodiment of fig1 the thickness of a coating pipe wall c is made thinner than that of an inner pipe wall b , and in the embodiment of fig1 both the inner pipe wall b and the coating pipe wall c is made to be in a form of a thin film . the hard belt - like member 1 shown in each of the embodiments of fig1 through 12 and 15 , is partially internally provided with a metal band 11 . in the embodiment of fig1 , the metal band member 11 is internally provided to extend from a base portion of the upwardly extending portion 3 to a base portion of the downwardly extending portion 43 . in the embodiment of fig1 , the metal band 11 extends in a z - shaped portion along the base portion 2 , the upwardly extending portion 41 , and the ceiling portion 42 . in the embodiment of fig1 , the metal band 11 extends in a u - shaped portion along the upwardly extending portion 3 , the base portion 2 , and the upwardly extending portion 41 . in the embodiment of fig1 , the metal belt 11 extends only in the base portion 2 . thus , it is not always necessary to use the metal band 11 over the whole region of the hard belt - like member 1 in such a manner as illustrated in the embodiment shown in fig6 through 8 , but may be desirably provided in accordance with the purpose of use of the hard pipe to be produced . neither the inner pipe wall b nor the coating pipe wall c according to the present invention necessarily needs to be made by helically winding a belt - like member as illustrated in each of the above - mentioned embodiments , but may be instead cylindrically extruded . although for the helically wound hard belt - like member 1 , the relative positional relationship between the fused portion and the position where the hard belt - like member 1 is helically wound is not particularly limited , it is advantageous to have such an arrangement that the base portion 2 of the hard belt - like member 1 is superimposed on the fusing portion of the inner pipe wall b ( the belt - like member b 1 ) and that the coating pipe wall c ( the belt - like member c 1 ) is superimposed on the ceiling portion 42 . the advantage is that the fusing can be more firmly performed . the present invention can be built with the following materials . ( 1 ) the hard belt - like member 1 and / or the inner pipe wall b and the coating pipe wall c may be made of a synthetic resin material in a group of polyolefin such as polyethylene , polypropylene , or the like , or of another synthetic resin material in a group of vinyl chloride . ( 2 ) the hard belt - like material 1 may be made of fiber resin - forced composite resin ( frp ) which is made by reinforcing synthetic resin with very strong fibers such as whisker , glass , boron , carbon , alumina ( al 2 o 3 ), silicon carbide ( sic ) or the like hard rubber , or fiber reinforced rubber ( frr ) which is made by reinforcing rubber with such very strong fibers , as described above . ( 3 ) the hard belt - like member 1 may be formed with a metal band plate . ( 4 ) the hard belt - like member 1 may be formed with a metal band plate lined on its inner and outer surfaces with a synthetic resin material or a rubber material . ( 5 ) the metal band plate may be formed of a punched metal in which a number so small holes are bored . the typical embodiments according to the present invention have been described above . however , the present invention is not limited to only those embodiments , but can be suitably modified and carried out within a range in which the constituent features of the present invention are provided , the objects of the present invention can be achieved , and the effects which will be described later can be obtained . according to the present invention , as described above with respect to the embodiments and as stated in the introductory paragraph , a specially shaped hard belt - like member 1 made of a hard material , perhaps including a metal band member 11 , is partially integrally fused with an outer peripheral surface of an inner pipe wall b made of the soft synthetic resin material . accordingly , the thus produced pipe is limited to not axially extend beyond a predetermined extent so that the tensile strength in the axial direction of the pipe is remarkably increased when compared with the conventional synthetic resin helical pipe . further , the inner pressure withstanding strength of the pipe can be significantly increased , and necessary strength against externally exerted compressive force can be held sufficiently by the hard outer pipe wall . thus , it is possible to obtain strong pressure - withstanding pipes which can be stably used as pipes for high - pressure fluid or pipes to be buried underground , in spite of its lightness . further , in spite of having pressure - withstanding property , the pipes have a further extremely unique effect , which the conventional hard pipes have never been expected . namely , the pipes can be laid along a curved path owing to the capability of expansion and contradiction of the hard outer pipe wall and the flexibility of the inner pipe wall during the pipe laying ( as shown by two - dotted chain lines in fig1 and 6 ). in the case where the outer peripheral surface of the hard belt - like member 1 is coated with a pipe wall c made of a soft synthetic resin material , as illustrated in the embodiments shown in fig6 through 15 , the hard pipe according to the present invention has such advantages that even if concave portions are formed in the hard belt - like member when the pipe is stretched or bent , the outer peripheral portion is coated with the coating pipe wall , so that there is no fear that external materials such as stones , soil , or the like , can come into the concave portions . such materials would prevent the pipe from changing its shape into a contacted state . thus the coating pipe wall makes it possible to use the pipe conveniently and more stably as a pipe arranged on or above the ground or as a pipe to be embedded under the ground .	5
fig1 shows one embodiment of the device of this invention comprising a cylindrical housing 10 which is preferably constructed of an opaque material . this housing has a base 12 and a top annular lip 14 in which sits a disk - shaped diffuser plate 16 . a source of light is also disposed in the housing and it is shown as lamp 18 suitably supported from the base 12 of the housing . a layer 20 of liquid soap or other liquid capable of being blown into a thin film bubble is disposed over the diffuser plate 16 . the plate 16 may be liquid sealed to the lip 14 with the lip 14 serving as a retaining means for the liquid 20 . fig1 also shows a blowing apparatus 22 which may comprise a blower and a source of power . from the apparatus 22 there is shown a tube 24 through which the forced air flows . the tube 24 is at least partially submerged in the liquid 20 and when the device 22 is operated , a bubble such as the bubble 26 shown in fig1 may be formed . the soapy water bubble 26 which has a form substantially that of a truncated sphere is essentially a thin film which , when illuminated by the light projecting through the diffuser plate 16 , demonstrates interference patterns of remarkable brightness and color change . the device 22 may be operated automatically or manually . in fig2 like reference characters are used to identify parts previously shown in fig1 . thus , there is shown the cylindrical housing 10 , the lamp 18 , and the diffuser plate 16 . in this embodiment , there is added a clear glass hemisphere 30 which may be tightly sealed at its edge to the top edge defining the housing . in fig2 the hemisphere is shown disposed on the retaining lip 14 . there may be provided a liquid - tight seal between the hemisphere 30 and the housing 10 . in the embodiment of fig2 a fluid such as water , hydrocarbons , or fluorocarbons is deposited on the plate 16 . because of the heat created from the lamp 18 , this fluid is evaporated and condenses on the inner surface of the hemisphere 30 . this action creates interference patterns on the inside of the glass hemisphere . with this second embodiment , it is preferred that the fluid have an index of refraction different from both the material comprising the hemisphere 30 , which may be of glass or plastic , and also different from the index of refraction of air . by the proper selection of the lamp and the selection of other components and the size thereof , proper evaporation and condensation can be obtained . in fig2 the dome 30 is preferably coated with an anti - reflective coating on its outside surface . in the embodiment shown in fig1 multiple bubbles can also be obtained . the liquid on the surface of plate 16 serves to cool and lubricate the path of the bubble &# 39 ; s edge as the bubble is being blown . thus , it is quite easy to form a bubble as shown in fig1 . fig3 shows how the phenomenon of interference arises when a thin film is illuminated . a light ray 40 incident on a film 44 of transparent material gives rise to two singularly reflected rays 48 and 50 . these rays , the results of reflection from the front and rear surfaces 52 and 56 of the film , are of nearly equal intensity to one another and are considerably less intense than the incident ray 40 and transmitted ray 60 . rays 64 and 68 resulting from multiple reflections inside the film are of negligible intensity . if the film is thin enough , the reflected rays 48 and 50 will interfere with each other . depending on the wave length of the incident light and the optical path difference of the reflected rays 48 and 50 ( itself dependent on the angle of incidence 70 , and the thickness and refractive index of the film ), the two rays 48 and 50 will tend to reinforce each other or cancel one another . if a mixture of wave lengths is incident , the reflected light will be a different mixture since some of the constituents will have cancelled while others will have reinforced . thus , if the incident light is white light ( a mixture of all colors ), the reflected light will appear as one of a great variety of colors . fig4 shows the manner of viewing a soap bubble displayed on the device . upon looking at the bubble 72 displayed on the device , the viewer 74 sees the various areas of the diffuse light source 75 reflected in various areas of the bubble that are concave toward the viewer . these concave areas of the bubble function in the manner of a spherical mirror . since the bubble is a thin film , the reflected light shows the interference phenomena described in connection with fig3 . the parts of the bubble surface that are convex toward the viewer serve merely as transparent windows through which the reflected light passes . for example , when the eye is directed at the portion of the bubble at 77 , the reflection of the portion of the light source at 78 is seen . similarly , the portion of the light source at 81 is seen reflected in the portion of the bubble at 80 . since different angles of incidence are involved , the different portions of the bubble will in general be seen as different colors . a similar variation occurs as the viewer changes position . multiple reflections also occur . thus , the viewer looking at the portion of the bubble at 83 sees the reflection of the portion of the light source at 84 , but the geometry is such that the light has reflected off the portion of the bubble at 85 as well . the normal diminution of intensity due to multiple reflections is offset by the increase in the coefficient of reflection at the glancing angles involved . using a thin film in the form of a bubble is advantageous in that the film is self - supporting and provides a wide range of incidence angles . illuminating the bubble from below allows for close proximity between the light source and the thin film . this , in conjunction with the concavity toward the light source , results in a relatively complete illumination of the film from most viewing positions . the rich panoply of colors is further enhanced by the thickness variations of the bubble wall itself . due to gravity , the wall tends to get thicker toward the bottom . in some configurations , this can increase the range of optical path differences ( and hence colors ). in addition , there are many local irregularities in the wall thickness . thus , a swirling abstract guality is lent to the otherwise precise and intricate geometrical pattern . since the wall thickness varies temporally as well as spatially as described above , the observed pattern is a dynamic one the boundaries and colors continually shifting in a most intriguing manner . first , it forms a reservoir which holds the liquid from which the bubble is blown , thus providing liquid for the bubble , and a lubricating surface to facilitate the blowing of large bubbles . second , it prevents the bubble from wandering , thereby keeping it positioned over the light source . fourth , it acts as a stop to shield the viewer &# 39 ; s eye from the diffuse light source which is much more intense than the interference patterns being observed . regarding the fourth function above , reference is made to fig5 . the viewer 90 who keeps his eye just at the line between the farthest lowest point 92 of the bubble and the highest nearest point 94 on the lip will see all of the far bubble wall ( the reflecting wall ), but none of the light source . the viewer 96 who keeps his eye higher will see part of the light source . the viewer 98 who keeps his eye below the line will miss part of the bubble . this shielding function is important since the present of the light source in the field of view causes the pupil of the eye to contract , resulting in an apparently less intense and brilliant interference pattern than is otherwise observed .	8
example embodiments of the present work use interrupted tsvs that provide serial connections through successive integrated circuit die in a stack without the need for die rotation . with an interrupted tsv , the connection between bottom pad and top pad is broken to allow connections other than direct ( uninterrupted ) vertical connections . fig3 shows an example of stacked chips interconnected using interrupted tsvs according to the present work to provide connections that are not direct vertical connections . the tsvs in position a are conventional uninterrupted vertical connections between a pad on the bottom surface of the die and the top metal layer , while the tsvs in positions b , c , and d are interrupted tsvs . within the active circuit and interconnect region of the chip there may be many conductive layers . modern logic processes have 9 layers of metal interconnect or even more . the top metal layer is indicated here as metal n and the bottom layer as metal 1 . in addition connections can be made with polysilicon or even diffusion layers . unlike the prior art continuous tsv ( see also fig1 and 2 ) that extends vertically from a bottom pad to a top pad , the interrupted tsv ( b , c , d ) extends from the bottom pad through the substrate and then terminates at metal layer 1 within the active circuit and interconnect region . the metal 1 tsv terminal can be connected to any circuitry within the active circuit and interconnect region . in various embodiments , the interrupted tsvs ( b , c , d ) terminate at various metal layers between layer 1 and layer n . the top metal layer n provides the connection at the top surface of the die for both uninterrupted and interrupted tsvs . with an interrupted tsv , the bottom pad 31 is separated and electrically distinct from the corresponding overlying and axially aligned top pad at metal n in fig3 and 4 . for mechanical support , both the top metal connection and the lower metal connection may each comprise several metal layers , for example metal 1 combined with metal 2 for the contact to the material in the through hole , and metal n combined with metal n − 1 for the top connection to the top pad ( tsv output ). the process for etching the through holes and filling in the tsv conductive material remains essentially the same as in the prior art . in the case of the uninterrupted tsv a , the deep silicon etch process and successive reactive ion etch ( rie ) processes will terminate at the top metal layer n . for the interrupted tsv ( b , c , or d ), the process will terminate at a lower metal layer . for enhanced uniformity of this etch process , even the uninterrupted tsv at a can be formed using the same lower metal layer as the interrupted tsvs , for example metal 1 , and the connection to the top metal can be made through normal vias and metal layers within the active circuit and interconnect region , as shown in fig4 . this can prevent such problems as over - etching the shallower through hole to the lower metal layer in the case of an interrupted tsv and under - etching the deeper through hole to the top metal layer in the case of an uninterrupted tsv . the interrupted tsv can be used to create serial connections between the chips in a stack of common chips , without the need for alternate chip rotation . therefore the location of the tsvs on the constituent common chips may be arbitrary and not subject to restrictions such as symmetry about an axis of rotation . interrupted tsvs ( b , c , d ) can be combined with vertically continuous ( uninterrupted ) tsvs ( a ) as may be advantageous for a desired function . for example , in a stack of memory chips , data , address , and control busses can use uninterrupted tsvs while a chip identification bus can employ interrupted tsvs interconnected in a staggered manner such as shown in fig3 and 4 . this provides capability to uniquely identify chips within a stack . the tsvs of the bottom chip are connected to logic “ 1 ” and logic “ 0 ” levels as shown . in some embodiments , logic “ 1 ” is the positive supply voltage vdd and logic “ 0 ” is the ground supply voltage vss . a vertical stack of interconnected , uninterrupted tsvs ( defined by all of the tsvs designated at a in fig3 and 4 ) is connected ( at the corresponding pad 31 of the bottom chip ) to logic “ 1 ”, while three other , interrupted tsvs b , c , and d are connected ( at the corresponding pad 31 of the bottom chip ) to logic “ 0 ”. among the interrupted tsvs ( b , c , d ), each output pad located on the top of the chip is connected to a respective input pad located on the bottom of the chip and axially offset from the top pad . interrupted tsvs having this axial offset feature are also referred to herein as staggered tsvs . as a result of the axially offset pairs of top and bottom pads connected by the respective staggered tsvs b , c , and d , each chip receives a different combination of bits from the four tsvs a , b , c , and d , starting with “ 1000 ” for the lowest chip , “ 1100 ” for the next chip , and “ 1110 ” for the uppermost chip shown . this type of code is sometimes referred to as a thermometer code . other codes may be employed that change from chip to chip as a result of interconnection using staggered tsvs . the number of staggered tsvs can be increased to provide a wider range of unique chip identification codes . a benefit of the staggered tsv approach is that no intervening logic or active circuitry between tsvs is required to produce the chip id codes . in some embodiments , the logic levels received on the tsv are encoded as binary numbers as shown in table 1 . in some embodiments , in addressing the stack of chips , the controller provides to every chip in the stack a number of chip enable ( ce ) signals through respective uninterrupted vertically interconnected tsvs . each chip in the stack would only respond to the ce signal combination corresponding to its unique chip identification code , such as the thermometer code described above . in some embodiments , the controller sends an encoded chip id address field as shown in table 1 above with each instruction . only the chip whose encoded chip id ( as determined on - chip using table 1 ) matches the encoded chip id field within the instruction responds to the instruction . serial tsv connections can also be created using a staggered arrangement of interrupted tsvs in combination with the die rotation approach disclosed in united states patent application publication 2009 / 0127668 . fig5 shows a top planar view of 4 chips to be stacked . in the diagram , a small solid circle represents a bonding pad on the bottom of the chip and a tsv . this is referred to as a tsv input ( which can optionally include a bonding pad on top of the chip ). a large open circle represents a bonding pad on the top of the chip and a solder ball . this is referred to as a tsv output ( which can optionally include a tsv and / or a bonding pad on the bottom of the chip ). two direct vertical ( i . e ., uninterrupted ) tsvs labeled as v 0 and v 1 include both top and bottom bonding pads as well as a tsv and a solder ball . these uninterrupted tsvs are shown as smaller solid circles inside larger open circles . v 0 and v 1 are located at positions symmetrically opposite the center of rotation of the chip . when one chip is rotated 180 ° and placed on top of another un - rotated chip , v 0 and v 1 on the bottom chip will be connected to v 1 and v 0 respectively on the top chip . in this example chip 1 is on the bottom and both v 0 and v 1 are connected to vdd through the package substrate . on each die there are also 3 tsv inputs labeled i 1 , i 2 , and i 3 and 3 tsv outputs labeled o 1 , o 2 , and o 3 . when a die is rotated and placed on top of an un - rotated die , o 1 , o 2 , and o 3 on the bottom die will be connected to i 1 , i 2 , and i 3 respectively on the top die . within the die , v 0 is connected to o 3 , i 1 is connected to o 2 , and i 3 is connected to o 1 , through internal connections . on the bottom die identified as chip 1 , i 1 , i 2 , and i 3 are connected to vss through the package substrate as indicated . chip 2 is rotated 180 ° and placed on top of chip 1 . i 3 on chip 2 receives vdd from o 3 on the lower chip and provides this logic level to o 1 . i 1 and i 2 on chip 2 remain at vss . chip 3 has the same orientation as chip 1 and receives vdd on both i 1 and i 3 while i 2 remains at vss . chip 4 has the same orientation as chip 2 and receives vdd on i 1 , i 2 and i 3 . in this way each chip receives a unique combination of logic levels on the three inputs i 1 , i 2 , and i 3 which can be used as chip identifiers . this approach can also be extended to accommodate larger numbers of chips by increasing the number of staggered , interrupted tsvs . the use of staggered , interrupted tsvs to uniquely identify individual chips in a stack of chips as explained above requires one additional tsv input and output on each chip for each additional chip in the stack . for a large stack this can lead to a significant number of tsvs . a solution is to propagate encoded chip id codes through the tsvs rather than the thermometer or similar type codes in the solution above . for this , some embodiments provide a binary adder 61 between tsv inputs at the bottom of each die and tsv outputs at the top of each die , as shown in fig6 . each chip includes a binary adder 61 which takes an n - bit binary word from the tsv inputs and adds binary “ 1 ” to provide an incremented n - bit binary word to the tsv outputs . the tsv inputs at the first chip at the bottom of the stack can be connected to vss , for example , representing the binary number ‘ . . . 0000 ’, so the second chip will receive the binary number ‘ . . . 0001 ’, the third chip will receive ‘ . . . 0010 ’, and so on . this approach can uniquely address up to 2 n die within a stack . the tsv inputs at each chip in the stack provide the chip id code ( as originated by the external controller ) for identifying when the particular chip is enabled / addressed , either by dedicated chip enable inputs or chip id fields encoded within received commands . this approach can be implemented using serial tsv connections implemented with interrupted tsv or with uninterrupted tsvs and alternate die rotation . to save further on the tsv overhead needed to uniquely identify individual chips within a stack of chips , some embodiments use a serial approach as shown in the example of fig7 and 8 . three additional tsvs are provided on each chip . two uninterrupted tsvs propagate through every chip to distribute a reset and a clock ( clk ). an enable signal is routed through a serial ( interrupted ) tsv in and out of a set - able d - type flip - flop 71 in each chip . the flip - flop 71 receives the tsv input ein from the previous chip in the stack at its d input terminal and provides its q output at the tsv output eout for the next chip in the stack . at stack power - up , the reset input is held high for a period of time to reset the binary counter outputs to “ . . . 000 ” and to set the d - type flip - flop &# 39 ; s output to “ 1 ”. the ein0 input at the bottom chip of the stack is held low . the reset input is then taken from the high logic level to the low logic level . on the first rising clock edge after the reset input is brought low , a binary counter 72 in each chip of the stack except the first ( bottom ) chip will be clocked and incremented from “ . . . 000 ” to “ . . . 001 ”. the counter 72 of the first chip will remain at the reset state “ . . . 000 ” because ein0 has a low logic level which prevents the counter from incrementing . on the same clock edge the q output d - type flip - flop on the first chip will change from the “ 1 ” set state to “ 0 ”. this q output is provided to tsv output eout0 that connects to the ein1 input on the second chip in the stack . since the second chip had a logic “ 1 ’ on the en1 input during the first rising edge of the clock , the counter will have incremented from “ . . . 000 ” to ‘ . . . 001 ”. after ein1 goes low following the first rising edge of the clock , the counter on the second chip is prevented from incrementing further and will remain at “ . . . 001 ”. similarly , the counter in the third chip in the stack will increment on the first two rising edges of the clock following de - assertion of the reset input and will stop counting at “ . . . 010 ”. de - assertion of the enable signal ein propagates through one more level of the chip stack on each rising edge of the clock to inhibit counting on each successive chip . in this way each chip in the stack is assigned a unique chip id , namely , the output of its counter 72 . this approach can be implemented using serial tsv connections implemented with interrupted tsv or with uninterrupted tsvs and alternate die rotation . embodiments such as shown in fig9 and 10 provide unique identifiers to chips in a stack through an initialization sequence transmitted using a serially connected protocol . in some embodiments , the protocol also supports other operations , such as background maintenance operations that are performed periodically or after initialization . in some embodiments , the protocol further supports normal functional operations of the chip , for example read and write operations of a memory chip . in the serially connected protocol , commands are received in one device in a stack from a previous device in the stack . in some embodiments , the received commands are latched into the receiving device , and also forwarded to the next device in the stack . an example command packet is shown as table 2 . each field in the command packet may be exactly one byte in length or may have a different length . each bit may be transmitted sequentially on a 1 - bit synchronous interface or each field may be transmitted on a single clock edge . clocking may be either single data rate ( sdr ) using one edge of the clock signal or double data rate ( ddr ) using both edges of the clock . the command includes a device id field indicating to which device the command is addressed , a command field indicating the type of command such as memory read or memory write , one or more optional address fields depending on the command , and one or more optional data fields depending on the command . if the command is addressed to a particular device indicated in the device id field , then , in some embodiments , command decoding / forwarding logic 91 resident on that device will latch and execute the command , but need not forward the command to the next device in the stack . in some embodiments , the device id field is also used to indicate a broadcast command , for example ‘ 11111111 ’. in this case , the command will be executed by the logic 91 on each device . in some embodiments , after reset , each device is ready to receive a command , for example , a broadcast set device id command . an example of the broadcast set device id command is shown in table 3 . on receiving a broadcast set device id command ( indicated in some embodiments by ‘ 11111111 ’ within the command field ), the logic 91 within the device will load its internal device id register to the value found within the data field of the packet . for other types of command packets , the logic 91 would normally forward the command packet unaltered to the following device . however , for the broadcast set device id command , rather than forwarding the broadcast set device id command packet to the next device unaltered , logic 91 will increment the data field before forwarding the command . if , for example , the external controller sends the command to the first device in the tsv stack with the value ‘ 00000000 ’ in the data field , then the first device in the stack will take this value for its device id , increment the value to ‘ 00000001 ’, and send to the next device the resulting broadcast set device id command with the incremented value in the data field . each device in the stack processes the command in the same fashion , so each device obtains a unique device id value . in some embodiments , the serial packet based protocol requires as few as four tsvs to support a single bit data stream , as is seen from fig9 . these include an interrupted tsv for data input d and data output q , an interrupted tsv for command strobe input csi and command strobe output cso , an uninterrupted tsv for clock clk , and an uninterrupted tsv for reset r . on initialization , the controller would issue the broadcast set device id command to the bottom device in the stack and provide enough clock edges for the command to propagate through the maximum number of devices to be supported in a stack . fig1 shows the timing of the broadcast set device id commands through the first three devices in the stack . the clock is not shown . either sdr or ddr clocking may be employed . the data stream could be single bit wide in which case 8 clock edges would be required to transfer each byte in the packet , byte wide in which case a single clock edge would be required to transfer each byte , or any other practical width . the data in the three fields of the packet are shown in hexadecimal format . in the example shown , the packet is completely received before it is forwarded to the next device . in some embodiments , the receiving device begins transmitting the packet to the next device before it has completely received the packet from the previous device . following chip id assignment , by any of the above - described approaches or another method , the controller in some embodiments determines how many devices are in the stack . in some embodiments , each chip is connected in parallel to unidirectional device id , address , and command busses , and bidirectional data busses through uninterrupted tsv connections as shown in fig1 . the controller writes several locations in memory for each possible die in the stack , and then reads the locations to determine whether each die is actually present . some embodiments use the command sequence of fig1 for determining the number of memory devices present in a stack , using the parallel bus architecture of fig1 . fig1 shows a sequence of commands , addresses , and data for a synchronous dram such as sdram , ddr sdram , or lpddr sdram . the clock is not shown . “ command ” in fig1 refers collectively to well known sdram control pins such as ras , cas , we , and ce . the device id bus is an addition to the conventional dram interface to support operation of stacked devices with connection through tsvs . for illustrative purposes the data bus is shown as an 8 - bit bus although other data widths can be accommodated . similar command sequences can apply to other forms of memory such as ddr2 sdram , ddr3 sdram , and nand flash memory . the controller sends a sequence of commands beginning with a bank activate ( ba ) command to the dram with device id = 00 ( the first device in the stack in this example ) along with address bits specifying bank address 0 and row address 0 ( abbreviated as 0 , 0 in the diagram ). after a period of time allowing the bank activation process to complete , the controller sends a write command ( wr ) to device 0 along with address bits specifying bank address 0 and column address 0 ( abbreviated as 0 , 0 in the diagram ) followed by a 2 byte burst of data to be written “ 55 ” and “ aa ”. the controller then continues to issue similar pairs of ba and wr commands to each possible device id up to the maximum number supported by the controller or the system . if a particular device id is not present in the stack , then the commands corresponding to that device id will be ignored . after completing the write operations the controller then reads each possible device in the stack to determine which ones are actually present . the reading process begins with a bank activate ( ba ) command to the dram with device id = 00 ( the first device in the stack in this example ) along with address bits specifying bank address 0 and row address 0 ( abbreviated as 0 , 0 in the diagram ). after a period of time allowing the bank activation process to complete , the controller sends a read command ( rd ) to device 0 along with address bits specifying bank address 0 and column address 0 ( abbreviated as 0 , 0 in the diagram ). after a period of time device 0 provides the expected data “ 55 ” and “ aa ” on the data bus . the data bus is a tri - stated bus in some embodiments . if there was no device with device id = 0 the data bus would remain floating and the data read by the controller would be indeterminate . the data pattern “ 55 ” and “ aa ” is used because each bit in the byte changes in the transition from “ 55 ” to “ aa ”. it is highly improbable that a floating data bus could mimic this pattern . a longer and more complex pattern could be used to further reduce the probability of noise mimicking the pattern . if the correct pattern is detected the controller knows the device is present . the controller then continues the read sequence up to the maximum number of device ids supported by the controller or the system . if , for example , any one particular device id does not return the expected data , the controller determines that , assuming n devices are supported , there are n − 1 devices in the stack . in some embodiments , the controller attempts to read data from devices associated with all possible device id numbers , to account for faulty die . if devices higher than a device number that failed to return the expected data are found , the intervening device can be noted as defective so that it will not be used in normal operation . if the wafer fabrication process allows an interrupted tsv , the location of tsvs on the die is not restricted . if the process does not allow breaking the connection between top tsv pad and bottom tsv pad , some embodiments employ an approach based on die rotation . for example a rectangular die will be stacked with alternating 180 ° rotation , although 90 ° rotation may also be possible especially for a square or nearly square die . serial connections will have input tsvs with no top ball , while output tsvs have a top ball . a top pad is optional for an input tsv while the output tsv may or may not include a bottom pad and silicon through hole . the serial input tsv is located 180 ° opposite the serial output equidistant from the chip center of rotation , so that the ball on top of the serial output contacts the bottom pad of the serial input tsv of an upper die when the chips are stacked . the serial input tsv of a lower chip does not make any contact with the chip above . an example of the die layout for the tsv area of a ddr type sdram including two serial tsvs connected through die rotation is illustrated in fig1 . the tsv area is in the center of the chip , with banks of memory located on either side . in the example architecture of fig1 , two series tsv connections s 0 and s 1 are provided . the outputs denoted by the suffix “ o ” have a top ball as indicated by the solid fill circle . the inputs denoted by the suffix “ i ” have no top ball as indicated by the outline circle . these two series tsv connections can support any of the above - described chip id assignment techniques . alternatively , additional series tsv connections could be provided to support higher numbers of chip ids in the case of the staggered tsv approach ( fig3 and 4 ) or the binary adder approach ( fig6 ). for the counter ( fig7 and 8 ) or serial protocol ( fig9 and 10 ) approaches , the required parallel distributed control signals such as clock and reset can be shared with the normal memory signals or provided by dedicated stacks of uninterrupted tsvs . the remainder of the tsvs in fig1 represent a synchronous ddr sdram type interface with 32 dq pins and a dqs / dqs pair per byte . since the functionality of each dq pin is interchangeable the alternating chip rotation poses no problem . dq0 on one die is connected to dq31 on the next die , but each die will access the same bit for both reads and writes . likewise there are 2 bank address bits ba , 10 multiplexed row / column address bits rca , and 8 row address only bits ra . bits within these groups are also interchangeable . there are also a number of unique signals whose functions are not interchangeable including reset ( r ), clk , clk , ras , cas , and we . these signals are duplicated in opposite vertical tsv connections . in some embodiments , the controller drives both vertical tsvs corresponding to the same function with identical signals . each die receives the signal on one of the tsvs and can ignore the other . in some embodiments , the tsvs are shorted together on each die and the controller only drives a single signal . this approach increases the loading and may limit the number of chips that can be stacked for a given frequency of operation . in some embodiments , series connected tsvs are used for each of the aforementioned unique signals . this still requires two tsvs on each die . but the controller only drives a single signal . loading is of course higher because of the two tsvs and the connection between them on each die . also included in the fig1 architecture are four device id address bits designated as dia - did . with each command the controller provides a 4 - bit device id supporting a stack of up to 16 devices in this example . only the device with a device id ( e . g ., assigned by one of the techniques described above ) that matches the bits dia - did will execute the command . the di bits could have been duplicated in the same way as the dram control signals but this would have required a total of 8 tsvs . instead , di bit assignment is based on chip id assignment . for even number chip id , dia , dib , dic , and did inputs are assigned to internal on - chip signals di0 , di1 , di2 , and di3 , respectively . for odd number chip id devices , representing chips rotated 180 ° with respect to the even number chip id devices , the dia , dib , dic , and did inputs are assigned to di3 , di2 , di1 , and di0 , respectively . a simple multiplexer circuit controlled by the least significant bit of the on - chip device id register is used to provide the internal di0 , di1 , di2 , and di3 signals based on the tsv inputs dia , dib , dic , and did . since device ids must be assigned before any mission mode dram operations occur , this approach can save tsvs . other dram pins such as ras and cas * could also be paired and assigned based on device id . only pins such as reset ( r ) and clk / clk , which are used in device id assignment , need be duplicated or connected serially . when a large number of stacked devices is to be supported , the loading on the parallel connected address , command , and data busses can limit the maximum operation frequency . in this case it is advantageous to use a serial point - to - point interface including suitable registered logic 141 , as shown in fig1 . since each device only has to drive the adjacent device , loading is significantly reduced allowing higher speed operation . a unidirectional output bus from the controller provides commands , addresses , and write data to the first device in the stack . this bus could be a single bit bus , a byte - wide bus or another width . a clock is provided by the controller . this could be a single ended clock or a differential clock . clocking could be sdr or ddr . the clock may be center aligned with the command / address / write data bus or it may be edge aligned . the clock can be regenerated in each device in the stack as shown or it could be bussed in parallel to some or all of the devices in the stack . a command strobe cs having functionality similar to the serial packet based chip id assignment bus is also included . the controller also provides a reset signal which can be regenerated in each device in the stack as shown or bussed in parallel to some or all of the devices in the stack . read data is returned to the controller on a unidirectional read data bus . a device providing read data on this downstream bus will also assert a downstream data strobe ds to delineate the read data burst so that lower devices will recognize the data and pass it on towards the controller . typically each device adds a full clock cycle latency in both upstream and downstream paths . the controller will therefore expect each level of the stack to provide read data two full clock cycles later than the next lower level . in the configuration shown in fig1 , the devices respond to a read command by driving read data on the downstream bus with a fixed latency from the read command . in some embodiments , the controller provides an upstream data strobe to the memory stack to indicate when read data is to be placed on the downstream read data bus . this allows read and write data transfers to be controlled independently and to occur simultaneously . on power up the controller can initialize device id using the upstream command / address / write data bus in the same way described above for serial packet based chip id assignment . the controller can then issue write and read commands as described above for the architecture of fig1 . table 4 shows a sequence of commands for writing and then reading a 2 - byte pattern “ 55 , aa ” to / from locations in memory . for simplicity a single command is shown although for dram two steps may be required including first a bank activation command and then a write or a read command . similarly for a nand flash device a page read followed by a burst read command for reads or a data load followed by a page program for writes may be required . in table 4 , the simplified single read command is encoded as ‘ 00000000 ” and the simplified single write command is encoded as ‘ 00000001 ’. following the sequence of operations in table 4 , the controller will determine how many devices are in the stack . some embodiments prevent garbage from being returned to the controller when no device is being read . in some embodiments , the controller may write to a register in the last device in the stack to disable downstream inputs from a non - existent device higher in the stack . only a device addressed with a read command will assert the data strobe ds . lower devices can simply pass on received read data and strobe without any further gating . in some embodiments , every device in the stack monitors read commands to determine which device will be placing data on the downstream read data path . only devices lower in the stack will enable the downstream read data path inputs when read data from a higher device is expected . to accomplish this with the correct timing a device will have to determine from the device id in the command whether the addressed device is higher or lower in the stack . if it is lower , the path can be continuously disabled . if it is higher , the device subtracts its own device id from the device id in the command , and then multiplies the result by two to determine the additional latency ( the number of additional clock cycles of delay between the received command and the actual read data ) appearing at its own read data input . the total latency is determined by adding to the calculated additional latency the fixed latency from read command to read data or , if an upstream data strobe is provided , by adding to the calculated additional latency the fixed latency from upstream data strobe to read data . if each device in the stack and the controller performs this operation , the downstream data strobe ds is not required . assuming the controller only sends commands to device ids physically present in the stack , the upper device will only send read data downstream when it is addressed itself . there is the potential that a faulty tsv connection could prevent the chip id from being properly assigned . in general the number of tsvs dedicated to chip id assignment will be low compared to the number of tsvs dedicated to address , data , and control . many hundreds and possibly 1000 &# 39 ; s of tsvs are expected in some applications . chip id assignment may require as few as 3 tsvs . therefore the relative cost of providing redundant chip id assignment tsvs is not great , so general error correction codes such as hamming codes are applied in some embodiments to solve the problem of faulty tsvs . fig1 diagrammatically illustrates ⅔ voting logic according to example embodiments of the present work . three separate tsv inputs , designated as ina , inb , and inc , provide three paths for the same digital data . in the absence of any errors all three tsv inputs will have the same logic level at any given time . if all three tsv inputs are logic 0 , then nand gates 151 - 153 all output logic 1 , and nand gate 154 outputs logic 0 . if all three tsv inputs are logic 1 , then nand gates 151 - 153 all output logic 0 , and nand gate 154 outputs logic 1 . however , if any one of the tsv inputs is faulty ( e . g ., due to faulty tsv connection from the previous die ), the ⅔ voting logic corrects the error . for example , a faulty tsv connection may cause one tsv input to be shorted to the substrate and held to vss , i . e ., a logic 0 level . with the other two tsv inputs at a logic 1 level , one of the nand gates 151 - 153 will have logic 1 on both inputs , so its output will be logic 0 . this provides a logic 0 input to nand gate 154 , causing it to output logic 1 . on the other hand , if two of the tsv inputs are logic 0 and the third tsv input is faulty at logic 1 , then nand gates 151 - 153 will all output logic 1 to nand gate 154 , causing it to output logic 0 . the fault - corrected level output by nand gate 154 may be used internally and also provided to three separate tsv outputs , designated as outa , outb , and outc , which are provided to the next die in the stack . thus any signal connection , including a clock signal connection , may be immunized from a single faulty tsv . for wider data fields a more efficient hamming error correction may be employed . if , for example , each chip is connected in parallel to unidirectional device id , address , and command busses , and bidirectional data busses through vertical tsv connections as shown in fig1 , the device id must be error free . some embodiments therefore apply voting logic or other hardware error correction to the device id bus . after assignment of chip ids through serial packet based chip id assignment , the serial packet interface can be used to send other diagnostic commands . in particular it is desirable to test address and command busses to ensure that there are no faulty tsvs in these paths . some embodiments provide additional serial commands , e . g ., ‘ 10000001 ’ and ‘ 10000010 ’ as shown in the table 5 , to each device in the stack , instructing the devices to receive data on the address and command busses and output the data on the databus . since the databus is typically much wider than the address and command busses , each address and command bit can be sent to multiple databus pins . if a data pattern identical to the pattern provided on an individual address or control bit appears on at least one databus bit , then that address or control bit input to the addressed chip is working . in the case of a synchronous interface this method can also be applied to the clock input . if the address or control bit input is shown to function properly for one or more databus bits , but one or more other databus bits associated with the address or control bit input do not output the pattern , then those databus bits are faulty . commands ‘ 10000001 ’ and ‘ 10000010 ’ are persistent so they must be cleared with command ‘ 10000000 ’ after the test is complete . finally , each chip in the stack should be tested for write data input . this can be accomplished over the normal address , command , and data busses after verifying address and command input and data output in the preceding steps . normal data writes followed by data reads can be performed . if there is a difference between data written and data read , it must be the result of a faulty data input buffer since the paths necessary for reading data have already been verified . some embodiments provide redundant address , control , and data bus tsvs so that faulty tsvs can be disabled and replaced by redundant tsvs . this is controlled in some embodiments by commands sent over the serial packet interface of fig9 and 10 . some embodiments write the location of a defective bus bit to a repair index register , so the defective bit can be tagged to be bypassed . for example , with an n bit address bus , if address bit 4 is defective , a skip address bit command ‘ 10000110 ″ with data field “ 00000100 ” ( see table 5 ) would be issued . after this command is executed and the value is written to the repair index register , address inputs 0 - 3 will be provided by tsvs 0 - 3 , tsv 4 will be bypassed , and address bits 4 -( n − 2 ) will be provided by tsv 5 -( n − 1 ), while address bit ( n − 1 ) will be provided by a spare tsv . rather than providing a single spare tsv for an entire bus , various embodiments assign to each of a plurality of subsets of the bus one or more spare tsvs . all applicable skip address bit commands are provided to all chips in the stack so that all chips will ultimately use an identical tsv configuration . in some embodiments , the controller and the chips in the stack leave all unused and faulty tsvs floating so that no power is wasted if the fault is due to a short circuit . a ) a substantially planar die having a top surface and a bottom surface ; b ) a plurality of metal interconnect layers separated by insulating layers disposed on the top surface of the die including a top metal layer and a bottom metal layer ; c ) a through silicon via ( tsv ) extending from the bottom surface of the die to a metal layer lower than the top metal layer and electrically contacting the metal layer lower than the top metal layer ; d ) a bottom metal pad disposed on the bottom surface of the die and electrically contacting the through silicon via ; and e ) a top metal pad formed above the through silicon via by a metal interconnect layer higher than the metal layer lower than the top metal layer . in some embodiments , the top metal pad is formed by the top metal layer . in some embodiments , the metal layer lower than the top metal layer is the bottom metal layer . in some embodiments , a solder ball is attached to the top metal pad . in some embodiments , the bottom metal pad is connected to a circuit input . in some embodiments the top metal pad is connected to a circuit output . some embodiments include one or more through silicon vias , top metal pads , and bottom metal pads substantially identical to the through silicon via , the top metal pad , and the bottom metal pad . some embodiments include a direct vertical connection having a bottom metal pad disposed on the bottom surface of the die , a top metal pad formed by a metal interconnect layer higher than the metal layer lower than the top metal layer , and a through silicon via extending from the bottom metal pad to the top metal pad . some embodiments provide a plurality of semiconductor devices assembled in a stack , each device including ; a ) a substantially planar die having a top surface and a bottom surface ; b ) a plurality of metal interconnect layers separated by insulating layers disposed on the top surface of the die including a top metal layer and a bottom metal layer ; c ) a through silicon via ( tsv ) extending from the bottom surface of the die to a metal layer lower than the top metal layer and electrically contacting the metal layer lower than the top metal layer ; d ) a bottom metal pad disposed on the bottom surface of the die and electrically contacting the through silicon via ; and e ) a top metal pad formed above the through silicon via by a metal interconnect layer higher than the metal layer lower than the top metal layer ; where adjacent devices in the stack are connected from the top metal pad of one device to the bottom metal pad of another device . in some embodiments , adjacent devices are connected by a solder ball . in some embodiments , the devices are identical . some embodiments provide a substantially planar semiconductor device including a plurality of through silicon vias ( tsvs ) each having a bottom pad , a top pad , and a through hole filled with conductive material electrically connecting the top pad and the bottom pad , where a ) a first tsv and a second tsv are located equidistant from an axis of rotation perpendicular to the plane of the semiconductor device and separated by an angle of rotation ; b ) a third tsv and a fourth tsv are located equidistant from the axis of rotation and separated by the angle of rotation , the third tsv being electrically connected to the second tsv ; and c ) a fifth tsv and a sixth tsv are located equidistant from the axis of rotation and separated by the angle of rotation , the fifth tsv electrically connected to the fourth tsv ; where the semiconductor device further includes a chip id circuit connected to the fourth tsv and the sixth tsv . in some embodiments , the angle of rotation is 180 °. some embodiments include a solder ball attached to the top pad of each of the first , second , third , and fifth tsvs . some embodiments provide three or more substantially planar semiconductor devices assembled in a stack , each device including a plurality of through silicon vias ( tsvs ) each having a bottom pad , a top pad , and a through hole filled with conductive material electrically connecting the top pad and the bottom pad , where each device includes ; a ) a first tsv and a second tsv are located equidistant and opposite an axis of rotation perpendicular to the plane of the semiconductor device ; b ) a third tsv and a fourth tsv are located equidistant and opposite the axis of rotation , the third tsv being electrically connected to the second tsv ; c ) a fifth tsv and a sixth tsv are located equidistant and opposite the axis of rotation , the fifth tsv electrically connected to the fourth tsv ; d ) the bottom pads of first and second tsvs of a first device on the bottom of the stack are connected to a first logic level , and the bottom pads of fourth and sixth tsvs of the first device are connected to a second logic level opposite the first logic level ; e ) the bottom pads of first , second , fourth , and sixth tsvs of a second device rotated and placed on top of the first device are connected with solder balls to second , first , third and fifth top pads respectively of the first device ; and f ) the bottom pads of first , second , fourth , and sixth tsvs of a third device having the same orientation as the first device and placed on top of the second device are connected with solder balls to second , first , third and fifth top pads respectively of the second device . some embodiments provide a method of establishing device ids in a stack of semiconductor devices including the steps of ; a ) providing logic levels to a first plurality of serial through silicon via ( tsv ) inputs on a first device in a stack ; b ) within the first device , receiving the logic levels on the first plurality of tsv inputs , scrambling the received logic levels , and providing the scrambled received logic levels to a first plurality of tsv outputs connected to a first plurality of serial tsv inputs on a second device in the stack ; c ) within the second device , receiving the logic levels on the first plurality of tsv inputs , scrambling the received logic levels , and providing the scrambled received logic levels to a first plurality of tsv outputs connected to a first plurality of serial tsv inputs on a third device in the stack ; d ) within the third device , receiving the logic levels on the first plurality of tsv inputs ; and e ) using the received logic levels in each of the first , second , and third devices to provide a device id . in some embodiments , the first , second , and third devices are identical . in some embodiments , the serial tsv outputs on each of the devices are located on the same axis perpendicular to the surface of the device as the corresponding tsv inputs . in some embodiments , the serial tsv outputs are located on an axis perpendicular to the surface of the device rotated 180 ° about the center of the device from an axis perpendicular to the surface of the device of the corresponding tsv inputs . in some embodiments , the scrambling includes connecting a logic level received on a first serial tsv input to a second serial tsv output and connecting a logic level received on a second serial tsv input to a third serial tsv output . in some embodiments , the serial tsv inputs are directly connected to serial tsv outputs within each device . in some embodiments , received logic levels in each of the first , second , and third devices are encoded to provide a device id . some embodiments provide a method of establishing device ids in a stack of semiconductor devices including the steps of ; a ) providing encoded logic levels to a first plurality of serial through silicon via ( tsv ) inputs on a first device in a stack ; b ) within the first device , receiving the encoded logic levels on the first plurality of serial tsv inputs , adding a fixed parameter to the encoded logic levels and providing the resulting logic levels to a first plurality of tsv outputs connected to a first plurality of serial tsv inputs on a second device in the stack ; c ) within the second device , receiving the encoded logic levels on the first plurality of serial tsv inputs , adding a fixed parameter to the encoded logic levels and providing the resulting logic levels to a first plurality of serial tsv outputs connected to a first plurality of serial tsv inputs on a third device in the stack ; d ) within the third device , receiving the logic levels on the first plurality of serial tsv inputs ; and e ) using the received logic levels in each of the first , second , and third devices to provide a device id . in some embodiments , the fixed parameter is 1 . in some embodiments , the first , second , and third devices are identical . in some embodiments , the serial tsv inputs and serial tsv outputs are located on opposite sides of the devices on common axes perpendicular to the plane of the devices . in some embodiments , the serial tsv outputs are located on an axis perpendicular to the surface of the devices rotated 180 ° about the center of the devices from an axis perpendicular to the surface of the device of the corresponding tsv inputs . some embodiments provide a method of establishing a device id within a semiconductor device including the steps of ; a ) resetting a counter ; b ) asserting a counter enable signal to a next device ; c ) receiving a counter enable signal from a previous device ; d ) incrementing the counter on edges of a clock signal while the counter enable signal from a previous device is asserted ; e ) de - asserting the counter enable signal to a next device following an edge of the clock signal that occurs when the counter enable signal from a previous device is de - asserted ; f ) providing a counter output as the device id . in some embodiments , the edges of the clock are rising edges of the clock . in some embodiments , the counter enable signal to a next device is provided by a flip - flop . some embodiments provide a semiconductor memory device configured for interconnection within a stack of devices including ; a ) a plurality of pairs of databus terminals , each pair having a first terminal on a first surface of the device and a second terminal on a second surface of the device opposite the first surface , the first and second terminals electrically connected by a through silicon via ( tsv ); b ) a plurality of pairs of control terminals , each pair having a first terminal on the first surface of the device and a second terminal on the second surface of the device , the first and second terminals electrically connected by a through silicon via ( tsv ); c ) a plurality of pairs of serial terminals , each pair having a first terminal on the first surface of the device and a second terminal on the second surface of the device , the first terminal electrically connected to a through silicon vias ( tsvs ); d ) a plurality of data output buffers electrically connected to the databus terminals ; e ) a plurality of data input buffers electrically connected to the databus terminals ; f ) a control circuit electrically connected to the control terminals g ) a device id circuit having inputs electrically connected to a selected terminal of each pair of serial terminals , and outputs electrically connected to a terminal other than the selected terminal of each pair of serial terminals . in some embodiments , the first terminal and the second terminal of each pair of serial terminals and are located on a common axis substantially perpendicular to the first surface and the second surface . in some embodiments , the first terminal of each pair of serial terminals is located on an axis rotated 180 ° about an axis perpendicular to the first surface and the second surface of the devices through the center of the device from an axis perpendicular to the first surface and the second surface of the devices passing through the second terminal of each pair of serial terminals . in some embodiments , the device id circuit comprises an adder . in some embodiments , the device id circuit comprises a counter . in some embodiments , the device id circuit comprises a serial command packet decoder . in some embodiments , the inputs of the device id circuit are electrically connected to the first terminal of the plurality of pairs of serial terminals . some embodiments provide a semiconductor memory device configured for interconnection within a stack of devices including ; a ) a plurality of pairs of upstream serial terminals , each pair having a first terminal on the first surface of the device and a second terminal on the second surface of the device , the first terminal electrically connected to a through silicon via ( tsv ); b ) a plurality of pairs of downstream serial terminals , each pair having a first terminal on the first surface of the device and a second terminal on the second surface of the device , the first terminal electrically connected to a through silicon via ( tsv ); c ) a plurality of command input buffers electrically connected to a selected terminal of each pair of upstream serial terminals and a plurality of command output buffers electrically connected to a terminal other than the selected terminal of each pair of upstream serial terminals ; d ) a plurality of data input buffers electrically connected to a selected terminal of each pair of downstream serial terminals and a plurality of data output buffers electrically connected to a terminal other than the selected terminal of each pair of downstream serial terminals ; e ) a control circuit electrically connected to the plurality of command input buffers ; f ) a device id circuit electrically connected to the plurality of command input buffers ; g ) a data input buffer disable circuit connected the plurality of data input buffers . in some embodiments , the first terminal and the second terminal of each pair of upstream and downstream serial terminals and are located on a common axis substantially perpendicular to the first surface and the second surface . in some embodiments , the first terminal of each pair of upstream and downstream serial terminals is located on an axis rotated 180 ° about an axis perpendicular to the first surface and the second surface of the devices through the center of the device from an axis perpendicular to the first surface and the second surface of the devices passing through the second terminal of each pair of upstream and downstream serial terminals . in some embodiments , the data input buffer disable circuit comprises a register that is set to indicate the last memory device in a stack of memory devices and disable the plurality of data input buffers . in some embodiments , the data input buffer disable circuit compares a target device address within a command received by the control circuit with a device id provided by the device id circuit to selectively disable the plurality of data input buffers . in some embodiments , the plurality of data input buffers are disabled when the target device address is upstream of the device . some embodiments provide a method of selecting a semiconductor device in a stack of semiconductor devices including the steps of : a ) providing logic levels to a first plurality of serial through silicon via ( tsv ) inputs on a first device in a stack ; b ) within the first device , receiving the logic levels on the first plurality of tsv inputs , scrambling the received logic levels , and providing the scrambled received logic levels to a first plurality of tsv outputs connected to a first plurality of serial tsv inputs on a second device in the stack ; c ) within the second device , receiving the logic levels on the first plurality of tsv inputs , scrambling the received logic levels , and providing the scrambled received logic levels to a first plurality of tsv outputs connected to a first plurality of serial tsv inputs on a third device in the stack ; d ) within the third device , receiving the logic levels on the first plurality of tsv inputs ; and e ) using the received logic levels in each of the first , second , and third devices to select one of the first , second , or third devices . in some embodiments , the first , second , and third devices are identical . in some embodiments , the serial tsv outputs on each of the devices are located on the same axis perpendicular to the surface of the device as the corresponding tsv inputs . in some embodiments , the serial tsv outputs are located on an axis perpendicular to the surface of the device rotated 180 ° about the center of the device from an axis perpendicular to the surface of device of the corresponding tsv inputs . in some embodiments , the scrambling includes connecting a logic level received on a first serial tsv input to a second serial tsv output and connecting a logic level received on a second serial tsv input to a third serial tsv output . in some embodiments , the scrambling includes connecting a logic level received on a first serial tsv input to a second serial tsv output and connecting a logic level received on a second serial tsv input to a third serial tsv output , the first serial tsv input of the first device receives a first logic level and the second serial tsv input of the first device receives a second logic level opposite the first logic level . in some embodiments , the scrambling includes connecting a logic level received on a first serial tsv input to a second serial tsv output and connecting a logic level received on a second serial tsv input to a third serial tsv output , the first serial tsv input of the first device receives a first logic level , the second serial tsv input of the first device receives a second logic level opposite the first logic level , and the received logic levels in each of the first , second , and third devices are scrambled to form a thermometer code . in some embodiments , the serial tsv inputs are directly connected to serial tsv outputs within each device . in some embodiments , received logic levels in each of the first , second , and third devices represent the position of the device in a stack of devices . in some embodiments , received logic levels in each of the first , second , and third devices represent the position of the device in a stack of devices , and are encoded to provide a device id . in some embodiments , received logic levels in each of the first , second , and third devices represent the position of the device in a stack of devices , a command including a device address is provided , and the device address is compared to the logic levels within each of the first , second , and third devices to determine which device should execute the command . in some embodiments , received logic levels in each of the first , second , and third devices represent the position of the device in a stack of devices , a command including a device address is provided , and the device address is compared to the logic levels within each of the first , second , and third devices to determine which device should execute the command , and only a single device executes the command . although example embodiments of the invention have been described above in detail , this does not limit the scope of the invention , which can be practiced in a variety of embodiments .	7
referring to the drawing , there is illustrated a television receiver including a uhf tuning circuit 10 according to the present invention , uhf tuning circuit 10 being adapted for tuning television channels 14 - 83 transmitted within the uhf band of frequencies extending between 470 and 890 mhz . the television receiver includes a conventional channel selector 12 operable by the viewer for identifying a selected uhf television channel , channel selector 12 in turn operating a tuning voltage generator 14 for developing an output tuning voltage signal v t representing the selected uhf channel . the tuning voltage signal v t is coupled to the input of an rf amplifier and filter stage 16 and also through a resistor 18 to the junction formed between a varactor diode 20 and a capacitor 22 . the series combination of varactor diode 20 and capacitor 22 are connected in parallel with a uhf resonant line 24 so as to form a resonant circuit 26 resonant at the frequency of the rf video carrier of the selected uhf channel in response to the tuning voltage signal v t . rf amplifier and filter stage 16 , which is capacitively coupled to resonant circuit 26 by a capacitor 28 , includes a number of similar resonant circuits such that only the selected uhf television signal is coupled from a receiving antenna 30 to resonant circuit 26 . the rf signal developed by resonant circuit 26 is magnetically coupled from uhf resonant line 24 to a second uhf resonant line 32 forming together with a varactor diode 34 and a capacitor 36 a further resonant circuit 38 . the output of resonant circuit 38 , which is also tuned to the rf video carrier of the selected television channel by means of a resistor 40 connected to the output of tuning voltage generator 14 , is coupled by a capacitor 42 to a first input gate electrode g1 of a mixer dual gate mosfet 44 . mosfet 44 may comprise , for example , part number bf960 manufactured by siemens ag . the second gate g2 of mosfet 44 is connected to a source of biasing potential b + through a resistor 46 and also to ground potential through the parallel combination of a bypass capacitor 48 and a resistor 50 . biasing potential b + is additionally connected through a pair of resistors 52 and 54 and a capacitor 55 to ground potential and also through a resistor 56 , a choke 58 and an inductor 60 to the drain of mosfet 44 , the junctions formed between inductor 60 and choke 58 and the drain of mosfet 44 being coupled to ground by capacitors 62 and 64 respectively . the source of mosfet 44 is connected to ground by the parallel combination of a bypass capacitor 66 and a resistor 68 . as explained in the previously mentioned patent , mosfet 44 exhibits a relatively large parasitic capacitance , represented by dotted line capacitance 70 which , especially at the low end of the uhf band , contributes to an impedance mismatch between the input of the mosfet and resonant circuit 38 reducing the conversion gain of the mosfet at these frequencies when used as a mixer . in order to overcome this problem a peaking inductor 72 is connected between capacitor 55 and gate g1 of mosfet 44 , peaking inductor 72 and coupling capacitor 42 forming an impedance transformation network for equalizing the conversion gain of mosfet mixer 44 . in particular , conversion gain equalization of mosfet mixer 44 is achieved by selecting capacitor 42 and peaking inductor 72 such that , in conjunction with input parasitic capacitance 70 , a resonant point is established slightly below the uhf range of frequencies , e . g . between 350 - 400 mhz , whereby an approximate impedance match is established over the uhf range . uhf tuning circuit 10 further includes a local oscillator stage 74 comprising a common - base transistor 76 and associated biasing circuitry , the collector of transistor 76 being coupled by a capacitor 78 to a local oscillator resonant circuit 80 . local oscillator resonant circuit 80 comprises a uhf resonant line 82 connected in parallel with the series combination of a varactor diode 84 and a capacitor 86 , the common junction between varactor diode 84 and capacitor 86 being coupled through a resistor 88 to tuning voltage generator 14 . local oscillator resonant circuit 80 is thereby responsive to the tuning voltage v t and cooperative with transistor 76 and its associated biasing circuitry for developing a local oscillator signal in proper relationship with the selected uhf channel for producing fixed intermediate frequency sound and picture carrier signals when heterodyned with the selected rf television signal . in accordance with the present invention , uhf resonant line 82 of local oscillator resonant circuit 80 is disposed in magnetically coupled relation with peaking coil 72 such that the local oscillator signal is magnetically coupled from uhf resonant line 82 to peaking coil 72 and therefrom to gate g1 of mosfet 44 . magnetic loop coupling of the local oscillator signal to the mosfet mixer in this manner results in efficiencies of both circuit fabrication , i . e . a minimum number of components are required to effect the coupling without adding undesirable stray circuit capacitance , and circuit operation , i . e . the achievement of high conversion gain with proper selection of peaking coil inductance , satisfactory tuning range and rf tracking and improved oscillator harmonic suppression at the mixer input as compared to capacitive oscillator coupling . in accordance with the foregoing , mosfet mixer 44 is operative for mixing or beating the rf television signal coupled to its input gate electrode g1 by capacitor 42 with the local oscillator signal derived from peaking coil 72 to produce the sound and picture intermediate frequency signals at its drain electrode . the intermediate frequency signals are subsequently applied through the single tuned intermediate frequency output circuit consisting of inductor 60 and capacitors 62 and 64 and a coupling capacitor 88 to an if stage 90 , the output of if stage 90 being suitable for processing by the video and sound processing circuits 92 and 94 of the receiver . while a particular embodiment of the invention has been shown and described , it will be apparent that changes and modifications may be made therein without departing from the invention in its broader aspects . for example , while the mixer of the present invention is embodied as a dual gate mosfet , it will be appreciated that other field effect transistor devices can also be used . the aim of the appended claims , therefore , is to cover all such changes and modifications as fall within the true spirit and scope of the invention .	7
as previously described , one of the essential features of the present invention is to employ , as the source of the gold in the electroplating bath , a water - soluble gold complex or compound wherein the gold ion is in the trivalent state . the preferred gold material is an alkali metal auricyanide , and the especially preferred gold component is potassium auricyanide . in general , the bath will contain from about 4 to 16 grams per liter , preferably 7 to 12 . 5 grams per liter of the alkali metal auricyanide . in general , the trivalent gold salts will contain from about 52 to 54 %, and preferably from about 53 to about 54 % gold metal . it is important that the alkali metal auricyanide be substantially free of chloride ions . the alloying metal components are ( a ) cobalt inorganic salts such as cobalt sulfate , often in the hydrated form ; and ( b ) molybdenum inorganic salts such as an alkali metal molybdate . in the electroplating systems of the invention , the concentration of the cobalt salt ranges from about 2 to 16 grams per liter , while the alkali metal molybdate concentration ranges from about 1 to 6 grams per liter . in the preferred baths of the invention , the cobalt inorganic salt will range from about 2 . 5 to 9 . 5 grams per liter , while the alkali metal molybdate will range from about 1 . 2 to 3 . 8 grams per liter . the bath matrix or electrolyte preferred for the present invention is citric acid . other acids , such as the carboxylic acids , may also be utilized in concentrations ranging from about 100 to 400 ml / l , and preferably from about 200 to 300 ml / l . according to one of the features of the present invention , minor amounts of an anionic fluorochemical wetting agent or surfactant such as a blend of potassium perfluoroalkyl sulfonates , sold under the trademarks fc - 98 and fc - 95 by the minnesota mining and manufacturing company , may be usefully employed . the amount of wetting agent or surfactant will generally range from about 2 to 15 ml / l , preferably from about 4 to 10 ml / l . fc - 95 and fc - 98 are potassium perfluoroalkyl sulfonates , and their use is generally preferred . both fc - 95 and fc - 98 decompose at 390 ° c . in a 0 . 1 % aqueous solution fc - 95 has a ph of 7 - 8 , while fc - 98 has a ph of 6 - 8 . fc - 98 is slightly less surface active and is capable of producing foam that is less dense and less stable . both types have outstanding chemical and thermal stability , especially in acidic and oxidizing systems . the method of preparing these perfluoroalkyl sulfonates is disclosed in u . s . pat . no . 2 , 519 , 983 to simons ; while a prior art use of such surfactants in electroplating is illustrated by u . s . pat . no . 2 , 740 , 334 to brown . the teachings of these patents are incorporated herein by reference . additionally the baths of this invention will contain a stress reduce - brightener such as organic compounds containing nitrogen and sulfur atoms , for example , alkali metal saccharin , etc . minor amounts of this additive will be employed , with amounts ranging from 25 to 75 mg / l being found quite useful . the ph of the electroplating bath may be within the range of from about 1 to 2 , and preferably from about 1 . 2 to 1 . 5 . current densities will range from 3 . 0 to 7 . 5 asd , preferably from 4 . 6 to 6 . 1 asd . although higher current densities may give a higher alloy concentration , the resulting alloy deposit is more brittle . for most operations , the electroplating bath of this invention will be maintained at a temperature of from about 45 ° to 65 ° c . substrate treatment times will , of course , vary widely depending upon such factors as the type of substrate , the deposit of thickness required , etc . as noted above , the electroplating baths of this invention may be effectively utilized for plating operations both in the electronic as well as in the decorative field . illustrative substrates including brass , copper , copper alloys , steel , stainless steel , as well as other commercial metals and alloys . in most commercial operations it is desirable for the substrate to be precleaned or pretreated before being subjected to electroplating . thus , for example , a metal substrate such as a brass panel may be subjected to a degreasing step using a hot alkaline solution followed by rinsing with deionized water . the panel may then be dipped in hydrochloric or sulfuric acid maintained at elevated temperatures . finally , there may be another rinsing treatment with deionized water . since all of these and other pretreatment or precleaning treatments are well known in the art , the exact procedure employed is not a feature of the present invention . as will be understood by those skilled in the art , the exact electroplating procedure and equipment employed in the practice of the present invention will also vary according to the substrate being treated as well as upon the results desired . the invention will be more fully understood by reference to the following illustrative embodiments . an electroplating bath was prepared from the ingredients set forth below : ______________________________________ingredients amounts ( g / l ) ______________________________________potassium auricyanide 7cobalt sulfate 9sodium molybdate 15citric acid 300sodium saccharin 50 mg / lfc - 98 10 mg / lwater balance______________________________________ the bath had a ph of 1 . 5 and a specific gravity of 16 . 0 ° be . a brass panel was electroplated with vigorous stirring at 50 ° c ., a current density of 4 . 6 asd , and a plating rate of 6 . 7 mg / a - minute . the deposited alloy coating was composed of 1 . 5 % by weight , cobalt , 0 . 2 % by weight molybdenum and the balance gold . the thickness of the bright , grey tinted deposit was about 20 micrometers . it has a hardness of 269 khn . remarkable wear resistance was revealed when the alloy survived crossed - wire wear tests of up to 20 , 000 passes at a deposit thickness of 80 microinches . this wear resistance is determined by using a crossed - wire tester reciprocating at 2 cycles per minute with a 200 gram load . ______________________________________ingredients amounts ( g / l ) ______________________________________potassium auricyanide 10cobalt sulfate 9sodium molybdate 3 . 8citric acid 300sodium saccharin 50 mg / lfc - 98 10 ml / lwater balance______________________________________ this bath also had a ph of 1 . 5 and a specific gravity of 16 ° be . a brass panel was electroplated with vigorous stirring at 50 ° c ., a current density 6 . 1 asd , and a plating rate of 8 . 4 mg / a minute . the deposited alloy was composed of 1 . 8 % by weight cobalt , 0 . 4 % by weight molybdenum , and the balance being gold . it has a hardness of 253 khn . remarkable wear resistance was demonstrated again when the alloy survived crossed - wire wear tests of up to 20 , 000 passes at a deposit thickness of about 80 microinches . an electroplating bath was prepared from the ingrediets set forth below : ______________________________________ingredients amount ( g / l ) ______________________________________potassium auricyanide 12 . 5cobalt sulfate 4 . 7sodium molybdate 1 . 5citric acid 300sodium saccharin 50 mg / lfc - 98 10 ml / lwater balance______________________________________ the ph of this bath was 1 . 2 and the specific gravity was 16 ° be . a brass panel was electroplated with vigorous stirring at 50 ° c ., a current density of 4 . 6 asd , and a plating rate of 8 . 4 mg / a - minute . the deposited alloy was composed of 1 . 0 % by weight of cobalt , 0 . 26 % by weight molybdenum , and the balance gold . it had a hardness of 263 khn . when subjected to the wear resistance test described in example i this alloy also survived up to 20 , 000 passes at a deposit thickness of about 80 microinches . the above data demonstrate that the ternary alloy of this invention , trivalent gold in combination with cobalt and molybdenum , has outstanding wear resistance . it will be further understood that the foregoing examples are illustrative only and that variations and modifications may be made without departing from the scope of the invention .	7
referring now to fig1 and 2 of the drawings , a control device and method for a four - cylinder automotive engine with a cylinder discrimination function according to the first embodiment of this invention is described . a crank shaft 1 and a cam shaft 2 are coupled via a timing belt 3 , such that the cam shaft 2 rotates once for every two rotations of the crank shaft 1 . each one of the four cylinders is provided with an ignition circuit comprising a power transistor 31 , an ignition coil 32 , and a spark plug 33 . ( referr to fig5 ; fig1 shows only one of the ignition circuits of the four cylinders ). a reference position sensor 11 , consisting of a proximity sensor , etc ., is disposed at the crank shaft 1 to generate a reference position signal l once for every half rotation ( 180 degrees ) and for every one rotation ( 360 degrees ) of the crank shaft 1 , such that the electrical control unit 40 can discriminate , on the basis of the signal l , the group of two cylinders ( e . g ., cylinders no . 1 and no . 4 , or the cylinders no . 2 and no . 3 ) which are currently in the compression and the exhaust stroke . thus , the sensor 11 constitutes ( together with the program stored in the electrical control unit 40 , as described hereinbelow ) the cylinder group discriminating means according to this invention . the electrical control unit ( ecu ) 40 , consisting of a microcomputer , controls , as described in detail hereinbelow , the ignition timings of respective cylinders , by turning on the power transistor 31 of the ignition coil 32 so as to generate a spark across the ignition plug 33 of each cylinder at the precise moment . the ionization current detector 41 , constituting ( together with the program stored in the microcomputer 40 ) the cylinder discriminating means according to this invention , comprises : a serial circuit ( connected across the ground and the non - grounded side of the spark plug 33 ) consisting of a dc voltage source e constituting the ionization current source , and of a resistor r1 ; and a voltage divider , coupled in parallel with the serial circuit of the voltage source e and resistor r1 , consisting of resistors r2 and r3 , whose junction point constitutes the output terminal of the ionization current detector 41 from which the output signal v i is outputted to the electrical control unit 40 . a diode d1 for preventing reverse current is inserted between the spark plug 33 and the secondary side of the ignition coil 32 . further , another diode d2 for preventing reverse current is inserted between the non - grounded side of the spark plug 33 and the junction point of the resistors r1 and r2 . the ionization current detector 41 may be provided for the spark plug 33 of one cylinder only ( e . g ., the cylinder no . 1 ), or for each one of the spark plugs 33 of all the four cylinders . the ionization current i flows through the ionization current detector 41 only when the ignition voltage is supplied to the associated cylinder when it is in the compression stroke . thus , as described in detail hereinbelow , the electrical control unit 40 can discriminate , from among the group of two cylinders currently in the compression or the exhaust stroke which are discriminated by the reference position signal l of the reference position sensor 11 , the cylinder in the compression stroke on the basis of the output signal v i of the ionization current detector 41 . next , the ignition control operation of the device of fig1 is described by reference to fig2 which shows the flowchart of the cylinder discriminating interrupt routine of the microcomputer 40 . first , at the initialization step s1 , the counter cnt representing the number of successive ionization current detections and the flag f representing the establishment of the cylinder discrimination are initialized , i . e ., are set to 0 ( zero ). further , the predetermined number n which serves , as described below , as the reference number for the establishment of the cylinder discrimination is set . next , at step s2 , the flag f is referenced so as to judge whether the cylinder discrimination is established already ( i . e ., f = 1 ) or not . in the initialized state , the cylinder discrimination is not yet established and hence f = 0 , so that the execution proceeds to step s3 , where it is judged whether the discrimination of the compression stroke is possible or not on the basis of the output v i of the ionization current detector 41 , which represents the presence of the ionization current i with respect to the cylinder associated with the ionization current detector 41 . for some length of time after the initialization , the four cylinders are under the simultaneous ignition control . namely , the fuel injection is effected in all the cylinders and the group of cylinders ( e . g ., the cylinders no . 1 and no . 4 ) having a phase difference of 180 degrees ( i . e ., 360 degrees with respect to the crank angle ) which are currently in the compression and the exhaust stroke are ignited simultaneously . that is , the reference position sensor 11 generates the reference position signals l for every one half rotation ( 180 degrees ) and for every one rotation ( 360 degrees ) of the crank shaft 1 , and the electrical control unit ( microcomputer ) 40 discriminates , in response to this signal l , the group of two cylinders which are in the compression and the exhaust stroke , such that the cylinders of the discriminated group may be ignited simultaneously . if the ignited cylinder is in the compression stroke , the explosion ( combustion ) takes place upon discharge across the spark plug 33 , such that multitude of ions are generated across the spark plug 33 . on the other hand , if the ignited cylinder is in the exhaust stroke , the explosion does not take place in the cylinder of the ignition plug , so that hardly any ions are generated thereacross . the ionization current detector 41 detects the ionization current i which flows from the dc voltage source e thereof and across the ignition plug 33 . it outputs the voltage v i ( corresponding to the ionization current i ) from the junction between the resistors r2 and r3 of the voltage divider thereof . thus , if the inputted voltage v i is less than a predetermined threshold value , the electrical control unit 40 judges at step s3 that the discrimination of the compression stroke is impossible , and proceeds to step s4 , where the counter cnt is decremented by one . however , the value of the counter cnt is clipped at the minimum 0 , such that it does not take a negative value . on the other hand , if the voltage v i is above the threshold value , the microcomputer 40 determines at step s3 that the cylinder in question is in the compression stroke , and proceeds to step s5 where the counter cnt is incremented . however , the value of the counter cnt is clipped at the maximum number n such that it does not exceed the predetermined number n whose value is set at the initialization step s1 . at the step s6 subsequent to the decrement or increment of the counter cnt at step s4 or s5 , it is judged whether the counter cnt is equal to the predetermined number n . if the counter cnt is not yet equal to the number n , the execution proceeds to the next step s7 so as to effect the simultaneous ignition control , as described above , and returns thereafter to step s2 . on the other hand , if the counter cnt has reached the predetermined number n at step s6 , the execution proceeds to step s8 where the flag f is set ( f ← 1 ), and returns thereafter to step s2 . thus , the flag f is set ( f ← 1 ) only when the compression strokes are discriminated successively for predetermined number n , such that the erroneous setting of the cylinder discriminator flag f is prevented , thereby enhancing the reliability of the cylinder discrimination . after a number of cylinder discrimination cycles as described above , the cylinder discriminator flag f is finally set after some time after the initialization . then , the establishment of the cylinder discrimination ( i . e ., f = 1 ) is determined at step s2 , and the execution proceeds therefrom to step s9 where the independent ignition is effected , thereby terminating the cylinder discrimination interrupt routine of fig2 . the independent ignition control at step s9 is effected as follows . on the basis of the output signal v i of the ionization current detector 41 , the microcomputer 40 discriminates , from among the group of cylinders in the compression and the exhaust stroke discriminated on the basis of the signal l from the position sensor 11 , the cylinder in the compression stroke , and outputs the driving signal corresponding thereto to the power transistors 31 . thus , the driving signal is outputted only to the power transistor 31 of the cylinders which are near the end of the compression stroke . thus , according to this invention , simultaneous ignition control is effected at step s7 until the cylinder discrimination on the basis of the detection of the ionization current i is established ; and the independent ignition control is effected at step s9 after the cylinder discrimination is established . the discrimination of the group of cylinders in the compression and the exhaust stroke is effected on the basis of the output l of the reference position sensor 11 . on the other hand , the discrimination of the cylinder in the compression stroke is effected on the basis of the output v i of the ionization current detector 41 , which thus performs the function of the cylinder discrimination sensor 10 of the conventional control device of fig5 . thus , according to this invention , the independent ignition control , which does not dissipate electric power uselessly , can be effected by means of a simple sensor organization which does not uttilize the cylinder discrimination sensor 10 of the conventional control device . on the other hand , if the system according to this invention is utilized together with the cylinder discrimination sensor 10 shown in fig5 for example , the erroneous discrimination of the cylinders can be prevented with further enhanced certainty , and hence a highly reliable ignition control is realized . it goes without saying that although the above embodiment relates to the ignition control only , this invention is applicable to the fuel injection control as well . in the case of the fuel injection control , simultaneous injection to all the cylinders is effected during the time when the cylinder discrimination is not yet established after the initialization . sequential injection for respective cylinders ( i . e ., successive fuel injection for the cylinders in the compression stroke ) is effected after the establishment of the cylinder discrimination . further , the above embodiment can be subjected to a variety of modifications . for example , although the ionization current i during the simultaneous ignition control is detected in the above embodiment for the purpose of discriminating the cylinder in the compression stroke ( i . e ., the cylinder which are about to enter into the combustion stroke ), inner pressures of cylinders may be detected instead of the ionization current i for the same purpose , by means of pressure sensors disposed within the cylinders . in such case , the cylinder which exhibits a pressure level above a predetermined level at top dead center ( tdc ) is discriminated to be in the compression stroke . furthermore , as shown in fig3 the cylinder discriminating means according to this invention may consist of a ignition voltage waveform detector 42 , instead of the ionization current detector 41 . in such case , the ignition voltage waveform detector 42 detects the waveform of the ignition voltage across the ignition plug 33 , i . e ., the waveform w of the secondary side voltage of the ignition coil 32 . in fig3 serial circuit of a diode d3 for preventing the reverse current , a load resistor r4 , and a waverform detector 42 , is connected across the non - grounded side of the ignition plug 33 and an input to the microcomputer 40 . a frequency filter ( i . e ., a high pass filter ) 43 may be inserted between the waveform detector 42 and the input to the microcomputer 40 . the method of operation of the circuit of fig3 is as follows . fig4 shows the secondary side voltage waveforms w of the ignition coil 32 when an ignition is effected . when the associated cylinder is in the exhaust stroke , there appears in the waveform w a small peak at the initial stage of the discharge , the waveform remaining smooth thereafter ( the waveform at the top in fig4 ). on the other hand , when the associated cylinder is in the compression stroke , there appears a high peak at the initial stage of the discharge , to be followed by an irregular waveform consisting of high frequency components resulting from the combustion and explosion in the cylinder ( the waveform at the bottom ). if the cylinder discrimination is effected solely on the basis of the peak level of the secondary side voltage waveform w , the frequency filter 43 can be dispensed with , since the initial peak waveform level is sufficient for the cylinder discrimination . however , in the case where the cylinder discrimination is effected on the basis of the integral of secondary voltage waveform w , it is preferred that the frequency filter 43 is inserted . if the integral of the secondary voltage waveform w is utilized for the cylinder discrimination , the higher frequency components subsequent to the initial peak are also detected , and the reliability of the discrimination of the cylinder in the compression stroke can thus be further enhanced . in the case of the embodiment of fig3 the secondary voltage waveform w indicative of the state of the ignition spark discharge is detected by the ignition waveform detector 42 , the output of which is inputted to the control unit ( microcomputer ) 40 via the frequency filter 43 . the control unit 40 compares with a predetermined level the peak level of the secondary voltage waveform w , or the level of the integral of the output of the filter 43 , and determines that the cylinder in question is in the compression stroke when the peak level or the level of the integral of the output of the filter 43 is above the predetermined level . apart from this , the method of operation is the same as that shown in fig2 the counter cnt storing the number of detections of the high level of the output of the filter 43 ( or of the detector 42 , when the filter 43 is not utilized ). while description has been made of the particular embodiments of this invention , it will be understood that many modifications may be made without departing from the spirit thereof . the appended claims are contemplated to cover any such modifications as fall within the true spirit and scope of this invention .	8
it will be appreciated that the following description is intended to refer to specific structure selected for illustration in the drawings and is not intended to define or limit that structure , other than in the appended claims . turning now to the drawings generally and fig1 in particular , one aspect of a water heater is disclosed . a water heater 10 includes a water tank / container 12 having a water inlet 14 and water outlet 16 . a substantially vertically oriented flue 18 extends upwardly through the tank and outwardly of the top of the water heater 10 at opening 20 . the top of water heater 10 is covered with a top pan 22 and has a draft hood 24 resting on top of it . draft hood 24 also is aligned with opening 20 . flue 18 contains an elongated baffle 26 having a multiplicity of flow turbulating fins 28 . baffle 26 extends substantially from the upper end of tank 12 to the lower end of tank 12 although other lengths of baffle 26 may be employed . the lower end of tank 12 has an opening 30 formed from tank bottom 32 . a catalytic converter 34 is also located within flue 18 and resides in an upper portion of flue 18 . catalytic converter 34 connects to baffle 26 and is sized and shaped to slide into flue 18 and have a substantially similar yet slightly smaller diameter as flue 18 . baffle 26 may be made from any number of materials such as carbon steel , stainless steel , aluminized steel and the like . water heater 10 has an outer jacket 36 that surrounds a layer of insulation 38 . insulation 38 is preferably made from any number of foam type of insulations well known in the art and / or fiberglass insulation such as around the lower portion of water heater 10 . a combustion chamber 40 is located below tank 12 and is formed by tank bottom 32 , skrit 42 and bottom pan 44 . legs 46 connect to bottom pan 44 and support water heater 10 . a burner 48 is positioned within combustion chamber 40 and above at least one opening ( not shown ) in bottom pan 44 . the opening may be covered with an air inlet / flame trap such as an air inlet / flame type trap of the type disclosed in any of u . s . pat . nos . 5 , 797 , 355 ; 6 , 142 , 106 and 6 , 085 , 699 , for example . similarly , burner 48 can be of any type well known in the art including standard stamped sheet metal steel burners , low nox burners , radiant heat burners or the like . of course , water heater 10 includes other components not described or shown herein that assist in its operation . those components are well known in the art and need not be discussed herein . fig2 shows one preferred catalytic converter 34 in accordance with aspects of the invention . catalytic converter 34 is preferably a substantially round disc formed from wound corrugated stainless steel foil . the corrugations preferably form “ cells ” in a range of between about 10 cells and about 100 cells per square inch . preferably , the number of cells is at a density of about 40 cells per square inch . also , the disc is preferably between about ⅛ inches and 4 inches in thickness , most preferably about 1 inches in thickness . it is advantageous to have the catalytic converter facilitate substantially laminar flow of flue gases through flue 18 . the stainless steel of catalytic converter 34 is preferably wash coated with one or more coatings of the oxide type such as aluminum oxide , zirconium oxide and titanium oxide , or the like . a catalyst metal is applied to the wash coating , the catalyst preferably being platinum metal , although other catalyst metals may be employed . alternately , the catalyst converter can be made of a stainless steel that has a high aluminum content such as aluminum content of between about 4 . 3 percent and about 6 . 0 percent . the stainless steel having the high aluminum content is then also coated with a catalyst metal such as platinum or the like . catalytic converter 34 preferably converts carbon monoxide ( co ) into carbon dioxide ( co 2 ). catalytic converter 34 preferably converts about 20 percent to about 100 percent of co in flue gases generated in the combustion chamber to co 2 . this results in a very low quantity of co flowing out of water heater 10 even when high quantities of co are generated in combustion chamber 40 under the least desirable conditions . as shown in all of fig1 , 2 and 3 , catalytic converter 34 is positioned in flue 18 and connects to baffle 26 . catalytic converter 34 may also be connected to flue 18 or suspended in flue 18 by means other than baffle 26 if desired . catalytic converter 34 is positioned in an upper portion of flue 18 , that upper portion meaning the upper half of flue 18 , as opposed to the lower half of flue 18 . baffle 26 has a lower portion with a plurality of fins 28 and an upper leader portion 50 as particularly shown in fig3 . leader 50 has a pair of arms 52 that support baffle 26 in flue 18 . arms 52 hang on the edge of opening 20 of flue 18 . this allows baffle 26 and catalytic converter 34 to be readily removed from flue 18 if desired . fig4 and 5 show draft hood 24 removed from water heater 10 . draft hood 24 has a plurality of legs 54 that preferably connect to top pan 22 and are used to center draft hood 24 over opening 20 . draft hood 24 connects to an exhaust line ( not shown ) in a conventional manner to exhaust flue gases from water heater 10 into a chimney , a wall opening or the like to the outer atmosphere . draft hood 24 also contains a debris catcher 56 which has a “ bowl ” or “ umbrella ” shape such that debris falling downwardly toward flue 18 can be caught and then collect in a lower most portion of debris catcher 56 . debris catcher 56 has a diameter that is preferably substantially the same as the diameter of flue 18 or slightly larger to prevent debris from falling into flue 18 and fouling catalytic 34 or falling down toward and onto burner 48 which , depending on the type of burner , could decrease the performance / efficiency of burner 48 . debris catcher 56 connects to draft hood 24 by a plurality of legs 58 . debris catcher 58 is preferably made from a material that is non - corrosive to both moisture and elevated temperatures . we discovered that it is advantageous to locate catalytic converter 34 in an upper portion of flue 18 , preferably in the upper quartile , more preferably in the upper quintile of flue 18 . the construction of catalytic converter 34 should be such that the pressure drop through converter 34 is low enough not to impede the flow of flue gases through flue 18 , especially for natural draft water heaters . as previously noted , metallic structures such as stainless steel structures for catalytic converter 34 are more desirable due to the inner wall thicknesses that provide for more open flow areas . the structure of catalytic converter 34 should have enough active surface area to be able to convert sufficient amounts of co to co 2 . the surface area of the honeycomb structure is determined by the cell count ( cells per inch ) and cell length and accordingly should be about 40 cells per inch and have a cell length ( of thickness of the catalytic converter disc 34 ) of about ½ - 1 inches . this structure also facilitates laminar flow of the flue gases flowing through flue 18 to maximize water heater performance . we also discovered that it is advantageous to have catalytic converter 34 function at an appropriate temperature which is from about 600 ° f . to about 1100 ° f . this temperature range was discovered to be in the above - mentioned upper portion of the water heater , preferably the upper quartile . we also discovered that the catalytic converter can be in the form of a coating applied to baffle 26 and have high effectiveness . application of a coating of platinum to baffle 26 is especially advantageous . the platinum coating is better adhered to baffle 26 by first wash coating with aluminum oxide , zirconium oxide , titanium oxide , some combination of those elements or the like . the coating provides the additional advantage that standard baffle dies used to fabricate baffle 26 may continue to be used instead of specialized dies . the catalytic converter coating should have enough active surface area to be able to convert sufficient amounts of co to co 2 . coverage of baffle 26 depends on the size and shape of baffle 26 . this approach has the further advantage that it does not disturb the natural flow of flue gases flowing through flue 18 , thereby maximizing water heater efficiency . one aspect of our water heaters artificially creates extra burner cycles ( more than those created by the load on the appliance ) to reduce accumulation of foreign materials in the burner ports and increase burner performance . the manner of creating the extra burner cycles includes , but is not limited to , solid state times in electronic controlled applications and mechanical timers in mechanical thermostat type controllers triggered by : pressure , bi - metal thermostats or time delay relays . the exact time of extra burner cycles depends upon the application and burner technology utilized . we have discovered a water heater that utilizes a wire mesh radiant pre - mix burner that consistently achieves low nox emissions . water heaters with inputs less than 75 kbtu must pass stringent test requirements , including a lint , dirt and oil ( ldo ) test that simulates the accumulation of ldo in the burner over a twenty year period during a nominal 20 hour test . testing has shown that these burners , if cycled often during the test ( every 10 - 15 minutes ), continue to operate close to the “ as new ” performance levels . if the burner is not cycled regularly , burner performance drops significantly , resulting in high concentrations of carbon monoxide and nitrogen oxides in the flue gas . gas valve controls can be equipped with electronic controls , powered either by the residential electric supply , or by thermopiles producing mv electrical power from the pilot burner . such electronic control technologies can be adapted to cycle the burner more often than the on - off cycles created by the actual demand for hot water . additionally , convenience mechanical thermostat controls can be adapted with timing devices that add the additional burner cycles . for example , the average burner on period for a residential water heater is 20 minutes . when equipped with a timing device in the control , the burner can be cycled one or more times within the 20 minute period to ensure the burner ports remain clear of foreign materials . the duration of the burner off period can be very short , such that the consumer does not notice a drop in the delivered hot water . fig6 shows a water heater that in some aspects is similar to the water heater shown in fig1 . like elements in fig6 have the same reference number as fig1 . the water heater 10 in fig6 includes a radiant screen gas burner 126 . although fig6 depicts a particular type of radiant screen burner , other radiant burners of this type , including various pre - mix radiant burners , may be used . burner 126 connects to a venturi 44 that receives fuel from fuel supply line 28 as well as combustion air . fuel and combustion air mix as they pass through venturi 44 , enter burner 126 and ignite on the upper surface of the screen 125 at the top of burner 126 . as shown in fig6 , gas control valve 31 contains a controller and the controller actuates burner 126 in response to water temperature detected by a sensor on an as - needed basis . of course , the controller can be programmed or pre - programmed to actuate the burner at various selected temperatures . the controller also periodically actuates burner 126 , irrespective of the water temperature . this periodic actuation decreases the possible accumulation of foreign materials on the radiant screen of the burner 126 . the controller may periodically actuate burner 126 at a selected time interval such as , for example , about every one hour or three hours or four hours , as desired . the actuation period for such periodic actuation can be very short , such as about a minute or two or the like . also , it is possible that , in the event the burner is activated for longer than the selected time period , the controller deactivates the burner for another selected period of time , followed by reactivating the burner . the selected period of time may be about 10 sec or thereabout , while the another selected time period may be about 30 sec or thereabout . alternatively , the controller can actuate burner 126 at a selected time when burner 126 has not been actuated in response to water temperature for a selected period of time . in other words , if burner 126 has not operated for a period of time , such as about one or two or three hours , the controller can actuate burner 126 after the passage of a selected period of time . operation of the periodic burner cycles assists in decreasing the potential accumulation of foreign materials on the surface of the burner , thereby keeping the surface of the burner in as close to “ as new ” condition as possible by avoiding the collection of lints , dirt , oil and the like within the pores or openings in the screen surface . this keeps generation of no x and co as low as possible . for example , water tank 12 may be made of a number of sizes and may be made from a wide variety of materials such as metals and / or plastics . foam insulation 38 may similarly be made from any number of high energy efficient foam insulations well known in the art . the bottom of the water tank 12 may have various shapes , either with lower flanges as shown or as a flat construction . other modifications may be made , including use of foam insulation between the bottom of tank 12 and bottom pan 44 . also , outer jacket 36 may be made from any number of materials such as rolled metals , preferably steel , or extruded vinyl materials and the like . also , top pan 22 and bottom pan 44 may be deep - drawn , stamped or the like , or be made from metal , plastic or other suitable materials . various types of heating elements may be utilized . the adjustment temperatures for the set point and the conditions necessary for set point adjustment are fully variable and the values used herein are examples for illustration purposes only . one skilled in the art will note that many set point usage combinations are possible without varying from the spirit and scope of the invention . although this disclosure has been described in connection with specific forms thereof , it will be appreciated that a wide variety of equivalents may be substituted for the specified elements described herein without departing from the spirit and scope of this disclosure as described in the appended claims .	5
the microorganism from which originates the cloned chitosanase is streptomyces n174 . this microorganism and the enzyme produced thereof have been isolated and characterized . the portion of the gene encoding the chitosanase has been isolated and cloned in suitable plasmidic vectors which led to the obtention of a recombinant strain of streptomyces overexpressing the chitosanase . the present invention will be more readily understood by the following examples and figures which purpose is to illustrate rather than to limit the scope of the invention . fig1 represents the ratio polyacrylic acid / total extracellular proteins which achieves the best yield of chitosanase ; fig2 represents the ph range activity of the chitosanase and the optimal temperature for the activity of the chitosanase for a 10 minute reaction at ph 5 . 5 ; fig4 represents the hplc elution pattern of different molecular weight chitosans which are produced after a short reaction in presence of chitosanase ; and fig5 represents the complete coding nucleic acid sequence and the deduced amino acid sequence of the chitosanase . in order to find microorganisms that secrete chitosan - degrading enzymes which could be used for biochemical and molecular studies as well as for large - scale production of chitosan oligomers , different types of soil were screened . bacteria belonging to the actinomycete group were retained for further studies , as they are known to be efficient producers of many extracellular enzymes ( peczynska - czoch and mordarski , 1988 ). the strain n174 was isolated from soil in a sugar maple grove near sherbrooke ( quebec , canada ) using the following procedure : one gram of soil was added to 100 ml of liquid medium containing ms salts without nh 4 ) 2 so 4 ( neugebauer et al ., 1991 ) supplemented with 100 mg / l of peptone ( difco lab ., detroit , mich .) and 3 . 0 g / l of chitosan flakes ( practical grade , sigma chemical co ., st - louis , mo .). the composition of the ms salt medium ( minimal salts ) is the following : 0 . 5 g of mgso 4 ; 1 . 0 g of ( nh 4 ) 2 so 4 ; 2 . 0 g of k 2 hpo 4 ; 2 . 0 g of kh 2 po 4 ; 0 . 1 g of peptone ; 0 . 01 g of cacl 2 , all dissolved in 1000 ml of distilled water , to which is added , after sterilization , 1 ml of a trace metal solution containing cocl 2 . 6h 2 o ( 200 mg ); feso 4 . 7h 2 o ( 500 mg ); mnso4 . h 2 o ( 160 mg ) and znso 4 . 7h 2 o ( 140 mg ), all dissolved in 100 ml of distilled water . after 4 to 6 days of growth at 30 ° c ., diluted portions of this selection culture were inoculated on tryptic soy agar ( difco ) plates . after different periods of growth , individual colonies with actinomycete - like morphology were tested for their ability to solubilize chitosan by transfer on chitosanase detection agar ( cda ). cda was prepared by mixing 15 g of agar , 300 ml of 1 % chitosan ( dissolved in 0 . 1m hcl ) and 650 ml of distilled water containing the following salts : ( nh 4 ) 2 so 4 . 1 . 0 g ; mgso 4 . h 2 o , 0 . 5 g ; nacl , 1 . 0 g ; k 2 hpo 4 , 0 . 5 g ; feso 4 . 7h 2 o , 0 . 01 g ; zncl 2 , 0 . 001 g ; cacl 2 . 2h 2 o , 0 . 01 g ; mncl 2 , 0 . 005 g ). the ph was adjusted to 6 . 5 with 5m koh and distilled water was added to 1 liter . the medium was sterilized for 15 minutes at 125 ° c . with constant stirring using a bench - top agar sterilizer ( new brunswick scientific , edison , n . j . ), allowing the formation of a fine chitosan precipitate . the strain was maintained on a sporulation medium ( dewitt , 1985 ) which composition is ( per liter ): starch 10 g , corn steep liquor 5 g , caco 3 3 g , feso 4 12 mg and agar 20 g ( ph ajusted to 5 . 8 by addition of hcl ). for chitosanase production , spores collected from an area of 10 - 15 cm 2 of the sporulation plate were used to inoculate 4 l flasks , each containing 800 ml of ms with 10 g / l of chitosan flakes , 0 . 2 % olive oil ( bertrand et al ., 1989 ) and 0 . 035 % antifoam agent ( antifoam a , sigma ). incubation was for 108 hours at 30 ° c . in a rotary shaker ( model g25 , new brunswick scientific ) at 250 rpm . mycelium was removed by filtration through a schleicher and schuell # 410 filter . the actinomycete streptomyces n174 which has been deposited at the american type culture collection rockville , m . d . on nov . 22 , 1994 , under accession number atcc 55633 , was selected as the most active chitosanase producer among 50 other actinomycete isolates . it produces abundant aerial mycelium on tryptic soy agar and sporulates well on the sporulation medium . spores are formed in long chains . the diaminopimelic acid form in the cell wall and the predominant sugar in whole - cell hydrolysates were analyzed by thin - layer chromatography according to staneck and roberts ( 1974 ). mycolic acids were analyzed according to tomiyasu and yano ( 1984 ). meso - diaminopimelic acid is the predominant form in the cell walls of vegetative mycelium but the ll - form becomes predominant in spores . galactose is the predominant sugar in whole - cell hydrolysates ( arabinose was not detected ). according to these data , the n174 strain was first classified in the genus kitasatosporia ( omura et al ., 1982 ). however , recently , the whole genus kitasatosporia has been transfered to the genus streptomyces ( wellington et al ., 1992 ). thus the n174 strain is referred as streptomyces n174 . other characteristics of this strain are listed in table 1 . table 1______________________________________characteristics of the strain n174______________________________________composition of phospholipids ( absence ofpii pattern ( le chevalier et al .) phosphatidyl choline and of phosphatidyl glycerolutilisation of sugarsraffinose + arabinose + mannitol + rhamnose + saccharose + fructose + xylose + glucose + no production of melanineno growth in presence of violet crystal 0 . 001 % sensitivity to neomycine ( 50 μg / ml ) resistance to streptomycine ( 50 μg / ml ) ______________________________________ the best results for chitosanase production by n174 were obtained in a medium containing chitosan as sole carbon source . various enrichments ( 0 . 5 % peptone ; 0 . 5 % casamino acids ; 1 % starch ) increased growth rate but decreased chitosanase production to , respectively , 5 - 10 %, 5 - 10 % and 20 - 50 % of the levels obtained with chitosan . 0 . 5 % d - glucosamine as sole carbon source also induced chitosanase production but at levels reaching only 15 - 25 % of those obtained in chitosan medium . example 3 the culture filtrate ( total volume 1 . 5 l ) was cooled to 4 ° c . ( this temperature was maintained throughout the purification procedure ) and adjusted to ph 4 . 5 with 5m acetic acid . chitosanase was precipitated following a modification of the procedure of sternberg and hershberger ( 1974 ): a 2 % ( w / v ) solution of polyacrylic acid ( average molecular weight 250 , 000 , aldrich chem . co ., milwaukee , wis .) was added dropwise to a final proportion of 4 mg per mg of extracellular proteins . after 30 minutes of mixing , the precipitate was collected by centrifugation ( 11 , 000 × g ; 30 minutes ) and resuspended in 300 ml of distilled water . naoh 1m was added until ph raised to 8 . 5 . in order to remove the residual polyacrylic acid , a 1m solution of calcium acetate was added dropwise ( final concentration : 35 mm ) and the precipitate was removed by centrifugation and discarded . the supernatant was acidified down to ph 5 . 0 with 1m acetic acid . the acidified supernatant was applied to a an ion exchange column , for instance a 1 . 6 × 38 cm s - sepharose fast flow column ( pharmacia lkb , baie d &# 39 ; urfe , quebec ) previously equilibrated with buffer a ( 25 mm na - acetate buffer , ph 4 . 5 ). the flow rate was 70 ml / h . 5 ml fractions were collected . unbound protein was washed from the column with 50 ml of buffer a , then a linear 300 ml gradient from 0 to 0 . 6m nacl in buffer a was applied . fractions containing the chitosanase activity were identified by spotting 10 μl of each fraction on cda plates and incubating for 4 hours at 45 ° c . the active fractions ( total volume 45 ml ) were pooled and concentrated 6 times by techniques well known in the art , for instance by overnight dialysis against bio - gel concentrator resin ( bio - rad , richmond , calif .) the concentrated sample was made 20 % glycerol and applied on a 1 . 6 × 98 cm column packed with bio - gel a - 0 . 5 m ( 200 - 400 mesh ; bio - rad ) equilibrated with buffer a under gravity pressure . in the same buffer , flow rate was 15 ml / h . 2 . 5 ml fractions were collected . active fractions were identified as before and analyzed by sds - page . the purified chitosanase was stored at - 20 ° c . after addition of 1 volume of sterile glycerol . under these conditions , the enzyme was stable for many months . various procedures for the isolation and the concentration of the enzyme were attempted : precipitation with acetone , ethanol , ammonium sulfate and polyethylene glycol 3350 . for unknown reasons , none was satisfactory , resulting in significant loss of enzyme activity . having established that the n174 chitosanase has a slightly alkaline pi ( fink et al ., 1991 ), polyacrylic acid , a precipitant used in large - scale preparations of some industrial enzymes ( sternberg and hershberger , 1974 ) was successfully tried . direct addition of polyacrylic acid solution to the culture supernatant ( which ph varied from 5 . 8 to 6 . 5 in different experiments ) gave relatively low enzyme recoveries ( 25 - 55 %). acidification of the culture supernatant with 1m acetic acid ( down to ph 4 . 5 ) before polyacrylic acid addition resulted in better enzyme recoveries ( around 85 %). the optimal ratio polyacrylic acid / total extracellular proteins was found to be around 4 ( fig1 ). after two subsequent chromatographic steps using the same procedure as above , a chitosanase was obtained , homogeneous as estimated from polyacrylamide gels stained with coomassie blue and from nh 2 - terminal amino acid sequencing and having a specific activity of 59 . 8 units per mg of protein . chitosanase activity standard assay contained 950 μl of 0 . 2 % chitosan solution in 50 mm acetate buffer ph 5 . 5 , l to 20 mu of enzyme and water to a final volume of 1 . 0 ml . incubation was for 10 minutes at 37 ° c . the reaction was terminated by addition of 300 μl of the reaction mixture to 1 . 2 ml of the neocuproine reagent ( dygert et al ., 1965 ). after 15 minutes of incubation at 100 ° c . in a mineral oil bath , chilling under tap water , dilution with 1 . 5 ml of distilled water and centrifugation in a table - top centrifuge ( in order to eliminate the chitosan precipitate ), soluble reducing sugars were measured spectrophotometrically at 450 nm . one unit of enzyme was defined as the amount that liberated 1 μmol of d - glucosamine equivalent in 1 minute under the above conditions . chitosan ( practical grade , c - 0792 , sigma ) was used for standard chitosanase assays . its degree of acetylation ( d . a .) was 21 %. chitosan a and b ( d . a . of 61 % and 54 %, respectively ) were prepared by acetylation of chitosan sigma with acetic anhydride according to hirano and ohe ( 1975 ). chitosan c ( d . a . 43 %) and d ( d . a . 34 %) were obtained by a thermo - mechano - chemical treatment ( pelletier et al ., 1990 ). chitosan e ( d . a . 1 %) was prepared by deacetylation of chitosan sigma by the procedure of domard and rinaudo ( 1983 ). chitosan f ( d . a . 1 %) was from katakura chikkarin co ., japan and was a gift of dr kusaoke . all chitosans were prepared as 10 mg / ml stock solutions in 0 . 25m acetate buffer ( ph 5 . 5 ). chitosans c and d were only partially soluble and enzymatic assays were carried out using their soluble fraction . other substrates like glycol chitosan , carboxymethyl cellulose , purified chitin and laminarin were from sigma . colloidal chitin was prepared using the procedure of hsu and lockwood ( 1975 ). avicell was purchased from fmc co . ( philadelphia , pa .). the purified enzyme was specific for chitosan degradation . no hydrolysis of colloidal chitin , purified chitin , cm - cellulose , avicell , laminarin , n - n - diacetylchitobiose , p - nitrophenyl - β - d - n - acetylglucasaminide or p - nitrophenyl - β - d - glucosaminide was observed . the relationship between enzyme activity and the degree of acetylation of the chitosan substrate was tested on a series of chitosans prepared by various chemical methods . maximal rates of hydrolysis was observed for chitosans with low degrees of acetylation ( 1 - 21 %: chitosans e , e and sigma ) but the n174 chitosanase was able to hydrolyse efficiently chitosans in the range of d . a . from 34 to 61 %, exhibiting still half of the maximal hydrolysis rate against the most acetylated of these substrates , chitosan a ( d . a . 61 %). glycol chitosan was hydrolysed at 35 % of the maximal rate . protein concentration was estimated by the method of stoscheck ( 1990 ) with bovine serum albumin as standard . the nh 2 - terminal protein sequence was determined by edman degradation with an applied biosystems 473a protein sequencer . thin - layer chromatography of end products of chitosan degradation was performed as described ( neugebauer et al ., 1991 ). the system used for analytical high - performance size - exclusion chromatography consisted of a waters 590 pump , a wisp 512 automatic injector and a waters 410 refractive index detector . two tsk gel columns in series ( 600 × 7 . 5 mm ) thermostated at 25 ° c . were employed : g3000pw and g4000pw ( toso haas , philadelphia , pa .). the effluent , degassed and filtered ( 0 . 45 μm ) 2 % acetic acid with sodium nitrate ( 0 . 2m ) and sodium azide ( 0 . 1 %), was pumped at 0 . 5 ml / minute . the samples from enzymatic digestions were filtered ( 0 . 45 μm ) and 50 μl were injected ( in some cases the samples had to be diluted in order to keep the dissolved solids concentration under 4 mg / ml ). all the data were acquired and processed with the aid of the waters maxima 820 software program ( millipore waters , mississauga , ontario ). the nh 2 - terminal sequence of the purified enzyme was determined to be ala - gly - ala - gly - leu - asp - asp - pro - his - lys - lys - glu - ile - ala - met - glu - leu -( seq id no : 1 ). previously , the m r of the purified enzyme was estimated to be approximately 29500 by sds - polyacrylamide gel electrophoresis ( fink et al ., 1991 ). optimal reaction conditions , enzyme stability and kinetic parameters were determined with chitosan sigma as the substrate . the ph range for activity extended from 4 . 0 to 6 . 0 with a maximum at 5 . 5 ( fig2 ). a sharp drop in activity was observed at ph values higher than 6 . 5 coinciding with precipitation of the substrate . the enzyme was stable in a ph range of 4 . 5 to 6 . 0 for at least 4 hours at 37 ° c . the optimal temperature for a 10 minute reaction at ph 5 . 5 was about 65 ° c . ( fig2 ). the apparent k m determined from a single reciprocal plot ( not shown ) was 0 . 088 mg / ml and v max was 96 . 6 u / mg . substrate inhibition was observed at chitosan concentrations higher than 1 mg / ml . thermal stability of the chitosanase was determined by incubating the enzyme in 50 mm acetate buffer ph 5 . 5 at various temperatures and for various periods of time in the absence of chitosan , after which the residual activity was determined by the standard assay . the enzyme was stable at 37 ° c . but its stability decreased rapidly above 40 ° c . ( fig3 ). as described for chitosanase a from bacillus megaterium p1 ( pelletier and sygusch , 1990b ), stability could be improved by addition of 0 . 1 mg / ml of bovine serum albumin to the preincubation buffer . these studies showed , however , that the enzyme is relatively thermolabile . therefore , for periods of incubation longer than 10 minutes , a temperature not higher than 40 ° c . should be used in order to insure the stability of the chitosanase . hplc analysis of products obtained from the early stages of reaction showed a rapid decrease of molecular weight of the chitosan substrate ( fig4 ), indicating that the enzyme hydrolyses chitosan in an endowise manner . the products of a complete digestion of chitosan were analyzed by thin - layer chromatography ( not shown ). as for other chitosanases ( price and storck , 1975 ; pelletier and sygusch , 1990b ), the main products detected were dimers and trimers of d - glucosamine with only traces of free d - glucosamine or higher oligomers . thus , the tetramer should be the shortest oligomer still recognized as a substrate by the chitosanase . in many respects , the streptomyces n174 chitosanase , described herein , resembles that of streptomyces sp . no 6 ( price and storck , 1975 ). both enzymes cannot be precipitated from culture filtrates by conventional laboratory techniques , both exhibit the same mechanism of chitosan hydrolysis , they do not attack chitin and cm - cellulose and they have similar molecular weights . the pi of streptomyces sp . no 6 chitosanase was not determined , but can be deduced as being near to neutral from its behaviour in ion exchange chromatography , thus it is similar to that of n174 chitosanase . the streptomyces sp . no 6 has however a much higher apparent k m for chitosan compared with that of n174 , suggesting that there are significant differences between the two enzymes . the strain streptomyces n174 is one of the most efficient producers of chitosanase described so far in the litterature . in filtrates obtained after cultivation of n174 in chitosanase production medium , the chitosanase accounts for approximately 50 - 60 % of total extracellular proteins . precipitation with polyacrylic acid , an easy and inexpensive step , gives enzyme preparations with a chitosanase specific activity reaching 72 - 75 % of that of the purified enzyme . this enzyme preparation is stable for many weeks at 4 ° c . and does not contain other chitino - or chitosano - lytic activities ( data not presented ). thus , the n174 strain is suitable for large scale chitosanase production ( in the hundreds of milligrams or the grams range ). even if n174 is an excellent producer of chitosanase , the yield of chitosanase can be greatly increased by using dna recombinant techniques . the recombinant microorganism of the present invention contains a hybrid plasmid that carried the chs gene that codes for the production of chitosanase . the hybrid plasmid can be constructed by any conventional methods for the insertion of required dna fragment ( chs gene ) into a vector plasmid . preferably , chromosomal dna is extracted from the above - described streptomyces n174 according to chater et al . ( 1982 ). plasmid dna was purified from the strain streptomyces lividans tk24 ( obtained from d . a . hopwood ( john innes institute , norwich , uk ) as described by kieser ( 1984 ). for the gene bank construction , 3 μg of vector pij702 dna ( katz et al ., 1983 ) cut with bglii and dephosphorylated using a heat - labile phosphatase ( bio / can sc ., mississauga , ontario , canada ) were ligated to 5 μg of a total bglii digest of n174 . after ligation , dna was transformed into tk24 protoplasts following the procedure of hopwood et al . ( 1985 ). 12500 transformants were recovered on r2ye regeneration medium containing 50 μg / ml of thiostrepton ( courtesy of squibb & amp ; sons ltd , montreal , canada ). from these transformants , approximately 9000 were melanin - negative , indicating the presence of an insert at the bglii site of the vector pij702 . the transformants were transfered by replica plating on cda plates . on this medium , the strain tk24 gave a faint solubilization of chitosan after 4 to 5 days of growth ( owing to chitinolytic activities produced by this strain ( neugebauer et al ., 1991 ). the clone pdf22 carrying an insert of 6 . 5 kb was selected . in order to localize the chs gene , a plasmid was constructed by sub - cloning the 6 . 5 kb bglii fragment of pdf22 into the bamhi site ( dephosphorylated ) of the shuttle vector pfd666 , which is able to replicate in streptomyces and e . coli ( denis and brzezinski , 1992 ). this plasmid has the origin of replication of cole1 for propagation in e . coli , the origin of replication of pjv1 ( bailey et al ., 1986 ) for propagation in actinomycetes , more particularly in streptomyces and a modified aminoglycoside resistance gene ( denis and brzezinski , 1991 ). the vector pfd666 is obtained from escherichia coli ( pfd666 ), a culture of which is on deposit at the national collection of industrial and marine bacteria limited , aberdeen , uk under accession number ncimb 13218 , and at the american type culture collection under accession number 77286 . donor and plasmid dna were mixed at a ratio 3 : 1 ( w : w ), ligated using 0 . 5 unit of t4 dna ligase for 4 hours at room temperature at a concentration of 80 μg / ml . after transformation , a chitosanase - producing clone was selected and designated streptomyces lividans ( pdf220 ). the plasmid pdf220 extracted from this clone carried the dna insert of 6 . 5 kb ( kilobase pairs ). when cultured in liquid medium ( as described in example 1 ), this clone was found to produce a chitosanase which m r was identical to that of the chitosanase produced by the dna donor strain streptomyces n174 . the host strain transformed with the vector pdf666 did not produce any significant chitosanase activity in the same conditions . various intraplasmidic deletions were produced by total or partial restriction enzyme digestion and by intramolecular ligation , giving plasmids pdf221 to 225 ( fig5 ). other deletions were produced directly in the pdf22 plasmid , giving the pdf22 - 11 and pdf22 - 5 plasmids ( fig5 ). after transformation into tk24 , the shortest segment of this series examined ( that of the pdf225 plasmid ) still gave an intense solubilization of chitosan . the dna of the hybrid plasmid pdf220 was digested with the restriction endonuclease psti and a dna fragment of 2 . 6 kb containing the chitosanase ( chs ) gene was subcloned by ligation with the pfd666 plasmid vector digested with the psti enzyme . the recombinant microorganism is produced by the introduction of the hybrid plasmid ( ligation product ) into a host microorganism strain of the genus streptomyces , preferably a microorganism lacking beta - 1 , 4 - glucosaminic linkage hydrolysing activity . a suitable host , streptomyces lividans 1326 is available from the national collection of industrial and marine bacteria limited , aberdeen , u . k . under accession number ncimb 40257 . a chitosanase - positive clone obtained after transformation of streptomyces lividans 1326 was selected and designated streptomyces lividans ( prl226 ). the extracellular chitosanase produced by the recombinant strain streptomyces lividans ( prl226 ) was purified to homogeneity . the purified enzyme has an apparent m r of 29 , 000 daltons and pi of 7 . 5 . this m r value corresponds exactly to the m r value of the native purified chitosanase from streptomyces n174 . the chitosanase produced by streptomyces lividans ( prl226 ) showed no activity towards chitin and n - n - diacetylchitobiose . the enzyme degrades chitosan , producing mainly chitobiose and a mixture of oligomers of d - glucosamine as end products . the level of chitosanase production in the original streptomyces n174 was approximately 5 iu / ml of culture supernatant . after cloning , the level of production reached approximately 35 iu / ml of supernatant . the expression of the chitosanase gene varies according to the source of carbon used in the culture medium . the chitosanase was produced by streptomyces lividans ( prl226 ) in culture medium containing 2 % tryptic soy broth or starch or malt extract as main carbon sources . preferably the carbon source in the growth medium is 1 . 5 % of chitosan flakes and 0 . 5 % malt extract or 1 . 5 % of chitosan flakes and 0 . 5 % starch . yet more preferably the carbon source in the medium consists in 3 % of dry sterile mycelium of a mould of the genus mucor or rhizopus . in the last - mentioned medium , streptomyces lividans ( prl226 ) produces chitosanase at a concentration of 95 iu / ml . further , in accordance with the method of the present invention , a chitosan solution in an aqueous medium at moderately acidic ph is treated with chitosanase . while it is preferred to employ solubilized chitosan , other insoluble chitosan forms may be used . the chitosan is treated with chitosanase contained in the supernatant of a recombinant streptomyces lividans clone . the enzyme solution can be purified and / or concentrated using the above - described biochemical techniques . the chitosanase is used at a concentration ranging from 0 . 001 to about 10 iu / ml and at a temperature of from 20 ° c . to about 80 ° c ., preferably about 40 ° c . the chitosan concentration is from about 0 . 1 % to about 4 %, based on the dry weight . a concentration of about 0 . 5 % to 2 % is preferred . the mixture can be mixed with the use of mixing devices . the chitosanase action can be inhibited by heating the reaction mixture to about 90 ° c . for the required amount of time . the depolymerized chitosan is then used depending upon the type of product desired . production of chitosanase and degradation of chitosan by the recombinant strain streptomyces lividans ( prl226 ) the ability of chitosanase production of the various strains was studied by cultures in liquid media . in all tests , the minimal salts ( ms ) medium was used . for chitosanase production tests , a medium containing ms salts supplemented with 10 g / l of chitosan flakes ( practical grade ; sigma chemical co ., st . louis , mich . u . s . a .) was used . cultures were incubated at 30 ° c . production levels are shown in table 2 . table 2______________________________________strain chitosanase activity in iu / ml * ______________________________________s . lividans 1326 0 . 02s . lividans ( pfd666 ) 0 . 02s . lividans ( pdf220 ) 35 . 5s . lividans ( prl226 ) 38 . 8______________________________________ (*): chitosanase activity was measured by incubating 0 . 05 ml of enzyme solution ( diluted , if necessary , in 0 . 1m naacetate buffer , ph 5 . 5 ) with 0 . 95 ml of 1 % chitosan in the same buffer , at 37 ° c . for 10 minutes . reaction was terminated by addition of the neocuproine reagent and heating for 15 min in an oil bath at 105 ° c .. reducing sugars were determined with dglucosamine as standard . the culture supernatant concentrates of all the strains described in table 2 were analyzed for secreted chitosanase by sds - polyacrylamide gel electrophoresis . the chitosanase produced by the strains s . lividans ( pdf220 ) and s . lividans ( prl226 ) had identical electrophoretic mobility as the purified chitosanase of the original strain streptomyces n174 . this was further confirmed by comparison of biochemical properties such as pi , ph and temperature optima . the expression of the chitosanase gene varied according to the carbon source present in the medium . while some production was observed in absence of chitosan , on media such a ms + 2 % malt extract ( difco lab , detroit , mich ., u . s . a .) or ms + 2 % starch ( potato starch powder ; anachemia canada inc ., montreal ); production was significantly enhanced on chitosan containing media , in which the content of malt extract or starch was reduced to 0 . 5 %. table 3 shows the level of chitosanase production in some media , obtained with the strain streptomyces lividans ( prl226 ). table 3______________________________________ chitasanase activity ( ui / ml ) medium composition 72 h 120 h______________________________________ms + 1 . 5 % chitosan + 48 . 8 19 . 50 . 5 % starchms + 1 . 5 % chitosan + 50 . 3 24 . 00 . 5 % malt extractms + 2 % malt extract 6 . 6 11 . 8ms + 2 % starch 4 . 9 10 . 0______________________________________ table 4 shows a comparison of enzyme production by streptomyces lividans ( prl226 ) on media with various natural substrates containing chitin or chitosan . sterile and dry cells and / or mycelia of various fungal microorganisms were included at a final concentration of 3 % ( dry weight ) into the production medium . the highest chitosanase levels were obtained with dry sterile mycelia of two chitosan - containing microorganisms , mucor rouxii and rhizopus oryzae , requiring , however , a significantly longer fermentation period of 7 - 8 days . table 4______________________________________ chitosanase activity ( ui / ml ) medium composition 96 h 144 h 192 h______________________________________ms + 3 % of dry 18 . 2 21 . 5 22 . 3cells ofsaccharomycescerevisiaems + 3 % of dry 26 . 2 29 . 0 27 . 7mycelium ofaspergillus nigerms + 3 % of dry 32 . 5 45 . 2 48 . 9mycelium ofrhizopus oryzaems + 3 % of dry 67 . 5 70 . 3 94 . 8mycelium of mucorrouxii______________________________________ the results shown in tables 3 and 4 stress out an interesting point . depending on the substrate used , the time chosen for measuring chitosanase activity is of importance . upon different substrates , the cells reach a stationnary growth phase more or less rapidly . proteasic activities develop when the cells attain this stationnary phase . this could explain why different substrates show different maximal chitosanase activities at different times because these proteasic activities were shown to degrade the chitosanase , when they develop in the medium . a supernatant of a recombinant streptomyces lividans ( prl226 ) clone containing the chitosanase enzyme assayed at approximately 60 iu / ml at a protein concentration of approximately 1 . 4 mg / ml ( bradford assay ) was further purified . the supernatant containing the enzyme was acidified with acetic acid down to ph 4 . 5 and a 2 % ( w / v ) solution of polyacrylic acid ( average molecular weight 150 , 000 ; aldrich chem . co ., milwaukee , wis .) was added dropwise to a final proportion of 4 mg per mg of extracellular proteins . after 30 minutes of mixing , the precipitate was collected by filtration and resuspended in 1 / 5 of the original supernatant volume of distilled water . 1m naoh was added until ph raised to 8 . 5 . in order to remove the residual polyacrylic acid , a 1m solution of calcium acetate ( final concentration : 35 mm ) was added dropwise and the precipitate was removed by filtration and discarded . the supernatant was acidified down to ph 5 with acetic acid . this crude enzyme preparation was kept at 4 ° c . until used . this precipitation step eliminates about 95 % of proteasic activity which is not precipitated with polyacrylic acid . this further explain the good stability of the so purified enzyme which is now substantially free of proteases . a chitosan sample used in this test was dissolved in 1m acetic acid and diluted up to a final concentration of 4 mg / ml with 50 mm sodium acetate ph 5 . 5 . treated and control samples ( 1 g of each ) were incubated at 37 ° c . the treated samples had various amounts of crude chitosanase preparation added to them for a final activity of 0 . 006 - 0 . 2 iu / ml , for 10 minutes of incubation with constant mixing . once the incubation completed , control and treated samples were boiled for 10 minutes in order to inactivate the enzyme . the average degree of polymerization of chitosan in various samples was determined by high - performance liquid chromatography ( hplc ). the results are listed in table 5 . a progressive decrease of the chitosan molecular weight was obtained . table 5______________________________________ average degree of polymerisation ofchitosanase activity in chitosan at the end ofsample treatment______________________________________no enzyme ( control 2750sample ) 0 . 006 iu / ml 10000 . 013 iu / ml 4500 . 025 iu / ml 2000 . 050 iu / ml 900 . 10 iu / ml 300 . 20 iu / ml 8______________________________________ for sequencing purposes , the dna segment containing the chs gene and some flanking sequences was obtained by digesting plasmid prl226 by the restriction endonuclease psti , separating this segment on agarose gel and extracting it thereof , and ligated in plasmid puc119 ( vieira and messing , 1987 ) digested by the same restriction enzyme . the ligated product was used to transform e . coli dh5α cells . clones having a recombinant plasmid bearing the inserted dna segment , in both directions were retained . a series of nested deletions was generated using the exonuclease iii / s1 - nuclease procedure ( hennikoff , 1984 ). the sequence of a 1575 nucleotide bamhi - psti segment was determined on both strands using the dideoxy method ( sanger et al ., 1977 ). the 5 &# 39 ;- gtaaaacgacggccagt - 3 &# 39 ; ( seq id no . 4 ) oligonucleotide ( obtained from new england biolabs , beverly , mass .) was used as a sequencing primer . the nucleic acid sequence and the amino acid sequence obtained are represented in fig5 . all the restriction enzyme sites first mapped using the recombinant puc119 and using standard and well known procedures ( fink et al ., 1991 ) have been confirmed by the sequence obtained ( seq id no . 2 ). the open - reading frame ( orf ) corresponding to the chitosanase starts at nucleotide 225 and ends at nucleotide 1058 . this orf determines a protein of 278 amino acids ( seq id no : 3 ). the n - terminal amino acid sequence of the purified extracellular chitosanase has shown that the mature enzyme starts at the amino acid 41 ( ala - gly - ala - gly . . . ). the first forty amino acids ( corresponding to the amino acids encoded by nucleotides 225 to 344 ) act as a signal peptide sequence ( von heijne , 1990 ) and are necessary for the secretion of the chitosanase outside the bacterial cell . the calculated molecular weight of the chitosanase does not correspond to that measured on sds - polyacrylamide gel . this discrepancy might be explained by the two putative glycosylation sites beared by the chitosanase or , by the non - globular conformation which could be adopted by the chitosanase , conferring retardation of migration on sds - polyacrylamide gel and engendering an over - evaluation of its molecular weight . these hypotheses are under investigation . bailey , c . r ., et al . ( 1986 ). j . gen . microbiol . 132 : 2071 - 2078 bertrand , j .- l ., et al . ( 1989 ) &# 34 ; expression of the xylanase gene of streptomyces lividans and production of the enzyme on natural substrates &# 34 ;. biotechnol . bioeng . 33 : 791 - 794 de witt , j . p . et al . ( 1985 ). &# 34 ; evidence for fex factor in streptomyces erythraeus . j . bacteriol . 164 : 969 - 971 domard , a ., et al . ( 1983 ). &# 34 ; preparation and characterization of fully deacetylated chitosan &# 34 ;. int . j . biol . macromol . 5 : 49 - 52 fenton , d . m ., et al . ( 1981 ). &# 34 ; purification and mode of action of a chitosanase form penicillium islandicum &# 34 ;. j . gen . microbiol . 126 : 151 - 156 fink , et al . ( 1991 ). biotechnology letters . 13 ( 12 ): 845 hirano , s ., et al . ( 1975 ) &# 34 ; a facile n - acylation of chitosan with carboxylic anhydrides in acidic solutions &# 34 ;. carbohydro . res . 41 : c1 - c2 hopwood , d . a ., et al . ( 1985 ). genetic manupulation of streptomyces -- a laboratory manual . john innes foundation , norwich horowitz , s . t . et al . ( 1957 ). journal of american chemical society 79 : 5046 hsu , s . c ., et al . ( 1975 ) &# 34 ; powdered chitin agar as a selective medium for enumeration of actinomycetes in water and soil &# 34 ;. appl . microbiol . 29 : 422 - 426 nanjo , f . et al . ( 1990 ). &# 34 ; purification and characterization of an exo - β - d - glucosaminidase , a novel type of enzyme , from nocardia orientalis &# 34 ;. j . biol . chem . 265 : 10088 - 10094 neugebauer , e . et al . ( 1991 ). &# 34 ; chitinolytic properties of streptomyces lividans , arch . microbiol . 156 : 192 - 197 omura , s . et al . ( 1982 ). &# 34 ; kitasatosporia , a new genus of the order actinomycetales &# 34 ;. j . antibiotics . 35 : 1013 - 1019 peczynska - czoch , w . p . et al . ( 1988 ). &# 34 ; actinomycete enzyme &# 34 ; in goodfellow , m . et al . ( eds ). actinomycetes in biotechnology . academic press . new york . pp . 219 - 283 pelletier , a . et al . ( 1990a ). &# 34 ; chitin / chitosan transformation by thermo - mechano - chemical treatment including characterization by enzymatic depolymerization &# 34 ;. biotechol . bioeng . 36 : 310 - 315 pelletier , a . et al . ( 1990b ) &# 34 ; purification and characterization of three chitosonase activities from bacillus megaterium p1 &# 34 ;. appl . environ . microbiol . 56 : 844 - 848 price , j . s . et al . 1975 ). &# 34 ; production , purification and characterization of an extracellular chitosane from streptomyces &# 34 ;. j . bacteriol . 124 : 1574 - 1585 sakai , k ., et al . ( 1991 ). &# 34 ; purification and hydrolytic action of chitosanase from norcardia orientalis &# 34 ;. biochim . biophys . acta 1079 : 65 - 72 sandford , p . a . ( 1989 ). in skjak - braek , g . et al . ( eds ). chitin and chitosan elsevier applied science . pp . 51 - 70 staneck , j . l . et al . ( 1974 ). &# 34 ; simplified approach to identification of aerobic actinomycetes by thin - layer chromatography &# 34 ;. appl . microbiol . 28 : 226 - 231 sternberg , m ., et al . ( 1974 ). &# 34 ; separation of proteins with polyacrylic acids &# 34 ;. biochim . biophys . acta 342 : 195 - 206 stoscheck , c . m . ( 1990 ) &# 34 ; increased uniformity in the response of the coomassie blue g protein assay to different proteins &# 34 ;. anal . biochem . 184 : 111 - 116 tomiyasu , i ., et al . ( 1984 ). &# 34 ; separation and analysis of novel polyunsaturated mycolic acids from a psychrophilic , acid - fact bacterium , gordona aurantiaca &# 34 ;. eur . j . biochem . 139 : 173 - 180 wellington , e . m . h ., et al . ( 1992 ). &# 34 ; taxonomic status of kitasatosporia , and proposed unification with streptomyces on the basis of phenotypic and 16s rrna analysis and emendation of streptomyces &# 34 ;. waksman and henrici 1943 , 339 al . int . j . syst . bacteriol . 42 : 156 - 160 yabuki , m . et al . ( 1988 ). &# 34 ; purification and properties of chitosanase from bacillus circulans mh - k1 &# 34 ;. j . gen . appl . microbiol . 34 : 255 - 270 __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 4 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 17 amino acids ( b ) type : amino acid ( d ) topology : unknown ( ii ) molecule type : peptide ( v ) fragment type : n - terminal fragment of chitosanase ( vi ) original source : streptomyces n174 ( xi ) sequence description : seq id no : 1 : alaglyalaglyleuaspaspprohislys510lysgluilealametgluleu 15 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 1575 base pairs ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear ( ii ) molecule type : cdna to mrna ( vi ) original source : streptomyces n174 ( xi ) sequence description : seq id no : 2 : ggatccgtccgggcggggc ccctctgcgtgtccgggctcctctgcgtga50gccggagtctgacggtccgtcacttcggtggcggatcgttggcatgcgcg100cggtcagggatttggggcggggcccttgcggagggccgggagggggcgct150 tgaatcggttaggaaagtttcctaactctctctgcgggcacccccatgcc200cagcgacagaagacggagcgtcatatgcactcgcagcaccggaccgcacg250catcgccctggccgtcgtcctcaccgcgatacccgca tcgctcgccaccg300ccggagtcggctacgcctccactcaggcgagcaccgccgtcaaggccggt350gccggcctcgacgatccccacaagaaggagatcgcgatggagctcgtctc400cagcgccgaga actcctccctcgactggaaggcccagtacaagtacatcg450aggacatcggtgacggccgcggctacaccggcggcatcatcggcttctgt500tccgggaccggcgacatgctggaactcgtccagcactacaccgacctgga5 50gcccggcaacatcctcgccaagtacctgcccgcgctgaagaaggtcaacg600gctcggcctcccactccggcctcggcaccccgttcaccaaggactgggcg650accgccgccaaggacaccgtcttccagcag gcccagaacgacgagcgcga700ccgggtctacttcgacccggccgtcagccaggcgaaggccgacggcctgc750gcgcgctgggccagttcgcctactacgacgccatcgtgatgcacggcccc800ggca acgacccgaccagcttcggtggcatccgcaagaccgccatgaagaa850ggccaggacccccgcccagggcggcgacgagaccacctacctcaacgcct900tcctggacgcccgcaaggccgccatgctcaccgaggccgcgcacgacg ac950accagccgcgtggacaccgagcagcgggtcttcctgaaggccggcaacct1000cgacctcaacccgccgctgaagtggaagacctacggggacccgtacgtca1050tcaacagctgagccggctcgtc cccggtgcggcagcgcaccaccccgccg1100caccgggggcacggcccgggatcgatcggccgccgaggccagctcggacc1150tggttcggggctgtccggcccgctgcggtgttctgcggcctgttccggtc1200 tgttccggccactcgaaaatgtcgggcggagtgcggcgggtgcccgtagc1250gtggtccgccatgacgcctccctcccgtacccgccccgcctacgacgccg1300tgagcgcacgcagttgatcgcctggctggacatgcagcgg gcggtcgtc1350cactggaagtgcgacggactgtccggcgaggacgcccaccgggtggtgat1400cccgacctcgcccctgatgactgcggccgggctggtctcccatctgcggt1450gggtcgagcactg ctggttcgaggtcatgctgacggggcgccccgcgacc1500ggaccgcagttcgacgagagcatcgaggacgcggacatgcgggtggaggg1550cgtcccgctggagcgactgctgcag1575 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 278 amino acids ( b ) type : amino acid ( d ) topology : unknown ( ii ) molecule type : protein ( vi ) original source : streptomyces n174 ( xi ) sequence description : seq id no : 3 : methisserglnhisargthralaargile 510alaleualavalvalleuthralailepro1520alaserleualathr alaglyvalglytyr2530alaserthrglnalaserthralavallys3540 alaglyalaglyleuaspaspprohislys4550lysgluilealametgluleuvalserser 5560alagluasnserserleuasptrplysala6570glntyrlystyrilegluaspileglyasp 7580glyargglytyrthrglyglyileilegly8590phecyssergl ythrglyaspmetleuglu95100leuvalglnhistyrthraspleuglupro105110 glyasnileleualalystyrleuproala115120leulyslysvalasnglyseralaserhis 125130serglyleuglythrprophethrlysasp135140trpalathralaalalysaspthrvalphe145150glnglnalaglnasnaspgluargasparg155160valtyrp heaspproalavalserglnala165170lysalaaspglyleuargalaleuglygln1751 80phealatyrtyraspalailevalmethis185190glyproglyasnaspprothrserphegly 195200glyilearglysthralametlyslysala205210argthrproalaglnglyglyaspgl uthr215220thrtyrleuasnalapheleuaspalaarg225230lys alaalametleuthrglualaalahis235240aspaspthrserargvalaspthrglugln245 250argvalpheleulysalaglyasnleuasp255260leuasnproproleulystrplysthrtyr 265270glyaspprotyrvalileasnser275 ( 2 ) information for seq id no : 4 :( i ) sequence characteristics :( a ) length : 17 nucleotides ( b ) type : nucleotide ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : oligonucleotide ( a ) description : sequencing primer ( vi ) original source : new england biolabs ( xi ) sequence description : seq id no : 4 : gtaaaacgacggccagt17	2
the following definitions are used in the description below . herein , the term &# 34 ; electrically insulating &# 34 ; ( or &# 34 ; dielectric &# 34 ;) generally applies to materials having a resistivity greater than 10 12 ohm - cm . the term &# 34 ; electrically non - insulating &# 34 ; thus refers to materials having a resistivity below 10 12 ohm - cm . electrically non - insulating materials are divided into ( a ) electrically conductive materials for which the resistivity is less than 1 ohm - cm and ( b ) electrically resistive materials for which the resistivity is in the range of 1 ohm - cm to 10 12 ohm - cm . these categories are determined at low electric fields . examples of electrically conductive materials ( or electrical conductors ) are metals , metal - semiconductor compounds , and metal - semiconductor eutectics . electrically conductive materials also include semiconductors doped ( n - type or p - type ) to a moderate or high level . electrically resistive materials include intrinsic and lightly doped ( n - type or p - type ) semiconductors . further examples of electrically resistive materials are cermet ( ceramic with embedded metal particles ) and other such metal - insulator composites . electrically resistive materials also include conductive ceramics and filled glasses . fig3 illustrates a portion of the viewing surface of a flat panel display 300 in accordance with one embodiment of the invention . fig4 is a cross sectional view of flat panel display 300 along section line 4 -- 4 of fig3 . the illustrated portion of flat panel display 300 includes faceplate structure 320 , backplate structure 330 and spacers 351 and 352 . faceplate structure 320 is a conventional structure which includes an electrically insulating glass faceplate 321 and a light emitting structure 322 . backplate structure 330 is also a conventional structure , and includes electrically insulating backplate 331 and electron emitting structure 332 . faceplate structure 320 and backplate structure 330 are described in more detail in commonly owned u . s . pat . no . 5 , 477 , 105 ; u . s . patent application ser . no . 08 / 081 , 913 &# 34 ; flat panel display with ceramic backplate &# 34 ; by curtin et al ., filed jun . 22 , 1993 , now u . s . pat . no . 5 , 686 , 790 ; and pct publication no . wo 95 / 07543 , published mar . 16 , 1995 , which are hereby incorporated by reference in their entirety . in one variation , each of spacers 351 and 352 is formed from a solid piece of uniform electrically resistive material such as a ceramic containing a transition metal oxide . each of spacers 351 and 352 can also be formed from an electrically insulating core having electrically resistive skins formed on the outside surfaces thereof . spacers 351 and 352 are described in more detail in schmid et al u . s . patent application ser . no . 08 / 414 , 408 filed mar . 31 , 1995 , now u . s . pat . no . 5 , 675 , 212 ; and spindt u . s . patent application ser . no . 08 / 505 , 841 filed jul . 20 , 1995 , now u . s . pat . no . 5 , 674 , 781 both of which are hereby incorporated by reference in their entirety . the illustrated portion of flat panel display 300 is logically partitioned into eleven display regions 301 - 311 . each of display regions 301 - 311 includes a corresponding light emitting region 301a - 311a of light emitting structure 322 , and a corresponding electron emitting region 301b - 311b of electron emitting structure 332 . each of light emitting regions 301a - 311a includes one or more rows of light emitting elements ( i . e ., pixel rows ) which extend in parallel with spacers 351 and 352 . similarly , each of electron emitting regions 301b - 311b includes one or more rows of electron emitting elements . each of light emitting regions 301a - 311a has a corresponding electron emitting region 301b - 311b . in the described embodiment , the pixels of flat panel display 300 have a pitch ( spacing ) of 12 . 5 mils , although other pitches are possible and considered to be within the scope of the invention . spacers 351 and 352 extend parallel to each other with a lateral spacing of 375 mils . thus , thirty pixel rows exist between spacers 351 and 352 . other spacers ( not shown ) of flat panel display 300 are identically spaced . flat panel display 300 can include , for example , 480 pixel rows . spacers 351 and 352 have a thickness t of approximately 2 . 25 mils , and a height h of approximately 50 mils . as a result , the spacing between faceplate structure 320 and backplate structure 330 is approximately 50 mils . a voltage difference of approximately 5 kv is maintained between electron emitting structure 332 and light emitting structure 322 . display regions 303 and 304 are located immediately adjacent to spacer 351 , and display regions 308 and 309 are immediately adjacent to spacer 352 . display regions 303 , 304 , 308 and 309 are therefore hereinafter referred to as spacer - adjacent regions . spacer - adjacent regions 303 , 304 , 308 and 309 are selected to include the pixel rows which would fail to receive an acceptable number of emitted electrons from their corresponding rows of electron emitting elements as a result of charge build up on spacers 351 and 352 , assuming that the rows of electron emitting elements were sequentially activated in the direction of arrow 340 . spacer - adjacent regions 303 , 304 , 308 and 309 are also selected to include the pixel rows which would receive electrons which are deflected by an amount which results in pixel distortion as a result of charge built up on spacers 351 and 352 , assuming that the rows of electron emitting elements were sequentially activated in the direction of arrow 340 . in the described embodiment , each of spacer - adjacent regions 303 , 304 , 308 and 309 includes one or two pixel rows which are located immediately adjacent to spacers 351 - 352 . if , for example , each of spacer - adjacent regions 303 , 304 , 308 and 309 includes two pixel rows , then light emitting regions 303a , 304a , 308a and 309a would each include two rows of light emitting elements , and corresponding electron emitting regions 303b , 304b , 308b and 309b would each include two corresponding rows of electron emitting elements . when electron emitting regions 303b , 304b , 308b and 309b are activated , electrons scattering from the corresponding light emitting regions 303a , 304a , 308a and 309a do not significantly charge spacers 351 and 352 . this is because the electrons which scatter from light emitting regions 303a , 304a , 308a and 309a tend to hit spacers 351 and 352 relatively close to the top of spacers 351 and 352 ( i . e ., near light emitting structure 322 ). as a result , the charge introduced by these electrons is easily bled off to light emitting structure 322 . display regions 302 , 305 , 307 and 310 are located immediately adjacent to spacer - adjacent regions 303 , 304 , 308 and 309 , respectively . display regions 302 , 305 , 307 and 310 are selected to include the pixel rows which , when sequentially fired upon by their corresponding rows of electron emitting elements , provide electron scattering which charges spacers 351 and 352 to an undesirably high level . regions 302 , 305 , 307 and 310 are hereinafter referred to as spacer - charging regions . spacer charging regions 302 , 305 , 307 and 310 include corresponding light emitting regions 302a , 305a , 307a and 310a , and corresponding electron emitting regions 302b , 305b , 307b and 310b . in the described embodiment , each of spacer - charging regions 302 , 305 , 307 and 310 includes three to five pixel rows which are located immediately adjacent to the corresponding spacer - adjacent regions 303 , 304 , 308 and 309 . if , for example , each of spacer - adjacent regions 303 , 304 , 308 and 309 includes five pixel rows , then light emitting regions 302a , 305a , 307a and 310a would each include five rows of light emitting elements , and corresponding electron emitting regions 302b , 305b , 307b and 310b would each include five corresponding rows of electron emitting elements . in a particular embodiment , the pixel rows included in spacer - charging regions 302 , 305 , 307 and 310 are those pixel rows which are spaced apart from spacers 351 and 352 by a distance in the range of approximately 0 . 5 to 1 . 5 times the distance between light emitting structure 322 and electron emitting structure 332 . display region 301 is located immediately adjacent to spacer - charging region 302 , display region 306 is located between spacer - charging regions 305 and 307 , and display region 311 is located immediately adjacent to spacer - charging region 310 . display regions 301 , 306 and 311 are selected to include the pixel rows which , when fired upon by their corresponding rows of electron emitting elements , do not scatter electrons in a manner which significantly charges spacers 351 and 352 . that is , when the pixel rows in display regions 301 , 306 and 311 are fired upon , the electrons which scatter from corresponding light emitting regions 301a , 306a and 311a either fail to reach spacers 351 and 352 , or fail to significantly charge spacers 351 and 352 upon reaching these spacers . regions 301 , 306 and 311 are hereinafter referred to as spacer - neutral regions . in the described embodiment , each of spacer - neutral regions 301 , 306 and 311 is laterally separated from spacers 351 and 352 by approximately 5 to 7 pixel rows . thus , each of spacer - neutral regions 301 , 306 and 311 includes 16 to 22 pixel rows which are located immediately adjacent to the corresponding spacer - charging regions 302 , 305 , 307 and 310 . if , for example , each of spacer - neutral regions 301 , 306 and 311 includes 16 pixel rows , then light emitting regions 301a , 306a , and 311a would each include sixteen rows of light emitting elements , and corresponding electron emitting regions 301b , 306b and 311b would each include sixteen corresponding rows of electron emitting elements . in a particular embodiment , the pixel rows included in spacer - neutral regions 301 , 306 and 311 are those pixel rows which are spaced apart from spacers 351 and 352 by a distance which is greater than 1 . 5 times the distance between light emitting structure 322 and electron emitting structure 332 . in accordance with one embodiment of the invention , electron emitting regions 301b - 311b are activated in the order described below . within each of electron emitting regions 301b - 311b , the rows of electron emitting elements are sequentially activated in the direction indicated by arrow 340 ( fig3 ). the activation order is controlled by a row addressing system of flat panel display 300 . first , the electron emitting elements of electron emitting region 301b are sequentially activated within spacer - neutral region 301 . as previously described , the activation of electron emitting region 301b does not excessively charge spacer 351 . next , the electron emitting elements of electron emitting regions 303b and 304b are sequentially activated within spacer - adjacent regions 303 and 304 . because spacer 351 is not excessively charged at the time that electron emitting regions 303b and 304b are activated , the electrons emitted from these regions 303b and 304b pass to corresponding light emitting regions 303a and 304b without significant deflection due to charging of spacer 351 . in a particular embodiment , electron emitting region 303b is activated before electron emitting region 304b . next , the electron emitting elements of electron emitting regions 302b and 305b are sequentially activated within spacer - charging regions 302 and 305 . in a particular embodiment , electron emitting region 302b is activated before electron emitting region 305b . although the activation of electron emitting regions 302b and 305b causes charge to build up on spacer 351 , this charge is dissipated by the time that the electron emitting regions 303b and 304b of spacer - adjacent regions 303 and 304 are subsequently activated . for example , assuming that flat panel display 300 has a refresh frequency of 70 hz , spacer 351 has approximately 14 . 3 milliseconds in which to discharge before the time that electron emitting regions 303b and 304b are subsequently activated . the electron emitting elements of electron emitting region 306b are then sequentially activated within spacer - neutral region 306 . as previously described , the activation of electron emitting region 306b does not excessively charge spacer 351 or 352 . next , the electron emitting elements of electron emitting regions 308b and 309b are sequentially activated within spacer - adjacent regions 308 and 309 . because spacer 352 is not excessively charged at the time that electron emitting regions 308b and 309b are activated , the electrons emitted from these regions 308b and 309b pass to corresponding light emitting regions 308a and 309b without significant deflection due to charging of spacer 352 . next , the electron emitting elements of electron emitting regions 307b and 310b are sequentially activated within spacer - charging regions 307 and 310 . again , the charge built up on spacer 351 in response to the activation of electron emitting regions 307b and 310b is dissipated by the time that electron emitting regions 308b and 309b are subsequently activated . the electron emitting elements of electron emitting region 311b are then sequentially activated within spacer - neutral region 311 . the activation of other electron emitting regions ( not shown ) of flat panel display 300 continues in the manner previously described for electron emitting regions 301b - 311b . eventually , the activation order returns to electron emitting region 301b of spacer - neutral region 301 and the previously described order is repeated . again , by the time that electron emitting regions 303b - 304b and 308b - 309b of spacer - adjacent regions 303 - 304 and 308 - 309 are activated for the second time , the charge on spacers 351 and 352 have had sufficient time to dissipate . because the electrons emitted from electron emitting regions 303b , 304b , 308b and 309b are routed to corresponding light emitting regions 303a , 304a , 308a and 309a without substantial deflection , the image displayed at the viewing surface of faceplate 321 advantageously does not exhibit dark lines adjacent to spacers 351 and 352 . electron emitting regions 301b - 311b can be fired in other sequences and still fall within the scope of the invention . however , the electron emitting regions 303b , 304b , 308b and 309b of spacer - adjacent regions 303 , 304 , 308 and 309 should not be activated immediately after the activation of the electron emitting regions 302b , 305b , 307b and 310b of spacer - charging regions 302 , 305 , 307 and 310 . in accordance with another embodiment of the invention , spacers 351 and 352 are fabricated such that these spacers exhibit a relatively high dielectric constant . a high dielectric constant is defined as being greater 100ε 0 , where ε 0 is equal to 8 . 85 × 10 - 12 farads / meter . a high dielectric constant can further be defined as being in the range of 400ε 0 to 800ε 0 . as a result of the high dielectric constant of the spacers , the charging time constant associated with spacers 351 and 352 is increased , thereby preventing rapid charging of these spacers . by preventing rapid charge build - up on spacers 351 and 352 , the deflection of electrons emitted by electron emitting regions 303b , 304b , 308b and 309b of spacer - adjacent regions 303 , 304 , 308 and 309 is minimized . in accordance with one variation of this embodiment , the rows of electron emitting elements of flat panel display 300 are activated in the manner described above in connection with the first embodiment . alternatively , the rows of the electron emitting elements of flat panel display 300 can be activated sequentially . in accordance with one variation of the present embodiment , high - dielectric constant spacers are fabricated to include titanium oxide ( tio 2 ), aluminum oxide ( al 2 o 3 ) and chromium oxide ( cr 2 o 3 ) in the percentages listed below in table 1 . by maintaining the percentage of titanium oxide at or about 4 percent , the dielectric constant of the spacer is maintained at a relatively high level . a spacer having the composition listed above in table 1 is hereinafter referred to as a &# 34 ; 4 / 32 / 64 &# 34 ; spacer . a 4 / 32 / 64 spacer exhibits a dielectric constant of approximately 700ε 0 to 750ε 0 at a frequency of 1200 to 1500 hz . in comparison , a spacer having a composition of only 1 . 6 % titanium oxide , 34 . 4 % aluminum oxide and 64 . 0 % chromium oxide exhibits a dielectric constant of approximately 10ε 0 or 11ε 0 at 100 hz . thus , by controlling the percentage of titanium oxide to be approximately 4 percent , a significant increase in the dielectric constant of spacers 351 and 352 is realized . in addition , the 4 / 32 / 64 spacer advantageously exhibits other properties which are considered advantageous in a flat panel display environment . more specifically , the 4 / 32 / 64 spacer exhibits a relatively high sheet resistance of approximately 7 × 10 8 ohms / square . thus , by holding the percentage of titanium oxide at approximately 4 percent , the spacer is maintained within an acceptable range of electrical resistivity . in addition , the 4 / 32 / 64 spacer exhibits a secondary emission ratio in the range of 1 to 2 . 2 at voltages between 1 kv and 4 kv . in one variation of the present embodiment , the 4 / 32 / 64 spacer is fabricated from a slurry created by mixing ceramic powders , organic binders and a solvent in a conventional ball mill . table 2 sets forth a formula for such a slurry . table 2______________________________________aluminum oxide powder 103 . 7 gramschromium oxide powder 207 . 3 gramstitanium oxide powder 12 . 9 gramsbutvar b76 34 gramssanticizer 150 10 gramskellox z3 menahden oil 0 . 65 gramethanol 105 gramstoluene 127 grams______________________________________ in other variations , the ceramic formula also contains modifiers chosen to control grain size or aid sintering . compounds such as silicon dioxide , magnesium oxide , and calcium oxide can be used as modifiers . using conventional methods , the milled slurry is used to cast a tape having a thickness of 60 - 120 μm . in one variation , this tape is cut into large wafers which are 10 cm wide by 15 cm long . the wafers are then loaded onto a flat conventional setter and fired in air and / or a reducing atmosphere until the wafers exhibit the desired resistivity . in particular , the wafers are typically fired in a cold wall periodic kiln using a hydrogen atmosphere with a typical dew point of 24 ° c . if the organic components of the wafer are to be pyrolized ( i . e ., removed ) by the action of heat in the same kiln , the dew point of the hydrogen atmosphere will be higher ( approximately 50 ° c .) to facilitate removal of the organics without damaging the wafers . the dewpoint will be shifted from the higher dew point ( 50 ° c .) to the lower dewpoint ( 24 ° c .) after the organic components of the wafer are pyrolized . pyrolysis is typically complete at a temperature of 600 ° c . typically , the wafers are fired at a peak temperature of 1500 ° c . for 1 - 2 hours . the properties of the ceramic composition are controlled by the detailed firing profile . depending on the starting raw materials , and on the exact combination of strength , resistivity , and secondary electron emission desired in the spacer , the actual peak temperature may be between 1450 ° c . and 1750 ° c ., and the firing profile may maintain this peak temperature from 1 to 5 hours . the wafers are then unloaded , inspected and cut into strips which are used as spacers 351 and 352 . in one variation , these strips are approximately 2 . 25 mils thick , 2 inches long , and 50 mils tall . in addition to controlling the electrical resistivity of the spacers by varying the percentage of titanium oxide , the electrical resistivity of the spacers can also be controlled by controlling the percentage of chromium oxide . by increasing the percentage of chromium oxide , the electrical conductivity of the spacer can be increased . however , increasing the percentage of chromium oxide also increases the required sintering temperature of the spacer material . the electrical resistivity can also be controlled by controlling the partial pressure of oxygen in the furnace during firing or by changing the dewpoint in the furnace by modifying the h 2 to o 2 ratio . fig5 is a schematic diagram of a flat panel display 500 in accordance with another embodiment of the present invention . the present embodiment can be used in combination with the previously described second embodiment , or independent of the second embodiment . in flat panel display 500 , a plurality of spacers , such as spacers 501 - 503 , are connected between a faceplate structure 510 and a backplate structure 511 . each of spacers 501 - 503 additionally includes a corresponding face electrode 501a - 503a which is connected to a common bus 504 . each of face electrodes 501a - 503a is located on an outer surface of its corresponding spacer 501 - 503 at a location between the faceplate structure 510 and the backplate structure 511 . common bus 504 effectively combines the resistances and capacitances of spacers 501 - 503 . common bus 504 also distributes charge among all of spacers 501 - 503 . for example , when a spacer - charging region adjacent to spacer 501 is activated , the resulting charge will be distributed among spacers 501 , 502 and 503 by common bus 504 . this advantageously reduces the charge built up on spacer 501 ( compared to the charge which would have been built up on spacer 501 in the absence of common bus 504 ). although the charge built up on spacers 502 and 503 is increased at this time ( compared to the charges which would have been built up on spacers 502 and 503 in the absence of common bus 504 ), such an increase is acceptable , since the spacer - adjacent regions corresponding to spacers 502 and 503 are not activated until some future time . fig6 is an isometric view of a spacer 601 which can be used in the present embodiment . spacer 601 includes a spacer body 602 , face electrodes 603 - 604 , and edge electrodes 606a , 606b and 607 . in one variation , spacer body 602 is made of the 4 / 32 / 64 spacer material previously described in the second embodiment . alternatively , spacer body 602 is made of another conventional spacer material , including , but not limited to , a solid piece of uniform electrically resistive material such as a ceramic containing a transition metal oxide , or an electrically insulating core having electrically resistive skins . face electrodes 603 and 604 , and edge electrodes 606a , 606b and 607 are made of an electrically conductive material such as aluminum or copper . the fabrication of face electrodes 603 and edge electrodes 606a , 606b and 607 is described in more detail in u . s . patent application ser . no . 08 / 414 , 408 , cited above . face electrodes 603 and 604 and edge electrodes 606a , 606b and 607 control the voltage distribution along spacer 601 . because spacer 601 has a thickness t of approximately 2 . 25 mils , which is relatively small compared to its height h of 50 mils , face electrodes 603 and 604 are only required on one surface of spacer body 602 to control the voltage distribution throughout spacer 601 . a gap 605 exists between edge electrodes 606a and 606b . the dimensions of gap 605 are selected such that edge electrode 606a is electrically isolated from edge electrode 606b . in a particular embodiment , gap 605 has a width w of approximately 50 mils . as described in more detail below , edge electrode 606a provides an electrical connection to the light emitting structure of a flat panel display , edge electrode 606b provides an electrical connection between face electrode 603 and a common bus , and edge electrode 607 provides an electrical connection to the electron emitting structure of a flat panel display . fig7 is a schematic representation of the upper surface of a flat panel display 700 . fig8 is a cross sectional view of flat panel display 700 along section line 8 -- 8 of fig7 . fig9 is a cross sectional view of flat panel display 700 along section line 9 -- 9 of fig7 . flat panel display 700 includes spacers 701 - 707 , faceplate structure 720 , backplate structure 730 , common bus structure 723 and sidewall structure 724 . faceplate structure 720 includes insulating faceplate 721 and light emitting structure 722 . backplate structure 730 includes insulating backplate 731 and electron emitting structure 732 . in the described embodiment , each of spacers 701 - 707 is identical to spacer 601 ( fig6 ). as illustrated in fig7 spacers 701 - 707 extend horizontally across light emitting structure 722 in parallel with the pixel rows of flat panel display 700 . light emitting structure 722 defines the viewing surface of flat panel display 700 . common bus structure 723 is laterally separated from this viewing surface . sidewall structure 724 laterally surrounds the light emitting structure 722 and common bus structure 723 . as illustrated in fig8 sidewall structure 724 extends between faceplate structure 720 and backplate structure 730 . light emitting structure 722 of faceplate structure 720 includes a light emissive material 722a , a matrix 722b and a conductive layer 722c . conductive layer 722c extends outside the outer boundary of sidewall structure 724 and is connected to a power supply 740 . common bus structure 723 includes an insulating strip 723a and a conductive bus layer 723b . in one embodiment , insulating strip 723a is formed at the same time as matrix 722b , thereby assuring that insulating strip 723a and matrix 722b have substantially the same thickness . in a particular variation , insulating strip 723a and matrix 722b are formed from polyimide , and have a thickness t of approximately 2 mils . insulating strip 723a further has a width w of approximately 50 to 100 mils . conductive layers 722c and 723b can also be formed at the same time . the thicknesses of conductive layers 722c and 723b are negligible with respect to the thicknesses of insulating strip 723a and matrix 722b . because insulating strip 723a and matrix 722b have approximately the same thickness , conductive layers 722c and 723b are located at the same distance from faceplate 721 , thereby facilitating contact between conductive layers 722c and 723b and spacers 701 - 707 . still referring to fig8 spacer 707 includes body 757 , edge electrodes 767a , 767b , and 768 , face electrodes 777 and 778 , and gap 755 . spacer 707 is connected between faceplate structure 720 and backplate structure 730 such that conductive layer 722cof light emitting structure 722 contacts edge electrode 767a , conductive bus layer 723b of common bus structure 723 contacts edge electrode 767b , and electron emitting structure 732 of backplate 730 contacts edge electrode 768 . gap 755 electrically isolates edge electrodes 767a and 767b . face electrode 777 is electrically connected to edge electrode 767b as illustrated . each of the remaining spacers 701 - 706 is connected in the same manner as spacer 707 . although not illustrated in fig8 it is understood that the top portion of spacer 707 could be engaged with a spacer support structure on faceplate structure 720 . such a spacer support structure is not illustrated for purposes of clarity . however , such spacer support structures are described in more detail in spindt u . s . patent application ser . no . 08 , 188 , 855 , filed jan . 31 , 1994 , now u . s . pat . no . 5 , 528 , 103 ; and haven , u . s . patent application ser . no . 08 / 343 , 074 , filed nov . 21 , 1994 , now u . s . pat . no . 5 , 650 , 690 , both of which are hereby incorporated by reference in their entirety . as illustrated in fig9 each of spacers 701 - 706 has a corresponding face electrode 771 - 776 which contacts a corresponding edge electrode 761 - 766 in the same manner previously described for spacer 707 . each of edge electrodes 761 - 766 contacts conductive bus layer 723b in the same manner as spacer 707 . as a result , conductive bus layer 723b provides a common bus which connects face electrodes 771 - 777 . in one variation , conductive bus structure 723 has a length l of approximately 8 inches . if the rows of electron emitting elements of electron emitting structure 732 are fired in the direction indicated by arrow 780 , spacer 701 will be the first one of spacers 701 - 707 to be exposed to conditions which could result in spacer charge build - up . however , the common connection of face electrodes 771 - 777 through conductive bus layer 723b increases the effective capacitance of spacer 701 , thereby preventing rapid charge build - up on spacer 701 . the charge buildup rate on spacers 702 - 707 is similarly reduced by the common connection of face electrodes 771 - 777 to conductive bus layer 723b . fig1 is a schematic diagram of a flat panel display 1000 in accordance with another embodiment of the present invention . like the third embodiment , the present embodiment can be used in combination with the previously described first and second embodiments , or independent of these previously described embodiments . because the flat panel display 1000 illustrated in fig1 is similar to the flat panel display 500 illustrated in fig5 similar elements in fig5 and 10 are labeled with similar reference numbers . fig1 additionally includes external capacitor 1010 which is connected between common bus 504 and ground 1011 . capacitor 1010 increases the effective capacitance of spacers 501 - 503 , thereby further increasing the charging time constant associated with spacers 501 - 503 and preventing rapid charging of these spacers . fig1 is a schematic representation of the upper surface of a flat panel display 1100 in accordance with the present embodiment . fig1 is a cross sectional view of flat panel display 1100 along section line 12 -- 12 of fig1 . because flat panel display 1100 is similar to flat panel display 700 ( fig7 - 9 ), similar elements in flat panel displays 700 and 1100 are labeled with similar reference numbers . in addition to the previously described elements of flat panel display 700 , flat panel display 1100 additionally includes a common bus extension member 1101 which contacts the conductive bus layer 723b of common bus structure 723 . in one variation , common bus extension member 1101 and conductive bus layer 723b are fabricated as a continuous element ( see fig1 ). bus extension member 1101 extends along faceplate 721 to a location outside of the outer perimeter of sidewall structure 724 . external capacitor 1010 is connected to the bus extension member 1101 at a point which is outside the outer perimeter of sidewall structure 724 . in this manner , bused face electrodes 771 - 777 are connected to an external capacitor 1101 . this increases the capacitance of spacers 701 - 707 and prevents fast charge build - up on these spacers . fig1 is a schematic diagram of a flat panel display 1300 in accordance with yet another embodiment of the present invention . like the third and fourth embodiments , the present embodiment can be used in combination with the previously described first and second embodiments , or independent of these previously described embodiments . because flat panel display 1300 is similar to flat panel display 500 ( fig5 ), similar elements in fig5 and 13 are labeled with similar reference numbers . fig1 additionally includes a capacitor 1310 which is connected between common bus 504 and voltage supply 1311 . capacitor 1310 increases the effective capacitance of spacers 501 - 503 , thereby further increasing the charging time constant associated with spacers 501 - 503 and preventing rapid charging of these spacers . fig1 is a schematic representation of the upper surface of a flat panel display 1400 in accordance with the present embodiment . fig1 is a cross sectional view along section line 15 -- 15 of fig1 , and fig1 is a cross sectional view along section line 16 -- 16 of fig1 . because flat panel display 1400 is similar to flat panel display 700 ( fig7 - 9 ), similar elements are labeled with similar reference numbers . flat panel display 1400 includes a capacitor structure 1310 which is fabricated on the interior surface of faceplate 721 . as illustrated in fig1 , capacitor structure 1310 is located outside of the viewing surface of display 1400 in a location similar to the location of common bus structure 723 ( fig7 ). as illustrated in fig1 and 16 , capacitor structure 1310 includes first conductive plate 1301 , dielectric layer 1302 and second conductive plate 1303 . in the illustrated embodiment , first conductive plate 1301 is continuous with conductive layer 722c of light emitting structure 722 . that is , first conductive plate 1301 and conductive layer 722c are deposited at the same time to form a continuous layer of conductive material . dielectric layer 1302 can be , for example , a layer of polyimide having a thickness t of approximately 2 mils , a width w of approximately 50 to 100 mils and a length l of approximately 8 inches . second conductive plate 1303 is deposited on the lower surface of dielectric layer 1302 . the combined thickness of plates 1301 , 1303 and dielectric layer 1302 are selected to be equal to the combined thickness of matrix 722b and conductive layer 722c of light emitting structure 722 . as a result , both capacitor structure 1310 and light emitting structure 722 make good electrical contact with spacers 701 - 707 . first and second conductive plates 1301 and 1303 and dielectric layer 1302 form a capacitor . the first conductive plate 1301 of this capacitor is connected to voltage supply 1311 through conductive layer 722c of light emitting structure 722 ( fig1 ). the second conductive plate 1303 of this capacitor is connected to face electrodes 771 - 777 , such that face electrodes 771 - 777 extend in parallel from second conductive plate 1303 . the capacitance of capacitor structure 1310 is determined by the thickness ( t ), cross sectional area ( l × w ), and dielectric constant of dielectric layer 1302 . these parameters can be varied to create a capacitor structure 1310 having the desired capacitance . in the described embodiment , capacitor structure 1310 has a capacitance in the range of approximately 3 to 6 nanofarads . in another variation of the present embodiment , the first conductive plate 1301 is not connected to conductive layer 722c of light emitting structure 722 . instead , first conductive plate 1301 is routed outside the outer perimeter of sidewall structure 724 ( see , e . g ., extension member 1101 of fig1 ) and connected to a ground voltage supply . fig1 is a schematic representation of the upper surface of a flat panel display 1700 in accordance with another embodiment of the present invention . flat panel display 1700 includes a plurality of spacers 1701 - 1705 which are disposed perpendicular to ( as opposed to in parallel with ) the pixel rows . dashed line 1710 represents one of these pixel rows . as the pixel rows of flat panel display 1700 are activated , each of spacers 1701 - 1705 is charged at a location which is immediately adjacent to the activated pixel row . for example , when pixel row 1710 is activated , spacers 1701 - 1705 tend to charge at locations 1701a - 1705a . fig1 is an isometric view of spacer 1701 . spacers 1702 - 1705 are identical to spacer 1701 . spacer 1701 includes spacer body 1711 , edge electrodes 1712 - 1713 and face electrode 1714 . the various elements of spacer 1701 are substantially identical to the elements of spacer 601 , which were previously described in connection with fig6 . face electrode 1714 is located approximately halfway up the height of spacer 1701 and extends along the length of spacer body 1711 , substantially in parallel with edge electrodes 1712 and 1713 . when a particular location along spacer 1701 , such as location 1701a , is subjected to excessive charge , face electrode 1714 allows this charge to be distributed ( and dissipated ) along the length of spacer 1701 as indicated by arrows 1721 and 1722 . consequently , there is no excessive charge build - up along spacers 1701 - 1705 at locations adjacent to activated pixel rows . although the invention has been described in connection with several embodiments , it is understood that this invention is not limited to the embodiments disclosed , but is capable of various modifications which would be apparent to one of ordinary skill in the art . for example , common bus structure 723 and capacitor structure 1310 can be fabricated on the backplate as well as the faceplate . thus , the invention is limited only by the following claims .	7
referring now to the drawings wherein like numerals have been used throughout the several views to designate the same or similar parts , there is illustrated in the drawings a rotating fluid coolant union 10 incorporating the novel sealing arrangement in accordance with the present invention . the fluid coolant union 10 , as shown in fig1 and 2 , is utilized to conduct a fluid coolant either in a liquid or gaseous state from a source of coolant ( not shown ) to a spindle of a machine tool and the like . the spindle could be a machine tool used in the various applications such as machining centers , flexible transfer lines or any environment where fluid coolants such as water - based , oil - based , air - oil mist based and air - based coolants may be used in conjunction with the fluid coolant union 10 . the fluid coolant union 10 is comprised of a rotor or shaft member 12 , coupled to an end cap or housing member 14 . the end cap or housing 14 provides a cylindrical housing for the fluid coolant union with the housing identified as reference numeral 14 . the cylindrical bore 16 of the housing 14 defines a seal chamber 15 which locates the seal assembly 18 within the coolant union 10 . as shown in fig1 and 2 , the seal assembly 18 is comprised of a rotating seal member 20 which is mounted to the end 12 a of the stub rotor member 12 and a non - rotating seal member 22 mounted to the end of a carrier member 24 . the rotating seal member 20 is , preferably , a disc - shaped , one - piece silicon carbide member which provides a generally flat - shaped annular seal surface 20 a about an opening 21 through the center thereof . the non - rotating seal member 22 of the seal assembly 18 is also a generally flat disc - shaped member that is also , preferably , comprised of silicon carbide . the seal members 20 and 22 of seal assembly 18 may be comprised of various silicon carbide grades . the non - rotating seal member 22 includes an opening 23 therethrough and includes an annular seal surface 22 a . the non - rotating seal member 22 is mounted to an end 24 a of a carrier member 24 which is axially movable within the cylindrical bore 16 of housing member 14 . importantly , one of the annular seal surfaces 20 a and 22 a is chamfered to present a narrowed and reduced annular contact seal facing between the floating seal assemblies . it is preferred that the non - rotating seal face surface 22 a is the seal surface that is chamfered . the chamfered portion is shown as beveled portions 25 and 29 in fig1 and 2 . the mating between seal surfaces 20 a and 22 a permits the handling of multiple media , such as water - based , oil - based , air - oil mist based and air - based fluid materials to be used without prolonged dry run conditions . as shown in fig1 and 2 , it has been found that when the width of the annular seal surface 22 a of the seal assembly 18 is narrower than the width of the rotating annular seal surface 20 a then the seal assembly 18 is more capable of operating in an unpressurized running dry run condition without significant damage to the seal members 20 and 22 . the fluid coolant union 10 in accordance with the present invention further includes a secondary seal assembly 26 to prevent leakage of the fluid coolant forwardly of the carrier 24 through the gap 27 between the outer surface of the carrier side wall 35 and the inner surface 17 of the cylindrical bore 16 of the housing member 14 . the secondary seal assembly 26 is comprised of a u - shaped annular sealing member 30 positioned within an annular groove 28 positioned within the inner surface 17 of the housing member 14 that engages the inner surface 17 of the housing member 14 and the outer surface 35 of the carrier member 24 . the u - shaped annular sealing member 30 of the secondary seal assembly 26 , as shown in fig3 , 4 and 5 is a modified u - shaped type annular seal . as shown in fig3 , the u - shaped annular seal member 30 is positioned within the annular groove 28 within the housing member 14 . when the u - shaped seal member 30 is positioned within the annular groove , the lip members 31 and 32 and the foot connection member 33 ( fig5 ) of the annular seal substantially contact the inner and outer surfaces of the annular groove as well as the front surface or the side of the groove opposite the high pressure area , as shown in fig1 and 3 . as shown in fig5 , the u - shaped seal member is comprised of an elastomer type material and includes a chamfered diagonal cut 34 on the foot portion of the seal assembly 30 that is positioned toward the outer surface 35 between the carrier 24 and the cylindrical bore 16 of the housing member 14 . this chamfered cut is sized in relation to a triangular back - up ring 36 to structurally cooperate with the triangular back - up ring 36 ( fig6 ) to provide an unfilled volume which , when pressurized , stores sufficient relative displacement energy ( fig4 ) to the floating seal assembly to create a micro pop - off or separation of the seal faces 20 a and 22 a when the coolant union is depressurized , the condition as shown in fig1 . fig6 represents a cross - section of the annular back - up ring 36 which is comprised of polymer material . this particular specialized plastic material provides a back - up ring that controls the absorption of moisture and controls the hardness of the material as well as controls the machineability of the back - up ring to permit the back - up ring 36 to be structurally arranged to occupy the space and volume within the chamfer cut in the inner wall of the u - shaped annular seal . during the operation of the coolant union 10 in the pressurized operating condition , the u - shaped secondary seal member 30 engages the annular back - up ring 36 to prevent the extrusion of the secondary seal into the gap . because of the precise control of the gap distance between the floating seal assembly and the rotor assembly , a reduced amount of fluid coolant is permitted to pass between the annular seal surfaces 20 a and 22 a of the rotating and non - rotating seal members . the gap between the seal members when the coolant union 10 is in the unpressurized , unoperable condition is minimized and substantially limited because of the pull - back action on the non - rotating seal member during depressurization of the union . thus , the secondary seal assembly provides a sealing function as well as a separation function of the floating seal assembly . because the gap is minimized in the unpressurized condition , a minimum amount of coolant is permitted to pass between this reduced gap during start up of the coolant union . the reduced amount of fluid coolant to pass between the annular seal surfaces 20 a and 22 a results in a cleaner operating and more efficient fluid coolant union . additionally , the radial interference fit between the chamfered u - shaped annular seal 30 and the annular groove 28 within the housing member 14 permits the adjustable setting of the gap between the annular seal faces 20 a and 22 a . this is because the interference fit is less than standard such that upon pressurization of the union , the chamfer on the annular seal 30 and the back - up ring provide a sufficient interaction or displacement energy to create the micro pop - off of separation when the union is depressurized . this permits the adjustment of the floating seal assembly 24 for variable axial locations of the stub rotor member 12 and permits the predetermined relocation and adjustment of the floating seal assembly 24 . while the invention is described with reference to a preferred embodiment , various modifications may be made without departing from the spirit and scope of invention as defined in the appended claims . for example , although the sealing arrangement is described with reference to a stub rotor member 12 , the stub rotor assembly may be contemplated to be a bearingless stub rotor member or may be a rotor assembly that is confined within fixed bearing structures . this permits the present invention to provide a wide range of operation through a coolant union from hundreds of rpms to in excess of 40 , 000 rpms .	5
referring now to the drawing for illustrative embodiments of this invention , reference numeral 1 indicates one illustrative embodiment of self - propelled spherical living space of this invention . the device 1 includes a spherical shell structure 2 divided generally in its interior into an active living space 3 , a power and utility section 4 , and a guidance and stabilizer section 5 . the living space section 3 has window areas 13 . it preferably accommodates two floors , but the number of floors does not constitute a part of this invention . in any case , however , the spherical shell 2 is large enough to accommodate persons for dwelling purposes , to which end it should be on the order of at least 26 ft . in diameter . as is apparent from the drawing , this embodiment of the device is intended to be self - propelled , and a cockpit area is provided within the shell behind the window or windshield 11 . suitable access doors , such as indicated at 12 are also provided . in the upper part of the shell are emergency parachute hatches 14 , below which are parachutes , best shown in connection with a different embodiment in fig1 , stored in such a way as to release automatically in the event of an emergency landing . in this embodiment , two different supporting structures are provided , one in the form of telescoping , shock - absorbing landing gear 16 , which may be provided with wheels 17 , and pontoons 20 and 21 , which are arranged in sets projecting chordally from the shell , spaced apart and parallel to one another as shown in fig4 . the pontoons 20 and 21 are mounted to be extensible and retractable , the outer ends of the pontoons being contoured to conform with the contour of the shell when they are retracted . suitable mechanical or hydraulic mechanisms for extending and retracting such element are well - known , as are suitable mechanisms for retracting and extending landing gear . this embodiment of the device is provided with four distinct but cooperable propulsion systems . one propulsion system is a helicopter type . in the embodiment , three sets of helicopter blades 29 are shown , mounted on independently rotatable , concentric shafts 129 , which can be driven by a conventional power plant 229 , of the general type shown by gorton u . s . pat . no . 3 , 261 , 572 or apostolescu , u . s . pat . no . 2 , 950 , 074 , preferably mounted within the power and utility section 4 . the helicopter blades and shafts are preferably designed to permit the shafts to be retracted until they are substantially flush with the surface of the shell 2 and the blades are preferably made to fold within a recess provided , to conform to the contour of the shell , when they are not in use . it will be appreciated that the torque and counter - torque of the rotating blades will be balanced conventionally . in the embodiment shown , four jet engine pods 35 , housing jet engines , are mounted on each side of a center line parallel to the axes of the pontoons , as best shown in fig3 and 4 . the pods and their engines are pivotally mounted to permit their selective movement between a position at which a jet issuing from them moves parallel to the axes of the helicopter blade shafts and a position at which the jet is directed perpendicularly thereto . as indicated in fig1 a pair of propellers , spaced from one another and mounted for rotation on shafts extending substantially parallel with the long axes of the pontoons are provided within the guide and stabilizer section 5 . this section of the shell is provided with openings , covered by a screen or lattice or shutter arrangement . the opening behind each propeller extends entirely , chordally , through the shell in a direction parallel to a plane parallel to the long axes of the pontoons . within that space , in effect a conduit through the shell , in this embodiment are set within the air stream from the propellers 40 , which normally would pass diametrically and linearly through the conduit , vertical rudders 41 , hingedly mounted at 42 for selective movement to direct the stream of air from the propellers to one side or the other of its original direction of flow , and horizontal directing ailerons 46 , hingedly mounted for selective movement up and down around a hinge 47 to direct the stream of air from the propellers upwardly or downwardly from its initial direction as the stream of air issues from the opening through the shell at the remote edge of the shell from the propellers . in this embodiment , the device is also equipped with four rocket engines 50 . these engines are equipped with nozzles which are preferably directed to produce lift in the direction of the axis of the helicopter shaft . it is apparent that for ordinary flight , the helicopter blades 29 , together with the propellers 40 will be adequate to accomplish the movement of the device through the air . however , at great altitudes and speeds , the effectiveness of the helicopter blades and propellers will be diminished , and the effectiveness of the jet engines and rockets will increase , so as to make them the preferred means of propulsion . referring now to fig6 through 8 for another embodiment , reference numeral 60 indicates the device . basically , the device 60 is the same as the device shown in fig1 through 5 , 9 and 10 . however , it differs in several important respects . a living space 63 of this embodiment is larger , by virtue of the moving of the guidance and stabilizing section down . dynamo - electric machines 66 , with propellers 67 , exposed to the atmosphere , are provided so arranged that when the propellers are driven by the dynamo - electric machines acting as motors , they assist in the propulsion and guidance of the device , and when the propellers are driven by the rush of air during descent , for example , they act as generators in a braking mode . in this embodiment , the chief departure from the embodiment first described , lies in the construction of pontoons 68 , which have cylindrical tubes 69 equipped at their outer ends with coupling members which at one end take the form of truncated conical or cup - shaped couplers 70 , and at the other end , ball - shaped couplers 71 . the cup - shaped couplers 70 have within them retainers 72 , which can take the form of expansible and contractible rings , or a series of releasable locking lugs . in any event , the retainers 72 permit the entrance of a ball 71 and its capture , selectively . those skilled in the art will recognize that there are countless practical ways of accomplishing the capture of the balls 71 and their selective release , the coupling art being an old and crowded one . in this embodiment , access doors are provided along a center plane through the axes of the helicopter shafts and parallel with the long axes of the pontoons , and extendible gangplanks or walkways with enclosing vestibule - type walkway enclosures are provided whereby a series of devices can be coupled and linked , to form a train of the devices . because all of the individual devices are self - propelled , they are capable of ascending and progressing as a train through the air . referring now to fig1 , reference numeral 110 indicates still another embodiment of device of this invention , the elements of which will be clear from the description of the embodiment shown in fig1 through 9 . in this embodiment , a set of helicopter blades 129 is shown in its folded condition , and parachutes 111 , issuing from emergency parachute hatches 114 are shown as lowering the device to earth in an emergency situation . if such an emergency occurs while the helicopter blades are in use , they can be locked against rotation to prevent the operation of the parachutes . it will be observed that in this embodiment no pontoons are provided . although such a device will float in an emergency , it is designed chiefly for land use , being less stable on water than the embodiment with pontoons . numerous variations within the scope of the appended claims will occur to those skilled in the art in the light of the foregoing disclosure . the shell is preferably made of light material , such as aluminum , but it may be made of any suitable material , and may be thoroughly insulated and made virtually impregnable to fire , water and wind . the fact that a sphere provides the most volume for a given surface area makes its construction inexpensive compared with conventional shapes , and efficient in terms of heating and cooling . suitable utility connections can be provided through the power and utility section , to permit attachment to existing or permanent water , electric , gas and sewage facilities . the spherical shape tends to make the living module of this invention buoyant , and the function of the pontoons is chiefly to provide stability to the module when it is water borne , although they can , of course , provide any additional buoyancy which seems desirable . a large number of small apertures in the shell can be and preferably are provided that can be put into immediate communication with a source of heat insulative or absorbent fluid ( gas or liquid ), which fluid , when released through the apertures , forms a protective barrier between the shell and an external source of heat .	1
fig1 shows one example of an apparatus for flowing liquefied gases to which the present invention is applied . in fig1 reference numeral 1 designates a body of a liquefied gas storage tank . the liquefied gases are introduced into the tank from a bomb ( not shown ) and stored therein . the liquefied gases are made to flow down from a valve device 2 provided on the bottom and filled into cans c continuously transported by a conveyor 3 . the valve device 2 has a valve seat 4 and a needle 6 , fitted in a tapered portion of a valve opening 5 of the valve seat , to effect opening and closing of the valve and adjustment of an opening degree . an upper end of the needle 6 is connected to a plunger 7 of a solenoid 8 which is a means for opening and closing the valve . the plunger 7 is attracted by the operation of the solenoid 8 to open the valve . in the plunger stroke of the solenoid 8 is positioned a valve opening - degree control rod 9 for defining a stroke of the plunger 7 . the opening - degree control rod 9 is controlled in its position by a pulse motor 10 to control the opening degree of the valve to follow the line speed . the amount of movement of the opening - degree control rod 9 is always detected by a potentiometer 22 which is a valve opening - degree detector . reference numeral 11 designates a direction changing nozzle for obliquely guiding a flow of liquefied gases flowing down from a liquefied gas flow valve . the direction changing nozzle 11 has a nozzle orifice 12 inclined in a direction of transporting the can c . the flow of liquefied gases flowing down from the flow valve flows down through the nozzle orifice 12 thereby imparting a speed component in a direction of transporting the can to relieve the shock produced when reaching a liquid level of the can c and prevent scattering of the liquefied gases outside of the can . the nozzle orifice 12 is in the shape of a v or a diamondshape which is large enough with respect to the flow amount and is converged into a single streak without diffusion of the flow liquid , and the average effect resulting from the downwardly inclined surface may be obtained . a heater 13 is provided to prevent a flow turbulence resulting from generation of frost at the nozzle orifice 12 . fig2 shows a liquefied gas filling line to which the liquefied gas flow apparatus is applied . in fig2 a filling machine 14 fills the content liquids into the can . the liquefied gas flowing apparatus is shown as numeral 15 and a seamer is shown as 17 . the can is filled with the content liquid by the filling machine 14 . the liquified gas is added to the head space by the liquefied gas flow apparatus 15 while being transported to the seamer 17 by means of a conveyor . a can lid is supplied to an opening by a can - lid turret 16 and the seaming of the can lid is carried out by seamer 17 . the control method for the aforementioned liquefied gas flowing apparatus will be described hereinafter . fig3 is a block diagram of control apparatus . the control apparatus comprises a detection unit , a condition setting unit , a central processing unit and a control output unit . data for conversion of a line speed to a valve opening amount and control program are stored in the central processing unit cpu . the detection unit comprises a speed converter , a seamer stop detector , a can detection sensor 20 and a valve opening - degree detector , which are connected to an input port of the cpu . in the speed converter , a cam top of a speed detection cam 18 provided on a drive shaft of a can - lid supply turret 16 , shown in fig2 is detected by a speed detection sensor 19 , the detection signal being converted into a line speed . the seamer stop detecting unit detects the stop of a seamer 17 by not receiving a detection signal for a fixed period of time from the speed detection sensor 19 . the speed detection cam 18 is not necessarily provided on the drive shaft of the can - lid supply turret 16 but may be provided on another drive shaft . the seamer stop signal does not depend on the output of the speed detection sensor 19 but an operating signal for the seamer 17 may be introduced from a seamer control panel . the condition setting unit comprises a table preparation data setting unit comprising a speed setting unit and an opening - degree setting unit for high speed , a speed setting unit and an opening - degree setting unit for low speed , and setting unit for an undulation absorbing width , and a control parameter setting unit comprising an instantaneous value control and setting unit and an average number setting unit . the condition setting unit is connected to an input port of the cpu . the line speed always varies finely due to variations of the load of the seamer 17 , and the like , as shown in fig6 and also has a long periodic undulation . the measured value always varies due to an error in construction of a cam top of the speed detection cam 18 and the like . when the opening degree of the valve is controlled accurately to follow the fine variation in speed a deterioration in the service life of a potentiometer 22 of the opening - degree detector and the opening - degree adjusting means occurs . however , it has been proven from experiments conducted by the present inventor that if variation in measuring speed is within a fixed range , a problem will not occur even if the opening degree of the valve is not accurately followed . in view of the aforesaid fact , in the present embodiment , the opening degree of the valve is made constant with respect to the speed variation within a fixed range so as to protect the valve opening - degree detector and the valve opening - degree setting means . the aforementioned setting unit for an instantaneous value control and the average number setting unit are provided to set the control parameter therefor . since the error in the cam top can be absorbed by taking an average with integer times of the number of tops of a cam , control can be effected at the speed of the average value . however , if control with an average value is always effected , the followability when the seamer 17 is varied in speed is insufficient . it is therefore designed so that when a difference between the average speed and the instantaneous speed exceeds a fixed value , the opening degree of the valve is made to be varied for each can . the aforementioned instantaneous value control and setting unit is provided to set a threshold in the variation range when shifting to control an instantaneous value . the average number setting unit is provided to set the average number used in control of the average value . on the other hand , the setting unit for undulation absorbing width is provided to set the range by making an opening of a fixed portion constant in a high speed region of a speed / opening degree conversion table to absorb the undulation of a seamer speed . influence of variation in measuring speed on variation in valve opening - degree is greater at the time of high speed . for example , in case of 600 cpm ( cans per minute ), if the number of pulses passing through a can is 500 pulses , the number of pulses passing through a can at a high speed of 1200 cpm is 200 pulses . accordingly , in the case where variation by one pulse is present , at the time of low speed , variation is 1 / 500 whereas at the time of high speed , it is 1 / 250 . at the time of high speed , even for a minute variation , the control of the valve opening - degree immediately responds . however , in the high speed region , even if the valve opening degree is made constant with respect to variation in speed in the fixed range , variation in internal pressure of the can , can be ignored . for example , as shown in fig5 where a can has a standard internal pressure , 1 . 8 kg / cm 2 , a value of 1200 cpm ± 20 cpm is set to be constant . thus , the internal pressure at 1180 cpm is 1 . 85 kg / cm 2 and the internal pressure at 1220 cpm is 1 . 75 kg / cm 2 . the difference therebetween is merely 0 . 05 kg / cm 2 , which is an amount that may be ignored when compared with an unevenness ± 0 . 5 kg / cm 2 of the internal pressure in general filling of liquid nitrogen . on the basis of the aforementioned knowledge , the present invention has intended to prolong the service life of the valve opening - degree control apparatus by making the opening degree constant in a fixed range of the high speed region of the speed / opening - degree conversion table as shown in fig5 . the aforesaid fixed range can be set under the optimum condition by making suitable presetting possible . the relationship between the line speed and the valve opening - degree according to the aforementioned control method is shown in fig6 . the control output unit comprises a pulse motor 10 for changing an opening degree and an opening - degree indicator . the control output unit is connected to an output port of the cpu . control of flowing of liquefied gases in the apparatus for filling liquefied gases organized as described above is carried out as follows : in the case where the line speed is high , such as 1200 cpm , a fixed line speed is set by a speed setting unit for high speed , and an amount of the valve opening - degree at the speed is set by an opening - degree setting unit in consideration of the filling condition or the like . the undulation absorbing width at the speed region is set by the setting unit for an undulation absorbing width and input into the cpu . in the cpu , a speed / valve opening conversion table is prepared on the basis of these inputs . in the case where the line speed is in a region of low speed , such as 600 cpm , table preparing data is input by the speed setting unit and opening - degree setting unit for low speed . next , as a control parameter , a difference between the average speed and instantaneous speed shifting to control an instantaneous value is input to the setting unit for an instantaneous value control , and an average number used for control of an average value is input to the average value setting unit and input into the cpu . in this manner , when the condition setting unit is provided and a program is started , a pulse is generated every detection of a cam top by the speed detection sensor 19 , and the pulse width is counted by a short pulse produced by the speed converter to thereby convert it into a line speed which is read in the cpu . at that time , when the speed detection sensor 19 does not produce pulses for a predetermine period of time , a seamer stop signal is input from the seamer stop detection unit , as a consequence of which the valve is closed . accordingly , when the seamer stops , due to the occurrence of jamming , in the state wherein a can is present , the flow of the liquefied gases momentarily stops , thus preventing a waste of the liquefied gases and occurrence of defective cans . it is noted that the seamer stop signal can be directly input from the control panel for the seamer . a speed detection signal is read whereby a valve opening - degree is arithmetically determined based upon the line speed / valve opening - degree conversion table . a control signal is output to the pulse motor 10 for changing an opening - degree compared with a signal from the valve opening - degree detector to control a position of the opening degree control rod 9 and set the valve opening - degree . when a can - present signal is provided from the can detection sensor 20 , the solenoid 8 is actuated to immediately open the valve . since the valve opening and closing means and the valve opening - degree adjusting means are dependently provided so as to independently control the valve opening degree , accurate valve opening - degree can be obtained even in the early stage of operation . the above - described control flow is shown in a flow chart in fig7 . as described above , the valve opening - degree is controlled to follow the speed of the line , and the liquefied gases flows down from the valve . the liquefied gases from the valve is applied with a speed component in a direction of transporting a can by the direction changing nozzle 11 and filled into cans moving thereunder . the speed component in a direction of transporting a can is applied to the flow of liquefied gases to thereby relieve the shock produced when reaching a liquid level in the can . scattering of liquid can be satisfactorily prevented without the provision of a porous tray in the midst portion as in prior art . since the tray is not provided , the change in the valve opening - degree directly serves as the change in the filling amount in the can , thus providing the high speed followability when the valve opening - degree is changed .	1
reference now should be made to the drawing , which is directed to a preferred embodiment of the invention used for converting analog information to a digitized form . one useful application of the embodiment of fig1 is to convert the analog information of a joystick potentiometer to a digitized form for utilization in conjunction with computer games employing such an input . such systems are disclosed in the above - mentioned copending applications , the disclosures of which are incorporated herein by reference . it should be noted , however , that the circuit of fig1 is suitable for use with any type of varying analog voltage which is to be converted to digital form for utilization by a computer system or other suitable utilization device . as shown in fig1 a joystick potentiometer 10 is connected between a source of supply voltage ( vdd ) 11 and a constant current : source 12 . the slider or output 14 of the potentiometer 10 ( the joystick axis ) is positioned by a joystick lever ( not shown ) in a conventional manner . the analog input also could be obtained from any other suitable source of analog signals . as is well known , the position of the slider 14 on the joystick resistor 10 causes a voltage to be supplied which is representative of the resistance between the vdd voltage at 11 and the current source 12 . because the use of analog joystick potentiometers for computer games is well known , the various controls and interconnections between such joysticks and other portions of a computer game are not shown , since these various controls and circuits are standard . the additions which are provided by the preferred embodiment of the invention , however , are shown in detail in fig1 . the output of the potentiometer at 14 is an analog voltage , as described above . this output is supplied to the input of an eight bit analog - to - digital converter ( adc ) 16 . the adc 16 continuously provides an eight bit digital representation of the analog voltage supplied to it from the output 14 of the joystick potentiometer 10 . this output is supplied to a joystick position register 22 , which typically is an eight bit count down register . the output of the register 22 , in turn , is supplied over a lead 24 to the bus interface 20 in the system . in some systems , the output of the position registers 22 may be supplied through zero detection logic to detect whenever the position register 22 reaches a zero count for supplying an interrupt to the bus interface circuit 20 . in other systems , the output of the joystick register 22 is supplied directly over the lead 24 to the bus interface 20 where the computer system resolves the joystick position absolutely by , reading the digital value temporarily stored in the joystick position register 22 . in the operation of the system of fig1 in an analog mode , a counter ( included with the joystick position register 22 ) may be started by a game write pulse followed by polling game reads , as described in the above identified co - pending applications . in this mode of operation , the game write loads the counter in the position register 22 with the current adc value from the joystick , and the continues to count down until a zero count is reached . once the zero count is reached , the joystick register bit for that access ( only one of which is shown in fig1 ) is set . this produces an analog position interrupt over the lead 24 . software operating through the bus interface 20 checks to see if this bit is set , and resolves the joystick position by measuring the time between the start of the count and when the count reached zero . this operation and the manner in which it is effected is not important to the circuit of fig1 which may be used in conjunction with other types of systems . for that reason , the details of this zero detection logic and production of the position interrupt is not shown in fig1 . in the system shown in fig1 the joystick position register output also is supplied to a position compare logic circuit 26 , which is employed to compare a delta threshold value 28 supplied through the bus interface , with the position which is stored in the joystick position register 22 to produce a digital position interrupt signal 30 whenever a comparison is effected through a count down of the signal in the joystick position register 22 . when this occurs , a digital position interrupt signal 30 is supplied to the bus interface for utilization by the system . in addition , the position compare logic . 26 supplies an output to a position timeout counter 34 located in a digital power management circuit 32 whenever a change occurs in the information stored in the register 22 . the position timeout counter 34 detects how long it has been since any change was detected on the joystick position register 22 . each time such a change occurs , a reset signal is supplied to the position timeout counter 34 to reset it to an initial or zero count . the counter 34 then continuously runs to produce a timeout pulse after a preset time interval . as long as continuous activity takes place in voltage changes to the adc 16 from the joystick output 14 , the reset pulses applied to the timeout counter 34 occur at a frequency which is greater than the timeout frequency of the counter 34 . in this mode of operation , no timeout or output pulse is obtained from the timeout counter 34 . as is apparent from an examination of fig1 the clock pulses which are supplied to the eight - bit adc 16 originate from a clock 38 and are supplied through a programmable clock divide circuit 36 . as mentioned above , these clock pulses from the programmable clock divider 36 , for a system operating at its highest performance level , may be on the order of 200 , 000 analog - to - digital conversions per second . if no activity or a low level activity of input changes from the joystick input 14 occur , the joystick position register 22 does not undergo any changes ; and no output pulses are obtained from the position compare logic 26 . under these conditions of operation , the position timeout counter 34 reaches its timeout or maximum count ; and a signal is produced to change the division ratio of the programmable clock divider 36 . the status of the programmable clock divider 36 is provided over a status lead 40 to the bug interface 20 ; so that the computer system which is utilizing the information supplied over the lead 24 is alerted to the clock rate or clock status provided by the programmable clock divider 36 . under normal high activity modes of operation , the clock signals supplied by a fast conversion clock 38 are supplied through the programmable clock divider 36 at a relatively high frequency , as described above . whenever the output of the position timeout counter 34 reaches its final count , however , the signal supplied from the timeout counter 34 to the programmable clock divider 36 changes the division ratio of the clock divider to reduce the clock pulse frequency . as illustrated in fig2 and 3 , this ratio may take one or the other of two forms . as shown in fig2 the programmable clock divider 36 may be programmed by the signal from the counter 34 to change the division ratio of the clock to reduce the frequency of the pulses . this is shown in fig2 where high frequency pulses are shown at both the left - hand edge and the right - hand edge of the figure . whenever a timeout signal is applied to the divider 36 , however , the division ratio changes to provide a much lower frequency clock signal , as illustrated by the central portion of fig2 where the clock pulses are widely spaced apart compared to the compressed or high frequency clock pulses at both ends of the signal of fig2 . these low frequency pulses then continue to be applied to the adc unit 16 to operate it in a &# 34 ; standby &# 34 ; mode of operation . as soon as any activity is detected on any of the joystick axes , however , the output of the adc 16 is supplied to the position register 22 . this changes the information stored in the position register , resulting in the production of a reset signal to the counter 34 through the position comparison logic 26 . this resets the timeout counter 34 and releases the programmable clock divider 36 back to its original mode of operation , producing high frequency signals from the fast conversion clock 38 through the programmable clock divider 36 , thereby resuming the normal maximum performance conversion for the adc 16 . it should be noted that the programmable clock divider 36 also may be programmed to resume the normal high frequency conversion clock by way of the commands over the lead 40 from the bus interface 20 . fig3 illustrates an alternative mode of operation for the programmable clock divider 36 . in fig3 the reduction of clock signals from the clock divider 36 is all the way to &# 34 ; zero &# 34 ; frequency ; so that no clock pulses are applied to the eight - bit adc 16 until activity is detected by a change of the potential on the joystick axis at the input 14 . as soon as this occurs , the programmable clock divider 36 is released to provide high frequency clock pulses in the same manner described above for the description of operation of the production of clock signals shown in fig2 . in the mode of operation shown in fig3 high frequency packets or bursts of fast conversion clock signals from the clock 38 are produced . fig3 shows this by illustrating the high frequency packet of clock pulses at the left - hand end of the time line of fig3 . then there is a flat period where no clock pulses are passed through the programmable divider 36 ( indicating timeout of the position timeout counter 34 ). once activity resumes , the programmable divider 36 is released to pass the fast conversion clocks 38 , as illustrated on the right - hand end of the waveform shown in fig3 . although the preferred embodiment of the invention described above is made in conjunction with illustrating the manner in which digital clock controls are used for a joystick adc application , the power management which is described may be used in any adc device where an automatic power - up feature is desired . for example , a common audio codec microphone input may be employed with this system , where the codec sample clock is slowed down to a slow sample rate enough to detect voice / music activity on the input of the microphone . once activity is detected , the digital logic automatically increases the sample clock back to its original desired frequency in the same manner described above for the operation with a joystick . for devices which do not operate under slower clock frequency ( possibly due to synchronization or stability issues ), the proper frequency clocks can be burst into the adc device and then shut down , as shown in the waveform of fig3 . the overall system operation , however , is the same whether a slower frequency clock as shown in the waveform of fig2 is employed , or is employed , or the bursts of frequency as shown in fig3 are employed . other modifications will occur to those skilled in the art for performing substantially the same function , in substantially the same way , to achieve substantially the same result , without departing from the true scope of the invention as defined in the appended claims .	8
embodiments described herein generally relate to use of a a gas decomposition reactor such as a fluidized bed reactor to make high purity polysilicon , as described in u . s . pat . no . 4 , 820 , 587 and 4 , 883 , 687 , which are incorporated herein in their entirety . a gas decomposition reactor contains and facilitates the chemical decomposition of a substance into two or more basic components . chemical decomposition is a separation of a chemical compound into elements or simpler compounds . the chemical compound may be supplied in the form of a gas , liquid , or solid . the gas decomposition reactor is a vessel with an inlet for receiving the chemical compound . the chemical compound is introduced into the vessel through the inlet and then subjected to an agent for causing a catalytic decomposition reaction , electrical current for causing an electrolytic decomposition reaction , or direct heat or radiation for causing a thermal decomposition reaction . once the chemical compound is broken down into elements or simpler compounds , these products and by - products are removed from the vessel . the products and by - products may be a mixture of solids and gases . these embodiments also apply generally to any decomposition reactor where the gas is decomposed to a mixture of solid and gaseous by - products , such as a free space reactor , or a siemens reactor . more specifically , embodiments described herein relate to depositing silicon via chemical vapor deposition in a fluidized bed of particles . the method described herein is not limited to this particular process or configuration of reactor , but is applicable to other types of reactors chemically related to the operation of a continuous fluidized bed reactor . referring to fig1 , a fluidized bed reactor of one embodiment is generally indicated at 10 . the fluidized bed reactor 10 generally includes a reactor vessel 12 that defines a reactor chamber 14 . an inlet 16 provides an inlet gas having a mixture of a reaction gas 18 or silane or first gas and a fluidizing gas 20 or hydrogen or a second gas to the reactor chamber 14 . the reaction gas 18 is supplied to the inlet 16 from a reaction gas source 22 and the fluidizing gas 20 is supplied to the inlet from a fluidizing gas source 24 . off gas is exhausted through an outlet 26 . the reactor chamber 14 is supplied with particles through a feeder tube 28 and larger particles / solids are removed from the reactor chamber 14 through an emptying tube 30 . the fluidized bed reactor 10 also includes a processor or feedback control system 32 connected with a raman spectrometer 34 and a pressure - flow control system 40 . the raman spectrometer is connected with two raman probes 36 and 38 . a first raman probe 36 is connected with the outlet 26 to determine the chemical composition of exhaust gases exiting the reactor chamber 14 . a second raman spectrometer 38 is connected with the inlet 16 to determine the chemical composition of the gas mixture entering the inlet 16 . the raman spectrometer is sensitive only to the number density of molecules in the probe and not their flow rate . therefore , the mixture of the reaction gas 18 and the fluidizing gas 20 is measured before entering the inlet 16 so calibration drift of the probe are canceled out on measured gases . separate measurement of the unmixed gases is prone to error due to relative drifts in calibration of different probes . the pressure - flow control system 40 includes a reaction control valve 42 connected with the reaction gas 18 and a fluidizing control valve 44 connected with the fluidizing gas 20 . the reaction gas 18 passes from the reaction gas source 22 through the reaction control valve 42 before mixing with the fluidizing gas 20 the raman spectrometer 38 and entering and then the inlet 16 . the fluidizing gas 20 passes from the fluidizing gas source 24 through the fluidizing control valve 44 before entering the raman spectrometer 38 the inlet 16 . the processor 32 of this embodiment receives signals from the raman probes 36 and 38 , via the raman spectrometer 34 , to determine the chemical composition of the mixture of reaction gas 18 and the fluidizing gas 20 , and the exhaust gas . the chemical composition of the gases is then analyzed by the processor 32 . the conversion of silane gases to silicon in fluidized bed reactors is calculated using raman spectra taken at inlet and outlet streams . the conversion efficiency is determined by ratiometric measurements , which do not rely on gas density or viscosity . silane , disilane , and hydrogen gases are detected simultaneously allowing feedback control of process conditions in real time . the flow rates of the reaction gas 18 and fluidizing gas 20 is adjusted using the pressure - flow control system 40 . use of the above embodiments permit the detection of gaseous by - products , such as disilane ( si 2 h 6 ) in the example if sih 4 decomposition , allowing conversion efficiency to be calculated based on the existence of a di silane content . the conversion efficiency changes correlating to exhaust filter pressure drop is a transient that can be detected by the in - line measurement . similarly , in the case of halosilane decomposition , the relevant gaseous by - products are also accounted for in the mass balance . during operation , the fluidized bed reactor 10 is supplied with particles ( not shown ) introduced into chamber 14 through feed tube 28 . the particles in chamber 14 are fluidized by the fluidizing gas 20 introduced through the inlet 16 . as the reaction gas or silane 18 passes over the surfaces of the particles within the reaction chamber 14 , silicon is deposited on the particles , which grow in size . when the particles become too large to be supported by the fluidized gas 20 , the larger particles fall down and are removed from chamber 14 through emptying tube 30 . as the fluidized bed reactor 10 operates , the raman probes 36 and 38 transmit optical signals ( spectra ) of the chemical composition of the gas mixture in the inlet 16 and outlet 26 to the raman spectrometer 34 . the raman spectrometer 34 determines the chemical composition of the gases in the inlet 16 and outlet 26 , and provide the processor 32 with signals representing the chemical composition of each of the gases . the processor 32 determines the efficiency of the chemical conversion within the reaction chamber 14 . the processor 32 then calculates a flow rate ratio of reaction gas to fluidizing gas that would yield optimum conversion . the processor 32 communicates accordingly with the control system 40 to optimize the flow rate of the reaction gas 18 and fluidizing gas 20 by manipulation of reaction control valve 42 and / or fluidizing control valve 44 . the chemical conversion efficiency is then reevaluated through a real - time feed back control loop to continuously adjust the gases being supplied to the reaction chamber 14 based on the chemical composition of the exhaust gas exiting the reaction chamber . in another embodiment , a sampling system is shown in fig2 and generally indicated at 100 . the sampling system 100 is connected with the inlet 16 and outlet 26 of the fluidized bed reactor 10 through a sample inlet 112 , a vent 114 , a calibration gas source 116 , and a bypass or vacuum 118 . the sampling system 100 includes a flow meter 120 , a pressure gauge 122 , a thermometer 124 , a pair of filters 126 and 128 , and a single raman probe 130 . in this embodiment one raman probe is shown , but more than one raman probe may be used . the raman probe 130 is used to determine the chemical composition of gases in each the inlet 16 and outlet 26 of the fluidized bed reactor 10 in sequential steps . during a first step of determining a chemical composition of an inlet gas in the inlet 16 , the inlet gas first passes through a filter 128 to remove decomposed particles . the temperature of the inlet gas is then measured by the thermometer 124 . next , the chemical composition of the inlet gas is determined by the raman probe 130 . the pressure of the inlet gas within the system is then determined by the pressure gauge 122 , and the flow rate is determined by the flow meter 120 before the inlet gas is evacuated from the system . during a second step , a calibration gas is supplied from the calibration gas source 116 . the calibration gas acts to both clean the sampling system 100 by removing the inlet gas and as a calibration tool . the calibration gas passes through the system in the same way as the inlet gas . however , the chemical composition of the calibration gas is known and provides a standard , or a predetermined set of values , to ensure that the sampling system 100 is maintained in a calibrated state to ensure the accuracy of the readings of the raman probe 130 . calibration is performed with pure gas such as silane 132 , hydrogen 134 , nitrogen 136 , and argon 138 . the pressure 122 and temperature 124 of the gas are measured with the pressure gauge 122 and thermometer 124 , respectively , to determine the absolute density of the gas at the time of calibration . the gas &# 39 ; s raman signal at probe 130 is linearly proportional to the absolute density of the gas . the absolute reference is the pressure gauge which , is selected for linear response and precision . during a third step , the chemical composition of an outlet gas in the outlet 26 is determined . the outlet gas travels through the sampling system 110 in the same way as the inlet gas . currently , raman light scattering is the only optical solution that can simultaneously detect h 2 and sih 4 . traditionally , raman scattering has not been used for low pressure gas applications due to poor sensitivity . however , a camera using a chilled charge coupled device ( ccd ) detector having quantum efficiencies on the order of 10 to 70 % is used to overcome this problem . chilled ccds have extraordinarily low dark current ( signal due to thermal fluctuations in the detector ) and low read noise ( spurious signals in the electronic circuitry ). a raman spectrometer with a high throughput optical system and a probe specially designed for efficient collection of scattered light can be used for low pressure gas measurements . in gas phase measurement , the raman signal is intrinsically linear in the number of molecules in the path of the laser beam . unlike a gas chromatography ( gc ), a raman spectrum can be used to determine unknowns from structural information implicit in the spectra . the absolute raman scattering factors of the gases involved must be known to design the instrumentation . these may be computed in the absence of data standards . for evaluation of equipment , absolute raman scattering factors were computed using the theory of georg placzek , and the gamess ab initio quantum chemistry code . an expression for the signal is examined to understand why raman spectroscopy is well suited for this application , and then a discussion is provided for how the signal is processed . a given line in watts of raman intensity is given by the expression below . the efficiency of the detector , geometric factors , and the temperature of the gas are taken into account for instrument specific factors . if the system were not a gas system , a correction for the refractive index would be required . in this expression , h is planck &# 39 ; s constant , c is the speed of light , λ is the wavelength of the laser , v ″ shift is the raman shift with respect to the laser line in 1 / cm , p laser is the laser power in watts , l e is the path length of the exposed gas in the detection cell , p is the molar density of the gas , n a is avogadro &# 39 ; s number , c e is the collection efficiency of the optics as a cross - section , q e is an empirical expression for the quantum efficiency detector at the absolute wavelength of the signal , and is the absolute frequency of the raman line . the absolute scattering factor of the molecule is a r , in units of å 4 / amu . the value of a r can be measured experimentally or calculated by quantum mechanical methods . the detected signal intensity in watts divided by hv sig is i electron ( in the ccd ) counts , where v sig is the detected frequency of the photon . in a measurement of a gas composition where the signal ratios are the only interest , v sig = v 1 and v ′ shift = v ′ 1 for gas 1 , and v sig = v 2 and v ′ shift = v ′ 2 for gas 2 . therefore , inserting these values into the expression for raman intensity results in the expression for i 1 / i 2 . the ratio does not depend on the laser power , or physical characteristics of the optical cell . in mass balance calculations that only depend on the signal ratio changes in properties which change in time of the optical system , such as connection and reconnection of the optical cable or of deposition of dust on the windows or mirrors , which cancel out . the calibration coefficients are temperature dependent , but if the temperature of calibration is the same for both gases , and the measurement of the sample is close to the calibration temperature , the temperature effect is negligible . this is equivalent to the approximation that : this is a good approximation at room temperature . if the temperature at measurement is not allowed to vary by more than a few degrees (+/− 10 ), the expression becomes a constant . to simplify , the value of the temperature correction is treated as 1 . thus , the following expression for signal ratios can be used : here the only error that can creep in is the long term drift of the detector response as a function of the frequency of the detected light . the short term drift is very small , and the stability has a greater relation to ccd thermal noise and read noise . however , the ccd thermal noise and read noise can be limited and controlled by chilling the detector to a constant temperature . such modern detectors are readily available in commercial instruments . for ratiometric measurements , the raman signals for a given set of lines inherently provide a stable response . the application to measurement of mass balance and conversion efficiency in a fluidized bed reactor will now be discussed . the example is a silane ( sih 4 ) decomposer using a hydrogen ( h 2 ) fluidizing gas , although the argument can be extended to a trichlorosilane ( sihcl 3 ) decomposer , which contain hydrogen , chlorosilanes , and hydrogen chloride gases . in the equations below , the chemical notation for gas concentration [ gas ] in moles per liter is used , where a subscript i is the input stream , and subscript o is the output stream . silicon solid is treated formally as mono - atomic silicon . the by - product , disilane , is included . even in the case of no - reaction , the measured concentrations in the inlet and outlet gas streams cannot be the same , because the local temperatures and pressures are not exactly the same . however , the mass balance to signal ratios can be coupled to determine the conversion ratios of silane to silicon , disilane and unreacted silane , and the ratio of outgoing to incoming hydrogen . solutions that are solely in terms of signal ratios internal to each spectrum at a given probe are sought . the signal measurement for the input gas is assumed constant between the time it is measured and the time the output signal is measured . gas flow fluctuations on a time scale equal to or less than the measurement of gas - in and gas - out will be averaged by this method . with a single sensor and switching sample lines , stable gas flow must be maintained into the reactor for both measurements . the time scale is typically 150 seconds but can be shortened considerably . an instrument that measures simultaneously from two sample cells is immune to gas flow fluctuations , but reports average conversion for the length of time of signal collection . silicon balance as si atoms : [ sih 4 ] 1 ═[ sih 4 ] o + 2 [ si 2 h 6 ] o +[ si ] o hydrogen balance as h 2 : [ h 2 ] 1 + 2 [ sih 4 ] 1 ═[ h 2 ] o + 2 [ sih 4 ] o + 3 [ si 2 h 6 ] o the mass balance is coupled to ratios of densities from raman signals ( a , b , c , d below ) benefiting from cancellation of calibration drift error , as discussed above . no ratios of input to output signals ( which are separate spectra ) are made . the measurement ratio d is a dependent variable , small and relatively inaccurate , and should not be used in propagated calculations . after the algebraic manipulation below , the conversion efficiencies entirely from the measured ratios a , b , and c are discussed . since everything is in ratios from a given spectrum , the advantage of insensitivity to detector drift can be obtained . the input and output gas streams can be measured with different raman probe heads , with separate calibrations for each . the fractional mole conversion of input silane to output silane , output disilane , and output solids are now computed . the left hand side of the expressions is multiplied by top and bottom by [ h 2 ] 1 to convert the expressions back to non - normalized density units . the expressions for conversion are expressed by the dimensionless values a , b , c which , are all ratiometric raman derived values . thus , once calibrated , the conversion efficiency can be steadily measured because the short and long term drift of q e ( v ) is very small . the propagated error in the derived conversions is found by standard methods . effective real - time measurement of a chemical conversion is made by ratiometric measurement of a gas composition using a single spectrometer . the composition of the gas stream can then be adjusted based on the measurement . the raman system provides a check on the gas flow when the input gas composition measures differently from the feed - forward of the mass flow controllers . an incorrect gas flow can lead to de - fluidization and sintering of the fluidized bed , or wastage of the silane gas due to incomplete conversion . additionally , excess silane input due to mass flow controller ( mfc ) error can lead to excess formation of silicon dust . a silane decomposer was constructed as a fluidized bed reactor . the reactor operated by the suspended seed principle , wherein the gas flow suspends the seeds . upon heating , the gas decomposes and deposits silicon on the seeds . some fraction of silane decomposes and forms a dust . the dust is filtered and the spend gas is exhausted . for the purposes of this example , it does not matter if the reactor is seeded . the seeded reactors operating efficiency is dependent on tightly controlled gas composition . feed gases to the decomposer consist of silane and hydrogen , typically with silane mole fraction with a range from 5 % to 13 %. the reactor used in these example runs was deliberately operated under conditions of partial conversion , from atmospheric pressure up to about 8 bar , and is referred to as the “ hp - fbr .” with reference to table 1 below , the examples discussed below are from runs labeled 67 , 69 , 70 , 73 ( at two times ), and 74 . the experimental input parameters are varied , but not all conditions are constant . during run 73 , the pressure drop across the exhaust filter upstream of sampling changed substantially over the course of 20 minutes ( fig5 ), and the choking of the filter presumably affected sampling . the table includes processed raman data immediately before , 73 ( 1 ), and after , 73 ( 2 ), this pressure drop change . with reference to fig3 , silane raman spectrum bands of reactor inlet and outlet gases scaled to match each other over the envelope are shown . there is an unknown peak ( marked with *) at 2163 . 5 / cm . the wings around the spectral band are rotational lines of the 2186 / cm silane peak . subtraction of sih 4 reference spectrum from the outlet gas spectrum , shown in fig4 , reveals a sharp line with evidence of wings . the blue line is the local baseline determined by least squares analysis . ( data from run 73 .) the gas signal at 2164 / cm is not silane . suspecting that the unknown gas was a related species , an ab initio calculation of the raman spectra of silane and disilane was undertaken . the position of the unknown peak is matched by calculation to within experimental error . isolating the 2164 / cm peak , evidence of symmetric wings can be seen around the central line , suggesting a small molecule with low rotational inertia about at least one axis . thus , disilane , si 2 h 6 is a likely candidate . as shown in fig5 , the ab initio calculated line shift of the si — h stretch from silane to disilane matches the experimental data to within experimental error (± 2 / cm ). the amplitudes have been scaled so the peaks have the same maximum values . ab initio methods for calculating line positions make certain , well known approximations . there are standard corrections to the approximations , which are known to those versed in the art and will not be discuss here . the method of calculation appropriate for computing raman scattering factors used a diffuse correlation - consistent basis set at the mp2 level , which correlate the motions of all electrons . the calculated shift is 22 / cm and the measured shift is 23 / cm . however , the uncertainty in relative peak positions is at least ± 1 / cm and the calculation matches the data to within experimental error . therefore , the 2164 / cm peak has a high probability of being disilane . no reference data or standards for the raman scattering intensity of disilane known to exist . therefore , to compute the quantity of disilane , the ratio of computed absolute scattering factors of disilane to silane was used to estimate the absolute instrumental sensitivity to calibration spectra of silane . the error in this procedure is small because the frequency shift is small , and the electronic structures are similar enough that proportional errors cancel out . thus , the signal can be used to complete the mass balance . in addition , the quantity of disilane is relatively small . even a large error in disilane concentration does not damage the calculation of conversion to solids . if the disilane measurement is not perfectly quantitative , the error is a proportional error . therefore , it can still be used as an indicator of the state of the process inside the hp - fbr . using the calibrated measurements for silane , hydrogen , and the calculated calibration coefficient for disilane , the conversion efficiency for each of the examples is calculated . the calculated ratio of absolute raman scattering factors is 1 . 78 : 1 si 2 h 6 : sih 4 . the number and type of bond stretches are not exactly the same , and the polarizability tensors of the two molecules are not exactly the same resulting in a ratio that is not 6 : 4 ( si 2 h 6 has 6 hydrogen atoms and sih 4 has 4 hydrogen atoms ). with this information , the conversion ratio of silane to solids and disilane can be calculated . it should be noted , the raman and mfc input compositions do not agree , and typically the raman composition reads a systematically 11 % higher [ sih 4 ] i /[ h 2 ] i ratio than the mfc settings . this is believed to be a calibration error , and if the raman signal is in error it will reduce all computed conversion efficiencies by a few percent . however , this does not affect the correlations drawn from the data . there appears to be a correlation between the disilane signal and the conversion efficiency of the hp - fbr process , provided operating conditions are similar . further the sudden increase in conversion efficiency in run 73 corresponds to the choking of the exhaust filter . this appears to lead to longer gas residence time in a zone where silane decomposes . these observations are independent of any systematic error , as discussed above . runs 67 and 74 have practically the same conversion efficiency , even though conditions are different . run 74 is hotter than run 67 . however , the charge in run 67 is greater than in run 74 , which , should lead to a longer dwell time in the fluidized bed . the effects of the two conditions practically cancel out . in run 73 , a change in the conversion of silane to solids was detected , which brackets in time a rate change in the filter pressure , as shown in fig6 . the black dot marks when a raman gas sample was taken . fig7 shows the conversion to disilane signal vs . conversion to solids in molecular ratios . the sudden reduction in si 2 h 6 for run 73 suggests longer residence time for the gas . the measured filter pressure rose about 14 . 7 % between the two measurements . typically , the spectrometer response is calibrated at nearly room temperature , but at an elevated pressure . therefore , the non - ideal behavior of the gas must be taken into account . the most straightforward way to correct for the non - ideal behavior of the gas is to use the virial equation of state to second order : the second virial coefficient is approximated by a function of the form : this is a well - documented property for hydrogen . however , there are still tables that are outrageously in error . values taken for hydrogen ( a = 10 . 84 cm 3 / mole ; b = 2 . 778 ; c = 135 . 55 k ) are derived from a rand technical report . however , this is not a well - documented property for silane . there is only one primary literature reference containing pvt data on silane , by ramaswamy and g . gundu rao ( r & amp ; r ). r & amp ; r had measured the density of oxygen in their apparatus , which allows for the correction of a systematic error in the density with modern data for oxygen using the corrected values . r & amp ; r have data for 297 . 71k and 193 . 35k , which is used to determine the lennard - jones parameters for the gas using the expression : the r & amp ; r data , corrected by using o 2 gas as a reference , yields σ = 4 . 041 å , and ε = 275 . 44 k . k for silane , where k is boltzmann &# 39 ; s constant . based on these values , the coefficients a = 328 . 74 cm 3 / mole , b = 1 . 1974 , c = 167 . 972k are determined by application of chapmn - enskog theory . the calibration errors are minimized by using an accurate pressure gauge and the virial equations of state , discussed above . a good baseline subtraction is possible during a calibration session to reduce the error to less than 0 . 1 %. these corrections must be made in this particular case . to calculate the density , as shown in table 2 below , either of the following expressions may be used : the mfc data should match the raman data for the inlet composition . there is only one primary reference available in primary literature for the viscosity of silane measured , at just two temperatures . parameters derived from pressure , volume , and temperature ( pvt ) data cannot be used because silane is not a true lennard - jones spherically symmetric molecule . as a result , the viscosity data must be reduced to determine the parameters □ and □ from fitting to a function from chapman - enskog theory : the two data points from primary literature are 112 . 4 and 142 . 4 □ poise at 15 ° c . and 100 ° c ., respectively . by fitting to the viscosity formula σ = 4 . 040å , and ε = 211 . 4 k . k are derived . mass flow controllers should be calibrated to ensure a match to the above equation with these parameters . the viscosity correlates to the temperature of the gas . the molecular radius determined from pvt and viscosity data match to 3 digits . however , the energy of the potential well ( ε ) does not match . this is because silane is not a perfectly spherical molecule and the resulting model deviations are different for pvt and viscosity data . since there is no other data in the available primary literature , these are the models that are used for gas density and viscosity , but the parameters should be changed if better data becomes available . it is assumed that if after calibration , mfc data and raman data do not match either the primary data is wrong , or the gas composition changed while flowing from the mfc to the raman gas cell . fig8 shows a calculated viscosity of silane at 1 . 0135 bar using the lennard - jones potential , chapman - enskog theory , and the only two published data points by rankine . the fractional conversion of silane can be computed strictly in terms of the ratios of signals internal to spectra , but not across sets of different spectra . the algebra used to compute fractional conversion of silane across sets of different spectra by mass balance is shown below . similar algebra can be made for decomposition of chlorosilanes . silicon balance as si [ sih 4 ] i ═[ sih 4 ] o + 2 [ si 2 h 6 ] o +[ si ] o hydrogen balance as h 2 [ h 2 ] i 2 [ sih 4 ] i ═[ h 2 ] o + 2 [ sih 4 ] o + 3 [ si 2 h 6 ] o there are 5 constraints with 6 degrees of freedom . the ratios of the parameters can be determined by dispensing with one degree of freedom when the absolute value of all parameters are not known . since the gas pressure / density in a gas cell is never the same as it is in the reactor this is acceptable . [ si ] o = x ; [ sih 4 ] o = y ; [ si 2 h 6 ] o = z . these values may be expressed in terms of a , b and c , which are the ratios of signals inside a given spectrum : step 1 substitute the expression for w into the hydrogen mass balance , preparing to eliminate w from the system of equations . a = w / u ; a / b =( w / y )( v / u )= v / y ; a / c =( w / z )( v / u )= v / z step 3 divide both mass balances by w , and list the system of equations u / w + 2 ( y − 2 z + x )= v / w + 2 y + 3 z ; a = w / u ; y =( b / a ) v ; z =( c / a ) v step 4 eliminate remaining w with au , express v / u as v to simplify the system of equations . the term w no longer appears . 1 / a + 2 ( y + 2 z + x )= v / a + 2 y + 3 z ; y =( b / a ) v ; z =( c / a ) v step 5 , with 4 equations expressed cleanly in 4 unknowns v , x , y , z is determined as functions of a , b , and c . variances may be found by the standard rules for error propagation for an arbitrary function f ( a , b , c ), and the chain rule for differentiation . the square of the variance of f is given by : for brevity the results are stated in a form convenient for coding . the raman signal has four significant sources of noise . actual noise values vary from instrument to instrument , the details and values shown herein are examples from one specific instrument . first , the read noise of the detector is 7 counts per read per ccd channel . second , the dark noise of the detector is 0 . 03 electrons per second per ccd pixel . a channel of one wave length is the sum of a strip of pixels . in the camera used , the spectra are split into two and stacked on top of each other across the detector surface . the instrument is the equivalent of an echelle spectrograh with a cross dispersing prism . in a given channel ( wave number ) the signal is integrated over ˜ 100 ccds . third , the noise of a raman signal is equal to the square root of the total number of counts . fourth , a back - ground fluorescence due to the optical system , primarily the windows and the mirror , is a broad background except for a few lines . the fluorescence is bleached by the laser beam after a “ warm - up ” period , but is not entirely eliminated . in a typical measurement , the instrument is alternated between laser on and off cycles , so the operator sees a spectrum with the read - signal and dark signal subtracted off . however , noise from those sources is still included as part of the data and must be considered . the resulting read noise and dark noise are the square root of the signals . the variance of the dark and read noise is now determined . these two contributions are a function of the camera and temperature of the camera . however , when the temperature is chilled and held constant , its effect is negligible and can be neglected . the dark noise is strictly proportional to time and the read noise is strictly proportional to number of accumulations , provided that detector does not become saturated . therefore , these errors grow at different rates , as discussed below . raman camera noise , shown in fig9 , from the raman system with the laser turned off . there is no contribution from fluorescence . noise is minimized by using the longest integration time possible without detector saturation , and the fewest possible accumulations . this is achieved by keeping the peak signal at ˜ 33000 to ˜ 53000 counts in any channel to minimize possibility of camera “ blooming .” the dark signal magnitude is proportional to time , and dark noise is proportional to the square root of counts , and therefore , to square root of time . the instrument measures a signal , then turns off the laser to measure the dark signal and subtract it off . thus , the average signal is zero , but the noise does not equal zero . s d = k ′ d t o ′ d =√{ square root over ( k ′ d t )} the signal visible to the user is zero , but the noise from subtracting one dark signal from another is of the form : therefore , the instrumental dark noise in a channel is proportional to square root of time : the read signal is treated the same way , it should subtract out to zero . with n accumulations , the total noise is then : for 10 seconds of signal integration , and 1 accumulation the experimental standard deviation is : σ =√{ square root over ( σ r 2 + k d 10 )}= 0 . 573 for 1 second of signal integration , and 10 accumulation the experimental standard deviation is : thus , in an exemplary instrument , the signal noise in a channel using n accumulations for a total of t seconds is : integrating a signal over a number of m channels decreases the error by 1 /√{ square root over ( m )}. the two cases , one from the hydrogen 585 line and the other the silane 2186 line , will be discussed below . typically , 15 seconds of signal integration repeated over 5 accumulations is used . the camera noise integrated over m channels is for hydrogen m ˜ 183 , and for silane m ˜ 1533 . in these cases , the average noise is ˜ 0 . 1 and ˜ 0 . 033 counts , respectively , while typical signal counts at the inlet are 6 . 29e + 05 and 5 . 63e + 05 counts for hydrogen and silane , respectively . therefore , the dark noise and read noise of the camera , removed by subtraction , are negligible . the raman signal ( i ) has an intrinsic noise that is exactly the square root of the total counts . the relative signal noise is : typical relative errors are ˜ 0 . 13 % for hydrogen and silane , and ˜ 1 % for disilane . the raman signal is superimposed on a background signal due to the optical system from multiple causes . there is the raman signal of the optical components , but more importantly , there is also a time - dependent fluorescent background from these same components . the time - dependent fluorescent background is minimized by bleaching the fluorescent impurities by prolonged exposure to the laser beam . this signal adds a curvature to the baseline that is time dependent , and prevents perfect baseline subtraction . fig1 shows an empty gas cell spectrum that is bleached . the inflection point is due to a join of spectral bands on the ccd detector , which is due to the optical system being equivalent do an echelle spectrograph + cross dispersing prism . the position of the join is to some extent selectable . the small sharp peaks to the left in fig1 are window raman peaks . these raman peaks are very weak and do not overlap the hydrogen line with any significant intensity . examination of the full data shows that in this instrument the best line for analytical work is the 586 / cm line . hydrogen ( h 2 ) spectrum with window background superimposed is shown in fig1 . the 586 line is suitable for hydrogen analytical work the 2186 / cm silane band from 1930 to 2450 / cm superimposed over a slightly curved fluorescent background is shown in fig1 . neglecting the curvature around hydrogen is perfectly valid and introduces negligible error . however , the error for silane signal integration must be considered . fig1 and 14 show a silane signal from the fbr experiment with simple , straight line baseline subtraction . the integrated area is 5 . 63e5 counts , as shown in fig1 . subtracting the estimated background ( linearly scaled ), the integrated area is 5 . 88e5 counts , as shown in fig1 . neglect of the baseline curvature on average introduces a higher error of about + 2 % in sih 4 concentration ( 12 data sets ). the window background is linearly scaled such that the signal at 1930 / cm is equal to the signal at 2350 / cm . this is determined by the requirement that the signal should dip to zero at each ripple from the 2186 central line . the expected improvement in signal error , including intrinsic raman noise , is reduced to approximately 0 . 5 % by this procedure . for the hydrogen line , this procedure should not be applied , because the local fluorescent background is flat . the ( local and very weak ) window lines should not be amplified to the point that they are in interference . neglect of baseline curvature introduces an error in the silane signal , as shown in fig1 . from this distribution , we see the error is systematic with a mean value of − 2 % with respect to the same data corrected for baseline curvature . the expected mean error when using curved baseline subtraction is ˜ 0 . 44 %. use of the above embodiments reduced the response time for silane analysis from approximately 6 minutes by chromatography to approximately 2 minutes , and detection of silicon oligomers , such as , for disilane ( si 2 h 6 ) from approximately 20 minutes to approximately 2 minutes . thus , the above embodiments provide a process control system that operates in real - time to simultaneously compute conversion efficiency to solid silicon and gas - by - products . another advantage of the above embodiments is a reduced risk of an un - calibrated or drifting calibration control system . when introducing elements of the present invention or the embodiment ( s ) thereof , the articles “ a ”, “ an ”, “ the ” and “ said ” are intended to mean that there are one or more of the elements . the terms “ comprising ”, “ including ” and “ having ” are intended to be inclusive and mean that there may be additional elements other than the listed elements . as various changes could be made in the above constructions and methods without departing from the scope of the invention , it is intended that all matter contained in the above description and shown in the accompanying drawing [ s ] shall be interpreted as illustrative and not in a limiting sense . the method described herein is not limited by the particular process or reactor configuration disclosed herein . for example , the method may be applied to other configurations and processes related to the operation of a continuous fluidized bed reactor .	1
a thin cylindrical rod can support longitudinal ( extension or bar ) and transverse ( torsional or shear ) acoustic modes , along with a multitude of surface modes and combinations of modes . by controlling launch conditions and frequency content of the excitation , a subset of these modes can be excited . the launch conditions , rod diameter and acoustic frequency all depend on the cable dimensions and the properties of the cable materials . for the present application , longitudinal or torsional waves are of primary interest . such waves will propagate in both the core and sheath of a conductor . the solution of the wave equation for the cylindrical bar is quite tedious and is not presented here for the sake of brevity , but the results are directly analogous to those for both electromagnetic and fiber optic waveguides . the critical aspects of the solution are the cutoff frequency and velocity dispersion behavior for various possible modes . this data is typically presented in terms of phase velocity dispersion curves that plot the phase velocity for possible modes against the product of frequency f and diameter d of the rod . the larger the f * d product , known as the mode parameter , the larger the allowed number of acoustic modes . when a single - frequency burst is used to excite longitudinal waves in a cylindrical conductor , the resulting sinc function spectrum is centered at the carrier frequency . if the mode parameter is sufficiently large , some portions of the burst spectrum may be cut off and others will travel at different velocities . this dispersion will result in a significantly different signature for the detected signal , which will complicate interpretation of the results . however , this problem can be minimized by selecting a sufficiently low frequency band for the given conductor diameter . in addition , to maximize the interaction of the acoustic wave with the conductor cross - section , the majority of the displacement energy should propagate in the conductor &# 39 ; s interior . this is achieved by using low acoustic frequencies , since higher frequencies propagate closer to the conductor surface , and become rayleigh waves at sufficiently high frequencies . for example , in the case of aluminum , a frequency - diameter product of less than 2 mhz - mm ensures operation below the cutoff for all modes except the zero - order longitudinal mode . the zero - mode velocity dispersion curve is nearly flat in this regime , being approximately given by c bar ( f )={ y o / p [ 1 −( 3 . 14 s * f * d /( 2 * c bar ) 2 ]} 0 . 5 , where f is the acoustic frequency , s is poisson &# 39 ; s ratio , y o is young &# 39 ; s modulus of the conductor , p is mass density of the bar , d is the bar diameter and c bar is the acoustic , or bar velocity based on strength - of - materials arguments . for a small mode parameter , the wave propagation velocity for all spectral components will be very close to the bar velocity given as c bar ={ y o / p } 0 . 5 . in this case , the launched burst will suffer very little dispersion and the acoustic velocity is directly related to the modulus of the conductor . table i lists relevant acoustic properties of the materials found in an overhead cable , transformer winding or underground cable . operation at lower frequencies is also important to minimize attenuation of the acoustic signal over long distances . few studies have investigated the acoustic loss in thin cylindrical rods composed of stranded or heterogeneous materials . a lower limit can be estimated by looking at some of the fundamental loss mechanisms found in solids . acoustic loss due to heat flow results from the rarefaction and compression of the solid , which heats or cools the body . the loss is proportional to the square of the acoustic frequency . this accounts for about half of the total thermal losses in single - grain metals . typical values for this loss are given in table 1 , and are extremely small . acoustic loss due to inter - grain heat flow is inversely proportional to the acoustic frequency above a relaxation frequency , which for metals is & lt ; 100 khz . below the relaxation frequency , the loss is frequency independent . acoustic loss due to grain scattering has a direct analogy to rayleigh scattering in electromagnetic theory . for frequencies well below the grain scattering resonant frequency , the loss varies as the fourth power of acoustic frequency . a lower limit on acoustic losses can be estimated by doubling the acoustic losses due to heat flow given in table 1 . for a steel core power cable with a length of 50 kilometers and an acoustic frequency of 10 khz , the total loss is 0 . 0008 db . clearly , other loss mechanisms will increase this value considerably . torsional waves usually have a factor - of - 3 ( or more ) lower attenuation than longitudinal waves . the lowest loss material in this table , annealed steel , gives an attenuation of 5 . 2 db / km for 10 khz longitudinal waves , and 1 . 5 db / km for 10 khz torsional waves . the transit time for an acoustic wave in a cable with bar velocity v e and length l is given by τ = l / v e , with a temperature dependence of 1 / t dt / dt = a − 1 /( 2y o ) dy o / dt + 1 /( 2p ) dp / dt , where t is the transit time , p is the mass density and a is the linear thermal expansion coefficient , or cte . the temperature dependence of young &# 39 ; s modulus y o will provide the largest temperature dependent effect in the measured transit time of an acoustic tone burst . typical data for polycrystalline aluminum indicates a temperature dependence of & lt ;− 100 ppm / c from − 50 to + 100 c , increasing to − 570 ppm / c from 100 - 200 c . steel has a young &# 39 ; s modulus temperature dependence of − 450 ppm / c from − 50 to + 100 c , and − 510 ppm / c from 100 - 200 c . similar behavior is expected for copper . this is more than an order of magnitude larger than the length change induced by thermal expansion , of + 12 ppm / c for steel and + 23 ppm / c for aluminum . the transit time can then be related to temperature and / or the cable length using one or more of several methods described below . fig1 is a schematic diagram of the disclosed method applied to an overhead power line . an overhead conductor 10 has an acoustic transducer 14 clamped on to allow acoustic energy to flow into or out of the conductor . the acoustic transducer 14 is electrically interfaced to a transmit / receive ( t / r ) switch 12 , a waveform generator 11 and a digitizing data collection and analysis system 13 . when the waveform generator 11 energizes the transducer 14 , two acoustic waves 15 and 16 propagate away from the transducer 14 in opposite directions inside the conductor 10 . the acoustic wave 16 eventually interacts with an acoustic perturbation 17 introduced onto the conductor , such as a cable clamp , a splice , a crimp , a termination or a sharp bend . the perturbation 17 causes a portion of the acoustic wave 16 to be reflected , resulting in two acoustic waves 19 and 18 traveling back to the transducer or continuing to travel away from the transducer , respectively . the acoustic wave 19 that is reflected from the perturbation 17 is detected by the transducer 14 and collected by the system 13 . by measuring the transit time between the launched acoustic wave 16 start time and the detection time of acoustic reflection 19 , the distance between the transducer 14 and perturbation 17 can be found , and / or the temperature of the conductor between transducer 14 and perturbation 17 can be found . fig2 is a schematic diagram of the disclosed method applied to measuring the temperature of a power transformer winding . the waveform generator 201 , receiver 203 , t / r switch 202 and transducer 204 are attached to the high voltage conductor 200 and bushing 206 of a power transformer 205 . the bushing conductor 200 connects to one side of the transformer winding 207 . the other end of the winding 207 is connected to a second bushing conductor 208 . an acoustic wave is launched into the conductor 200 by the transducer 204 and propagates along the winding 207 . at regular intervals , the conductor 200 undergoes sharp turns or experiences clamping points as part of the winding 207 , resulting in a plurality of small acoustic reflections returning to the transducer 204 . by measuring the return time of each reflection in the winding , the winding temperature can be determined . by measuring the return time difference between adjacent returning acoustic reflections , the temperature of the segment of conductor winding located between the two conductor bends causing the acoustic reflections can be calculated . by combining a plurality of measurements from the various reflections detected by the receiver 203 , a temperature distribution of the transformer winding 207 can be determined . for windings that cause a large acoustic loss due to their shape or length , a second transducer 209 can be attached to the second bushing conductor 208 . the transducer 209 is connected to t / r switch 212 , waveform generator 210 and receiver 211 . reflections from the acoustic wave generated by transducer 209 can be used to calculate the temperature in the lower half of winding 207 , whereas the temperature distribution in the upper half of winding 207 can be calculated using measurements from transducer 204 . alternatively , the signal generated by transducer 204 can be detected by transducer 209 to calculate the average temperature of the entire transformer winding 207 . fig3 is a schematic diagram of the disclosed method applied to an underground or underwater coaxial power cable . the transducer 304 is connected to t / r switch 302 , waveform generator 301 and receiver 303 . the transducer is clamped to conductor 300 that is part of transition bushing 306 that provides a dielectric transition for the conductor 300 from the open air into the cable 305 . the opposite end of the cable is terminated in a transition bushing 306 . an acoustic wave 313 is coupled into conductor 300 by transducer 304 and propagates along the central conductor of cable 305 . sharp bends or distortions 312 in the cable cause acoustic reflections 314 that return to transducer 304 where they are detected and recorded by receiver 303 . the time delay between the start of acoustic wave 313 and the detection of reflection 314 can be used to calculate the distance from the transducer 304 to the distortion 312 . alternatively , the time delay can be used to calculate the temperature of the cable between the transducer 304 and the distortion 312 . the acoustic wave 313 eventually reaches the opposite end of the cable 305 , where it is reflected by the termination 311 . the reflected wave travels back to transducer 304 where it is detected . the time delay between this reflected wave and the start of the acoustic wave 313 is used to calculate the average temperature of the central conductor of the cable 305 . the acoustic wave 313 can also be detected and recorded by a second transducer 307 , t / r switch 308 , waveform generator 309 and receiver 310 , where the transducer 307 is clamped to the second transition bushing 315 . a number of approaches are now disclosed regarding the choice of acoustic wave and the required signal processing that may be applied to any of the applications already described above and shown in fig1 , 2 and 3 . in the descriptions that follow , the t / r switch , waveform generator and receiver are not shown , but are assumed to be present . a first approach , shown in fig4 , consists of a transducer 401 clamped to a conductor 400 that generates an acoustic wave 402 . a clamp or other device 406 is attached to the conductor 400 a known , short distance from the transducer . the time of flight of the first reflection 405 returned to the transducer is used to determine the temperature of the conductor , since the length of conductor between the transducer and the clamp is known . the time delay is proportional to the group velocity of the acoustic wave 402 and 405 , which in turn has known temperature dependence for the material from which the conductor 400 is fabricated . the majority of the acoustic wave 402 continues past the clamp 403 as acoustic wave 404 with slightly diminished amplitude . a subsequent reflection 408 generated by a second defect or clamp 406 further along the cable is used to provide a second time of flight . in addition , the time delay between the arrival of the first reflection 405 and the second reflection 408 can be used to determine the temperature or length of the second section of conductor . if the first section of conductor 409 is much shorter than the second section of conductor 410 , then the time delay between reflections 405 and 408 is mainly controlled by the second section of conductor 410 . the first reflection time delay 405 can be used to calculate the temperature of the conductor . assuming that the temperature along the cable is constant , then the difference time delay between reflections 405 and 408 can be used to calculate the length of the long section of conductor 410 . with knowledge of the fixed support locations of the conductor in an overhead line application , the conductor sag can then be computed . a second transducer 411 attached to the conductor 400 a known distance from the first transducer 400 can alternatively be used to detect the transmitted acoustic wave 407 . the time delay between the detection of wave 407 at transducer 411 and the start of wave 402 at transducer 401 can be used to determine the average temperature of the conductor sections 409 and 410 . by combining this time delay with a measurement of the temperature of the conductor section 409 , the length of conductor sections 409 and 410 can be calculated , and in an overhead line application , the conductor sag can be estimated . a second approach is shown in fig5 . a conductor 500 has a transducer 501 clamped to it . the transducer has the ability to launch and receive both a longitudinal acoustic wave 502 and a torsional acoustic wave 503 along the conductor 500 . both waves 502 and 503 have the same frequency but they travel at different group velocities and they have different group velocity temperature dependencies . a clamp or other device 504 is attached to the conductor 500 some distance from the transducer . the two waves 502 and 503 arrive at the clamp 504 at different times , and a portion of each wave is reflected back towards the transducer 501 as waves 506 and 508 , respectively . the two acoustic waves 506 and 508 are detected by transducer 500 . the time delay between receiving the two waves can be used to calculate the length of the conductor and the temperature of the conductor section 509 . the remaining waves 505 and 507 continue along the conductor and can be detected by a second transducer 510 that is capable of detecting both longitudinal and torsional waves . the time delay between the arrival of the two waves 505 and 507 can be used to determine the temperature and length of the conductor sections 509 and 511 . the time delay is proportional to the group velocity of the acoustic wave 502 or 503 , which in turn has known temperature dependence for the material from which the conductor 500 is fabricated . with knowledge of the fixed support locations of the conductor in an overhead line application , the conductor sag can then be computed . a third approach , shown in fig6 , has a transducer 601 clamped to a conductor 600 . the transducer 601 generates two longitudinal or torsional acoustic waves 602 and 603 having different center frequencies . one acoustic wave 602 with a lower center frequency is selected to propagate along the conductor as a lowest order mode with a first group velocity . the second acoustic wave 603 with a higher center frequency is selected to propagate along the conductor in a higher order mode with a second group velocity . the two waves also have different temperature coefficients of velocity . the two acoustic waves can generate reflections 606 and 608 at a clamp 604 , or the remaining acoustic waves 605 and 607 can continue on to a second transducer 610 . the difference in arrival time between the two acoustic waves arriving at transducer 601 or 610 can be used to determine the temperature of the conductor and the length of the conductor section being tested . with knowledge of the fixed support locations of the conductor in an overhead line application , the conductor sag can then be computed . in a fourth approach , shown in fig7 , a transducer 702 is clamped to a conductor composed of an inner core 701 ( such as steel ) and an outer cladding 700 ( such as aluminum ). the transducer 702 launches a longitudinal or torsional wave into the conductor , where a portion of the wave travels in the conductor core 701 as wave 703 , and the remainder of the wave energy travels in the cladding 700 as wave 704 . the launched waves 703 and 704 travel in the two cable regions at different velocities , and experience different temperature dependencies of their velocities . for example , a commonly used overhead power line conductor consists of a steel core surrounded by an aluminum cladding . in the temperature range of − 50 to + 100 c , the young &# 39 ; s modulus of aluminum is almost independent of temperature , whereas the young &# 39 ; s modulus of the steel core varies by − 450 ppm / c . therefore , the velocity in aluminum is almost unchanged over this temperature range , whereas it varies considerably in steel . the two acoustic waves can generate reflections 706 and 707 at a clamp 705 , or the remaining acoustic waves 709 and 710 can continue on to a second transducer 711 . the difference in arrival time between the two acoustic waves arriving at transducer 702 or 711 can be used to determine the temperature of the conductor and the length of the conductor section being tested . with knowledge of the fixed support locations of the conductor in an overhead line application , the conductor sag can then be computed . in a fifth approach , shown in fig8 , an electromagnetic pulse 804 is launched by a pulse generator 803 along the conductor 800 at the same time that a longitudinal or torsional acoustic wave 802 is launched by transducer 801 . the electromagnetic pulse reflects from a clamp or other perturbation 805 along the conductor . the resulting reflected electromagnetic pulse 807 is detected by electronic detector 811 and its arrival time is measured relative to the launch time of pulse 804 . the group velocity of the electromagnetic pulse is substantially independent of the conductor temperature . the total elapsed travel time of the electromagnetic pulse is used to determine the distance or range from the generator 803 to the clamp or perturbation 805 . the time of flight of the reflected acoustic wave 809 is also measured relative to the start time of the acoustic wave 802 . the acoustic wave travel time is used to calculate the temperature of the conductor 800 along its length . the remaining electromagnetic pulse 806 and acoustic wave 808 can also be detected by a second transducer 810 and a second electronic receiver 812 . the time of flight of the electromagnetic pulse is used to calculate the length of the conductor section , and the time of flight of the acoustic wave is used to calculate the temperature of the conductor section . a sixth approach uses a plurality of transducers along the conductor . as shown in fig9 , a transponder 901 , 902 or 903 is comprised of a transducer 901 a , a t / r switch 901 b , a waveform generator 901 c , a receiver 901 d , a real time clock 901 e and a data storage unit 901 f . each transponder 901 , 902 and 903 ( three transponders are shown for illustrative purposes , although the number can be much larger than this ) generates an acoustic wave 904 , 905 and 906 that is encoded with the transponder identification and the absolute time that the acoustic wave was launched . each transponder also receives the acoustic waves launched by the other transponders clamped to the conductor . for example , transponder 902 receives acoustic wave 904 generated by transponder 901 , and acoustic wave 906 generated by transponder 903 . the acoustic waves received by each transponder are decoded and the transponder identification and the time delay associated with that acoustic wave are stored in each transponder 901 , 902 or 903 . each transponder also includes a reference clock that is used to determine the time of flight for each detected acoustic wave . this is accomplished by recording the time that an acoustic wave is received , decoding the start time that is coded into the acoustic wave , and digitally subtracting these two times to arrive at a travel time for the acoustic wave . a database is included in each transponder 901 , 902 or 903 that is comprised of the time delay for travel between a transponder and every other transponder clamped to the conductor . the resulting database stored in the transponders can be used to determine temperature and conductor length in each section separating two transponders . the launch transducer should be capable of introducing longitudinal waves and / or torsional waves into the conductor . in addition , the transducer must be able to clamp onto a conductor , and be capable of operating reliably over an extended temperature range (− 40 to + 150 c ). piezoelectric ( such as lead zirconate titanate ceramics ), electromagnetic ( emat ) and magneto - acoustic ( based on terfenol - d ) drivers are all candidate technologies for this application . however , piezoelectric ceramic transducers provide a good combination of low cost , availability , reasonably high mechanical stiffness and good efficiency . for all of the measurement methods described , the time of flight can be measured in a number of ways . the simplest method involves using a comparator to determine when the detected acoustic signal exceeds a threshold level . a second method uses a tone burst that is coded , for example by amplitude modulating each cycle of the burst to impart information about the origin of the burst . this data can be detected using commonly available technologies such as code division multiple access ( cdma ) or a universal asynchronous receiver transmitter ( uart ). a third method uses a ring - around technique , whereby the detection of an acoustic wave triggers the launching of a second acoustic wave . this process repeats indefinitely . the travel time can be inferred by measuring the repetition rate of the launched acoustic wave . this method can be very precise since it provides averaging of variations in each individual round trip time , and the frequency can be very precisely measured ( to better than 1 ppm ). while particular embodiments of the present invention have been illustrated and described , it is understood that the invention is not limited to the precise construction and compositions disclosed herein and that various modifications , changes , and variations will be apparent that lie within the scope and spirit of the invention as defined in the attached claims .	6
the present invention overcomes the aforementioned disadvantages of existing installation tools by providing a novice - friendly printer installation tool that configures both the client computer and the printer , and is capable of configuring a client computer for use as a network server . in addition , the disclosed printer installation tool allows a user to select a unique and intuitive identifier for the printer being installed , which will be then be associated with the installed printer by the disclosed installation tool so that it may be quickly identified by a person using the client computer to request a print job by the installed printer . the disclosed installation tool may be an embedded firmware implementation of a network print server and its associated client software . the disclosed installation tool may be initiated through a cd rom , the web ( both internet and intranet ), or from windows dos mode with no user interface , for example . the disclosed installation tool may allow a user , who may be either a system administrator or a novice , to install the printer in a small or enterprise network for direct ( peer - to - peer ) printing . the disclosed installation tool preferably supports printer installation and client computer and optionally server configuration in the win 95 / 98 / me and win nt4 . 0 , win 2k and win xp platforms , for example . one preferred disclosed printer installation tool is responsible for the installation of the printer drivers and associated software components for the client computer and any applicable server . the installation application discovers all the available print devices accessible to the client computer , either locally or through a shared network and presents a list of those discovered devices to the user , who can select the interested one for installation . in the discovery process the disclosed printer installation tool discovers one or more of the following : the wins / dns name , ip address , location of the printer , device type / information , mac address , installation flag ( indicate whether the printer is previously installed in the network or not ), sharp - net - mask , sharp - net - gateway , dhcp on / off printer parameters through slp discovery . the user has the option of configuring printer parameter like the wins / dns name of the printer , location of the printer , installation flag , sharp - net - gateway , sharp - net - mask , dhcp on / off . the user - configured printer parameters are pushed back from the client computer and / or the server through the snmp protocol operation . also , the disclosed printer installation tool may add registry entries and store the discovered devices in a disk file . the disclosed invention may be quickly understood in reference to a series of user interface ( ui ) screens , shown in fig1 - 21 , that guide a user though one embodiment of a disclosed printer installation tool . it should be understood that the ui screens depicted in fig1 - 21 are illustrative only , and that other embodiments of the disclosed printer installation tool may present different ui screens to a user . the ui screens depicted in fig1 - 21 are preferably 332 × 218 dialog based units ( dbu ) or 498 × 354 pixels screen units size . furthermore , unless explicitly stated , the ui scope will always be focused on the button that will lead the user though the default path of the dialogs so that the user can install the device with a minimum number of hits of the enter key . fig1 shows an exemplary splash screen 10 that may appear when a user inserts a cd that contains an executable printer installation tool into a cd - rom drive . preferably , the printer installation tool will automatically run upon insertion of the cd - rom , however , the installation tool should also preferably be executable from a dos command , or by manually selecting the installation tool through the client computer &# 39 ; s operating system . alternatively , the splash screen 10 may appear after the installation tool is downloaded from the web and the user executes a “ setup . exe ” file , or other executable file that initiates the disclosed printer installation tool . the splash screen 10 presents a user with the options of either exiting the program , reading documentation associated with the disclosed printer installation tool , or beginning the installation process . the user may exit the program by selecting the “ exit ” button 12 , after which the installation tool will terminate operation . the user may choose to view any associated documentation by selecting the “ read documentation ” button 14 . associated documentation may include a user &# 39 ; s manual , a networking tutorial , and / or an installation tutorial presents the installation procedure to the user and suggests responses to any foreseen problems that may occur during the installation process . some embodiments of the disclosed printer installation tool may require the presence of a winsock 2 . 0 file to install a printer on a computer that operates in a windows 95 environment . if so , upon a user &# 39 ; s selection of the “ install software ” button 16 , the printer installation tool may check whether the operating system on the client computer is windows 95 , and if so , check to see whether winsock 2 . 0 is installed in the windows directory of the client computer . if it is not , the “ installation termination ” screen 19 of fig2 may be displayed and operation of the installation tool terminated after the user clicks the “ ok ” button or the “ exit window ” button 20 . furthermore , some embodiments of the printer installation tool may require that the user have administrative rights to install a printer , as is common within windows nt 4 . 0 , windows 2000 or windows xp , for example . if so , the printer installation tool will check to see whether the user has such rights , and if not , display a termination screen ( not shown ) informing the user of the his or her lack of authority to install the printer . if the printer installation tool does not require the presence of winsock 2 . 0 to install a printer on a client computer running in a windows 95 environment , or if winsock 2 . 0 is present on a client computer running in a windows 95 environment , or if the client computer runs on an operating system other than windows 95 , or if either administrative rights are not required or are present , the splash screen 10 will be replaced with the “ installer welcome ” screen 22 shown in fig3 after a user selects the “ install software ” button 10 . the installer welcome screen 22 may present the user with a license agreement that may be selectively browsed in a window 24 . the installer welcome prompts the user to either accept the license agreement by selecting the “ yes ” button 26 or decline the license agreement by selecting the “ no ” button 28 . if the license agreement is not accepted , operation of the printer installation tool may either terminate , or the user may be presented with an additional dialog window , shown in fig4 giving the user the option of either terminating operation of the printer installation tool by selecting the “ exit ” button 34 or to resume installation by selecting the “ resume ” button 36 , after which the user is once again prompted to either accept or decline the license agreement in the installer welcome ” screen 22 . in one preferred embodiment of the disclosed printer installation tool , the ui scope is focused on the “ no ” button 28 of the installer welcome screen 22 so that a user cannot inadvertently accept the license agreement by carelessly clicking the “ enter ” button on the user &# 39 ; s keypad . rather , the license agreement can only be accepted , and the installation program can be completed , only upon the conscious selection of the “ yes ” button 26 . other embodiments . though , may focus the ui scope on the “ no ” button 28 . selection of the “ yes ” button 26 , which accepts the license agreement , may lead to the “ installer select ” screen 38 , shown in fig5 , which gives a user the option of having the disclosed printer installation tool automatically configure a desired printer , or let the user configure the printer . this selection may be made by checking the desired one of the boxes 40 or 42 and subsequently selecting the “ next ” button 44 . selection of the box 40 provides for an easy installation and selection of the box 42 provides for an advanced printer setting configuration for advanced users . alternatively , the user may choose to go back to the previous screen by selecting the “ back ” button 46 , cancel installation by selecting the “ cancel ” button 50 , or initiate a help dialog window by selecting the “ help ” button 50 . selection of the help button 50 may present a help dialog window ( not shown ) explaining the consequences of electing to configure the printer manually , along with a list of parameters which will need to be entered manually . the help dialog window may also suggest that novice users elect to let the installation program proceed with an automatic installation . selection of the cancel button 48 may either terminate operation of the printer installation tool or present the user with an exit setup window with the same functionality as the exit setup window 32 of fig4 . unless otherwise indicated , any “ back ”, “ cancel ” or “ help ” buttons in any of the dialog windows discussed in this disclosure are functionally equivalent to the respective buttons 46 , 48 , and 50 discussed in this paragraph . referring to fig6 , if the client computer is running in a windows 95 environment ( e . g ., an operating system without a port monitor ), the selection of the desired installation option will cause the “ select installation directory ” window 52 to appear , from which the user may either select a displayed default directory or input a new directory for an installation folder and proceed to a select program folder window 56 , as shown in fig7 . the select program folder window 56 permits the user to input a desired program folder in the window 57 by either typing it in manually or selecting one of the existing folders detected by the printer installation tool and displayed in the window 58 . selection of the “ next ” button 60 will cause the “ select printer ” window 62 to appear . furthermore , if the client computer is operating within a windows nt 4 . 0 , a windows 2000 , or a windows xp environment , selection of the “ next ” button 44 in the “ installer select ” window 38 ( fig5 ) leads to the “ select printer ” window 62 ( fig8 ). initially , the “ select printer ” dialog window may be overlaid with a “ searching ” window 64 that indicates to the user that the disclosed printer installation tool is detecting available printers for installation . the printer installation tool may use any appropriate protocol for this search , such as simple network management protocol ( snmp ) or common management information protocol ( cmip ). while the search is proceeding , a running count of detected available printers may be displayed in the box 66 and the user may be allowed to terminate the search by selecting the “ stop ” button 68 . before displaying the “ select printer ” dialog , slp files ( slp . dll ) will be copied to the temporary directory . the “ select printer ” dialog shows a list of discovered devices . referring to fig9 , once the search has been completed , or the user stops the process , the “ searching ” window 64 will disappear and the user will be presented with a list of printers , within the window 70 . the disclosed printer installation tool may provide for a filtering tool that filters the list of printers shown in the window 70 . for example , the filtering tool may first show only “ new ” devices , i . e ., devices that were not previously discovered in an earlier iteration of the disclosed printer installation tool , or if this “ new ” list is empty then only “ uninstalled ” devices , i . e . those devices that have not been previously configured , or if the “ uninstalled ” list is empty then all discovered devices . this simplifies the installation of new printers on a network by showing the new printers without showing all the previously installed printers ( or less than all ). the user may also elect to show all available printers rather than a presented filtered list by selecting the button 72 . if all devices are being shown then the “ show all printers ” button 72 will be gray . further , the disclosed printer installation tool may include a “ refresh ” button 74 to be selected if a desired printer is not shown and a further search is desired after connections are checked , etc . in some embodiments of the disclosed printer installation tool , the user can select more than one device to perform a multi device installation . the printer device itself may include a flag ( memory location ) that may be set by the installation tool to indicate that the printer has now been installed with the flag being unset as default ( or vice versa ). in this manner , the installation tool may query the printer for the flag . the flag may be reset in any suitable manner . the filtering criteria may be achieved by processing installation flag values retrieved from the client computer and / or server through snmp operation and a file containing a list of previously discovered devices . the installation flag value will give the information on whether the printer is installed or not configured at all in the network . optionally , the location of the printer may be displayed when the focus of the mouse is on the row of the printer . at this point , the user has the option of choosing an advanced configuration or an automatic configuration . the advanced configuration option will be discussed first . if the user opted for “ let me configure my network setting ” 42 in the “ installer select ” dialog box 38 ( fig5 ), upon selecting the “ next ” button 76 the disclosed printer installation tool will check to see whether the snmp community string of the selected device is the default value . if the snmp community string is not the default value ( see box 238 of fig2 ), the user will be presented with the dialog window so that he can enter the correct string for the selected device in the window 80 and press the “ enter ” button 82 or return to the “ select printer ” dialog by pressing the button 84 , as illustrated in fig1 . if the snmp community string is incorrect the user will again be prompted to enter the correct snmp community string . the “ advanced printer configuration ” window 98 ( see fig1 ) allows the entry of an ip address for the printer , a subnet mask identifier , and a default gateway , by entries into the appropriate windows 99 , 100 , and 101 . these entries may be made automatically by selecting the box 102 via dhcp or the values may be specified manually after selecting the box 103 . specifying either an invalid address or an address already being used , and selecting the “ next ” button 104 will result in the error message windows 106 and 107 , respectively where the user will be prompted to enter correct values ( see fig1 and 14 ). in either automatic or advanced configuration , the “ configure the printer ” window 108 ( see fig1 ) will appear in response to the selection of the “ next ” button 104 ( see fig1 advanced configuration ) or the next button 76 ( see fig9 automatic configuration ) in the case that it is a first time installation ( see fig2 ). the window 108 allows the user to name the device and optionally provide a location description in the appropriate windows 109 and 110 . the description 110 may subsequently be displayed together with the name of the device , such as with a mouse or other window . this provides additional descriptive information to a subsequent installer of the same printer . a default name may be initially displayed in the window 109 . the default name that is displayed should be the device name retrieved from the printer , and is preferably limited to 15 characters and follows the dns naming convention ( no spaces , no special characters ). the user can change this name so long as it follows the aforementioned length limitations . this name and location string is written back to the printer using snmp or cmip and the printer will register this name with the wins / dns server . typically , when a user selects the “ next ” button 112 of the “ configure the printer ” window 112 ( see fig1 ), the “ name the printer ” window 118 will appear ( see fig1 ). the “ name the printer ” window 118 is similar to the add printer wizard dialog used in the windows operating system . the “ name the windows printer ” 118 allows the user to give a windows name of the printer . the default will be the name of the printer in the installed machine . using this window , a user has the option of giving the printer an intuitive name by which the user may subsequently recognize that particular printer when sending it a print job so that the user can locate the printer and easily retrieve the completed print job . this eliminates difficulty in distinguishing identical printers on a network that all have the same or similar default identifications . in the advanced configuration , if the printer is shared in , the “ select print type ” window may be displayed ( see fig1 b ) so that the user has the option , by selecting the appropriate box 94 or 95 , of installing the printer as a peer - to - peer , i . e . connected directly to a network or as a network printer , i . e . connected to a network server through another network computer ( e . g ., a server ). selection of the “ next ” button 96 will show the “ driver location ” window 114 ( shown in fig1 ). in either the automatic or advanced configuration the “ driver location ” window allows the user to select the appropriate driver to install . normally this is only displayed when the system can not locate the appropriate driver . in the case of advanced configuration for non - win 9x , if direct printing as a result of fig1 b is selected a “ share printer ” window 86 , shown in fig1 a may be displayed by which the user may indicate whether the printer is to be shared or not by selecting the appropriate box 88 or 89 , give a share name in the window 90 and select the operating system of all the computers printing to the selected printer from the list shown in the window 91 . clicking the “ install ” button 120 leads to the copy files and configure printer screen 122 of the installation process ( see fig1 ). when displaying the window 122 , the disclosed printer installation tool may do three additional things . first , it may push the configurable attribute values to the installed printer . second , it may check whether the installed printer started using those values . finally , the disclosed printer installation tool may configure the client computer so that it can print to the printer the disclosed printer installation tool starts configuring the print server with user configured new values , the copy files and configure printer window 122 may tell the user to “ please wait while configuring the device ” above a progress bar . the message “ please wait while configuring the device ” should preferably be displayed for approximately ten seconds beyond the actual download time or until the printer installation tool has detected that the client computer has started using the new parameters whichever is shorter . after pushing the configurable values to the printer , the disclosed printer installation tool checks whether the printer is using the configured values . if it finds that the device is not using the currently configured values , it may shows the “ reset printer ” window 124 ( see fig1 ). this dialog should be displayed only as long as the device still contains its old / original parameters . for example : if the address has been changed and the printer is still answering pings on its old address . ( if the device has started using the new parameters , this dialog can be skipped .) after the reset , if the device is not responding to any queries , another window ( not shown ) may display the text , “ waiting for the device to initialize , please make sure that the power is on ” in the copy files and configure printer . this message should be shown only as long as the device is not responding to any queries on any address . ( if the device has started using the new parameters , this dialog can be skipped .) if the device started responding , the next message displays is the “ waiting for the device to initialize ” in the copy files and configure printer dialog . this should be shown only as long as the device is responding but has not set all parameters . for example : the printer is responding to pings but the new name is not set . ( if the device has started using the new parameters , this dialog can be skipped .) once the installed printer configuration and validation is done , the disclosed printer installation tool may start configuring the client computer . first it copies the port monitor . then it installs and configures the port monitor while optionally displaying the text “ configuring the port monitor ”. then the tool installs the printer driver while optionally displaying the text “ installing the printer driver ” in the “ copy file and configure the printer ” 122 . on completing host and printer configuration , the disclosed printer installation tool displays the “ last install ” window 126 ( see fig2 ). the foregoing installation tool may be used with any computer operating system , such as windows , dos , linux , unix , etc . some embodiments of the installation tool may be configured for use with an individual one of these operating systems , or alternatively may be capable of installing a printer on any number of operating systems . for example , fig2 a to 25 illustrate an embodiment for the disclosed installation tool that is able to install and configure a printer on a host computer that operates under either windows 9x , windows nt , windows 2k or windows xp . referring specifically to fig2 a and 21b , this embodiment of the disclosed installation tool begins by displaying 150 an introductory screen , such as the splash screen 10 shown in fig1 or any other similar screen . the introductory screen may be initiated from either the insertion of a cd that contains an executable installation tool into cd - rom drive , by downloading the installation tool from the internet , or by selecting an executable installation tool program file within a windows operating system , including a dos prompt . the introductory screen preferably presents a user with the option 152 of proceeding with the printer installation , reviewing any associated documentation , or exiting the installation tool . if the user elects to exit 154 the installation tool , the installation tool may then terminate 156 . if the user elects to review associated documentation , the installation tool may display 158 the associated documentation to the user so that it may be read . once the user has indicated that he or she has finished reading the documentation , the user may once again be presented with the introductory screen and given the option of whether continuing with the installation or terminating the installation . if the user elects to continue with the installation , the installation tool may identify 160 the operating system of the host computer . if the host computer is operating on a windows 95 operating system , the installation tool may check 162 whether winsock 2 . 0 is installed in the windows directory . if winsock 2 . 0 is not installed , then the installation tool may terminate 164 after preferably indicating to the user that installation cannot proceed because of the missing file . if winsock 2 . 0 is available in a windows 95 operating system , the installation tool may proceed and display and installer welcome dialog 170 . similarly , if the host computer is operating on a win nt 4 . 0 , windows 2k , or windows xp operating system , the installation tool may check 166 whether administrative rights are needed to install a printer , and if so , determine whether the user has such administrative rights . if not , the installation tool may terminate 168 , else proceed and display the installer welcome dialog 170 . the installer welcome dialog 170 may be presented in a user interface such as that shown in fig3 . preferably , the installer welcome dialog 170 warns the user to terminate any other application that may be running on the host computer and to make sure that the printer to be installed is turned on and connected to the host computer either locally or through a network . also , the installer welcome dialog 170 preferably presents the user with a license agreement that may be either accepted or declined . if the user declines the license agreement , the installation tool may be terminated 174 . if the user accepts the license agreement , the installation tool may proceed and display an installer select dialog 176 . the installer select dialog 176 may be presented in a user interface such as that shown in fig5 . the installer select dialog preferably gives the user the option of selecting an automatic configuration where the installation tool configures the selected printer using default network settings , or an advanced configuration where the user customizes the settings of the selected printer . once the user has made the desired selection , the installation tool may identify 178 the operating system of the host computer . the embodiment of the disclosed installation tool presently being discussed is capable of installing a printer within any of the windows 9x , win nt 4 . 0 , win 2k , or windows xp operating systems . in this embodiment , four possible installation procedures may be used : a win 9x automatic configuration 180 , a win 9x advanced configuration 182 , a win nt 4 . 0 / 2k / xp automatic configuration 184 , or a win nt 4 . 0 / 2k / xp advanced configuration 186 . referring to fig2 , if the user selected an automatic configuration and the host computer operates on a win 9x operating system , the user may be presented with a dialog 188 in which the user can select an installation directory . the dialog 188 may be presented in a user interface like that shown in fig6 . some embodiments of the disclosed installation tool will have default directory indicated within the user interface so that the user only needs to hit the enter key to proceed , or may alternately override the default selection and either choose another , existing directory or create a new directory . once an installation directory has been selected or created , the user may be presented with a dialog 190 in which the user can select a program folder for the installation tool . the dialog 190 may be presented in a user interface like that shown in fig7 . some embodiments of the disclosed installation tool will have default program folder indicated within the user interface so that the user only needs to hit the enter key to proceed , or may alternately override the default selection and either choose another , existing program folder or create a program folder . once a program folder has been created , the installation tool may perform a search to identify 192 the available printers that can be installed and present a list of such computers to the user . the printer installation tool may use any appropriate protocol for this search , such as simple network management protocol ( snmp ) or common management information protocol ( cmip ). while the search is proceeding , a running count of detected available printers may be displayed to the user . some embodiments of the disclosed installation tool may allow the user to terminate the search at any time . if the user stops the search while it is proceeding , the user may still be allowed to select from the list already compiled . once the user selects an available printer from the presented list , the installation tool performs a check 194 to see whether the selected printer is being installed for the first time . if so , the user may be presented with a dialog 196 to configure the printer . the dialog 196 may be presented in a user interface like that shown in fig1 . in the dialog 196 , the user is allowed to name the device and optionally provide a location description for the printer . a default name may be initially displayed by the dialog 196 . the default name that is displayed should be the device name retrieved from the printer , and is preferably limited to 15 characters and follows the dns naming convention ( no spaces , no special characters ). the user can change this name so long as it follows the aforementioned length limitations . this name and location string is written back to the printer using snmp or cmip and the printer will register this name with the wins / dns server . this step may be skipped if the printer has previously been installed . this permits subsequent installations for the user to merely select next to install the printer properly . once the printer has been configured by the user , or alternately if the printer had been previously configured , the user may be presented with a dialog 198 to name the printer . the dialog 198 may be presented in a user interface similar to that shown in fig1 . the dialog 198 allows the user to give a windows name of the printer . the default will be the name of the printer in the installed machine . using this window , a user preferably has the option of giving the printer an intuitive name by which the user may subsequently recognize that particular printer when sending it a print job so that the user can locate the printer and easily retrieve the completed print job . the dialog 198 may also preferably allow the user to select the printer as the default windows computer for local print jobs . once the user has configured and named the selected printer , the installation tool may request the driver location as illustrated in fig1 and then the disclosed installation tool may push the configuration parameters back to the host computer / server using snmp protocols and updating the printer &# 39 ; s dns name . this step may not be necessary if no values have changed , i . e . the default values were selected . if , however , any value has been changed , the installation tool will preferably check whether the printer started using the new values pushed to the printer . if the printer is not started using the new values , the installation tool may reset 200 the printer and verify the printer on resetting starts using the new values . once the printer has been verified to use the new parameters , the installation tool may create a new lpr port and add registry entries , install the printer driver on to the newly created port , and prompt the user to print a test page , send the test printer data to the printer . the user may then be presented with a last install dialog 202 and the installation tool will then terminate . referring to fig2 , if the user selected an advanced configuration and the host computer operates on a win 9x operating system , the user may be presented with a dialog 204 in which the user can select an installation directory . the dialog 204 may be presented in a user interface like that shown in fig6 . some embodiments of the disclosed installation tool will have default directory indicated within the user interface so that the user only needs to hit the enter key to proceed , or may alternately override the default selection and either choose another , existing directory or create a new directory . once an installation directory has been selected or created , the user may be presented with a dialog 206 in which the user can select a program folder for the installation tool . the dialog 206 may be presented in a user interface like that shown in fig7 . some embodiments of the disclosed installation tool will have default program folder indicated within the user interface so that the user only needs to hit the enter key to proceed , or may alternately override the default selection and either choose another , existing program folder or create a program folder . once a program folder has been created , the installation tool may perform a search 208 to identify the available printers that can be installed and present a list of such computers to the user . the printer installation tool may use any appropriate protocol for this search , such as simple network management protocol ( snmp ) or common management information protocol ( cmip ). while the search is proceeding , a running count of detected available printers may be displayed to the user . some embodiments of the disclosed installation tool may allow the user to terminate the search at any time . if the user stops the search while it is proceeding , the user may still be allowed to select from the list already compiled . once the user selects an available printer from the presented list , the installation tool performs a check 210 to see whether the snmp community string of the selected device is the default value . if the snmp community string is not the default value , the user will be presented with a dialog 212 so that the user can enter the correct string for the selected device or return to the dialog 208 . if the snmp community string is incorrect the user will again be prompted to enter the correct snmp community string . once the disclosed installation tool has verified that the correct snmp community string has been entered , the user may be presented with an advanced printer configuration dialog 214 . the dialog 214 allows the entry of an ip address for the printer , a subnet mask identifier , and a default gateway . these entries may be made automatically via dhcp or the values may be specified manually . specifying either an invalid address or an address already being used will preferably result in an error message where the user will be prompted to enter correct values . otherwise , a printer configuration dialog 216 will appear . the dialog 216 allows the user to name the device and optionally provide a location description . a default name may be initially displayed in the dialog 116 . the default name that is displayed should be the device name retrieved from the printer , and is preferably limited to 15 characters and follows the dns naming convention ( no spaces , no special characters ). the user can change this name so long as it follows the aforementioned length limitations . this name and location string is written back to the printer using snmp or cmip and the printer will register this name with the wins / dns server . once the printer has been configured in the dialog 216 , the user may be presented with a “ driver location ” window ( not shown ) where the user may select the appropriate driver to install , at which point the dialog 218 will appear to name the printer . the dialog 218 may be presented in a user interface similar to that shown in fig1 . the dialog 218 allows the user to give a windows name of the printer . the default will be the name of the printer in the installed machine . using this window , a user preferably has the option of giving the printer an intuitive name by which the user may subsequently recognize that particular printer when sending it a print job so that the user can locate the printer and easily retrieve the completed print job . the dialog 218 may also preferably allow the user to select the printer as the default windows computer for local print jobs . once the user has configured and named the selected printer , the installation tool may request the driver location as illustrated in fig1 , the installation tool may select the print type as illustrated in fig1 b , and the disclosed installation tool may push the configuration parameters back to the host computer / server using snmp protocols and updating the printer &# 39 ; s dns name . this step may not be necessary if no values have changed , i . e . the default values were selected . if , however , any value has been changed , the installation tool will preferably check whether the printer started using the new values pushed to the printer . if the printer is not started using the new values , the installation tool may reset 220 the printer and verify the printer on resetting starts using the new values . once the printer has been verified to use the new parameters , the installation tool may creates a new lpr port and add registry entries , install the printer driver on to the newly created port , and prompt the user to print a test page , send the test printer data to the printer . the user may then be presented with a last install dialog 222 and the installation tool will then terminate . referring to fig2 , if the user selected an automatic configuration and the host computer operates on any of a win nt 4 . 0 , a win 2k , or a win xp operating system , the user need not select any installation directory or program folders . instead the user may be immediately presented with a dialog 224 following a search is performed to identify the available printers that can be installed and present a list of such computers to the user . the printer installation tool may use any appropriate protocol for this search , such as simple network management protocol ( snmp ) or common management information protocol ( cmip ). while the search is proceeding , a running count of detected available printers may be displayed to the user . some embodiments of the disclosed installation tool may allow the user to terminate the search at any time . if the user stops the search while it is proceeding , the user may still be allowed to select from the list already compiled . once the user selects an available printer from the presented list in the dialog 224 , the installation tool performs a check 226 to see whether the selected printer is being installed for the first time . if so , the user may be presented with a dialog 228 to configure the printer . the dialog 228 may be presented in a user interface like that shown in fig1 . in the dialog 228 , the user is allowed to name the device and optionally provide a location description for the printer . a default name may be initially displayed by the dialog 228 . the default name that is displayed should be the device name retrieved from the printer , and is preferably limited to 15 characters and follows the dns naming convention ( no spaces , no special characters ). the user can change this name so long as it follows the aforementioned length limitations . this name and location string is written back to the printer using snmp or cmip and the printer will register this name with the wins / dns server . this step may be skipped if the printer has previously been installed . once the printer has been configured by the user , or alternately if the printer had been previously configured , the user may be presented with a dialog 230 to name the printer . the dialog 230 may be presented in a user interface similar to that shown in fig1 . the dialog 230 allows the user to give a windows name of the printer . the default will be the name of the printer in the installed machine . using this window , a user preferably has the option of giving the printer an intuitive name by which the user may subsequently recognize that particular printer when sending it a print job so that the user can locate the printer and easily retrieve the completed print job . the dialog 230 may also preferably allow the user to select the printer as the default windows computer for local print jobs . once the user has configured and named the selected printer , the installation tool may request the driver location as illustrated in fig1 , and the disclosed installation tool may push the configuration parameters back to the host computer / server using snmp protocols and updating the printer &# 39 ; s dns name . this step may not be necessary if no values have changed , i . e . the default values were selected . if , however , any value has been changed , the installation tool will preferably check whether the printer started using the new values pushed to the printer . if the printer is not started using the new values , the installation tool may reset 232 the printer and verify the printer on resetting starts using the new values . once the printer has been verified to use the new parameters , the installation tool may creates a new lpr port and add registry entries , install the printer driver on to the newly created port , and prompt the user to print a test page , send the test printer data to the printer . the user may then be presented with a last install dialog 234 and the installation tool will then terminate . referring to fig2 , if the user selected an advanced configuration and the host computer operates on any of a win nt 4 . 0 , a win 2k , or a win xp operating system , the user may be immediately presented with a dialog 236 in which the user is presented with a list of available printers for configuration after the installation tool has completed a search . the printer installation tool may use any appropriate protocol for this search , such as simple network management protocol ( snmp ) or common management information protocol ( cmip ). while the search is proceeding , a running count of detected available printers may be displayed to the user . some embodiments of the disclosed installation tool may allow the user to terminate the search at any time . if the user stops the search while it is proceeding , the user may still be allowed to select from the list already compiled . once the user selects an available printer from the presented list , the installation tool performs a check 238 to see whether the snmp community string of the selected device is the default value . if the snmp community string is not the default value , the user will be presented with a dialog 240 so that the user can enter the correct string for the selected device or return to the dialog 236 . if the snmp community string is incorrect the user will again be prompted to enter the correct snmp community string . once the disclosed installation tool has verified that the correct snmp community string has been entered , the user may be presented with an advanced printer configuration dialog 242 . the dialog 242 allows the entry of an ip address for the printer , a subnet mask identifier , and a default gateway . these entries may be made automatically via dhcp or the values may be specified manually . specifying either an invalid address or an address already being used will preferably result in an error message where the user will be prompted to enter correct values . otherwise , a printer configuration dialog 244 will appear . the dialog 244 allows the user to name the device and optionally provide a location description . a default name may be initially displayed in the dialog 244 . the default name that is displayed should be the device name retrieved from the printer , and is preferably limited to 15 characters and follows the dns naming convention ( no spaces , no special characters ). the user can change this name so long as it follows the aforementioned length limitations . this name and location string is written back to the printer using snmp or cmip and the printer will register this name with the wins / dns server . once the printer has been configured the user may be presented with a dialog 246 in which the printer may be named by the user . the dialog 246 may be presented in a user interface similar to that shown in fig1 . the dialog 246 allows the user to give a windows name of the printer . the default will be the name of the printer in the installed machine . using this window , a user preferably has the option of giving the printer an intuitive name by which the user may subsequently recognize that particular printer when sending it a print job so that the user can locate the printer and easily retrieve the completed print job . the dialog 246 may also preferably allow the user to select the printer as the default windows computer for local print jobs . once the printer has been configured and named in the dialogs 244 and 246 , respectively , the installation tool may request the driver location as illustrated in fig1 , the installation tool may select the print type as illustrated in fig1 b , and the installation tool may present the dialog 248 in which the user may elect to share the printer with other network computers . if the printer is to be shared , the user should preferably give a share name the operating system of all the computers printing to the selected printer . if the printer is shared , a dialog ( not shown ) may be displayed so that the user has the option of installing the printer as a peer - to - peer , i . e . connected directly to a network or as a network printer , i . e . connected to a network server through another network computer . once the user has configured and named the selected printer , and indicated whether or not the printer is to be shared , the disclosed installation tool may push the configuration parameters back to the host computer / server using snmp protocols and updating the printer &# 39 ; s dns name . this step may not be necessary if no values have changed , i . e . the default values were selected . if , however , any value has been changed , the installation tool will preferably check whether the printer started using the new values pushed to the printer . if the printer is not started using the new values , the installation tool may reset 250 the printer and verify the printer on resetting starts using the new values . once the printer has been verified to use the new parameters , the installation tool may creates a new lpr port and add registry entries , install the printer driver on to the newly created port , and prompt the user to print a test page , send the test printer data to the printer . the user may then be presented with a last install dialog 252 and the installation tool will then terminate . the terms and expressions that have been employed in the foregoing specification are used therein as terms of description and not of limitation , and there is no intention , in the use of such terms and expressions , of excluding equivalents of the features shown and described or portions thereof , it being recognized that the scope of the invention is defined and limited only the claims that follow .	6
thereinafter , a preferred embodiment of the present invention will be described with reference to the accompanying drawings . firstly , an impulse noise reduction method according to the present comprises the steps of : ( a ) vertical line delay step for delaying an input brightness signal in a unit of line ; ( b ) vertical correlation determination step for determining impulse noise on the basis of a vertical correlation between the 1 horizonal line ( 1h )- delayed line at the step ( a ) and upper and lower horizontal lines ; ( c ) noise signal detection step for detecting the impulse noise from the 1h - delayed signal at the step ( a ) and outputting a noise detection signal ; ( d ) correction signal produce step for producing a correction signal by using upper and lower horizontal lines upwardly and downwardly positioned with respect to the impulse noise - detected line ; and , ( e ) output step for outputting the correction signal produced at the correction signal produce step ( d ) when the impulse noise is detected at the step ( c ). in an aspect of the present invention , the vertical correlation detection step , that is , the step ( b ) comprises the steps of : obtaining a difference between upper and lower lines on the basis of the 1h - delayed line and comparing the difference with a reference value to detect a correlation between the vertical lines ; determining the impulse noise by using the defference between the upper and lower lines on the basis of the 1h - delayed line ; and , outputting a noise detection signal when the impulse noise is determined without the correlation between the vertical lines at the step of detecting the vertical line correlation and the step of detecting the impulse noise . also , the noise signal detection step ( c ) further includes the steps of : differentiating the 1h - delayed brightness signals ; integrating the differentiated brightness signal ; and , obtaining an absolute value of the intrgreated brightness signals and comparing the absolute value with a reference value to output a noise detection signal when the noise is detected from the comparison result . the correction signal produce step ( d ) comprises the steps of : delaying the present input brightness signal and the 1h - delayed brightness signal by a predetermined time ; and , obtaining an average value of the signals delayed at the step of delaying the signals and outputting the average value as a correction signal . moreover , at the correction signal output step ( e ), if the impulse noise is detected , the correction signal is produced from the average value between the upper and lower lines . alternatively , if no the impulse noise is detected , the 1h - delayed original brightness signal is delayed by a predetermined time for processing the signal and then outputted . referring to fig4 there is shown a noise reduction circuit according to the present invention , in which the noise between the upper and lower lines is determined on the basis of the vertical correlation therebetween while the noise in a horizontal directon is determined by summing ( that is , integrating ) the primarily differentiated values of the brightness signals . in this case , if the impulse noise is detected , it can be reduced by substituting it with the average value of the upper and lower lines . in fig4 reference numerals 17 and 19 denote line delay portions forming a delay means which delays the brightness signal inputted to an input terminal in a unit of line , respectively . also , reference numeral 100 denotes a vertical correlation detector means which detects a vertical correlation of the brightness signals delayed by a predetermined line by way of the line delay means 17 and 19 . 200 denotes an impulse noise detector means which detects the impulse noise on the basis of a vertical correlation of the 1h - delayed brightness signals by means of the line delay portion 17 . furthermore , a logic portion , generally designated 25 , forms a logic means which outputs a detection signal when the vertical correlation and the impulse noise are detected by the vertical correlation detector 100 and the impulse noise detector 200 , respectively . also , first to third delay portions , generally designated 11 , 13 and 15 commonly form a delay means which delays the brightness signals by a predetermined time for processing the signals . an adder 21 and a multiplier 23 form a correction signal produce means which adds and averages the brightness signals delayed by a predetermined time , and produces a corrected brightness signal . a multiplexer , generally designated at 300 , is an output means which selectively outputs the correction signal from the correction signal produce means 21 and 23 and the 1h - delayed image signal from the line delay portion 17 on the basis of the impulse noise detection signal from the logic portion 25 . referring now to fig5 there is shown a detailed circuit diagram of an embodiment of the vertical correlation detector 100 in fig4 . in the drawing , first and second adders , generally designated at 101 and 102 , form the vertical correlation detector means 100 which obtains a difference among the present input brightness signal a , 1h - delayed brightness signal b and 2h - delayed brightness signal c so as to detect the vertical correlation therebetween . reference numerals 103 and 104 denote an absolute value calculator portion which calculates an absolute value from the differences of the brightness signals obtained by the first and second adders 101 and 102 . also , first and second comparators 106 and 107 and an and 108 commonly form a vertical correlation determination means which determines a vertical correlation by performing logic comparison and product of the absolute values of the differences of the brightness signals , obtained by the first and second absolute value calculator portions 103 and 104 , with a reference value th1 . an exclusive - or gate 105 and an inverter 109 are composed of an impulse noise determination means which performs exclusive - or operation and inversion for the differences of the brightness signals , each being obtained by the first and second adders 101 and 102 , to thereby determine whether the signal is the impulse noise or not . in addition , an and gate , generally designated at 110 , is a vertical noise determination means which outputs a vertical noise generation signal when the signal is the impulse noise by using the correlation determination means and the impulse noise determination means . referring to fig6 there is shown a detailed circuit diagram of an embodiment of the impulse noise detector portion 200 in fig4 . in the drawing , reference numerals 201 and 202 denote first and second pixel delay portions which form together with an adder generally designated at 203 a differential means for differentiating the brightness signals . also , a plurality of pixel delay portions 205 to 212 and an summer 213 are composed of an integral means or integrator which integrates the differentiated brightness signals . an absolute value calculator 214 and a comparator 215 are composed of the noise determination means which obtains an absolute value of the brightness signals differenticated and then integrated as mentioned above , and compares the absolute value with a reference value th2 thereby to determine whether the signal is a horizontal noise or not . referring to fig7 there is shown views illustrating frequency components of the impulse noise ( white ) which has not the correlation between the upper and lower lines , but has the frequency component of 2 [ mhz ] or more in the horizontal direction . further , in fig7 ( a ) denotes the white impulse noise having the frequency of approx . 7 [ mhz ], ( b ) denotes the white impulse noise having the frequency components of approx . 3 . 58 [ mhz ] and ( c ) denotes the white impulse noise having the frequency component of approx . 2 . 3 [ hhz ]. in the drawings , dots denote sampling positions of 14 [ mhz ], respectively . referring now to fig8 there is shown waveforms obtained in processing the transition - period pulses of the high - frequency brightness signals and the noise . if the impulse noise as shown in fig8 ( a ) is differentiated , then a sine waveform is obtained from the noise , as shown in fig8 ( b ). further , if the pulses of the transition period of the high - frequency brightness signals with edges changed from black to white , as shown in fig8 ( c ) are differentiated , then the pulses are in positive pulses as shown fig8 ( d ). also , if the noise and the positive pulses are integrated for a predetermined time , then the noise is to be zero while the pulse is not to be zero . more particularly , when an original function is set to f ( x ), the primary differential function is indicated by f &# 39 ;( x ). then , if the primary differential function f &# 39 ;( x ) is integrated for a predetermined time , then it is obtained the following equation . that is ; ## equ1 ## accordingly , if the integrated value is zero , it means that the value is the impulse noise . alternatively , if the value is not zero , then it means that the value is the original brightness signal . next , fig9 shows waveforms obtained in processing the white noise . if the differential is carried - out for the noise shown in fig9 ( a ), then a sine waveform is obtained from the noise , as shown in fig9 ( b ). furthere , if the noise of the sine waveform is integrated again , then the linear waveform which in turn is determined as the noise is obtained as shown in fig9 ( c ). referring to fig1 , there is shown an examplary view of a size of a noise detecting window according to the present invention . with the window in fig1 , the noise is detected by using , for example , 3 lines in the horizontal direction and 9 pixels in the vertical direction . in this case , as the size of the window is increased , the noise can be effectively removed . now , an embodiment of the noise reduction method and circuit according to the present invention will be described . referring to fig4 if the brightness signal is entered to the input terminal in , then the signal is dealyed by the line delay portions 17 and 19 in a unit of line . in the drawing , a , b and c denote the present input brightness signal , 1h - delayed brightness signal and 2h - delayed brightness signal , respectively . if the signals a , b and c are entered to the vertical correlation detector portion 100 , the first and second adders 101 and 102 in the vertical correlation detector portion 100 add the brightness signals a and b , c and b , inputted to inverting and non - inverting terminals thereof and obtain the difference between the present input brightness signal a and the 1h - delayed brightness signal b and the difference between the 1h - delayed brightness signal and the 2h - delayed brightness signal so as to detect the vertical correlation therebetween . consequently , the first and second absolute value calculator portions 103 and 104 calculate the absolute values of the differences of the brightness signals , obtained by the first and second adders 101 and 102 and output the absolute values to input terminals b1 and b2 of the first and second comparators 106 and 107 . the first and second comparators 106 and 107 compare the absolute values of the brightness signals from the absolute value calculator portions 103 and 104 with the reference value th1 . denpending upon the comparison result , if the absolute value of the brightness signal is larger than the reference value th1 , the comparators 106 and 107 produce a high - level output , respectively and consequently the and gate 108 outputs a high level signal according to the high level outputs of the comparators 106 and 107 to thereby indicate a generation of the noise . also , if the brightness signals a , b , and c are determined as the impulse noise such as 1 , 0 , 1 or 0 , 1 , 0 , the exclusive - or gate 105 outputs a low level signal and the inverter 107 inverts the output signal of the exclusive - or gate 105 . as a result , the inverter 109 outputs a high level signal in case of generation of the impulse noise . also , if the impulse noise is determined by using the correlation determination means and the impulse noise determination means , the and gate 110 outputs a vertical noise generation signal f . as described above , the vertical correlation detector portion 100 obtains the difference between the upper and lower lines on the basis of the 1h - delayed brightness signal to be presently processed in view of the fact that no the noise has any correlation between the vertical upper and lower lines , and calculates the absolute value of the difference signals whereby it determines the absolute value larger than the reference value as the noise and it also determines that the noise is the impulse noise by exclusive - oring and inverting the difference signal between the upper and lower lines . meanwhile , the input brightness signal is delayed by means of the 1h delay portion 17 by 1 horizontal line and the 1h - delayed brightness signal is entered to the impulse noise detector portion 200 which differentiates the 1h - delayed brightness signal b by the differential means including the first and second pixel delay portions 201 and 202 and the adder 203 as shown in fig6 . next , the brightness signal thus differentiated is subjected to the integration using the integral means composed of the pixel delay portions 205 to 212 and the summer 213 . accordingly , when the brightness signal is differentiated and integrated sequentially as described above , if the signal is the impulse noise , the output of the summer 213 becomes zero as shown in fig9 . alternatively , if the pulse of the transition period of the high - frequency brightness signal with the edge changed from black to white is subjected to processing then the summer 213 outputs not zero but a constant value . the absolute value calculator portion 214 calculates the absolute value of the signal supplied from the summer 213 in the integral means and outputs the obtained absolute value to the comparator 215 which compares the value with the previously set reference value th2 and outputs the horizontal noise detection signal g under the output &# 34 ; zero &# 34 ; of the absolute value calculating portion 214 according to the detect of the noise . herein , a reason to set the reference value th1 into the input terminal b of the comparator 215 is to reduce an erroneous detection of the noise when the summed value at forward and backward sides of a peak noise point has an offset value out of &# 34 ; zero &# 34 ;. accordingly , if the impulse noise is determined on the basis of the outputs f and g from the vertical correlation detector portion 100 and the impulse noise detector portion 200 , then the logic portion 25 ( fig4 ) outputs the noise detection signal i , and the multiplexer 300 produces a correction signal according to the output of the impulse noise detection signal i from the logic porton 25 . more particularly , in order to process the signal , the brightness signals delayed by the first to third delay portion 11 , 13 and 15 are added to each other by the adder 21 and the added signals are averaged by the multiplier 23 to produce the correction signal d which in turn is supplied to the output terminal out . on the contrary , if the impulse noise is not determined , the multiplexer 300 outputs the brightness signal , delayed by 1 horizontal line by means of the line delay portion 17 and also delayed by a predetermined time by means of the second delay portion 13 . as described above , according to the present invention , since the impulse noise can be removed without the damage of the original image signal it has an effect that a distinct picture image is provided . the present invention has been described in consideration of the specified embodiment , it can be made various modifications and changes without departing from scope and spirit of the invention . in particular , the present invention has been described mainly with respect to the determination and reduction ( correction ) of the impulse noise of the brightness signal , but it will be applied to a color signal and it can be usally used in a combination relation with other noise reduction means . accordingly , the present invention is not limited to the specifically	7
referring to fig3 through 6 there is illustrated a preferred embodiment of a ladder - type electric filter to which the method of the invention is applied . in the drawings , 1 denotes a thin and rectangular case made of a synthetic resin material and having an opening 2 provided on a front surface thereof . a pair of square parallel resonators p1 and p2 are superimposed or arranged in two layers within a lower portion of an inner space 3 of the case 1 . a pair of strip - shaped series resonators s1 and s2 are arranged in chambers 4a and 4b formed side by side by arranging a partition , wall 4c in an upper portion of the space 3 . the series resonators s1 and s2 are relatively thick whereas the parallel resonators p1 and p2 are relatively thin so that the former have a small capacitance relative to that of the latter . also , the parallel resonators p1 and p2 are made square and their electrodes have a large surface area in order to utilize a contour vibration mode . in a ladder - type electric filter having a configuration as described above , the principal resonance frequency of the strip - shaped series resonators s1 and s2 in the longitudinal vibration mode is made to agree with the center frequency of the filter . additionally , the antiresonant frequency of the parallel resonators p1 and p2 in the contour vibration mode is made to agree with the center frequency of the filter as in the case of conventional filters of the type under consideration so that a desired unit filter circuit may be formed by the series resonators s1 and s2 and the parallel resonators p1 and p2 . in a ladder - type electric filter as described above , each of the series resonators s1 and s2 may typically be 1 . 5 mm wide , 3 . 8 mm long and 0 . 50 mm thickness whereas each of the parallel resonators p1 and p2 may normally have a square surface with 4 . 65 mm long edges and a thickness of 0 . 32 mm . now , the components stored in the space 3 will be described in detail . the pair of square parallel resonators p1 and p2 are superimposed one on the other with a grounding terminal plate 5 and a square connector terminal plate 6 interposed therebetween , their electrodes arranged on the interface being connected to the grounding terminal plate 5 . an end of the grounding terminal plate 5 is extended to form a connector leg 5a . the square connector terminal plate 6 is arranged between the grounding terminal plate 5 and the parallel resonator p1 . the connector leg 5a is extened out of the case 1 as shown in fig4 when the case 1 is produced by molding . the strip - shaped series resonators s1 and s2 designed to utilize a longitudinal vibration mode are horizontally arranged side by side on the upper parallel resonator p2 with an insulating plate 7 and a terminal strip 8a of a connector terminal plate 8 interposed therebetween . these series resonators s1 and s2 are specifically positioned in the respective storage chambers 4a , 4b formed side by side on the upper portion of the space 3 . the connector terminal plate 8 comprises a pair of terminal strips 8a and 8b arranged in parallel with each other and connected with each other by a connector section 8c , the terminal strip 8b being disposed under the lower parallel resonator p1 in such a manner that the lower surface electrodes of said series resonators s1 and s2 are connected with their counterpart of the parallel resonator p1 by way of the connector terminal plate 8 . the connector section 8c is buried in the case at the time of molding . an input terminal plate 9 is arranged on the upper surface electrode of the series resonator s1 and is provided with a connector leg 9a projecting out of the case 1 through the opening 2 from an end thereof . thus , the upper surface electrode of the series resonator s1 can be connected to an external input circuit . the upper surface electrodes of the series resonator s2 and the parallel resonator p2 are electrically connected with each other by an output terminal plate 10 , which also is provided with a connector leg 10a projecting out of the case 1 through the opening 2 from an end thereof so that the upper surface electrodes of the series resonator s1 and the parallel resonator p2 can be connected to an external output circuit . additionally , buffer plates 11a and 11b are respectively arranged between ceiling or upper inner wall of the case 1 and the input and output terminal plates 9 and 10 . the terminal plates are provided with contacting protuberant portions x in order to ensure electrical connection with the resonators p1 , p2 , s1 and s2 , these contacting protuberant portions x being so located that each of them provides a node of vibration on the corresponding one of the resonators . the case 1 of the above described embodiment is formed by molding integrally with the grounding terminal plate 5 and the connector terminal plate 6 . then , the components are inserted into the case 1 through the opening 2 to place them in position with the connector legs 9a and 10a projecting outward through the opening 2 . thereafter , a plate 12 is fitted in the opening 2 and secured there by injecting a sealing resin material 13 such as epoxy resin to produce a finished ladder - type electric filter . the connector legs a and 10a and the connector leg 5a of the grounding terminal plate 5 are bent twice along the case 1 so that their free ends are positioned on the bottom of the case 1 . thus , the ladder - type electric filter f has its input terminal plate 9 , output terminal plate 10 and grounding terminal plate 5 partly exposed to the outside under the bottom so that it may be incorporated into a filter circuit simply by soldering and electrically connecting the exposed ends of the terminal plates to the associated circuit portions provided on a printed circuit board not shown . since the strip - shaped series resonators s1 and s2 are horizontally arranged side by side on the parallel resonator p2 , the overall height of the ladder - type electric filter unit is significantly reduced as compared with a conventional filter unit of the type . the resonance frequency of each of the series resonators s1 and s2 of a ladder - type electric filter of the type under consideration is required to strictly agree with a given value and therefore their frequencies need to be regulated in order to accommodate themselves to any discrepancy in the operating frequency of the filter that may be given rise to by inaccurate molding and other causes . since the space for containing such series resonator is designed to have a given length , the contact point x of a terminal plate contiguous to the series resonator s1 or s2 may inevitably be shifted relative to the latter if the length of the latter is modified by cutting it along one of its shorter edges . while the center of each of the series resonators s1 and s2 provides its node of vibration , the relative displacement of the contact point x and the center of the resonator can significantly increase the insertion loss and adversely affect the efficiency of the filter . fig7 - a , 7 - b and 7 - c illustrate three possible alternatives for modifying the resonance frequency of each of the resonators s1 and s2 . in fig7 - a , all the four corner portions β of each of the series resonators s1 and s2 are beveled by 45 ° whereas only a pair of corner portions β located at one end of the resonator are beveled by 45 ° in fig7 - b and alternatively a pair of corner portions β located at the opposite ends of the resonator are beveled by 45 ° in fig7 - c . in any of the above alternatives , it is appreciated that the lengths of the series resonators s1 and s2 are not changed . therefore , the respective positional relationships between the containing chambers 4a and 4b and the series resonators s1 and s2 are not altered and consequently each contacting protuberant portion x of the terminal plates contiguous to the series resonator s1 or s2 is constantly aligned with the center of the resonator where the node of vibration is located . thus , the operation of regulating the resonance frequency of the device does not involve any insertion loss and ensures a desired filtering performance . fig8 and 10 illustrate how the resonance frequency of each series resonator may be changed by the extent of beveling , that is the fact that the resonance frequency of each of the series resonators s1 and s2 of a ladder - type electric filter can be increased by beveling one or more comer portions of each series resonator by 45 °. in the graphs , the transverse axis represents the extent of beveling when the corner portions of each series resonator are evenly beveled at 45 °. as seen in these graphs , the more beveled the greater is the resonance frequency of the series resonator . fig8 shows the relationship between the extent of beveling and the increase in the resonance frequency when all the four corner portions of the resonator are evenly beveled as shown in fig7 - a . whereas fig9 and 10 illustrate the corresponding relationships when two corner portions at the opposite ends of a short and long horizontal edges are evenly beveled respectively as shown in fig7 - b and c . in the graphs , x represents the length of the edge generated by beveling which is obtained by averaging the values measured on the samples in the experiments . while the parallel resonators p1 and p2 in the above illustrated embodiment are strip - shaped rectangular devices that utilize a longitudinal vibration mode , they may alternatively be square devices like series resonators s1 and s2 that utilize a contour vibration mode . the angle of beveling or obliquely cutting one or more corner portions of the series resonators s1 and s2 may not necessarily be 45 ° and may alternatively be 30 °, 60 ° or any other appropriate angle or , still alternatively , they may be arcuately beveled with a given radius of curvature . as is described above in detail , the present invention is based on the fact that the resonance frequency of each of the series resonators s1 and s2 of a ladder - type electric filter can be increased and regulated by beveling or obliquely cutting one or more corner portions thereof . with such beveling or obliquely cutting , the length l of each of the series resonators is not modified and therefore its node of vibration can be always aligned with the corresponding contacting point x of the contiguous terminal plate to eliminate any insertion loss due to the resonance frequency regulation . thus , the present invention provides an excellent method for regulating the resonance frequency of a strip - shaped series resonator . it is to be understood that the illustrated and described embodiments are only illustrative of the application of the principles of the present invention . numerous modifications and alterations may be made by those skilled in the art without departing from the spirit and scope of the invention , and the appended claims are intended to cover such modifications and alterations .	7
for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device , and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . fig1 schematically illustrates a first embodiment of the present invention , an engine system 20 including a variable geometry turbine or vgt 22 . the engine system 20 includes an air intake manifold for drawing air into the engine system fluidically connected to an air cooler . intake air is cooled in the air cooler before being drawn through an intake valve and mixed with fuel vapor in a combustion chamber . the fuel vapor is introduced into the combustion chamber by a fuel injector fed by a fuel pump connected to a fuel supply . after the fuel - air mixture is combusted , exhaust gasses are expelled from the combustion chamber through an exhaust valve . some of the exhaust gasses are reintroduced into the intake air flow through an egr valve while the remaining exhaust gasses are expelled from the engine system 20 through the exhaust orifice 21 . the vgt 22 is positioned to receive exhaust gasses generated by the engine system 20 when in operation . the vgt 22 includes a compressor 24 operationally connected to a turbine 26 . the compressor 24 functions to compress intake air for the engine system 20 . the turbine 26 has a changeable nozzle open area , which allows adjustment of the velocity of the exhaust gasses flowing therethrough and out the exhaust orifice 21 . the turbine nozzle open area is adjusted by compressed air regulated by a pressure regulator 28 pneumatically connected between an air tank 30 and the turbine 26 . the pressure regulator 28 is preferably a proportionally controllable electronically actuated pressure regulator . a capsule 32 is preferably pneumatically connected between the pressure regulator 28 and the turbine 26 . a pressure sensor 34 is operationally connected between the air tank 30 and the turbine 26 , and is preferably connected near the capsule 32 . while this embodiment preferably envisions the pressure sensor 34 as integral to the vgt system 22 , the pressure sensor 34 may be an independent unit temporarily operationally connected to the vgt system 22 for the duration of the diagnostic testing procedure . the capsule 32 operates to temporarily store compressed air for controlling the turbine 26 . the air tank 30 is pneumatically connected to an air pump 36 . when the engine system 20 is running , the air pump 36 pressurizes the air tank 30 . when the engine system 20 is shut off , the air tank 30 gradually becomes depressurized . a vgt position sensor 38 is operationally connected to the turbine 26 . while the vgt position sensor 38 is preferably integrally connected to the vgt system 22 , the vgt position sensor 38 may also be an independent unit temporarily operationally connected to the vgt system 22 for the duration of the diagnostic testing procedure . the vgt position sensor 38 is preferably a potentiometer , but may be any convenient sensor capable of assessing the motion and position of the turbine 26 . for example , vgt position sensor 38 may be a suitable electromechanical device or a suitable optical device . the vgt position sensor 38 functions to monitor and provide feedback information regarding the turbine configuration . preferably , both the vgt position sensor 38 and the pressure sensor 34 are integral with the engine system 20 , although one or both may be part of a diagnostic station or otherwise connected for the purposes of checking the function of the vgt system 22 . an electronic controller 40 is electrically connected to the pressure regulator 28 , the pressure sensor 34 , and the vgt position sensor 38 . preferably , the electronic controller is also adapted to receive direct input commands from an engine system operator . more preferably , the electronic controller 40 is in electronic communication with an engine speed sensor and one or more fuel pumps and / or fuel injectors providing fuel to the engine system 20 . the electronic controller 40 is adapted to generate a sinusoidal control signal and transmit the control signal to the pressure regulator 28 . the control signal actuates the pressure regulator 28 to send a sinusoidal pressure profile to the turbine 26 , resulting in the turbine configuration changing sinusoidally . in other words , the sinusoidal control signal actuates a periodic opening and closing of the turbine 26 which , when plotted as a function of time , has the shape of a sine wave . the electronic controller 40 preferably initiates the diagnosis process by generating a control sinusoidal signal having a duration of about 60 seconds , although shorter or longer duration control signals may be chosen . during the duration of the control signal , the electronic controller 40 receives and records input signals from the pressure sensor 34 and the vgt position sensor 38 . the electronic controller 40 is then able to plot the data from the pressure sensor 34 and vgt position sensor 38 ( i . e ., the air pressure and vgt position data ) individually as a function of time or of the sinusoidal signal or both . from this data , information regarding the calibration of the sensors 34 , 38 and the status of the pressure regulator 28 and the turbine 26 may be calculated . the electronic controller 40 is preferably programmed to initiate diagnosis of the vgt system 22 under a number of specific conditions . for example , the electronic controller 40 may be directed to initiate diagnosis by a command from an operator . alternately , the electronic controller 40 may be programmed to initiate diagnosis of the vgt system 22 when the engine is in a prolonged idling state . a prolonged idling state might be defined by the engine running within +/− 10 % of a predetermined idling speed ( as detected by the engine speed sensor ) and with fueling less than 30 % of a predetermined maximum amount ( as controlled by the electronic controller 40 ) for a predetermined period of time ( such as sixty seconds or five minutes , depending upon the desired frequency of testing ). while the above parameters defining a prolonged idling time are preferred , any set of parameters may be chosen to define a desired prolonged idling period . a prolonged idling time is preferred since it both allows for sufficient pressure to be built up in the air tank 30 as well as keeping the testing frequency low to avoid excessive interference with the normal operation of the engine system 20 . additionally , the electronic controller 40 may be programmed to wait a minimum amount of time between tests to further avoid too frequent testing . likewise , the electronic controller 40 may be programmed to initiate diagnosis immediately following engine shut down , as detected by the engine speed sensor . preferably , the electronic controller 40 is programmed to wait a predetermined length of time ( such as one minute ) after engine shut down before initiating diagnosis in order to allow the turbine sufficient time to come to rest without allowing enough time for the air tank 30 to depressurize . conducting engine diagnosis after engine shut down allows isolated diagnosis of the vgt system 22 to occur when no other engine systems are in operation , thus minimizing the probability of confounding factors . preferably , the electronic controller 40 is programmed to abort the diagnosis if the test conditions are changed , such as by the throttle position changing , to eliminate degradation of engine performance due to the diagnosis as well as minimizing variables that could influence the test results . fig2 - 8 schematically illustrate the diagnosis process . during diagnosis , the electronic controller 40 preferably begins by overwriting the per - existing vgt command with a 5 second flat signal at pulse - width modulation ( pwm )= 0 to return the turbine 26 to a fully open position . next , the electronic controller 40 generates a sinusoidal control signal to the pressure regulator 28 to actuate the turbine 26 to perform two full cycle movements ( i . e ., to move from the fully opened position to the fully closed position and back , twice ). the electronic controller 40 receives separate data streams from the pressure sensor 34 and from the vgt position sensor 38 while the turbine 26 is cycling , and records the respective data streams as functions of time and / or the sinusoidal control signal . the electronic controller 40 also calculates and records the respective minimum and maximum positions of the turbine 26 and the respective minimum and maximum capsule 32 pressures as detected by the pressure sensor 34 . the electronic controller 40 also calculates and records the respective maximum turbine travel distance and the capsule 32 pressure maximum difference . additionally , the electronic controller 40 plots the hysteresis curve of the turbine position as a function of the command signal ( i . e ., the vgt hysteresis curve ) and calculates the area of the vgt hysteresis curve ( see fig7 ). the electronic controller 40 also plots the hysteresis curve of the capsule 32 pressure as a function of the control signal ( i . e ., the capsule 32 pressure hysteresis curve ) and calculates the area of the capsule 32 pressure hysteresis curve ( see fig8 ). fig7 and 8 illustrate the difference between typically normal hysteresis curves and abnormal hysteresis curves indicative of a malfunctioning turbine and a malfunctioning pressure regulator , respectively . the respective hysteresis responses are well known for vgt turbine systems that are functioning normally and can be characterized by the area defined within the normal hysteresis curve . the electronic controller 40 may therefore be programmed with maximum allowable area values for the respective hysteresis curves . the area of a measured hysteresis curve exceeding the predetermined maximum hysteresis value for that curve indicates a physical system ( here , either the pressure regulator or the turbine ) that is responding sluggishly to a command signal . in other words , the area of one or both hysteresis curves exceeding a predetermined threshold value for the vgt system 22 signals degradation in the controllability of the vgt system and a corresponding degradation in engine efficiency . referring back to fig2 - 6 , the diagnosis logic is illustrated in detail . first , the electronic controller 40 sends a sinusoidal control signal to the pressure regulator . the electronic controller 40 then measures the position of the variable geometry turbine 26 as well as the pressure of the air tank / regulated compressed air source 30 ( assumed to be equal to the capsule 32 pressure ) for the duration of the control signal . the electronic controller 40 next respectively calculates the position of the variable geometry turbine 26 and the pressure of the compressed air source 30 as functions of the sinusoidal control signal . the electronic controller 40 then sequentially determines the calibration status of the pressure sensor 34 , checks the operating status of the pressure regulator 28 , determines the calibration status of the variable geometry turbine position sensor 38 , and checks the operating status of the variable geometry turbine 26 . the electronic controller 40 does this by comparing the calculated calibration values and operating status values ( i . e ., the areas of the respective calculated hysteresis curves ) against respective predetermined normal operating parameters and / or threshold values . if any of the above - listed measured or calculated values deviate from the predetermined normal operating parameters and / or exceed the predetermined threshold values , an appropriate error message is generated and displayed , and further diagnostic testing is halted at that point . specifically , the calibration status of the pressure sensor 34 is determined by first determining if the measured capsule 32 pressure is outside of a predetermined pressure range defined by a predetermined minimum capsule 32 pressure value and a predetermined maximum capsule 32 pressure value . typically , this range is from about 25 psi to about 75 psi , but may vary with different engine designs or operating parameters . if the measured capsule 32 pressure is within the predetermined pressure range , the electronic controller 40 next determines if the minimum measured capsule 32 pressure is in excess of a predetermined maximum allowed minimum pressure value and if the maximum calculated capsule 32 pressure maximum difference is in excess of a predetermined minimum allowed capsule 32 pressure maximum difference value . in other words , the electronic controller 40 determines if the minimum capsule 32 pressure stays below some maximum threshold value and if the maximum capsule 32 pressure stays above some minimum threshold value over a sinusoidal cycle . the vgt system 22 requires a minimum capsule 32 pressure difference to ensure sufficient capsule 32 pressure to actuate movement of the turbine 26 . likewise , if the capsule 32 pressure exceeds a practical maximum value , control of the turbine 26 becomes difficult . the electronic controller 40 generates and displays a pressure sensor error message if the capsule 32 pressure is outside of a practical operating pressure range defined by a predetermined minimum and a predetermined maximum pressure value or if the minimum measured capsule 32 pressure is in excess of a predetermined maximum allowed minimum pressure value and if the maximum calculated capsule 32 pressure maximum difference is in excess of a predetermined minimum allowed capsule 32 pressure maximum difference value . the electronic controller 40 checks the operating status of the pressure regulator 28 by first verifying that the pressure sensor 34 is functioning normally and , if so , then determining if a predetermined minimum allowed capsule 32 pressure maximum difference exceeds the maximum calculated capsule 32 pressure maximum difference . if not , the electronic controller 40 generates a hysteresis curve of the capsule 32 pressure as a function of the sinusoidal control signal for comparison to a predetermined maximum hysteresis curve area value . the electronic controller 40 generates and displays a compressed air source error message if the predetermined minimum allowed capsule 32 pressure maximum difference exceeds the maximum calculated capsule 32 pressure maximum difference or if the area of the hysteresis curve exceeds a predetermined maximum hysteresis curve area value . the electronic controller 40 next determines the calibration status of the variable geometry turbine position sensor by first verifying that the pressure regulator 28 is functioning normally and , if so , then determining if a predetermined minimum variable geometry turbine minimum position exceeds the minimum measured variable geometry turbine position . if not , the electronic controller 40 then calculates the maximum travel distance of the variable geometry turbine 26 for comparison to a predetermined maximum variable geometry turbine maximum position and calculates the maximum travel distance of the variable geometry turbine 26 for comparison to a predetermined maximum variable geometry turbine travel distance value . the electronic controller 40 generates and displays a variable geometry turbine position sensor error message if a predetermined minimum variable geometry turbine minimum position exceeds the minimum measured variable geometry turbine position or if the maximum variable geometry turbine position exceeds a predetermined maximum variable geometry turbine maximum position and if the calculated maximum travel distance of the variable geometry turbine is in excess of a predetermined maximum variable geometry turbine travel distance value . the electronic controller 40 then checks the operating status of the variable geometry turbine by first verifying that the variable geometry turbine position sensor is functioning normally and , if so , then calculating the maximum travel distance of the variable geometry turbine 26 as a function of the sinusoidal control signal . the electronic controller 40 next determines if the calculated variable geometry turbine travel distance is outside a range defined by a predetermined maximum variable geometry turbine travel distance and a predetermined minimum variable geometry turbine travel distance . if not , the electronic controller 40 generates a hysteresis curve of the variable geometry turbine position as a function of the sinusoidal control signal and compares it to a predetermined maximum hysteresis curve area value to determine if the area of the hysteresis curve exceeds the predetermined maximum hysteresis curve area value . the electronic controller 40 generates and displays a variable geometry turbine error message if the calculated variable geometry turbine travel distance is outside a range defined by a predetermined maximum variable geometry turbine travel distance and a predetermined minimum variable geometry turbine travel distance or if the area of the hysteresis curve exceeds a predetermined maximum hysteresis curve area value . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are to be desired to be protected .	5
a preferred embodiment of the traffic lane delineator device of the present invention is shown in perspective view in fig1 . as may there be seen , the device 10 includes a housing 12 within which is mounted an electric lamp 14 having leads 16 and 18 extending therefrom . the housing 12 includes a base portion 20 and a generally transparent or translucent raised portion 22 through which light emitted by the electric lamp 14 may be transmitted . a flexible pliable sheet - like body 24 surrounds an extended base portion of the housing , such that the base portion is sandwiched therein and allows the raised portion 22 of the housing 12 and the leads 16 and 18 of the lanp 14 to protrude . the body 24 is preferably constructed from three sheets 26 , 27 and 28 , respectively , of unvulcanized rubber . the top sheet 26 is provided with an opening for the raised portion 22 of the housing and is sealed to the upper surface of the base portion of the housing 12 and to the bottom sheet 28 , which in turn extends across and is sealed to the bottom of the base portion 20 so as to completely seal the housing therebetween . the middle sheet 27 is provided with a hole in the center to receive the base portion of the housing 12 and provides a more gradual transition around the periphery of the housing so as to improve the seal between the top and bottom sheets 26 and 28 . in order to ensure that the outer surfaces of the layers 26 and 28 remain clean and do not undesirably adhere to other objects during shipment and the like , release liners 29 and 30 are provided on the surfaces of the layers 26 and 28 , respectively , which liners are removed prior to applying the device during installations . as shown in fig1 ( and also in fig3 and 4 discussed hereinafter ), the sheet - like body 24 preferably extends beyond the base portion 20 of the housing so as to provide an extended area for contact and bonding to the lane marking film . the extended area of the body 24 is preferably three times the area of the base portion 20 , and may desirably be approximately four times the area of the base portion . the exact amount desired may vary depending upon the specific installation . clearly an excess amount would be wasteful , while for seldom used areas or protected installations not subjected to severe traffic , a smaller relative area is satisfactory . in a preferred embodiment , the extended base portion of the housing 12 has been constructed to be approximately 3 inches ( 7 . 6 cm ) in diameter , the film is approximately 4 inches ( 10 cm ) wide , and the extended sheet - like body 24 approximately 4 × 7 inches ( 10 × 17 . 8 cm ), resulting in a ratio of respective areas of approximately four . a partially cut - away view of a traffic lane delineator film preferably used in the present invention is shown in fig2 . as is there set forth , the film is preferably constructed from two strips 32 and 34 , laminated together and having , as an array of electrical conductors , two flat conductors 36 and 38 extending along the length of the strips 32 and 34 . each of the conductors 36 and 38 is preferably equivalent to an awg wire size no . 16 , and is preferably pretinned to promote ease in soldering the leads such as leads 16 and 18 of the lamp 14 to the conductors 36 and 38 . further , it has been found that the pretinning tends to anneal the conductors , improving the conformability of the film to a road surface . the strips 32 and 34 are laminated together such as with a conventional neoprene adhesive and thereby provide electrical insulation and environmental protection for the conductors 36 and 38 . release liners 40 and 42 are also preferably provided on the exposed surfaces of the strips 32 and 34 so as to maintain the surfaces of the film clean and to prevent undesirable adhering of the surfaces to opposite surfaces of the film such as when the film is shipped in a rolled - up form . the composition of the layers 32 and 40 is primarily unvulcanized rubber ; however , additional fillers and extenders such as asbestos , pigments and glass beads may also be included . for example , to increase the conspicuity of the film when used in lane marking applications , the composition of the layers 32 and 40 is desirably modified to contain a white pigment . alternatively , where the film is provided to facilitate connection of the conductors 32 and 38 from a lane marking film to appropriate electrical sources along the side of a roadway , the layers 32 and 40 may desirably contain a gray or black pigment such that the film blends with the road surface . similar films may likewise be formed via extrusion and other conventional techniques . a portion of a film and light source combination such as typically used in a road installation is shown in fig3 . in this figure , a film 44 containing a pair of electrical conductors 46 and 48 is shown to have two light sources 50 and 52 secured thereto . each of the light sources 50 and 52 include a housing and an electrical lamp as set forth in fig1 and are adhered to the film 44 with the electrical leads from each of the lamps soldered to the electrical conductors 46 and 48 . the film 44 is desirably provided in lengths up to 500 feet . a maximum of 20 light sources would typically be provided for application at desired intervals along the length of the film . in a typical installation , the film 44 is cut to a desired length , depending upon the length of lane to be delineated . the release liner along one surface of the film is removed . a contact adhesive such as a neoprene based adhesive , modified with a slow drying solvent to provide a longer drying time , is applied to the exposed surface and to a desired portion of a road surface . the film is pressed onto the coated portion of a road surface and normal traffic is allowed to further press the film into the surface to provide a firm mechanical , as well as adherent bond of the film to the road surface . no treatment of the road surface such as cutting a groove or modifying the road surface is required , other than ensuring that the surface is reasonably free of debris . the light sources 50 and 52 are then attached to the film 44 at desired intervals . for example , where conventional lane markings are desired , adjacent lamps may be attached at 50 - foot spacings , i . e ., as many as 10 lamps in a 500 - foot length may be utilized . in other applications where directional information is to be provided , the light sources may obviously be placed at closer intervals as desired . to install a light source such as sources 50 and 52 to the film 44 , a small portion of the film on top of the conductors 36 and 38 is peeled away to expose the conductors . the electric lamp leads , such as leads 16 and 18 of the light source shown in fig1 are soldered to the conductors 46 and 48 . the release liner on the light sources , such as layer 30 , is removed , a layer of contact adhesive applied to the bottom of the layers 26 and 28 and to the top surface of the film , and the light source is pressed against the top surface , thereby forming a tight adherent bond to the film , electrically insulating the leads 16 and 18 therebetween . a cross section of the light source 50 taken across lines 4 -- 4 are shown in fig4 . as is there clearly shown , the film 44 is secured to a road surface 54 via a thin layer of adhesive 56 . the light source 50 is secured to the film 44 via a layer of neoprene adhesive ( not shown ) extending between the bottom of the layers of unvulcanized rubber 58 and 64 and the top surface of the film 44 . the layer of unvulcanized rubber 62 is provided around the housing 60 to minimize the irregularity between the bottom layer of unvulcanized rubber 58 and the top covering layer 64 . in an alternative construction , the body of polymeric material may be extruded , molded or the like around the housing 60 . the housing 60 is provided with base portion 66 , thus facilitating a weather - tight seal of the housing 60 between the top and bottom layers 64 and 58 respectively . the housing 60 also includes a portion 68 which projects above the top layer of unvulcanized rubber 64 such that light from an electric lamp 70 within the housing 60 may be transmitted . the lamp 70 is positioned within the housing 60 by a small amount of an adhesive such as silicone adhesive applied inside the top and side of the housing such as at locations 72 and 74 . the housing 60 is preferably formed of a molded thermoplastic material such as polycarbonate , polybutyrate , or polymethylmethacrylate and may also be filled with fiber glass or the like for greater structural strength . for omnidirectional lane markers , the housing 60 is preferably transparent or translucent throughout . alternatively , where directional light is desired , such as in providing one - way lane indications , one portion of the housing 60 may be formed of a non - light transmitting material while another portion is formed of a light transmitting material . similarly , portions of the housing may be painted or otherwise made non - transmitting . the electric lamp 70 is preferably a ruggedized incandescent lamp such as general electric types 124 , 161 or 194 , which are generally designed for automotive instrumentation uses . such lamps are designed for use at low voltages and are preferred for use with the present invention , inasmuch as the insulation requirements and hazards of using such devices on road surfaces are then minimized . in order to minimize variations in the intensity of the light sources along the length of a section of applied film , it is preferred to limit the number of light sources along a given length , i . e ., with no . 16 awg conductors in the film , no more than 10 light sources are desirably provided in a 500 - foot section . the intensity is further maintained uniform by using a constant voltage transformer to provide power to the film , thus ensuring that a constant potential is applied , regardless of the load , i . e ., regardless of the number of sources secured to the film or of nominal leakage currents resulting from moisture or the like .	5
generally speaking , the systems described herein are directed to an imaging probe using either optical or ultrasonic ( or both ) imaging . as required , embodiments of the present invention are disclosed herein . however , the disclosed embodiments are merely exemplary , and it should be understood that the invention may be embodied in many various and alternative forms . the figures are not to scale and some features may be exaggerated or minimized to show details of particular elements while related elements may have been eliminated to prevent obscuring novel aspects . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention . for purposes of teaching and not limitation , the illustrated embodiments are directed to an imaging probe . as used herein , the terms “ about ”, and “ approximately ” when used in conjunction with ranges of dimensions , temperatures or other physical properties or characteristics is meant to cover slight variations that may exist in the upper and lower limits of the ranges of dimensions so as to not exclude embodiments where on average most of the dimensions are satisfied but where statistically dimensions may exist outside this region . for example , in embodiments of the present invention dimensions of components of the imaging probe are given but it will be understood that these are not meant to be limiting . generally , in the several embodiments of the present invention that enable forward looking imaging with a cantilever based imaging assembly ; the principal of electrostatic dissipative polymers is used advantageously in order to create an oscillatory motion and / or to prevent electrostatic discharge . while direct connection of the cantilever to an electrical field such that the cantilever is held at ground / potential and an electrode within the catheter is held at a potential / ground , will cause motion of the cantilever as described in prior art , the present invention describes herein a configuration which includes coupling of the cantilever to a dissipative polymer . as discussed hereinafter , it is possible to cause the cantilever to move continuously in an oscillatory motion with the application of a high constant voltage , low current field when coupling a dissipative polymer between a metalized cantilever and the ground potential . the use of the probe with two electrodes in which motion is driven by turning individual electrodes either on or off or driven by providing different driving signals to each electrode is also described . in these cases the use of a dissipative polymer eliminates the direct connection to ground potential and hence limits the chance of electrical discharge . the embodiments shown in fig1 b to 21 and 28 use electrostatic actuation in order to move a cantilever . fig2 to 32 describe an embodiment in which electrostatic actuation is used to move a reflecting disk . in all the drawings the source of the field is marked as “ hv ”. a high voltage power source with a low current ( 3 to 100 microamperes ) has been used in the embodiments described hereinafter . however , those skilled in the art will understand that a high voltage amplifier may be used with a function generator as well as high voltage , high current sources . fig1 a represents an overview of an exemplary imaging system constructed in accordance with the present invention shown generally at 10 . it comprises an electrostatically driven imaging probe 200 , which connects via an adapter 14 to an image processing and display system 16 . the image processing and display system 16 comprises the necessary hardware to support one or more of the following imaging modalities : 1 ) ultrasound , 2 ) optical coherence tomography , 3 ) angioscopy , 4 ) infrared imaging , 5 ) near infrared imaging , 6 ) raman spectroscopy - based imaging and 7 ) fluorescence imaging . the system herein described further typically comprises a controller and processing unit 18 to facilitate the coordinated activity of the many functional units of the system , and may further comprise a display and / or user interface and may further comprise electrode sensors to acquire electrocardiogram signals from the body of the patient being imaged . the electrocardiogram signals may be used to time the acquisition of imaging data in situations where cardiac motion may have an impact on image quality . the optical circuits and electronics forming image processing and display system 16 , if included in a particular implementation of the present invention , may include any or all of the following components : interferometer components , one or more optical reference arms , optical multiplexors , optical demultiplexors , light sources , photodetectors , spectrometers , polarization filters , polarization controllers , timing circuitry , analog to digital converters and other components known to facilitate any of the optical imaging techniques described in the background and prior art sections . the ultrasound circuitry 20 may include any or all of the following components : pulse generators , electronic filters , analog to digital converters , parallel processing arrays , envelope detection , amplifiers including time gain compensation amplifiers and other components known to facilitate any of the acoustic imaging techniques described in the background and prior art sections . the controller and processing units 18 , if included in a particular implementation of the present invention , serve multiple purposes and the components would be markedly adapted based on the needs of a particular imaging system . it could include one or a combination of motor drive controller , data storage components ( such as memory , hard drives , removable storage devices , readers and recorders for portable storage media such as cds and dvds ), position sensing circuitry , timing circuitry , cardiac gating functionality , volumetric imaging processors , scan converters and others . a display and user interface 20 is also optionally provided for either real time display or display of data at a time later than the time at which imaging data is acquired . the imaging probe 200 comprises an imaging means 206 in the distal front section , an imaging conduit 204 and a connector 36 at the back of the sheath 202 . the imaging means 206 is located at the distal end of a catheter for the purpose of scanning optical or ultrasonic energy in front of the catheter to examine tissue located either inside or on the surface of the human body . the imaging conduit 204 serves to transfer the information obtained from the scanned beam to either optical circuits and electronics or ultrasound electronics 20 outside of the imaging probe 200 . the imaging probe 200 will be discussed in more detail below , but it may comprise an optical fiber or an ultrasound transducer with associated coaxial cable in the imaging conduit 204 . the adapter 14 facilitates transmission of signals within any fibers and / or wires to the appropriate image processing units . the adapter 14 may also incorporate a pullback mechanism or a reciprocating push - pull mechanism to facilitate longitudinal translation of the imaging assembly . such longitudinal translation of the imaging assembly may occur in conjunction with the longitudinal translation of an external shaft that surrounds the imaging conduit 204 , or may occur within a relatively stationary external shaft . additional sensors may be incorporated as part of the adapter 14 , such as position sensing circuitry , for example to sense the angle of rotation of a rotary component within the imaging probe 200 . the imaging probe 200 may also include a memory component such as an eeprom or other programmable memory device that includes information regarding the imaging probe 200 to the rest of the imaging system . for example , it may include specifications regarding the identification of specifications of the imaging probe 200 and may also include calibration information regarding the probe 200 . also included in the adaptor 14 is the possibility of a coupling means such as a fiber optic rotary joint and / or an electrical slip ring ( not shown ) to allow the imaging conduit 204 to be rotated while maintaining structural fidelity . this adaptor 14 may also provide a coupling means to the connector 36 such that a rotational torque may be applied to the imaging probe causing the probe to rotate . fig1 b shows a cross sectional view of an embodiment of the front portion of probe 200 in a forward looking ultrasound or oct imaging catheter probe using an electrode and a dissipative polymer catheter shown generally at 200 . fig2 is a cross sectional view of the probe of fig1 b taken along line 2 - 2 of fig1 b . referring to fig1 b and 2 , probe 200 includes an outer sheath 202 which defines a distal front section which contains an imaging means , and a proximal back section . when the probe is configured for oct , an imaging means 206 comprises an optical fiber ( which forms the imaging conduit 204 ) which emits optical radiation from the front end of the optical fiber in the distal front section and the optical fiber is connected to a source of light through the proximal back section . this same optical fiber is capable of collecting the reflection of the emitted optical radiation from the tissue under examination and transfers this radiation to the optical circuits and electronics for detection . in the case where the probe is configured as an ultrasound probe the imaging means is an acoustic transducer located in the distal front section and the imaging conduit is an electrical wire connecting the transducer to a power supply through the proximal back section with a metal coil 205 disposed around the proximal end of the fiber / cable imaging conduit 204 . the proximal back section of the probe 200 includes a volume 210 containing a dissipative polymer which is wrapped by a metal wire or coil 212 . the outer sheath 202 may be any plastic material of dimensions from about 300 to about 100 , 000 micrometers in diameter with wall thickness on the order of about 30 to about 1000 micrometers . possible materials include , but are not limited to , ptfe ( teflon ), polyethylene , nylon , polyetheretherketone ( peek ), nylon , acrylic ( pmma ), polycarbonate ( lexan ), polyimide , latex , polyvinylchloride ( pvc ), silicone rubber , polyurethane and polyesters . the distal front section of probe 200 includes a media 208 . the media 208 in is transparent or semitransparent to the imaging ultrasound or optical energy . this media may be a gas , vacuum or fluid , such as for example air , as well as where in the media was air with a drop of water on the proximal end of the grin lens , and also with low density oils such as olive oil and mineral oil . additional possibilities include the use of carbon dioxide or helium gas within the catheter sheath which is advantageous due to their high solubility in blood . the media , in the case of fluids , may serve to dampen the oscillatory motion of the cantilever such that slower scanning speeds may be obtained . potential fluids for use as the media include , but are not limited to , olive oil , mineral oil , silicone oil ( of viscosity between about 0 . 1 to about 400 centipoises ) also possible are glycerol , ethanol and distilled water . an adapter ring 214 is located at the front end of the proximal back section containing dissipative polymer in volume 210 between the dissipative polymer and the outer sheath 202 and a high voltage electrode 218 is located beside the section of the imaging conduit 204 wrapped in the coil 205 in the distal front section of probe 200 . the purpose of the adapter ring 214 is to contain the media 208 located in the proximal compartment of the imaging probe . a high voltage power supply 222 is connected to the electrode 218 . a circuit 221 parallel to the grounded metal wire or coil 212 forms a trigger signal monitor 224 . this circuit 221 may possess a resistor to limit the current delivered to the trigger signal monitor 224 . this trigger signal monitor 224 may be connected to an oscilloscope or a data acquisition system for image segmentation . this circuit provides a peak for each time that the cantilever ( combined imaging conduit 204 , coil 205 and fiber 204 ) touches the electrode 218 to be discussed hereinafter with the voltage being measured by the oscilloscope or the data acquisition card . the functional purpose of the dissipative polymer in volume 210 of the catheter probe 200 is to allow an indirect electrical connection between ground potential and the cantilever ( formed by combined coil 205 and the portion of the optical fiber 204 and / or ultrasound transducer located in the distal front section of probe 200 ). the dissipative polymer in volume 210 provides a finite migration time for the electrical charge to travel from the cantilever 204 / 205 / 206 to ground potential . it is this finite migration time that is used advantageously to provide an oscillatory motion and as well to limit electrostatic discharge within the catheter . generally , the dissipative polymer is made by either blending an antistatic agent ( molecule ) with another polymer or it may be made by adding conductive particles to a substantially insulating polymer . a non - limiting example of a dissipative polymer that may be used in volume 210 is pebax ( trade name of arkema group &# 39 ; s polyether block amide ( peba ) compounds ). this compound is also referred to as polyamide / polyether block copolymer . this polymer is a hydrophilic static dissipative polymer and a permanent antistatic polymer that is thermally stable . its dissipative properties are independent of humidity . this polymer may be blended at 5 % to 30 % levels with acrylonitrile butadience styrene ( abs ), polycarbonate ( pc ), abs / pc , polystyrene ( ps ), high impact polystyrene ( hips ), polybutylene terephtalate ( pbt ), acetal , polyvinyl chloride ( pvc ), polyethylene terephthalate ( pet ), polyethylene terephtalate glycol ( petg ), or polyolefins . dissipative polymers may also be produced using other antistatic molecules combined with insulating polymers . examples of additional antistatic agents include : pedot : pss or poly ( 3 , 4 - ethylenedioxythiophene ) poly ( styrenesulfonate ), glyceryl monostearate , octadecylbis ( 2 - hydroxyethyl ) amine , n , n - bis ( 2 - hydroxyethyl ) dodecanamide , tallow bis ( 2 - hydroxyethyl ) amine , sodium sec - alkanesulfonate , cocobis ( 2 - hydroxyethyl ) amine , alkyl ( c14 - c18 ) bis ( 2 - hydroxyethyl ) amine , oleylbis ( 2 - hydroxyethyl ) amine , ethoquad t / 13 - 50 acetate , ciba ® irgastat ® p . these antistatic agents may be blended with low density polyethylene ( ldpe ), high density polyethylene ( hdpe ), polymethyl methacrylate ( pmma ), polyethylene terephthalate ( pet ), san , polypropylene ( pp ), polystyrene ( ps ), polycarbonate ( pc ) acrylonitrile - butadiene - styrene terpolymer ( abs ), styrene acrylonitrile copolymer ( san ) teflon ( ptfe ), polyvinyl chloride ( pvc ), polyethylene terephthalate glycol ( petg ) and nylon ( polyamide ) to form polymer mixtures . alternatively , examples of conductive particles that may be potentially added to the above list of insulating polymers include : carbon black , carbon fiber , indium tin oxide ( ito ), indium tin oxide doped with an additional metal such as antimony . stainless steel , copper , gold , silver , tin , and lead may also be added to the above list of polymers in either particulate or fiber form to create a static dissipative effect . the metallic coil 205 around the fiber / cable 204 forming the imaging conduit provides the function of metallizing the imaging conduit 204 as well as shielding the conduit itself from high voltage field . the metallic coil 205 may be a platinum coil of 300 micrometers in diameter . the coil 205 may be of dimensions between about 50 to about 1000 micrometers in diameter . the coil 205 may be comprised of any conductive metal such as , but not limited to , platinum , gold , copper , silver , steel , lead , aluminum and any of their alloys . the metallic coil 205 may also be replaced by a metal coating on the imaging conduit where the metal is comprised of , but not limited to , gold , chrome , brass , copper , or platinum . the metal wire or coil 212 wrapped around the dissipative polymer in volume 210 provides a connection to ground potential through circuit 221 . wire 212 may be any conductive metallic wire such as , but not limited to , copper , gold , lead , steel , platinum or any of their alloys . wire 212 may also be fashioned in counter woven strands as described by crowley et al . ( u . s . pat . no . 5 , 372 , 138 ) such that it would enable a torque applied at the proximal end of the catheter to be transmitted to the end . this cable would , therefore allow an angular rotation produced at one end to be transmitted to the other . combining this rotation with the scanning of the cantilever would allow the cantilever to scan the two dimensional plane in front of it . employing optical coherence tomography or ultrasound imaging with this complete two dimensional scan would allow for a three dimensional imaging volume to be obtained . the electrode 218 shown in fig1 b may be an insulated wire and may be a copper beryllium alloy wire that includes four insulating layers . additional possibilities include wires of dimensions from about 50 to about 1000 micrometers in diameter comprised of , but not limited to , steel , copper , gold , platinum , silver , iron or any of their alloys . the wire forming electrode 218 may or may not possess a single or a plurality of insulating layers . a seal 220 for the probe located at the most distal end of the distal front section of the probe 200 would be required for use inside in a living organism . this seal 220 acts to seal the media 208 so that it remains within the front section of the probe 200 without being contaminated by fluid from the imaging field inside the patients body being imaged with the probe . the seal 220 would be anywhere from about 10 to about 4000 micrometers thick depending on the intending imaging field of the probe 200 . this seal 220 is preferably made of a material that is transparent to either optical and / or acoustic energy . potential materials include a wide range of plastics such as but not limited to ptfe ( teflon ), polyethylene terephthalate ( pet ), nylon , polyetheretherketone ( peek ), nylon , poly ( methyl methacrylate ) ( pmma ), polycarbonate ( lexan ), polyimide , latex , polyvinylchloride ( pvc ), silicone rubber , polyurethane and polyesters . a glass window may also be possible in some embodiments as may the use of a precisely fitted grin lens . liquid sealants may also be employed in conjunction with the materials described above . the imaging conduit 205 may be either an optical fiber for optical imaging , or a micro coaxial cable with an ultrasound transducer affixed to its end for ultrasound imaging . more particularly , imaging conduit 205 may either be a fiber optic cable capable of transmitting and receiving optical energy of wavelengths between about 250 to about 2000 nm . the fiber optic may be between about 15 to about 400 micrometers in diameter . the probe 240 shown in fig7 has a fiber optic forming the imaging conduit 204 to which there is coupled to a grin lens 228 , while fig8 shows a probe 250 having a ball lens 230 fused to the distal end of fiber optic 204 . fig9 shows a probe 256 configured with an ultrasound transducer 258 affixed to the distal end of a micro coaxial cable 207 for ultrasound imaging . the microcoaxial cable 207 may be between about 50 to about 400 microns in diameter . the catheter used for initial experiments was a three lumen catheter to allow for separate lumens for the cantilever and two electrodes — a ground and a high voltage electrode . also claimed are applications in which the dissipative polymer catheter possesses only a single lumen or multiple lumens such as 2 - 10 separate lumens within the dissipative polymer . fig3 to 6 illustrate a time sequence during operation of probe 200 in which an optical or acoustic signal emitter is displaced . fig3 shows the probe immediately after the potential has been applied ; the cantilever at this point is electrically neutral and therefore is attracted to the electrode . fig4 shows the cantilever undergoing some deflection towards the electrode 218 . fig5 shows the cantilever in contact with the electrode 218 , this results in the coil 205 acquiring a similar charge from the electrode 218 . this charge causes the coil 205 and hence fiber 204 to be repelled from the electrode 218 as like charges repel . this acquisition of charge is observed in the parallel circuit 221 as shown in the figures as a spike on the trace in circuit 224 . thus the coil 205 and hence fiber 204 ( and / or ultrasound transducer ) returns to its original position allowing the cycle to begin again as shown in fig6 . fig1 , 11 and 12 illustrate different embodiments of the catheter probe whereupon two wires are used in the imaging component . in probe 260 shown in fig1 electrode 218 is connected to the high voltage source 222 as in fig1 b , while the other wire 238 is connected to ground potential through ground circuit 221 and therefore acts as a ground electrode . this ground wire ( ground electrode ) 238 allows the cantilever to quickly dissipate all of its acquired charge upon contact and immediately be attracted to the high voltage electrode 218 once again . thus , this ground wire 238 allows for more rapid oscillation than was observed in embodiments without this ground wire 238 that the coil 205 could take several seconds after repelling from the electrode 218 before it was once again attracted . when the ground wire 238 was added , this delay was eliminated . the presence of this ground wire 238 in close vicinity to the electrode 218 also insures that any electrostatic discharges will be delivered to the ground electrode 238 rather than the tissue under examination . in this probe 260 as before the imaging conduit 204 may be an optical fiber or a microcoaxial cable with a transducer . in probe 270 shown in fig1 two electrodes , 218 a and 218 b are both connected to the high voltage source 222 . time varying electrical potentials may be applied independently to either electrode 218 a and 218 b to allow for a desired scanning motion of the cantilever . coupling to ground is provided by the wire 212 wrapped around the dissipative polymer in the proximal back section of probe 270 . in addition , or alternatively , in this embodiment either one of the electrodes 218 a and 218 b , may be grounded at one time . fig1 shows a cross section of an embodiment of a catheter imaging probe 290 using four ( 4 ) electrodes 218 a , 218 b , 218 c and 218 d arranged as illustrated in order to provide actuation of the cantilever . in this embodiment , the four wires may possess different individual electrical potentials . in this embodiment each of the electrodes 218 a to 218 d may be driven individually at different voltages in order to adjust the angle by which the metallic coil and the imaging conduit move thereby to provide two dimensional control of the cantilever . used in conjunction with an imaging conduit containing an ultrasound , or an optical coherence tomography probe , this embodiment may be used to form three dimensional images . fig1 shows a three lumen embodiment of a catheter probe 300 in which the distal front section of the outer sheath 202 is flared out to accommodate a rigid tube 225 . this rigid tube 225 is used to facilitate alignment of the distal portion of the catheter . this rigid tube 225 may be composed of , but not limited to , polymide , polycarbonate , glass , nylon or urethane . this embodiment of the probe 300 shows the imaging conduit 204 as a fiber optic with a ball lens 302 attached to it . the ball lens 302 serves to focus the light a distance of 10 to 3000 microns in front of the lens 302 . it will be appreciated by those skilled in the art that the ball lens 302 may be replaced with a multimode graded index fiber of a specified length such that the fiber length serves to focus the light a pre - selected distance in front of the distal end of the probe 300 . alternatively one could use a miniaturized axicon ( conical ) lens at the end of the fiber 206 to create a “ bessel beam ” that would not diverge as it propagates . fig1 shows another embodiment of a three lumen catheter probe 310 with the imaging conduit including a fiber optic 204 that is scanned proximal to grin lens 228 . by scanning the fiber proximal to a grin lens 228 the lateral displacement of the fiber 204 is translated into both a lateral displacement of the exiting beam as well as an angular offset of the exiting beam . it will be understood that the grin lens 228 may be replaced with a ball - lens or “ fish eye ” style lens or combination of lenses . also possible would be to replace the grin lens 228 with a circular array of micro lenses . in these examples the fiber optic 204 would be scanned proximal to the imaging optics . fig1 illustrates another three lumen embodiment of a probe 320 in which an exposed portion of grounded electrode 322 is located within the proximal back portion of probe 320 in volume 210 containing the electrically dissipative polymer such that the exposed conductive portion of the grounded electrode 322 is in contact with the dissipative polymer material . this portion of electrode 322 thus provides a coupling to ground for the charge . this electrode 322 may be used to replace , or be used in conjunction with , grounding materials on the outside of the dissipative polymer . by varying the amount of conductive surface of the ground electrode 322 touching the inside of the polymer , it is possible to increase or decrease the coupling strength of the cantilever to ground . an increased coupling to ground will result in a larger force of attraction towards the applied voltage . fig1 shows a cross - section of fig1 along the 16 - 16 line as shown . fig1 shows an embodiment of a probe 330 in which a two lumen catheter is used with the grounding electrode comprised of a ring electrode 332 that fits inside sheath 202 in the proximal back section adjacent to the distal front section . this ring electrode 332 may be composed of , but not limited to : metals such as stainless steel , brass , or copper . it may also be machined from plastics such as polymethylmethylacrylate ( pmma ), polyetheretherketone ( peek ), polymide , or polycarbonate that may be machined and then subsequently coated with a metal such as gold , chrome , or silver . this ring electrode 332 is connected to ground by ground electrode 238 that is insulated over a portion of its length . in this embodiment , the grounding wire 238 is placed underneath the ring electrode such that the ring electrode 332 allows both electrical coupling and precise positioning of the grounding electrode 238 . the ring electrode 332 may also be machined such that it contains a rigid extension that serves as the grounding electrode . fig1 is a cross section of the fig1 along the line 18 - 18 . fig1 is a cross section of the fig1 along the line 19 - 19 . fig2 shows an embodiment of a probe 350 in which the imaging means 206 includes forward - facing ultrasound transducer 352 that is affixed to the distal end of a micro - coaxial cable 353 which is connected to the ultrasound imaging system electronics this transducer 352 is capable of transmitting and receiving ultrasound energy . thus , when combined with the electrostatic scanning mechanism described herein , two dimensional ultrasonic imaging is possible . it will be appreciated that shaping the end face of the transducer 352 may be employed for optimal ultrasound focusing . fig2 shows an embodiment of a probe 360 in which a more conventional side - directed ultrasound transducer 362 is coupled to a reflective prism or mirror like object 364 to direct the ultrasound energy forward . this prism or mirror 364 may be composed of , but not limited to , steel , brass , or glass . a three lumen catheter that was used in the optical coherence tomography imaging experiments with the results shown in fig2 , 25 and 26 discussed hereinafter . the catheter was 1 . 8 mm in diameter with a 400 micron central lumen to house the cantilever and 300 micron peripheral lumens to contain the electrodes . the catheter was extruded using arkema pebax 7233 sa01 . an image of the cantilever probe in motion was taken using a low magnification stereomicroscope and is shown in fig2 . in this case , an electrical potential of 1700 volts with 5 micro ampere current was applied as a driving voltage using a power supply that was current limited at 20 micro amperes . a thirteen ( 13 ) degree angle of oscillation was measured in software and is labeled in fig2 as θ . the probe used two electrodes in one electrode was grounded while the other electrode was held at a constant voltage of 1700 v . the electrodes both possess exposed regions which allow for electrical contact with the cantilever . a 60 micron optical fiber was contained within the oscillating metallic coil . the 60 micron diameter optical fiber was obtained by etching a stand 125 micron fiber in an acid . in this case the coil was composed of platinum . this design used to oscillate the cantilever is very similar to the embodiment shown in fig1 . fig2 shows a calibration plot for the frequency of oscillation of the cantilever in a configuration similar to that shown in fig1 and fig2 . we plot the frequency of oscillation when the cantilever is placed in either mineral oil ( diamonds ) or air ( circles ). the oscillation rate was measured using the frequency of the trigger signals that were measured on an oscilloscope . note that a certain driving voltage is required to commence motion of the cantilever . this voltage is marked with arrows on the graph . once motion is started , however , the voltage can be decreased and the cantilever will oscillate at a slower rate corresponding to the decreased driving voltage . fig2 shows oct images taken with a probe similar to that shown in fig1 . in the embodiment of the imaging probe used to acquire the optical coherence tomography images a ball lens was affixed to a 60 micron optical fiber . the fiber was attached to the sample arm of a commercially available oct system and scanning of the cantilever was initiated by activating the high voltage power source . an oct image of an arterial phantom mimicking a nearly occluded vessel is shown in fig2 a with the corresponding photograph in fig2 b . walls of the phantom are labeled “ w ” and the channel is identified with an arrow in both fig2 a and fig2 b . the arterial occlusion phantom was created by mixing titanium dioxide powder into a poly ( dimethylsiloxane ) ( pdms ) polymer prior to curing ; this mixture was then allowed to cure inside a piece of tygon tubing ; a wire was also placed in the tygon tubing to form a small channel that is seen on the oct image . an oct image of a formalin - fixed rabbit colon is shown in fig2 c with a corresponding white light picture shown in fig2 d . a dashed circle identifies a crypt - like object seen in the oct image while the letter “ f ” is used to denote fissures . scale bars represent 1 mm . fig2 a and 25b demonstrate the use of an electrostatic imaging probe similar to that shown in fig1 to image a stage 45 xenopus laevus ( african frog ) embryo in vivo . fig2 a shows a structural image while fig2 b shows a processed doppler image of the blood flow in the heart of the xenopus laevus . in these images the probe was driven with 1700 v at an oscillation frequency of 5 hz . this imaging speed allowed for sufficient signal to noise to allow for doppler imaging . scale bars in the image represent 1 mm . fig2 illustrates motion characterization of the vertical displacement of the cantilever tip as a function of time when driven at 2100 v in mineral oil . the design used to perform this calibration is very similar to the embodiment shown in fig1 and the oscillating probe shown in fig2 . the position of the end tip of the cantilever was imaged using a high speed camera with a frame rate of 454 frames per second ; commercially available motion tracking software was used to track the position of the end tip of the cantilever . fig2 a and 27b show a comparison of oct images taken with two different probe designs . the image in fig2 a shows an oct image of an ir card taken with a design similar to that shown in fig1 while the image in fig2 b shows was taken with a design similar to fig1 . of importance to note is the increase in the angular field of view in the right hand image by scanning the fiber proximal to the grin lens . the left image has an angular field of view of 13 degrees while the right image has an angular field of view of 33 degrees . scanning the optical fiber in front of the grin lens does however does introduce more image artifacts in the image . scale bars represent 1 mm . fig2 illustrates an embodiment of an electrostatically driven imaging probe in which the grounding electrode 322 is located only inside the lumen of the dissipative polymer catheter 210 in the proximal back section of the probe . the grounding electrode 322 possesses an uninsulated length which is conductive that only contacts the dissipative polymer in the distal back section of the catheter . this grounding electrode 322 thus serves to indirectly couple the coil 205 to ground through the dissipative polymer . this conductor may or may not be sealed off from the media 208 . by being short enough so that it is not in direct conduct with the media 208 located in the distal front section of the probe , more conductive or polar media may be used in the distal front section of the probe without resulting in electrolysis of the media . it was observed that when a polar media was used in the probe design and the ground electrode was contained within the media as in fig1 , that bubbles were produced . withdrawing the grounding electrode inside the proximal back section of the probe resulted in a slower oscillation rate , but without the production of bubbles inside the media 208 . fig2 illustrates an embodiment of an electrostatically driven imaging probe in which the cantilever is replaced by a reflecting disk 380 . this reflecting disk 380 , may be reflective to both ultrasound and / or optical energy . the reflecting disk 380 is pivotally mounted on a pivoting pin 384 , that allows the disk 380 to rotate and thus alter its angle . the disk 380 is electrically connected to the pivoting pin 384 , by producing both the disk 380 and the pin 384 using metal conductors . the pivoting pin 384 in turn , is connected to a wire 386 that connects to a conductive segment 390 contained within a lumen of the dissipative polymer in volume 210 . thus the reflecting disk 380 is electrically connected to the conductive segment 390 . this conductive segment 390 is coupled to the ground electrode 322 through the dissipative polymer in section volume 210 . thus the reflecting disk 380 is indirectly coupled to ground through the dissipative polymer in volume 210 . upon activation of the high voltage from the high voltage source 222 the reflecting disk 380 is attracted to the high voltage electrode 218 . this attraction results in the disk 380 pivoting about the pivoting pin 384 such that the proximal edge touches the electrode , 218 . upon contact , the reflecting disk 380 acquires charge of the same polarity as the high voltage electrode 218 and thus repels . this repulsion results in the disk 380 pivoting about the pin 384 such that the proximal edge touches the ground electrode 322 . upon contract with the ground electrode 322 the disk 380 loses its acquired charge and may once again be attracted towards the high voltage electrode 218 . the imaging conduit 204 in this embodiment , is placed above the grounding electrode 322 . a beam directing element 366 causes the energy emitted from the imaging conduit 204 to be reflected towards the disk 380 . finally an end cap 390 capable of transmitting optical and ultrasonic energy is located on the distal end of the probe that serves to seal the distal front section of the catheter . the different embodiments of the imaging probe disclosed herein and the various components they are made from may span several different dimensions and properties depending on the anatomic location and application of the imaging probe . for example , for use in the cardiovascular system , including the cardiac chambers , the imaging probe would be elongate and flexible , with a length ranging from about 5 to about 2000 mm , preferably with a length ranging from about 300 mm to about 1500 mm . the imaging conduit and imaging assembly may have a maximum cross - sectional dimension ranging from about 200 microns to about 10 mm , preferably ranging from about 500 microns to 5 about mm . the imaging conduit and imaging assembly are surrounded by an external sheath . this enables the imaging conduit 204 ( fig1 b ) and imaging assembly to rotate within the external sheath while mechanically isolating the rotational motion of these two components from the surrounding tissues . in yet another example , the use of the imaging probe in the gastrointestinal system would typically have the imaging probe being elongate and flexible , with a length ranging from about 100 mm to about 2000 mm and preferably in the range of about 300 mm to about 1500 mm . the maximum cross - sectional dimension would typically range from about 3 mm to about 20 mm . in yet another example , the use of the imaging probe to image soft tissue via percutaneous means would require the imaging probe include a rigid shaft , rather than flexible as for the aforementioned applications . thus the external sheath would be replaced by a rigid hollow shaft , such as a stainless steel tube . the length of the shaft would be from about 1 to about 12 cm . as mentioned previously , boppart et al . ( u . s . pat . no . 6 , 485 , 413 ) discloses an electrostatic - based actuator for forward - viewing optical coherence tomography in which the cantilever is directly connected to ground or enabled with an electrostatic slide . the direct connection to ground results in significant electrostatic discharge given the high voltage necessary to oscillate a rigid fiber . by coupling the cantilever to ground through a dissipative polymer such as disclosed in the present application circumvents this problem . furthermore the boppart et al . discloses the use of a time varying electrical field in order to produce an oscillatory motion . by using a dissipative polymer to couple the cantilever to ground in the present application allows production of oscillatory motion with both constant voltage as well as time varying driving voltages . the electrostatic scanning motion described in this work can be used in conjunction with a torque cable as described by crowley et al . in u . s . pat . no . 5 , 372 , 138 ( which is incorporated herein by reference in its entirety ) to extend the scanning motion to cover a two dimensional scanning field by rotating the probe while the cantilever is scanning . in such an embodiment a torque cable may be placed over the dissipative polymer in volume 210 causing the cantilever , and the electrode ( s ) 218 to rotate inside the sheath 202 ( fig1 a ). alternatively the torque cable may be placed over the outer sheath 202 such that the entire imaging probe rotates at the same time as the cantilever scans . this rotational driving torque would be provided by a motor external to the catheter . this rotational torque would be coupled into the catheter through an element generally labeled as an adaptor 14 in fig1 a . this adaptor 14 would include an electrical slip ring to allow electrical connections be preserved in the rotating catheter . it may also include a fiber optic rotary joint to allow optical connections to be maintained while the probe rotates . the goal of this rotation is to allow multiple different angles for the cantilever to scan . it will be appreciated by those skilled in the art that the scanning cantilever disclosed herein may be used as a switching means in non - medical applications such as , but not limited to , optical networks , electrical switching , optical switching , and mechanical switches . as used herein , the terms “ comprises ”, “ comprising ”, “ includes ” and “ including ” are to be construed as being inclusive and open ended , and not exclusive . specifically , when used in this specification including claims , the terms “ comprises ”, “ comprising ”, “ includes ” and “ including ” and variations thereof mean the specified features , steps or components are included . these terms are not to be interpreted to exclude the presence of other features , steps or components . the foregoing description of the preferred embodiments of the invention has been presented to illustrate the principles of the invention and not to limit the invention to the particular embodiment illustrated . it is intended that the scope of the invention be defined by all of the embodiments encompassed within the following claims and their equivalents .	6
in order to permit a player to practice his golf swings , particularly for longer shots rather than putting , there is afforded a setup which can be utilized indoors and in the usual size room . on the room floor there is erected a target board 6 , usually of plywood or the like , arranged substantially upright and adequately supported against impact . the face 7 of the board is conveniently demarked or decorated to illustrate a golf hole 8 and a surrounding green 9 as well as accompanying rough 11 or comparable typography . while there is no particular scale involved , it is convenient to have the green 9 appear to an observer just as a practical green would appear to him if he were many yards distant . in the same room and disposed on the floor a short distance from the target 6 ; for example , about six or eight feet away , is a mat 12 conveniently of a flexible material having upstanding bristles 13 therein and also carrying a deposit 14 of a clayey material so as to receive the stem of a golf tee 16 of the customary construction . the arrangement is such that the tee stands above the mat 12 very much as a tee would appear under normal exterior circumstances , the clayey material 14 serving as a substitute for the earth . for use in connection with this equipment there is provided a pellet 21 . this is a substantially spherical body of a clayey , energy - absorbing material 22 of approximately the same configuration and size as the customary golf ball and approximately of the same weight . the precise material used can be any of several variations , such as modelling clay , some waxes and the like , preferably with an additive such as sand grains of different sizes . these increase the weight of the pellet , and they are readily reworked with the main pellet material as the pellet is reshaped after impact . the material 22 in generally spherical form is first encased in a pocket - like enclosure 23 of two - way stretch woven , knit or other fabric having small interstices 24 therethrough . the fabric is brought around the spherical core 21 and has its edges gathered and sewn together at a closure 26 so that in effect the exterior appearance of the pellet is substantially spherical and uniform and is like that of a golf ball . in addition , the pellet is provided with a particular area marker 27 . this can be accomplished in various different ways , but in the present case the cover at one site is provided with a number of extending filaments 28 of a readily visible color . the cover 24 is especially provided with and carries a fine powder , which does not show in the drawing but is interrelated with the cover and occupies many of the interstices therein . the powder is a relatively fine , readily visible talc , preferably white . during normal handling of the pellet , the powder remains well in place . nevertheless , upon hard impact of the pellet with a surface , the powder is shaken loose or dislodges and deposits on the impacting surface . in the normal use of the structure , the powdered and covered pellet , in its generally spherical configuration , is placed on the tee 16 in the usual way of a golf ball . the player , standing on or near the mat 12 , addresses the pellet in the usual fashion , customarily with an iron club with which he particularly desires to practice . he makes the customary swing against the pellet and dislodges and drives or impels the pellet toward the target 6 , endeavoring to land the pellet in the vicinity of the hole 8 . as he does so , two things occur . first , the impact of the golf club face against the pellet dislodges some of the powder onto the club face so that the area or zone of impact can be readily discerned upon later looking at the club face . also , the club face , usually not flat but scored or serrated , makes a comparable imprint in the surface of the deformable pellet . upon examination thereof subsequently it can readily be determined just where and at what orientation the club face contacted the pellet . in addition , the pellet absorbs much of the impact energy by deforming out of the spherical shape to afford a flattened face where the club head hit it and where it hits the target . the pellet does not spring back nor restore itself to its initial shape . the second thing that occurs is that when the pellet hits the target , the impact is sufficient so that additional powder leaves the pellet covering and deposits on the target so as to afford an indication of the location where the target impact occurred . if desired , the target 6 can contain a number of indicating markers 31 with indicia 32 simulating arbitrarily the number of yards that the pellet has travelled comparable to the true flight of an actual golf ball . at the target the pellet is likewise flattened and so eventuates with two flattened faces the relationship of which to the initial position of the pellet and to each other is more readily gauged by reference to the marker 27 and filaments 28 . the impact of the club face leaves a corresponding approximately flat area on the pellet , and the customary grooves on the club face leave corresponding marks on the pellet . these can be visually compared with a corresponding flat area due to impact with the target as to location in order to estimate closely just how the pellet was hit and in what direction it rotated during flight . a close estimate of hooking or slicing can be made . by the use of this structure the player can determine accurately where the impact of his club with the pellet has occurred , both as to position on the club face above the teedup portion and laterally with respect to the club shank . furthermore , by observing the powder mark on the target he can determine how well his swing has propelled the ball to the desired target area ; that is , whether there has been rotation during flight resulting in a hook or a slice . following a single use of the pellet , it can be retrieved and after examination can manually be pressed back into substantially its original spherical form for reuse . since the pellet is highly energy absorbing and soft and not springy , it cannot cause any substantial damage even if it misses the panel completely and hits other objects in the room . it has been found that by repeated use of the setup described with the characteristic pellet that it is possible to improve the accuracy of golf shots sufficiently to reduce the number of strokes required in an actual game .	0
storage tanks 1 have side walls 2 and bottom base plates 7 that inherently are contained or located upon a substrate 6 . the bottom base plate extends across the entire bottom of the tank and generally extends outwardly thereof to form an external bottom base plate edge , flange , or annulus 7 a . substrates typically encompass hard surface materials such as concrete and asphalt , etc ., either alone or in conjunction with porous materials such as soil , e . g . clay , loam , sandy soils , sand , fine or small - sized stones , pebbles , etc . the external side of the tank bottom plate surface that is situated on or contacts the substrate typically is referred to as the soil side bottom 5 . hard materials or substrates can be located under the entire tank bottom or at least desirably in the vicinity under the tank sides to support the weight thereof . various porous substrates sometimes referred to as being partially hard can also extend under the entire tank bottom base plate , but it is often desirable that they extend only in the internal tank area as within the tank sides . in this situation , the area beneath the tank side walls will either contain a hard substrate or a ring wall as further set forth herein below . of course , combinations of hard substrates and porous substrates can be utilized such as concentric ring portions , and the like . original or natural substrate 15 is typically firm earth such as soil or clay and optionally can be located beneath tank 1 within tank side wall 2 in lieu of porous substrate 6 . the tank soil side bottoms are subject to corrosion during the course of time . the present invention relates to an apparatus and system to protect the tank soil side bottoms 5 with respect to old or existing storage tanks and / or new or installed storage tanks . corrosion protection of the present system is also achieved through the utilization of various one or more corrosion inhibitors such as water soluble corrosion inhibitors ( sci ) and preferably volatile corrosion inhibitors ( vci ) to protect tank soil side bottoms 5 . another important aspect of the present invention that relates to fully protecting tank soil side bottoms from corrosion is the utilization of an inhibitor ring delivery system such as chime seal 3 that extends at least around an external ( perimeter ) portion of the tank bottom base plate 7 circumference , desirably around a majority of the tank bottom plate circumference , and preferably around the entire tank bottom plate circumference thereof . the chime seal can be plastic , mastic , asphalt , bitumen or elastomer and exists generally on the external edge of the tank bottom base plate or , preferably can be an integral part thereof . chime seal 3 has at least one refill port 8 that is an opening at the end thereof as shown in fig1 , whereby a perforated pipe 9 can be inserted therein . it also serves as an opening into which sci or vcis can be added . as explained in greater detail herein below , perforated pipe 9 , or in other words the inhibitor ring delivery system , can extend inside the tank chime seal 3 about a portion , desirably around the majority of the tank bottom plate edge or periphery , or preferably extend about the entire periphery thereof . the purpose of the chime seal is to keep moisture , water , etc . out of perforated pipe 4 and keep the corrosion inhibitor in , i . e . trapped under the tank bottom . perforated pipe 9 can be made out of any material that is not affected by the corrosion inhibitors and is not degraded by water . flexible plastics such as thermoplastics and rubbers are thus preferred . the perforated pipe diameter , as well as the sizes , positions and number of the one or more perforations ( holes ) can vary . for example , using a 1 - inch diameter pipe , one or two rows of perforations are typically used . if two rows are used , the rows are typically positioned at 180 ° of arc . the perforations are typically round , in the range of 0 . 25 - inch diameter , but can also be oblong or slotted , and spaced in the range of 2 inches apart . it is important that the perforated pipe holes 9 be in communication with the substrate so that corrosion inhibitors admitted or injected therefrom can permeate the substrate and contact the soil side of the tank bottom plate to protect the same from corrosion . the term “ communication ” is defined here are meaning there are pathways , channels , openings , and the like for the corrosive inhibitor to be introduced into the area formed between the substrate , the tank soil side bottom and the chime seal . additional advantages of the corrosion inhibitor delivery systems for tank soil side bottoms are that it is very convenient to supply various corrosion inhibitors to the substrate area , that one or more different corrosion inhibitors can be utilized , that the corrosion inhibitors can be applied at any desired time and duration , and that the corrosion inhibitors can be replenished in the inhibitor ring delivery system without disruption to tank operations . inhibitor replenishment can be performed when needed and can be controlled manually , automatically with respect to certain times and duration thereof , or automatically upon receiving feedback as from sensors , etc . reference is now made to a specific embodiment as set forth in fig1 - 3 by way of example and that the scope of the invention is not limited thereto in as much as many other embodiments , examples and figures do exist within the metes and bounds of the present invention . fig1 and 2 show an embodiment of a tank 1 having sides 2 and bottom base plate 7 wherein a chime seal 3 is utilized to encapsulate or house a perforated corrosion inhibitor pipe 4 that is in communication with tank soil side bottom 5 and generally the substrate 6 . the chime seal has one leg that resides upon a hard surface portion of substrate 6 , for example , concrete or asphalt , that extends outwardly of the periphery of the perforated pipe 4 , and chime seal 3 optionally has another leg that resides upon the top surface of the outward extending tank base plate edge 7 a . both legs of the chime are sealed . the delivery system relates to various one or more corrosion inhibitors being supplied in a permeable casing , not shown , through refill port 8 that is connected to an end of perforated pipe 4 , which has perforations 9 positioned such that the corrosion inhibitor is allowed to communicate with tank soil side bottom 5 . chime openings 10 and the perforated pipe end openings are desirably located adjacent to one another . upon delivery of one or more corrosion inhibitors through ports 8 into perforated pipe 4 , the same will flow through pipe 4 and flow out of perforations 9 . due to the fact that both the top surface of substrate 6 and the tank soil side bottom surface 5 are never even , but contain undulations and openings therein , the corrosion inhibitor can flow underneath tank baseplate edge or annulus 7 a and baseplate 7 and flow toward the center of the tank soil side bottom . that is , chime seal 3 acts to confine the corrosion inhibitor to the void space 11 under the tank soil side bottom plate 5 whereupon it contacts and / or coats the tank bottom plate 5 and forms a protective corrosion inhibitor surface thereon . as known to those skilled in the art , the bottom of the storage tank performs a breathing action due to slight movement of the tank bottom with respect to filling and entering operations , draining operations , temperature , and the like . due to these inherent breathing aspects , the corrosion inhibitors are drawn or pulled into the small open or void areas 11 beneath tank bottom plate 5 . as with the other embodiments , the corrosion inhibitors can even be soluble inhibitors , generally not preferred , volatile corrosion inhibitors , which are preferred , or a mixture thereof , which is also preferred . an important aspect of the present invention is that it is essentially or preferably free of any perforated pipe or similar embodiments that extend to substrate area 6 located beneath tank 1 generally within side walls 2 . thus , there is no need to drill or dig into substrate area 6 to install perforated pipes therein . an advantage of the same is that expensive construction and / or installation costs are eliminated . other advantages are similar to those set forth above and the fact that the corrosion inhibitors can be replenished as needed , automatically , or by any other system as described herein above . another advantage is that the present invention is ideally suited for storage tanks wherein the void space or volume between the tank bottom and substrate are small . the inhibitors can be applied in solid form or in liquid form . with respect to soluble corrosion inhibitors , they include , but are not limited to , mixtures of znso 4 and nah 2 po 4 , organic nitrites , imidazoles and organic aminophosphites . suitable solvents for such soluble corrosion inhibitors include , but are not limited to , aqueous solutions including those of sodium , potassium , and calcium compounds , or mixtures of two or more thereof . the strength and / or concentration of such aqueous solvents will depend , in part , upon the amount of soluble corrosion inhibitor to be dissolved therein . accordingly , the present invention is not limited to any one set of strengths and / or concentrations of solvents for the soluble corrosion inhibitors disclosed herein . suitable sodium and calcium compounds for use in forming the above - mentioned aqueous solvents include , but are not limited to , na 2 moo 4 , na 3 po 4 , nah 2 po 4 , nano 2 , na 2 sio 3 , calcium phosphonate , or suitable mixtures of two or more thereof . in another instance , corresponding potassium compounds can be used in place of the above - mentioned sodium compounds . in another embodiment , the one or more soluble corrosion inhibitors of the present invention are powders in granular form . however , the present invention is not limited to only the above - mentioned forms . in connection with the present invention , suitable vci compounds for use in connection with the present invention are known in the art and , as such , any suitable volatile or vapor phase corrosion inhibitors can be used in the rust - resistant perforated pipes of the present invention . suitable vcis for use in the present invention are disclosed in u . s . pat . nos . 4 , 290 , 912 ; 5 , 320 , 778 ; and 5 , 855 , 975 , which are incorporated by reference in their entirety for their teachings of such compounds . examples of vcis set forth in u . s . pat . no . 4 , 290 , 912 include inorganic nitrite salts including metal nitrites , preferably group i and ii metal nitrites such as potassium nitrite , sodium nitrite , barium nitrite , and calcium nitrite . examples of vcis set forth in u . s . pat . no . 5 , 320 , 778 include anhydrous sodium molybdate [ na 2 moo 4 ], anhydrous ammonium dimolybdate [( nh 4 ) 2 moo 4 ], or an anhydrous amine - molybdate . the preferred amine molybdates of this component of the composites of the present invention are amine - molybdates comprising dicyclohexylamine , 2 - ethylhexylamine , and cyclohexylamine . another group of vcis comprise amine benzoates , amine nitrates , and benzotriazole . other vcis comprise cyclohexylamine benzoate , ethylamine benzoate , dicyclo - hexylamine nitrate and benzotriazole . examples of vcis set forth in u . s . pat . no . 5 , 855 , 975 include sodium nitrite and benzotriazole . useful volatile or vapor phase corrosion inhibitors also include but are not limited to , benzotriazole , tolytriazole and salts thereof , mixtures of benzoates of amine salts with benzotriazole , nitrates of amine salts , and c 13 h 26 o 2 n . fig3 relates to an embodiment of the present invention somewhat similar to the embodiments of fig1 and 2 but additionally contains a ring wall . as shown in fig3 , tank 1 contains a sidewall 2 that is located on tank base plate 7 that extends the entire diameter or width of the tank and has a slight exterior circumferential annulus or edge that extends readily outward of the tank side wall . chime seal 3 is desirably located in the vicinity of the outer end of bottom exterior edge 7 a and the top of ring wall 20 as shown in fig3 . although not shown , the chime seal contains refill ports that allow perforated pipe 4 to be inserted therein and subsequently various one or more sci and / or one or more vci compounds . such compounds , as noted above , will flow through perforated pipe 4 enclosed within chime seal 3 and exit desirably at the bottom portion thereof through perforations 9 so that they can enter void spaces 11 inherently located under tank soil side bottom 5 and flow radially inwardly toward the center of the tank . in this embodiment , ring wall 20 , instead of being located on a hard substrate surface such as asphalt or concrete , is located below tank side wall 2 so that it can support the same . ring wall 20 , of course , is made of a hard material , usually concrete or the like , and extends downward into the ground beneath tank 1 thus forming a cylinder . substrate 6 located within ring wall 20 , as noted above , can either be hard , for example concrete or asphalt , or porous such as sand , small stones such as pebbles , actual soil such as clay , loam or a sandy soil , and the like . in the embodiment of fig3 , the substrate located radially inward of ring wall 20 is sand wherein the same was placed there prior to the installation of the tank . in order to prevent the sci and / or vci from penetrating sand substrate 6 and permeating down into the ground or soil underneath the ring wall and laterally ( radially outwardly ) exiting therefrom , liner 22 is utilized under porous substrate 6 . the liner desirably is a polymer or other non - corrosive material that is generally impermeable with regard to the sci and / or vci compounds . suitable plastics include pvc , polyolefins such as polyethylene , and polyurethanes . alternatively , liner 22 can be located under the entire tank base plate or any portion thereof . while in the embodiment of fig3 , a porous substrate is utilized within ring wall cylinder , other embodiments exist . for example , interior substrate 6 can be a hard material that extends across the entire area within ring wall 20 , or it can extend partially into the inner tank area , as say a few or several inches , or to any extent therebetween . conversely , the remaining non hard area can be a porous area . another embodiment of fig3 is that the substrate located radially outward the ring wall 20 can be hard . while in accordance with the patent statutes , the best mode and preferred embodiments have been set forth , the scope of the invention is not limited thereto , but rather , by the scope of the attached claims .	2
the present invention relates , in part , to methods , compositions , and kits for detecting and monitoring an immune response to a therapeutic protein ( e . g ., a therapeutic antibody ) that is administered to a subject . in one aspect , the invention provides methods for identifying patients with a clinically significant immune response to a therapeutic antibody . according to the invention , the presence of a detectable immune response is not clinically significant unless the immune response reaches a clinically significant threshold level . for example , in clinical studies of natalizumab , a clinically significant threshold level of immune response was surprisingly more than 1 . 645 standard deviations ( e . g ., at more than about 2 standard deviations ) above a control level of immune response observed for subjects that have not received the therapeutic agent . certain aspects of the invention relate to methods for detecting a clinically significant immune response against a therapeutic vla - 4 binding antibody that is administered to a subject . aspects of the invention are particularly useful for detecting and monitoring immune responses in a subject who has received at least one dose ( e . g ., one therapeutic dose ) of a vla - 4 binding antibody . aspects of the invention include identifying and / or monitoring a subject with a clinically significant immune response to a therapeutic vla - 4 binding antibody , evaluating the immune response , and / or determining an appropriate clinical treatment ( e . g ., a particular therapeutic regimen ) based on the nature and / or extent of the immune response . information about a subject &# 39 ; s response to the administration of a vla - 4 binding antibody may be used to adjust , design , and / or optimize a therapeutic regimen for the subject . accordingly , one aspect of the invention relates to identifying a subject who has a clinically significant immune response to a therapeutic vla - 4 binding antibody . another aspect of the invention relates to monitoring a subject &# 39 ; s immune response to a therapeutic vla - 4 binding antibody . a further aspect of the invention relates to determining appropriate therapeutic strategies to treat certain diseases ( e . g ., multiple sclerosis , crohn &# 39 ; s disease , or rheumatoid arthritis , etc .) based on a subject &# 39 ; s immune response to a therapeutic vla - 4 binding antibody . vla - 4 binding antibodies may be used to treat a number of diseases and disorders associated with inflammation . such disorders include , e . g ., inflammation of the central nervous system ( e . g ., in addition to multiple sclerosis , meningitis , neuromyelitis optica , neurosarcoidosis , cns vasculitis , encephalitis , and transverse myelitis ), tissue or organ graft rejection or graft - versus - host disease , acute cns injury , e . g ., stroke or spinal cord injury ; chronic renal disease ; allergy , e . g ., allergic asthma ; type 1 diabetes ; inflammatory bowel disorders , e . g ., crohn &# 39 ; s disease , ulcerative colitis ; myasthenia gravis ; fibromyalgia ; arthritic disorders , e . g ., rheumatoid arthritis , psoriatic arthritis ; inflammatory / immune skin disorders , e . g ., psoriasis , vitiligo , dermatitis , lichen planus ; systemic lupus erythematosus ; sjogren &# 39 ; s syndrome ; hematological cancers , e . g ., multiple myeloma , leukemia , lymphoma ; solid cancers , e . g ., sarcomas or carcinomas , e . g ., of the lung , breast , prostate , brain ; and fibrotic disorders , e . g ., pulmonary fibrosis , myelofibrosis , liver cirrhosis , mesangial proliferative glomerulonephritis , crescentic glomerulonephritis , diabetic nephropathy , and renal interstitial fibrosis . in some embodiments , the disorder is a disease effected by modulation of an α4β1 or / an α4β7 subunit . in one embodiment , a vla - 4 binding antibody is a humanized version of murine mab 21 . 6 , e . g ., natalizumab . accordingly , aspects of the invention relate to evaluating a subject &# 39 ; s response to natalizumab and determining appropriate treatments for multiple sclerosis and other inflammatory conditions or diseases that can be treated with natalizumab . the invention relates in part to identifying an immune response to a vla - 4 binding antibody ( e . g ., a humanized version of murine mab 21 . 6 , such as natalizumab , or an100226 ) in a subject , and determining whether the response is clinically significant . as used herein , “ identifying ” a subject with an immune response means detecting or diagnosing the presence of an immune response in a subject . accordingly , identifying a subject with a clinically significant immune response means detecting or diagnosing the presence of a clinically significant immune response in a subject . as used herein , a “ clinically significant threshold ” for an antibody response to a therapeutic protein is at least 2 standard deviations above a control reference level . in one embodiment , the threshold level for a clinically significant immune response to a therapeutic protein may be between 3 and 6 ( e . g ., about 4 or 5 ) standard deviations above a control level . the control level may be a mean or median level of binding activity that is present in a patient population ( e . g ., a population of subjects with a disease or condition such as multiple sclerosis , crohn &# 39 ; s disease , or rheumatoid arthritis ) before exposure to the therapeutic protein . in one embodiment , a clinically significant threshold for anti - natalizumab antibodies is 500 ng / ml of patient sera ( e . g ., a 50 ng / ml threshold in an assay of 10 - fold diluted serum ). as used herein , an immune response is an immunogenic response to a therapeutic protein characterized by increased levels in the subject of one or more antibodies that bind the protein . thus , an immune response may be characterized by the induction of increased levels of soluble antibodies that recognize ( e . g ., specifically recognize ) and bind to the protein , e . g ., a vla - 4 binding antibody ( e . g . natalizumab ). a typical immune response is polyclonal and may include antibodies with different affinities ( and therefore different degrees of specificity ) for the therapeutic protein . accordingly , methods of the invention may involve detecting the presence in a subject of one or more induced antibodies that bind to a therapeutic protein ( e . g ., a vla - 4 binding antibody ) that was administered to the subject . in some embodiments , the induced antibodies may be detected as soluble antibodies that are present in a biological sample ( e . g ., a serum sample ). aspects of the invention relate to assays for detecting a clinically significant threshold level of binding activity in a biological sample obtained from a patient . the threshold level represents a level below which any detectable binding activity is considered not to be clinically significant . as used herein , binding activity refers to the detected amount of binding to a therapeutic protein in a biological sample . as described herein , the presence of binding activity in a biological sample may reflect a polyclonal response to the administration of a therapeutic protein . accordingly , the amount of binding may reflect an aggregate of binding by different antibodies with different affinities for the protein . in certain embodiments , the binding activity is further analyzed to determine with greater confidence whether the level of binding is due to the presence of specific antibodies against the therapeutic protein or due to other factors such as rheumatoid factors . the specificity of a binding activity may be evaluated in competition assays as described herein . in one aspect of the invention , a subject is identified as a positive ( i . e ., as having a clinically significant immune response to a therapeutic protein ) only if one or more samples obtained from the subject test positive in an assay of the invention . a positive test result is determined when a sample obtained from a subject contains at least a clinically significant threshold level of binding activity for the therapeutic protein , e . g ., vla - 4 binding antibody . surprisingly , the presence of any detectable immune response to a therapeutic antibody is not clinically significant . according to the invention , methods based on screening patients to detect any level of immune response to a therapeutic antibody identify many false positive patients , resulting in unnecessary additional clinical monitoring and potential anxiety for patients who do not have a clinically significant immune response . for example , an excessive number of false positives are detected when patients are identified as positive based on an immune response to a therapeutic antibody that is greater than 1 . 645 standard deviations above a mean level of binding activity present in subjects that have not received the therapeutic antibody . according to the invention , the theoretical 5 % false positive rate using a 1 . 645 standard deviation cut - off is an underestimate of the number of false positives , because the 5 % represents the rate of false - detection of any immune response and not the rate of false - positives for a clinically significant immune response . surprisingly , by raising the cut - off level ( the level below which a response is considered to be negative ) to higher than 1 . 645 standard deviations above a control reference level , the number of false positives is reduced without affecting the identification of subjects with clinically significant immune responses . it should be appreciated that the threshold should be set at a level that results in acceptable detection rates of patients with a clinically significant immune response . therefore , even though the clinically significant threshold should be set at more than 1 . 645 standard deviations above a pre - immune reference level , the threshold should not be set so high as to reduce the detection efficiency of actual positives . in one aspect of the invention , a subject &# 39 ; s immune response may be classified as negative if samples obtained from the subject do not test positive in an assay of the invention , e . g ., they do not reach the clinically significant threshold level of antibody response . in contrast , if a subject is identified as positive based on a positive level ( a level at or above a clinically significant threshold level ) of binding activity in a single assay , the patient may be either a “ transient ” or a “ persistent ” positive . a transient positive is a patient who has a positive immune response to the therapeutic antibody for a specified period of time after which the patient becomes negative . in contrast , a persistent positive is a patient who is positive for clinically significant levels of immune response for greater than a specified period of time . it should be appreciated that transient and persistent are relative terms . accordingly , a patient may be classified initially as persistent if the patient tests positive for an immune response at two or more time points ( e . g ., at 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 or more time points ) separated by clinically significant time intervals . however , the patient subsequently may be reclassified as transient if the patient tests negative for an immune response in a subsequent , assay . clinically significant time intervals may be at least one week , one month , one year , or longer . for example , the threshold time interval may be between 30 and 180 days , about 60 days , about 42 days , etc . the presence of a transient immune response may be indicative of a transient reduction in therapeutic efficacy . the presence of a persistent immune response may be indicative of a persistently reduced therapeutic efficacy . accordingly , the presence of a transient or persistent immune response may be clinically relevant and may affect the nature of a therapeutic regimen in a subject that is identified as transiently positive or persistently positive . a persistent immune response may necessitate a modification of the subject &# 39 ; s therapeutic regimen . as used herein , the term “ therapeutic regimen ” means a course of treatment for a subject . a therapeutic regimen may include administration of pharmaceutical agent ( s ) and / or application of a therapy . the selection of a regimen may include selection of dose amount , dose timing , dose frequency , duration of treatment , combination therapies with one or more pharmaceutical agents or therapies , and any other aspects of treatment decision making that are used by those of skill in the medical and therapeutic arts . a therapeutic regimen also may include the use of therapies such as procedures or devices that are administered to or used on a subject for the prevention or treatment of a disease or disorder . examples of therapeutic procedures , although not intended to be limiting , include the use of medical devices or surgery . accordingly , determining or altering a vla - 4 binding antibody therapeutic regimen may involve determining or altering the dose amount of therapeutic vla - 4 binding antibody that is administered to a subject , the frequency of administration , the route of administration , the duration of the treatment ( e . g ., the number of doses that are administered ), whether or not to combine a vla - 4 binding antibody treatment with one or more additional treatments , whether to discontinue a vla - 4 binding antibody treatment , whether to use a different vla - 4 binding antibody , and / or whether to use a combination of vla - 4 binding antibodies , etc . in one embodiment , the invention may involve determining whether to use a therapeutic alternative to a vla - 4 binding antibody , e . g ., whether to use beta interferon . aspects of the invention relate to detecting and / or monitoring an immune response to a vla - 4 binding antibody in a human ( e . g ., a human patient ). accordingly , as used herein , a subject may be a human subject . a subject may be a human patient that has an inflammatory disease or condition . a subject may be a patient that has received at least one dose of a vla - 4 binding antibody ( e . g ., natalizumab ). a subject may be a patient that is being ( or was ) treated chronically with a vla - 4 binding antibody ( e . g ., natalizumab ). a subject may be a patient that is being ( or was ) treated repeatedly with a vla - 4 binding antibody ( e . g ., natalizumab ). as used herein , a chronic treatment may involve administering a vla - 4 binding antibody over an extended period of time ( e . g ., to control or manage symptoms of an inflammatory disease or condition during the time period ). in contrast , a repeated treatment may involve repeating a course of treatment ( e . g ., a period of administration ) with a vla - 4 binding antibody when necessary ( e . g ., to treat symptoms of an inflammatory disease when they worsen or “ flare up ”). in one embodiment , a patient is considered to be undergoing a repeated treatment when the subject is re - treated with a therapeutic vla - 4 binding antibody for the first time . it will be understood by those of ordinary skill in the art that a subject may also undergo or have undergone treatments with therapies or procedures in combination with or separate from treatment with a vla - 4 binding antibody . it should be appreciated that aspects of the invention are not limited to human subjects . accordingly , a subject may be a non - human primate , cow , horse , pig , sheep , goat , dog , cat , rodent , or other non - human subject . in one aspect , the invention involves identifying and / or monitoring an immune response to a vla - 4 binding antibody in a subject . in certain embodiments , the identification and / or monitoring is performed by assaying a biological sample obtained from the subject , preferably blood , for the presence of induced antibodies that bind to the administered vla - 4 binding antibody as described herein . in one aspect of the invention , a qualitative assay is performed on a biological sample obtained from a subject , and the presence of an immune response is identified if the biological sample contains antibodies against the vla - 4 binding antibody in an amount greater than a threshold amount . in one embodiment , a threshold amount is an amount above which an immune response is identified as being clinically relevant , e . g ., the threshold level is determined as described herein . a clinically relevant immune response may have clinical implications , e . g ., it indicates that the subject should be evaluated to determine whether the dosage of the administered vla - 4 binding antibody should be modified , to determine whether other physiological parameters of the patient should be monitored , to determine whether a further assay for an immune response should be performed , or to determine whether any alternative or additional steps should be taken to treat or monitor the subject , etc . a clinically relevant immune response may be evaluated along with one or more other factors . it should be appreciated that the identification of a clinically relevant immune response does not , by itself , require that a change be made to the subject &# 39 ; s therapy or treatment regimen . in another aspect of the invention , a quantitative assay may be performed on a biological sample to quantify the amount of antibodies ( e . g ., the antibody titer ) against a vla - 4 binding antibody that was administered to a subject . quantitative results also may be analyzed to determine whether an immune response is above a clinically significant threshold level . according to the invention , an immune response against a vla - 4 binding antibody ( e . g ., natalizumab ) may be assessed in a subject over time by performing assays on samples obtained at different time points from the subject . the multiple - assessment strategy permits monitoring of a subject &# 39 ; s immune response to the vla - 4 binding antibody and may allow the therapeutic vla - 4 binding antibody regimen to be individually tailored to the subject &# 39 ; s therapeutic needs . for example , a sample may be obtained from a subject , tested for an immune response to the vla - 4 binding antibody that has been administered to the subject , and at a second , subsequent time , another sample may be obtained from the subject and similarly tested . detection and confirmation of the presence of an antibody response in a subject &# 39 ; s samples over time by sequential determinations at predetermined time intervals permits monitoring of an immune response to a therapeutic vla - 4 binding antibody treatment . the detection and monitoring of an immune response to an administered vla - 4 binding antibody also allows adjustment in the overall treatment of the subject , for example by adjusting ( e . g ., modifying or suspending ) the vla - 4 binding antibody treatment and / or by adjusting additional therapies ( e . g ., therapies that modulate the immune response of the subject ). the selection or adjustment of a therapeutic regimen may be based on a determination of a clinically significant immune response to a vla - 4 binding antibody in at least two biological samples obtained at different times from a subject who has been administered a vla - 4 binding antibody . the determination of a subject &# 39 ; s clinically significant immune response to the vla - 4 binding antibody may indicate that initiating , continuing , adjusting , or stopping administration of a specific pharmaceutical agent and / or therapy to the subject would be beneficial . for example , the determination of a clinically significant immune response to a vla - 4 binding antibody in at least two biological samples obtained from a subject may be the basis for altering the dose of a pharmaceutical agent that is administered to the subject as part of a current therapeutic regimen . the treatment may be changed to include additional pharmaceutical agents or therapies or to lower or raise the dose of a currently administered agent or therapy . for example , the identification of an immune response to a vla - 4 binding antibody in a subject may suggest initiating or continuing a treatment with an immunosuppressive pharmaceutical agent , etc . in some embodiments , an initial therapeutic regimen may be selected based on the determination of an initial immune response to a vla - 4 binding antibody in a single biological sample obtained from a subject who has been treated with a vla - 4 binding antibody . following the selection and administration of a selected therapeutic regimen , a subsequent determination of an immune response to a vla - 4 binding antibody in one or more subsequent biological samples obtained from the subject may be made and may provide a basis for adjusting the therapeutic regimen . the determination of a clinically significant immune response to a vla - 4 binding antibody in two or more biological samples obtained from a subject at different time points can be compared to evaluate or measure the onset , progression , or regression of an immune response in the subject to the vla - 4 binding antibody therapy . onset of an immune response to a via - 4 binding antibody in a subject may be characterized by increased level ( s ) of at least one antibody that binds to a vla - 4 binding antibody , and may be accompanied by the onset of one or more physiological changes or symptoms in the subject . progression of an immune response to a therapeutic vla - 4 binding antibody may be characterized by a further increase in the level of the at least one antibody that binds to the therapeutic vla - 4 binding antibody . however , the progression of an immune response may involve an increase in the level ( s ) of at least one additional antibody , and / or a decrease in the level of at least one of the antibodies that increased with the onset of the illumine response . for example , an initial immune response may be predominantly an igm response . as the immune response progresses , the predominant antibodies may switch from igm to igg antibodies . progression of an immune response also may be accompanied by a progression ( e . g ., an increase , decrease , or modification ) of one or more of the initial physiological changes or symptoms or the onset of one or more additional physiological changes or symptoms . regression of an immune response in a subject to a therapeutic vla - 4 binding antibody may be characterized by a decrease in the level ( s ) of one or more antibodies that bind to the therapeutic vla - 4 binding antibody . the regression of an immune response also may be accompanied by a decrease of certain physiological changes or symptoms . however , it should be appreciated that onset , progression , and / or regression of an immune response to a therapeutic vla - 4 binding antibody may be clinically asymptomatic , other than the detectable changes in antibody levels . progression and regression of a clinically significant immune response to a vla - 4 binding antibody may generally be indicated by the increase or decrease , respectively , of the level of an antibody that binds a vla - 4 binding antibody in a subject &# 39 ; s samples over time . for example , if no antibody , or a subclinically significant level of an antibody , that specifically binds a vla - 4 binding antibody is determined to be present in a first sample from a subject and a clinically significant threshold of antibodies that specifically bind a vla - 4 binding antibody is determined to be present in a second or subsequent sample from the subject , it may indicate the onset of an immune response to the vla - 4 binding antibody in the subject . progression of an immune response to a vla - 4 binding antibody in a subject may be indicated by the presence of a higher level of an antibody that specifically binds a vla - 4 binding antibody in a second or subsequent sample from a subject compared to the level present in the initial or previous sample from the subject . regression of an immune response to a vla - 4 binding antibody may be indicated by the presence of a lower level of an antibody that specifically binds a vla - 4 binding antibody in a second or subsequent sample from a subject compared to the level present in the initial or previous sample from the subject . in one aspect of the invention , an immune response may be categorized as either positive or negative based on whether a level of antibodies against a therapeutic vla - 4 binding antibody is above a predetermined clinically significant threshold . in some embodiments , a clinically significant threshold is more than 1 . 645 ( e . g . more than 2 , 3 , 4 , 5 , or 6 ) standard deviations above a mean level of binding activity measured in pre - immune subjects ( i . e ., subjects who have not received any dose of therapeutic vla - 4 antibody ). in some embodiments , the subjects are healthy subjects and in certain embodiments , the subjects are diseased patients ( e . g ., patients with multiple sclerosis , crohn &# 39 ; s disease , or rheumatoid arthritis ). in one embodiment , the threshold level is & gt ; 0 . 5 micrograms / ml serum . in some embodiments , the threshold level is equal to about 0 . 5 micrograms / ml serum . in one embodiment , subjects who have been administered a vla - 4 binding antibody may be categorized as falling into one of at least three categories . one category , referred to herein as “ negative ”, includes subjects in which binding activities are at or below , clinically significant threshold levels ( e . g ., a subject in which antibodies to a vla - 4 binding antibody are not detected at a concentration of at least about 500 ng / ml in a biological sample ( e . g ., serum ) obtained from the subject ). a second category , referred to herein as “ transient positive ” includes subjects in which binding activities are detected above a threshold level only a limited number of times , e . g ., at one , two , three , four , five points in time ( e . g ., antibodies to a vla - 4 binding antibody are not detected at a subsequent time point separated by at least 30 days from the last time point ). a third category , referred to herein as “ persistent positive ” includes subjects in which binding activities are detected above a threshold level a predetermined number of times , e . g ., at two , three , four , five , six , seven or more time points separated by a minimum threshold time interval ( e . g ., a subject in which antibodies to a vla - 4 binding antibody are detected at a concentration of at least about 500 ng / ml in two three , four , five , six , seven or more biological samples obtained from the subject at time points separated by at least a threshold interval ). in some embodiments , the threshold interval is at least about 10 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 , or more days . patients who are “ persistent positive ” may have a loss of efficacy from vla - 4 antibody therapy , while “ transient positive ” patients have full efficacy restored after only a temporary diminution in efficacy . it should be appreciated that a negative subject may become a transient positive . and either one may become a persistent positive if a positive immune response develops and persists for a specified number of time points , e . g ., at least two time points . in one embodiment , a therapy may be changed based on a determination of a single positive result . in another embodiment , a therapy may be changed based upon a determination that a subject is a transient positive subject . in yet another embodiment , a therapy may be changed based upon a determination that a subject is a persistent positive subject . as discussed above , it should be appreciated that the terms transient and persistent are relative terms , and that a patient that seems to be persistently positive may become negative at a later time . accordingly , patients with positive responses should be monitored regularly to evaluate the persistence of the positive response , the effectiveness of the therapy , and / or the presence of other clinical manifestations of a positive immune response . according to the invention , the risk of a reduction in therapeutic efficacy ( e . g ., the risk of a relapse ) increases with the length of time that a positive immune response persists . accordingly , in one aspect of the invention , the number of times that a patient tests , positive is less important than the length of time over which the patient remains positive . in one embodiment , a patient may be identified as being at risk of a reduction in therapeutic efficacy ( e . g ., at risk of a relapse ) if a positive result is detected within 3 months of the first administration of a therapeutic vla - 4 binding antibody . in one embodiment , this risk increases if the positive immune response persists for 3 - 6 months , and further increases if the positive immune response persists for 6 - 9 months , and yet further increases with persistence for 9 - 12 months after the first administration of the therapeutic vla - 4 binding antibody . it should be appreciated that persistence for more than one year even further increases the probability of a relapse . accordingly , different therapeutic regimens may be appropriate for a patient with a persistently positive immune response . however , it should be appreciated that even in the presence of a persistently positive immune response , a therapeutic antibody therapy need not be discontinued unless it becomes ineffective ( e . g ., a loss of substantially all efficacy ) or causes other negative clinical manifestations . in some embodiments , treatment with a therapeutic vla - 4 binding antibody may be discontinued if the treatment is ineffective or is losing is effectiveness in a patient that has a below - threshold level of immune response . a lack of efficacy ( or a reduction in efficacy ) in the absence of a clinically significant immune response may indicate that the ineffectiveness of the treatment is due to one or more factors other than a patient immune response to the therapeutic agent . a patient will not be a transient positive if no positive response is detected . accordingly , alternative treatment may be considered . it should be appreciated that binding activities or antibody levels may be compared to pre - immune activities or levels ( i . e ., measured before the administration of the first dose of vla - 4 binding antibody ). however , a comparison to a pre - immune amount is not necessary as discussed herein , because a positive immune response may be identified when a clinically significant threshold ( or above threshold ) amount of binding activity or antibody levels are present in a patient sample . according to aspects of the invention , a threshold amount of an antibody response is assayed for . as discussed herein , a qualitative assay may be performed . alternatively , a quantitative assay may be performed and in one embodiment , the quantitative data may be translated into a qualitative output ( e . g ., whether the amount of antibody is greater than a threshold amount ). any suitable method for detecting an amount of antibody or binding activity may be used to determine whether it is at least a threshold amount or activity . detection assays may include any known immunodetection methods for detecting , confirming , binding , purifying , removing , quantifying and / or otherwise generally detecting antibodies that specifically bind to a specified therapeutic protein , e . g ., to a vla - 4 binding antibody , or fragments thereof . for example , immunodetection techniques may include , but are not limited to , enzyme linked immunosorbent assays ( elisa ) ( including , but not limited to , a standard sandwich elisa or a bridging elisa ), radioimmunoassays ( ria ), immunoradiometric assays , fluoroimmunoassays , chemiluminescent assays , bioluminescent assays , radioimmunoprecipitation assays ( ripa ), and western blots . in addition , immunodetection techniques may include optical sensor - based methods , such as surface plasmon resonance ( spr ), or guided mode resonance filter ( bind ). although certain examples provided herein relate to assays utilizing an immobilized vla - 4 binding antibody attached to a surface ( e . g . an elisa ), one of ordinary skill in the art will recognize that the invention in some aspects may include assays without surface attachment of a vla - 4 binding antibody ( e . g . flow cytometric assays , etc .). other immunodetection techniques may include immunoradiometric assays ( irma ), time - resolved fluorometry ( trf ), or electrochemiluminescence ( ecl ). a number of useful immunodetection methods have been described in the scientific literature , such as , e . g ., doolittle m h and ben - zeev 0 , 1999 ; gulbis b and galand p , 1993 ; de jager r et al ., 1993 ; and nakamura et al ., 1987 , each incorporated herein by reference . in one aspect , an assay is performed to detect a presence of a binding activity for a vla - 4 binding antibody in a biological sample . in one embodiment , the specificity of the binding activity may be evaluated by determining whether the observed binding activity is specific for the vla - 4 binding antibody or whether it is due to an interfering factor that may be present in the biological sample such as a rheumatoid factor or other binding factor . aspects of the invention may include an assay that involves contacting a biological sample with an immobilization moiety to immobilize any binding activity that is present in the biological sample . immobilized binding activity may be detected using a detection moiety . immobilization and detection moieties may be , respectively , immobilized unlabeled and non - immobilized labeled vla - 4 binding antibodies as described herein . in one embodiment , an immobilization moiety may be bound to a solid substrate or surface ( e . g ., in a well of a multi - well plate , on the surface of an elisa plate , etc .). in another embodiment , an immobilization moiety may be attached to a bead ( e . g ., a magnetic bead ) via a covalent or other linkage ( e . g ., the immobilization moiety may be conjugated to a biotin molecule and attached to a bead coated with streptavidin via a biotin - streptavidin interaction ). in some embodiments , the bead may be attached to a surface or a matrix . for example , a magnetic bead may be immobilized on a magnetic surface . similarly , a charged bead may be immobilized on a charged surface ( e . g ., an electrode ). a positive result may be determined if the detected amount of binding activity ( e . g ., the amount of binding activity that is captured by the immobilization moiety ) is above a predetermined threshold . the specificity of the detected binding activity may be evaluated by including a competition moiety in the assay . the competition moiety may be a non - immobilized unlabeled vla - 4 binding antibody that may be included to compete with the immobilization and / or detection steps of the assay . if the presence of the competition moiety reduces the binding activity by at least a predetermined percentage or cut - off , the binding activity is determined to be specific and the positive result is confirmed . if the presence of the competition moiety fails to reduce the binding activity by at least a predetermined percentage or cut - off , the binding activity is determined to be non - specific and the initial positive result is now determined to be a negative result for an immune response . according to aspects of the invention , predetermined amounts of immobilization , detection and / or competition moieties may be used . similarly , an initial threshold level of binding activity may be established using a sample that contains a predetermined amount of an antibody that is known to bind to a vla - 4 binding antibody . for example , a threshold level may be established using between 10 ng and 1 , 000 ng ( e . g ., about 50 ng , or about 500 ng ) of a control antibody per ml of assay . the amount of antibody used to determine the threshold level will determine the sensitivity of the assay . in general , the sensitivity of the assay may be considered to be similar to the amount of antibody that is used to determine the initial threshold . it should be appreciated that the amount of binding in the control may serve as a reference that is used to determine the threshold ( e . g ., the threshold amount may be a multiple or a fraction of the signal obtained in the control ). however , in one embodiment , the signal obtained in the control assay is used as the threshold amount . it also should be appreciated that the assay sensitivity may be affected by a number of factors including the affinity and specificity of the control antibody . in one embodiment , the specificity of the binding activity may be evaluated by spiking the assay with an amount of competition moiety that is similar to the amount of control antibody that was used to establish the threshold level of binding . for example , an assay may be spiked with between about 10 ng and 1 , 000 ng ( e . g ., about 50 ng , or about 500 ng ) of unlabeled soluble vla - 4 binding antibody per ml of assay . however , other amounts of competition moiety may be used . accordingly , in some embodiments of the invention , a first level of binding activity , in a biological sample , to the vla - 4 binding antibody is determined in a first immunoassay for a first aliquot of the biological sample , and a second level of binding activity to the vla - 4 binding antibody is determined in a second immunoassay for a second aliquot of the biological sample , wherein the second immunoassay is spiked with a greater amount of unlabeled soluble vla - 4 binding antibody than the first immunoassay , and the presence of at least a threshold level of soluble antibody to the vla - 4 binding antibody is indicated if the first level of binding activity is greater than a reference level and the second level of binding activity is less than a predetermined percentage of the first level of binding activity . one of ordinary skill in the art will recognize that different methods can be used for assessing and / or monitoring an immune response in a subject who has been treated with a therapeutic antibody such as a vla - 4 binding antibody . for example , as described above , the assessment and / or monitoring may be performed by determining whether the amount of an antibody that specifically binds to a vla - 4 binding antibody using a single - level “ cut - off ”. as used herein the cut - off level of binding is the level at or above which increased detection will be scored as significant and / or positive and a confirmatory determination that the detection of a level of soluble binding activity in a biological sample reflects the level of an antibody that specifically binds to a vla - 4 binding antibody in the sample . in other embodiments , the identification of an immune response to the therapeutic vla - 4 binding antibody may be performed quantitatively to determine a titer of an antibody that specifically binds to a vla - 4 binding antibody in a biological sample from a subject . in one aspect of the invention , an immunodetection assay may be an elisa . as will be understood by those of ordinary skill in the art , the term “ elisa ” encompasses a number of protocols for immunodetection . for example , elisa methods include sandwich elisas , bridging elisas , etc . in some embodiments of the invention , the elisa immunoassay is a manual assay . however , in some embodiments of the invention all or part of the elisa may be performed robotically . in some embodiments of the invention , an elisa assay includes using a vla - 4 binding antibody as an immobilized target moiety with which an elisa plate is coated . the coated elisa plate may then be contacted with a biological sample for determination of the level of a subject antibody that specifically binds a vla - 4 binding antibody . in some embodiments of the invention , a first aliquot of a biological sample is assayed using an elisa assay to determine the presence or absence of a threshold amount of binding to the immobilized target vla - 4 binding antibody and a second aliquot of the same biological sample is also assayed using an elisa to confirm whether or not a threshold ( or above threshold ) level of binding to the immobilized target vla - 4 binding antibody is indicative of a vla - 4 binding antibody - specific antibody . in one aspect of the invention , the threshold level of soluble binding activity in an aliquot is about equal to the level of binding activity present in a control or reference sample comprising at least about 50 ng , 100 ng , 200 ng , 300 ng , 400 ng , 500 ng , 600 ng , 700 ng , 800 ng , 900 ng , or 1 , 000 ng per ml of a reference antibody that binds to a vla - 4 binding antibody . in one embodiment , the threshold level is determined as about equal to the level of binding activity in a control or reference sample containing about 500 ng / ml of a reference antibody that binds to a vla - 4 binding antibody . the reference antibody may be polyclonal or monoclonal . the reference antibody may be a murine anti - natalizumab antibody ( e . g ., 12c4 described in sheremata et al ., 1999 , neurology 52 , pages 1072 - 1074 , incorporated herein by reference ): as described herein , if the level of binding to the immobilized target vla - 4 binding antibody that is at least at the threshold level , and the soluble binding activity is determined to be the binding activity of an antibody that specifically binds to a vla - 4 binding antibody , then it identifies an immune response to the vla - 4 binding antibody in the subject . in general , elisa methods useful in methods of the invention may include obtaining a biological sample from a subject who has been administered a therapeutic antibody such as a vla - 4 binding antibody ( e . g . natalizumab , etc .) and contacting an aliquot of the sample with an immobilization antibody . in some embodiments , the immobilization antibody may be the same vla - 4 binding antibody that was administered to the subject . the immobilization antibody captures molecules or compounds in the sample that bind to the antibody , and the sample is contacted with a second detection moiety that is capable of selectively binding to or detecting the molecule or compound that is captured , ( e . g ., a labeled second antibody ). examples of moieties capable of selectively binding or detecting the complex include , but are not limited to antibodies or other ligands that can be labeled using a variety of markers ( e . g ., biotin / avidin ligand binding arrangement , as is known in the art ). one skilled in the art may also use a labeled third antibody . in preferred embodiments , the second moiety is a labeled form of the immobilization antibody . in some embodiments of the invention , an elisa assay includes using the therapeutic vla - 4 binding antibody as an immobilized target moiety with which an elisa plate is coated . the coated elisa plate may then be contacted with a biological sample for determination of the level of a subject antibody that specifically binds the therapeutic vla - 4 binding antibody . in some embodiments of the invention , a first aliquot of a biological sample is assayed using an elisa assay to determine the presence or absence of a threshold amount of binding activity for the immobilized target vla - 4 binding antibody , and a second aliquot of the same biological sample is assayed using an elisa to confirm whether or not a threshold ( or above threshold ) level of binding to the immobilized target vla - 4 binding antibody is indicative of a vla - 4 binding antibody - specific antibody . in one aspect of the invention , the threshold level of soluble binding activity in an aliquot is about equal to the level of binding activity present in a control or reference sample comprising at least about 50 ng , 100 ng , 200 ng , 300 ng , 400 ng , 500 ng , 600 ng , 700 ng , 800 ng , 900 ng , or 1 , 000 ng per ml of a reference antibody that binds to a vla - 4 binding antibody . in one embodiment , the threshold level is determined as about equal to the level of binding activity in a control or reference sample containing about 500 ng / ml a reference antibody that binds to a vla - 4 binding antibody . the reference antibody may be polyclonal or monoclonal . the reference antibody may be a murine anti - natalizumab antibody ( e . g ., 12c4 described in sheremata et al ., 1999 , neurology 52 , page 1072 ). a reference antibody that binds to a vla - 4 binding antibody may be a reference antibody that binds to natalizumab ( for example , an antibody that binds to natalizumab with high affinity , e . g ., with nanomolar affinity ). in some embodiments , a reference antibody that binds to natalizumab may block natalizumab binding to vla - 4 ( e . g ., it may inhibit binding of natalizumab to vla - 4 by at least 50 %, at least 60 %, at least 70 %, at least 80 %, at least 90 %, or more ). the reference antibody may be a murine monoclonal antibody . the reference antibody may be an anti - idiotypic antibody specific for natalizumab . in some embodiments , the reference antibody is the 12c4 antibody ( available from maine biotechnology services , inc ., portland me . ; see , e . g ., sheremata et al ., 1999 , neurology 52 , page 1072 ). 12c4 is a blocking antibody that blocks natalizumab binding to vla - 4 . in some embodiments , the reference antibody competes with 12c4 for binding to natalizumab . antibody binding competition may be demonstrated using standard methods of assessing an antibody &# 39 ; s ability to competitively inhibit the 12c4 antibody &# 39 ; s ability to block binding of natalizumab to vla - 4 . in some embodiments , the presence of an antibody that specifically binds to a vla - 4 binding antibody is determined using a bridging elisa . in a bridging elisa , antibodies that specifically bind to a vla - 4 binding antibody ( e . g ., from a biological sample ) act as a bridge between vla - 4 binding antibody coated on an elisa plate and detectably labeled vla - 4 binding antibody in solution ( e . g ., non - immobilized ). thus , an elisa signal after standard processing indicates that the detectable label has been linked to the solid phase and that a soluble binding activity is present in the biological sample . contacting an aliquot of the biological sample with the immobilized antibody under effective conditions and for a period of time sufficient to allow the formation of immune complexes ( primary immune complexes ) is generally a matter of adding the aliquot of the biological sample to the immobilized antibody ( e . g ., a vla - 4 binding antibody immobilized on an elisa plate ) and incubating the mixture for a period of time long enough for the immobilized antibody to form an immune complex with ( i . e ., to bind to ) a molecule or compound with soluble binding activity that is present in the aliquot of the biological sample . the molecule or compound with soluble binding activity may be an induced antibody that specifically binds to the vla - 4 binding antibody or may be a non - induced endogenous antibody or receptor that binds to the vla - 4 binding antibody ( e . g ., a rheumatoid factor [ rf ] or an anti - fab antibody ). after this time , the sample - antibody mixture ( e . g ., the elisa plate , dot blot , or western blot ) will generally be washed to remove unbound antibody species and / or materials from the assay mixture . if a threshold level of binding activity is detected , an additional step may involve confirming whether or not the binding activity is indicative of an induced antibody that specifically binds to the therapeutic vla - 4 binding antibody . for this confirmation step , a second aliquot of the biological sample may be prepared and assayed as described for the first aliquot , except that a predetermined amount of non - immobilized unlabeled competition vla - 4 binding antibody also is added to the assay ( e . g ., the elisa assay ). for example , the predetermined amount of competition antibody may be an unlabeled amount that reduces a specific signal by about 50 % or more in a control assay . if the presence of the unlabeled vla - 4 binding antibody reduces the signal by more than an expected percentage amount , then the threshold ( or above threshold ) binding activity is judged as a positive indicator for the presence of an antibody that specifically binds to the therapeutic vla - 4 binding antibody . in contrast , if the presence of the unlabeled vla - 4 binding antibody reduces the signal by less than an expected percentage amount then the threshold ( or above threshold ) binding activity is judged as negative for an antibody that specifically binds to a vla - 4 binding antibody . it should be appreciated that a non - specific signal may be due serum factors other than an antibody that binds to the vla - 4 binding antibody . as used herein the terms “ spike ” or “ spiked ” refers to the addition of an unlabeled ( or differently labeled ) soluble competition vla - 4 binding antibody to a sample or assay . as used herein , the “ percentage reduction ” is the percentage of the level of binding determined in the first aliquot . thus , for example , if there is an indication of about 500 ng / ml equivalent of a molecule or compound with binding activity in the first aliquot and the inclusion of the unlabeled vla - 4 binding antibody in the second aliquot reduces the amount of signal by more than 40 - 90 % ( e . g ., by about 50 % or more , by about 55 % or more , by about 60 % or more , by about 65 % or more , by about 70 % or more , by about 75 % or more , by about 80 % or more , by about 85 % or more , by about 90 % or more ), then the binding activity in the biological sample is considered indicative of the presence of an induced antibody that specifically binds to the therapeutic vla - 4 binding antibody . but if the inclusion of the unlabeled vla - 4 binding antibody in the second aliquot reduces the amount of signal by less than 20 - 40 %, then the binding activity in the biological sample is not considered to be indicative of the presence of an induced antibody that specifically binds to the therapeutic vla - 4 binding antibody . in some embodiments , the competition antibody may be soluble unlabeled natalizumab . in some embodiments , the soluble unlabeled natalizumab may be used at a final concentration of about 100 μg / ml . however , any concentration of free unlabeled natalizumab may be used if it results in a predetermined decrease ( e . g ., about 40 %, about 50 %, or more ) in the signal obtained for a control sample containing a control amount of reference antibody . for example , a control sample may contain about 500 ng / ml , about 3 μg / ml or any other suitable amount of reference antibody ( e . g ., 12c4 ). as indicated herein , the presence in a biological sample from a patient of an antibody that specifically binds to a vla - 4 binding antibody indicates that the subject has a clinically significant immune response to the vla - 4 binding antibody . in an exemplary “ sandwich ” elisa , a therapeutic vla - 4 binding antibody ( e . g ., natalizumab ) may be used as the target antibody and may be immobilized onto a selected surface exhibiting protein affinity , such as a well in a polystyrene microtiter plate . then , a sample from a subject who has had at least one administration of a therapeutic vla - 4 binding antibody , e . g ., natalizumab , is added to the wells . after binding and / or washing to remove non - bound materials , binding molecules or compounds that are bound to the target antibody may be detected . detection may be achieved by the addition of a second antibody that is linked to a detectable label . in addition , the identity of the binding molecule or compound as an antibody that specifically binds to a vla - 4 binding antibody may be confirmed as described above herein . as will be understood by those of ordinary skill in the art , notwithstanding individual features ( e . g . the confirmatory steps described herein ), in general , elisas have certain features in common , such as coating , incubating and binding , washing to remove non - specifically bound species , and detecting the bound immune complexes . in coating a plate with either antigen or antibody , the wells of the plate will generally be incubated with a solution of the target antibody , either overnight or for a specified period of hours . a coating buffer may be a sodium phosphate / bsa coating buffer or another suitable art - known coating buffer . the wells of the plate will then be washed to remove incompletely adsorbed material . any remaining available surfaces of the wells are then “ coated ” with a nonspecific protein that is antigenically neutral with regard to the test sample . this protein may be bovine serum albumin ( bsa ), casein or solutions of milk powder , etc . the coating allows for blocking of nonspecific adsorption sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antisera onto the surface . in an elisa , a secondary or tertiary detection means may be used or a direct detection means may be used . when using a secondary or tertiary detection methods , after binding of a protein or antibody to the well , coating with a non - reactive material to reduce background , ( e . g . with blocking buffer such as tris - sucrose blocking buffer or other art - recognized blocking buffer ), and washing to remove unbound material , the immobilizing surface is contacted with the biological sample to be tested under conditions effective to allow immune complex ( antigen / antibody ) formation . detection of the immune complex then requires a labeled secondary binding ligand or antibody , and a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or a third binding ligand . in preferred embodiments of the invention the second binding ligand is a vla - 4 binding antibody ( e . g . the same vla - 4 binding antibody as used for the target antibody ). as used herein , the term “ under conditions effective to allow immune complex formation ” means that the conditions preferably include diluting the antigens and / or antibodies with solutions such as bsa , bovine gamma globulin ( bgg ), phosphate buffered saline ( pbs )/ tween , pbs with casein and tween 20 , or pbs / bsa buffer with tween 20 . various other art - known assay diluents can be used in the methods of the invention . these added agents also tend to assist in the reduction of nonspecific background and may include up to 0 . 5m nacl . as used herein , the “ suitable ” conditions also mean that the incubation is at a temperature or for a period of time sufficient to allow effective binding . incubation steps are typically from about 1 to 2 to 4 hours or so , at temperatures preferably on the order of 25 ° c . to 27 ° c ., or may be overnight at about 4 ° c . various art - known assay temperature and timing parameters can be used in the methods of the invention . after the incubation steps in an elisa , the contacted surface is washed to remove non - bound material . a preferred washing procedure may include washing with a solution such as pbs / tween , tbs / tween , or borate buffer , which may also include up to 0 . 5m nacl . following the formation of specific immune complexes between the test sample and the target antibody , and subsequent washing , the presence of even minute amounts of immune complexes may be determined . it will be understood that additional art - known wash buffer formulations can be used in the methods of the invention . to provide a detecting means , the second or third antibody will have an associated detectable label . in certain embodiments , the detectable label is an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate . thus , for example , one may contact or incubate the first and second immune complex with a urease -, glucose oxidase -, alkaline phosphatase -, hydrogen peroxidase - conjugated antibody , or other conjugated antibody for a period of time and under conditions that favor the development of further immune complex formation ( e . g ., incubation for 2 hours at room temperature in a pbs - containing solution such as pbs - tween ). it also will be understood by those of skill in the art that one or more positive and negative quality controls may be utilized in the methods of the invention . a positive quality control sample may be a normal serum sample that contains a predetermined amount of an antibody that is known to bind to a vla - 4 binding antibody . quality control samples may be reacted in parallel with and under the same conditions as the biological and control samples of the assay and provide a measure of the function of the assay . a negative quality control sample may be a serum sample known not to include an antibody that is known to bind to a vla - 4 binding antibody one of ordinary skill will understand how to utilize positive and negative control reactions and samples in an elisa to ascertain and validate the functionality of the solutions and / or substrates and / or protocol used in the assay . for example , a positive control may include a known amount of an antibody that specifically binds the vla - 4 binding antibody so when treated under the same conditions as the test samples ( e . g ., the biological sample ) it indicates that the assay works within expected parameters . an example of a negative control may be a sample that is known to not include an antibody that specifically binds to the vla - 4 binding antibody . such a negative control , when treated under the same conditions as the test sample ( e . g ., the biological sample ), will demonstrate that the binding detected in a biological sample arises from the biological sample and is not due to contamination of assay components or other factor not associated with the biological sample . a non - limiting example of an assay encompassed by the methods of the invention may involve the following procedures . coating the wells of an elisa plate with a solution of about 0 . 25 μg / ml natalizumab reference standard in a buffer and incubating the coated plate overnight at ambient temperature ; washing the plate wells a least once with a wash buffer and incubating the plate wells with a blocking buffer for a minimum of 1 hour at ambient temperature ; diluting control samples and screening samples by about 1 : 10 in an assay diluent ; diluting competition samples and natalizumab ( at about 1 mg / ml ) together in the assay diluent to a final concentration of natalizumab of about 100 μg / ml and about a 1 : 10 final dilution of the competition samples ; incubating control samples , screening samples , and competition samples about 1 hour at ambient temperature and washing the plate wells at least once with wash buffer ; incubating the samples in the plate wells between about 60 and 150 minutes at ambient temperature and washing the plate wells at least three times with wash buffer ; adding about 100 μl / plate well of biotinylated - natalizumab diluted to about 1 : 1000 in the assay diluent , incubating the plate for about 60 - 90 min at ambient temperature , and washing the plate wells at least three times with wash buffer ; adding streptavidin - horseradish peroxidase diluted about 1 : 5000 in assay diluent to the samples in plate wells , incubating the plate about 60 - 90 minutes at ambient temperature , and washing the plate at least three times with wash buffer ; adding a sufficient amount of color - producing substrate to the plate wells to visualize antibody binding , developing the plate for several minutes at ambient temperature , stopping the development by adding 1n h2so4 to the plate wells ; and reading the plate wells thereby obtaining a result . it also is contemplated that the elisa reagents described herein maybe packaged in a kit that may be produced commercially to detect the presence of and / or measure an antibody that specifically binds a vla - 4 binding antibody in a biological sample as described herein . it will also be understood that the controls for use in the invention may include , in addition to predetermined values ( such as clinically significant threshold values identified as described herein for a particular therapeutic protein ), samples of materials tested in parallel with the experimental materials . examples include control samples ( e . g ., generated through manufacture ) to be tested in parallel with the experimental samples . as used herein , a biological sample may be , but is not limited to , any of the following : a body fluid of a subject including , blood , serum , plasma , urine , saliva , pleural effusions , stool , synovial fluid , cerebral spinal fluid , mucus , and tissue infiltrations . preferred body fluids include blood , plasma , and serum . as used herein , biological samples may be obtained using methods well known to those of ordinary skill in the related medical arts . a biological sample may be obtained directly from a subject or may be obtained from cell , tissue , or other culture . a biological sample may be fresh or may have been stored under suitable conditions ( e . g ., frozen , chilled , etc .) prior to use in methods of the invention . it should be appreciated that a biological sample may be obtained from a subject at different time intervals after the administration of a therapeutic agent . however , a therapeutic agent may have a characteristic in vivo half - life , and the amount of free therapeutic agent that is present in a biological sample typically will decrease as a function of time after administration of the agent to the subject . the presence of free therapeutic agent ( unlabeled and non - immobilized ) in a biological sample may interfere with binding and detection reactions of the invention . accordingly , biological samples should be obtained as long as possible after a therapeutic administration , for example at a “ trough ” in the treatment cycle . a “ trough ” represents the lowest amounts of free therapeutic agent that are present in a subject during a treatment cycle . a trough may occur , for example , long after one therapeutic administration and soon before a subsequent therapeutic administration . it should be appreciated that the timing of the trough may be influenced by many factors , including the amount of agent that is administered , the half - life of the agent , the frequency of administration , etc . for example , a monthly administration of a vla - 4 binding antibody ( e . g ., 300 mg of natalizumab ) results in a trough at about 30 days after one administration and immediately before a subsequent administration . however , it should be appreciated that assays of the invention may be performed on samples taken at different times after treatment administration provided that the assays are relatively insensitive to , or account for , the presence of free therapeutic agent in the biological sample . when levels of binding activity are compared for different samples taken at different time points , it may be particularly important to obtain each sample from a similar stage in the treatment cycle ( e . g ., a similar length of time after a therapeutic administration ) so that the results can be interpreted without needing to correct for differences in levels of free therapeutic agent in the biological samples . it should be appreciated that biological samples may be diluted before being assayed ( e . g ., 2 fold , 5 fold , 10 fold , 50 fold , 100 fold , and including higher or lower fold values or any fold value in between ). in one embodiment , a reference sample containing a clinically significant threshold amount of reference antibody may be diluted by the same amount as the biological sample being tested so that the signal obtained for the biological sample can be compared directly to the signal obtained for the reference sample . in some embodiments of the invention , one or more aliquots from a biological sample are used . as used herein , the term “ aliquot ” means a portion or part of the biological sample . in some embodiments , two or more aliquots may be taken from a biological sample obtained from a subject and the aliquots can be tested using methods of the invention to determine the presence of an immune response to a vla - 4 binding antibody in the subject . for example , two substantially equivalent aliquots can be taken from a biological sample obtained from a subject to whom a vla - 4 binding antibody ( e . g . natalizumab ) has been administered , and a level of soluble binding activity can be detected in one aliquot ( e . g . a “ first ” aliquot ) can be determined . additionally , the other aliquot ( e . g . the “ second ” aliquot ) may be assessed using the methods of the invention to determine whether the soluble binding activity detected in the first aliquot , which would also be present in the second aliquot by virtue of their common sample origin , is an antibody that specifically binds a vla - 4 binding antibody . in some embodiments , if at least a threshold level of binding is present in the first aliquot and the soluble binding activity is determined to be the activity of an antibody that specifically binds a vla - 4 binding antibody , it identifies that an immune response to the vla - 4 binding antibody is present in the subject . aspects of the invention relate to detection assay ( s ) for identifying and / or monitoring an immune response to one or more therapeutic vla - 4 binding antibodies that are administered to a subject . in certain aspects of the invention , a detection assay involves both immobilization and detection moieties . in some embodiments , a detection assay also may include a competition moiety . as described herein , an immobilization moiety may be used to immobilize an induced antibody ( e . g ., a serum antibody ) that binds to the vla - 4 binding antibody . a detection moiety may be used to detect the immobilized antibody . a competition moiety may be used to compete with the either the immobilization and / or detection moiety for binding to the induced antibody in order to determine the specificity of binding to the induced antibody . the immobilization and detection moieties may bind independently to one or more antibodies that are characteristic of an immune response to a vla - 4 binding antibody . accordingly , the immobilization and detection moieties may be the same vla - 4 binding antibody that was administered to the subject ( e . g ., the immobilization moiety may be an immobilized form of the therapeutic vla - 4 binding antibody that was administered to the subject , and the detection moiety may be a labeled form of the therapeutic vla - 4 binding antibody that was administered to the subject ). however , in other embodiments , each of the immobilization and detection moieties independently may be variants of the therapeutic vla - 4 binding antibody that was administered to the subject , provided that the immobilization and detection moieties bind with suitable affinity to detect one or more induced antibodies ( e . g ., serum antibodies ) against the therapeutic vla - 4 binding antibody . the competition moiety is typically a soluble unlabeled ( or differentially labeled ) form of the immobilization or detection moiety . however , the competition moiety may be a variant of the immobilization or detection moiety , provided that it competes sufficiently for binding to the therapeutic vla - 4 binding antibody to determine the specificity of the binding activity detected in the assay . according to aspects of the invention , any one or more vla - 4 binding antibodies ( including natalizumab and / or related vla - 4 binding antibodies ) may be used therapeutically . accordingly , any one or more of the vla - 4 binding antibodies may be used as immobilization , detection , and / or competition moieties in a detection assay of the invention . in one embodiment , a vla - 4 binding antibody may be an igg antibody ( e . g ., an igg4 antibody ). in another embodiment , a vla - 4 binding antibody may be polyclonal or monoclonal . in yet another embodiment , a vla - 4 binding antibody may be a humanized version of a murine antibody . natalizumab and related vla - 4 binding antibodies are described , e . g ., in u . s . pat . no . 5 , 840 , 299 . mab 21 . 6 and hp1 / 2 are exemplary murine monoclonal antibodies that bind vla - 4 . natalizumab is a humanized version of murine mab 21 . 6 ( see , e . g ., u . s . pat . no . 5 , 840 , 299 ). a humanized version of hp1 / 2 has also been described ( see , e . g ., u . s . pat . no . 6 , 602 , 503 ). several additional vla - 4 binding monoclonal antibodies , such as hp2 / 1 , hp2 / 4 , l25 and p4c2 , are described ( e . g ., in u . s . pat . no . 6 , 602 , 503 ; sanchez - madrid et al ., 1986 eur . j . immunol ., 16 : 1343 - 1349 ; hemler et al ., 1987 j . biol . chem . 2 : 11478 - 11485 ; issekutz and wykretowicz , 1991 , j . immunol ., 147 : 109 ( ta - 2 mab ); pulido et al ., 1991 j . biol . chem ., 266 ( 16 ): 10241 - 10245 ; and u . s . pat . no . 5 , 888 , 507 ). many useful vla - 4 binding antibodies interact with vla - 4 on cells , e . g ., lymphocytes , but do not cause cell aggregation . however , other anti - vla - 4 binding antibodies have been observed to cause such aggregation . hp1 / 2 does not cause cell aggregation . the hp1 / 2 mab ( sanchez - madrid et al ., 1986 eur . j . immunol ., 16 : 1343 - 1349 ) has an extremely high potency , blocks vla - 4 interaction with both vcam1 and fibronectin , and has the specificity for epitope b on vla - 4 . this antibody and other b epitope - specific antibodies ( such as b1 or b2 epitope binding antibodies ; pulido et al ., 1991 j . biol . chem ., 266 ( 16 ): 10241 - 10245 ) represent one class of useful vla - 4 binding antibodies . an exemplary vla - 4 binding antibody has one or more cdrs , e . g ., all three hc cdrs and / or all three lc cdrs of a particular antibody disclosed herein , or cdrs that are , in sum , at least 80 , 85 , 90 , 92 , 94 , 95 , 96 , 97 , 98 , or 99 % identical to such an antibody , e . g ., natalizumab . in one embodiment , the h1 and h2 hypervariable loops have the same canonical structure as those of an antibody described herein . in one embodiment , the l1 and l2 hypervariable loops have the same canonical structure as those of an antibody described herein . in one embodiment , the amino acid sequence of the hc and / or lc variable domain sequence is at least 70 , 80 , 85 , 90 , 92 , 95 , 97 , 98 , 99 , or 100 % identical to the amino acid sequence of the hc and / or lc variable domain of an antibody described herein , e . g ., natalizumab . the amino acid sequence of the hc and / or lc variable domain sequence can differ by at least one amino acid , but no more than ten , eight , six , five , four , three , or two amino acids from the corresponding sequence of an antibody described herein , e . g ., natalizumab . for example , the differences may be primarily or entirely in the framework regions . the amino acid sequences of the hc and lc variable domain sequences can be encoded by a sequence that hybridizes under high stringency conditions to a nucleic acid sequence described herein or one that encodes a variable domain or to a nucleic acid encoding an amino acid sequence described herein . in one embodiment , the amino acid sequences of one or more framework regions ( e . g ., fr1 , fr2 , fr3 , and / or fr4 ) of the hc and / or lc variable domain are at least 70 , 80 , 85 , 90 , 92 , 95 , 97 , 98 , 99 , or 100 % identical to corresponding framework regions of the hc and lc variable domains of an antibody described herein . in one embodiment , one or more heavy or light chain framework regions ( e . g ., hc fr1 , fr2 , and fr3 ) are at least 70 , 80 , 85 , 90 , 95 , 96 , 97 , 98 , or 100 % identical to the sequence of corresponding framework regions from a human germline antibody . calculations of “ homology ” or “ sequence identity ” between two sequences ( the terms are used interchangeably herein ) are performed as follows . the sequences are aligned for optimal comparison purposes ( e . g ., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non - homologous sequences can be disregarded for comparison purposes ). the optimal alignment is determined as the best score using the gap program in the gcg software package with a blossum 62 scoring matrix with a gap penalty of 12 , a gap extend penalty of 4 , and a frameshift gap penalty of 5 . the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared . when a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence , then the molecules are identical at that position ( as used herein amino acid or nucleic acid “ identity ” is equivalent to amino acid or nucleic acid “ homology ”). the percent identity between the two sequences is a function of the number of identical positions shared by the sequences . the skilled artisan will realize that conservative amino acid substitutions may be made in vla - 4 binding antibodies to provide functionally equivalent variants , of the antibodies , i . e ., the variants retain the functional capabilities of the vla - 4 polypeptides . as used herein , a “ conservative amino acid substitution ” refers to an amino acid substitution that does not alter the relative charge or size characteristics of the protein in which the amino acid substitution is made . variants can be prepared according to methods for altering polypeptide sequence known to one of ordinary skill in the art such as are found in references that compile such methods , e . g . molecular cloning : a laboratory manual , j . sambrook , et al ., eds ., second edition , cold spring harbor laboratory press , cold spring harbor , n . y ., 1989 , or current protocols in molecular biology , f . m . ausubel , et al ., eds ., john wiley & amp ; sons , inc ., new york . exemplary functionally equivalent variants of vla - 4 binding antibodies include conservative amino acid substitutions of in the amino acid sequences of proteins disclosed herein . conservative substitutions of amino acids include substitutions made amongst amino acids within the following groups : ( a ) m , i , l , v ; ( b ) f , y , w ; ( e ) k , r , h ; ( d ) a , g ; ( e ) s , t ; ( f ) q , n ; and ( g ) e , d . as used herein , the term “ hybridizes under high stringency conditions ” describes conditions for hybridization and washing . guidance for performing hybridization reactions can be found in current protocols in molecular biology , john wiley & amp ; sons , n . y . ( 1989 ), 6 . 3 . 1 - 6 . 3 . 6 , which is incorporated by reference . aqueous and nonaqueous methods are described in that reference and either can be used . high stringency hybridization conditions include hybridization in 6 × ssc at about 45 ° c ., followed by one or more washes in 0 . 2 × ssc , 0 . 1 % sds at 65 ° c ., or substantially similar conditions . antibodies can be tested for a functional property , e . g ., vla - 4 binding , e . g ., as described in u . s . pat . no . 6 , 602 , 503 . antibodies that bind to vla - 4 can be generated by immunization , e . g ., using an animal . all or part of vla - 4 can be used as an immunogen . for example , the extracellular region of the alpha - 4 subunit can be used as immunogen . in one embodiment , the immunized animal contains immunoglobulin producing cells with natural , human , or partially human immunoglobulin loci . in one embodiment , the non - human , animal includes at least a part of a human immunoglobulin gene . for example , it is possible to engineer mouse strains deficient in mouse antibody production with large fragments of the human ig loci . using the hybridoma technology , antigen - specific monoclonal antibodies derived from the genes with the desired specificity may be produced and selected . see , e . g ., xenomouse ™, green et al . nature genetics 7 : 13 - 21 ( 1994 ), us published patent application no . 2003 - 0070185 , u . s . pat . no . 5 , 789 , 650 , and wo 96 / 34096 . non - human antibodies to vla - 4 can also be produced , e . g ., in a rodent . the non - human antibody can be humanized , e . g ., as described in u . s . pat . no . 6 , 602 , 503 , ep 239 400 , u . s . pat . no . 5 , 693 , 761 , and u . s . pat . no . 6 , 407 , 213 . ep 239 400 ( winter et al .) describes altering antibodies by substitution ( within a given variable region ) of their complementarity determining regions ( cdrs ) for one species with those from another . cdr - substituted antibodies are predicted to be less likely to elicit an immune response in humans compared to true chimeric antibodies because the cdr - substituted antibodies contain considerably less non - human components . ( riechmann et al ., 1988 , nature 332 , 323 - 327 ; verhoeyen et al ., 1988 , science 239 , 1534 - 1536 ). typically , cdrs of a murine antibody substituted into the corresponding regions in a human antibody by using recombinant nucleic acid technology to produce sequences encoding the desired substituted antibody . human constant region gene segments of the desired isotype ( usually gamma i for ch and kappa for cl ) can be added and the humanized heavy and light chain genes are co - expressed in mammalian cells to produce soluble humanized antibody . queen et al ., 1989 proc natl acad sci usa . december ; 86 ( 24 ): 10029 - 33 and wo 90 / 07861 have described a process that includes choosing human v framework regions by computer analysis for optimal protein sequence homology to the v region framework of the original murine antibody , and modeling the tertiary structure of the murine v region to visualize framework amino acid residues which are likely to interact with the murine cdrs . these murine amino acid residues are then superimposed on the homologous human framework . see also u . s . pat . nos . 5 , 693 , 762 ; 5 , 693 , 761 ; 5 , 585 , 089 ; and 5 , 530 , 101 . tempest et al ., 1991 , biotechnology 9 , 266 - 271 ) utilize , as standard , the v region frameworks derived from newm and rei heavy and light chains respectively for cdr - grafting without radical introduction of mouse residues . an advantage of using the tempest et al ., approach to construct newm and rei based humanized antibodies is that the three - dimensional structures of newm and rei variable regions are known from x - ray crystallography and thus specific interactions between cdrs and v region framework residues can be modeled . non - human antibodies can be modified to include substitutions that insert human immunoglobulin sequences , e . g ., consensus human amino acid residues at particular positions , e . g ., at one or more of the following positions ( preferably at least five , ten , twelve , or all ): ( in the fr of the variable domain of the light chain ) 4l , 35l , 36l , 38l , 43l , 44l , 58l , 46l , 62l , 63l , 64l , 65l , 66l , 67l , 68l , 69l , 70l , 71l , 73l , 85l , 87l , 98l , and / or ( in the fr of the variable domain of the heavy chain ) 2h , 4h , 24h , 36h , 37h , 39h , 43h , 45h , 49h , 58h , 60h , 67h , 68h , 69h , 70h , 73h , 74h , 75h , 78h , 91h , 92h , 93h , and / or 103h ( according to the kabat numbering ). see , e . g ., u . s . pat . no . 6 , 407 , 213 . as will be apparent to one of ordinary skill in the art , the present invention also provides for f ( ab ′) 2 , fab , fv and fd fragments ; chimeric antibodies in which the fc and / or fr and / or cdr1 and / or cdr2 and / or light chain cdr3 regions have been replaced by homologous human or non - human sequences ; chimeric f ( ab ′) 2 fragment antibodies in which the fr and / or cdr1 and / or cdr2 and / or light chain cdr3 regions have been replaced by homologous human or non - human sequences ; chimeric fab fragment antibodies in which the fr and / or cdr1 and / or cdr2 and / or light chain cdr3 regions have been replaced by homologous human or non - human sequences ; and chimeric fd fragment antibodies in which the fr and / or cdr1 and / or cdr2 regions have been replaced by homologous human or non - human sequences . in certain embodiments , a vla - 4 binding antibody may be a vla - 4 single - chain antibody , a single - domain antibody , or a nanobody ™. characteristics of each of these antibody types and methods for their use are well known in the art . nanobodies ™ are the smallest functional fragments of antibodies and are derived from naturally occurring single - chain antibodies ( see ablynx , belgium ; ablynx . com ). nanobody ™ technology was developed following the discovery that camelidae ( camels and llamas ) possess a unique repertoire of fully functional antibodies that lack light chains . nanobody ™ structure consists of a single variable domain ( vhh ), a hinge region , and two constant domains ( ch2 and ch3 ). the cloned and isolated vhh domain is a stable polypeptide harboring the full antigen - binding capacity of the original heavy chain . nanobodies ™ combine the features of conventional antibodies with features of small molecule drugs . nanobodies ™ show high target specificity and low inherent toxicity . additionally , nanobodies ™ are very stable , can be administered by means other than injection , and are easy to manufacture . in certain embodiments , a therapeutic vla - 4 binding antibody , an immobilization moiety , and / or a detection moiety may be a humanized nanobody ™. fully human monoclonal antibodies that bind to vla - 4 can be produced , e . g ., using in vitro - primed human splenocytes , as described by boerner et al ., 1991 , j . immunol ., 147 , 86 - 95 . they may be prepared by repertoire cloning as described by persson et al ., 1991 , proc . nat . acad . sci . usa , 88 : 2432 - 2436 or by huang and stollar , 1991 , j . immunol . methods 141 , 227 - 236 . u . s . pat . no . 5 , 798 , 230 . large nonimmunized human phage display libraries may also be used to isolate high affinity antibodies that can be developed as human therapeutics using standard phage technology ( see , e . g ., vaughan et al , 1996 nat biotechnol . march ; 14 ( 3 ): 309 - 14 ; hoogenboom et al . ( 1998 ) immunotechnology 4 : 1 - 20 ; and hoogenboom et al . ( 2000 ) immunol today 2 : 371 - 8 ; us published patent application no . 2003 - 0232333 ); antibodies can be produced in prokaryotic and eukaryotic cells . in one embodiment , the antibodies ( e . g ., scfvs ) are expressed in a yeast cell such as pichia ( see , e . g ., powers et al . ( 2001 ) j immunol methods . 251 : 123 - 35 ), hanseula , or saccharomyces . in one embodiment , antibodies , particularly full length antibodies , e . g ., iggs , are produced in mammalian cells . exemplary mammalian host cells for recombinant expression include chinese hamster ovary ( cho cells ) ( including dhfr - cho cells , described in urlaub and chasin ( 1980 ) proc . natl . acad . sci . usa 77 : 4216 - 4220 , used with a dhfr selectable marker , e . g ., as described in kaufman and sharp ( 1982 ) mol . biol . 159 : 601 - 621 ), lymphocytic cell lines , e . g ., ns0 myeloma cells and sp2 cells , cos cells , k562 , and a cell from a transgenic animal , e . g ., a transgenic mammal . for example , the cell is a mammary epithelial cell . in addition to the nucleic acid sequence encoding the immunoglobulin domain , the recombinant expression vectors may carry additional sequences , such as sequences that regulate replication of the vector in host cells ( e . g ., origins of replication ) and selectable marker genes . the selectable marker gene facilitates selection of host cells into which the vector has been introduced ( see e . g ., u . s . pat . nos . 4 , 399 , 216 , 4 , 634 , 665 and 5 , 179 , 017 ). exemplary selectable marker genes include the dihydrofolate reductase ( dhfr ) gene ( for use in dhfr - host cells with methotrexate selection / amplification ) and the neo gene ( for g418 selection ). in an exemplary system for recombinant expression of an antibody ( e . g ., a full length antibody or an antigen - binding portion thereof ), a recombinant expression vector encoding both the antibody heavy chain and the antibody light chain is introduced into dhfr - cho cells by calcium phosphate - mediated transfection . within the recombinant expression vector , the antibody heavy and light chain genes are each operatively linked to enhancer / promoter regulatory elements ( e . g ., derived from sv40 , cmv , adenovirus and the like , such as a cmv enhancer / admlp promoter regulatory element or an sv40 enhancer / admlp promoter regulatory element ) to drive high levels of transcription of the genes . the recombinant expression vector also carries a dhfr gene , which allows for selection of cho cells that have been transfected with the vector using methotrexate selection / amplification . the selected transformant host cells are cultured to allow for expression of the antibody heavy and light chains and intact antibody is recovered from the culture medium . standard molecular biology techniques are used to prepare the recombinant expression vector , transfect the host cells , select for transformants , culture the host cells , and recover the antibody from the culture medium . for example , some antibodies can be isolated by affinity chromatography with a protein a or protein g . u . s . pat . no . 6 , 602 , 503 also describes exemplary methods for expressing and purifying a vla - 4 binding antibody . antibodies may also include modifications , e . g ., modifications that alter fc function , e . g ., to decrease or remove interaction with an fc receptor or with c1q , or both . for example , the human igg1 constant region can be mutated at one or more residues , e . g ., one or more of residues 234 and 237 , e . g ., according to the numbering in u . s . pat . no . 5 , 648 , 260 . other exemplary modifications include those described in u . s . pat . no . 5 , 648 , 260 . for some antibodies that include an fc domain , the antibody production system may be designed to synthesize antibodies in which the fc region is glycosylated . for example , the fc domain of igg molecules is glycosylated at asparagine 297 in the ch2 domain . this asparagine is the site for modification with biantennary - type oligosaccharides . this glycosylation participates in effector functions mediated by fcγ receptors and complement c1q ( burton and woof ( 1992 ) adv . immunol . 51 : 1 - 84 ; jefferis et al . ( 1998 ) immunol . rev . 163 : 59 - 76 ). the fc domain can be produced in a mammalian expression system that appropriately glycosylates the residue corresponding to asparagine 297 . the fc domain can also include other eukaryotic post - translational modifications . antibodies can also be produced by a transgenic animal . for example , u . s . pat . no . 5 , 849 , 992 describes a method for expressing an antibody in the mammary gland of a transgenic mammal . a transgene is constructed that includes a milk - specific promoter and nucleic acids encoding the antibody of interest and a signal sequence for secretion . the milk produced by females of such transgenic mammals includes , secreted - therein , the antibody of interest . the antibody can be purified from the milk , or for some applications , used directly . as used herein , the vla - 4 binding antibodies of the invention may be substantially full length vla - 4 binding antibodies or functional fragments thereof . for example , if a fragment of a vla - 4 binding antibody is sufficient to allow specific binding by an antibody that specifically binds a vla - 4 binding antibody it is a functional vla - 4 binding antibody and may be used in the methods and kits of the invention . one of ordinary skill in the art will be able to identify vla - 4 binding antibody fragments and determine whether a vla - 4 binding antibody fragment is a functional vla - 4 binding antibody fragment using only routine procedures and binding assays . thus , descriptions and examples of methods of using immobilized and non - immobilized vla - 4 binding antibodies that are provided herein , also apply to the use of functional immobilized and non - immobilized vla - 4 binding antibody fragments . aspects of the invention include using non - immobilized , anti - therapeutic protein antibodies ( e . g ., vla - 4 binding antibodies ) as detection moieties to assess the presence and / or level of soluble binding activity that is bound to an immobilized antibody against a therapeutic protein ( e . g ., a target vla - 4 binding antibody ). methods to evaluate the presence and / or level of soluble binding activity may include the use of one or more labeled detection moieties ( e . g ., a vla - 4 binding antibody containing or attached to a detectable label ). a detectable label is defined as any moiety that can be detected using an assay . the antibodies and functional antibody fragments of the invention can be coupled to specific labeling agents for detecting binding according to standard coupling procedures . a wide variety of detectable labels can be used , such as those that provide direct detection ( e . g ., a radioactive label , a fluorophore , [ e . g . green fluorescent protein ( gfp ), red fluorescent protein ( rfp ), etc . ], a chromophore , an optical or electron dense label , etc .) or indirect detection ( e . g ., an enzyme tag such as horseradish peroxidase , etc .). non - limiting examples of detectable labels that have been attached to or incorporated into antibodies include : enzymes , radiolabels , fluorescent labels , phosphorescent molecules , chemiluminescent molecules , chromophores , luminescent molecules , photoaffinity molecules , and colored particles or ligands such as biotin , etc . in addition , detection methods of the invention may include electrochemiluminescence methods ( ecl ). a variety of methods may be used to detect a label , depending on the nature of the label and other assay components . labels may be directly detected through optical or electron density , radioactive emissions , non - radiative energy transfers , etc . or indirectly detected with antibody conjugates , streptavidin - biotin conjugates , etc . many additional detectable labels are known in the art , as are methods for their attachment to antibodies . labeled antibodies of the invention may be antibodies that are used in vitro , e . g ., in an immunoassay such as an elisa . such detectably labeled antibodies may be antibodies that have a detectable label incorporated into the antibody or may be antibodies that are linked to a secondary binding ligand and / or to an enzyme ( an enzyme tag ) that will generate a colored product upon contact with a chromogenic substrate . examples of suitable enzymes include urease , alkaline phosphatase , ( horseradish ) hydrogen peroxidase or glucose oxidase . preferred secondary binding ligands are biotin and / or avidin and streptavidin compounds . the use of such labels is well known to those of skill in the art and are described , for example , in u . s . pat . nos . 3 , 817 , 837 ; 3 , 850 , 752 ; 3 , 939 , 350 ; 3 , 996 , 345 ; 4 , 277 , 437 ; 4 , 275 , 149 and 4 , 366 , 241 ; each incorporated herein by reference . numerous methods for the attachment or conjugation of an antibody to its detectable label are known in the art . an attachment method may include the use of a metal chelate complex employing , for example , an organic chelating agent such a diethylenetriaminepentaacetic acid anhydride ( dtpa ); ethylenetriaminetetraacetic acid ; n - chloro - p - toluenesulfonamide ; and / or tetrachloro - 3 . alpha .- 6 . alpha .- diphenylglycouril - 3 attached to the antibody ( u . s . pat . nos . 4 , 472 , 509 and 4 , 938 , 948 , each incorporated herein by reference ). monoclonal antibodies may also be reacted with an enzyme in the presence of a coupling agent such as glutaraldehyde or periodate . antibodies may be labeled with fluorescein markers in the presence of these coupling agents or by reaction with an isothiocyanate . in other embodiments , antibodies may be labeled by derivatization , for example , by selectively introducing sulfhydryl groups in the fc region of the antibody , using reaction conditions that do not alter the antibody recognition site . the detection of the detectable label in an assay of the invention is also referred to herein as detecting the “ signal ”. methods for detecting the signal in an immunoassay are well known in the art . in some important embodiments of the invention , the assay signal can be detected using with a multi - well plate reader ( e . g . microplate reader ) to assess the amount and / or location of a signal . signal detection can be optical detection or other detection means suitable for detecting a detectable label utilized in the invention . additional methods for detecting labels are well known in the art and can be used in methods of the invention . methods of the invention include elisas that have a sensitivity for detecting an antibody that specifically binds to a vla - 4 binding antibody , wherein the sensitivity is at least about 1000 ng , 500 ng , or 50 ng . in preferred embodiments , the elisa sensitivity for detecting an antibody that specifically binds to a vla - 4 binding antibody is at least about 500 ng . in general , the detection of immunocomplex formation may be achieved through the application of numerous approaches . these methods are generally based upon the detection of a label or marker , such as any of those radioactive , fluorescent , biological and enzymatic tags . u . s . patents concerning the use of such labels include u . s . pat . nos . 3 , 817 , 837 ; 3 , 850 , 752 ; 3 , 939 , 350 ; 3 , 996 , 345 ; 4 , 277 , 437 ; 4 , 275 , 149 and 4 , 366 , 241 , each incorporated herein by reference . of course , one may find additional advantages through the use of a secondary binding ligand such as a second antibody and / or a biotin / avidin ligand binding arrangement , as is known in the art . it should be appreciated that techniques described herein to obtain and produce a vla - 4 binding antibody ( e . g ., natalizumab ) also may be used to obtain and produce a reference antibody that binds to the vla - 4 binding antibody with high affinity ( for example , a high affinity natalizumab binding antibody ( e . g ., 12c4 ). the invention also relates , in part , to kits for assaying the presence of an immune response to a vla - 4 binding antibody in a sample . an example of such a kit may include the above - mentioned antibodies including , but not limited to natalizumab or other vla - 4 binding antibody , or a fragment thereof . a kit may include detectably labeled and / or unlabeled antibodies and may include solutions and compounds for detectably labeling an antibody . a kit of the invention may also include one or more of the following components : plates , pipettes , vials , detectable label , solutions ( e . g . blocking buffer , wash buffer , binding solutions , diluent solutions , etc ), positive and / or negative control samples and solutions . a kit of the invention may also include written instructions for the use of the kit for the identification of an immune response to a vla - 4 binding antibody in a biological sample . kits of the invention may also include additional components useful in the performance of positive and / or negative elisa control assays . a kit of the invention may also include equipment such as plate readers and / or robotic instrumentation for use in the methods of the invention . the assay format and design was based upon a bridging enzyme - linked immunosorbent assay ( elisa ). standard reagents and procedures suitable for bridging assays were used . in brief , using standard procedures natalizumab was adsorbed to the surface of microtiter plates followed by a blocking step to minimize non - specific binding of serum antibodies . controls and samples were diluted and added to the wells . using standard procedures , detection of bound anti - natalizumab antibodies was accomplished by incubating the plates with biotin - natalizumab followed by streptavidin - alkaline phosphatase ( sa - ap ). the color development was proportional to the amount of anti - natalizumab antibody bound . natalizumab was diluted to a specific concentration in plate coating buffer was incubated in 96 - well microtiter elisa plates overnight at ambient temperatures . the recommended volume was 100 μl / well . the plates were washed with washing buffer then incubated with blocking buffer at ambient temperatures for & gt ; 1 hr . the volume of blocking buffer was 200 μl / well . the plates were washed with washing buffer and then incubated with quality control and subject ( patient ) samples diluted 1 : 10 in assay diluent with or without added natalizumab ( 100 μg / ml final concentration ) at ambient temperatures for 2 hr ± 15 min . the assay diluent containing added natalizumab represented a confirmatory step . the volume for the assay diluent was 100 μl / well . the plates were then washed in washing buffer , and then incubated with sa - ap at ambient temperatures for 30 - 35 min . the volume for the incubation with sa - ap was 100 μl / well . the plates were then washed in washing buffer , and then incubated with ap substrate , p - nitrophenyl phosphate ( pnpp ) at ambient temperatures for 45 - 50 min . the volume for the incubation in the ap substrate was 100 μl / well . stop solution ( e . g . h2so4 , etc .) was then added directly to the substrate reaction mixture and the optical density ( oc ) was read at 405 nm . for assay acceptance the positive and negative controls had to provide results within a pre - defined value and precision . for the assessment of subject ( patient ) samples results , the samples were judged as negative if their od value fell below the defined negative cut - off quality control sample . samples were also judged negative if their od value fell above the defined negative cut - off quality control sample and the inhibition of the subject ( patient ) sample signal by added natalizumab in the confirmatory step was less than a pre - defined percent . samples were judged positive if their od value fell above the defined negative cut - off quality control sample and the inhibition of the subject ( patient ) sample signal by added natalizumab in the confirmatory step was greater than or equal to a pre - defined percent . a screening assay ( as described above ) was performed on samples from subjects who had been administered natalizumab . the presence of an immune response to a vla - 4 antibody was examined in patients who had undergone natalizumab administration . biological samples from subjects who had been administered natalizumab were tested for the presence of a soluble antibody that specifically binds natalizumab using the methods described in example 1 . the tests included the use of a high affinity mab as a positive control . the high affinity mab detected binding antibodies ( e . g . antibodies that bound natalizumab ) that were present in biological samples from subjects . the negative cut - off level was determined to the lowest concentration that returned acceptable accuracy / precision ( 25 %/ 25 %); 50 ng / ml in 10 % serum . the sensitivity of the mab was 500 ng / ml in neat ( undiluted ) serum . with respect to sensitivity , the mab was determined to detect anti - natalizumab abs but to be insensitive to irrelevant human monoclonal antibodies . the interference with the mab by other molecules or components of the samples was determined to include interference by free drug at an mab : drug ratio of greater than 1 : 2 . fig1 illustrates the effects of free natalizumab interference with the immunoassay for anti - natalizumab antibodies . rheumatoid factor was also found to interfere with the assay . in addition to the screening assay described in examples 1 and 2 , characterization assays to assess binding in the screening assays were also preformed . biological samples from subjects who had been administered natalizumab were tested for the presence of a soluble antibody that specifically binds natalizumab using a flow cytometry blocking assay . a high affinity mab was used as a positive control . the assay detected blocking antibodies . the negative cut - off level for the mab used was determined at 3 - 4 standard deviations above the mean of measured levels in sera obtained from non - dosed patients . there was a 5 % false - positive rate and the sensitivity of the assay was 500 ng / ml of neat serum . the specificity of the mab was tested and the mab was determined to detect anti - natalizumab antibodies but was found to be insensitive to irrelevant human monoclonal antibodies . free - drug interference with the assay was also examined . the assay showed the presence of free - drug interference . results from an assessment of blocking assay interference by free drug are shown in fig2 . the positive results of the screening and blocking assays were compared . there were 217 blocking assay positives and 222 screening assay positives , thus there was a difference of 5 % and a percent concordance of 98 %. accordingly , the screening assay provides an accurate measure of a subject &# 39 ; s immune response to a therapeutic vla - 4 binding antibody . a screening assay ( as described in examples 1 and 2 ) was performed on samples from 625 subjects who had been administered natalizumab . the presence of an immune response to a vla - 4 antibody was examined in patients who had undergone natalizumab administration . incidence of antibodies to natalizumab in the patients examined was : 91 % ( 569 patients ) antibody negative and 9 % ( 56 patients ) “ binding antibody ” positive at any time point with 3 % ( 19 patients ) “ transiently ” positive and 6 % ( 37 patients ) “ persistently ” positive . the transient positive patients had detectable antibodies ( at a concentration of & gt ; 0 . 5 μg / ml ) at a single time point , but negative for antibodies at all other time points . the persistent positive patients had detectable antibodies at two or more time points that were at least 42 days apart , or at a single time point with no follow - up samples tested . fig3 shows the time of first positive results in patients who developed any antibodies . six percent of patients developed “ persistent ” antibodies to natalizumab . over 90 % of persistent - positive patients first had detectable antibodies at week 12 . no subject became positive for persistent antibodies after week 36 . transient - positive patients had detectable antibodies at week 12 , but were subsequently antibody negative . the results were analyzed to determine the presence of an effect of antibodies on the rate of relapse of the original disorder in the patients treated . fig4 illustrates the overall effect of antibodies on relapse rate . the relapse rate was also assessed for subjects with respect to the time elapsed from the administration of the natalizumab . fig5 a - d depict the rate of relapse at 0 - 3 months , 3 - 6 months , 6 - 9 months , and 9 - 12 months respectively . the results indicated that there is no apparent effect of antibodies during the first three months of treatment . from three to six months the “ transient ” antibody - positive patients showed diminution in efficacy of the natalizumab treatment . “ persistent ” antibody - positive patients showed lost of efficiency of natalizumab treatment . from six to twelve months , full efficacy was restored in “ transient ” antibody - positive patients , but not in “ persistent ” antibody - positive patients . accordingly it is important to identify transient antibody - positive patients as a target population for continued vla - 4 binding antibody therapy . those skilled in the art will recognize , or be able to ascertain using no more than routine experimentation , many equivalents to the specific embodiments of the invention described herein . such equivalents are intended to be encompassed by the following claims . all references , including patent documents , disclosed herein are incorporated by reference in their entirety . in case of conflict , the present application , including any definitions herein , will control . the terms and expressions which have been employed are used as terms of description and not of limitation , and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof , it being recognized that various modifications are possible within the scope of the invention .	6
the invention relates to a pneumatic spring system comprising at least the following structural components , specifically a pneumatic spring piston which in particular is made of plastic or aluminum , and which comprises a face area that is arranged opposite the pneumatic spring cover ; a lateral roll - off surface for the pneumatic spring bellows to roll off on , and a base area that is designed in such a way that a multi - chamber system projects into the interior of the pneumatic spring piston ; a first fastening system , which is arranged within the base area of the pneumatic spring piston ; as well as a reinforcement , in particular a longitudinal guiding rod or element with which the base of the pneumatic spring piston is anchored by the means of the first fastening system as well as an additional second fastening system . a pneumatic spring system of said type is described , for example in published patent document ep 0 501 043 b1 ( fig2 ). the pneumatic spring piston , which is referred to also as the roll - off piston or immersion piston , is made of steel , plastic or aluminum , whereby the two last - mentioned materials are increasingly finding preferred use because of their lower weight as compared to steel . furthermore , the multi - chamber system of the pneumatic spring piston comprises a ring chamber in most cases , which extends within the edge zone of the base area , forming an annular outer edge and an inner edge ; and one or a plurality of core chambers defined by bridges , such core chamber or chambers being arranged within the inner edge of the ring chamber . in addition , the pneumatic spring piston has the largest diameter in most cases within the zone of its base area , so that a widening is formed in this way . the pneumatic spring pistons known heretofore are constructed in such a way that they have a plurality of mirror planes in conjunction with a central support body . pneumatic spring pistons that are rotation - symmetrical in relation to the center axis of the piston are known as well . now , two variations exist with respect to the stress acting on the pneumatic spring piston : the pneumatic spring piston is stressed eccentrically , which is the case in particular in conjunction with a longitudinal guiding rod serving as the spring support . this could be accomplished until now in conjunction with the piston construction described above only with the help of a holding plate made of steel , which is secured on the base of the pneumatic spring piston especially when a pneumatic spring piston made of plastic is used . now , the problem of the invention is to provide a pneumatic spring system of the type specified above , in conjunction with which the pneumatic spring piston can be stressed eccentrically while omitting a holding plate and achieving at the same time a reduction of the weight . said problem is solved according to the characterizing part of claim 1 in that the multi - chamber system and the first fastening system are arranged in a way such that only one mirror plane at the most is present vertically in relation to the base of the pneumatic spring piston , namely with respect to the center axis of the piston , with formation of an eccentric support surface for the pneumatic spring piston with direct contact with the spring support . advantageous design variations of the pneumatic spring system as defined by the invention are specified in claims 2 to 27 . now , the invention is explained in the following with the help of exemplified embodiments and by reference to five drawings , in which : fig1 show two particularly advantageous construction variations of the multi - chamber system . fig3 shows a pneumatic spring piston made of plastic , with a metal insert cooperating with a spring support ; fig4 show two different views of a metal insert consisting of a threaded component and a reinforcing rib . the following list of reference numerals and symbols applies in conjunction with said figures : 2 , 2 ′, 2 ″ base area of the pneumatic spring piston 3 , 3 ′, 3 ″ face area of the pneumatic spring piston 4 , 4 ′, 4 ″ roll - off surface of the pneumatic spring piston fig1 shows a pneumatic spring piston 1 with the base 2 , the face 3 , the latter being arranged opposite the pneumatic spring cover , as well as with the lateral roll - off surface 4 , on which the pneumatic spring bellows can roll off . within the zone of its base area 2 , the pneumatic spring piston has its largest diameter , with formation of a widening . furthermore , the base area 2 is designed in such a way that a multi - chamber system projects into the interior of the pneumatic spring piston . the multi - chamber system comprises a ring chamber 5 , which is arranged within the marginal zone of the base area 2 with formation of a ring - shaped outer edge 6 and an inner edge 7 . furthermore , several core chambers 8 are present , said core chambers being defined by bridges and being located within the inner edge 7 . the base area 2 of the pneumatic spring piston has a through - and straight - extending main bridge 9 , which is connected with the center zone of the base area , but which does not extend through the center axis “ s ” of the piston . no central support body is provided within the direct zone of the center axis “ s ” of the piston . furthermore , the base area 2 of the pneumatic spring piston has the two fastening bridges 10 with an area size adequate for receiving the first fastening system 11 . the two fastening bridge connect in this conjunction the outer edge 6 and the inner edge 7 of the ring chamber 5 , specifically with inclusion of the main bridge 9 , forming in this manner the four ring segments a , b , c and d . the main bridge 9 in turn is connected with a system of four bridges extending perpendicular to the main bridge , with formation of the two outer bridges 12 and the two inner bridges 13 . said bridges are arranged in this conjunction with about the same spacing between each other and exclusively extend from the inner wall 7 to the inner wall of the ring chamber 5 . the two outer bridges 12 as well as the main bridge 9 each change in this conjunction with a wide surface area into the fastening bridge 10 . furthermore , the two inner bridges 13 are connected by a transverse bridge 14 , which extends parallel with the main bridge 10 , clamping the center axis “ s ” of the piston . the pneumatic spring piston 1 is constructed in such a way that one single mirror plane “ x ” is present perpendicular to the base area 2 , specifically as opposed to the designs known until now . the pneumatic spring piston 1 ′ according to fig2 is different from the pneumatic spring piston 1 according to fig1 in that the core chambers 8 ′ are designed in another way . a total of four bridges , specifically the two outer bridges 15 and the two inner bridges 16 extend within the inner edge 7 ′ of the ring chamber 5 ′ inclined in relation to the main bridge 9 ′, specifically with formation of a fan - shaped structure . said four bridges extending in the form of a fan merge in this conjunction in the area of the inner edge 7 ′ of the ring chamber 5 ′ in the form of a common meeting point , whereby a head chamber 17 is present within said meeting point . said head chamber is outwardly defined by the inner edge 7 ′ of the ring chamber 5 ′. said head chamber is located about half way between the two fastening bridges 10 ′. furthermore , the bridges extending in the form of a fan are connected with each other by a bridge 18 extending in a curved manner . said bridge extends in this conjunction from the fastening bridge 10 ′ to the fastening bridge . within the area of the two outer bridges 15 , the curved bridge 18 furthermore extends through the main bridge 9 ′, with formation of a total of two areas of intersection . said pneumatic spring piston 1 ′, too , is constructed in such a way that one single mirror plane “ x ” is present perpendicular to the base area 2 ″. furthermore , in the present case , too , no central support body is present within the immediate range of the center axis “ s ” of the piston . fig3 shows a pneumatic spring piston 1 ″ made of plastic , in particular from glass fiber - reinforced plastic , which rests with direct contact on the spring support 19 , which is referred to also as a rocking arm ( or rocker ). an eccentric support surface 20 is formed in this conjunction with respect to the center axis “ s ” of the piston , said support surface being part of the base area 2 ″. said support surface is at the same time the fastening surface because the first fastening system 11 ″ is located within said area . said first fastening system is connected in a fixed manner with a second fastening system ( e . g . a screw ) via a drilled hole 21 located in the spring arm 19 . the main bridge 9 ( fig1 or 9 ′ ( fig2 ) extends in particular parallel with the longitudinal outer edge 22 of the spring support 19 , specifically in a way such that the main bridge is located within the support area 20 of the pneumatic spring piston 1 ″, whereby the edges of the main bridge and the spring support are substantially aligned with each other . the depth of the core chambers 8 ″ amounts to at least ⅔ of the overall height “ h ” of the pneumatic spring piston 1 ″. fig4 and 5 again show details of the first fastening system 11 ″ according to fig3 viewed from two different aspects . in the present case , the first fastening system 11 ″ is a metal insert , which in turn consists of a threaded part 23 and a reinforcing rib 24 . furthermore , the reinforcing rib has a number of horizontally extending bores 25 . the fastening system 11 ″ is particularly suited for a pneumatic spring piston made of plastic , whereby the plastic extends through the bores 25 in a material - locked matter . it is possible also to provide for holding ribs instead of using such bores . the fastening system 11 ″ offers the advantage that the stress within the environment of the threaded part 23 is reduced . furthermore , the reinforcing rib 24 provides for a reduction in the deformation of the piston , which is important when a plastic material us used . this assures a long useful life of the pneumatic spring system . if necessary , it is possible also to employ as the first fastening system simple threaded bores or threaded bushes for receiving the second fastening system , especially when a pneumatic spring piston made of metallic materials is used .	5
the embodiment shown in fig1 - 6 of the drawings is intended for application to any of various standard or existing rotary lawn mowers of the type shown diagrammatically in fig1 . such lawn mower comprises a wheeled housing 10 in the shape of an inverted pan having a top deck 11 which carries a vertical - shaft engine 10 bolted to the deck about the edges of a central opening , with the engine shaft projecting downward centrally of the housing and supporting a blade 15 . the engine is desirably a conventional variable - speed internal combustion engine provided with a manually operable speed control or throttle 14 movable between an idling position and a mowing position . the engine may also have conventional controls for varying the idle speed and the mowing speed , and the mower may have powered propulsion . the mower shown is a manual - propulsion mower having a handle 16 provided with a &# 34 ; deadman &# 34 ; lever 18 . the deadman lever 18 is connected by a main cable 20 in a sheath 21 to a coupler 22 which connects the main cable 20 both to a throttle cable 24 in a sheath 25 and a brake cable 26 in a sheath 27 . when the deadman lever 18 is in its released position as shown in fig1 the throttle 14 is in the idle position and the brake cable is in a position to apply the brake to stop the blade . to operate the mower , the operator pulls the deadman lever 18 upward against the handle 16 and holds it there . this moves the throttle 14 to its mowing position and accelerates the engine to mowing speed , which may be controlled by a governor . this also pulls the brake cable 26 to release the brake on the blade and permit the engine to drive the blade 15 at cutting speed . in the blade mounting and control arrangement shown in fig2 - 6 , the shaft 30 of the engine 10 projects downward below the deck 11 of the mower housing . the shaft carries a hub 32 keyed to it by a key 34 . the large upper or main portion of the hub 32 contains a bore to fit the shaft 30 , and such bore terminates at a radial wall 36 which forms an inner face 37 to bear against the end face of the shaft 30 . below such wall , the hub is of reduced diameter and forms a bearing sleeve 38 which terminates at its upper end at an outward facing shoulder 40 . the driven portion of the assembly comprises a driven drum element 42 having an outer cylindrical wall forming a drum 44 adapted to be engaged from within by centrifugal clutch shoes 46 and from outside by a brake band 48 . the lower end of the cylindrical drum 44 is joined to a radial web 50 extending inward to an inner cylindrical bearing ring 52 which lies within the axial length of the drum 44 and carries an in - turned lip or flange 54 at its end . a ball bearing has its inner race 56 mounted on the bearing sleeve 38 , preferably with a press - fit , and has its outer race 58 mounted in the bearing ring 52 of the driven drum element , also preferably with a press - fit . the web 50 of the driven drum element carries a pair of bolts 60 having knurled upper portions pressed into locking engagement with the metal of the web 50 . a blade mounting and retaining plate 62 is mounted against the lower face of the web 50 and is normally retained thereon by a tight fitting relation with the bolts 60 . such plate extends inward into underlapping relation with the outer race 58 of the ball bearing , to positively secure the same in the bearing ring 52 and against the lip 54 when a blade 15 is bolted against the mounting plate 62 . the hub is secured on the shaft 30 by a bolt 64 threaded into a bore in the shaft . the head of the bolt engages a pilot washer 66 which is of sufficient size to engage the inner race 56 of the ball bearing , and thrust that race against the shoulder 40 on the hub 32 , and thereby clamp the bearing race and the hub to the end of the shaft 30 . the compact arrangement provides a firm support from the shaft 30 for the driven drum element and blade which are supported by the ball bearing , and allows free relative rotation between the shaft and the driven assembly . the centrifugal clutch shoes 46 are mounted on a carrier plate 70 fixed , as with splines , on the large upper portion of the hub 32 . desirably and as shown , each clutch shoe 46 is made of two complementary formed metal parts which are riveted together by rivets 71 and which define between them a flat tapered radial socket 72 for the reception of driving lugs 74 on the shoe carrier plate 70 . the sockets 72 are desirably displaced from the circumferential centers of the shoes 46 toward the leading ends thereof , so as to give the shoes a soft engaging action and prevent the clutch from locking or grabbing . the two shoes are interconnected at their ends by springs 76 , engaged in holes formed in the ends of the shoes , and the springs are of calibrated characteristics to control the clutch engagement and disengagement speeds . rotary mower engines are commonly built with a light weight flywheel and air blower at the top , and rely for a major portion of their required flywheel mass on the presence of a mower blade which is fixed to and rotates with the engine shaft . since the present invention requires the engine shaft to rotate independently of the mower blade , if an engine of this character is utilized it is desirable to provide additional flywheel mass . this is done by mounting a flywheel 80 on the upper portion of the hub 32 . the flywheel may be fixed on the hub in any convenient way , as by engaging it with splines 82 on the hub and staking it in place . when the engine used is provided with its own heavy flywheel , the flywheel 80 may be omitted . the blade mounting and driving assembly described is located below the mower deck and at the center of the blade cutting space . to protect it from contamination , it is desirably enclosed by a stamped bowl 84 . the bowl has a peripheral mounting flange 86 , which desirably rests against the top surface of the deck 11 of the mower and between that deck and the mounting flange 13 of the engine 10 . the flange 86 is relatively thin , so that it does not significantly change the position of the engine 10 or its shaft 30 , and its engagement against the top face of the deck 11 provides for accurate location relative to the reference surfaces of the deck and motor mounting . the bowl 84 has a generally cylindrical upper portion 86 of sufficient diameter to clear the flywheel 80 , and this is joined at its lower edge to a horizontal radial wall forming a platform 88 which is used for mounting the brake assembly . the inner edge of the platform 88 joins a downward extending section 90 which is joined to a generally radial annular portion 92 having a lip 94 at its inner edge in close running proximity with the lower edge of the drum 44 . the brake comprises a band 96 having a lining 98 of a length to engage the outer face of the drum 44 over about three - fourths of its circumference . the ends of the band 96 extend beyond the ends of the lining 98 and are turned back upon themselves to form an anchor loop 100 engaging an anchoring pin 102 and a loop 104 for engaging an actuating pin 106 . as shown in fig5 the ends of the band are bifurcated . the loop 100 at the fixed end of the band 96 contains a central narrow slot 108 , while the forward loop 104 at the free end of the band has a wider slot 110 formed between a lower tongue 103 of the same width as the lower tongue of the loop 100 , and an upper narrower tongue 105 spaced above the lower tongue 103 . the brake is supported by a brake mounting plate 112 , mounted on the platform 88 of the bowl 84 , and fixed thereto by rivets 114 . as shown in fig3 the brake mounting plate 112 is a generally arcuate plate with an outer portion which overlies the platform 88 and an inner portion which projects inward in generally parallel - spaced relation with the annular lower portion 92 of the bowl 84 so as to define a brake clearance space between itself and that portion . the shaft 30 and the clutch shoes 46 rotate clockwise as shown in fig3 . the clockwise end of the brake mounting plate 112 , shown to the right in fig3 and 5 , lies in the central slot 108 of the fixed end 100 of the brake band , and that end is anchored to the plate 112 by the anchor pin 102 . as shown in fig5 the pin 102 has a head on its lower end which is held against escape by the underlying portion 92 of the bowl 84 . the loop 104 at the opposite end of the brake band is engaged about an actuating or draw pin 106 . such pin has a groove intermediate its ends , and is held in place by engagement of a spring hook 116 in such groove . the hook is at the end of a tension spring 118 stretched between the draw pin 106 and an up - turned ear 120 near the opposite end of the brake mounting plate 112 . the spring 118 pulls the brake band 96 into engagement with the drum 44 so that the brake is normally in applied position . to prevent the spring from moving into contact with the drum when the brake is released , a guard finger 122 is bent up from the inner edge of the mounting plate 112 and lies against the side of the spring 118 . for releasing the brake , the draw pin 106 is connected by a link 124 to a crank pin 126 on a crank wheel 128 rotatably mounted by a pivot stud 130 on the brake mounting plate 112 . as shown in fig6 the crank wheel 128 is formed with a peripheral series of oppositely offset lugs 132 which together define a circumferential groove , and with an anchor socket 134 connected to the groove . the brake control cable 26 is engaged in the groove and has a cross pin 136 fixed to its end and received in the socket 134 . the sheath 27 of the cable 26 is anchored to an ear 29 bent up from the outer edge of the plate 112 , so as to transmit cable reaction to that plate . when the brake cable 26 is pulled by the deadman lever 18 , it rotates the crank wheel 128 from the braking position shown in fig3 to the release position shown in fig4 and this acts through the link 124 to pull the free end of the brake band against the spring pressure and releases the brake band from the drum 44 . the actuating pin 106 at the movable end of the brake band extends through a slot 136 &# 39 ; and rides in that slot as a guide during its movement between braking and release positions . the counterclockwise end of such slot 136 &# 39 ; is positioned to form a stop 138 which stops the travel of the pin 106 at the point shown in fig4 at which the crank pin 126 is close to but spaced a short distance from a dead center position . in fig4 the dead center position is indicated by the center line x -- x . the position of the crank pin is desirably in the range of from 4 ° to 15 ° before dead center and preferably between 6 ° and 10 ° from dead center . this shortens the effective lever arm of the torque exerted on the crank wheel by the spring in relation to the lever arm of the torque exerted by the cable 26 , so that when the brake is in released position , spring force is taken almost entirely by the crank wheel 128 and its pivot stud 130 , and only a small portion of such force , from 10 % to 15 %, is exerted on the brake cable 26 and through it to the deadman lever 18 . accordingly , the deadman lever 18 can be easily held in operating position , but when released , will be promptly pulled by the spring 118 to its deadman position in which the brake is applied and the engine throttled to idle condition . operation of the embodiment of fig1 - 6 is as follows : with the deadman lever 18 in its released or deadman position as shown in fig1 the engine throttle 14 is in engine idling position and the blade control cable 26 is slack and extended as shown in fig3 and the crank pin 126 and link 124 are in slack position , so that the spring 118 acts to pull the brake band into applied engagement with the drum 44 . with the engine at rest , the clutch shoes 46 are retracted by the springs 76 so that they are free from the drum 44 and permit the hub 32 and the engine shaft 30 to rotate freely while the mower blade 15 is held stationary by the brake . under these conditions , the engine can be started and run at idle speed , while the drum 44 is positively held against rotation by the brake and the blade is thus held stopped . to actuate the blade , the deadman lever 18 is swung up against the mower handle 16 and held in that actuated position . this pulls the brake cable 26 through its actuating movement so that it rotates the crank wheel 128 from the slack position shown in fig3 to the actuated position shown in fig4 . the link 124 pulls the free end of the band against spring pressure to released position and the drum 44 is then free to rotate . the deadman lever also pulls the throttle cable 14 , and this accelerates the engine and causes the shoes 46 to move by centrifugal force against the inside of that drum 44 to clutch that drum to the engine shaft 30 . the blade 15 is then driven at mowing speed . in the event the blade becomes overloaded with heavy grass and is slowed , the reduced rotational speed will reduce the clutching action of the shoes 46 and allow the engine to continue running . even if the blade is completely stopped , the clutch will release sufficiently to allow the engine to continue running , and it is only necessary to back the mower off from the heavy grass and it will then clear itself and return to mowing speed and condition . if and when the deadman lever 18 is released , the spring 118 acts through the linkage and cable to pull the brake band to applied position as shown in fig3 . the spring pulls the link 124 to rotate the crank wheel 128 counterclockwise from the position of fig4 to that of fig3 and pulls the control cable 26 through its sheath 27 , and this in turn pulls the deadman lever 18 to its released position . movement of the cable 26 also moves the throttle cable 24 and moves the throttle 14 to idle position . the engine then decelerates , aided by the brake , and the clutch shoes 46 are retracted by their springs 76 to declutch the shaft 30 from the drum 44 , and allow the engine to run freely at idle speed while the drum and blade are braked to a stop . in the modification shown in fig7 and 8 , the blade 215 is bolted directly to a drum 242 which is welded to a hub 232 keyed to the engine shaft 230 . there is no releasable clutch between the shaft and the drum . the drum is surrounded by a brake band 248 which is mounted and actuated by mechanism identical with that shown in fig3 , and 6 , except for the addition of an ignition shorting contact 250 mounted on and insulated from a supporting bracket 252 held by one of the rivets 214 by which the brake mounting plate 212 is fixed to the bowl . an ignition shorting wire 254 is connected between such contact and the engine spark plug circuit . the shorting contact 250 lies in the path of the movable end loop 204 of the brake band , in a position such that when the brake is applied , that loop engages the contact 250 and connects that contact to ground . this grounds out the ignition of the engine , and kills the engine . the operation of the grounding contact is similar to that disclosed in the coates u . s . pat . no . 3 , 228 , 177 of jan . 11 , 1966 . operation of this modification is as follows : the brake control cable 226 is connected to a deadman lever on the mower handle as in fig1 . the brake is normally engaged by the action of the spring 218 , and the blade is held stationary by the brake . this also holds the engine stationary , and it cannot be started until the deadman lever is pulled to release position . when the deadman lever is pulled to its running position , this pulls the cable 226 to actuate the crank wheel 228 and link 224 and release the brake band . the engine can then be started , and directly drive the blade 215 . the mower can then be operated in the usual manner so long as the deadman lever is held in running position . when that lever is released , the brake is automatically applied by the spring 218 , and this carries the movable end of the brake band into engagement with the grounding contact 250 , and this grounds the ignition of the engine and stops the engine .	8
the present invention is arranged such that , during printing , paper is fed by a capstan roller , and during paper feeding , paper is fed at least by a platen roller , and the paper is caused to slide relatively over the platen roller . therefore , when an uneven slack has occurred between the right - and left - hand sides of the paper between a capstan roller and the platen roller , such slack of the paper is eliminated by causing the paper to slide over the platen roller during paper feeding . referring now to the accompanying drawings , description will be given of the preferred embodiments of the present invention . fig3 a and 3b are diagrams schematically illustrating paper feeding and printing sections of a printer in accordance with a first embodiment of the present invention . first , at the time of paper feeding , as shown in fig3 a , paper 25 is fed by an amount corresponding to one image plane from a paper holder 26 in the direction of the arrow a by the counterclockwise rotational driving forces of a pinch roller 4 and a platen roller 6a . at this time , a printing head 19 is located at a position spaced apart a relatively large distance from the platen roller 6a , an ink film 27 remains stopped , and printing is not effected . in order to prevent paper slackness between the capstan roller 5 and the platen roller 6a , the outside diameter of the platen roller 6a is made greater than a theoretical value by a very small amount , and the platen roller 6a is thereby adapted to feed the paper by an amount several millimeters greater than an amount of feeding by the capstan roller 5 . in addition , in this embodiment , the platen roller 6a is so arranged that its surface has a lower coefficient of sliding friction than that of the conventional platen roller 6 , and there is provided a paper feed roller for bringing the paper into contact with the platen roller 6a at a fixed winding angle . for this reason , the surface of the platen roller 6a is coated with a teflon - based resin material . incidentally , in fig3 a , reference numeral 28 denotes an ink film holder , while numeral 29 denotes an ink film takeup holder . at the time of printing , as shown in fig3 b , the platen roller 6a and the pinch roller 4 rotate clockwise , and the paper 25 is unwound by the amount of one image plane in the direction of the arrow b . at this time , the head 19 is in contact with the platen roller 6a the ink film holder 28 and the ink film takeup holder 29 rotate counterclockwise , and the ink film 27 is unwound in the direction of the arrow b . subsequently , heat is applied from the head 19 to the ink film 27 , and predetermined printing is effected on the paper 25 . yellow , magenta , and cyan are arranged sequentially within each image plane , and color printing is carried out by repeating the above - described operation three times . fig4 a and 4b are top plan views schematically illustrating a heat transfer color printer in accordance with an embodiment of the present invention . first , the paper 25 is fed forward while being clamped by the pinch roller 4 and the capstan roller 5 . at this time , the platen roller 6a is rotated by a one - way clutch 35 in synchronization with the capstan roller 5 via gears 32 , 33 and 34 , and the amount of the paper 25 fed by the platen roller 6a is greater than that fed by the pinch roller 4 and the capstan roller 5 to the extent that the diameter of the platen roller 6a is made greater . a pressing force of the paper feed roller 10 acting on the paper 25 helps to feed the paper 25 further by applying tension thereon . the slack of the paper 25 due to slippage of the paper 25 over the platen roller 6a is thereby eliminated . subsequently , the head 19 is brought into contact with the platen roller 6a , and as the motor 36 is rotated reversely , the paper 25 is fed backward while being pinched between the capstan roller 5 and the pinch roller 4 , and printing is then carried out . in this embodiment , by virtue of the above - described arrangement , as shown in fig4 a , if a greater amount of slack has occurred on the right - hand side , as viewed in the drawing , between the capstan roller 5 and the platen roller 6a , the tension on the left - hand side becomes greater than that on the right - hand side . accordingly , a component force a is generated in the direction of the left - hand side by the tension acting on the left - hand side of the paper 25 , and the paper 25 is thereby pulled leftwardly until the slack of the paper 25 is eliminated . in addition , if a greater amount of slack has occurred on the left - hand side , as shown in fig4 b , the paper 25 is pulled rightward by a component force b until the slack is eliminated , and its slack is thus corrected . hence , the correction of the feed path of the paper 25 is effected by allowing the paper 25 to be slid on the platen roller 6a . as has been described above , in accordance with this embodiment , since it is possible to correct the slack of the paper resulting from a degree of non - parallelism of the paper between the rollers , printing is always effected in a favorable state , so that it is possible to provide a high - quality printer . in the case of the above - described embodiment 1 , it is impossible to correct a large degree skew ( meandering ) which occurs when the paper 25 is mounted . therefore , in this embodiment , an arrangement is provided to allow a large degree skew to be corrected first and a small degree skew to be corrected afterwards . fig5 a , 5b and 5c are diagrams schematically illustrating the operation of paper feeding and printing sections of the heat transfer color printer in accordance with this embodiment . first , at the time of the primary paper feeding for correcting a large degree skew , as shown in fig5 a , the pinch roller 4 is located spaced apart a relatively large distance from the capstan roller 5 , and no driving force is imparted to the paper 25 by the capstan roller 5 . consequently , the paper 25 is fed about by an amount corresponding to one fourth of the image plane in the direction of the arrow a by the counterclockwise rotation of the platen roller 6a alone . if the paper 25 slants toward , for instance , the right - hand side with respect to the direction of the arrow a , the tension between the platen roller 6 and the paper holder 26 in the direction of the arrow b is greater on the left - hand side with respect to the direction of the arrow a than on the right - hand side . accordingly , as the platen roller 6a rotates , the paper 25 slidingly moves toward the left - hand side from the right - hand side with respect to the direction of the arrow a in the axial direction of the platen roller 6a . the correction of the feed path of the paper 25 is thus carried out . in addition , even if the paper 25 is set in a slack condition , it is possible to eliminate the slack on the above - described principle . during the secondary paper feeding for correcting a small degree skew , as shown in fig5 b , the pinch roller 4 moves to a position at which it is brought into contact with the capstan roller 5 , and the paper 25 is fed about by three fourths of the image plane in the direction of the arrow a , and the feeding operation of the paper 25 is thereby completed . at this time , the correction described in embodiment 1 is carried out . during printing , in the same way as the conventional example , the paper 25 and the ink film 27 are unwound by one image plane in the direction of the arrow b , and printing on one image plane is effected in the meantime ( see fig5 c ). yellow , magenta , and cyan are arranged on the ink film 27 sequentially on each image plane , and color printing is effected by repeating the above - described operation three times . accordingly , since , upon starting of each paper feeding , the operation shown in fig5 a is carried out , the feed path of the paper 25 is corrected on each such occasion . therefore , printing is always effected in a favorable condition . in particular , since the slack of the paper 25 is caused by the nonuniformity of the diameter of the capstan roller 5 , nonuniform pressing , uneven urging forces of springs disposed at opposite ends of the paper holder 26 , shrinkage of the paper , or the like , the fact that the paper feed path is corrected on the occasion of each printing bears great significance meaning . referring now to fig6 a and 6b , description will now be made of the operation of the lever and the cam which control the operation of the pinch roller 4 and the head 19 . fig6 a is a diagram schematically illustrating a printing head up - down mechanism . as is apparent from the drawing , by virtue of the counterclockwise rotation of a cam 30 and the action of a head holding spring 20c , the head arm 20 which traces the cam 30 by means of a roller 20b moves vertically about a fulcrum 20a as its rotational center , so as to move the head 19 vertically . namely , the head 19 is brought into contact with the platen roller 6 when the roller 20b traces each point 30a , 30b and 30c of the cam 30 the point 30a corresponding to yellow printing , the point 30b to magenta printing , and the point 30c to cyan printing , respectively . fig6 b is a diagram schematically illustrating a pinch roller opening and closing mechanism . as is apparent from the drawing , by virtue of the counterclockwise rotation of a cam 31 and the action of a spring 8c , the pinch lever 8 which traces the cam 31 by means of a roller 8b moves vertically about a fulcrum 8a as its rotational center , and the gap between the pinch roller 4 and the capstan roller 5 is thereby opened and closed . namely , the gap between the pinch roller 4 and the capstan roller 5 is opened at a point 31a , but is closed at the other points . the cams 30 and 31 are adapted to rotate concentrically , and operations shown in fig6 a and 6b are effected simultaneously in conjunction with the rotation of the cams 30 , 31 , and the operations described with reference to fig5 a , 5b and 5c are performed . although , in the above - described embodiment , the operation is effected by means of a cam mechanism , it goes without saying that it is possible to realize the operations shown in fig5 a to 5c even if , for instance , a solenoid or the like is used . as has been described above , in accordance with the present invention , since the correction of the feed path of the paper can be performed in advance of printing , printing is always carried out in a favorable condition , so that it is possible to provide a high - quality heat transfer printer .	1
a large number of experiments were performed , varying the respective concentration of each of the ingredients of a desired direct buffer , including tris - hcl , kcl , dntps , bsa , amplitaq gold polymerase , mgcl2 , and single stranded binding protein ( ssb ). these experiments used , for example , humic acid as a mimic for the inhibitors typically present in difficult to analyze samples of biological material , and hence served as an easy to produce proxy for crude samples . the results of these experiments yielded the following formulations . in some embodiments , the present teachings provide a direct buffer comprising tris - hcl at 10 - 16 mm , kcl at 25 - 75 mm , dntps at 200 - 400 um each dntp , bsa at 160 - 960 ug / ml , amplitaq gold polymerase at 2u - 8u , mgcl2 at 1 . 25 - 2 . 2 mm , ssb at 20 ng / ul or higher . in some embodiments , the direct buffer comprises tris - hcl at 10 mm ph 8 . 3 , kcl at 50 mm , dntps at 200 um each dntp , bsa at 800 ug / ml , amplitaq gold polymerase at 0 . 16 units / ul , mgcl2 at 1 . 6 mm , and ssb at 60 ng / ul . in some embodiments , the direct buffer further comprises sodium azide , for example at 0 . 2 percent . in some embodiments , the ssb is the t4 gene 32 protein from bacteriophage t4 , commercially available from , for example , ambion , catalog # 2424 . generally , the desired concentration of ssb is 20 - 60 ng / ul . higher concentrations are possible of course , but a ceiling appears at about 60 ng / ul . in some embodiments , the ssb is present at 60 ng / ul . the reagents used in the direct buffer are readily available from commercial suppliers . for example , amplitaq gold is commercially available for applied biosystems . bsa is commercially available from a variety of sources , for example catalog number 10711454001 from roche . fta paper is commercially available from whatman . in some embodiments , the direct buffer comprises a plurality of pcr primer pairs . for example , in some embodiments , the direct buffer comprises 5 primer pairs . in some embodiments , the direct buffer comprises 10 primer pairs . in some embodiments , the direct buffer comprises greater than 10 primer pairs . in some embodiments , the direct buffer does not comprise pcr primer pairs , but rather the pcr primer pairs are added to the eluate after the nucleic acids in the crude sample are liberated with the direct buffer . in a first example , blood was applied to fta paper ( whatman ) and air - dried . a 1 . 2 mm disc punch of fta paper was made and placed into the direct buffer containing pcr primers from the commercially available identifiler human identity kit ( applied biosystems ). the disc punch was incubated in the direct buffer for the 10 minutes at room temperature with gentle vortex - mixing occasionally , and the eluate was then transferred into a fresh tube . ( additional dilution of eluate can be made with the pcr master mix if necessary .) pcr was then performed . in a second example , 100 - fold dilutions of blood were made with te buffer ( 10 mm tris - cl and 0 . 1 mm edta at ph 8 . 0 ). 1 ul of diluted blood was used to set up a pcr in the direct buffer . in a third example , buccal swab samples were collected and placed in 500 ul te buffer . the resulting suspension was heated at 97c for 5 minutes . 10 ul of the resulting suspension was used to set up a pcr in the direct buffer . exemplary kits in accordance with some embodiments of the present teachings in some embodiments , the present teachings also provide kits designed to expedite performing certain methods . in some embodiments , kits serve to expedite the performance of the methods of interest by assembling two or more components used in carrying out the methods . in some embodiments , kits may contain components in pre - measured unit amounts to minimize the need for measurements by end - users . in some embodiments , kits may include instructions for performing one or more methods of the present teachings . in certain embodiments , the kit components are optimized to operate in conjunction with one another . while the present teachings have been described in terms of these exemplary embodiments and experimental data , the skilled artisan will readily understand that numerous variations and modifications of these exemplary embodiments are possible without undue experimentation . all such variations and modifications are within the scope of the current teachings . thus , in some embodiments , the present teachings provide a kit comprising ; a plurality of primer pairs , wherein each primer pair flanks a genomic locus containing a short tandem repeat ( str ); and , a direct buffer , wherein the direct buffer comprises tris - hcl at 10 - 16 mm , kcl at 25 - 75 mm , dntps at 200 - 400 um each dntp , bsa at 160 - 960 ug / ml , amplitaq gold polymerase at 2u - 8u , mgcl2 at 1 . 25 - 2 . 2 mm , and ssb of at least 20 ng / ul . such a kit can be used , for example , in the identification of an organism such as a human by the collection of polymorphic microsatellites analyzed , using for example capillary electrophoresis . illustrative procedures for performing such human identification can be found for example in the identifiler hid kit , commercially available from applied biosystems , as well as u . s . pat . nos . 6 , 221 , 598 , 6 , 479 , 235 , 5 , 843 , 660 , and 7 , 008 , 771 . in some embodiments , the kits , and methods and reaction mixtures provided by the present teachings can be used with procedures for multiplexed pcr of degraded samples , as found for example in wo05054515 to dimsoski and woo . in some embodiments , the direct buffer in the kit comprises , tris - hcl at 10 mm ph 8 . 3 , kcl at 50 mm , dntps at 200 um each dntp , bsa at 800 ug / ml , amplitaq gold polymerase at 0 . 16 units / ul , mgcl2 at 1 . 6 mm , and ssb at 60 ng / ul . in some embodiments , the direct buffer in the kit further comprises sodium azide at 0 . 2 percent . in some embodiments , the ssb in the kit is the t4 gene 32 protein from bacteriophage t4 .	2
persons of ordinary skill in the art will realize that the following description of the present invention is illustrative only and not in any way limiting . other embodiments of the invention will readily suggest themselves to such skilled persons . as will also be appreciated by persons of ordinary skill in the art , modern fabrication technology allows i / o pads to be placed over active circuitry . it is presently preferred to employ such technology in the present invention , which is shown in the drawing figures herein . however the invention does not require the use of pad - over - active technology and may be practiced without the use of such technology . in addition , it is to be understood that the various aspects of the present invention disclosed herein may be used individually or in combination with one another . referring now to fig2 , a diagram shows a top view of the physical layout of an i / o pad arrangement 30 for an integrated circuit die 32 according to a first aspect of the present invention . according to this aspect of the present invention , i / o cells 34 disposed away from the corners of the die have i / o pads 36 located at a first position as shown in fig2 . bonding wires 38 are bonded to i / o pads 36 and extend to a lead frame ( not shown ) to which they are also bonded as is known in the art . i / o cells 40 and 42 located at the top edge of die 32 near a corner thereof , have i / o pads that are located further from the edge of the integrated circuit die to allow for maintaining adequate wire spacing without needing to provide extra spacing between adjacent i / o pads at these locations where the wires may not be parallel to one another and are not perpendicular to the die edge . as the i / o cell gets closer to the corner 66 of die 32 , its i / o pad is moved further from the edge of the die . as shown in fig2 , i / o pad 46 in i / o cell 40 is further from the edge of die 32 than are i / o pads 36 to its right . i / o pad 48 , in i / o cell 42 nearest the corner 44 is further from the edge of die 32 than is i / o pad 46 to its immediate right . similarly , i / o pad 50 is located in the same relative place in i / o cell 52 on the left edge of die 32 as are i / o pads 36 in i / o cells 34 . i / o pad 54 in i / o cell 56 is located further from the edge of the die 32 than is i / o pad 50 below it . i / o pad 58 , in i / o cell 60 nearest the corner 44 is further from the edge of die 32 than is i / o pad 54 to its immediate right . while fig2 shows two pads 46 and 48 located further from the edge of the die , persons of ordinary skill in the art will appreciate that one or more pads may be located further in from the edge of the die according to the present invention . this arrangement according to this aspect of the present invention provides more spacing between bonding wires 62 , 64 , 66 , 68 , and 70 than would be the case using prior - art layout schemes . furthermore , unlike the prior art arrangements , the arrangement according to this aspect of the present invention permits uniform spacing between all of i / o cells 34 , 40 , 42 , 52 , 56 , and 60 while still providing additional spacing between adjacent bonding wires . referring now to fig3 a and 3b , respectively , diagrams show top and side views of the physical layout of an i / o pad arrangement according to a second aspect of the present invention . the cross section of fig3 b is taken through the dashed line 3 b - 3 b . according to this aspect of the present invention , bonding wires for alternate i / o pads near the corners are routed in upper and lower bonding - wire spaces . this increases the spacing between bonding wires associated with adjacent i / o pads , allowing the i / o pads to be located closer together . thus , as shown in fig3 a and 3b , a package substrate 82 supports an integrated circuit die 84 . a first i / o cell 86 is shown in the plane of the drawing figure . a bonding pad 88 is disposed in the i / o cell 86 . a second i / o cell 90 has a bonding pad 92 . a first bonding wire 94 is bonded to the bonding pad 88 and a second bonding wire 96 is bonded to the bonding pad 92 . the first and second bonding wires extend to a lead frame ( not shown ) to which they are also bonded as is known in the art . as is most easily seen in fig3 b , bonding wires 94 and 96 describe arcs at different heights to avoid contact with one another . this scheme may be employed only near the corners of the chip where the bonding wires do not cross the die boundary at angles close to 90 ° and it is necessary to maintain a tight pitch between i / o cells . conventionally , bonding wires disposed at two different heights are used only for staggered pad layouts , not for in - line pad layouts , and only uniformly along the entirety of each side of the chip . referring now to fig4 a , a diagram shows a top view of the physical layout of an i / o pad arrangement according to a third aspect of the present invention . according to this aspect of the present invention , i / o cells that require smaller drivers may be disposed in otherwise unused areas in the corners of the integrated circuit die . for example , in fpga integrated circuits , most i / os require highly flexible i / o drivers , which are of necessity large . however , a few of the i / os may need only much smaller drivers , e . g . those for jtag test pins or special power supplies . these types of i / o are good candidates for laying out at the die corners . thus , in layout 100 a plurality of i / o cells 102 are disposed along the top edge of the periphery of an integrated circuit die 104 . similarly , additional i / o cells 102 are disposed along the left edge of the periphery of integrated circuit die 104 . each i / o cell includes an i / o pad 106 bonded to a bonding wire 108 which extends to a lead frame ( not shown ) to which they are also bonded . in one embodiment , for example where the integrated circuit is a programmable logic device , all of i / o cells 102 are of a general - purpose type , which means that they need to be designed to be versatile to be able to handle more than one function and are sized accordingly . another type of i / o cell 110 is also included in the layout 100 . unlike i / o cells 102 , i / o cell 110 does not need to have as large a driver and may be sized smaller so as to fit in an area at the corner 112 of the die 104 , as shown in fig4 a . i / o cell 110 has an i / o pad 114 to which a bonding wire 116 is attached . an unused area represented by the area within dashed lines 118 remains at the corner 112 of the die 104 as shown in fig4 a . however , this area 118 is smaller than the area that would otherwise exist . in some embodiments , the pads may be located at different distances from the edges of the die as shown in the figure . as previously noted herein , persons of ordinary skill in the art will appreciate that the different i / o layout techniques disclosed herein may be used independently or in combination with one another . this is shown in fig4 a wherein , as in the embodiment of fig2 , the pads associated with i / o cells located near the corners of the die are located further from the edge of the die than are the pads associated with i / o cells further from the corners of the die . fig4 b is a diagram showing a top view of the physical layout of an i / o pad arrangement according to a variation of the third aspect of the present invention . in most respects it is the same as the embodiment of fig4 a , but the pads associated with all of the i / o cells are placed at the same distance from the edges of the die . fig5 is a diagram showing a top view of two i / o cells illustrating an i / o pad arrangement according to a variation of the present invention . as shown in fig5 , the total spacing between bond pads 106 ( and thus the angles of the associated bonding wires , may be varied not only by varying the distance between the bond pad and the edge of the integrated circuit die ( e . g ., distance 150 is greater than distance 152 ), but also by varying the distance of the bonding pad from the edge of the i / o cell ( e . g ., distance 154 is greater than distance 156 and distance 158 is smaller than distance 160 ). in this way , the distances between i / o bonding pads may be optimized in more than one direction . while embodiments and applications of this invention have been shown and described , it would be apparent to those skilled in the art that many more modifications than mentioned above are possible without departing from the inventive concepts herein . the invention , therefore , is not to be restricted except in the spirit of the appended claims .	7
in fig1 is shown a preferred embodiment of a wave powered generator incorporating the subject invention . a central barge 12 is positioned between and in spaced parallel relationship to a pair of elongated floats 14 and 15 . the floats 14 and 15 are each connected to the central positioned barge by a pair of pins 16 , 17 and 18 , 19 which are pivotally connected at opposite ends by ball - type sockets 20 . by such connections the floats are maintained more or less in parallel relationship to the barge but are permitted to rise and fall , sway , rock and pitch relative to each other and within the constraints of the rigid pins 16 , 17 , 18 and 19 . it is this relative movement caused primarily by the wave and wind action acting on the floats and barge that is used to generate power . the relative motions are generally described in the previously identified patent application . each float 14 and 15 includes a mast structure 21 held in position by guy wires 22 and supporting a plurality of wind vanes 24 which are controlled in a manner to enhance the relative motion between the floats and the barge . the wind vanes are supported in a manner ( not shown ) so as to pivot between a position extending in a vertical plane so as to catch the wind and a horizontal position so as not to catch the wind . preferably these wind current vanes are each made of a rigid material which is strong enough to withstand the force of the wind and also will hold up in the sea spray environment . additionally there is provided a mechanism ( not shown ) for actuating the vanes on each float in unison much in the manner that a venetian blind is moved between open and closed positions . a wind pressing on the closed vanes , i . e . vertically positioned vanes , will cause the float to heel over and the opening of the vanes will allow the float to move back to the normal position thereby creating a rocking motion . a plurality of water current vanes 27 ( fig1 and 2 ) are provided under each float 14 and 15 . these vanes are supported on vertically extending supports 28 and are rotatable ( preferably in unison ) about a longitudinal axis . by specific control of the vanes ( in a manner not shown ) the vanes can be manipulated so as to cause a rocking motion of the floats and , by cycling such vane movement with the wind vane movement previously described , the floats can be caused to rock relative to the barge . to make use of this rocking motion in the generation of power , there are provided a plurality of elongated members or cables 30 , 31 , 32 and 34 having one end fixed to the various locations on the floats . the cables 32 and 34 extend diagonally upward and downward , respectively , to upper and lower pulleys 35 and 36 located at the ends of vertically extending watertight cylinders 37 in the barge . similarly the cables 30 and 31 extend substantially horizontally over pulleys 38 and 39 positioned at opposite ends of the cylinders 37 and 38 . the cylinders 37 and 38 each function in a similar manner such that only one will be described . however , pairs of such cylinders preferably are positioned at the corners of the float 12 and , if desires , more cylinders can be spaced along the barge . as shown primarily in fig3 wherein a pair of the cylinders are shown in cross - section , a piston 40 is supported therein by the cables 32 and 34 connected to opposite sides . the cables pass through watertight seals 41 at the end of the cylinder . at the lower end of the cylinder is a port 42 connecting to a water inlet 44 extending beneath the float . a one - way valve 45 allows water to be drawn through the inlet 44 and into the cylinder when the piston 40 is moved upward . a separate such inlet with one - way valve is connected with a port 46 positioned at the top of the cylinder ( but for simplification is not shown ). thus as the piston moves up and down the evacuated side of the cylinder is always refilled and maintained full by water drawn in from the sea . in the embodiment shown , upper movement of the piston 40 will force water out through the port 46 , down through the conduit 47 , up through the conduit 48 and into an accumulator 49 . this accumulator is a closed chamber having an air space 50 so that the pumping of pressured water therein pressurizes the air . subsequent downward movement of the piston 40 will force water through the horizontal conduit 51 and upwards through the conduit 48 into the accumulator . stop valves 52 and 54 in the conduits 51 and 47 , respectively , prevent a back flow of water when water is being forced out of the other end of the cylinder . with pressured water flowing into the accumulator , the air pressure buildup results in a constant flow of water through the outlet 55 in the accumulator and upwards through the conduit 56 to a turbine 57 which when rotated turns a shaft 58 . coupled to the shaft is a drive belt 59 leading to a power generator 60 . thus pressured water forced into the accumulator 49 will result in the turning of the turbine to subsequently drive the power generator . by use of the accumulator there is a buffet provided which in essence stores energy in the form of air pressure in the accumulator to supply a constant source of pressured fluid to the turbine . similarly the cylinder - piston combination at the other corner of the barge functions to supply pressure fluid to the accumulator . the cylinder 37a and the connections with the conduits are marked with a similar numbered prefix and the suffix &# 34 ; a &# 34 ; when the function is identical . thus the piston 40a is pulled up and down by the similar diagonal cables 32a and 34a . these cables pass over pulleys 35a and 36a which run through seals 41a and into the cylinder . as the piston 40a is forced up and down , water is drawn into the inlet 44a in the same manner as previously described and another inlet ( not shown ) for passage into the cylinder . the cylinder in turn forces fluid through the horizontal pipes 61 and 62 to pass into the same accumulator 49 in the same manner as previously described . thus there is a parallel flow of fluid into the accumulator as both floats move relative to the barge . similarly there are positioned in parallel to the cylinders 37 and 37a other cylinders connecting with the horizontal cables 30 and 31 , which cylinders function in the same manner to supply pressured water either to the accumulator 49 or to another accumulator ( not shown ). thus as described there is provided a pump and valve system for transmitting the fluid from the pump to the turbine for driving the generator 60 . by use of the closed pressure system , the energy input to the turbine is smoothed out so as not to be as cyclic as might occur otherwise due to the rocking motion of the floats . water is readily available from the surrounding medium and the power can be generated on a more or less constant basis assuming the presence of current and / or wind for moving the float . additionally any number of closed pressure systems can be positioned on the barge so long as there is physical space and flotation and these other systems . all the systems can be caused to turn turbines operating on the same shaft 58 , or turbines independently connected to other generators . in fig4 is shown another embodiment of the invention . shown therein is a barge 64 and float 65 . the barge and float are connected by a pin 66 extending lengthwise through a housing rigidly fixed to the adjacent side of the floating craft . this connecting arrangement allows the craft to pivot under action of the ocean current and wind current but prohibits relatife up and down motion . such an arrangement simplifies the relative motion and makes more rigid the connecting of the craft . cables 66 and 67 are connected between the barge and float in the same manner as described before , with the ends of the cables connected to opposite sides of a piston 40b to pump water to a system in the same manner as previously described .	5
other objects and aspects of the invention will become apparent from the following description of the embodiments with reference to the accompanying drawings , which is set forth hereinafter . an apparatus for controlling a self - refresh operation in a semiconductor memory device according to an embodiment of the present invention includes a first period selector for generating one of a period - fixed pulse signal having a constant period and a period - variable pulse signal having a variable period based on a temperature of the semiconductor memory device in a test mode ; and a self - refresh block for performing the self - refresh operation in response to an output of the first period selector . fig2 is a circuit diagram of a test self - refresh period selecting circuit in accordance with an embodiment of the present invention . as shown , the test self - refresh period selecting circuit includes a period comparator 210 , a hot temperature stop controller 220 , a second period - fixed pulse generator 230 , a period selector 240 , and a self - refresh period selector 250 . the period comparator 210 outputs a period comparison signal comp by combining a self - refresh identifying signal sref_p and a period - fixed pulse signal osct_p . the self - refresh identifying signal sref_p notifies an entrance into a self - refresh mode . that is , as shown in fig3 , the period comparator 210 outputs the period comparison signal comp that maintains a high level until a first period - fixed pulse signal osct_p is outputted from the entrance into the self - refresh mode . the hot temperature stop controller 220 combines the period - variable pulse signal atcsr_p and the period comparison signal comp and checks whether or not the period - variable pulse signal atcsr_p is generated during an enable period of the period comparison signal comp . that is , as shown in fig4 , the hot temperature stop controller 220 detects the period - variable pulse signal atcsr_p while the period comparison signal comp is in the high level , and then generates a hot temperature stop signal hstop_p . the hot temperature stop controller 220 can include a delay unit that delays the hot temperature stop signal hstop_p by a predetermined time , thereby generating a delayed hot temperature stop signal hstop_p_d . the delay unit is used to generate a second pulse after passing through a period where the period - variable pulse signal atcsr_p is in the high state . if the delay is not provided , two test self - refresh signals sreft may be generated from the test self - refresh period selecting circuit . the second period - fixed pulse generator 230 outputs a second period - fixed pulse signal osct_p 2 in which the period - fixed pulse signal generated just after the enable period of the period comparison signal comp is removed . referring to fig5 , the second period - fixed pulse generator 230 performs a logical and operation on a delayed and inverted period comparison signal comp and the period - fixed pulse signal osct_p to output a second period - fixed pulse signal osct_p 2 . when the period - variable pulse signal atcsr_p is shorter than the period - fixed pulse signal osct_p , the period - variable pulse signal atcsr_p is generated during the enable period of the period comparison signal comp . therefore , when the period comparison signal comp is disabled , the period - fixed pulse signal osct_p has to be generated . at this time , if the signal generated by delaying the period comparison signal comp by a predetermined time is not blocked , two test self - refresh signals sreft may be generated from the test self - refresh period selecting circuit . the period - variable pulse signal atcsr_p generated during the enable period of the period comparison signal comp cannot be blocked . therefore , by removing the period - fixed pulse signal osct_p generated just after the enable period of the period comparison signal comp , the generation of two test self - refresh signals sreft can be prevented . referring to fig6 , the period selector 240 outputs the second period - fixed pulse signal osct_p 2 as the period select signal atcsrt_p 2 when the delayed hot temperature stop signal hstop_p_d is generated , and outputs the period - variable pulse signal atcsrt_p as the period select signal when the delayed hot temperature stop signal hstop_p_d is not generated . in addition , this operation is performed only when the test mode signal tm_hstop is enabled to a high level . referring to fig7 , the self - refresh period selector 250 outputs the period - fixed pulse signal osct_p having a constant period regardless of temperature change , or outputs the period selection signal atcsr_p 2 when the period selection signal atcsr_on is enabled . fig8 is a flowchart illustrating a case where a period of the period - variable pulse signal is shorter than the period of the period - fixed pulse signal . at t 1 , if the self - refresh identifying signal sref_p is enabled , the period comparison signal comp is enabled to a high level . at t 3 , if the first period - fixed pulse signal osct_p is outputted , the period comparison signal comp is disabled to a low level and thus the enable period of the period comparison signal comp is set . meanwhile , if the period - variable pulse signal atcsrt_p is generated within the enable period of the period comparison signal comp , the top temperature stop signal hstopb_p is outputted . at t 4 , the period - fixed pulse signal osct_p is outputted from the test self - refresh period selector . fig9 is a timing diagram illustrating a case where the period of the period - variable pulse signal is longer than the period of the period - fixed pulse signal . an operation of setting the enable period of the period comparison signal comp is identical to that in fig8 . however , since the period of the period - variable pulse signal atcsrt_p is longer than that of the period - fixed pulse signal osct_p , the hot temperature stop signal hstopb_p is not generated . accordingly , the period - variable pulse signal atcsrt_p is also outputted at t 3 and t 4 . the present application contains subject matter related to korean patent application no . 2005 - 0027352 , filed in the korean intellectual property office on mar . 31 , 2005 , the entire contents of which is incorporated herein by reference . while the present invention has been described with respect to certain preferred embodiments , it will be apparent to those skilled in the art that various changes and modifications may be made without departing from the scope of the invention as defined in the following claims .	6
in the practice of the present invention , an absorbent pad includes a porous outer fabric surface covering that draws toxic liquid from a chemical spill on a substrate to a liquid absorbing component and further for neutralization and containment of the toxic liquid within the pad . the surface covering material is desirably a chemically resistant cloth or cloth - like material which will shape and maintain the integrity of the pad while containing the inner components and absorbed liquid during use and cleanup . a preferred material is woven polypropylene because of its strength and known affinity to absorb many noxious liquids . many other porous materials well known in the art can be used for this porous outer fabric surface . the types of materials which are available for use as a surface covering can be determined by examining spill pillows that are already commercially available and through simple experimentation . for example , see u . s . pat . nos . 4 , 659 , 478 and 4 , 965 , 129 , incorporated herein by reference for all purposes , which discusses the use of cotton , rayon , nylon and like materials to create a number of porous fabric , outer &# 34 ; bags &# 34 ;. of course , a significant consideration is the ability of the material to withstand the chemicals with which it will come into contact and the physical abuse of spreading and collecting . this &# 34 ; bag &# 34 ; may be of any convenient shape , but a pillow or sausage shape is preferred . an absorbent component is disposed inside the outer fabric bag with an absorbent interior or core . the absorbent component and absorbent interior may be a material such as a fibrous polyolefin , finely divided polyethylene , silica gel , absorbent clay , and the like to draw the spilled liquid through the porous surface covering , thereby removing it from the substrate and to conduct the liquid to the interior core of the pad where it reacts with an appropriately selected reactive neutralizing agent . other suitable absorbent materials for containment within the outer fabric surface core are described in the incorporated u . s . pat . no . 4 , 965 , 129 . furthermore , the absorbent component within the porous surface covering should be chemically inert if the reaction rate must be controlled since the mass transfer kinetics through the inert material limits the rate at which the reactive chemicals of the absorbent material and of the spill come into contact . if the reaction rate is not a concern , the absorbent component within the porous surface could be completely comprised of chemical reagents for neutralizing the toxic liquid . the absorbent interior core of the pad is disposed , or imbedded within the absorbent component and includes chemical reagents specifically selected for reacting with components of the liquid spill . in one embodiment of this invention , the reactive reagents of the interior core may be enclosed in one type of absorbent material throughout the pad , such as , for example , polyethylene . alternatively , the absorbent interior core may use a different type of absorbent material such as an absorbent silica gel to act as a support for the reactive chemical reagent , such as , copper oxide . such choices depend on the design goals and the requirements of the types of liquids which are to be absorbed . preferably , the reactive core material will be enclosed in a second porous pad imbedded in the absorbent component . thus , the interior could be removed and replaced after every use thereby creating a reusable portion if it results in a more efficient utilization of resources . it is not necessary for the absorbent interior core and the chemical reagent to be separate but may be physically mixed components . the mixture may either be a purely physical mixture or a chemical combination comprising a single material . a person skilled in the art will readily be able to make these choices based upon the disclosure of the specification , analysis of the liquid spill components , design requirements and reagent availability without undue experimentation . in the practice of this invention , the interior core will be a chemical reagent which will react with and neutralize or isolate troublesome components of liquid spills . for example , use of an acid reagent ( certain acid clays like montmorillonite are useful ) for the neutralization of caustic spills ; a base reagent for the neutralization of acid spills ; chelating or precipitating agents for spills containing metallic salts in solution ( mercury , cadmium , etc . ); oxidizing agents for reaction with spills containing certain organic agents . the size and shape of the pad of this invention is such that it is easily removed from the substrate for discarding or cleaning and reuse in some cases . of particular importance in the practice of this invention is the removal of a hydrazine spill to which much attention has been given in the prior art cited above , particularly u . s . pat . no . 4 , 804 , 527 , incorporated herein for all purposes . in the instance of the removal of hydrazine , the interior core of the pad of this invention includes a reducing metal oxide , preferably a copper oxide and most preferable cupric oxide ( cuo ). the reducing oxide , when coming in contact with the hydrazine , oxidizes the hydrazine to hydrogen gas and water . since the reaction and safety considerations are amply discussed in the incorporated u . s . pat . no . 4 , 804 , 527 , no further discussion is needed here . in the preferred embodiment of the practice in this invention , the absorbent reactive core of the pad of this invention is a second porous pad or pillow imbedded within the fibrous absorbent component , preferably a fibrous polyethylene made up of a oxidizing metal oxide , preferably a copper oxide . since hydrazine is highly reactive and gives off considerable energy in the oxidation reaction , it is preferred that the copper oxide be intimately mixed with an absorbent clay such as , for example , bentonite or incorporated into a silica gel where the rate at which the hydrazine reacts could be controlled . to illustrate this preferred embodiment of the practice of this invention , without limitation of the scope of such invention , a test pad was constructed using an outer surface cover of woven polypropylene . it was sewn in the form of a bag which was filled with an inert absorbing component , a polyethylene fibrous mass as a filler . the absorbent inner core was a nylon mesh cloth inner pillow containing 1000 grams of 10 % cuo supported on an absorbent silica gel . the nylon mesh was stuffed with the absorbent silica gel which was imbedded within the fibrous polyethylene filler of the woven polypropylene pad . this was used to remove a hydrazine spill , under lab conditions , diluted with water . in use , the hydrazine was diluted with water before the pad was applied to &# 34 ; clean up &# 34 ; the spill . the water in an aqueous hydrazine solution assists in the chemical reaction by allowing the hydrazine to gradually migrate to the absorbent interior where the aqueous hydrazine is converted by the silica gel / cuo reagent to innocuous products , namely nitrogen and water and by assisting in the reduction of the cuo . the amount of water to be added is not strictly defined and can be varied by those skilled in the art without an undue amount of experimentation . the quantity and relative ratios of the components used in creating a pad are a function of reaction characteristics and related considerations . in the example above , the silica gel / cuo was prepared by dissolving 372 grams of cupric nitrate hexahydrate cu ( no 3 ) 2 . 6h 2 o in water to make one liter of aqueous solution . it is then absorbed into a silica gel and heated . however , one skilled in the art has the ability to examine the parameters of the chemical reaction and utilize those parameters in conjunction with the disclosure herein to create a pad which will operate effectively and safely for a particular spill in question , particularly hydrazine . for the specific pad described herein , the combination of the polyethylene filler and the silica gel as the two absorbent materials established a sufficiently slow absorption rate that the chemical reaction between the aqueous hydrazine and the copper oxide did not reach the flash point temperature of 51 ° c . ( 124 ° ) for hydrazine . the foregoing disclosure and description of the invention are illustrative and explanatory thereof and various changes in the size , shape , combination of materials or chemical elements , and the details of the illustrated construction as well as the methods may be made without departing from the scope of the invention . it is understood that the invention is not limited to the specific embodiments or methods disclosed above for the purpose of exemplification and that many modifications and changes will be apparent from the description without departing from the scope of the attached claims .	1
fig1 and fig2 illustrate a sliding window component 1 , which comprises a stationary window pane 2 and a movable sliding window 3 . the sliding window 3 is guided in an upper guide 4 a and in a lower guide 4 b , which do not run parallel to one another . in addition to a holding device 5 , which is fixedly connected to the window pane 2 , the upper guide 4 a encompasses a guide rail 6 , which is supported so as to be movable relative to the holding device 5 via an equalizing bearing . in fig1 , the sliding window 3 is in closed position and in fig2 in open position , in which it releases an opening in the window pane 2 . the comparison of fig1 and fig2 shows that the distance of the upper sliding window edge relative to the holding device 5 of the upper guide 4 a changes across the displacement path of the sliding window 3 . the more the sliding window is opened , the greater this distance becomes . this change of distance is equalized in that the guide rail 6 of the upper guide 4 a , which is supported so as to be pivotally movable relative to the holding device 5 , pivots out of the holding device 5 in response to the displacement of the sliding window 3 , is thus displaced relative to the holding device 5 . however , the lower guide 4 b of the sliding window 3 is embodied as a classic guide , as it is sufficiently known to the person of skill in the art . the embodiment , which is shown in the figures in an exemplary manner , in the case of which the upper guide 4 a equalizes the non - parallelism of the guide rails , is not absolutely necessary for the realization of the invention . it is likewise also possible that the lower guide 4 b or even the lower and the upper guide are embodied to take over the equalizing function . insofar as reference is made below to “ in the front ” or “ in the rear ”, respectively , or “ front ” or “ rear ” components , respectively , these terms refer to the driving direction indicated by the arrow in fig1 and fig2 , and to the embodiment , which is illustrated therein in an exemplary manner , in the case of which the distance of the outer edges of the stationary window pane and the distance of the upper and lower guide expand in driving direction and in the case of which the sliding window must be displaced in driving direction , so as to be transferred from the closed into the open position . in view of the invention , it goes without saying that this is not to be considered as being limiting . the invention can just as well be realized in embodiments , which deviate from this . in the case of sliding window components , as they are typically used , the distance between the lower guide 4 b and the upper guide 4 a is generally between approximately 400 mm and 500 mm , depending on the vehicle . in the case of non - parallelism of the guides and a typical opening angle of approximately 1 . 5 ° to 3 ° and a total length of the guides of approximately 1000 mm , the change of distance , which is to be equalized by means of a displacement of the guide rail , is approximately 13 mm to 26 mm , when assuming that the movable sliding window in closed position engages with the front guide elements approximately in the center of the guide . in particular when the guide rail 6 , which is preferably made of plastic , is pivoted out of the holding device 5 after the opening of the sliding window 3 , the guide rail 6 , which guides the sliding window 3 , is to be connected to the vehicle in a manner , which is as stable and as robust as possible . otherwise , there is a risk that the sliding window 3 is not sufficiently stable and is too movable due to the potentially occurring transverse forces at right angles to the stationary window pane 2 . this gives an instable and thus qualitatively low quality impression and can negatively impact the disturbance - free function . the same applies analogously also to other forces , which act on the guide rail , which can lead to a twisting of the guide rail , for example . to attain the desired stability , provision is made in the case of the upper guide 4 a for a pivotally movable interlink , which can be seen from fig2 and fig3 , via which the guide rail 6 and the holding device 5 are coupled to one another . the interlink is a pivot handle 7 , which is pivotally supported on the holding device 5 by means of a support bolt 8 . at the same time , the pivot handle 7 engages with a control groove 10 , which is provided on the guide rail 6 , via a control bolt 9 and can thus be pivoted as well as displaced relative to the guide rail . fig3 illustrates the position of the guide rail 6 and of the pivot handle 7 in open position of the sliding window by means of solid lines and the position of the guide rail 6 and of the pivot handle 7 in closed position of the sliding window by means of dotted lines . in the event that the guide rail 6 is displaced relative to the holding device 5 as a result of an opening movement of the sliding window , the pivot handle 7 is pivoted about the support bolt axis and the control bolt 9 slides along in the control groove 10 until it stops at the groove end . this stop prevents a further displacement of the guide rail 6 and thus forms an effective limitation for the degree of opening . to be able to insert the pivot handle 7 , which is preferably produced as a torsion - resistant steel molded part , into the control groove 10 with its control bolt 9 , which is arranged thereon , an assembly aid precedes the control groove 10 . in fig3 , the assembly aid is formed in an exemplary manner by an assembly groove 11 , which can be accessed on the edge side and via which the control bolt 9 can be transferred into the control groove 10 . in the event that the sliding window is in closed position , the length of the control groove 10 ensures that the control bolt 8 cannot slide out of the control groove 10 . it can further be seen in fig3 that the holding device 5 overlaps the guide rail 6 on the side thereof such that a gap between holding device 5 and guide rail 6 , which can be accessed from the outside , is not formed , even when the maximum degree of opening has been reached . this particularly advantageous matching of the guide rail 6 and of the holding device 5 to one another is optional and is not illustrated in the remaining figures . as can be seen from fig4 , which shows the sectional view along the sectional line b - b , which has been drawn in fig3 , the pivot handle 7 is embodied as a u - handle , encompasses the guide rail 6 on both sides of the guide grooves 12 , which are provided in the guide rail 6 , and is also engaged therewith on both sides of the guide rail 6 via control bolts 9 and control grooves 10 . in addition , the pivot handle 7 abuts closely and free of play , as far as possible , on the inner side on the holding device 5 , and is pierced by the support bolt 8 on the holding device for the purpose of a pivotal support . the u - shaped embodiment of the pivot handle 7 does not only make the pivot handle 7 as such to be particularly torsion - resistant , it furthermore provides for the coupling of guide rail 6 with the holding device 5 so as to be particularly stiff and less susceptible to torsion . at the same time , the u - shaped embodiment of the pivot handle ensures that the pivot handle can dip into the holding device and that the guide rail can dip into the pivot handle , so that the components are located within one another in a space - saving and optically advantageous manner when the sliding window is in closed position . it goes without saying that the invention is not limited to the embodiment , which is illustrated in the figures in an exemplary manner . the pivot handles can also engage on the inner side on a guide rail and / or on the outer side on the holding device . likewise , it is possible for the control unit to be provided on the pivot handle and for a control bolt to be provided on the guide rail . an embodiment , in the case of which the pivot handle 7 is prestressed by means of a prestressing element , so that it either retracts the guide rail into the holding device or pushes the guide rail against the sliding window , is also not illustrated . such a prestressing element can be placed around the support bolt 8 as a flexible spring , for example , and can be supported by the interlink as well as by the holding device 5 or the guide rail . fig5 shows a sectional view of the upper guide 4 a , which is illustrated in fig1 , along the sectional line c - c . a centering pin for a prestressing element in the form of a pressure spring 13 is in each case provided on the guide rail 6 on the upper side and on the holding device 5 on the lower side . said pressure spring 13 places the guide rail 6 against the sliding window 3 , so that the sliding window 3 and the guide rail 6 are in a defined abutment with one another at any time . as can be seen from fig5 and fig6 and also from fig1 and fig2 , the upper guide 4 a is preferably designed such that the guide rail 6 is articulated on the holding device at the front end via the interlink and at the rear end via a pivot bolt 14 . due to the pivot bolt 14 , which only allows for a pure pivoting movement of the guide rail , the guide 4 a opens in response to the displacement of the sliding window in the manner of scissors . due to its simplicity and the high stability of the connection between guide rail 6 and holding device , such a pivot bolt is advantageous . however , it is also possible that the guide rail 6 is connected to the holding device at a plurality of locations , in particular at the front and rear end , via a plurality of interlinks , instead of the support via a pivot bolt shown in fig6 . this would have the advantage that the guide rail 6 could not only be displaced in a pure pivoting movement about the pivot bolt relative to the holding device , but that it could also and simultaneously as a whole be displaced downwards relative to the holding device . the equalization devices at the sliding window , which will be described below with reference to fig7 a and 7 b , would then no longer be necessary . fig4 to 6 show that the holding device 5 can be embodied as an elongate and / or u - shaped profile part made of plastic , in which sheet metal inserts 15 are embedded , which ensure additional stability . the holding device is preferably connected to the stationary window pane 2 via an adhesion 16 on the inner side , but can also be arranged on other components , which are fixedly connected to the auto body , or on the auto body itself . the holding device must not necessarily be extend across the entire length of the guide rail as an elongate profile , as is shown in particular in fig1 and fig2 , but can also comprise a plurality of holding devices , which are arranged at a distance to one another . however , the embodiment of the holding device as an elongate profile part , which extends across the entire length of the guide rail , makes it possible for the guide rail to be able to dip into the holding device across its entire length . this is desirable for optical reasons , because the multi - part design of the guide can thus not simply be identified from the outside . the sliding window interacts with the guide rail in the front as well as in the rear by means of guide elements . due to the spring force , which the pressure spring 13 exerts on the guide rail 6 , the guide rail 6 is placed against the front part of the sliding window and pivots downwards during the opening movement of the sliding window 3 . the distance of the guide rail relative to the front part of the sliding window and the guide elements , which are arranged in this area , thus does not change in a functionally considerably manner during the opening movement . only the angle between guide rail and the upper edge of the sliding window changes slightly , but not to an extent , which impacts the function of the guide elements . however , the distance in the rear part of the sliding window changes considerably , as can be seen from fig1 and fig2 . to be able to ensure that the guide elements interact in a disturbance - free manner with the guide rail in spite of this distance change , they are arranged on the sliding window 3 , thus either directly in or on the sliding window pane itself , respectively , or in or on a frame element , respectively , which is connected to the sliding window pane as part of the sliding window 3 , and are embodied such that the guide elements are capable of equalizing the distance change . as can be seen from fig7 a and 7 b , the guide elements are preferably embodied as guide pins 17 , which are accommodated in a spring - loaded manner in an accommodation , for example in the form of the sleeve 18 , which is illustrated in the figures . while the guide pin 17 in fig7 a represents the position in closed position of the sliding window 3 , fig7 b shows the same guide pin 17 in open position of the sliding window 3 , in which the pressure spring 19 relaxes further in the situation shown in fig7 a , and the guide pin 17 projects further from the sleeve 18 , so as to engage with the guide groove 12 at the same depth in spite of the greater distance to the groove base of the guide groove 12 . the guide pin 17 is preferably a steel pin and the sleeve 18 is preferably a steel sleeve , which is pressed into a locking cap 20 at its lower end after the insertion of the guide pin 17 and of the pressure spring 19 at the lower side . the sleeve 18 together with the guide pin 17 , pressure spring 19 and locking cap 20 is preferably embedded within a plastic part or is injection molded by said plastic part , respectively , which is attached to the sliding window on the inner side , in particular by means of molding . in particular , the plastic part can be formed by a strip , which extends across a part of the periphery of the sliding window , for example along the upper and / or lower sliding window edge . however , it can also be a frame , which extends along the entire periphery of the sliding window .	1
fig1 is a diagrammatic cross - section of a part of a liquid crystalline display device 1 , for example of the size of a few pixels , comprising a liquid crystal cell with a twisted nematic liquid crystalline material 2 which is present between two substrates 3 , 4 of , for example , glass provided with , for example , transparent ( ito ) picture electrodes 6 and a reflecting counter electrode 5 . the device further comprises two polarizers 7 , 8 whose directions of polarization are mutually crossed perpendicularly . the cell further comprises orientation layers 9 which orient the liquid crystalline material on the inner walls of the substrates . in this case , the liquid crystalline material has a positive optical anisotropy and a positive dielectric anisotropy . if the electrodes 5 , 6 are energized by an electric voltage , the molecules and hence the directors direct themselves to the field . the voltage across the picture electrodes is determined by the drive mode . fig2 shows diagrammatically a picture display device 1 which is driven with active switching elements , in this example thin - film transistors . it comprises a matrix of pixels 18 at the area of crossings of row or selection electrodes 17 and column or data electrodes 11 . the row electrodes are consecutively selected by means of a row driver 16 , while the column electrodes are provided with data via a data register 10 . if necessary , incoming data 13 is first processed in a processor 15 . mutual synchronization between the row driver 16 and the data register 10 takes place via drive lines 12 . drive signals from the row driver 16 select the picture electrodes via thin - film transistors ( tfts ) 19 whose gate electrodes 40 are electrically connected to the row electrodes 17 , and the source electrodes 21 are electrically connected to the column electrodes 11 . the signal present at the column electrode 11 is transferred via the tft to a picture electrode of a pixel 18 coupled to the drain electrode 22 . the other picture electrodes are connected to , for example one ( or more ) common counter electrode ( s ) 24 . in this embodiment , the display device of fig1 also comprises an auxiliary capacitor 23 at the location of each pixel . in this embodiment , the auxiliary capacitor is connected between the common point of the drain electrode 22 and the pixel in a given row of pixels , on the one hand , and the row electrode of the previous row of pixels , on the other hand . other configurations are alternatively possible , for example , an auxiliary capacitor between said common point or one of the subsequent rows of pixels ( or a previous row ). it is to be noted that these auxiliary capacitors do not occur in all display devices based on tfts . to prevent picture deviations , the display device of fig2 comprises an extra row electrode 17 ′. fig3 and 4 show drive signals of the display device . at the instant t 0 , a row electrode 17 is energized by means of a signal v sel ( fig3 ), while simultaneously data signals v d ( fig4 ) are presented to the column electrodes 11 . after a line selection time t l has elapsed , a subsequent row of electrodes is selected at instant t 1 , etc . after some time , for example , a field time or a frame time , usually 20 msec or 16 . 7 msec , said row electrode 17 is energized again at instant t 2 by means of a signal v sel , while simultaneously inverted data signals v d are presented to the column electrodes 11 ( in the case of an unchanged picture ). after a line selection time t l has elapsed , the next row of electrodes is selected at instant t 3 , etc . this is repeated again at the instant t 4 . since the data voltages are inverted at every subsequent selection of the pixel , the voltage across the pixel changes polarity , as is shown in fig5 . during the period when the pixel is not selected , the absolute value of this pixel voltage decreases . the voltage decrease is also dependent on the polarity , notably , but not exclusively , in pixels having an asymmetrical structure , as is the case in reflective display devices or when different materials or thicknesses of , for example , orientation layers on both substrates are used . the voltage decrease is determined by a dc component which is inherent in the structure of the device . after the ( positive ) selection during the period t 0 - t 1 , the ( absolute value of the ) pixel voltage v p decreases from v 1 to v 2 ′ ( broken line 25 in fig5 ) during the other part t 1 - t 2 of the frame time ( t f ) without special measures . likewise , the ( absolute value of the ) pixel voltage v p decreases from v 3 to v 4 ′ ( broken line 25 ′ in fig5 ) during the other part t 3 - t 4 of the frame time after the ( negative ) selection during the period t 2 - t 3 . since the voltage decrease for the two polarities δv a = v 1 - v 2 ′ and δv b = v 4 ′- v 3 is asymmetrical , this is visible as flicker at half the time frequency ( 25 or 30 hz ). according to the invention , the variation of the voltage across one or more pixels is measured ; preferably , a row of dummy pixels ( not used for the actual display ) is controlled for this purpose by means of , for example , the data voltage for medium grey , and one or more control voltages are adapted in such a way that ( in this example ) δv a = δv b . the control voltages to be adapted may be data or selection voltages but also , for example the voltage across the counter electrode . the voltage across the pixel then has the variation as shown by the solid lines 26 , 26 ′ ( δv a = v 1 - v 2 = δv b = v 4 - v 3 ). instead of measuring the voltage difference between the voltages at the beginning and the end of the non - selection period , it is also possible to measure at several positions in the time - voltage curve ( or a voltage integral may be determined ). in the case of passive display devices , the switches 19 are absent . pixels are now defined by overlapping parts of row and column electrodes . for the purpose of measurement , one or more measuring elements are provided which are driven and measured by means of extra electrodes ( for example ) via the processor 15 . dependent on the measured result , for example , the line selection voltages are adapted . fig6 shows diagrammatically the display device with a picture area 27 and a row of dummy pixels 28 , which functions as a measuring element and is selected by means of a selection electrode 17 ″. the signal across the pixels 28 is simultaneously applied via a measuring electrode 37 to a measuring section 14 of the processor 15 in which the values v 1 , v 2 , v 2 ′, v 3 , v 4 , v 4 ′ are stored and compared . if necessary , one of the drive signals is adapted until δv a = v 1 - v 2 = δv b = v 4 - v 3 . for the purpose of measurement ( and possible adaptation of the bias voltage ), the common counter electrode 24 is also connected via a measuring electrode 37 in this embodiment . corresponding signals for the picture area 27 are adapted in a similar manner . instead of a row of dummy pixels , a pixel from the picture area 27 may also be used as a measuring element , for example , prior to its actual use ( when the display device is switched on ). the signal across the dummy pixels 28 is applied via the measuring electrode 37 in the measuring section 14 to an input section 30 with an operational amplifier 29 ( fig7 ). its output is applied to a sample - and - hold section 31 via switches 35 successively at the instants t 1 , t 2 , t 3 , t 4 so that the voltages v 1 , v 2 , ( v 2 ′), v 3 , v 4 , ( v 4 ′) are stored via operational amplifiers 29 ′ and subsequently processed in a differential amplifier 32 consisting of operational amplifiers 29 ″ and resistors 33 , 33 ′. the difference voltages δv a , δv b are compared in the output amplifier 36 consisting of operational amplifiers 29 ′″ and resistors 34 , 34 ′. dependent on a possible voltage at the output of the output amplifier 29 ′″, one or more control voltages are adapted until δv a = δv b or , if necessary , δv a = δv b + c , in which c is a constant voltage . it will be evident that many variations within the scope of the invention can be conceived by those skilled in the art . for example , the measuring electrodes may also be spread on the surface of the display device . in summary , the invention relates to a display device comprising a measuring circuit for detecting flicker due to , for example , dc offset ( in both active and passive display devices ) and , if necessary , adapting control voltages . the invention is based on each novel characteristic feature and each combination of characteristic features .	6
fig1 shows a first embodiment example for measuring and stabilising the horizontal movements of a helicopter 1 . the lens 2 acts as objective lens and projects a visible section of the ground 4 onto the optical shift sensor 3 having an integrated analysing unit , on the same chip . during a forward movement , ground spot 44 migrates optically to the position 44 ′, and accordingly , its image on the sensor 3 is shifted . the sensor outputs the incremental measurement values of the shift in two coordinates ( x and y ). if the line of sight , as indicated , is downwards , information concerning the flight velocity with respect to ground in both components forward direction and lateral direction is obtained . these measurement values may be used for stabilising the flight path or a still - standing hovering flight . to this end , the feedback - control electronics 7 is , at its input side , connected to the optical measurement signals , and at its output side outputs control values for controlling the airborne object , wherein at least parts of the whole control are included , in this case the cyclic adjustment of rotor blades 8 , for instance by means of a wobble plate controlling the inclination of the main rotor plane , and therefore influencing the horizontal acceleration of the helicopter . one example for the operation of a regulation - control 7 is described in detail further below , as well as in fig5 . on the other hand , the measurement value does not only depend on the horizontal movement , but on rotational movements , which the airborne object might carry out simultaneously as well , as for example rolling and pitching . this influence is compensated by admixing a rotational signal . the rotational signal may for example be proportional to the angular velocity of the rotation , or to other rotational values as for example the angular position . different possibilities for obtaining a rotational signal adapted for compensating are described in the following . the rotational signal may be obtained by means of a gyroscope or a piezoelectric rotation sensor 9 , 10 ( piezo - gyro ). such additional measurement pick - ups may be provided at the airborne object or may be attached to or implemented into the apparatus 5 according to the invention . since a piezo - gyro measures the angular velocity , the compensation is reasonably done by mixing the gyro - signal into a frequency signal obtained from the shift sensor , for example by differentiating , which already represents the velocity . in case of a helicopter , a rotational signal may be created in that an acceleration sensor is moved together with the main rotor shaft , and is disposed at a distance from the rotor axis , wherein the acceleration component parallel to the rotor axis is measured , and the continuous measurement value is , as a function of the rotation of the rotor , cyclically analysed with respect to phase . as is the case with a gyroscope , rotations of the rotor plane induce precession forces that occur in the acceleration sensor as cyclically changing accelerations and are measured . the amplitude of the change is a measure for the angular velocity of the rotation to be measured . the phase position with respect to the rotors rotation is a measure for the direction of the rotation to be measured and for the orientation of the axis . the phase - related analysis may be carried out by creating a sampling sequence synchronised with respect to the rotors rotation , according to the clock - rate of which , the measurement signal is measured in an intersected way , or switched , for example in quadrants . thereby , measurement values of the rotation are obtained divided into components , like for example the pitching axis and rolling axis . the synchronising may be effected by means of a rotary encoder , which samples the rotations of the rotor axle . preferably , the measured forces occur as cyclic changes . therefore , the acceleration sensor does not need to be able to measure absolute values , but only the changes . therefore , as acceleration sensor , a budget - priced piezoelectric force converter may be used , the measurement value of which can only be coupled capacitively . further , the advantage that zero point errors of the measurement value do not occur from the beginning onwards is the result , in that the measurement value is obtained in form of an amplitude . a signal transmission from the rotating sensor to the regulating control - device may occur by means of radio communication , optoelectric transducers , inductive signal coupling or sliding contact . even without optical measurement , this measurement procedure may generally be applied for stabilising a rotary wing airplane , the inclination of which is regulation - controlled depending on a measurement value . to this end , it is sufficient , if an acceleration sensor is moved along with the main rotor axle , and is disposed at a distance to the rotor axis , and if the acceleration component parallel to the rotor axis is measured , and the continuous measurement value is cyclically analysed with respect to phase , according to the rotor &# 39 ; s position , and synchronous therewith . to obtain a rotational signal for compensating the rotational influences without using a separate sensor , a control signal may be used as rotational signal , the control signal being supplied to a control means controlling the respective rotation , for example the servo signal of the wobble plate &# 39 ; s inclination . this works , because usually the airborne object responds with a roll or pitch rate quite precisely proportional to the actuation . therefore , such a control signal provides a suitable measure for the angular velocity to be used as compensating rotational signal . at this , the compensation is done by mixing the control signal into the velocity signal obtained from the shift sensor , which may be obtained by frequency measurement . if the control signal itself is created by means of a regulation - control - loop according to the invention , the actual value of which includes the measurement signal to be compensated , the compensation conforms to an inverse mixing within the regulation - control - loop in form of a negative feedback from the control value to the actual value , reducing the loop amplification . in this case , with identical principle of operation , the compensating mixing - in of the rotational signal may be realised by the regulating control - loop simply having a respectively smaller amplification . an alternative or combinable possibility to obtain a rotational signal is to use a second optical shift sensor for this purpose , which according to the invention works as rotational sensor , as described , and the line of sight of which is differently aligned with respect to the first sensor . fig5 shows , as an example , a block diagram of a regulation - control unit 7 for helicopter ( s ). the regulation - control loop may be constructed in the same way for the pitching axis and the rolling axis , and therefore is only shown once . during usual manual operation , control signals are supplied via the receiver 21 to the rotor blade control 24 . the location reached in flight results from the flight response behaviour , which conforms to a series of several integrations with respect to time , as is shown in a self - explaining manner . the entirety of these motion related values represents the actual flight motion for each point in time . the influence of the movements onto the measurement is shown with dashed lines . below the measurement instruments 9 , 10 , 25 , 3 , the operations of the regulation - control unit 7 are shown , divided into the representation of the measurands and the regulation - control itself , the control carrying out a comparison of actual value and target value . from the signal of the shift sensor 3 , at first a frequency 27 is obtained . the frequency may , as described , be purged from the influence of inclination and possibly flight altitude . this is done here by addition 24 . the subsequent integration 28 may be a summation or a counting , and creates a position signal , in which the differentiating effect of the frequency measurement is reversed again . a target value of the flight path or of the flight velocity be given . this may , for example , be a velocity vector or position vector , parameterised as a function of time . this function may be programmed prior to the flight , or may be pre - set during flight , or in the special case of the hovering flight may be zero ( as velocity vector ) or constant ( as position vector ), respectively . the present - time target - value is evoked , for example by means of the radio communication receiver 22 , and is compared to the optical measurement value by subtraction 30 a . the acquired difference corresponds to the momentary deviation from the target route ( in 30 a ) or target velocity , respectively . in the ( drawn ) case of a target value for the required position vector , the regulation may occur in that at first the positional deviation 30 a is defined as a control value for a flight - back velocity , and in that this velocity itself is regulation - controlled 30 b . according to the pid method , a mixture from positional measurement values and velocity measurement values may be regulation - controlled together . proportionally and reverse to the deviation of the velocity , an inclination control value 30 b is defined , according to which the inclination of the main rotor plain is to be controlled . upon the inclination , the helicopter would respond with a horizontal acceleration proportional to the inclination . therefore , the flight velocity would change proportionally to the time integral of the inclination , and the regulation - control - loop is closed . in order to have the inclination approach the target value , the actuators of the swash - plate 8 are controlled . since the helicopter does not allow for a control of its inclination directly , but only via the velocity of its change ( angular rate ), the inclination is not immediately known from the position of the actuators . therefore , in order to control the inclination , it is advantageous , if an own measurement value thereof is available . in fig5 , an inclination sensor 25 is provided for this task , which allows for an own target value comparison 30 c . via a mixer or switcher 23 the result is supplied to the rotor control 8 as control value 26 . as inclination sensor , for example a device according to the cited ru 9300250 may be used . this is imprecise though . alternatively or additionally , the time integral of the signal of a piezo gyroscope 9 , 10 , indicating the angular velocity of inclination , may be derived , and thereby , according to the operation of an artificial horizon , represents the rotor &# 39 ; s inclination . it is problematic though , that the integration gives rise to an undefined constant of integration , correspondingly to an unknown declination of the horizon . it may stem from the situation in the moment of the switching - on as well as of slight drifts , and would significantly disturb the control . the inclination may be measured in that a measured signal 24 , which is obtained from the optical shift sensor 3 , and is proportional to the velocity , is differentiated with respect to time in at least a part of its frequency range . this works , because the helicopter in common flight situations accelerates proportional to its inclination , and the acceleration can be obtained by differentiating the measured velocity . resulting from the differential operation applied to the optical measurement signal , which itself is outputted in steps , there may emerge disturbing discontinuities from the incremental steps . the measurement value for the inclination may be created as the combination of both , the measured value , which is obtained from the shift sensor and is differentiated with respect to time , as well as the time integrated signal of a rotational signal , proportional to the angular velocity of the inclination . in this respect , especially the differentiated measurement value &# 39 ; s spectral components of higher frequency may be weighted less , and the integrated signal &# 39 ; s spectral components of lower frequency and the constant signal component may be weighted less . in this way , the described problems of the integration constant and of the zero point drift are solved , because they cease to exist , if the lower spectral components are taken out , as well as the discontinuities , because they are smoothened by lowering the higher spectral components . the respective missing portions can be replaced by the other signal . the combination resulting to the optical measurement signal by differentiating and low - pass filtering , can , in a synonymic manner , also be represented by and be created as a high - pass of first degree ; the combination resulting to the gyro signal by integrating and high - pass filtering , can , in a synonymic manner , also be represented by and created as a low - pass of first degree . as rotational signal for this regulating control of inclination , there may be used each of the methods described in connection with the rotation compensation , as for example piezo gyroscopes or control value for control . alternatively to this , or in combination herewith , the rotational signal may again be created as described above . the regulation - control of the inclination may be combined with the regulation - control of the horizontal movement , in that the described measurement values for inclination as well as for motion ( velocity and / or position ) are mixed , and thus are regulation - controlled together . the explicit separation of the operations “ representation of the measurands ” and “ regulation - control ” was done for the sake of better understanding , but is not essential for the realisation . generally , proportional , differentiated and possibly integrated portions of the optical measurement signal may be admixed to the regulation - control loop in parallel , what results in that the described regulation - control in its entirety , in a synonymic manner , may be realised in form of a shared pid regulation - control loop . in using an integral signal branch within the regulation - control loop , a stationary regulation - control is obtained , whereby a hovering flight is stabilised in such a manner , that even subsequent to temporary deviations like disturbances , wind gusts and the like , the original position is reconstituted . in computing an integral of the shift values , a measured value , which is proportional to position can be obtained . when obtaining the absolute spacial position in ground - based coordinates , the yawing movements can be accounted for in a compensating manner . for this , the incremental sensor signals of both sensor coordinates may be summed up in an integrating manner , wherein , representative for two ground coordinates , two integration sums are to be provided , and wherein , in addition , the alignment of the sensor is measured with respect to a rotational axis perpendicular to the ground coordinates , and the sensor signal increments to be summed up , prior to being summed up , are vectorially rotated under control of the measured heading . a target value may be provided for a velocity instead of a position . such a target value may at first be integrated , and then be used as target value for position . the position proportional actual values and target values may also be omitted , and the regulation - control may be confined to velocities . the mixing 30 a and integration 28 may be omitted , and the manual control value 22 may be directly supplied to a velocity comparison 30 b . the described regulation - control methods , especially the ones for regulation - controlling the inclination of a helicopter , may also be applied for flight stabilisation without the use of an optical sensor . thereby , the position proportional actual values and target values may be omitted and the regulation - control be confined to the inclination angle . instead of the optical sensor 3 or in combination herewith , any of the navigation systems known from the state of the art may be applied to obtain actual values 28 of the position or the velocity , and thereby to realise the regulation - control method , which is described here . to this end , the described regulation - control method only has to be modified in such a way , that the sensor 3 and the frequency measurement 27 are omitted , and a position measurement value 28 and / or a velocity measurement value , which stems from an alternative measurement system , is employed . fig2 shows a second embodiment example : for measuring a rotational movement or rotational velocity , at least two shift sensors 31 and 32 are present . both sensors , in a dislocated way , may be disposed behind a shared lens 2 or other imaging optical system , or may as well possess own imaging optical systems , as shown in fig4 . the thereby resulting arrangement may be a combined device , or may be assembled in separate units . the lines of sight of the different sensors are aligned such that they diverge in predetermined angles . for most applications , acute angles are suited . therefore , both lines of sight are similar and result in a shared main line of sight , which may be assumed to be the angle &# 39 ; s bisecting line . rotations with respect to an axis in the angle &# 39 ; s bisecting line or close to it , result in image shifts of the ground spot &# 39 ; s images 61 , 62 in tangential direction . accordingly , the sensors 31 , 32 are aligned in such a way that they detect tangential displacements . the tangential displacements measured by both sensors may be related to each other , for example by subtraction , mixing , comparison or generally a superposition of the measurement values of both sensors . in this manner , the tangential portion of the shifts is filtered out , the measurement becomes substantially independent of other movements . the signal comparison may consist of a mixing or generally a superposition . if the individual measurements are weighted differently prior to mixing , the position of the axis of rotation may be changed in a defined way . at the same time , another mixing of the measurement values may give a different measurement value , for example like according to the first embodiment example , whereto a sum of equally directed motion may be utilized . instead of superposition , any known kind of signal comparison may generally be used . fig3 shows a third embodiment example . it is adapted to be used to measure the distance or change of distance or approach velocity . the arrangement described in fig2 is used , but instead of tangential image shifts , a radial component of the image shift is measured . by means of a subtraction of both sensor signals , or generally a superposition of both measurement values , the radially counter - propagating portion of the shifts is filtered out . when approaching the object or the ground 2 , respectively , into position 4 ′, a visible spot 41 migrates into position 41 ′, and its image on the sensor 31 migrates from position 51 in radial direction to 51 ′. the same is true with respect to sensor 32 for the spots 42 , 42 ′ and the images 52 , 52 ′. due to the beam geometry , the measured angle difference migrates proportional to a change in distance , and inverse proportional to the square of the absolute distance . if the distance is approximately known , therefore can be measured the change , and , starting from the change signal , the longitudinal velocity . contrary to the distance measuring described earlier , it is not the absolute value of the distance , what is measured here , but the rate of change . further , it is not necessary here , that a different velocity be present in transverse direction , and that it be known . if the line of sight is directed vertically , there results the measuring of a rate of declining or rise , respectively . if , on the other hand , the velocity is approximately known , instead of the velocity , there may be determined the absolute distance by means of the same arrangement . since the measured value is quadratic to the reciprocal distance , the accuracy of the measured distance is twice as good as the one , up to which the velocity is known . if , for example , the velocity is known only up to ± 10 %, the measured distance accordingly only varies by 5 %. all described measurement methods for distances or approach velocities may be applied to detect collision , for example to anticipate or avoid the collision . besides the sum of the radial shift , there may as well be formed the difference , which means the sum of the equally directed translation . therefore , transverse movements with respect to the other two axes may be measured simultaneously . the measurement methods for rotation and approach described with reference to fig2 and 3 may be combined , in that the measurement values of both coordinates of each of the at least two shift sensors are analysed . fig4 shows a forth embodiment example . three sensors 31 , 32 , 33 are arranged in such a way , that their respective lines of sight are disposed in three different , for example orthogonal directions , wherein each sensor may have 2 directions of measurement . there result up to 6 measurement values . the lines of sight may be orthogonal , but do not need to be . to obtain a flight stabilising , all three lines of sight may be directed at the ground , like the feet of a tripod . the measurement values of the aslant lines of sight , by means of calculation mixing according to a rotational matrix , may easily be transformed into the straight coordinates relevant for control . by means of such an arrangement , there may be obtained an orientation with respect to all six spatial coordinates , and all components of the flight movement may be detected and stabilised . all measured values may be purged for the described influences caused by rotation , in that three independent rotation sensors are provided . the axes of rotation of these sensors may be aligned to the same vector system for the sake of simplicity . these independent rotation sensors may be obviated though . in order to compensate for a respective one of the sensors 31 , 32 , 33 , the signals of one or both of the remaining sensors are used , wherein these remaining sensors accordingly are used for rotation measurement , and their measured value is used as rotational signal to compensate the first sensor , using a compensation manner described earlier . generally , any arbitrary ones of the measurement methods described here may be combined . further , disturbing effects of a movement related component to the measuring of another motion related component may thereby be eliminated , in that another mixture of movements is measured with another sensor , and in that both signals are subjected to a comparison . movement related values may be measured in several degrees of freedom independent of each other , even if these degrees of freedom consist of combined movements , i . e . are not separated from each other . axes of movement or coordinates , respectively , do not necessarily have to be orthogonal to each other . since each sensor measures another mixture of movement related components , there may be done an un - mixing of the measured values into separate coordinates , in that the measured signals , by means of a suitable mixing according to the laws of vector geometry , are transformed into linearly independent , optionally orthogonal measurement signals . generally , an arbitrary number of sensors may be applied , and these may be aligned in differing ways . in addition , in order to analyse the signals of that sensors may be selected , that report a sufficient contrast . thereby , the probability of insufficient image details is reduced . for a regulation - control , the described transformation is not compulsory . generally , spatial coordinates of a movement may be measured and regulation - controlled in mixed form as well . by means of a suitable sensor alignment , the intended mixing may be defined . in case of the helicopter , an optical measuring of rotation may be applied for controlling the tail rotor . thereby , the line of sight may be directed aslant backwards and downwards . a combination of jaw axis rotation and lateral drift is measured then . in this way , the fuselage aligns itself into the flown direction , independent of wind . other flight instruments already commonly used for stabilising may be replaced as well . for example , in case of remote controlled models , the commonly used jaw axis gyro may be replaced by the measurement of rotation . further , instead of a variometer , an optical measurement of climbing rate according to fig3 may be used . in combination with commonly used instruments for measuring other motion related components , like for example the flight altitude ( barometer ) and the nose alignment ( compass ), a complete autopilot may be realised , which takes over the complete control . in case of gps - controlled applications , the accuracy , resolution and speed of the measurement may be substantially improved by supplementing with the optical measurement values , especially in the range close to ground . if illumination or contrasts from / of the ambiance are insufficient , the sensor signal may be erroneous . such errors mostly express themselves in form of shift values having a magnitude that is too small or completely missing , and which mostly occur locally , i . e . at singular locations . in order to increase the number of utilisable image locations , and to decrease dropouts , several sensors having different lines of sight may be provided , as already explained with reference to fig2 , 3 or 4 , to analyse the relations of the sensor signals with respect to one another . thereby , a shared measurement result may be created , in which sensors having a smaller measurement value are not weighted , or are weighted less . the term “ smaller ” may refer to the magnitude of the shift measurement value from one or several coordinates , and / or to a measured value , being outputted by the shift sensor , of the actual brightness and / or quality of contrast of the respective sensor . the quality of contrast can be determined and output by each single sensor separately . the shared measurement value may , for example , be created by means of maximal value formulation , by means of weighted average formulation or by means of a switching to the respective strongest sensor . advantageously the detection precision is increased as compared to a single sensor , since several sensors always complement one another if the contrast is insufficient . from a plurality of shift sensors , an array may be created , and the sensors may be connected with each other in a matrix net form , wherein the weighted result described here may be formed . further , a combination with signal analysis methods described with reference to fig2 , 3 and 4 is possible . this allows for a thorough analysis of the movements , which is far superior to a method based on analysis of a video signal , as far as speed is concerned . in order to avoid control errors , which might result in a disturbance of measurement , independently from the above named methods , or in combination therewith , in case the measurement signal is omitted , the regulation - control might be switched into another mode , in which no optical measurement signal is needed . the switching may be controlled by the absence of the measurement signal and / or the falling below a minimal contrast value and / or a minimal brightness . the switching of the regulating control may be effected , in that the weighting portions for the mixing of the actual values and measurement values participating in the mixing and the regulation - control may be reorganised in a suitable way , for example to a configuration , as it is known from the state of the art , without shift sensor , until the optical signal is again sufficiently present . in a simple special case thereof , the rotor inclination can be held horizontal , while the measurement signal is missing . an apparatus according to the described manner , or the manner described in the claims , may generally be used also for detecting or measuring relative movements between the device and an object of any kind distantly disposed thereto ( in measuring the change of angle of the direction of optical inclination of a virtual image ), whereby on the one hand , the optically sampled object may be moving , and / or on the other hand , as in the described case of the airborne object , that object or any body carrying the sensor device can move . since a scanned object may move , the device may be mounted fixed and unmovable . the sensor can drive a machine control . generally , it is only necessary that at least the chip of an opto - electronic shift sensor 3 provided with a plurality of photosensitive partial areas ( pixel ) and detecting shifts of optical structures , and outputting a measurement signal for the shift , and for this containing an analysing unit integrated on its chip , is combined with an imaging optical system 1 , and located such that optical structures of infinitely distant objects are imaged onto the light sensitive area of the sensor with a resolution sufficient for detecting an image shift . the sensor chip can be of the sort commonly used at optical mice , or of identical structure . as illumination , there may serve the ambient light . the contrasts necessary for shift - scanning may arise from the surface of the imaged object , or from the contours of one or several object ( s ) with respect to a background . in contrary to the operation of an optical mouse , the object may be smaller than the optical capturing range of the device , wherein this range is determined by the size of the light sensitive sensor area , the focal length and the scanning distance . the object may be transilluminated by the light necessary for scanning . here is a list of the applications possible therewith , when the scanned object is moving : an application is the detecting of the presence of moving objects , for example for automatic opening of gates for driving - in vehicles or entering persons , wherein in contrary to known optical sensors like photoelectric relays or light baffles , there is no restriction in the range of coverage . if the background is unstructured , the detected object may be substantially smaller than the optical detection range , which is determined by the size of the light sensitive sensor area . a further modification is the non - contacting measurement of velocities or rotations of moving objects or the measurement of the distance to moving objects . for example , the sensor may be directed to the transported material positioned on a conveyor belt . if the transport speed is known , from the optically measured shifting velocity , there may be obtained a measurement value for the height of the transported material , in that its reciprocal value is formed . further , continuous materials may be analysed with respect to freedom of error . depending on the state of the surface and on the illumination , an error can be detected as a detected structure or as a missing structure as well . contrary to commonly used imaging systems , a substantial saving in costs is possible . further , the velocity of liquids or gases can be measured on account of the floating particles carried along . a further application is , to have a visual representation , as for example of a display window , be dependent on the movement of a viewer . to this end , the viewer is optically scanned by means of the device . in that the face of a viewer is scanned , the problem of tracing ( head tracking ) known in connection with 3d image presentations , may be solved in a cost - effective way . the measurement signal of the shift sensor may be used as a measure of the shift of the head and / or the actual eye position . this signal may both , control the perspective of viewing of an image to be seen by a viewer , so that it corresponds to the head movement of the viewer , as well as control the exit direction of the exit pupils , being provided for separate eyes in case of a stereo - optical image representation , in order to obtain an entering into the correctly assigned eyes , also in case of head movements . in addition to the shift signals of the sensors , further measurement signals obtained from the sensor , like an illumination value or a contrast quality value may be analysed as well . this is advantageous in detecting transported material and in controlling machines . applications in case of moved sensor device : for robots and vehicles , also self - steering , namely for automatic steering by means of a regulation - control loop , as well as for distance detection and avoiding of collision . in this case as well , the movement may selectively be quantitatively measured , or only the presence of an object be detected , as for example a barrier . in case of lateral line of sight , the lateral distance , as for example with respect to a wall , may be measured and regulation - controlled . thereby , as actuator , the steering may be controlled , and allows for a driving along a barrier . instead of implementing the methods disclosed in the present application by means of electronic circuits only , said methods may also be carried out at least in part by software executed on a computer system and operable to perform at least some of the method steps .	6
[ 0021 ] fig1 shows a self - propelled combine 10 with a supporting frame 12 that is supported on the ground and moved by means of driven front wheels and steerable rear wheels 14 . the wheels 14 are set in rotation by a not - shown driving means in order to move the combine 10 over a field to be harvested . a harvesting assembly in the form of a cutting mechanism 16 is connected to the front end region of the combine 10 in order to harvest the crop standing in a field and to upwardly and rearwardly feed the crop to threshing and separating means via a feeder house 18 . the threshing and separating means comprise a transversely arranged threshing cylinder 20 and a concave 21 associated therewith . the harvested crop is initially fed to the threshing cylinder and concave . however , it would also be conceivable to omit the transversely arranged threshing assembly 20 and 21 and utilize a rotary threshing and separating assembly that is axially arranged . in this respect , it is possible to use only one axial separator or two ( or more ) axial separators arranged adjacent to one another . the separating assembly could also consist of straw walkers or separating drums that are arranged downstream of a threshing assembly 20 and 21 . in the illustrated combine 10 , a stripping roll 23 and a fed beater 22 cooperate with a feed housing to feed the threshed crop from the threshing assembly 20 and 21 to an axial separator 24 . the axial separator 24 is driven on its rear side by a gear 80 . in the following description , all directions such as front , rear , above and underneath refer to the forward driving direction v of the combine 10 . the grain and the chaff separated during the threshing process fall onto at least one screw conveyor 30 that feeds the grain and the chaff to a preparation bottom plate 33 . however , the grain and chaff emerging from the axial separator 24 fall onto a vibrating bottom plate 32 that conveys the grain and the chaff onto the preparation plate 33 . the preparation plate 33 conveys the grain and the chaff to a cleaning assembly 34 having sieves arranged therein , wherein a blower 36 is assigned to the cleaning assembly in order to promote the separation of the chaff from the grain . the clean grain is fed to a not - shown elevator by means of a clean grain auger 38 , and the elevator transports the grain into a grain tank 40 . a tailings auger 42 returns non - threshed crop parts to the threshing process by means of another not - shown elevator . the chaff is ejected on the rear side of the sieves onto a vibrating bottom plate 84 that carries out an oscillating movement . the cleaned grain can be unloaded from the grain tank 40 by means of an unloading system with transverse screw augers 44 and an unloading auger 46 . the aforementioned systems are driven by an internal combustion engine 48 that is controlled by an operator from a driver cab 50 . the different threshing , conveying , cleaning and separating assemblies are situated within the supporting frame 12 . a first crop residue stream that essentially comprises threshed crop residues ( straw ) is downwardly ejected from the axial separator 24 that serves as the separating assembly ( or one of the other alternative separating assemblies mentioned above ), through an outlet 64 on the underside of the rear end of the rearwardly closed axial separator 24 . the crop residues fall into a vertical ejection shaft , the front of which is defined by a front wall 62 . an ejection drum 66 with drivers 67 distributed over its circumference is arranged beneath the outlet 64 . the rear of the ejection drum 66 is enclosed by a rear wall 86 . the ejection drum 66 is set in rotation about its longitudinal axis that extends transverse to the driving direction by an assigned drive , namely in the counterclockwise direction in fig1 . a straw guide element 68 that can be pivoted in its entirety about the axis of rotation of the ejection drum 66 adjoins the front wall 62 at approximately half its height , namely underneath the axis of rotation of the ejection drum 66 . the straw guide element 68 can be pivoted about this axis between the swath laying position illustrated in fig1 a and 4 a and the chopping position illustrated in fig5 a . a generally known straw chopper 70 is arranged in a housing 72 beneath and slightly to the rear of the ejection drum 66 . this straw chopper can be set in rotation ( in the counterclockwise direction in the figures ) about a horizontal axis that extends transverse to the driving direction by means of a suitable drive and said chopper comprises a cylindrical body with chopping knives suspended thereon in a pendulum fashion . these chopping knives cooperate with stationary knives arranged in the housing 72 in order to chop and distribute the crop residues on the field over approximately the cutting width of the cutting mechanism 16 by means of a straw distributing shroud 74 that is equipped with straw guide plates 82 . one part of the housing 72 extends above the straw chopper 70 in the form of a circular arc , namely from the front end of the straw distributing shroud 74 to a point that approximately lies above the axis of rotation of the straw chopper 70 as shown in fig1 a , 4 a and 5 a . the straw guide element 68 is curved in a concave fashion ( and in the shape of a circular arc ) and concentrically surrounds the ejection drum 66 for an angle of approximately 45 degrees . the straw guide element is coupled to the supporting frame 12 of the combine 10 in a pivoted fashion on its outer ends in the transverse direction . in the swath laying position shown and fig1 a and 4 a , the straw guide element 68 extends from the front wall 62 to a point that approximately lies above the axis of rotation of the straw chopper 70 . in this position , the straw guide element 68 conveys the threshed crop residues from the ejection drum 66 transversely rearward and downward beneath the ejection shroud 76 . the underside of the ejection shroud 76 is , just like the straw distributing shroud 74 , provided with straw guide plates 78 in order to define the width of the swath of crop residues being laid down . the vibrating bottom plate 84 extends rearward and upward from the lower rear end of the cleaning assembly 34 to a chopper inlet 88 that is in the form of an opening between the lower end of the front wall 62 of the ejection shaft and the upper end of the housing 72 of the straw chopper 70 , wherein said opening extends over the width of the ejection shaft and the straw chopper 70 . according to fig2 the vibrating bottom plate 84 is connected to a suitable drive , such as a cam , so that it carries out an oscillating back and forward movement along its longitudinal direction similar to the vibrating preparation plate 32 . this is indicated by the arrows 92 . the vibrating bottom plate 84 is provided with sawtooth - shaped steps 90 as shown in fig2 or another suitable surface structure . this causes the chaff and other chopped straw fractions which are delivered onto the vibrating bottom plate 84 from the rear end of the cleaning assembly 34 under the influence of the blower 36 and through gravitational force in the form of a second crop residue stream to travel rearward and upward on the vibrating bottom plate 84 until they are conveyed through the opening 88 and into the straw chopper 70 . the straw chopper 70 also operates in the position of the guide plate 68 illustrated in fig1 a and 4 a . in this case , the straw chopper conveys the chaff and the chopped straw fractions , wherein the conveying effect suffices for conveying the chaff and the chopped straw fractions along the straw guide plates 82 and for ejecting them behind the combine 10 onto the field . the straw guide plates 82 of the straw distributing shroud 74 are coupled to the straw distributing shroud 74 such that they can be pivoted about axles 94 that extend transverse to their longitudinal axis and the crop conveying direction . the pivoting axles are approximately situated on the rear ends of the straw guide plates in the embodiment shown . the straw guide plates 82 can be adjusted manually or in a remote - controlled fashion from the driver cab 50 , namely by means of suitable actuators in the form of electric or hydraulic motors that , in particular , are controlled by suitable sensors that automatically ensure the desired width of distribution . the straw guide plates 82 can be moved in this fashion between the broad laying position shown in fig3 b and the swath laying position shown in fig4 b . in the broad laying position ( fig3 b ), the rear ends of the straw guide plates 82 point outward and the two central straw guide plates 82 contact one another on their front ends such that the chaff is prevented from being conveyed into the swath and the chaff is distributed on both sides and outside the swath of straw laid down in the swath laying mode , namely over approximately the width of the cutting mechanism 16 . the arrows in fig3 b indicate that the straw can be harvested without a chaff fraction . in the swath laying position ( fig4 ), the straw guide plates 82 extend in the forward driving direction v of the combine 10 . the chaff is blown into the straw swath in the form of a swath , the width of which approximately corresponds to the width of the straw swath , such that a swath consisting of a straw / chaff mixture is laid down as indicated in fig4 a and 4 b . the chaff could also be laid down beneath the straw swath by manually or mechanically pivoting the straw distributing shroud 74 downward about the horizontal axle that extends transverse to the forward driving direction v at its coupling point on the housing 72 of the straw chopper 70 . in the swath laying mode , it would also be conceivable to move the straw guide plates 82 into a position , in which the chaff is distributed over the field . in this case , part of the chaff also is laid down underneath the straw swath analogous to the position illustrated in fig5 b . in the chopping position , the straw guide element 68 is pivoted rearward ( in the clockwise direction referred to fig1 ) about the axis of rotation of the ejector drum 66 as shown in fig5 a . this causes an opening to be formed between the front wall 62 and the front edge of the straw guide element 68 , wherein the crop residues are introduced into the straw chopper 70 through this opening . in this position , the straw guide element 68 extends the rear wall 86 downward and forward . if the straw guide element is in the swath laying position , the front wall 62 , in its region below the line at which the straw guide element 68 adjoins , could also be provided with guide skids 84 in order to introduce the crop residues into the straw chopper 70 in the most uniform fashion possible . the straw and the chaff are chopped in the straw chopper 70 and ejected transversely rearward and downward such that they are distributed on the field over the operating width of the cutting mechanism 16 as indicated by the arrows in fig5 b . the straw guide element 68 can be moved between the swath laying position and the chopping position by means of a manually actuated mechanism or suitable motors that are preferably remote - controlled from the driver cabin 50 . it would be conceivable to provide buttons or menus that make it possible to simultaneously adjust the straw guide element 68 and the straw guide plates 82 such that any of the operating positions of the straw guide element 68 and the straw guide plates 82 which are illustrated in fig3 and 5 can be selected by pressing only one button or selecting only one operating mode on a screen . having described the illustrated embodiment , it will become apparent that various modifications can be made without departing from the scope of the invention as defined in the accompanying claims .	0
referring now to fig1 ( a ) and 1 ( b ), there is illustrated schematic block diagrams showing a principal configuration of a talking timepiece embodying the present invention . in one preferred embodiment of the present invention , linguistic information codes indicative of words to be audibly displayed ( for example , &# 34 ; tadaima &# 34 ;, &# 34 ; kara &# 34 ;, &# 34 ; go &# 34 ;, &# 34 ; ji &# 34 ;, &# 34 ; ni &# 34 ;, &# 34 ; jyu &# 34 ;, &# 34 ; go &# 34 ;, &# 34 ; fun &# 34 ;, &# 34 ; wo &# 34 ;, &# 34 ; oshirase &# 34 ;, &# 34 ; shimasu &# 34 ;, etc .) and pause codes necessary for the establishment of pause or silent slots are stored within an audible output information storage on the order in which the linguistic information codes and the pause codes should be delivered in sequence . in reply to the linguistic information codes and the pause codes , its corresponding audible outputs with desired pause periods or slots are delivered . each of the linguistic information codes and the pause codes is 8 - bit long and the latter comprises a first half portion ( upper 4 bits ) indicative of the pause codes itself and a second half portion ( lower 4 bits ) indicative of the length of the pause periods . in other words , according to the above embodiment , the length of the respective pause periods is variable by modifying the contents of the second half portion of the pause codes . an audible output storage 1 of fig1 ( a ) stores the linguistic information codes and the pause codes on the order in which they are outputted therefrom . the storage 1 may be implemented with either a read only memory where information is contained in a fixed manner or a read write memory where audible output information may be introduced therein by the use of a discrete control device whenever time to announce is approached . the above illustrated uses the latter . an example of information contained within the audible output storage 1 is depicted in fig2 ( a ) and 2 ( b ) wherein pa1 to pa5 represent the pause codes . as described above , the pause codes each comprises the first half portion (&# 34 ; 1100 &# 34 ; in the more significant 4 bits ) indicative of the pause code itself and the second half portion (&# 34 ; 0001 &# 34 ;, &# 34 ; 0011 &# 34 ;, &# 34 ; 0100 &# 34 ;, &# 34 ; 0101 &# 34 ;, etc , in the less significant 4 bits ) indicative of the length of the pause periods . provided that p1 is the pause code indicative of the pause period of 200 msec long , pa3 , pa4 and pa5 will be those indicative of the pause periods of 600 msec , 800 msec and 1 sec long . the initial address of the storage 1 is labeled ai and the final address af . in the illustrated example , the linguistic information code and the pause codes are stored in an address region beginning with the initial address ai and ending with a specific intermediate address am , while the remaining address region from a m + 1 up to af is blank ( that is , &# 34 ; 00000000 &# 34 ;). the audible output storage 1 has its peripheral circuits such as an address counter 2 and an address decoder 3 . a switching device 4 for indicating that the delivery of audible outputs is to start is turned on in response to an audible output start signal and the like , loading the address counter 2 with the initial address and supplying an adder 5 with a start instruction signal . upon receipt of the start instruction signal the adder 5 increments one the address counter 2 whenever an end signal s 2 is derived from an audible output control and an audible output pause control as will be discussed later , the end signal being developed when the delivery of the audible information outputs or the pause periods are completed . each time the signal s 2 is developed the address of the output storage 1 is incremented step by step . an output buffer 6 temporarily stores the linguistic information codes and the pause codes derived from the audible output sorage 1 in response to the address specified by the addrees counter 2 . the audible output control for allowing corresponding linguistic outputs to be delivered in sequence according to the contents output sequentially to the output buffer 6 is illustrated in fig1 ( b ) as well as the audible output pause control for prohibiting the audible outputs from being delivered in response to the pause codes outputted from the output buffer 6 . a sound quantizing information storage ( read only memory ) 7 is adapted to make verbal words corresponding to the linguistic information codes audible to human beings . in order to display a word in the form of audible sounds , it is necessary to provide a plurality of pieces of the sound quantizing information vqc . a first region a for storing the pieces of the sound quantizing informatin vqc on the order in which these pieces are to be delivered and a second region b for storing an end code located at a step following the final step of the first region a form an information storage region for the audible voice delivery relating one word ( see fig3 ). the sound quantizing information storage 7 has an address counter 8 and an address decoder 9 . a codes converter 10 provides an address selection signal ( specifying the leading step of the region where information is stored for displaying words corresponding to the linguistic information codes output via the output buffer 6 in the form of audible sounds and particularly synthesized voices ) for the address counter 8 and a reset signal gr for a flip - flop 11 under the direction of a signal s 1 developed from the output buffer 6 of the audible output information storage 1 when the signal s 1 is one of the linguistic information codes . the situation when the signal s 1 is the pause codes or the blank codes &# 34 ; 00000000 &# 34 ; will be described later . when the address selection signal from the code converter 10 is applied to the address counter 81 the address counter 8 is decremented by &# 34 ; 1 &# 34 ; at an appropriate interval of time . the decrementing of the address counter 8 is accomplished by a subtractor 12 . accordingly , when the address counter 8 receives the address selection signal , the sound quantizing information is derived in sequence beginning with the second leading step specified by the address selection signal . an output gate circuit 13 is provided for the sound quantizing information storage 7 and adapted to be turned on when the flip - flop 11 is in the reset state ( in other words , when the information applied to the code converter 10 is one of the linguistic information codes ). a digital - to - analog converter 14 converts the sound quantizing information supplied via the output gate circuit 13 into corresponding analog signals . a low - pass filter 15 receives the output of the digital - to - analog converter 14 and passes only its low frequency components . a speaker driver 16 receives the output from the low - pass filter 15 and drives a loud speaker 17 for the delivery of audible outputs . the reason why the low - pass filter 15 is provided is that , when the analog output converted from the sound quantizing information is stepwise , this will cause noisy or harsh sounds due to its high frequency components as long as the analog output is applied directly to the loud speaker 17 . an end code detector 18 senses the end code from the sound quantizing information storage 7 and develops the end signal s 2 . the end signal s 2 , as described previously , is supplied to the adder 5 to increment the address counter 2 of the audible output storage 1 by one and is also supplied to the reset circuit 19 for resetting the address counter 8 , thus terminating the delivery of the audible sounds . with the address counter 8 in the reset state , the sound quantizing information storage 7 is neither addressed nor does the subtractor 12 operate for decrementing operation . with such an arrangement , the audible sounds indicative of selected words are delivered according to the linguistic information storage codes from the audible output storage 1 . in the case where the information derived from the audible output storage 1 is in agreement with the pause codes , the length of the pause periods where the audible outputs are prohibited is determined in the following manner . when the output signal s 1 from the output buffer 6 of the audible output storage 1 is in the pause codes , the code converter 10 supplies the set signal gs to the flip - flop 11 . the output gate circuit 13 of the sound quantizing information storage 7 is closed to inhibit the transmission of the sound quantizing information therefrom . the code converter 10 decodes the lower 4 bits ( specifying the length of the pause periods ) of the pause codes into its corresponding codes which in turn are supplied to the address counter 8 for decrementing the same by one . the information stored at the address of the sound quantizing informatin storage 7 as specified by the count of the address counter 8 is sequentially derived . however , since the output gate circuit 13 is closed , any audible output is not provided . an address counter detector 20 senses if the count of the address counter 8 reduces to &# 34 ; 0 &# 34 ; and , if so , supplies the signal s 2 to the adder 5 to increment the working address of the audible output storage 1 by one . for example , provided that the decrementing of the address counter 8 is achieved &# 34 ; n &# 34 ; for a period of time of 200 msec , the code converter 10 supplies the code signal indicative of &# 34 ; n &# 34 ; to the address counter 8 when the pause codes are pa1 . when the pause codes are pa2 , pa3 , pa4 , pa5 . . . , the code signals indicative of &# 34 ; 2n &# 34 ;, &# 34 ; 3n &# 34 ;, &# 34 ; 4n &# 34 ; and &# 34 ; sn &# 34 ; are likewise supplied to the address counter 8 . the above procedure puts a temporary stop to the delivery of the audible sounds . moreover , when the code output from the audible output storage 1 is blank , the code converter 10 supplies the end signal s 2 . the above disclosed arrangement will operate as follows : when the switching device 4 is turned on , the address counter 2 is loaded with the initial address for the audible output storage 1 . if the count of the address counter 2 agrees with the file address of the storage 1 , then the address counter will overflow and return to &# 34 ; 0 &# 34 ;. with the switching device 4 in the on state , the initial address ai of the audible output storage 1 is selected so that the linguistic information codes &# 34 ; 10010111 &# 34 ; indicative of &# 34 ; tadaima &# 34 ; are supplied to the output buffer register 6 . in reply to those codes the code converter 10 supplies the leading address identifying signal to the address counter 8 in relation to the region where the sound quantizing information is contained for the audible sounds &# 34 ; tadaima &# 34 ;. thus , the sounds &# 34 ; tadaima &# 34 ; are delivered . upon the completion of the delivery of that audible sounds the adder 5 receives the signal s 2 to increment one the count of the address counter 2 . when this occurs , the pause codes pa1 &# 34 ; 11000001 &# 34 ; are supplied to the output buffer register 6 to initiate the silent period of 200 msec long . then , the adder 5 receives the signal s 2 and increments by one the count of the address counter 2 so that the linguistic information codes &# 34 ; 10011000 &# 34 ; indicative of &# 34 ; kara &# 34 ; are output from the output buffer register 6 . through the above mentioned events the audible sounds &# 34 ; tadaima kara goji nijyugofun wo ashiraseshimasu &# 34 ; are delivered . while in the above illustrated embodiment the switching device 4 is turned on by the sound output start signal automatically developed within the interior of the timepiece , it may be turned on manually in the practice of the present invention . since the length of the pause periods is variable by a proper selection of the contents of the second half ( lower 4 bits ) of the pause codes , the speed of the voice delivery is also variable according to the contents to be announced by a proper selection of the second half of the pause codes . the pause codes are effective in establishing a short pause during the delivery of a double consonant such as &# 34 ; ippun &# 34 ; and &# 34 ; roppun &# 34 ; in addition to the above illustrated example . by way of an example of &# 34 ; ippun &# 34 ; or &# 34 ; roppun &# 34 ; the pause codes pa may be interposed between the linguistic information &# 34 ; i &# 34 ; or &# 34 ; ro &# 34 ; and the linguistic information &# 34 ; pun &# 34 ;. although in the above embodiment , the pause codes of different kinds are provided for the establishment of pause periods of different lengths , only one pause code may be rather employed to establish phase periods of the fixed length and a combination of a plurality of the common pause code used for a pause period of any desirable length . whereas the present invention has been described with respect to specific embodiments thereof , it will be understood that various changes and modifications will be suggested to one skilled in the art , and it is intended to encompass such changes and modifications as fall within the scope of the appended claims .	6
referring firstly to fig1 of the drawings , a client unit formulates a query and sends the query to a database server . the database engine running on the database server builds a table of results , which is sent back to the client unit for subsequent processing or analysis in answer to the query . fig1 shows three possible points for sampling the result obtained from the database . preferably , sampling is performed at one of the first two points , i . e . ( i ) as the database engine builds the table of results or ( ii ) after the table of results has been completed but before it is sent back to the client . this ` server - end ` sampling minimises the quantity of data to be transmitted back to the client , and correspondingly reduces the transmission time and / or bandwidth . however , it is possible to employ ` client - end ` sampling at the third point shown in fig1 i . e . before or during the loading of the results table into an analysis tool running on the client unit . in the sampling routine illustrated in fig2 input is a stream of records received , for example , from a file , from a communication device , or from a database query engine either singly or in groups . output is a stream on which the sampled records can be written , for example , to a file , to a communication device , or to a program designed to analyse the sampled result . before executing the sampling routine , a sampling rate is selected . this is the intended ratio of the number of records read from input to the number of records written to output . for example , if the sampling rate is set at 100 then , on average , one record will be written to output out of every 100 records that are read from input . at the start of the sampling routine , while records remain in input , the next record is obtained from input and r , a randomly - generated real number between 0 and 1 , is set . thereafter , r is compared with s , a real number being the reciprocal of the sampling rate . if r is less than s , the record read from input is written to output but , if r is greater than or equal to s , the record read from input is discarded . finally , in each case , the sampling routine reverts to the start and continues to iterate through the loop until no more records are available in input . on each iteration through the loop , the sampling rate ( and therefore s ) remains constant while r is renewed , i . e . a new random number is generated and set as r for every record read from input . this ensures a truly random selection of records from input . a sampling algorithm ( in this case , a c code fragment ) effecting the abovementioned sampling routine is as follows : ______________________________________ \* random ( ) returns a random number between 0 and 1samplerecord ( ) writes out the current record and increments to the nextskiprecord ( ) skips the current record and increments to the next \ records = 0 ; threshold = 1 . 0 / sampling rate ; while ( morerecords ( )) { records = records + 1 ; if ( random ( ) & lt ; threshold ) samplerecord ( ) else skiprecord ( )}; printf (&# 34 ;% d \ n &# 34 ;, records ); ______________________________________ in an alternative sampling routine , random records in the initial result stream may be sampled . such an algorithm involves the generation of random skip count integers with a predetermined mean equal to the desired overall sampling rate . each successive random integer determines the number of records from the input stream to skip , before examining a record . after skipping the required number of records , the next record from the input stream is selected and written to output . while a constant skip count is possible it can yield biased results , if there are any periodic patterns in the data being sampled , that are integral multiples of this skip count . whilst it is desirable to sample data that has not been operated on in any way , for example , by averaging or aggregating , since such operations can lose data that may be important in subsequent analysis , it is still necessary to have a technique for accurately sampling this data , as in some cases , only data in such a form is available from the database . the original number of records nrec averaged or aggregated to produce the averaged or aggregated result record is recorded . in order to sample data in this form correctly , each record is treated as nrec identical records . where the sampling rate is n and f is the total number of records in the initial result , this algorithm produces data in f / n rows , the total number of rows being recorded together with the sampled result so that the results of further analysis can be correctly scaled . if , for example , a sampled result of 1000 records includes 900 records that meet a particular criterion , one would expect 90 % of the initial result also to meet that criterion , e . g . approximately 900 , 000 records out of 1 million . in analysing the sampled result , various techniques common in statistics can be employed . for example , one can derive the confidence interval of the sampled result ( e . g the 95 % confidence interval ), as follows . if samples are divided in accordance with a given criterion , such that sc samples out of s samples match that criterion , the probability p of a record matching the criterion is : if the total number of records from which the sample s was drawn is f , then the estimated number of records matching the criterion , fc , is : if , for example , f is 20000 and a sample of f records estimates that fc is 8000 ( i . e . that 8000 of the 20000 total number of records are estimated to meet the criterion ), the graph shown in fig3 can be drawn to show the probability that the estimate is correct . the curve depicted in fig3 can be assumed to represent a normal distribution . for the normal distribution , a 95 % confidence interval represents approximately 1 . 96 times the standard deviation . the standard deviation being the square root of the variance and sc being assumed to be much smaller than s , the percentage error of fc in a 95 % confidence test is : in this case , as sc is 40 , the % error on the estimate is 196 √( 1 / 40 )≈ 31 % 31 % of 8000 is 2480 , thus enabling 95 % confidence that the true number of records meeting the criterion is between 5520 and 10480 . analysing the sampling data in order to draw conclusions about process performance , is accomplished by the general algorithm illustrated in fig4 . the data may be filtered so that only part of the data is considered . filters are generally constructed to perform subsequent analysis based on the sampled records and identify the subset of the data corresponding to the area of interest . for example , a filter may select a particular ` sales region ` so that ` sales by product for a particular sales region ` can be analysed . the sampled records which match the filter are grouped by selected attributes , for example , by ` division `, ` product `, ` sales region ` or ` division and product `. values from sampled record attributes or values that can be computed therefrom , are accumulated by grouping as each filtered sample is examined . once all the sampled records have been considered , the resulting accumulated values are scaled to compensate for the fact that the data has been sampled . different scaling functions yield estimated totals , averages , record counts and variances for each category . the groupings can finally be displayed graphically . a specific algorithm ( in this case , a c code fragment ) effecting the above mentioned analysis routine is as follows : __________________________________________________________________________ / f the total number of records from which the sample was drawns the total number of sampled recordsmatchesfilter ( filter , sampledrecord ) true if the sampledrecord matches the filter functioncreatekey ( categorycolumnindices , sampledrecord ) creates a key using the selected columnsretrievevaccum ( key ) retrieves value - accumulator associated with key ( accumulator is created and initialized to zero when first retrieved ) firstvaccum ( ) initializes the value - accumulator iterator so that nextvaccumu ( ) will return the first one . morevaccums ( ) true if the value - accumulator iterator has not yet reached the end of the value - accumulator collection . nextvaccum ( ) retrieves the next value - accumulator in the collection , and increments the value - accumulator iterator . sortvaccums ( ) sorts value - accumulators according to their scaled values . plotbarchart ( ) plots a bar chart with a bar for each value - accumulator key , with height equal to the value - accumulator scaled value / plothistogram ( filter , categorycolumnindices , valuecolumnindex , sampledrecords ) for ( recordindex = 0 ; recordindex & lt ; s ; recordindex ++) { \ does record match filter criterion \ if ( matchesfilter ( filter , sampledrecords recordindex ! )){ key . sub .-- t key ; vaccum . sub .-- t * vaccum ; float value ; \* aggregate data by selected category and accumulate selected values \ key = createkey ( categorycolumnindices , sampledrecords recordindex !) value = sampledrecords recordindex ! valuecolumnindex ! ; vaccum = retrievevaccum ( key ); vaccum . n = vaccum . n + 1 ; vaccum . sum = vaccum . sum + value ; vaccum . sumsquared = vaccum . sumsquared + ( value value ); } } \* scale accumulated values \ firstvaccum ( ); while ( morevaccums ( )){ vaccum . sub .-- t vaccum ; vaccum = nextvaccum ( ); vaccum . scaledvalue = f * ( vaccum . sum / s ); } \* sort values and plot histogram *\ sort vaccums ( ); plotbarchart ( );} __________________________________________________________________________ if subsequent analysis is based upon the sampled records , such that further estimates are based upon or derived from the estimates initially obtained , the variance of the further estimates will be larger than that of the initial estimates . this increased variance may be offset to some extent by weighting the probability of sampling each record in accordance with the contents of a field relating to the further estimates . the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof and , accordingly , reference should be made to the appended claims rather than to the foregoing specification as indicating the scope of the invention .	8
it shows first phalange 1 , second phalange 2 , third phalange 3 , first tendon 4 , second tendon 5 , activating rod 6 and rod &# 39 ; s guiding pin 9 . each phalange has a clevis at one end and one ear at the other end . guiding pin 9 is placed with loose in the round holes made across the ears placed on the palm structure and has a role to allow side movements of the upper part of the rod while restricting undesirable side movements of the lower part of the rod . the driving rod protrudes with the loose through the hole made across said pin 9 . this will allow for the unrestricted up and down movement of the driving rod . on the palm structure are shown two more single ears for mounting the neighboring fingers . it shows all elements and describes the mechanics of the presented invention . it shows driving rod 6 placed in the clevis of the first phalange 1 and connected to that phalange by the pin 12 which is press fitted in the clevis and loose in the rod . in the middle of the first phalange 1 there is an opening through which protrudes firs tendon 4 . said tendon 4 can be anchored to the back of the palm structure or , as shown here , can be connected to the adjustable rod 7 . the other end of the tendon 4 is firmly connected to the front of the second phalange 2 by an any means of the firm connection , and depending on the materials used , it can be glued , thermo integrated with the second phalange &# 39 ; s material , connected by a mechanical fasteners and as such . the same connection applies to the both ends of the second tendon 5 which is permanently anchored to the back of the first phalange , protrudes through the middle opening of the second phalange and is firmly connected to the front of the third phalange 3 . the similar fastening will also apply to the lower end of the flat spring 8 which is permanently connected to the back of the first phalange . the upper end of said spring 8 protrudes through the slot placed at the back of the third phalange . the role of the spring is to straighten second and third phalanges upon up movement of the rod 6 . the spring can be single flat or multiple flats depending on the version of the prosthetic hand and the flexibility of the flesh imitating material . pins 10 connect firs phalange to the palm structure and the second phalange to the first phalange . the smaller pin 11 connects phalange 3 with phalange 2 . the pins are press fitted in the devises and having a loose in the ears . upon the movement of the first phalange initiated by the down moving rod 6 the first tendon 4 will be stretched because it &# 39 ; s lower end is not attached to the pivot point of the phalange 1 but to an element behind . this tension of the tendon will initiate movement of the second phalange . similarly the movement of the third phalange will be initiated by the stretch of the second tendon upon movement of the second phalange . the length of the tendons as well as a shape of the lower back of the first and the second phalanges will determine amount of the stretch of the tendons and therefore will determine degree of the movement of the phalanges . the tension of the first tendon can be also adjusted by the down or up movement of the rod 7 and will apply mostly to the thumb finger because thumb for most of the grips , has a different timing for closing than remaining four fingers . it is believed that for all fingers the third phalanges degree of movement don &# 39 ; t need any adjustments as they are moving in the strict relation with the second phalanges except for the thumb again . but in order to accommodate for the fundamental movements steering elements for all the fingers in the arm limited space , some secondary functions are intended to be abolished as the goal of this invention is not to create perfect human prosthetic hand but rather more simple , yet practical , reliable and affordable one . it shows first and second phalanges clevises and ears configuration at the pivot point . they are shaped to make a contact in the point p and keep phalanges in the straight position when open and prevent them from over bending by the action of the spring 8 . it shows adjustable rod 7 and the lower end of tendon 4 . it shows the one of many possible connections between them throughout pin 11 which is press fitted in the rod &# 39 ; s clevis . it is the section throughout guiding pin 9 and protruding across it activating rod 6 shown and described previously on fig1 . the same mechanism is used also in the massaging device fig7 for connecting fingers 24 and 25 with disc 23 . it is the cross section of the top of the third phalange 3 . it shows slot at the back of phalange throughout which protrudes spring 8 . it shows the massaging device installed in the back of the chair . it shows all the parts used and describes mechanics of said massaging device . cylinder 21 is threaded on its outside bottom diameter and is fastened to chair &# 39 ; s structure by nuts 27 . special washers 28 are having unparallel surfaces on both sides what allows to adjust device &# 39 ; s mounting angle on the chair . inside cylinder 21 is placed piston 22 sealed with o rings 14 . the bottom boss of the piston 22 is out of round to accommodate for the gripping tool during assembly . under the bottom of the piston is placed spring 26 and washers 20 and 30 . inner wall of the lower end of the cylinder 21 has thread to connect closing plug 29 . connection is sealed by gasket 17 . in upper part of the cylinder there is threaded side hole in which is placed nozzle 19 . hose 16 is attached to the nozzle and secured by clip 18 . upper part of the cylinder 21 has a bigger diameter to accommodate for the fingers 24 and 25 as well as the driving disc 23 . said driving disc 23 is round and is guided with loose in the round opening made in the upper end of cylinder 21 . disc 23 has two slots opposite to each other and two round holes across the slots . in said across holes are placed with loose guiding pins 13 which have round holes across them . disc 23 has a threaded hole in the centre and is connected through it with the rod of the piston 22 . cylinder 21 has a hole in the centre between the lower and the upper part of the body . through this hole protrudes piston &# 39 ; s 22 rod and it is sealed with the o ring 15 . two slots opposite to each other are made in the wall of the upper body of the cylinder 21 . in those slots are placed fingers 24 and 25 which are connected to the body of said cylinder 21 with the pins press fitted in the across holes . this connection is the same one than between the finger and the palm structure and was earlier described on fig1 and fig2 . also the finger 24 is the same than earlier described on fig1 , fig2 , fig3 and fig6 . the only difference is that the clevis to connect activating rod at the front of the lower end of first phalange is eliminated and this part of the phalange is shaped into the round pin . those round pins placed at the bottom of the fingers 24 and 25 are protruding with loose through across holes of the guiding pins 13 . said guiding pins 13 are acting the same way than earlier described on fig1 and fig5 guiding pin 9 . they will turn in their round holes of the disc 23 during up and down movement of said disc what will allow for sliding in them round bottom pins of the fingers 24 and 25 and therefore allow unrestricted movement of the fingers . described above two fingers are intended to imitate pinching action of the thumb and the index or the thumb and the middle finger . one or two more slots can be added though to the upper wall of the cylinder 21 as well as to the driving disc 23 and one or two more fingers or specifically shaped claws can be accommodated into these slots . such a device can be attached to a tip of mechanical arm or a manipulator . the presented here massaging device is powered preferably by pressurized air what will allow to install multiple units in a chair or other structure and operate them by a single pump . the air supplied through hose 16 will drive piston 22 down and together with it will drive down disc 23 . down movement of the disc 23 will create closing action of the finger 24 and finger 25 together with the bending action of the finger 24 as per previous description . the opening of the fingers is done by the action of compressed spring 26 upon release of the air pressure . it shows skeleton of the finger and both tendons in the straightened inactive position as well as a bare skeleton of the finger in the closing position . this figure is intended to clarify the fingers bending mechanism . the entire finger without tendons from the first upward position to the second lower position would rotate about point a . point c of the second phalange where upper end of the first tendon attaches would move along the arc defined by radius r and in lower position would take location c 2 . point c of the upper end of the first tendon will rotate about point b along the arc defined by radius r 1 and in the lower position will take location c 1 forcing therefore point c 2 to move along the arc defined by radius r to the location c 1 where the arcs of radius r 1 and radius r intersect . the same principle applies toward rotation of the third phalange upon stretching of the second tendon and it is very characteristic to this design that top phalange will be bending spontaneously with the middle phalange just like in our human fingers where it is very difficult or impossible to bend middle digit without bending top digit at the same time .	0
the present invention involves an apparatus comprising a first container and a second container , and a conduit interconnecting the first container with the second container ; and having interposed between the first container and the second container , at least one porous medium including a leucocyte depletion medium , a red cell barrier medium , an assembly comprising a leucocyte depletion medium and a red cell barrier medium , or combinations thereof . in a preferred form of the filter of the subject invention , the fibers of which the filter element is composed are modified by grafting thereon a mixture of two monomers , one containing hydroxyl groups and another containing anionic groups , such as carboxyl groups , with the hydroxyl groups present in larger numbers . as described in u . s . pat . no . 4 , 880 , 548 , herein incorporated by reference , the filter media of this invention are preferably surface modified using a mixture comprising hydroxyl - terminated and carboxyl - terminated monomers . in a preferred form of this invention , the monomers are respectively hydroxyethyl methacrylate ( hema ) and methacrylic acid ( maa ), and the monomer ratios are preferably in the range ( carboxyl : hydroxyl ) of about 0 . 01 : 1 to about 0 . 5 : 1 , and more preferably in the range of about 0 . 05 : 1 to about 0 . 35 : 1 . a preferred monomer ratio is one which produces a desired zeta potential at the ph of plasma ( 7 . 3 ) of about - 3 to about - 30 millivolts , a more preferred ratio produces a zeta potential of about - 7 to about - 20 millivolts , and a still more preferred ratio produces a zeta potential of about - 10 to about - 14 millivolts . the cwst of the filter elements made with the pbt fibers according to this invention have a cwst as formed of about 50 to about 54 dynes / cm , and most or all other fibers which may be used have a cwst below 55 dynes / cm . surface grafting using the monomers noted above causes the cwst of the fibers to increase , the exact value obtained being dependent on the ratio of the two monomers . a preferred range for the cwst of the devices of this invention is about 70 to about 115 dynes / cm , a more preferred range is about 90 to about 100 dynes / cm and a still more preferred range is about 93 to about 97 dynes / cm , these ranges being obtained by varying the ratio of carboxyl - terminated and hydroxyl - terminated monomers . although the fibers of the porous medium may remain untreated , they are preferably treated to make them even more effective . for example , the fibers may be surface modified to increase the critical wetting surface tension ( cwst ) of the fibers . as disclosed in u . s . pat . no . 4 , 880 , 548 , the cwst of a porous medium may be determined by individually applying to its surface a series of liquids with surface tensions varying by 2 to 4 dynes / cm and observing the absorption or non - absorption of each liquid over time . the cwst of a porous medium , in units of dynes / cm , is defined as the mean value of the surface tension of the liquid which is absorbed and that of the liquid of neighboring surface tension which is not absorbed within a predetermined amount of time . the absorbed and non - absorbed values depend principally on the surface characteristics of the material from which the porous medium is made and secondarily on the pore size characteristics of the porous medium . liquids with surface tensions lower than the cwst of a porous medium will spontaneously wet the medium on contact and , if the medium has through holes , will flow through it readily . liquids with surface tensions higher than the cwst of the porous medium may not flow at all at low differential pressures and may do so unevenly at sufficiently high differential pressures to force the liquid through the porous medium . in order to achieve adequate priming of a fibrous medium with a liquid such as blood , the fibrous medium preferably has a cwst in the range of about 53 dynes / cm or higher . the number of carboxyl groups per unit of surface area appears to have an important effect on the adhesion of platelets to fiber surfaces . this effect is reflected in the proportion of platelets recovered in the filter effluent as a fraction of the number present in the platelets prior to filtration . platelet recovery peaks at the optimum proportion of maa . the number of carboxyl groups per unit of fiber surface is , over the range of interest of this invention , thought to be close to proportional to the amount of maa in the monomeric grafting solution . while the porous media can be produced from any material compatible with blood , practical considerations dictate that consideration be given first to the use of commercially available materials . the porous medium of this invention may be formed , for example , from any synthetic polymer capable of forming fibers and of serving as a substrate for grafting . preferably , the polymer should be capable of reacting with at least one ethylenically unsaturated monomer under the influence of ionizing radiation without the matrix being significantly or excessively adversely affected by the radiation . suitable polymers for use as the substrate include , but are not limited to , polyolefins , polyesters , polyamides , polysulfones , acrylics , polyacrylonitriles , polyaramides , polyarylene oxides and sulfides , and polymers and copolymers made from halogenated olefins and unsaturated nitriles . examples include , but are not limited to , polyvinylidene fluoride , polyethylene , polypropylene , cellulose acetate , and nylon 6 and 66 . preferred polymers are polyolefins , polyesters , and polyamides . the most preferred polymer is polybutylene terephthalate ( pbt ). surface characteristics of a fiber can be modified by a number of methods , for example , by chemical reaction including wet or dry oxidation , by coating the surface by depositing a polymer thereon , and by grafting reactions which are activated by exposure to an energy source such as heat , a van der graff generator , ultraviolet light , or to various other forms of radiation . the preferred method is a grafting reaction using gamma - radiation , for example , from a cobalt source . radiation grafting , when carried out under appropriate conditions , has the advantage of considerable flexibility in the choice of reactants , surfaces , and in the methods for activating the required reaction . gamma - radiation grafting is particularly preferable because the products are very stable and have undetectably low aqueous extractable levels . furthermore , the ability to prepare synthetic organic fibrous media having a cwst within a desired range is more readily accomplished using a gamma radiation grafting technique . an exemplary radiation grafting technique employs at least one of a variety of monomers each comprising an ethylene or acrylic moiety and a second group , which can be selected from hydrophilic groups ( e . g ., -- cooh , or -- oh ). grafting of the fibrous medium may also be accomplished by compounds containing an ethylenically unsaturated group , such as an acrylic moiety , combined with a hydroxyl group , preferably monomers such as hema or acrylic acid . the compounds containing an ethylenically unsaturated group may be combined with a second monomer such as maa . use of hema as the monomer contributes to a very high cwst . analogues with similar functional characteristics may also be used to modify the surface characteristics of fibers . in a first variation of the devices of this invention , the prp derived from a single unit of about 450 cc of human blood is passed , typically during a flow interval of about 10 to 40 minutes , through a filter comprising grafted fibers , the element of the filter preferably comprising fibers with a surface area in the range of about 0 . 08 to about 1 . 0 square meters , and more preferably about 0 . 1 to about 0 . 7 square meters , with a voids volume in the range of about 50 % to about 89 % ( i . e ., if pbt fiber is used , corresponding to a density of the filter element in the range of about 0 . 69 g / cc to about 0 . 15 g / cc ), and more preferably about 60 % to about 85 % ( for pbt , about 0 . 55 g / cc to about 0 . 21 g / cc ). the filter element is preferably of right cylindrical form with the ratio of diameter to thickness preferably in the range of about 7 : 1 to about 40 : 1 . the range of fiber diameter is preferred to be about 1 . 0 to about 4 μm and is more preferred to be in the range of about 2 to about 3 μm . these parameters can be varied ; for example , the diameter of the filter element could be reduced and the thickness of the filter element increased while retaining the same total quantity of fiber , or the fibers could be larger in diameter while increasing the total quantity of fiber , or the fibers could be packed as opposed to preformed into a cylindrical disc . such variations fall within the purview of this invention . if desired , flow rate of the prp through the filter can be regulated to obtain a total flow period of about 10 to about 40 minutes by selecting the appropriate element diameter , element thickness , fiber diameter , and density , and / or by varying the diameter of tube 12 either upstream or downstream of the filter , or both up and downstream . at these flow rates , leucocyte depletion efficiency in excess of about 99 . 9 % may be achieved and even as high as about 99 . 9995 %. these levels of efficiency result in a pc product with substantially less than about 0 . 1 × 10 6 leucocytes per unit of pc compared with the target of less than about 1 × 10 6 leucocytes per unit . the above - described device and its mode of use provide the advantages set forth below , among other advantages . ( a ) in the blood bank , the filtration step requires no labor input additional to the current practice , and , in the hospital , the need for bedside filtration is completely eliminated . ( b ) the volume of the prp processed is about five or more times that of the pc which is derived from the prp . because the volume processed is larger , loss of pc due to hold up within the filter is only about 1 % compared with a loss about five or more times greater when pc is filtered at bedside . ( c ) compared with hospital practice , filtration within the blood bank is generally under better control , as it is performed in relatively larger numbers by personnel trained to the specific task . ( d ) it is the belief of some researchers that when pc is stored prior to removal of leucocytes , the platelets are damaged during storage as the leucocytes disintegrate , releasing their components , some of which are highly toxic to human tissues . removing the leucocytes within a few hours after collection is believed to greatly reduce damage due to this cause . ( e ) in the process of tapping the donor &# 39 ; s vein , the hypodermic needle cuts a disc of the donor &# 39 ; s skin which is transferred into the collected blood . the alcohol swab applied prior to venipuncture is not adequate to assure sterility of this skin disc . thus , the skin disc may contain one or more varieties of bacteria , the most common being staphylococcus epidermidis , which has been detected in pc along with other organisms . the presence of the skin disc in pc is a suspect source of bacterial growth during storage , and it is fear of such growth which is the principal impetus for the regulation ( in the usa ) which limits the storage life of platelets to five days . removal of the skin disc by filtration at an early stage of processing is , for this reason , an important advantage as it may permit the five day regulation to be relaxed . ( f ) compared with a bedside filtration method of &# 39 ; 548 , improved recovery of platelets is obtained , i . e ., recovery in excess of 98 % to 99 % compared with about 90 to 95 % typically recovered in bedside filtration . in a second variation of this invention , the interposed filter 14 is preferably made with smaller fiber surface area , smaller filter element flow area , higher filter element density , and reduced voids volume in relation to the first variation . the total quantity of fiber used is also reduced such that a preferred range for the fiber surface area of the filter element is about 0 . 04 to about 0 . 3 m 2 and a more preferred range is about 0 . 06 to about 0 . 20 m 2 . a preferred range for the filter element flow area is about 3 to about 8 cm 2 , and a more preferred range is about 4 to about 6 cm 2 . a preferred range for the relative voids volume is about 71 % to about 83 % ( corresponding for pbt fibers to a density of about 0 . 23 to about 0 . 40 g / cc ), and a more preferred range is from about 73 % to about 80 % ( about 0 . 27 to about 0 . 37 g / cc ). a preferred range for the cwst of the fiber is about 70 to about 115 dynes / cm , a more preferred range is about 90 to about 100 dynes / cm , and a still more preferred range is about 93 to about 97 dynes / cm . because of its very small size , a preferred device in accordance with the second variation of the invention retains internally only 0 . 5 to 1 cc of prp , representing less than a 0 . 5 % loss of platelets . this second variation may also comprise a porous medium wherein the upstream portion of the medium is of a higher density than the downstream portion . for example , the porous medium may comprise a higher density upstream layer for blocking the passage of red blood cells and a lower density downstream layer for the depletion of leucocytes . filters made in accordance with this second variation and which are interposed between the blood collection bag and prp bag will generally remove about 85 to 99 % or more of the incident leucocytes , a removal rate that is not sufficient to consistently achieve a residual leucocyte count of less than 10 7 leucocytes per 50 ml of pc ( see table ii ). a principal function of this device , however , is to act as an automatic &# 34 ; valve &# 34 ; during the decantation process by instantly stopping the flow of prp at the moment that red cells contact the filter surface . the mechanism of this valve - like action is not well understood , but it may reflect aggregation of the red cells as they reach the filter surface , forming a barrier which prevents or blocks further flow of prp through the filter element . aggregation of red cells on contact with the filter surface appears to be related to the cwst and / or to the surface characteristics of the fibers which are generated by the herein described procedure for modifying the fibers . this theory for the proposed mechanism is supported by the existence of filters capable of highly efficient leucocyte depletion of human red blood cell suspensions and which have pore sizes as small as 0 . 5 μm , through which red cells pass freely and completely with no clogging , with applied pressure of the same magnitude as that used in the present invention . on the other hand , filters of the present invention , which typically have pore diameters larger than about 0 . 5 μm , abruptly stop the flow of red blood cells when the filter is contacted by the red cells . this suggests that the filter &# 39 ; s valve - like action is not related to or caused by pore size or by a filtration mechanism . the mechanism of this valve - like action is not well understood , but it may reflect zeta potential - related aggregation of the red cells as they reach the filter surface , forming a barrier which prevents or blocks further flow of prp through the filter element . the advantages to be gained by the use of this device include the following : ( a ) the collected prp , and the pc derived therefrom , are substantially free of red cells . ( b ) the operator needs only to start the flow of prp , which will continue to flow into the first satellite bag until red cells contact the filter surface , at which point flow stops . this eliminates the need for a skilled operator to estimate when to stop flow . the prp so obtained has the faintly yellow color of normal prp and , for practical purposes , may be considered to be free of red cells . the pc derived from the prp has the characteristic light yellow color of pc and , for practical purposes , may be considered to be essentially free of red cells . ( c ) the volume of prp recovered from the blood collection bag during the plasma extraction operation is increased by about 2 % to about 3 % when compared with very competent manual operation and probably by about 2 % to about 5 % compared with average blood bank practice . ( d ) labor input is reduced , as monitoring of the interface during decantation is not required . ( e ) freshly donated blood contains platelets varying in age from newly formed to nine days or more ( platelet half - life in vivo is about nine days ). newly formed platelets are larger and are generally believed to be more active . because the younger platelets are larger , they tend to sediment faster during centrifugation and , consequently , are present in larger numbers in the prp nearest to the red cell interface . measurements have shown that the concentration of platelets in the 10 % of the prp volume nearest the interface is about twice that in the uppermost 10 % of prp . taking this into account , the total number of platelets recovered is increased by about 4 to 10 %. ______________________________________ incremental number of platelets , % ______________________________________due to increased volume 2 to 5of prpdue to the higher 2 to 5concentration ofplatelets in theincremental volumeof prptotal 4 to 10 % ______________________________________ ( f ) the larger proportion of younger platelets in the pc administered to the patient means that their life within the patient after administration will be longer and that the platelets will be more active , compared with current blood bank practice . ( g ) the yield of plasma , a component of value comparable with that of prc and pc , is also increased by about 2 to about 5 %. ( h ) insofar as the plasma yield is increased , the plasma content of the prc is decreased . this is advantageous because the mhc ( major histocompatibility complex ) contained in the plasma is responsible for the occurrence of urticaria ( hives ) in a proportion of transfusion recipients transfused with prc . in a third variation of this invention , the fiber is surface modified in the same manner as for the preceding versions , but the fiber surface area of the element is increased while , at the same time , the density of the filter element is somewhat reduced . in this way , the automatic blockage of flow on contact by red cells is combined with higher efficiency of leucocyte depletion . a preferred range of fiber surface area for the third variation of the invention is from about 0 . 3 to about 2 . 0 m 2 , and a more preferred range is from about 0 . 35 to about 0 . 6 m 2 . the upper limits of fiber surface area reflect the desire to accomplish the filtration in a relatively short time period , and may be increased if longer filtration times are acceptable . a preferred voids volume of a filter for a filter element is in the range of about 71 % to about 83 % ( i . e ., if pbt fiber is used , corresponding to a density of the filter element in the range of about 0 . 24 g / cc to about 0 . 40 g / cc ), and more preferably about 75 % to about 80 % ( for pbt , about 0 . 28 g / cc to about 0 . 35 g / cc ). a preferred filter element flow area is from about 2 . 5 to about 10 cm 2 , and a more preferred area is from about 3 to about 6 cm 2 . leucocyte depletion efficiencies in excess of about 99 . 9 to about 99 . 99 %, which corresponds to an average residual leucocyte content per unit of less than about 0 . 005 × 10 7 , can be obtained . for all three of the above described variations of the porous medium for use with prp , a preferred range for the cwst of the fiber is preferably above about 70 dynes / cm , typically about 70 to 115 dynes / cm ; a more preferred range is 90 to 100 dynes / cm , and a still more preferred range is 93 to 97 dynes / cm . a preferred range for the zeta potential ( at the ph of plasma ( 7 . 3 )) is about - 3 to about - 30 millivolts , a more preferred range is about - 7 to about - 20 millivolts , and a still more preferred range is about - 10 to about - 14 millivolts . housings for the leucocyte depletion media of the invention can be fabricated from any suitably impervious material , including an impervious thermoplastic material . for example , the housing may preferably be fabricated by injection molding from a transparent or translucent polymer , such as an acrylic , polystyrene , or polycarbonate resin . not only is such a housing easily and economically fabricated , but it also allows observation of the passage of the fluid through the housing . the housing into which the porous medium is sealed or interference fit is designed to achieve convenience of use , rapid priming , and efficient air clearance . the blood collection and processing assembly 10 , with one or more satellite bags attached or connected via a conduit , may be used integrally to separate components from whole blood . during the centrifugation step in which the red cells are concentrated at the bottom of collection bag 11 , forces of up to about 5000 times gravity ( 5000 g ) or more may be generated . therefore , collection bag 11 is preferably flexible , as are the other bags , allowing them to settle to the bottom and against the walls of a centrifuge bucket , so that the bags themselves are subject to little or no stress . a ) blood product : anti - coagulated whole blood ( awb ); packed red cells obtained from awb ; platelet - rich plasma ( prp ) obtained from awb ; platelet concentrate ( pc ) obtained from awb or prp ; plasma obtained from awb or prp ; red cells separated from plasma and resuspended in physiological fluid ; and platelets separated from plasma and resuspended in physiological fluid . as used herein , blood component or product refers to the components described above , and to similar blood products obtained by other means and with similar properties . in accordance with the invention , each of these blood products is processed in the manner described herein . b ) unit of whole blood : blood banks in the united states commonly draw about 450 milliliters ( ml ) of blood from the donor into a bag which contains an anticoagulant to prevent the blood from clotting . however , the amount drawn differs from patient to patient and donation to donation . herein the quantity drawn during such a donation is defined as a unit of whole blood . c ) unit of packed red cells ( prc ), platelet - rich plasma ( prp ), or platelet concentrate ( pc ): as used herein , a &# 34 ; unit &# 34 ; is defined by the united states &# 39 ; practice , and a unit of prc , prp , pc , or of red cells or platelets in physiological fluid or plasma , is the quantity derived from one unit of whole blood . typically , the volume of a unit varies . for example , the volume of a unit of prc varies considerably dependent on the hematocrit ( percent by volume of red cells ) of the drawn whole blood , which is usually in the range of about 37 % to about 54 %. the concomitant hematocrit of prc , which varies over the range from about 50 to over 80 %, depends in part on whether the yield of one or another blood product is to be minimized . most prc units are in the range of about 170 to about 350 ml , but variation below and above these figures is not uncommon . d ) porous medium : refers to the porous medium through which one or more blood components pass . the platelet or prp porous medium refers generically to any one of the media which deplete leucocytes from the non - prc blood components , i . e ., from prp or from pc . the red cell barrier medium blocks the passage of red cells and depletes leucocytes from prp to a greater or lesser degree while allowing the passage of platelets . the porous medium for use with prp may be formed from any natural or synthetic fiber or other porous material compatible with blood . preferably , the cwst and zeta potential of the porous medium are within certain ranges , as disclosed above and as dictated by its intended use . for example , the cwst of a prp porous medium is typically above about 70 dynes / cm . the porous media according to the invention may be connected to a conduit interposed between the containers , and may be positioned in a housing which in turn can be connected to the conduit . as used herein , filter assembly refers to the porous medium positioned in a suitable housing . preferably , the porous medium forms an interference fit at its edges when assembled into the housing . the porous medium may be configured as a flat sheet , a corrugated sheet , a web , or a membrane , although it is not intended that the invention should be limited thereby . e ) voids volume is the total volume of all of the pores within a porous medium . voids volume is expressed hereinafter as a percentage of the apparent volume of the porous medium . f ) conversion of density when using fibers other than pbt : in the preceding exposition the term density has been used , and the density values quoted for the filter element have been based on the use of pbt fibers . other fibers which differ in density from the pbt may be used , as noted above , providing that their surfaces have , or have been modified to have , the characteristics noted above , e . g ., a cwst of greater than 70 dynes / cm . in accordance with the invention , to use an alternate fiber of different density , the density of an element made using an alternate fiber may be calculated as follows : denoting v as a percentage of the voids volume relative to the apparent volume of the pbt element [ i . e ., v =( volume of voids / volume of element )× 100 ], the objective is to calculate the element density of an alternate fiber element which will have a relative voids volume percentage equal to v . if f is the density of the alternate fiber and 1 . 38 g / cc is taken as the density of pbt fiber , and m 1 is the element density of the pbt element and m 2 is the density required for an element with equivalent performance , then voids volume v of the pbt fiber element is and the density required for the element made using the alternate fiber is the more preferred fiber diameter range for the practice of this invention is about 2 to 3 μm , the diameter being defined in terms of surface area , as described in u . s . pat . no . 4 , 880 , 548 . this range is preferred because much above this range , the dimensions of the elements and consequently the liquid hold - up volumes of the filters become significantly larger ; below this range , the filter elements become relatively less coherent and are more easily compressed . for example , an element made using less than 2 μm polypropylene fibers would be compressed by the pressure developed by the plasma extractor , which can be as high as 300 mm of hg . pore diameters of filter elements in accordance with the invention can be determined using the modified osu f2 method as described in u . s . pat . no . 4 , 925 , 572 . g ) in accordance with the invention , a useful technique for the measurement of fiber surface area , for example by nitrogen gas adsorption , is that developed by brunauer , emmet , and teller in the 1930 &# 39 ; s , often referred to as the &# 34 ; bet &# 34 ; measurement . using pbt as an example , the surface area of melt blown webs can be used to calculate average fiber diameter : total volume of fiber in 1 gram = 1 / 1 . 38 cc ( where 1 . 38 = fiber density of pbt , g / cc ) ## equ1 ## dividing ( 1 ) by ( 2 ), ## equ2 ## where l = total length in cm of 1 gram of fiber , if the units of d are micrometers , the units of a f become m 2 / g ( square meters / gram ), which will be used hereinafter . for fibers other than pbt , substitute the density for 1 . 38 . h ) general procedure for measuring zeta potential : zeta potential was measured using a sample cut from a 1 / 2 inch thick stack of webs . the zeta potential was measured by placing the sample in an acrylic filter holder which held the sample snugly between two platinum wire screens 100 × 100 mesh ( i . e ., 100 wires in each direction per inch ). the meshes were connected , using copper wire , to the terminals of a triplett corporation model 3360 volt - ohm meter , the mesh on the upstream side of the sample being connected to the positive terminal of the meter . a ph - buffered solution was flowed through the sample using a differential pressure of 45 inches of water column across the filter holder and the effluent was collected . for measurements at ph 7 , a buffered solution was made by adding 6 ml ph 7 buffer ( fisher scientific co . catalog number sb108 - 500 ) and 5 ml ph 7 . 4 buffer ( fisher scientific co . catalog number sb110 - 500 ) to 1 liter pyrogen - free deionized water . for measurements at ph 9 , a buffered solution was made by adding 6 ml ph 9 buffer ( fisher scientific co . catalog number sb114 - 500 ) and 2 ml ph 10 buffer ( fisher scientific co . catalog number sb116 - 500 ) to 1 liter pyrogen - free deionized water . the electrical potential across the filter holder was measured during flow ( it required about 30 seconds of flow for the potential to stabilize ) and was corrected for cell polarization by subtracting from it the electrical potential measured when flow was stopped . during the period of flow the ph of the liquid was measured using a cole - parmer model j - 5994 - 10 ph meter fitted with an in - line model j - 5993 - 90 ph probe . the conductivity of the liquid was measured using a cole - parmer model j - 1481 - 60 conductivity meter fitted with a model j - 1481 - 66 conductivity flow cell . then the polarity of the volt meter was reversed , and the effluent was flowed backwards through the filter holder using a differential pressure of 45 inches of water column . as in the first instance the electrical potential measured during flow was corrected for cell polarization by subtracting from it the electrical potential measured after flow was stopped . the average of the two corrected potentials was taken as the streaming potential . the zeta potential of the medium was derived from the streaming potential using the following relationship ( j . t . davis et al ., interfacial phenomena , academic press , new york , 1963 ): ## equ3 ## where η is the viscosity of the flowing solution , d is its dielectric constant , λ is its conductivity , e s is the streaming potential and p is the pressure drop across the sample during the period of flow . in these tests the quantity 4 πη / dp was equal to 0 . 800 . each of the examples was run using the following basic procedure to process and test a bag of donated blood . the blood collection set was constituted as shown in fig1 . bag 11 , into which anticoagulant had been placed , was used to collect one unit of about 450 cc of blood from a human volunteer . bag 11 along with its two satellite bags was then centrifuged for 5 minutes at 2280 × gravity , causing the red cells to sediment into the lower parts of the bag and leave a transparent , yellowish layer of red cell - free plasma in the upper part of the bag . this bag was then transferred , with care not to disturb its contents , to a plasma extractor . with tube 12 clamped adjacent to bag 11 to prevent flow , tube 12 was cut and the test filter was inserted at position 14 in fig2 . with the plasma extractor applying sufficient force to the bag to generate a pressure of about 200 to 300 millimeters of mercury within the bag , the clamp on tube 12 was removed , allowing the supernatant liquid to flow through the filter into bag 13 which had been placed on a weight scale . one of several skilled operators was instructed to signal when , in normal blood bank practice , flow would have been manually shut off . for examples 1 and 2 , which were in accordance with the first variation of this invention , tube 12 was at the signal promptly shut - off , the weight of prp collected was recorded , and the contents of the bag analyzed , with results recorded in table i . for examples 3 - 8 and 9 - 10 , the weight of the prp bag 13 was recorded at the signal , i . e ., the precise moment when flow would in normal blood bank practice have been shut off , while flow was allowed to continue until the red cell layer reached filter 14 , at which time flow spontaneously and abruptly stopped , and the weight of prp collected was recorded . the results for examples 3 - 8 are shown in table ii , and for examples 9 and 10 in table iii . in each of the ten examples , the resulting prp was visually free of red cells , and weights of the prp were converted to volume by dividing by the density of plasma ( 1 . 04 g / cc ). the data on residual leucocyte content of the pc derived from the filtered prp are reported in tables ii and iii as multiples of 10 7 ( i . e ., × 10 7 ), which can be conveniently compared with a target criterion of fewer than about 1 × 10 7 leucocytes per unit , which is a level believed adequate to significantly reduce alloimmunization in patients receiving platelet transfusions . the widely used melt blowing process for making fibrous plastic webs is a convenient , economical , and effective means for manufacturing fibrous webs with fiber diameter in the 1 - 4 μm range . it is characteristic of this process that the quality of melt blown webs is optimal when the web weight is maintained in a preferred range of about 0 . 0005 to about 0 . 01 g / cm 2 , and more preferably between about 0 . 0005 and about 0 . 007 g / cm 2 . for this reason , the webs used to form the examples of this invention were , wherever necessary , formed by laying up two or more layers of web of weight about 0 . 006 g / cm 2 , and then hot compressing these to form an integral filter element . devices were prepared in the manner of the first variation of this invention . the filter elements of these devices were preformed from 2 . 6 μm average diameter pbt fibers , which had been surface modified in the manner as described above and as taught in u . s . pat . no . 4 , 880 , 548 using a mixture of hydroxyethyl methacrylate and methacrylic acid in a monomer ratio of 0 . 35 : 1 to obtain a cwst of 95 dynes / cm and a zeta potential of - 11 . 4 millivolts . filter element effective diameter was 4 . 74 cm , presenting a filter area of 17 . 6 cm 2 , thickness was 0 . 15 cm , voids volume was 83 % ( density = 0 . 23 g / cc ), and fiber surface area was 0 . 69 m 2 . the volume of prp held up within the filter housing was 2 . 5 cc , representing a loss of prp due to hold - up of about 1 %. the results , obtained using the operating procedure described earlier in this section for the first variation , are shown in table i . table i______________________________________leucocyte depletion efficiency of the first variation leucocyte volume content of leucocyte of prp pc after removalexample passed , filtration efficiency ,** number cc ( per unit )* % ______________________________________1 237 & lt ;. 006 × 10 . sup . 7 & gt ; 99 . 9 % 2 206 & lt ;. 006 × 10 . sup . 7 & gt ; 99 . 9 % ______________________________________ * total leucocyte count in the pc after centrifuging the filteredprp to obtain the pc . ** assumes that the leucocyte content of the prp prior tofiltration conformed to an average value of 5 × 10 . sup . 7 per______________________________________unit . devices were prepared in the manner of the second (&# 34 ; automatic valve &# 34 ;) variation of this invention . the filter elements of these devices were preformed from 2 . 6 μm average diameter pbt fibers , which had been surface modified in the manner as described above and as taught in u . s . pat . no . 4 , 880 , 548 using hydroxyethyl methacrylate and methacrylic acid in a monomer ratio of 0 . 35 : 1 to obtain a cwst of 95 dynes / cm and a zeta potential of - 11 . 4 millivolts . the filter element &# 39 ; s effective diameter was 2 . 31 cm , presenting a filter area of 4 . 2 cm 2 , thickness was 0 . 051 cm , voids volume was 75 % ( density , 0 . 34 g / cc ), and fiber surface area was 0 . 08 m 2 . the volume of prp held up within the filter housing was & lt ; 0 . 4 cc , representing a loss of prp due to hold - up of less than 0 . 2 %. in each test , flow stopped abruptly as red cells reached the upstream surface of the filter element , and there was no visible evidence of red cells or hemoglobin downstream . the results obtained , using the operating procedure described earlier in this section for the second variation , are shown in table ii . table ii______________________________________ 5 leuco - 3 cyte volume content 2 of prp after estimated obtained 4 filtrat - volume / prp using the incre - ion ( per1 using normal procedure mental unit ) example blood bank of inven - volume , of pc * × number practice , ml tion , ml percent 10 . sup . 7______________________________________3 175 . 2 178 . 8 2 . 0 1 . 04 212 . 9 218 . 8 2 . 7 1 . 75 221 . 1 225 . 7 2 . 0 0 . 56 185 . 9 191 . 4 2 . 9 0 . 27 257 . 2 263 . 2 2 . 3 & lt ; 0 . 18 196 . 6 200 . 7 2 . 1 0 . 1______________________________________ * total leucocyte count in the pc after centrifuging the filtered prp to obtain pc . devices were prepared in the manner of the third variation of this invention , i . e ., the combination of an automatic shut - off valve and a high efficiency filter , both comprised in a single filter . the filter elements of these devices were preformed from 2 . 6 μm average diameter pbt fibers , which had been surface modified in the manner as described above and as taught in u . s . pat . no . 4 , 880 , 548 using a mixture of hydroxyethyl methacrylate and methacrylic acid in a monomer ratio of 0 . 35 : 1 to obtain a cwst of 95 dynes / cm and a zeta potential of - 11 . 4 millivolts at the ph of plasma ( 7 . 3 ). the filter element effective diameter was 2 . 31 cm presenting a filter area of 4 . 2 cm 2 thickness was 0 . 305 cm , density was 0 . 31 g / cc ( voids volume = 77 . 5 %), and fiber surface area was 0 . 46 m 2 . the volume of prp held up within the filter housing was 1 . 3 cc , representing a loss of prp due to hold up within the filter of about 0 . 5 %. in each case , flow stopped abruptly as red cells reached the upstream surface of the filter element , and there was no visible evidence of red cells or hemoglobin downstream . the results obtained , using the operating procedure described earlier in this section for the third variation , are shown in table iii . table iii__________________________________________________________________________incremental volume and leucocvre depletionefficiency of the third variation volume of prp leucocyneestimated obtained contentvolume / prp using the incre - afterusing normal procedure mencal filtration leucocyteexampleblood bank of inven - volume , ( per unit ) removalnumberpractice , ml tion , ml % of pc * × 10 . sup . 7 efficiency ** __________________________________________________________________________ 9 251 256 2 & lt ;. 004 & gt ; 99 . 9 % 10 212 216 1 . 9 . 005 & gt ; 99 . 9 % __________________________________________________________________________ * total leucocyte count in the pc after centrifuging the filtered prp toobtain pc . ** assumes that the leucocyte content of the prp prior to filtrationconformedto an average value of 5 × 10 . sup . 7 per unit . __________________________________________________________________________ while the invention has been described in some detail by way of illustration and example , it should be understood that the invention is susceptible to various modifications and alternative forms , and is not restricted to the specific embodiments set forth in the examples . it should also be understood that these examples are not intended to limit the invention but , on the contrary , the intention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the invention .	0
referring now to the drawings , wherein like reference numerals refer to like parts throughout , there is seen in fig1 a a schematic of a dmfs 10 in a first position . the dmfs 10 has a slider assembly 12 consisting of s 1 14 and s 1 a 16 . slider assembly 12 is shown in position “ a ,” which connects the slider to pins 18 and 20 on the quad bulkhead 22 . when the slider assembly 12 moves to position “ b ,” as shown in fig1 b , the slider assembly connects to pins 24 and 26 on the quad bulkhead 22 . the configuration illustrated is a 2 × 2 mechanical switch ( duplex ). referring now to fig2 is an exploded view of the components of a dmfs 10 . the dmfs 10 comprises a quad mfs housing bottom 28 . quad housing bottom 28 contains the quad bulkhead 22 and the steel flat head screws 30 beneath the quad bulkhead 22 . the slider assembly 12 provides the physical movement in the x and y directions . slider assembly 12 contains two lc / apc connectors which are used to provide the mating in the two positions . a stainless bar 32 is used to move the slider assembly 12 in the x or y direction . there are two pins 34 on top of the slider , as shown in fig3 , which are used with the program plate 36 above , to insure the direction of travel when the knob and shaft 38 is turned . the front of the bottom 40 of the slider 12 , as shown in fig3 , has two magnets 42 beneath each connector which are used to “ snap ” the connectors into the quad bulkhead 22 where the steel flat head screws 30 are located below in fig2 . the two magnets 42 also provide stability and consistency to the ferrules . the double cam assembly 44 provides a unique movement for the slider 12 in the x and y direction via the program plate 36 . the quad dms housing top 46 has all of the screws 48 to secure the module . referring now to fig3 is an exploded view of the components for the slider assembly 12 . it can comprise , for example , a bottom housing 40 which contains the stainless steel bar 32 along with the two magnets 42 . the connector retainer clip 50 holds the two connectors in place . it is important to note that the connector retainer clip 50 also provides added flexibility for the connector housings when inserting into the mating bulkhead . in order to maintain consistency , regarding losses of light , the connector housings are isolated in order to keep the ferrules mating tension consistent when the magnetic field is sensed . the two set screws 52 are used to stabilize the connector housings . the two dowel pins 34 are used to position the slider assembly 12 based on the program plate 36 shown in fig2 . the top plate 46 is used to secure to the bottom housing 40 with the three screws 48 . the top plate 46 also holds the dowel pins 34 and the connector adjusting screws 52 . referring now to fig4 is a performance table illustrating various parameters including as loss , back reflection , crosstalk and fiber type . the “ existing ” column contains information about typical measurements of all of the parameters of existing switches on the market . the “ mfs ” mechanical fiber switch column is measurements using the dmfs . the measurement results are significant because the mfs is a “ true mechanical fiber switch ” which uses standard mating connectors and mating bulkheads . some of the advantages of the mfs consist of manual switching without any external power . low loss based on ferrule to ferrule contact which are using the magnets to provide a consistent balance and attraction for the ferrules . repetitive connections are also consistent when the loss is measured because of the added magnet attraction for stability . various types of fiber can be used such as single mode , multi - mode , along with the added specialty fiber on the market . the crosstalk continues to be very high because of the isolation of the connectors . according to one embodiment , it is eliminating stainless steel bar 32 from the slider assembly 12 . for example , according to an embodiment the program plate 36 in fig2 can be modified to incorporate an additional pin guide . the added pin on the slider makes a total of three pins in a triangle configuration and can be used to navigate the slider assembly 12 without the stainless steel bar 32 . the pin , which is on the top center of the slider assembly 12 , is connected to the double cam assembly 44 which is considered to be the “ driver pin .” the two pins that are directly behind the “ driver ” are called the “ steering pins ,” which are used to guide the slider 12 in the various directions like a wheel barrel . for example , according to an embodiment , the program plate 36 or board can comprise three horseshoes which control the slider . this slider 12 has three dowel pins on the top plate instead of two . the three pins work with the program board 36 and follow the triple horse shoe pattern . this provides a more consistent movement for the slider 12 because it is like a wheel barrel and the single pin is the wheel and the other two pins are the handles for the wheel barrel for steering . although the present invention has been described in connection with a preferred embodiment , it should be understood that modifications , alterations , and additions can be made to the invention without departing from the scope of the invention as defined by the claims .	6
fig1 shows a compression band pipe coupling 10 for securing pipe elements together in end to end relationship according to the invention . coupling 10 comprises a deformable sealing member 12 , preferably in the form of a ring of elastomeric material . sealing member 12 engages the pipe elements to ensure a fluid - tight joint as described below . sealing member 12 has an inner diameter 14 sized to receive the pipe elements and an outer surface 16 . outer surface 16 supports a plurality of segments 18 . segments 18 are preferably formed of metal and may be cast , formed , stamped or machined . the segments are supported on the outer surface 16 of the sealing member 12 and are positioned circumferentially around it in predetermined spaced apart relation to one another . a compression band 20 extends around the outer perimeter of the segments 18 . band 20 is preferably a flexible metal strap and has opposite ends 22 and 24 connected to one another by a tensioning member 26 mounted thereon . tensioning member 26 preferably comprises a threaded bolt 28 mounted on one band end 22 and a threaded body 30 mounted on the other band end 24 . the bolt 28 is rotatable and engages the threaded body 30 . tightening of the bolt draws the band ends 22 and 24 towards one another , applies tension to the band and forces the segments 18 radially inwardly against the sealing member 12 . fig1 a illustrates an alternate coupling embodiment 11 wherein compression band 20 is divided into a plurality of band portions , in this example , two portions , 20 a and 20 b . each band portion has opposite ends 22 a and 24 a , and 22 b and 24 b respectively , which are positioned adjacent to one another so as to arrange the band portions in end to end relationship around the segments 18 . the ends in facing relation , 22 a and 24 b , and 22 b and 24 a , are joined by respective tensioning members 26 a ( mounted between 22 a and 24 b ) and 26 b ( mounted between 22 b and 24 a ). each tensioning member preferably also comprises a bolt 28 , mounted on one end of a band portion ( 22 a and 22 b ), the bolt engaging a threaded body 30 mounted on the adjacent end portion ( 24 a , 24 b ). tightening of the tensioning members applies tension to the band portions and forces the segments 18 radially inwardly against the sealing member 12 . compression band couplings having two or more band portions and the appropriate number of tensioning members are advantageous for use with larger diameter pipes to distribute the tension force among multiple tension members and limit the size of the bolts required to reasonable and practical lengths and diameters . with reference again to fig1 , it is advantageous to maintain the segments 18 in spaced apart relation at substantially equal intervals around the seal . this ensures that no large gaps form between the segments that will allow the sealing member to be pinched during assembly or blow out under pressure . to this end , each segment 18 has a projection 32 that extends radially outwardly and engages an aperture 34 in band 20 . the positions of the apertures in the band and the projections on the segments are coordinated such that the apertures receive the projections and maintain the segments in the desired relative spacing , engagement between the projections and the band limiting the relative motion between the band and the segments . in order to allow some free play permitting the segments 18 to shift circumferentially relatively to sealing member 12 , the apertures 34 may be oversized holes or , as shown in fig6 , they may comprise slots 36 that extend lengthwise along the band 20 . alternately , projections 32 may be relatively flexible or deformable to allow relative shifting of the segments when the tensioning member is tightened . deformation may be elastic , plastic , or a combination of the two . as shown in fig4 , in an alternate embodiment of the coupling , segments 18 may have a projection 32 that is received within an indentation 38 in band 20 . indentation 38 may be elongated to allow some free play to the segments . alternately , as shown in fig5 , the projection 32 may be mounted on the band 20 and the indentation 38 which receives it is positioned in the segment 18 . as shown in fig2 , segments 18 each have a pair of arcuate surfaces 40 and 42 positioned respectively on opposite sides of the sealing member 12 . arcuate surfaces 40 and 42 respectively engage outer surfaces 44 and 46 of pipe elements 48 and 50 when the tensioning member is tightened . preferably , arcuate surfaces 40 and 42 project substantially radially inwardly and engage respective grooves 52 and 54 formed in the outer surfaces 44 and 46 . engagement between the arcuate surfaces and the grooves provides mechanical restraint to the joint and ensures that the pipe elements remain coupled even under high internal pressure and / or external force . couplings 10 according to the invention may also be used with plain end pipe elements ( described below ) as well as with pipe elements that have shoulders proximate the ends or which have flared or expanded ends . arcuate surfaces 40 and 42 are positioned at the ends of segment sidewalls 56 and 60 that are joined by a back wall 62 and together form a channel 64 that receives the sealing member 12 . additional sidewalls 66 and 68 may also be extended radially outwardly to form a trough 70 that receives the band 20 . trough 70 helps keep the band properly engaged with the segments 18 during tightening of the tensioning member 26 by limiting the axial and rotational motion of the segments relatively to the band . installation of the banded coupling is described with respect to fig1 and 2 a . as shown in fig1 and 2 , coupling 10 is sized with segments 18 spaced diametrically from one another such that pipe elements 48 and 50 may be inserted between the segments in end to end relationship . the pipe elements are received by the sealing element 12 , which may have lips 72 that engage the pipe element outer surfaces 44 and 46 and use the internal pressure within the pipe elements to effect a tighter seal . once both pipe elements are engaged within the coupling 10 , the grooves 52 and 54 , if present , are aligned with the arcuate surfaces 40 and 42 and the tensioning member 26 is tightened . as shown in fig2 a , this forces the arcuate surfaces on each segment into engagement with the outer surfaces 44 and 46 of the pipe elements , in this example within grooves 52 and 54 . as shown in fig1 , segments 18 have oppositely disposed end faces 74 and 76 . end faces 74 and 76 are oriented substantially parallel to the longitudinal axis 78 of the pipe elements to be joined . as the tensioning member 26 is tightened , the end faces on adjacent segments move toward one another and the segments may be sized so that the end faces are in contact with one another to close off the entire outer surface 16 of the sealing member 12 when the arcuate surfaces 40 and 42 are engaged with grooves 52 and 54 . while projecting arcuate surfaces engageable with grooved pipes are a preferred embodiment , the coupling according to the invention may also be used to join plain end pipe elements . such an embodiment 80 is shown in fig2 b , wherein segments 18 have arcuate surfaces 40 and 42 that may comprise a tooth or teeth 82 and 84 . the teeth , when present , face substantially radially inwardly to grip the outer surface of plain pipe elements and provide mechanical restraint to the joint when the tensioning member of the coupling is tightened and the segments are forced into engagement with the pipe elements . the teeth may extend substantially continuously around the segment as illustrated by teeth 82 , or they may be a single tooth 84 , or a plurality of single teeth 84 spaced apart at intervals from one another . in an alternate coupling embodiment 79 , shown in fig3 and 3 a , segments 18 have opposite end faces 86 and 88 that are angularly oriented with respect to the longitudinal axis 78 of the pipe elements . this angular orientation is best shown in fig7 and 7 a . fig7 shows an axial view of a single segment 18 from coupling 79 wherein end faces 86 and 88 are visible . fig7 a shows the segment 18 of fig7 as it would appear looking inwardly toward axis 78 to render the relative orientation of both end faces 86 and 88 visible and thus emphasize the angular relation between the end faces and the axis 78 . note that the end faces on each segment have opposite slopes . furthermore , as shown in fig3 and 3 a , the end faces 86 and 88 on neighboring segments 18 are substantially parallel to one another . in this embodiment , the segments are sized so that the end faces 86 on each segment engage the end faces 88 on each neighboring segment upon tightening of the tensioning member and as the arcuate surfaces begin to engage the outer surface of the pipe elements being joined together . the angular orientation of the end faces is such that forced contact between them ( engendered by tightening of the tensioning member ) causes neighboring segments to move in opposite directions to one another in the direction lengthwise along the pipe elements as shown in fig3 a . relative shifting of the segments 18 is advantageous when the coupling is used with grooved pipe because the lengthwise motion of the segments forces the arcuate surfaces into engagement with the shoulders of the grooves and increases the stiffness of the joint about all of its axes . in another coupling embodiment 90 , shown in fig8 and 8 a , segments 18 have end faces 92 and 94 that are angularly oriented with respect to the longitudinal axis 78 of the pipe elements . this angular orientation is best shown in fig9 and 9 a . fig9 shows an axial view of a single segment 18 from coupling 90 wherein end face 92 is visible but end face 94 is hidden . fig9 a shows the segment 18 of fig9 as it would appear looking inwardly toward axis 78 to render the relative orientation of both end faces 92 and 94 visible and emphasize the angular relation between the end faces and the axis 78 . note that the end faces on each segment have substantially the same slope . furthermore , as shown in fig8 and 8 a , the end faces 92 and 94 on neighboring segments 18 are substantially parallel to one another . in this embodiment , the segments are sized so that the end faces 92 on each segment engage the end faces 94 on each neighboring segment upon tightening of the tensioning member and as the arcuate surfaces begin to engage the outer surface of the pipes being joined together . the angular orientation of the end faces is such that forced contact between them ( engendered by tightening of the tensioning member ) causes neighboring segments to rotate in opposite directions to one another about respective radii 96 and 98 extending outwardly from axis 78 as shown in fig8 a . relative rotation of the segments 18 is again advantageous when the coupling is used with grooved pipe because the rotational motion of the segments forces the arcuate surfaces into engagement with the shoulders of the grooves and increases the stiffness of the joint about all of its axes . pipe couplings having compression bands according to the invention provide for rapid and sure installation , creating a pipe joint while avoiding the need to partially or totally disassemble and then reassemble the coupling and handle the individual piece parts .	8
reference is made to fig1 and 2 , illustrating one embodiment of the album - like package or album 1 in top plan view and side view , respectively . album 1 is generally rectangular in shape and resembles an ordinary text book in geometry and size so as to conveniently fit on a bookshelf or other shelf for convenient storage . the exposed surface of the cover or top panel 3 is opaque to light . that surface is covered by an opaque treated printable material , suitably , treated paperboard material 9 , that is attached to and overlies transparent plastic material 11 ( as represented by the cutaway in the lower right of the figure ) that defines the structure of the package , both of which are later herein more fully described . the top panel also contains transparent ( e . g . light transmissive ) openings or windows 5 and 7 . those windows are formed by cut - out openings or windows in treated paperboard material 9 , exposing a portion of the underlying transparent plastic material 11 that serves as the window pane and admitting exterior light in the visual range into the interior of the package . the windows permit the contents of the package to be partially observed , such as the cover of a book 4 , titled “ the good book ”, generally represented in the figure , but which does not form part of the package . the panel surface includes printers ink 13 . the printers ink is arranged to define printed material , such as text and / or graphics symbols and background color , to provide advertising , brand names , contents description and other information and a pleasant appearance to the retail consumer . an example of such text is represented in the figure by the term “ learning store ”, as it is not practical to display all of such text and graphics . as later discussed in connection with fig6 , the reverse side of the treated paperboard material 9 also contains printers ink that conveys information , color and / or graphics . a hanger or hook 15 , preferably formed integrally in a package wall , is included to permit the package to be hung on a conventional retail point - of - sale display rack . a tear line , not illustrated , in the plastic adjacent the base of the hook should allow removal of the hook following purchase of the article . alternatively , in other embodiments the hook may be formed as a structure separate from the package and is attached to the package by tape or other adhesive that may conveniently be removed following the purchase of the product . as illustrated in the lower side view of fig2 , package 1 , shown closed , is of an album type structure containing sections 17 and 19 joined together by a spine 21 to which the two sections are hinged . as also illustrated in fig2 and in the front edge view of the package in fig3 , like a book , the outer surfaces of top panel 3 and bottom panel 2 are flat . the end of the package opposite the end shown in fig2 , not illustrated , is a mirror image of the view of fig2 . spine 21 is joined to the respective sections by hinges , not illustrated in the figure and later herein described , that extend the length of the package height as presented in the side view of the closed package ( opposite to the side of fig3 ) illustrated in fig4 . the outer surface of spine 21 , actually , as becomes apparent later in this description , a psuedo - spine , is also a treated paper board material that is scored along hinge lines and attached to the underlying spine of the plastic material , the latter of which is not visible in this view . as with the outer surface illustrated in fig1 , the treated paper board is opaque and contains printers ink 13 that defines textual information and / or graphics , as represented , as example , by the term “ the good book .” the lower panel or back side of the package 2 , opposite to that of fig1 , is illustrated in fig5 . the exposed surface of that side is also formed of the treated opaque printable paper board material used on the front cover and spine . in practice , the treated paper board surfaces are formed of a single sheet of treated paper board as described later herein in connection with fig8 . that treated paperboard is attached to the underlying plastic material of the wall of section 19 and also contains printers ink 13 on the outer surface . the printers ink on this panel also provides text and graphic symbols intended to provide information to a potential purchaser of the product . as later described , the opposite side surface of the foregoing paperboard surface also contains printers ink defining printed matter . a cut - out region in the treated paper board serves as an additional light transmissive window 12 to the underlying transparent plastic material of the package and through that plastic material into the interior of the package . package 1 is illustrated open and in perspective in fig6 to which reference is made . in this view the package is open with the two housing sections 17 and 19 positioned on respective sides of spine 21 . hinges 43 and 45 respectively connect opposite elongate edges of spine 21 to an elongate edge of top panel 3 and bottom panel 2 , respectively , joining the sections and permitting section 17 to pivot into mating engagement with section 19 and vice - versa to close the package as earlier illustrated in fig1 – 5 . the disclosed embodiment is designed to hold a multi - part child &# 39 ; s toy that contains a book 4 ( earlier partially viewed through window 5 in fig1 ) and a plug - in rom cartridge 10 , an add - on accessory to a game or educational computer unit , not illustrated , which are shown in exploded view . the book fits loosely inside a recessed tray , receptacle or compartment 23 inside section 19 . that compartment is defined by a bottom wall to the section and by a raised shoulder 25 that extends in a closed rectangular loop about the upper surface of package section 19 . the book compartment is designed to be slightly greater in length and width dimensions than the corresponding dimensions of book 4 and is deep enough to receive the book so that the book easily fits inside the formed compartment and may be easily withdrawn when needed . another formed narrow shoulder 27 , shorter in height than shoulder 25 , extends about the outer periphery of shoulder 25 adjacent a formed flange 29 to the section . that shoulder engages a corresponding shoulder 34 in section 17 , later herein described when the package is closed . flange 29 , which defines the outer edge of section 19 , extends in a web about three sides of the section , but not along the spine 21 . a like flange 31 is included in the other package section 17 . section 19 also contains an additional light transmissive transparent window 12 through which a portion of the book may be viewed from the package exterior when the package is closed . the location of that window is determined by the designer who is guided by the particular information contained on the back cover of book 4 that is desirably displayed . as example , that information may be information that is required by regulation , such as the country in which the book was printed , or notices for the consumer , such as information on trademark ownership and / or copyright information on the book . section 17 , on the left of the figure , also includes a flange 31 , a first outer shoulder 33 upstanding from the base that extends in a closed rectangular loop about the section defining a four - sided compartment on top panel 3 , and a second inner shoulder 35 upstanding from the base , adjacent to the former shoulder , that also extends in a closed rectangular loop defining an internal region in the section . in this section the outer shoulder 33 is greater in height than inner shoulder 35 . those shoulders are sized to mate with the corresponding shoulders of the other section to enable the package to close to the book - like shape ( as was illustrated in fig2 and 3 ) and the side walls of the two outer shoulders 33 and 25 of the respective sections frictionally engage when the package is closed . that mating engagement tightly closes the package . as better illustrated in this figure the pane of window 5 is recessed from the plane of the outer cover surface 3 and protrudes into the rectangular frame formed by shoulder 33 . in addition to passing light through to the interior ( and vice - versa ), the flat surface of the plastic window also functions to prevent the book from tilting from the bottom wall of compartment 23 when the closed filled package is held upright ( e . g . flopping ), preventing the book from rattling in the closed package during transport or when the package is handled by a prospective purchaser . the distance by which the flat transparent plastic surface of the window protrudes from the plane of top cover 3 , the depth , as defined by the window frame 8 , is determined by the thickness of the installed book 4 . the flat surface of window 5 should be at least contiguous with the cover of the installed book or may even press slightly against the flat surface of the book when the book is placed in receptacle 23 and the package is closed . that provides for a wider tolerance in manufacture and / or for slight change in book thickness . when the surface of window 5 presses against the book , the inherent elasticity of the plastic material forming the window produces a slight pressure ( e . g . compressive force ) to more firmly hold the book in place in the compartment , while the reactive force produced thereby between sections 17 and 19 does not exceed the frictional strength of the frictional engagement between those two mating sections when the package is closed . as one appreciates , other embodiments of the package may be designed to hold articles other than a book and the size and / or shape of the recessed window may be varied accordingly , while permitting a portion of the other article to be visually inspected . a pocket or receptacle 37 is located on the inside surface of section 17 which is designed to hold another component of the multi - component article . in this embodiment that receptacle is for holding the semiconductor rom plug - in cartridge 10 , which does not form part of the package . pocket 37 is formed by a raised shoulder 39 on the inside surface of the section that extends in a closed loop . the inside surface of the shoulder defines a region that is of the same essential geometry of the of cartridge 10 , but is slightly smaller in size so that cartridge 10 may be held in place . the cartridge must be pressed into the pocket and is frictionally held in place by the side walls of shoulder 39 . the hollow walls of that shoulder , formed of the same thin plastic material previously described , exhibits sufficient flexibility to capture and hold the cartridge . two depressions 41 at diametrically opposite locations in that shoulder define finger holes permitting the user to grip cartridge 10 from the side with two fingers and pull the cartridge from the receptacle . pocket 37 is located over window 7 with the transparent plastic material of that window serving also as the bottom wall of the receptacle . thus , a purchaser is able to view the content of the receptacle from the exterior of the package . although the foregoing embodiment is intended for use with a two component product and contains only a single pocket in section 17 , the invention is not limited to that number of pockets . as those skilled in the art appreciate , in other embodiments of the invention intended to package a multi - component product that contains a greater number of components , additional pockets of the foregoing type ( and additional windows associated with those additional pockets , may be formed in the section to hold ( and display ) those additional components . reference is made to fig7 which is an inverted section view taken along the lines 7 — 7 in fig6 . the section view assists in a review of the manner of manufacturing the invention . the plastic portion 11 of the package is first considered . the preferred plastic material used in the preferred embodiment is polyvinylchloride (“ pvc ”). however , it should be understood that other less preferred plastic materials may be substituted . thus the term plastic or plastic material should be construed to include not only pvc , but also polypropylene , polyethylene (“ pet ”), polystyrene and any other equivalent material that gives the housing sections a relatively rigid form and is used for packaging , whether existing or that may be developed hereafter . briefly , transparent pvc is supplied by the manufacturer as a flat rolled sheet of pvc plastic of the desired thickness and size . using conventional thermoforming processes the flat sheets are transformed using an appropriate mold and heat to permanently reshape the plastic material into the desired three - dimensional shape illustrated , including the recessed window , right and left sections , the spine and hinges previously described . the process of thermoforming plastic is known and has been used to form the vacuformed plastic packages , also sometimes referred to as thermoformed packages . that process simultaneously produces the deep recesses or depressions on one side of the sheet that produce the hollow shoulders 25 and 27 , 33 and 34 , the recessed window 5 , the hollow should 39 of the pocket , earlier described , that protrude from the opposite side of the sheet . that thermo - forming process also produces the hinges 43 and 45 . the foregoing three - dimensional structure is seen as an integral structure formed of one piece of plastic material . once formed the structure is removed from the mold . the manufacture of the treated paper board material 9 is next considered . reference is made to the partial section view of fig8 taken along the lines 8 — 8 in fig7 . this section view shows the layers of the treated paper board material 9 as attached to the formed plastic structure 11 . printable material 9 a of the appropriate size and thickness is supplied to the printer who applies printer &# 39 ; s ink to the front and reverse side of the paper board sheet , producing ink layers 9 b and 9 c . that ink prints the text , background color and graphics material supplied by the packaging artist for the front and reverse sides of the paper board . by printable material it should be understood that such term encompasses ordinary printing , lithography and any other printing process that applies ink ( or dye ), as example , to paper or paper board materials and the like . the printers ink is applied to define textual and graphics information for the consumer . brand names , product features and graphic characters , as example , provided on the side of the paper board that is located outside of the container assist to induce the customer to inspect and purchase the article . on the reverse side of the paperboard the printer &# 39 ; s ink may define additional information on product start up and use of the type that often is presented on a separate sheet of paper , product support information , and further use of brand names and graphic characters . on some portions of the paper board , the printer &# 39 ; s ink may be a simple background color . once printing is completed , the sheets of the printed board are coated on the inside surface with a thin transparent layer of a heat sealable compound 9 d or other adhesive that covers the printer &# 39 ; s ink on that side . the layer of sealing compound is transparent so as to permit incident light to pass through and allow the printer &# 39 ; s ink on layer 9 c to receive incident light and show through . one such compound ( also referred to as an ink ) is the gv series vinyl screen ink , a vinyl lacquer , sold by the azdar company of chicago , ill . that uv material is heat sensitive and can bond the treated paper board with pvc when heat is applied with pressure . then the treated paper board material is die cut to form the window openings 5 , 7 and 12 . that material is also scored along the lines of the two hinges that weakens the paper board material at those locations overlying the living hinges 43 and 45 formed in the plastic sheet and , when the treated paper board is bonded to the plastic , as next described , allows the paper board to fold more easily . the next step is to attach the treated paper board 9 to the flat side of the thermoformed plastic material 11 as illustrated in fig7 . the printed and coated paper board is then properly aligned on the flat side of the thermoformed plastic with the heat sealable bonding coating 9 c contacting the plastic 11 and the score lines 44 and 46 aligned with the respective hinges 43 and 45 . the assembly is then placed in an oven where the heat sealing coating is activated and heat seals the treated paper board to the thermoformed plastic . as bonded to the thermoformed plastic 11 , the treated paper board covers any opening or deep depression in that surface . the score lines 44 and 46 overlie and are aligned with the formed plastic hinges 43 and 45 , but those formed plastic hinges remain detached from treated paper board 9 . the package is ready to be stuffed with the multi - component product . in the illustrated embodiment of fig6 , a book 4 is placed in the appropriate compartment or receptacle 23 in one section of the package and a rom cartridge 10 is inserted into compartment 37 in the other section of the container . section 17 of the package is then pivoted about the hinge and spine 21 and is forced into mating frictional engagement with the other section 19 , closing the package . the sections of the package may then be secured by a sealing device to prevent a customer from tampering with the product at retail . in one embodiment the sealing device may be a strip of plastic tape 40 , shown in fig3 , which is then placed along one or more edges at which the two sections 17 and 19 abut to provide a tamper evident seal . in alternative embodiments the two edges of the sections may be tacked with glue , provided with an ultrasonic weld , sealed with an ultra - violet sensitive or sealed with a heat sealing compound , all of which fall within the scope of the invention . as example , referring to fig6 dots of ultra - violet sensitive glue or heat sealing component may be placed at the four corners of shoulder 33 in section 17 . the section is folded over into mating engagement with section 19 , enclosing the product components . then the dots on the shoulder is exposed to uv light or heated in a heat chamber , depending upon which sealing material is employed . the dots then harden and fasten the two sections together . to access the package , the consumer need only insert a knife at the location of each dot and cut the bond at those locations . the sections may then be pivoted apart . as one appreciates , that is much simpler than when opening present clamshell type packages . gluing may be used as a less preferred alternative to heat sealing for permanently attaching the paper board to the plastic material , in which case a thin layer of transparent glue is applied to the printed paper board . then the board is properly aligned on the plastic material of the package and pressed into place on the plastic material . any convenient known transparent glue conventionally used in plastic to paper board attachment in packaging may be used . the drawings of the section view of fig7 and 8 and those which follow in this specification are not to scale , particularly the thicknesses of the paper board material 9 and the plastic 11 , the latter of which typically is greater in thickness . reference is made to fig9 , 10 and 11 , which are sections taken along the lines 9 — 9 , 10 — 10 and 11 — 11 , respectively , in fig1 . as is evident from the section view of fig9 , when the package is closed the shoulder 33 and 35 of section 17 frictionally mate with the corresponding shoulders 27 and 25 , respectively , of the other section 19 . the openings and deep depressions in the surface of plastic 11 underlying paper board 9 produced when hollow shoulders 33 and 35 and shoulders 25 and 27 and the hollow shoulder to pocket 37 were formed in the thermoforming process are covered over by treated paper board 9 so that the outer panel surfaces 2 and 3 are planar . the treated paper board 9 is flat and sufficiently rigid to provide a firm surface to cover those open portions of the outside surface of the two sections of the board overlying the deep indentations in the surface of the plastic material and gives the resultant structure an overall book - like or album like appearance and feel . reference is made to fig1 , which is a section taken along the lines 10 - 10 in fig1 . this figure show the hinge configuration when the package is closed , and shows pocket 37 and the section of hollow shoulder 39 that forms the pocket . shoulder 39 is hollow . that hollow extends through the flat base portion of plastic material 11 producing a deep depression and opening in the surface that is covered over by treated paperboard 9 . reference is next made to fig1 , the section view taken along the lines 11 — 11 in fig1 . the protruding wall 8 of recessed window 5 is shown to penetrate from the one housing section into the other housing section , leaving clearance for the thickness of the intended book . the window forms a depression ( e . g . opening ) in the flat base portion of the plastic material . fig1 and 13 are enlarged partial section views of the spine 21 and hinges 43 and 45 with the package , respectively , open and closed . the hinges are shown to be of an inverted rectangular u - shape in cross section . when the book is closed , the stems of the u - shape should squeeze together slightly . the scoring 44 and 46 in the paperboard material 9 is aligned with the hinges . note is again made that the paperboard material , although bound to spine 21 , is not bound to the plastic hinges 43 and 45 . reference is made to fig1 which is a partial view of the spine and hinges taken along the lines 14 — 14 in fig6 looking down on the spine . the hinges extend linearly forming an inverted rectangular channel along the spine of the container hingedly joining the spine to each of sections 17 and 19 . as one appreciates the shape of the hinges is new and is particularly effective when joining the album type sections so that the sections can be pivoted close to the book - like configuration when the sections are formed of any of the plastic materials , including pvc , earlier described . the foregoing embodiment contained a recessed window 5 that pressed into contact with book 4 when the package was assembled with the product inside and closed . as those skilled in the art appreciate in other less preferred embodiments that do not require that feature a recessed window need not be included and only windows that are co - planar with the section surface , like window 7 , would be used . in still other less preferred embodiments one may elect to include a single window or in still other embodiments , eliminate windows entirely . such an embodiment is illustrated in the not - to - scale - views of fig1 – 21 , next described . the combined package and storage album 50 of fig1 is designed to hold a two - component product that consists of a rom game cartridge 60 and an interactive book 62 . the package and storage album and is shown laid open with a game cartridge 60 and the interactive book 62 , containing game instructions and information , are shown in withdrawn positions , removed from storage album 50 . when the album is closed , housing sections 51 and 53 are in mating frictional engagement , confronting one another , and from the bottom side appear as in fig1 , and in perspective as in fig1 . as shown in the cutaway in fig1 the side of the album is formed of a layered structure containing transparent plastic layer 64 , that forms a thermoformed shell structure containing all the formed plastic elements shown in fig1 , a second transparent plastic sheet 68 forming a side wall of the album , and a paper board sheet 66 containing printed matter , text 67 a and graphics 67 b , on both sides , that is visible through the transparent plastic . those elements are described more fully in the description that follows . continuing with fig1 , album 50 contains two housing sections , 51 and 53 , pivotally joined together by a spine 52 and two mechanically formed hinges 54 and 55 . a hanger 56 is integrally attached to an upper end of housing section 53 . that hanger contains an opening 57 to enable the package , filled with product and closed , to be rack mounted for retail sales display . the walls of the storage album are formed of transparent plastic , preferably polyvinyl chloride . a rectangular sheet of printable opaque material 66 that is easy to bend or fold , suitably thin cardboard or paperboard , underlies and most of the transparent plastic walls of the two housing sections and the spine , which , overall , is of a like rectangular shape as the paperboard sheet . the paperboard sheet may contain coloring and contains advertising material in both text 67 a and graphics 67 b , only some of which is labeled and which is only partially illustrated . that printed material is visible through the overlying transparent plastic material . the opposite side of that paper board sheet also contains like kinds of printed matter , both text and graphics , which is also visible to view through a plastic backing layer 66 , later described . a shallow rectangular pocket or well in the interior of housing section 53 , framed by a peripherally extending upstanding wall 58 , is designed to receive and frame the contents intended to be placed in that housing section , namely , book 62 . a pair of nubs 63 and 65 are located on the outside of wall 58 and extend outwardly a short distance . when the album is closed the nubs press into the wall of the other housing section to enhance the frictional contact between the two housing sections . a pocket or receptacle 59 is located on the inside surface of housing section 51 and is designed to frictionally hold cartridge 60 , a semiconductor rom plug - in cartridge , in place . pocket 59 is formed by a raised shoulder , integrally formed on the inside surface of housing section 51 , that extends in a closed loop . the inside surface of the shoulder defines a region that is of the same essential geometry of the of cartridge 60 , but is slightly larger in size sufficient to create a tight fit with the cartridge . the hollow walls of that shoulder , integrally formed of the same thin plastic material as other portions in the upper portion of the package , exhibits sufficient flexibility to capture and grip the cartridge when the cartridge 60 is pressed into the receptacle for storage , and , thereafter , frictionally holds the cartridge in place . further , two depressions 61 at diametrically opposite locations in that shoulder of receptacle 59 define finger holes that permit the user to grip cartridge 60 from the side with two fingers and pull the cartridge from the receptacle . although the foregoing embodiment is intended for use with a two component product and contains only a single receptacle in the one housing section , the reader is reminded that the invention is not limited to that number of receptacles . as those skilled in the art appreciate , in other embodiments of the invention intended to package a multi - component product that contains a greater number of components , additional receptacles of the foregoing type ( and additional windows associated with those additional receptacles may be formed in the section to hold ( and display ) those additional components . preferably the height of the walls of receptacle 59 is less than the height of the surround outer raised shoulders of housing section 51 so that when housing sections 51 and 53 are pivoted into a mating frictional engagement closing the album to confine the multiple components of the product , the upper edge of the wall defining receptacle 59 in housing section 51 , ideally , should press against a surface of the book 62 located in the confronting housing section 53 to minimize potential rattling within the closed package . it may be difficult to understand the physical relationship of the flat opaque sheet of printed material 66 referred to with the remainder of the structure without first considering the process of manufacturing package 50 . for that description , reference is made to fig1 , which illustrates an intermediate stage of assembly of the package structure . the principal constituent of the two housing sections 51 and 53 and spine 52 in fig1 is the single piece thermoformed transparent plastic shell 64 illustrated in fig1 . the foregoing structure 64 is thermoformed formed to the shape illustrated in this figure and in fig1 and 18 from a sheet of plastic using known conventional thermoforming technology , not illustrated . the resultant shell structure 64 and its walls are quite flexible . as shown , shell structure 64 defines the two housing sections and spine , the interiors of those housing sections , the outer walls , and other elements of the album above described and illustrated in the figures . in one specific embodiment , the walls of shell structure 64 are about 0 . 012 to 0 . 015 inches thick , that is twelve to fifteen thousandths . a thin sheet of paper board material 66 is placed over the rear of shell structure 64 , covering most , but not all , of that rear surface . paper board sheet 66 is pre - printed with the desired text and graphics on both the front and back surfaces . paper board sheet 66 is thin , about one mil thick in one specific embodiment , and can be easily be folded or bent over . the sheet is placed over the back side of the structure 64 and fitted in place in that structure within a shallow molded receptacle on the back side of the shell structure that serves as an assembly guide to center sheet 66 in the shell and provide a shallow receptacle to receive the paperboard sheet . continuing with fig1 , some of the printed matter on both front and back sides of the paper board sheet overlies both housing sections 51 and 53 and spine 52 in the formed container 50 . paperboard sheet 66 is of a rectangular shape that is slightly shorter in length and width , and , hence , area , than the corresponding rectangular dimensions of shell structure 64 . when centered on the rear side of shell structure 64 , paper board sheet 66 leaves a narrow peripherally extending annular strip of shell 64 exposed . next , a flat sheet of thin transparent plastic 68 is placed over the paperboard sheet 66 backing the rear of the plastic shell structure . that flat sheet abuts against the rear side of paperboard 66 and contacts the back side of the plastic shell structure along a peripherally extending frame or rim . plastic sheet 68 is of a rectangular shape that is the same shape rectangular shape as that of the rear of plastic shell structure 64 , but is slightly larger in both the length and width dimensions , and , hence , in area . those larger dimensions result in an annular ribbon - like surplus that extends about the periphery of plastic shell 64 when the sheet is centered on shell structure 64 . brief reference may be made to the section view of fig2 , which shows the relationship between the plastic members 64 and 68 and the cardboard 66 along the outer periphery , but in an inverted position from that of fig1 . the peripheral rim portion of plastic shell structure 64 is elevated from the central portion to form a shallow receptacle in the central portion of the rear side and the paper board sheet 66 is located in that receptacle . flat plastic sheet 68 is in contact with that rim portion of the plastic shell structure . in the specific embodiment referred to the thickness of this sheet is about six mils . continuing with fig1 , as the three pieces are thus assembled to this stage , the assembly is placed in an rf heating device or station , not illustrated . the rf heating device is designed to produce heating and partial melting of the plastic material all about the periphery of the assembly and subsequent cooling fuses the contacting plastic sheets together along the line of contact . the rf heating also cuts through the plastic backing sheet , except in the peripheral position of the hanger 56 , illustrated in fig1 . at the location of the hanger the heating apparatus is designed to define the shape of hanger 56 and cut through the plastic sheet to provide the outline of the hanger and cut through and produce the opening 57 in that hanger . with the rf energy heating the edges of the two plastic parts melt and fuse together . that produces a permanent seal between those parts , once the heating energy is terminated . following termination of the rf energy , the now unitary assembly is removed from the rf heating apparatus , and the peripheral strip is manually detached from the plastic backing sheet 68 during the procedure and discarded . the completed integrated structure is then placed in a staging area for filling with product , closing and sealing the filled package closed with sealing tape . the foregoing fusing operation can be accomplished in about five seconds . the not - to - scale section view of fig1 illustrates the foregoing assembly in great part , with a bottom side , including the plastic backing sheet , that is greatly enlarged in scale relative to the remaining parts of the assembly . the outer edge of the assembly is better illustrated in the section view of fig2 , which is taken along the lines 20 — 20 in fig1 . as shown , paper or paperboard sheet 68 stops short of the outer edge and is smaller in dimension than both shell structure 64 and plastic backing sheet 66 . the outer bottom edge of the rear side of the shell structure 64 contains a raised shoulder or rim . that raised rim extends peripherally about the rectangular backside of the shell structure to define a frame or guide , earlier referred to , in which to place the printed paper sheet 68 during the assembly described in connection with fig1 . moreover the edge of that shell and the peripheral edge of the flat plastic backing sheet 66 are placed in direct contact . that permits the peripheral edges of the two plastic components to be directly fused together by the rf heating apparatus ( as earlier described ) without any interference from paper sheet 68 . returning again to fig1 , on completion of the assembly procedure described , it is seen that the paper board sheet 68 , the plastic backing sheet 66 and the shell structure 64 remain relatively flat in the region of spine 52 , and , more specifically , in the junctures between the spine and the respective housing portions 51 and 53 . that is , no hinges have as yet been formed , and none of the sheets were scored to aid in folding as occurred in the prior embodiment of fig1 . as becomes apparent scoring is not required . fig1 , to which reference is made , illustrates the section of fig1 after the album - like package is initially closed ( and reopened ), whereby a pair of longitudinally extending permanent creases ( e . g . hinges ) of a slight u - shape section shape are formed in the plastic sheets 64 and 68 and in the paperboard , thereby defining hinges 54 and 55 . those hinges are illustrated in enlarged scale in fig2 , which is a section taken along the lines 21 — 21 in fig1 . in effect , the hinges 54 and 55 are manually mechanically formed on the initial closing of the package . the final step in the packaging is to place strips of bonding tape over the slit between the two housing sections to permanently prevent the two sections from being opened prior to customer purchase . the sections of the package may then be secured by a sealing device to prevent a customer from tampering with the product at retail . the preferred seal in this embodiment is one or two strips of plastic tape 70 , one of which is illustrated in fig1 , to provide a tamper evident seal . a strip of the tape is placed along a slit and extends a short distance around the corner of the album . the second strip extends around the opposite corner , but is not visible in this view . the preferred plastic material used in the embodiment of fig1 is polyvinylchloride (“ pvc ”). however , it should be understood that other less preferred plastic materials may be substituted . thus the term plastic or plastic material should be construed to include not only pvc , but also polypropylene , polyethylene (“ pet ”), polystyrene and any other equivalent material that gives the housing sections a slightly stiff , yet flexible , form and is used for packaging , whether existing or that may be developed hereafter . as one appreciates , the paper board sheet in the foregoing embodiment completely covered both sections , preventing the customer from viewing any portion of the product , which remains unaccessible . should the manufacturer wish , however , to allow visual inspection of a portion of the product in situs in the package as in the prior embodiment , suitable openings may be located in the paper board sheet to form windows and those openings would be die cut out of the paper board sheet prior to the assembly procedure described in connection with fig1 . die cutting of windows requires extra steps in manufacturing and , hence , increased labor costs . if cost containment is a requirement , then the incorporation of windows in the package would be less preferred . moreover , the assembly of this embodiment avoids any need to coat the paper board sheet with an adhesive , saving additional labor and supply cost . as another advantage , no extra steps are required in this embodiment for the formation of the creases or hinges that permit the housing sections to be closed , and then , repeatedly opened and closed . the act of closing the package which occurs in all embodiments mechanically forms the hinges . that technique also saves labor and , hence , labor costs , and is preferred . it is believed that the foregoing description of the preferred embodiments of the invention is sufficient in detail to enable one skilled in the art to make and use the invention . however , it is expressly understood that the detail of the elements presented for the foregoing purpose is not intended to limit the scope of the invention , in as much as equivalents to those elements and other modifications thereof , all of which come within the scope of the invention , will become apparent to those skilled in the art upon reading this specification .	1
the present invention will now be described with reference to the figures . reference is now made to fig2 a . this figure shows a portion of an active pixel array constructed according to the present invention in which respective charge pumps 300 , 301 and 302 are used to supply the gate voltages for the reset transistor , transfer gate transistor and row select transistors 31 , 29 and 38 . as shown in fig3 , reset transistor 31 is formed by n + region 30 and n + region 34 and controlled by rst signal 32 . transfer transistor 29 is formed by n + region 26 and n + region 30 and controlled by tx signal 28 . in fig2 a , charge pump 303 is shown for providing a gate voltage to a photogate 24 for charge transfer . charge pump 304 is shown for providing a voltage pump to a n + junction , which is the v dd pixel supply junction in this case . this figure shows a 2 × 2 array of pixels for simplification . it should be understood that the invention is directed to a m × n multiple pixel array of any size . the operation of the fig2 a pixel array will now be described . photodetectors 14 of a row of pixels are coupled via their respective row select transistors 38 to column line 42 . the photodetector selected by a row decoder via line 86 will provide electrical current depending upon the voltage at the gate of source follower transistor 36 supplied by floating diffusion node 30 . as noted , the gate of transistor 36 controls the current through load transistor 39 ( not shown in fig2 a ) and in consequence the voltage on column line 42 . signal row select turns row select transistor 38 on . the voltage controlled by the row select signal on line 86 is a charge pump 302 output voltage . row select line 86 is connected to charge pump 302 to overdrive the row select transistor 38 , that is , the gate voltage of transistor 38 is higher than the v dd supply voltage . in a v dd system , charge pump 302 will supply v pump & gt ; v dd volts to the gate of row select transistor 38 . in the absence of a charge pump on the reset gate , the reset gate rst turns on reset transistor 31 , which causes the floating diffusion node 30 to be reset to a potential of v dd - v th , where v th is the threshold voltage of the reset transistor 31 . the actual gate 32 a to transistor 31 is supplied by charge pump 300 to overdrive the gate of the reset transistor 31 with a voltage of v pump & gt ; v dd to achieve higher floating diffusion voltage reset value on node 30 at v dd . by having a higher reset voltage available at node 30 , a wider dynamic response range is available for the pixel output signal and variation in the voltage at which the floating diffusion node 30 is reset due to the reset transistor 31 v th variation is reduced . the photogate 24 is also supplied from a charge pump 303 , ensuring that all possible collected charge for an image signal is stored in the imager substrate beneath the photogate until it is to be transferred out of the collection area . the fig2 a circuit shows use of a transfer gate 28 a and associated transfer transistor 29 . if the cmos imager cells uses a transfer transistor , then the transfer gate 28 a voltage is also supplied from a charge pump 301 in response to transfer signal tx , once again ensuring that the transfer transistor is overdriven to its on state and eliminating the v th voltage drop which normally occurs . the charge pump on the transfer gate enables improved charge transfer between the photosensor and the floating diffusion . the operation of the fig2 a circuit to acquire , transfer and output pixel charge is otherwise as previously described . the charge pumps 300 and 301 provide voltage to the reset gate 32 a and transfer gate 28 a at a potential which is greater than the supply potential v dd . the pumped voltage enhances the performance of the transfer and reset transistors . in order to turn “ on ” the various transistors of the pixel array , a gate voltage to the transistor must exceed a source or drain voltage ( depending on the type of transistor ) such that v pump & gt ; v dd . however , the threshold voltage ( v th ) may differ for each transistor of a pixel array due to manufacturing imperfections . as a consequence , when all transistors of the array are turned “ on ” or “ off ” using the voltage supply potentials to supply control signals to the gates of the transistors , some transistors which are turned “ on ” are more “ on ” than other transistors thereby inconsistently transferring and / or amplifying the pixel charges transferred to the pixel output line 42 . likewise , some of the transistors which are turned “ off ” are more “ off ” than other transistors causing leakage . this is reflected as an improper output of signals reflecting the charges collected by the photodetector circuit 14 . the charge pumps 300 , 301 and 302 help to overcome the inconsistent on / off threshold voltages ( v th ) of the transistors by overdriving the gates with voltages which ensure that they turn on or off as required , regardless of manufacturing inconsistencies . the charge pump 303 ensures that the maximum possible charges are collected in the collection region beneath the photogate . while multiple charge pumps 300 , 301 , 302 , 303 and 304 are shown in fig2 a for the entire cmos pixel array , it should be understood that a single charge pump having multiple controlled output voltages may be used for the entire cmos imager and for associated logic circuits . also , individual charge pumps may be used for different portions of the imager circuit and for the associated logic circuits . also , while the charge pumps 300 , 301 , 302 , 303 , 304 are shown supplying voltage for the reset gate , the transfer gate , the row select gate and the photogate and v dd supply , it should be understood that a charge pump may be used for one or more of these gates to achieve a benefit over conventional cmos imagers which do not use a charge pump . it is understood that the present invention is not limited to the examples described herein . more complex 5t , 6t , 7t cmos imagers are contemplated supporting global shutter , high dynamic range , and dual conversion gain applications . pumped gates or diffusion will be advantageous in these applications as well . that is , a common charge pump source could be used to supply the high state voltage level to all pumped clocked gates ( e . g . reset , row select , transfer , photogate and v dd supply ) so long as v pump & gt ; v dd . the particular construction of the charge pump is not critical to the invention and many circuits circuit can be used . representative output voltages of charge pumps 300 , 301 , 302 and 303 are 4 . 0 , 4 . 0 and 4 . 0 , respectively , for a 3 . 3 volt v dd supply and assuming that the v th of each of these transistors is less than 0 . 7 volts . while it is advantageous to have v pump ≧ v dd + v th it is not required or limiting . the photogate pump when turned on by the positive clock pulse can be at a pumped voltage such that v pump & gt ; v dd . when the clock voltage applied to the photogate returns to its low or off - state voltage that off - state may be pumped low so that the gate sees a negative voltage . all of the other gates of the cmos imager may benefit from having a negative pumped voltage applied to turn the transistor off . the negative voltage can be any value so long as it is lower than a reference ground ( 0v ) potential . it should be understood that the output of voltage charge pumps 300 , 301 , 302 , 303 and 304 may vary , individually , depending upon the v dd and / or v ss supply as well as the v th , of the individual transistors . for collecting charge in the photogate , the charge pump 303 is configured to supply an output voltage v pgp where v pgp is greater than input voltage v dd . fig2 b shows a generalized signal applied to any gate of a cmos imager . fig2 c shows a repeating clock voltage which can be applied to any gate . the high state voltage 205 is pumped above v dd ( v pump & gt ; v dd ). the clock voltage applied returns to a low or off - state voltage 215 resulting in a pumped voltage that is below ground ( 0v ). the above discussion has described the circuit for an exemplary 2 × 2 pixel shown in fig2 a . it is desirable for an additional pump circuit to supply voltage v aa - pix to diffusion node 34 and through diffusion node 34 to floating diffusion node 30 so that the cmos imager operating voltage could be different from a periphery supply voltage . the pump circuit includes a v aa - pix charge pump , which is supplied by external power supply v dd . the pump circuit outputs a new supply voltage that is booted . the new booted v aa - pix supply then is used to supply all of the pixels . this permits the cmos imager array to operate at a different voltage than the periphery . as described above from v dd a voltage v aa - pix is created using a pump circuit such that v aa - pix & gt ; v dd . the present invention also encompasses the situation where v pump & lt ; v dd using a regulated power supply that is less than the supplied voltage source v dd . in the alternative v dd could be a high state voltage such as depicted in fig2 b . from this high state voltage a regulated voltage v reg can be created , where the regulated voltage is a low state voltage . in this instance , v dd could supply the array and v reg could supply the periphery where 0 & lt ; v reg & lt ; v dd . fig2 d is an example of an external v dd supply 115 as the input to five separate internal pumps , v aa - pix pump 120 , photogate pump 125 , row select pump 130 , transfer gate pump 135 and reset pump 140 . these could be pumps to independently supply v pump & gt ; v dd and / or they could supply a negative off - state voltage to the various shown clocked voltages driving the array transistor gates and diffusions of imager array 110 . a regulator 145 is also shown providing a regulated voltage to the imager circuits in the periphery , such as periphery circuit 1 ( 150 ). if the external supply , is , for example , 3 . 3 volts , then the five shown array pumps can produce clocked voltages to the array such that v pump & gt ; v dd . in our examples if the v th of the array transistors is 0 . 7 volts then a reasonable v pump high voltage to the array gates would be 4 . 0 volts . the pumps could also include negative pumps to control the off - state voltage of the voltage clocks supplying the array circuits . to conserve power , in this example , the regulator is supplied at v reg & lt ; v dd to support the circuits in the imager periphery . in this example v reg is the range of 2 . 5 v to 1 . 2 v might be reasonable . periphery circuit 2 ( 155 ) in this example is driven directly by the v dd external supply . for example , periphery circuit 1 ( 150 ) could be digital circuits and periphery circuit 2 ( 155 ) could be analog circuits . in this example , the imager array 110 is provided with voltages greater than or equal to the supply voltage for the “ high state ” or “ on ” voltage of the array circuits . the periphery circuits 150 , 155 are provided with voltages less than or equal to the supply voltage . in fig2 e the external supply could be at a lower voltage of 2 . 5 volts . in this case it would be advantageous to have a periphery circuit pump 160 to increase the voltage supply to the analog circuits of periphery circuits 2 ( 155 ). it would also be possible to have a lower regulated voltage , v reg & lt ; v dd ( 1 . 2 . 1 . 5 , 1 . 8 , 2 . 0 , 2 . 2 v ) supplying the digital circuits in periphery circuits 1 . fig2 f is an example of an external v dd supply 115 applied to a positive high voltage pump 190 , a negative low voltage gate pump 195 and a negative substrate pump 197 . the negative substrate pump 197 supplies voltage to p - well and p - substrate 199 . the positive high voltage pump 190 and the negative low voltage pump 195 each supply a reset driver 165 , a row select driver 175 , a transfer gate driver 180 , a photogate driver 185 and a v aa - pix driver 170 , each of which is coupled to the imager array 110 . in this example , the positive high voltage pump 190 also supplies voltage to periphery circuits 2 ( 155 ). periphery circuits 1 ( 150 ) is supplied directly by the external v dd supply 115 . the advantageous operation of cmos imagers is described using a four transistor ( 4t ) cmos imager . actual cmos imagers may contain fewer or more than four transistors . it is understood that the use of 4t cmos imagers is not meant to limit the present invention to a 4t embodiment . if the cmos imager requires more than four transistors , then some of those additional transistors will show improved performance by having their own pump . fig3 is an exploded view of an exemplary 4t pixel of the present invention illustrated in fig2 a , where the pixel is formed using n - channel ( n - ch ) devices . like components are labeled the same as in fig2 a . n + type region 34 is actively driven by v aa - pix charge pump 100 , which gets its supply of voltage ( charge ) from v dd 105 . a v aa - pix charge pump allows the cmos imager to operate at higher voltages and , thus , achieve better image performance . the v aa - pix charge pump permits lower voltage periphery and can be coupled with shorter transistor lengths to improve periphery performance . n + type region 30 ( floating diffusion node ) is also supplied by v aa - pix charge pump 100 through n + diffusion node 34 via reset transistor 31 . photodiode ( pd ) 26 is an n - type diffusion region . the n - ch devices are in a p - well . substrate contact 20 may be ground ( 0v ) or negative if a negative substrate pump is provided . the present invention also applies to an array containing n - ch transistors . fig4 is an exploded view of an exemplary 3t pixel of the present invention formed using n - ch devices . the 3t transistor pixel of fig4 is similar to the 4t pixel of fig3 except that there is no transfer transistor used in the 3t implementation . fig4 is appropriate for a v aa - pix charge pump for any cmos imager , 2t , 3t , 4t , 5t , or any type . pd 405 is n - type diffusion region , rst signal 410 controls a reset transistor formed by pd 405 and diffusion region 415 , which is an n + diffusion region . n + diffusion region 420 is actively driven by v aa - pix charge pump 425 , which gets its supply of voltage ( charge ) from v dd 430 . the n - ch devices are in a p - well . the present invention also applies to an array containing p - ch transistors . fig5 is an exploded view of an exemplary 3t pixel using a negative substrate pump . the pixel is formed using n - ch devices . the pd 505 is diffusion n - type ; diffusion region 515 is diffusion type n +. the diffusion region 520 under the substrate pump contact 526 is p +. negative v substrate pump 525 is also connected to ground 530 and the external power supply , v dd . reset signal ( rst ) 510 controls the reset transistor formed by n - type diffusion region 505 and n + diffusion region 515 , which supplies v aa - pix . the n - ch devices are in a p - well . all p - wells in the entire array are linked and the p - well attached to the negative substrate pump is connected to the array p - wells . the present invention also applies to an array containing p - ch transistors . in another embodiment , a negative gate pump supplies a negative voltage , which is applied to gates such as reset and transfer gates . specifically , fig6 a is an exploded view of a 4t pixel of the present invention , where the pixel is formed using n - ch devices . the gates ( 28 a , 32 a ) of transfer transistor 29 and reset transistor 31 are driven by negative gate pump 650 via a transfer voltage driver 655 and a reset voltage driver 660 respectively . which gets it supply of voltage from v dd 105 . both the transfer gate and the reset gate could see a negative pumped off - state voltage but they would have separate clocks in that instance . in this embodiment , the negative gate pump operates to drive the gate “ off ” harder in n - ch devices . the negative gate pump could also be applied to the row select gate or any gate on a cmos imager and is not limited by the exemplary embodiments described herein . typical gates used in cmos imagers include but are not limited to reset devices , transfer devices , global shutter devices , storage devices , high dynamic range devices and lateral overflow drain devices . fig6 b is an example of a timing diagram for a reset gate and a transfer gate . in each case , the gates are supplied with a negative pumped voltage . the present invention can be utilized within any integrated circuit which receives an input signal from an external source . fig7 illustrates an exemplary processing system 600 which may utilize a processor circuit comprising a cmos imager constructed in accordance with any of the embodiments of the present invention disclosed above in connections with fig1 - 6b . the processing system 600 includes one or more processors 601 coupled to a local bus 604 . a memory controller 602 and a primary bus bridge 603 are also coupled the local bus 604 . the processing system 600 may include multiple memory controllers 602 and / or multiple primary bus bridges 603 . the memory controller 602 and the primary bus bridge 603 may be integrated as a single device 606 . the memory controller 602 is also coupled to one or more memory buses 607 . each memory bus accepts circuits such as 608 which include at least one pixel 631 using the present invention . the imaging device , e . g . a cmos imager , may also be integrated with a memory card or a memory module and a cpu in accordance with the present invention . examples of memory modules include single inline memory modules ( simms ) and dual inline memory modules ( dimms ). the imaging device 608 may include one or more additional devices 609 ( not shown ). for example , in a simm or dimm , the additional device 609 might be a configuration memory , such as a serial presence detect ( spd ) memory . the memory controller 602 may also be coupled to a cache memory 605 . the cache memory 605 may be the only cache memory in the processing system . alternatively , other devices , for example , processors 601 may also include cache memories , which may form a cache hierarchy with cache memory 605 . if the processing system 600 include peripherals or controllers which are bus masters or which support direct memory access ( dma ), the memory controller 602 may implement a cache coherency protocol . if the memory controller 602 is coupled to a plurality of memory buses 607 , each memory bus 607 may be operated in parallel , or different address ranges may be mapped to different memory buses 607 . the primary bus bridge 603 is coupled to at least one peripheral bus 610 . various devices , such as peripherals or additional bus bridges may be coupled to the peripheral bus 610 . these devices may include a storage controller 611 , a miscellaneous i / o device 614 , a secondary bus bridge 615 , a multimedia processor 618 , and a legacy device interface 620 . the primary bus bridge 603 may also be coupled to one or more special purpose high speed ports 622 . in a personal computer , for example , the special purpose port might be the accelerated graphics port ( agp ), used to couple a high performance video card to the processing system 600 . the storage controller 611 couples one or more storage devices 613 , via a storage bus 612 , to the peripheral bus 610 . for example , the storage controller 611 may be a scsi controller and storage devices 613 may be scsi discs . the i / o device 614 may be any sort of peripheral . for example , the i / o device 614 may be a local area network interface , such as an ethernet card . the secondary bus bridge may be used to interface additional devices via another bus to the processing system . for example , the secondary bus bridge 616 may be a universal serial port ( usb ) controller used to couple usb bus devices 617 to the processing system 600 . the multimedia processor 618 may be a sound card , a video capture card , or any other type of media interface , which may also be coupled to additional devices such as speakers 619 . the legacy device interface 620 is used to couple legacy devices 621 , for example , older styled keyboards and mice , to the processing system 600 . in addition to pixel 631 which may contain a pump circuit of the present invention multimedia processor 618 of fig7 may also utilize an imaging device of the present invention including the cpu 601 . the processing system 600 illustrated in fig7 is only an exemplary processing system with which the invention may be used . while fig7 illustrates a processing architecture especially suitable for a general purpose computer , such as a personal computer or a workstation , it should be recognized that well known modifications can be made to configure the processing system 600 to become more suitable for use in a variety of applications . for example , many electronic devices which require processing may be implemented using a simpler architecture which relies on a cpu 601 coupled to imaging device 608 and / or memory buffer devices 604 . these electronic devices may include , but are not limited to audio / video processors and recorders , gaming consoles , digital television sets , wired or wireless telephones , navigation devices ( including system based on the global positioning system ( gps ) and / or inertial navigation ), and digital cameras and / or recorders . the modifications may include , for example , elimination of unnecessary components , addition of specialized devices or circuits , and / or integration of a plurality of devices . in another embodiment , a negative pump supplies a negative voltage , which is applied to gates such as reset and transfer gates . in this embodiment , the negative pump operates to drive the gate “ off ” harder in n - ch devices . in an alternative embodiment , a positive pump supplies a positive voltage , which is applied to gates such as reset and transfer gates . in this embodiment , the positive pump operates to drive the gate “ off ” harder in p - ch devices . while the invention has been described and illustrated with reference to specific exemplary embodiments , it should be understood that many modifications and substitutions can be made without departing from the spirit and scope of the invention . accordingly , the invention is not to be considered as limited by the foregoing description but is only limited by the scope of the appended claims .	7
first , embodiment 1 of a machine tool according to the present invention will be described with reference to fig1 and 2 . a saddle 23 is supported on a bed 22 of a machine tool 40 by a saddle movement mechanism 25 , and a table 6 is supported on the saddle 23 by a table movement mechanism 24 . further , a column 21 is set up on the bed 22 , and a spindle 3 to which a tool 4 is attached is secured to the top of the column 21 . as the spindle 3 and the table 6 are relatively moved in a machining space , the machine tool 40 machines a workpiece 5 placed on the table 6 . a cover 1 isolates the saddle 23 , table 6 , column 21 , spindle 3 , and tool 4 from the outside and defines the machining space . the cover 1 comprises a front cover 30 , side covers 31 and 32 , rear cover 33 , ceiling cover ( not shown ), and bottom part . the front cover 30 is disposed on the side opposite to the column 21 with the table 6 therebetween . the side covers 31 and 32 are provided on the left and right sides , respectively , of the front cover 30 . the bottom part of the cover 1 comprises a cover front - bottom surface 7 , a cover left - bottom surface 9 , and a cover right - bottom surface 10 . the cover front - bottom surface 7 connects the lower end of the front cover 30 and the front end surface of the bed 22 . the cover left - bottom surface 9 connects the lower end of the left side cover 31 and the left end surface of the bed 22 . the cover right - bottom surface 10 connects the lower end of the right side cover 32 and the right end surface of the bed 22 . the cover front - bottom surface 7 , cover left - bottom surface 9 , and cover right - bottom surface 10 that constitute the bottom part may be members integral with or independent of the front cover 30 , left side cover 31 , and right side cover 32 , respectively . left and right cutting fluid supply passages 11 and 12 are disposed in the machining space to introduce a cutting fluid into the machining space that is isolated from the outside by the cover 1 . the cutting fluid is supplied from a cutting fluid supply device 2 to the left and right cutting fluid supply passages 11 and 12 through a passage ( not shown ). first and second cutting fluid supply nozzles 13 and 15 are provided at predetermined places of the left cutting fluid supply passage 11 , and third and fourth cutting fluid supply nozzles 14 and 16 at predetermined places of the right cutting fluid supply passage 12 . the cutting fluid is discharged in predetermined directions ( see flows 27 of the cutting fluid ) in the machining space from the cutting fluid supply nozzles 13 to 16 . the bottom part of the cover 1 is inclined so that a portion thereof connected to the bed 22 is most elevated and that it gradually inclines from that portion toward its peripheral portion ( or toward the respective lower ends of the front cover 30 and the left and right side covers 31 and 32 ). specifically , the cover front - bottom surface 7 is a slope that gradually inclines from the side connected to the bed 22 toward the lower end of the front cover 30 . further , the cover left - bottom surface 9 is a slope that gradually inclines from the side connected to the bed 22 toward the lower end of the left side cover 31 , while the cover right - bottom surface 10 is a slope that gradually inclines from the side connected to the bed 22 toward the lower end of the right side cover 32 . furthermore , the left and cover right - bottom surfaces 9 and 10 may be gradually inclined from the side connected to the bed 22 toward the lower ends of the left and right side covers 31 and 32 , and at the same time , gradually inclined from the front side of the cover 1 toward the rear side ( or toward the rear cover 33 ). further , a corner portion where the respective lower end portions of the left side cover 31 and the front cover 30 intersect each other may be machined into a round shape with a predetermined curvature , as designated by reference numeral 17 in fig1 . also , a corner portion where the respective lower end portions of the right side cover 32 and the front cover 30 intersect each other may be machined into a round shape with a predetermined curvature , as designated by reference numeral 18 in fig1 . in this way , the flow of chips 26 can be improved to reduce stagnation . with this configuration , if the chips 26 produced by machining are deposited on the cover front - bottom surface 7 of the bottom part of the cover 1 , they are caused to flow toward the outer peripheral portion of the cover front - bottom surface 7 by the cutting fluid supplied from the second and fourth cutting fluid supply nozzles 15 and 16 and collected along the lower end of the front cover 30 . then , the chips 26 , along with the cutting fluid , are discharged to the cover left - bottom surface 9 or the cover right - bottom surface 10 . on the other hand , the chips 26 deposited on the cover left - bottom surfaces 9 and the cover right - bottom surfaces 10 of the bottom part of the cover 1 , along with the chips 26 and the cutting fluid discharged from the cover front - bottom surface 7 , are urged to flow toward and discharged into the cutting fluid supply device 2 at the back by the cutting fluid ( designated by reference numeral 27 in fig1 ) supplied from the first and third cutting fluid supply nozzles 13 and 14 . in the case where the chips 26 are discharged to the front surface or the left and right side surfaces of the machine tool 40 , they are discharged into the cutting fluid supply device 2 through left and right discharge passages 19 and 20 at the respective lower ends of the left and right side covers 31 and 32 , as shown in fig2 . according to this embodiment , the chips 26 deposited on the bottom part of the cover 1 are urged to collect at the outer peripheral portion , the most sunken portion , of the bottom part of the cover 1 by the flows of the cutting fluid from the cutting fluid supply nozzles . thus , the chips 26 deposited on the bottom part ( comprising the cover front - bottom surface 7 , the cover left - bottom surfaces 9 , and the cover right - bottom surfaces 10 ) are discharged into the cutting fluid supply device 2 while moving along the outer peripheral portion of the cover 1 , which is located farthest from the central portion of the machining space inside the cover 1 where a drive system ( comprising the saddle movement mechanism 25 , saddle 23 , table movement mechanism 24 , and table ) is disposed . consequently , it is possible to prevent failure of the machine tool that may be caused if the chips get into the components of the drive system or a lubricant is washed away by the cutting fluid . embodiment 2 of the machine tool according to the present invention will now be described with reference to fig3 and 4 . in this embodiment , the cover front - bottom surface 7 of the bottom part of the cover 1 of embodiment 1 is divided into a cover front - left - bottom surface 7 a and a cover front - right - bottom surface 7 b . the cover front - left - bottom surface 7 a is gradually inclined from the side connected to a bed 22 toward the lower end of a front cover 30 and also gradually inclined toward a left side cover 31 . further , the cover front - right - bottom surface 7 b is gradually inclined from the side connected to the bed 22 toward the lower end of the front cover 30 and also gradually inclined toward a right side cover 32 . thus , in this embodiment , the cover front - bottom surface 7 of the bottom part of the cover 1 is in the shape of an inverted v inclining left and right . since other configurations are the same as those of embodiment 1 , a further description thereof is omitted . in this embodiment , if chips 26 are deposited on the cover front - left - bottom surface 7 a , they are caused to flow on the cover front - left - bottom surface 7 a by a cutting fluid supplied from a second cutting fluid supply nozzle 15 and discharged along with the cutting fluid to the cover left - bottom surface 9 . if the chips 26 are deposited on the cover front - right - bottom surface 7 b , moreover , they are caused to flow on the cover front - right - bottom surface 7 b by the cutting fluid supplied from a fourth cutting fluid supply nozzle 16 and discharged along with the cutting fluid to the cover right - bottom surface 10 . on the other hand , the chips 26 deposited on the cover left - bottom surface 9 and the cover right - bottom surface 10 , along with the chips 26 and the cutting fluid discharged from the cover front - left - bottom surface 7 a and the cover front - right - bottom surface 7 b , are urged to flow toward and discharged into a cutting fluid supply device 2 at the back by the cutting fluid ( designated by reference numeral 27 in fig1 ) supplied from first and third cutting fluid supply nozzles 13 and 14 . embodiment 3 of the machine tool according to the present invention will now be described with reference to fig5 and 6 . this embodiment resembles embodiment 2 described above in that a cover front - bottom surface 7 of a bottom part of a cover 1 is divided into the cover front - left - bottom surface 7 a and the cover front - right - bottom surface 7 b so that it is in the shape of an inverted v inclining left and right . however , this embodiment differs from embodiment 2 in that the cover front - left - bottom surface 7 a and the cover front - right - bottom surface 7 b are not inclined from the side connected to a bed 22 toward the lower end of a front cover 30 . since other configurations are the same as those of embodiment 1 , a further description thereof is omitted . in the machine tool according to the present invention , as described above , the cover comprises the front cover , left and right side covers , and bottom part , and the bottom part is connected to the bed of the machine tool through the respective lower ends of the front and side covers . according to the present invention , moreover , the bottom part of the cover comprises slopes that at least partially inclines from the side connected to the bed toward the outer periphery . the following is a description of some examples of the form of the bottom part of the cover 1 that characterizes the invention . of the bottom part of the cover 1 , the cover left - bottom surfaces 9 connected to the left side cover 31 and the cover right - bottom surfaces 10 connected to the right side cover 32 are slopes that incline outward ( or toward the left and right side covers 31 and 32 ) from the side connected to the bed 22 . of the bottom part of the cover 1 , the cover front - bottom surface 7 connected to the front cover 30 is a slope that inclines outward ( or toward the front cover 30 ) from the side connected to the bed 22 . of the bottom part of the cover 1 , the cover left - bottom surfaces 9 connected to the left side cover 31 and the cover right - bottom surfaces 10 connected to the right side cover 32 are slopes that individually incline rearward or forward relative to the machine tool 40 , in addition to example 1 or 2 . of the bottom part of the cover 1 , the cover left - bottom surface 9 connected to the left side cover 31 is a slope that inclines rearward relative to the machine tool 40 , and the cover right - bottom surface 10 connected to the right side cover 32 is a slope that inclines forward relative to the machine tool 40 , in addition to example 1 or 2 . alternatively , the cover left - bottom surface 9 connected to the left side cover 31 is a slope that inclines forward relative to the machine tool 40 , and the cover right - bottom surface 10 connected to the right side cover 32 is a slope that inclines rearward relative to the machine tool 40 , in addition to example 1 or 2 . of the bottom part of the cover 1 , the cover front - bottom surface 7 connected to the front cover 30 is a slope that inclines from the side of the left side cover 31 toward the right side cover 32 , or vice versa , in addition to example 2 or 4 . of the bottom part of the cover 1 , the cover front - bottom surface 7 connected to the front cover 30 comprises slopes that incline from its central portion to the left and right ( or toward the left and right side covers 31 and 32 ), in addition to any one of examples 1 to 3 . a portion ( or junction ) where the front cover 30 and the left side cover 31 intersect each other and a portion ( or junction ) where the front cover 30 and the right side cover 32 intersect each other are curved surfaces with a predetermined curvature , in addition to any one of examples 1 to 6 . the bottom part of each of the front cover 30 and the left and right side covers 31 and 32 is provided with left and right cutting fluid supply passages 11 and 12 , in addition to any one of examples 1 to 6 .	1
with reference to the above - mentioned drawings , the numeral 1 designates the device provided by the present invention , associated with a tabletting machine 2 , made basically as described in the patent application no . 3746a / 87 filed in italy on dec . 30 , 1987 , in the name of the same applicant . as mentioned above , the tabletting machine 2 comprises a turret 3 to which rotating table 4 , is fastened . matrices 5 for making tablets 10 are housed in the table 4 . for each matrix 5 two punches are provided , an upper punch 6 and a lower punch 7 , which are operated axially by means not illustrated , as described in the application no . 3746a / 87 . above and under the table 4 there are drums designed to support and guide the upper punches 6 and the lower punches 7 respectively . the upper drum bears a series of bushings 9 to support and guide the upper punches 6 . the device 1 , that is the object of the present invention , is located close to a station e where the tablets 10 are ejected . the ejection is caused by the downward axial translation of the upper punch 6 , which pushes the tablet 10 out of the matrix 5 below the table 4 . a column 15 is fastened to the machine 2 with its axis vertical . on the column 15 a metal tube 17 is coaxially mounted by means of bearings 16 which allow the tube to rotate axially with respect to the column . a crown gear 18 is made integral with the upper head of the metal tube 17 and is positioned so that its teeth 18a fit the bushings 9 supporting and guiding the upper punches 6 . in this way the crown gear engages with the upper drum 8 and thus with the turret 3 , and the tube is made to rotate in synchronism with the turret 3 . a disk 19 is coaxially fixed to the lower head of the metal tube 17 just over a supporting plate 21 keyed onto the column 15 just below the table 4 .. on the circumference of the disk 19 there are provided hollows 20 equally spaced angularly . the &# 34 ; pitch &# 34 ; between two consecutive hollows 20 coincides with the &# 34 ; pitch &# 34 ; existing between two consecutive matrices 5 on the table 4 . the rotation of the turret 3 causes a corresponding rotation of the disk 19 in synchronism with the rotation of the table 4 , so that the hollows 20 pass in turn below the matrices 5 , in the ejection station e , during the ejection phase of the tablets 10 . the disk 19 is covered by a cover 11 fastened above the border 22 . the supporting plate 21 , is located below the disk 19 is placed coaxially fastened to the column 15 . a raised border 22 , is made along the circumference of the plate 21 and extends to enclose the disk 19 , for 270 degrees approximately , starting from the area corresponding to the station e . close to the terminal part of the border 22 and along the trajectory of the hollows 20 , three holes 23 , 24 , 25 are provided , having the purpose to discharge the tablets . the device can work even in presence of a single hole , however , as described below , the presence of several holes makes it possible to select the tablets . under the plate 21 there are three discharge channels , made integrally in a single body 26 , one for each hole . it is evident that , in the case that a single hole is provided , or two holes , or three holes , in the plate 21 , the number of channels shall be varied accordingly . furthermore , the channels can be made in several separate bodies , each of them comprising a single channel or several channels . the tablets 10 are ejected from the matrices 5 in the ejection station e and in turn drop into the hollows 20 of the disk 19 . then the tablets are pulled along the route of the hollows , being supported from below by the plate 21 , and being held inside the hollows by the raised border 22 and by the cover 11 . when the tablets reach the area with the three holes , then selecting means , not illustrated since they are known , are activated and cause the ejection of the tablet to be discarded , through the first hole 23 and through the first discharge channel . these are , for instance , the tablets produced during the starting and stopping phases of the machine , or those coming out when special control means associated with the punches have detected an irregular compression of the tablet . the tablet can also be discharged through the second hole 24 to be sent to a control device , through the second discharge channel . furthermore , and this is the most general case , the tablets are discharged through the third hole 25 and sent to a collecting container or to a packaging machine . the third hole 25 can be omitted since the tablets can leave the device following a tangential trajectory , after the end of the raised border 22 ( fig4 a and 4b ). in this last case a special c - shaped conveyor 12 intercepts the tablets 10 which , by the action of inertia , tend to continue their run with a rectilinear trajectory , after the end of the raised border 22 . then the c - shaped conveyor 12 conveys the tablets towards the relative discharge channel 13 . the conveyor 12 is closed on its front side by a front panel 14 . the selecting means can comprise ejectors suited to eject a jet of air after a start signal . as it results from what has been said above , the adoption of the present device makes it possible to carry out a rational selection of the tablets coming out of the tabletting machine with which it is associated . in other words , it is possible to determine which of the matrices has produced a tablet and in which moment , thanks to the relationship of phase existing between the movement of the disk 19 and the rotation of the table 4 . for example , following the detection , made by suitable means of known type , of differences of pressure acting on the punches , it is possible to determine the malfunctioning of a matrix , and without stopping the machine immediately , it is possible to selectively discard the tablets produced by that particular matrix . furthermore , it is possible to carry out periodic controls on the operating conditions of each matrix as well as of means associated thereto . in particular it is possible to check at regular intervals of time the weight , height ( or , more generally , the dimensions ) and the consistency of the tablets produced by each matrix , in order to verify the correct feeding or the correct working of the matrices and of the means associated thereto . by means of an electronic processing unit , operated by a suitable program , it is possible to check in turn all the matrices and to compare the results with the features of the tablet made by each of them . as another option , it is possible to select a more frequent check on one or more matrices and a less frequent check on the other ones . moreover it is possible to modify , when necessary , the frequency of checks on the ground of the results accomplished each time and of the comparison with the previously obtained results . all this can be done in a flexible way and in &# 34 ; real time &# 34 ; through the electronic management of the check procedure cooperating with the device here described that establishes a mechanical correlation between each matrix working and the tablet produced each time by the matrices . the data resulting from the checks on the finished product are not lost , but they are stored in a memory and subsequently compared with new data as well as with other data collected while obtaining the products ( e . g . by loading cells associated with the punches ). hence it is possible to draw a real diagram of the operating features , as they are recorded time by time , for each matrix and for the means associated thereto . according to such diagrams , virtually drawn in the computer memory , the machine is able to fix whether and when it is necessary to discard the tablets ejected from a matrix , or to arrange a more frequent series of checks on a particular matrix , or when it is necessary to modify any parameter before stopping the machine for a more radical intervention . all the skilled in the field will surely acknowledge the opportunities offered by this device , so designed , to check and modify the operating modes of the machine . in conclusion , the present invention provides a system for self - checking the settings of the tabletting machine , with obvious advantages . the object of the invention is therefore accomplished through the device described hereby , which takes the ejected tablets keeping the phase correlation with the tabletting machine , so as to trace the origin of each tablet . it is understood that the above has been described by way of example and it is not restrictive , therefore any other possible embodiment of the device described above is to be considered as covered by the patent hereby applied for , as described above and as claimed here below .	1
for clarity , the same elements have been designated with the same reference numerals in the different drawings and , further , the various drawings are not to scale . fig5 a , 5 b , 5 c , 6 a , 6 b , 7 a , 7 b , and 8 a , 8 b schematically illustrate steps of a method for manufacturing semiconductor chips , capable of producing , in a production line specifically adapted to process semiconductor wafers arranged on a frame 34 of the type described in relation with fig3 , chips arranged on a frame 44 of the type described in relation with fig4 , of outer dimensions smaller than those of frame 34 . fig5 a , 6 a , 7 a , and 8 a are top views , fig5 b , 6 b , 7 b , and 8 b respectively are cross - section views along planes b - b of fig5 a , 6 a , 7 a , and 8 a , and fig5 c is a bottom view corresponding to fig5 a . fig5 a , 5 b , and 5 c illustrate a step during which frames 34 and 44 are superposed , and then fastened to each other . in this example , frame 34 comprises three guide rails 51 a to 51 c previously fastened to its lower surface , for example , by welding or by gluing , in the vicinity of three side of the square forming the outer contour of the frame . guide rails 51 a , 51 b , and 51 c delimit a space inside of which frame 44 is capable of being inserted so that frames 34 and 44 are superposed , that is , their inner contours have approximately the same center in top view . the interval between two guide rails 51 a and 51 c fastened to opposite sides of frame 34 substantially corresponds to the outer width of frame 44 , and the distance between the center of frame 34 and third guide rail 51 b substantially corresponds to half the outer width of frame 44 . a removable lug 53 is capable of being fastened , for example by means of screws 55 ( three screws in the present example ), to the lower surface of frame 34 , in the vicinity of the side of frame 34 which is not provided with a guide rail 51 ( on the side of frame 34 opposite to guide rail 51 b ). for this purpose , tapped holes may have been drilled in frame 34 . as an example , when lug 53 is screwed to frame 34 , the interval between lug 53 and guide rail 51 b is substantially equal to the outer width of frame 44 . to superpose frame 44 to frame 34 , mounting lug 53 is removed and frame 44 is inserted between guide rails 51 a , 51 b , and 51 c to have the centers of the frames coincide ( in top view ). to lock frame 44 in this position , mounting lug 53 is put back in place and screwed to frame 34 . at the end of this assembly step , frames 34 and 44 are superposed and firmly fastened to each other . in this example , the lower surface of frame 34 is placed against the upper surface of frame 44 . guide rails 51 a to 51 c and mounting lug 53 are provided to remain within the outer contour of frame 34 . thus , in top view , the outer contour of the assembly formed by frames 34 and 44 corresponds to the outer contour of frame 34 . such an assembly is compatible with processing machines capable of receiving frame 34 . it should be noted that the thickness difference between this assembly and frame 34 alone poses no problem of compatibility with existing equipment . it will however preferably be provided to use a specifically thinned down frame 34 so that the thickness of the assembly is as close as possible to the thickness of a standard frame 34 . fig6 a and 6b illustrate a step during which a semiconductor wafer 57 is arranged on a surface of an adhesive film 59 stretched on frame 44 . the adhesiveness of film 59 allows an easy bonding of the film to the frame and of the wafer to the film . however , if film 59 is not adhesive , it may be provided to bond the film to the frame and / or the wafer to the film by means of glue or of any other adapted bonding means . in this example , film 59 is bonded on the lower surface side of frame 44 . fig7 a and 7b illustrate the step during which the semiconductor wafer is cut into individual chips 58 . the cutting is conventionally performed by means of a circular saw ( not shown ) running through the wafer along a grid of lines and columns . any other adapted cutting means may however be used . in this example , the cutting is performed across the entire thickness of the wafer and stops in the upper portion of adhesive film 59 , without however cutting this film . fig8 a and 8b illustrate a final step where frames 34 and 44 are separated and frame 34 is removed . to achieve this , removable mounting lug 53 ( fig7 a ) is unscrewed and frame 44 supporting film 59 and individual chips 58 is removed from the space delimited by guide rails 51 a to 51 c ( fig7 a ). the wafer cut into individual chips 58 can then be shipped to a user on frame 44 , for example , for a mounting of chips 58 in electronic devices by means of equipment which is not compatible with frame 34 but which is capable of receiving frame 44 . it should be noted that other steps , not shown , for example , inspection , testing and / or marking steps , may be provided between the wafer cutting ( fig7 a , 7 b ) and the separation of the frames ( fig8 a , 8 b ). an advantage of such a method is that it enables , by a simple operation , to produce , in a manufacturing line specifically adapted to receiving frames of a first type , semiconductor chips arranged on a frame of a second type having dimensions smaller than those of the frames of the first type . specific embodiments have been described . various alterations , modifications and improvements will readily occur to those skilled in the art . in particular , a method comprising a step during which a second smaller frame is fastened to a first frame , a step during which a wafer arranged on the second frame is cut by means of equipment compatible with the first frame , and a step of frame separation to use equipment compatible with the second frame have been described herein . the present invention is not limited to this specific case . it will be within the abilities of those skilled in the art to implement the provided method in the case where the steps of processing , by means of equipment compatible with the first frame , of a wafer arranged on the second frame , are steps other than the cutting and / or test steps . further , the present invention is not limited to the above - mentioned case in which the processing steps implemented by means of equipment compatible with the second frame , after separation of the frames , are steps of assembly of the cut chips . further , the frames may have any other shape than those shown and described hereabove , provided however for the outer dimensions of the second frame to be smaller than the outer dimensions of the first frame and greater than the inner dimensions of the first frame . moreover , it will be within the abilities of those skilled in the art to implement the desired operation by using systems for fastening the second frame to the first frame other than the above - described system . it will however be ascertained for the used fastening system to remain contained within the outer contour of the first frame . such alterations , modifications and improvements are intended to be part of this disclosure , and are intended to be within the spirit and the scope of the present invention . accordingly , the foregoing description is by way of example only and is not intended to be limiting . the present invention is limited only as defined in the following claims and the equivalents thereto .	8
in a preferred embodiment the present invention is directed to a process for fluorination of compounds of the above formula wherein ar is benzene ; z is 1 or 2 ; r is a halogen , preferably fluorine , chlorine , or bromine and n is 0 to 2 . such starting compounds may be characterized by the formula : ## str1 ## wherein z is 1 or 2 , preferably 2 , r is halogen , preferably chlorine , and n is 0 to 2 , preferably 0 . in accordance with this invention such compounds are fluorinated by reaction with hydrogen fluoride , preferably in an amount less than the stoichiometric amount necessary to completely replace the chlorine atoms on the side chain ( s ) with fluorine in the presence of molybdenum pentachloride . the fluorination occurs on the side chain of the aromatic compound with the replacement of the halogen atoms thereof by fluorine . the degree of fluorination will depend in part on the amount of fluorinating agent supplied to the reaction and the length of time the reaction is carried out . thus , for example , depending on these and other conditions of reactions described hereinbelow , a compound of the above formula wherein z is 1 , such as ## str2 ## in the liquid phase , may be reacted with hydrogen fluoride , in the presence of molybdenum pentachloride to prepare ## str3 ## or mixtures thereof . similarly , a compound of the above formula wherein z is 2 , such as , ## str4 ## wherein n is 0 to 2 , is reacted with hydrogen fluoride in the presence of molybdenum pentachloride to prepare compounds such as : ## str5 ## or various mixtures of such fluorinated or partially fluorinated compounds . alternatively , partially fluorinated compounds , such as compounds a i and a ii may be employed as starting materials and further fluorinated by the process of this invention to produce higher fluorinated compounds such as compounds a ii and a iii . similarly , partially fluorinated compounds such as b i through b viii may be employed as starting materials and further fluorinated by the process of this invention to produce higher fluorinated compounds such as b ii through b ix . the temperature of the reaction may vary considerably , but will typically be maintained in a range of about 0 ° celsius to the boiling point of the halogenated aromatic reactant . the optimum temperature will vary somewhat , depending on the particular halogenated aromatic compound to be fluorinated . preferably , in the fluorination of benzotrichloride or hexachloroxylene , the reaction temperature is about 20 ° to about 75 ° celsius . the reactions are preferably carried out at atmospheric pressure , although sub - atmospheric or super - atmospheric pressures may be employed . the amount of catalyst employed may vary considerably , for example , as high as 5 percent or higher . higher concentrations may be employed but provide no special advantage and in addition , increase the possibility of polymer formation . moreover , it is a particular advantage of the catalyst of this invention that the reaction may be effectively carried out with relatively low concentrations of catalyst . thus , the preferred amount of molybdenum pentachloride catalyst is about 0 . 01 to about 1 . 0 percent by weight based on the amount of halogenated aromatic compound . most preferably , the amount of molybdenum pentachloride catalyst is about 0 . 02 to about 0 . 2 percent by weight based on the amount of halogenated aromatic compound . typically , the process of this invention is carried out by charging the liquid halomethyl aromatic compound and molybdenum pentachloride catalyst to a reactor and feeding hydrogen fluoride in either the liquid or gaseous state , at a temperature , for example , of about 0 ° to about 100 ° celsius , into the charged reactor . the reaction mixture may be stirred or agitated to provide good contact of the reactants and the catalyst . the reaction may be carried out in a batch process or continuous process . the length of time of the reaction will vary considerably , depending for example , on the strength or concentration of fluorinating agent employed and the degree of fluorination desired . many of the common fluorinating agents which will result in the desired reaction , may be employed . however , because of its reactivity and availability , the preferred fluorinating agent is hydrogen fluoride . it is an advantage of this invention that hydrogen fluoride may be employed either in concentrated or dilute form . it is preferred to carry out the fluorination process of this invention in the absence of a solvent . however , a solvent may be employed , if desired . typical solvents which may be employed include , for example , aromatic hydrocarbon solvents , such as benzene , or perfluorinated solvents , such as perfluorinated alkanes and the like , which solvents may , in some instances , be added as a reactant . the amount of hydrogen fluoride employed will vary depending on the degree of fluorination desired . an excess of fluorinating agent may be employed . however , it is a particular advantage of the process of this invention that a large excess hydrogen fluoride is not required . thus , hydrogen fluoride is preferably employed in an amount of approximately stoichiometric quantities , up to about 15 percent stoichiometric excess , based on the degree of fluorination desired . thus , for example , when a compound such as benzotrichloride is to be partially fluorinated in accordance with the invention it is preferred to employ less than about 3 moles of hydrogen fluoride per mole of benzotrichloride . similarly , for the partial fluorination of hexachloroxylene , it is preferred to employ less than about 6 moles of hydrogen fluoride reactant . in one aspect of this invention , the liquid phase fluorination , utilizing a molybdenum pentachloride catalyst may be combined with a known vapor phase fluorination process to provide a highly effective two step fluorination process wherein improved utilization of hydrogen fluoride is achieved . vapor phase fluorination processes commonly employ a substantial stoichiometric excess of hydrogen fluoride -- typically in the range of a 50 percent excess . as a result , the off - gases from such processes are a mixture of hf and hcl . dilute hf mixtures of this type are generally ineffective as starting materials in the vapor phase processes and thus are not readily re - cyclable in the process . however , such dilute hf gas mixtures , especially mixtures of hf and hcl , may be employed as the fluorinating agent in the process of this invention . thus , the process of this invention provides an effective means of utilization of the dilute hf effluent gases of a vapor phase fluorination process . hf - hcl mixtures , such as the effluent gases from a vapor phase fluorination process may be utilized as fluorinating agents in accordance with this invention either in a separate , independent liquid phase fluorination process or as an additional step , in combination with a vapor phase fluorination process . in the latter case , the hf - hcl off - gases from a vapor phase process may be supplied directly or indirectly to a liquid phase reactor charged with the haloalkyl aromatic compound to be fluorinated and a catalytic amount of molybdenum pentachloride . the haloalkyl aromatic compound is then at least partially fluorinated in the manner hereindescribed so that for example on the average , at least one halogen atom on the haloalkyl side chain is replaced by a fluorine atom . the liquid phase fluorination may be carried out to various degrees of fluorination . thus , in the liquid phase fluorination step the haloalkyl aromatic may be fully fluorinated or fluorinated to the degree required for a particular product and this fully or partially fluorinated product recovered as the end product . alternatively , in a preferred embodiment , the haloalkyl aromatic is partially fluorinated in the liquid phase and the partially fluorinated product re - cycled to the vapor phase fluorination step to be more fully fluorinated . as an example of this embodiment , the preparation of p - chlorobenzotrifluoride may be considered . in a simplified overview the process may be described as follows : p - chlorobenzotrochloride is fed into a vapor phase fluorination reactor together with a substantial excess of anhydrous hydrogen fluoride and reacted therein until substantially complete conversion to p - chlorobenzofluoride is achieved . the effluent gas , primarily a mixture of hf and hcl is routed to a liquid phase reactor charged with p - chlorobenzotrichloride and a catalytic amount of molybdenum pentachloride . in the liquid phase fluorination step the p - chlorobenzotrichloride is partially fluorinated to form , for example , a monofluorinated product and / or a difluorinated product . this partially fluorinated product is then filtered and recycled to the vapor phase reactor , and combined with the vapor phase starting material p - chlorobenzotrichloride to be substantially fully fluorinated by reaction with anhydrous hf . the preferred partially fluorinated product of the liquid phase reaction , to be recycled is the monofluorinated product . the final off - gas from this two step process is hcl which may contain minor amounts , such as up to about 10 % of hf . the hf may be separated by known means to produce substantially pure hcl , useful in a variety of commercial purposes , such as the production of commercial grade muriatic acid . the aforementioned &# 34 ; monofluorinated product &# 34 ; and &# 34 ; difluorinated product &# 34 ; refer to products having a corresponding average replacement of halogen atoms by fluorine atoms , even though some molecules may have no halogen atoms replaced while others may have one , two or three halogen atoms replaced . thus , for example , in the fluorination of benzotrichloride , the monofluorinated product may be a mixture of benzotrichloride ( α , α , α - trichlorotoluene ), benzofluorodichloride ( α - fluoro - α , α - dichlorotoluene , benzodifluorochloride ( α , α - difluoro - α - chlorotoluene ) and benzotrifluoride ( α , α , α - trifluorotoluene ) wherein the average replacement for all of the benzotrichloride molecules subject to the fluorination process is approximately one fluorine atom per molecule . in a similar manner , the difluorinated product may refer to a product wherein the average replacement is two fluorine atoms per molecule . it will be seen that in accordance with the description hereinabove the liquid phase fluorination process of this invention may be employed in the production of partially fluorinated or fully fluorinated haloalkyl aromatic products ( the term &# 34 ; fluorinated &# 34 ; referring to fluorine replacements on the haloalkyl side chain ); and may utilize as the fluorinating agent either anhydrous hf or dilute hf - hcl mixtures or other fluorinating agents . furthermore , this liquid phase process may be employed as an independent process or may be employed in a two step process together with a vapor phase fluorination step . one suitable vapor phase reaction that may be employed in combination with the liquid phase process of this invention is described in u . s . pat . no . 3 , 859 , 372 , the disclosure of which is incorporated herein by reference . however , other vapor phase processes known in the art may similarly be combined with the liquid phase process of this invention . thus the partially fluorinated compounds such as a - 1 , a - ii and b - i through b - viii , and others , which may be prepared in accordance with this invention may be advantegeously employed as starting materials in various other fluorination processes such as the aforementioned vapor phase fluorination processes . in addition , the partially fluorinated compounds may be employed as chemical intermediates for the preparation of various end products , such as pesticides and dyestuffs . in particular , trichloromethyl - trifluoromethyl aromatic compounds , such as compound b - iv , above , are especially useful as chemical intermediates since the trichloromethyl group is readily hydrolyzed to form , for example carboxylic acid or carboxamide derivatives or partially hydrolyzed to form benzoyl chloride derivatives . the examples set forth hereinbelow will serve to further illustrate the invention and the manner in which it may be practiced . the examples are set forth for purposes of illustration and are not to be construed as limitative of the present invention . many variations of the process may be made without departing from the spirit and scope of the invention . in the examples , unless otherwise stated , all parts and percentages are by weight and all temperatures are in degrees celsius . a stirred batch steel reactor was charged with 15 , 436 parts of distilled benzotrichloride ( greater than 99 % purity ) and 23 . 2 parts of molybdenum pentachloride . the reactor was heated to a temperature in the range of 40 ° to 60 ° c . and anhydrous hydrogen fluoride , at a temperature of about 75 ° c . was bubbled in at a rate of about 15 to 17 parts per minute , with agitation . the effluent gases were passed through a reflux condenser and cold trap to prevent loss of organic materials . the reaction was continued under these conditions with periodic sampling and specific gravity determination of the samples . the effluent gases were analyzed periodically and when hcl evolution ceased the reaction was assumed to be complete . the reaction product was analyzed by gas chromatographic techniques and found to contain 99 . 4 % benzotrifluoride . in a continuous liquid phase fluorination , a stream of parachlorobenzotrichloride ( 96 . 5 % pure ), containing 0 . 05 percent molybdenum pentachloride , was fed into a columnar nickel reactor co - currently with a gaseous mixture of hf and hcl in a molar ratio of about 0 . 5 hf : hcl . the reaction temperature was maintained between 35 ° and 55 ° c . and the flow rate of the reactants was adjusted to provide a retention time of about 3 hours . the reaction was continued for a period of 75 hours during which the progress of the reaction was monitored through periodic sampling and analysis of the reaction mixture and effluent gases . analysis of the product by gas chromatography indicated the following typical composition in mole percent : chlorobenzotrifluorides , 0 . 2 %; p - chloro - α - fluoro - α , α - dichlorotoluene , 12 . 0 %; p - chloro - α , α - difluoro - α - chlorotoluene , 39 . 0 %, parachlorobenzotrichloride , 43 . 0 %; others , 5 . 8 %. the product collected during the reaction was filtered and fed to a vapor phase fluorinator of the type described in u . s . pat . no . 3 , 859 , 372 where it was further reacted with anhydrous hydrogen fluoride . in the vapor phase fluorinator , anhydrous hydrogen fluoride was supplied to the reaction in an amount of about 3 moles of hf per mole of organic feed . the final product of the vapor phase reaction step contained greater than 95 % parachlorobenzotrifluoride . a mixture of 29 , 860 parts of parachlorobenzotrichloride and 2 . 968 parts of molybdenum pentachloride was charged to a nickel reaction vessel and heated to 50 ° c . ( the parachlorobenzotrichloride feed was 95 % pure , and contained about 5 % of metachloro -, and orthochloro - isomers and higher chlorinated materials ). the temperature was maintained at about 50 ° c . and the reactor contents were stirred continuously while a gaseous mixture of hydrogen fluoride and hydrogen chloride was sparged into the reactor over a period of 10 hours and 20 minutes . the gaseous mixture was composed of about 33 mole percent of hf and 67 mole percent of hcl and was representative of the effluent gas from a catalytic vapor phase fluorination process wherein 4 . 5 moles of hc is supplied per mole of parachlorobenzotrichloride . the feed rate of hf was 1 . 45 parts per minute . samples of the reaction mixture and the hcl effluent gas were withdrawn periodically and analyzed . completion of the reaction was indicated by the cessation of hcl evolution . the final product was analyzed by gas chromatography and found to contain 97 . 5 percent parachlorobenzotrifluoride . parachlorobenzotrichloride was fluorinated as in example 3 except that the reaction was carried out on a continuous basis over a 54 hour period as follows : the parachlorobenzotrichloride , containing 0 . 1 percent molybdenum chloride was fed to the reactor at a rate of 4 . 94 parts per minute . the hf - hcl mixture was fed to the reactor at a rate of 1 . 45 parts per minute , based on hf ( about 10 percent above the stoichiometric amount . the feed rates of the reactants were such as to allow a 10 hour residence time . the composition of the hf feed gas varied between an hf : hcl molar ratio of about 1 : 2 and 1 : 3 . analysis of the reaction product over a 54 hour period indicated an average composition of about 92 percent parachlorobenzotrifluoride . in examples 5 - 10 a mixture of 583 parts of benzotrichloride ( btc ) and 0 . 583 parts of molybdenum pentachloride was charged to a teflon reaction vessel and heated to about 50 ° c . hydrogen fluoride , at a temperature of about 70 ° c . was cooled slightly and bubbled into the reactor . the temperature was maintained at about 50 ° c . and the reaction mixture was stirred , while the hydrogen fluoride was introduced slowly at the rate and total amount shown in the table i below . product samples were stirred over soda ash , filtered and the percent benzotrifluoride ( btf ) was determined by gas chromatography with the results as shown in the table . for purposes of comparison , in example 11 the procedure was repeated except that the reactor was not heated , no catalyst was employed , and the reaction mixture was exposed to ultraviolet radiation from a 100 watt mercury lamp laced about one inch from the reactor wall . also for purposes of comparison , in example 12 , the procedure of examples 5 - 10 was repeated except that no molybdenum pentachloride catalyst was employed . table i__________________________________________________________________________mocl . sub . 5 catalyzed btc to btf reactionsweight % total hfof mocl . sub . 5 btc btf time of hf flow % excess reactor introducedexamplecatalyst ( parts ) (%) reaction ( parts / min .) hf temp ° c . ( parts ) __________________________________________________________________________5 0 . 10 583 97 . 5 5 hr . 10 min . 0 . 64 12 % 50 °- 55 ° 2006 0 . 10 583 98 . 1 2 hr . 45 min . 1 . 48 36 % 50 °- 70 ° 2447 0 . 10 583 97 . 2 1 hr . 50 min . 1 . 77 10 % 50 °- 60 ° 1958 0 . 10 583 98 . 4 1 hr . 35 min . 1 . 93 3 % 50 °- 60 ° 1839 0 . 10 583 98 . 5 1 hr . 11 min . 2 . 70 8 % 50 °- 53 ° 19210 0 . 10 583 95 . 4 48 min . 4 . 65 25 % 50 °- 60 ° 22311 -- 583 3 . 0 3 hr . 5 min . 1 . 62 167 % 15 °- 25 ° 300 ( u . v . ) 12 -- 583 3 . 5 3 hr . 20 min . 1 . 64 183 % 15 °- 25 ° 328__________________________________________________________________________ a mixture of 62 . 6 parts of 3 - bis -( trichloromethyl ) benzene and 1 . 0 part of molybdenum pentachloride was heated to about 60 ° c . and maintained thereat , with stirring , while hydrogen fluoride was bubbled into the mixture at a rate of about 0 . 077 parts per minute until a total of about 12 . 0 parts of the hydrogen fluoride had been added . the mixture was stirred for an additional hour . the reaction product was analyzed by gas chromatographic techniques and found to contain the following : ______________________________________product % ______________________________________1 , 3 - bis -( trichloromethyl ) benzene 9 . 01 - trichloromethyl - 3 -( dichloro - fluoromethyl ) benzene 6 . 31 - trichloromethyl - 3 -( chloro - difluoromethyl ) benzene 38 . 61 , 3 - bis -( dichloro - fluoromethyl ) benzene 1 . 41 - trichloromethyl - 3 - trifluoromethyl benzene 14 . 71 -( dichloro - fluoromethyl )- 3 -( chloro - difluoromethyl ) benzene 1 . 61 -( dichloro - fluoromethyl )- 3 -( trifluoro - methyl ) benzene 22 . 11 , 3 - bis -( chloro - difluoromethyl ) benzene 1 . 11 -( chloro - difluoromethyl )- 3 - trifluoro - methyl benzene 1 . 11 , 3 - bis -( trichloromethyl ) benzene trace amount______________________________________	2
the multifunction video camera assembly of the present invention can be connected to a computer , such as , a desktop computer or a notebook , to output image signals , and equipped with additional peripheral interfaces to provide the additional functions of various computer peripherals . referring to fig1 , fig2 , and fig3 , a multifunction video camera assembly according to a first embodiment of the present invention is provided . the multifunction video camera assembly includes a computer video camera 100 and two computer peripherals 200 , wherein the computer video camera 100 and the computer peripherals 200 are column shaped . however , the shape is not limited to this , and other various shapes also can be used . also , in the present embodiment , each of the computer peripherals 200 is a speaker , and it is also may be a microphone , a wireless receiver , a usb hub , a fingerprint identification device , a card reader , a ion generator , and the like . the computer video camera 100 includes an inner frame 110 , two housings 121 and 122 , and a video camera unit 300 , wherein the inner frame 110 is provided with a first bevel surface 111 respectively on both ends of the computer video camera 100 , and the first bevel surface 111 forms an inclined angle with the central axis of the computer video camera 100 . a shaft hole 112 is formed on the first bevel surface 111 , and an annular groove 112 a is provided on the inner wall of the shaft hole 112 . the inner frame 110 is formed with a pivot base 113 , to which the video camera unit 300 is pivotally connected , so that the video camera unit 300 is pivotally disposed in the computer video camera 100 , and a camera lens 310 of the video camera unit 300 is exposed to the outside through an opening 121 a of the housing 121 . also , several expansion interfaces are disposed in the computer video camera 100 for expanding the function of the computer video camera 100 . a circuit board 114 is disposed in the computer video camera 100 , and the expansion interfaces are disposed on the circuit board 114 . the expansion interface are exposed to the outside via through holes 122 a of the image camera 100 , wherein the through holes 122 a has many configurations to match with various forms of expansion interfaces . the expansion interfaces can be an earphone socket 1141 , a microphone socket 1142 , and a usb port 1143 , which can be exposed to the outside via the through holes 122 a for inserting an earphone , a microphone , or a usb wire . the usb port 1143 is used to connect to the computer , for plugging in other computer peripherals , so that the present invention is provided with the function as a usb hub . each of the two computer peripherals 200 has two inner housings 210 and two outer housings 220 , wherein an inner accommodation space is formed after the two inner housings 210 have been coupled with each other , and then the two inner housings 210 are wrapped by the two external housings 220 to change the appearance of the computer peripherals 200 . a second bevel surface 230 is formed on one end of the computer peripheral 200 , and a shaft 231 is protruded on the second bevel surface 230 perpendicularly , wherein a flange 231 a is formed surrounding the circumference surface of the shaft 231 . moreover , the other end of the computer peripheral 200 is formed as a planar surface ; and the planar surface is composed of a cover board 240 with meshes 241 . a speaker unit 250 is disposed in the inner housing 210 , which directs to the cover board within the computer peripheral 200 , so as to produce sounds to the outside through the meshes 241 , such that the computer peripheral 200 is formed as a speaker . referring to fig4 , fig5 , and fig6 , as for the assembling the multifunction video camera assembly the first embodiment of the of the invention , the shaft 231 of the computer peripheral 200 is first inserted into the shaft hole 112 of the computer video camera 100 , so that the second bevel surfaces 230 of the two computer peripherals 200 get into contact with the first bevel surfaces 111 of the computer video camera 100 respectively ; and each of the second bevel surfaces 230 is pivotally connected to one of the first bevel surfaces 111 of the computer video camera 100 , such that the flange 231 a on the shaft 231 can be embedded into the annular groove 112 a of the shaft hole 112 , thus , the computer peripheral 200 is pivotally connected to the computer video camera 100 , and it can rotate relative to the computer video camera 100 without falling off . through the relative rotation of the computer peripherals 200 and the computer video camera 100 , the relative angle there - between can be changed , and the angle between the central axis of the computer peripheral 200 and the central axis of the computer video camera 100 also can be changed , such that the direction of the planar surface of one end of the computer peripheral 200 can be changed by rotating the computer peripheral 200 without moving the computer video camera 100 , as shown in fig5 . the computer video camera 100 and the computer peripheral 200 can relatively rotate along the first bevel surface 111 and the second bevel surface 230 , so that there is an inclined angle relatively between the computer video camera 100 and the computer peripheral 200 . this inclined angle is determined by the oblique angle of the first bevel surface 111 and the second bevel surface 230 , the inclined angle between the i computer video camera 100 and the computer peripheral 200 after both of them have relatively rotated 180 degrees can be changed by changing the oblique angles . of course , the relative angle between the image camera 100 and the computer peripheral 200 also can be changed gradually , such that the user can determine the desirable angle , and the multifunction camera assembly can be provided with various use configurations . as shown in fig7 , a second embodiment of the present invention is provided , wherein the function of the computer peripheral 200 is not limited to the speaker , and other forms of peripheral interface devices also can be used to cater to the demanding of the user . in the second embodiment , a speaker unit 250 is disposed in one of the two computer peripherals 200 to form a speaker ; a card reader module 260 is disposed in the other computer peripheral 200 , then the computer peripheral 200 becomes a card reader . the card reader module 260 has a slot 261 for plugging in an electronic card 262 , such as a flash card or a financial chip card with various specifications , to read data and transmit the data to the computer through the transmission wire . through rotating the computer peripheral 200 according to the requirement of the user , the direction of the opening of the slot 261 can be turned to the direction suitable for operation . referring to fig8 , a third embodiment of the preset invention is provided . a speaker unit 250 is disposed in one of the two computer peripherals 200 to form a speaker ; an audio receiver unit 270 is disposed in the other computer peripheral 200 , such that the computer peripheral 200 becomes a microphone . therefore , the multifunction camera assembly is provided with the functions of image capturing , sound broadcasting , audio receiving , and the like . meanwhile , since the computer peripheral 200 can rotate relative to the image camera 100 , the directions of the speaker unit 250 and the audio receiver unit 270 can be changed , such that both of them have preferred effects for receiving audio and broadcasting sounds . referring to fig9 , a fourth embodiment of the present invention is provided . a speaker unit 250 is disposed in one of the two computer peripherals 200 to form a speaker ; a fingerprint identification module 280 is disposed in the other computer peripheral 200 , such that the computer peripheral 200 becomes a fingerprint identification device through this fingerprint identification module 280 , thereby a user can carry out fingerprint identification , to protect the computer and to provide different authorization of different users for operating the computer . referring to fig1 , a fifth embodiment of the present invention is provided . a speaker unit 250 is disposed in one of the two computer peripherals 200 to form a speaker ; an ion generating module 290 is disposed in the other computer peripheral 200 , such that an ion generating effect can be achieved through this ion generating module 290 . therefore , the computer peripheral becomes an ion generator for improving the quality of the environment when a user operates the computer . referring to fig1 , a sixth embodiment of the present invention is provided , which includes a computer video camera 400 , wherein one end of the computer video camera 400 has a first bevel surface 410 , and the other end has a second bevel surface 420 . two computer peripherals 500 , 600 with a third bevel surface 530 and a fourth bevel surface 640 respectively are provided , wherein the first bevel surface 410 is pivotally connected to the third bevel surface 530 ; the second bevel surface 420 is pivotally connected to the fourth bevel surface 640 , such that the two computer peripherals 500 , 600 are pivotally connected to both ends of the computer video camera 400 . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	7
preferred embodiments of the invention provide a linear character selection interface that enables a user to enter ambiguous text input using only a linear navigation control . the linear character selection interface provides character / symbol clusters that are linearly rendered on a device display and are navigable in a single dimension . the linear character selection interface addresses the drawbacks of linear navigation of an alphabet space by ( 1 ) reducing the average distance traversed by clustering the alphabets into groups and ( 2 ) providing for the coarse selection of the desired alphabet . these advantages enable the user to avoid the overshoot and undershoot problems described above , and increase the user &# 39 ; s speed of text entry . the techniques described herein are particularly useful on input constrained and / or display constrained devices with or without a keypad . embodiments of the present invention build on techniques , systems , and methods disclosed in earlier filed applications , including , but not limited to u . s . patent application ser . no . 11 / 136 , 261 , filed 24 may 2005 , entitled “ method and system for performing searches for television programming using reduced text input ”, u . s . patent application ser . no . 11 / 246 , 432 , filed 07 oct . 2005 , entitled “ method and system for incremental search with reduced text entry where the relevance of results is a dynamically computed function of user input search string character count ”, u . s . patent application ser . no . 11 / 312 , 908 , filed 20 dec . 2005 , entitled “ method and system for dynamically processing ambiguous , reduced text search queries and highlighting results thereof ”, u . s . patent application ser . no . 11 / 235 , 928 , filed 27 sep . 2005 , entitled “ method and system for processing ambiguous , multiterm search queries ”, and u . s . patent application ser . no . 11 / 682 , 693 , filed on 6 mar . 2007 , entitled “ methods and systems for selecting and presenting content based on learned periodicity of user content selections ”, the contents of all of which are incorporated by reference herein . those applications taught specific way to perform incremental searches using ambiguous text input and methods of ordering search results . the present techniques , however , are not limited to the systems and methods disclosed in the incorporated patent applications . thus , while reference to such systems and applications may be helpful , it is not believed necessary to understand the present embodiments or inventions . fig2 illustrates an embodiment of a linear character selection interface 200 . the interface 200 has a display 201 where a portion of an alphabet 202 is presented . the interface also has a selection highlight 203 indicating that a particular cluster of characters is currently selected . in the embodiment shown in fig2 , the alphanumeric clusters correspond to the clustering found on a 12 - key phone keypad , such as the one shown in fig3 . however , unlike the 12 - key phone keypad , the selection highlight 203 expands and contracts dynamically to encompass clusters having different numbers of characters , for example , the “ a , b , c , 2 ” cluster has four characters , while the “ w , x , y , z , 9 ” cluster has five characters . the 12 - key phone keypad arrangement is merely an example of one possible arrangement of clusters , and clusters having more or less characters are consistent with embodiments of the invention . similarly , the number of characters present in a cluster may be dynamic and , for example , may be based on the user &# 39 ; s typical speed of navigation . thus , the selection highlight 203 may increase the number of characters encompassed within the highlight 203 if the user is navigating the linear arrangement at a high rate of speed . furthermore , the linear character selection interface 200 provides for the disambiguation of a selected cluster . therefore , in some implementations , after the user has selected one of the ambiguous clusters , the user can enter the cluster and select among the letters and numbers of the cluster to specify a particular character to be part of the text entry . in an implementation of the linear character selection interface 200 utilizing ambiguous text input , the systems and / or devices employing the methods disclosed herein can provide for an express word separator character . an express word separator character is one that unambiguously identifies that one ambiguous search term has ended and another has begun . by providing an express word separator , the number of unambiguous search terms that can match the ambiguous input is reduced . whereas , if an ambiguous character is used to represent a word separator , a text entry intended by the user to be a multiple term entry can be interpreted by a disambiguation system to be a single search term , thereby causing the search system to return results not of interest to the user . in addition , because the number of possible unambiguous search terms matching the ambiguous input is increased , the processing load on the system is increased , which can result in reduced system performance . once an ambiguous text input has been supplied , ambiguous search techniques , such as those in the incorporated applications , can be used to retrieve search results . navigation of the character clusters can be accomplished through a variety of interfaces . fig4 and 5 illustrate a five - button navigation interface 400 and a circular scroll pad 500 , respectively . the five - button interface 400 and scroll pad 500 are two examples of physical interfaces that can be used with the linear character selection interface 200 of fig2 . for example , two opposing navigation buttons 401 , 402 of the five - button navigation interface 400 is used to manipulate the selection highlight 203 of fig2 left and right through the linear character list . meanwhile a central selection button 403 is used to select the highlighted character cluster . thus , the linear character selection interface 200 enables the user to quickly enter ambiguous text input , which can be used to render nonambiguous text input or produce search results using the techniques disclosed in the incorporated applications . similarly , the user can slide the selection highlight 203 left and right by contacting a circular track 501 of the scroll pad 500 in a counterclockwise and clockwise direction , respectively , and a central selection button 502 is used to select the highlighted cluster . any other form of navigation that can traverse a one - dimensional sequence of character clusters can be used with embodiments of the invention . when the user &# 39 ; s navigation pace exceeds a certain threshold , the selection highlight 203 moves in discrete steps of the alphanumeric clusters . the user &# 39 ; s navigation pace can be determined by measuring the amount of time between sequent browse action inputs . for example , if the user uses a fast circular browse motion on the scroll pad 500 , or does a press - and - hold or quickly clicks the left or right buttons of the five - button interface 400 , the selection highlight 203 of fig2 moves at the cluster boundaries 204 and 205 . this method enables user to quickly get to the character of interest . when the character of interest is anywhere within the selection highlight 203 , the user selects the highlighted alphabet cluster . as described above , the user input is ambiguous input containing all the characters displayed within the selection highlight or a symbol indicative of the alphanumeric cluster . when the user &# 39 ; s navigation pace falls below a certain threshold , the selection highlight 203 navigates the alphabet clusters such that one letter enters the selection highlight 203 as one letter leaves . for example , as shown in fig2 , when the user navigates relatively slowly , the selection highlight 203 moves from position 205 to position 206 . numbers may enter and leave depending on the position of the selection highlight 203 . alternatively , numbers may be placed at the beginning or end of the list of letters and form additional clusters . this movement of the selection highlight 203 reduces the likelihood of the user overshooting the desired character . this is so because the selection highlight 203 spans multiple alphabets , thus , for a cluster having three letters , a horizontal positioning error of one on each side of the desired letter is tolerated . the clustering both enables fast navigation and easy selection of the desired character . changes in the user &# 39 ; s navigation pace can change whether the selection highlight 203 moves according to the fast or slow techniques described above . in other words , if the user &# 39 ; s navigation pace accelerates , the selection highlight 203 will transition from adding a single letter at a time to a cluster - by - cluster navigation style . also , if the user decelerates his or her navigation pace , the selection highlight 203 will transition from the cluster - by - cluster style to the letter - by - letter style . in another implementation , instead of moving at either the fast - pace style or the slow - pace style , the number of letters added to the selection highlight 203 can vary continuously depending upon the user &# 39 ; s navigation pace . thus , at a relatively slow pace of navigation , the selection highlight 203 would move the letter - by - letter , as described above . as the user increases his or her pace of navigation , more letters would be added and removed with each navigation action . finally , above a maximum threshold value , the selection highlight 203 would move cluster - by - cluster , as described above . in yet another implementation , the selection highlight 203 can move cluster - by - cluster similar to that described above . however , the clusters are not contiguous . thus , for a relatively high navigation pace , the system moves the selection highlight 203 from one cluster to another cluster by skipping adjacent letters . for example , referring to fig2 , for a high navigation rate , the system could move the selection highlight 203 from the cluster with cluster boundaries 204 to the cluster with cluster boundaries 206 , thereby skipping the letter “ g ”. more than one letter could be skipped , depending upon the navigation rate . the navigation pace thresholds can be determined empirically based on user preference . in addition , the navigation pace thresholds can be configurable by the particular user on his or her device . in an alternative implementation of the linear character selection interface , the user &# 39 ; s speed of navigation does not change how the selection highlight 203 moves . in such an implementation , the selection highlight always moves according to the clusters of letters and / or numbers , as described above for the fast pace navigation or always moves one letter at a time , as described above for the slow pace navigation . the linear character selection interface described herein reduces the amount of linear navigation the user must perform for text input on a device . the selection highlight , which has multiple characters highlighted at any time , requires the user only get the character of interest within the selection highlight window , as opposed to accurately selecting just one character . this reduces the effort of navigation and character selection and increases the speed with which the user can enter text . fig6 illustrates a configuration for an input and / or display constrained device utilizing the linear character selection interface described herein . for example , the device could be a remote control coupled with a television system a portable music player . the device has a display 601 and an input interface 604 . the input interface can be the five - button navigation interface 400 , described above , for navigation and / or circular scroll pad 500 . such a device can have a processor 602 and can have remote connectivity ( for example , a remote control ir ) 605 . the device can also have persistent storage 606 , on which could reside a text composition or a search application , which is loaded into volatile memory 603 for execution using the device bus 607 . a remote control can communicate with a television via the remote connectivity 605 and the linear character selection interface would be rendered on the television display . in the case of the music player device , the linear character selection interface would be rendered on the device display 601 itself . the remote connectivity 605 can also provide a connection to a content system ( not shown ) for providing content to the device the content search methods found in the incorporated applications are useful for identifying and selecting content based on the search input provided by the linear character selection interface . in one implementation , each content item is associated with one or more descriptive metadata terms . this metadata describes , for example , the types of content items , the information contained in the content items , and keywords associated with the content items . thus , the incremental input can be compared against the various descriptive terms / metadata to identify content that matches what the user seeks . fig7 illustrates an application of an embodiment of the invention implemented on a handheld user device 700 ( e . g ., a mobile telephone , pda , or handheld computer ). the handheld user device 700 has a display area 701 , a five - button interface 702 , a scroll wheel 703 , and an escape button 704 . the display area 701 has a query input section 705 for receiving text input supplied by a linear character selection interface 706 . as described above , the five - button interface 702 and / or the scroll wheel 703 is used to move a selection highlight 707 back - and - forth along the linear arrangement of alphanumeric symbols to select clusters . in fig7 , the user wishes to find content related to the “ red sox ”. thus , the user has selected the clusters “ pqrs7 ” and “ def3 ” to represent “ re ”. in response , the device searches a collection of content items using , for example , the techniques and method disclosed in the incorporated applications . based on this ambiguous input , the device 700 ( and / or a content system in communication with the device ) returns content items for “ red sox ” 708 . in addition , the device 700 returns other results 709 that have metadata that match the partial prefix “ re ”, as well as other possible prefixes formed by the letters of the ambiguous clusters 710 . because one unambiguous prefix of the selected clusters matching the “ red sox ” results is “ re ”, the device can indicate which letters of the clusters form the prefix “ re ”. fig7 illustrates this optional feature by showing the “ r ” and “ e ” in a larger font and in bold . other methods can be used to highlight the characters , such as the use of different colors , highlight windows , and the like . the choice of which letters to select from the cluster can be based on the metadata associated with the content item results ranked most highly in the list of search results ( e . g ., using the ranking techniques discussed in the incorporated applications ), or the selection can be based on a currently highlighted search result . in the alternative , rather than displaying the entire cluster of alphanumeric characters in the query input section 705 and highlighting a specific character , the device 700 can display only the specific character forming the search prefix that caused the content items to be listed . fig8 illustrates a system 800 for entering an alphanumeric string using the techniques set forth above . the system 800 includes presentation logic 801 for displaying the letters and numerals arranged in a linear configuration ( as shown , for example , in linear character selection interface 706 of fig7 ). the presentation logic 801 can also display the characters and / or character clusters selected by the user . the presentation logic 801 can also display the search results returned based on the search query input supplied by the user . the system 800 also includes indication logic 802 and navigation logic 803 . the indication logic 802 cooperates with the presentation logic 801 to indicate those characters that are currently highlighted by the user &# 39 ; s selection . the navigation logic 803 receives navigation inputs from the user for traversing the linear arrangement of characters . the navigation logic 803 cooperates with the indication logic and the presentation logic to determine , according to the user &# 39 ; s navigation pace , which letters and numerals are included in the alphanumeric clusters . the navigation logic feeds this information to the indication logic 802 so that the indication logic can highlight particular letters and / or numerals . the system 800 further includes selection logic 804 to receive selection actions from the user for selecting a particular cluster . the selection logic 804 can optionally also provide a mechanism for selecting a particular letter or numeral within a selected cluster . for example , once a cluster has been selected , the user can indicate a desire to further refine the character selection ( e . g ., pressing a particular button on the user &# 39 ; s device ). the selection logic 804 responds by presenting the user with a character - by - character selection interface for only those letters and numerals contained in the selected cluster . the system 800 also has disambiguation logic 805 and search logic 806 . the disambiguation logic 805 receives the ambiguous text input formed by the user &# 39 ; s entries and creates unambiguous , or otherwise encoded , query input for use in searching for results . the search logic 806 employs the disambiguated , or otherwise encoded , search input from the disambiguation logic 805 to search a set of content in order to find results matching the query input . the techniques disclosed in the incorporated applications can be used to implement the disambiguation logic 805 and / or search logic 806 . furthermore , the system 800 can operate as described above without the disambiguation logic 805 . the applications incorporated above describe systems and techniques for encoding metadata associated with content items into ambiguous prefixes . for example , the ambiguous search prefixes may be organized into a trie data structure . the system 800 can accept ambiguous input from the user and perform a search of the data structure directly employing the ambiguous input . thus , referring to fig7 , instead of disambiguating the clusters “ pqrs7 ” and “ def3 ” into “ r ” and “ e ” to match the metadata term “ red sox ”, the system 800 can send the sequence of characters that represent the selected clusters , e . g ., “ 73 ”. in this way , the system 800 will match the encoded ambiguous input “ 73 ” against any content items or associated metadata similarly encoded into the data structure . it will be appreciated that the scope of the present invention is not limited to the above - described embodiments , but rather is defined by the appended claims , and these claims will encompass modifications of and improvements to what has been described . for example , the embodiments provided above are described as being useful for performing searches on input and / or display constrained devices . however , the techniques , methods , and systems described and incorporated herein can be implemented to perform incremental text entry independent of searching for content item results .	6
referring initially to fig1 , a personal alert safety system ( pass ) 10 is shown in use with a self - contained breathing apparatus ( scba ) 12 . as described herein , the pass 10 may be used with the scba 12 or independently , as necessary or desired . the scba 12 does not form part of the invention and is illustrated as an example of one form of an scba 12 . the pass 10 may be operable to detect firefighter motion , surrounding temperature , air pressure of scba cylinders , or the like . this application is not directed to these features , but rather a new method to manually start an emergency alarm . the scba 12 includes a high pressure air tank 14 providing breathable air in accordance with the en12021 standard . the scba 12 air is provided through a hose 16 to a mask 18 . the pass 10 is operatively connected to a pressure hose 20 also connected to the tank 14 . the pass 10 includes a housing 22 of generally parallelepiped construction including opposite insets 24 and 26 . the first inset 24 has a sound hole 25 . the first inset 24 also receives an adaptor 28 through which the pressure hose 20 passes . the second inset 26 also has a sound hole ( not shown ) and receives an activation key 30 . the sound holes open into the housing 22 and connect an internal tunnel for passing the audio alarm . a lens 31 between the insets 24 and 26 overlies an led 43 . as described below , the pass 10 is activated , i . e ., enabled for operation , responsive to the hose 20 being under pressure . in some instances , the pass 10 may be used without the pressure hose 20 and adaptor 28 , as shown in fig2 . in these instances , the activation key 30 must be removed to activate circuitry in the device . referring to fig3 , a block diagram illustrates an electronic circuit 32 contained on a circuit board within the housing 22 . the control circuit 32 includes a control 34 for controlling operation of the pass 10 . the control 34 may comprise a microcontroller including a processor and associated memory and operating in accordance with a control program for controlling operation of the pass 10 . the circuit 32 includes an accelerometer 36 having an output at terminals int 1 and int 2 connected to an interrupt input of the control 34 . the control 34 is also connected to a strain gauge 38 , a key detector block 40 , a speaker 42 and the led 43 . the speaker 42 may comprise , for example , a speaker and transducer functioning as a buzzer for generating an audio alarm that is dispersed through the sound holes 25 . the accelerometer 36 as described herein comprises a type adxl345 digital accelerometer . the accelerometer 36 is a low power device controlled by battery power from a power supply 44 . the accelerometer 36 measures dynamic acceleration resulting from pre - defined motion . particularly , tap sensing functionality is able to detect single and double taps in any direction . because the accelerometer 36 is fixedly mounted in the housing 22 , the accelerometer 36 is operable to sense tapping motion on the housing 22 . the accelerometer 36 is operated as illustrated in fig4 which compares acceleration to a threshold . the maximum tap duration time is defined by a value dur . a tap latency time is a waiting period from the end of a first tap until the start of a time window when a second tap can be detected . an interval after the latency time is defined by a window register . although a second tap must begin after a latency time has expired , the second tap does not have to finish before the end of the tap defined by the window register . the control circuit 32 can be used for either single tap operation or double tap operation although double tap is preferred to avoid inadvertent operation . a single tap interrupt is triggered when acceleration goes below the threshold as long as the duration dur has not been exceeded . a double tap interrupt is triggered when a second tap is sensed within the time window for the second tap . the control 34 is programmed to sense the interrupt from the accelerometer 36 and immediately initiate an alarm signal by providing a loud tone out the speaker 42 . a visual indication is provided by the led 43 . activation of the device and the alarm function are enabled by either the strain gauge 38 sensing a pressure condition from the high pressure hose 20 , in the configuration of fig1 , or by removal of the key 30 , in the configuration of fig2 , as sensed by the key detector block 40 . as described herein , manual initiation of an emergency alarm may be based on a double tap made on a specific axis with predetermined frequency and strength , as determined by the settings made in the accelerometer 36 . as a result , the pass 10 is easy to use with gloves and without sensitivity to how it is operated . the firefighter or other user need not search for a button in order to generate the alarm . moreover , the accelerometer 36 is not sensitive to electromagnetic fields or anti - static plastic and the pass 10 does not rely on buttons or the like which can wear out and require moving parts . in fact , there are fewer mechanical parts which can provide for faster assembly . this also results in lower manufacturing costs . it will be appreciated by those skilled in the art that there are many possible modifications to be made to the specific forms of the features and components of the disclosed embodiments while keeping within the spirit of the concepts disclosed herein . accordingly , no limitations to the specific forms of the embodiments disclosed herein should be read into the claims unless expressly recited in the claims . although a few embodiments have been described in detail above , other modifications are possible . other embodiments may be within the scope of the following claims .	0
referring now to the drawings in detail , and particularly to fig1 there is shown a preferred embodiment of the present invention which comprises an adjustable surgical wound protector / incision retractor ( protractor ) 10 and stiffener ring support arrangement 12 . the protractor 10 comprises a flexible sleeve of thin material , impervious to solids or fluids containing bacteria and other contaminants . the flexible sleeve of the protractor 10 has an opening at each opposed end thereof , having a first or a lower o - ring 14 at a first end 16 , and a second or upper o - ring 18 at its second end 20 . the portion of the protractor sleeve 10 extending above the wound incision “ i ” is rolled about the upper or second o - ring 18 , to reduce the longitudinal dimension of the sleeve into a tight contiguous engagement with the sides of the wound incision “ i ”. in the first preferred embodiment of the present invention , a protractor stiffening ring 12 is placed about the wound periphery , according to the size of the particular incision “ i ”, as may be seen in fig1 . the rolled - up uppermost portion 20 of the protractor sleeve 10 is inserted within a channel 22 of the protractor stiffening ring 12 . the protractor stiffening ring 12 comprises an inner flange 24 , a base portion 26 , and an outer flange 28 , which defines the channel 30 into which the rolled - up outer ring 18 and sleeve 10 is inserted . the channel 30 thus comprises an annular trough defining the periphery of the surgical site . a lip 32 extends radially outwardly from the uppermost edge of the outer flange 28 , as shown in fig1 to define a support surface for a movable blade - receiving adapter 34 . the peripheral lip 32 has a peripheral edge 36 on its outermost side having a plurality of notches 40 thereon . the movable blade - receiving adapter 34 comprises a cylindrically - shaped housing for receipt of a portion of a paddle or blade arm 42 . the paddle or blade arm 42 has a lower end 44 which extends within the opening of the incision “ i ” on the radially inside of the protractor sleeve 10 . the blade arm 42 has an elbow portion 46 which extends through a bore the movable blade adapter 34 , for engagement therewithin . the adapter 34 has an innermost lip 48 and an outermost tab 50 , for secure engagement within the notches 40 on the peripheral edge 36 of the lip 32 . thus , once the protractors level 10 is fully wound up and snuggly engaged within the channel 30 of the protractor stiffening , ring 12 , one or more movable blade adapters 34 may be secured to the top side of the stiffening ringer 12 , and retractor blades or paddles 44 may be juxtaposed therewithin to hold body organs out of the way of the surgical procedure during the treatment of the patient . a further embodiment shown in fig2 discloses an l - shaped retractor ring 58 defined by an annular base 60 , having an inner flange 62 extending upwardly therefrom . a blade support station 64 may be arranged at various spaced - apart ( i . e . approx . 30 degree ) locations about the periphery of the annular base 60 of the l - shaped protractor ring 58 , as may be seen in fig2 . the upper end of each blade support station 64 has an opening 66 therethrough , in radial alignment with the longitudinal axis of the protractor sleeve 10 about which it is disposed . a retractor blade or paddle 68 is arranged within the sleeve 10 , and may have an uppermost arm and elbow portion 70 which extends through the opening 66 of each lade support station 64 . the sleeve 10 and lower o - ring 18 are mated adjacent and below the incision “ i ” in the patient &# 39 ; s abdomen as in the aforementioned embodiment . the sleeve 10 is wound up above about the uppermost 0 - ring 18 as in the aforementioned embodiment , the wound - up sleeve 10 and upper o - ring 18 mating in with the space “ s ” between the blade support stantions 64 and the inner flange 62 of the annular base 60 . frictional engagement between the blade support stantions 64 and the inner flange 62 provides the tautness of the sleeve 10 . the retractor ring 58 provides the stiffness , as in the aforementioned embodiment , to the assembly , for support of the retractor blades and the paddles 68 in a circular pattern about the edge of the incision “ i ”. a further embodiment of the stiffening ring 74 , is shown in fig3 a . the stiffening ring 74 comprises an “ l - shaped ” combination of an annular base 76 with an upstanding flange ring 78 . the flange ring 78 has an upper lip 80 to act as an anti - slip guard . the ring 74 is arranged so as to fit about the periphery of an incision “ i ” or wound site in a generally circular manner , as shown in combination with a protractor sleeve 82 in fig3 b . the upper end of the sleeve 82 has an upper o - ring 84 which is rolled - up in the sleeve 82 and fitted over the lip 80 and into the corner of the l - shaped ring 74 for retention thereof and maintenance of the generally circular configuration of the sleeve 82 and incision “ i ” of the wound site . a further embodiment of the retractor arrangement of the present invention comprises the annular stiffener protractor ring 90 having an annular base portion 92 , similar to the aforementioned embodiment , with an inner upstanding flange wall 94 and an outer upstanding flange wall 96 . an annular channel 98 therebetween defines the trough for securing a rolled - up sleeve , not shown . a flexible resilient torroidally shaped chamber 100 may be attached to the lower side of the annular base 92 . this torriodally shaped chamber 100 provides an airtight fit between the stiffener ring 90 and the peripheral surface of the abdomen incision “ i ” about which the stiffener retainer ring 90 is placed . the to noidally - shaped chamber 100 may be filled with a resilient material or pressurizably actuated by a fluid fill conduit 102 . the outermost flange 96 may have a notch 104 circumferentially spaced around its outermost surface , so as to receive an o - ring 106 for sealing purposes . a cover or dome 108 may be arranged so as to snap over the outermost flange 96 of the stiffener ring 90 to provide containment , pressure , security and cleanliness for the surgical site . the cover or dome 108 has a peripheral lip 10 and corresponding groove 112 to engage the o - ring 106 on the outer flange 96 . the cover 108 may have a sealable instrument opening 114 therein , to permit laparoscopic instruments and or treatment arrangements or a surgeon &# 39 ; s hand ( s ) to be disposed through the opening 114 to allow surgical procedures to be enclosively performed within that site . thus what has been shown are a number of embodiments of stiffener rings , to provide rigidity to a protractor sleeve so as to both protect the periphery of the incision or wound site as well as to provide a base for support of retractor blades or paddles to hold organs in place or aside during a particular surgical procedure .	0
reference will now be made in detail to the preferred embodiments of the present invention with reference to the accompanying drawings . the detailed description , which will be given below with reference to the accompanying drawings , is intended to explain exemplary embodiments of the present invention , rather than to show the only embodiments that can be implemented according to the invention . the following detailed description includes specific details in order to provide a thorough understanding of the present invention . however , it will be apparent to those skilled in the art that the present invention may be practiced without such specific details . in some instances , known structures and devices are omitted or are shown in block diagram form , focusing on important features of the structures and devices , so as not to obscure the concept of the invention . the same reference numbers will be used throughout this specification to refer to the same or like parts . as described above , an sta that wants to operate in a whitespace band needs to acquire information on an available channel in the whitespace band . the information on an available channel may have a wsm ( white space map ) format . a wsm information element is used for a specific sta ( e . g ., an enabling sta or a dependent ap that enables a dependent sta ) to signal a channel available for transmission to other stas ( e . g ., dependent stas ). the wsm information element can be transmitted being included in a management action frame such as a beacon frame , a probe response frame , a wsm announcement frame , etc . a wsm in a tv whitespace band includes information indicating whether a tv signal occupies a channel . the wsm can indicate the numbers of channels available for unlicensed devices at a specific time and maximum allowable power values in the available channels in the form of a list . an enabling sta can transmit a wsm to a dependent sta . a dependent ap enabled by the enabling sta transmits a wsm to a dependent sta . the wsm can be used to efficiently support scanning procedures of dependent stas operable in a whitespace band , as described above . that is , the dependent sta can scan only a specified wlan channel only in an available channel designated by the received wsm . in the wsm information element shown in fig1 , a country code field provides information on the location of a channel map following this field . with respect to tv whitespace , countries may have different tv bands and tv channel bandwidths , and different regulatory domains are assigned to the countries . accordingly , the country code field helps recognize the physical location of a tv channel available for an sta that receives the wsm along with a channel map field . the country code field can be signaled as a country string value of 3 octets . that is , the first 2 octets may indicate a country code defined in iso / iec 3166 - 1 and the last octet may mean an environment . the country code field can include more detailed information than country information in an extensive manner . for example , the country code field can include a regional code value of a specific country . although the basic unit of a channel map that signals whether or not a channel is available is not limited to a tv channel bandwidth , the basic unit can be channel information in the smallest basic unit provided by a database of a corresponding regulatory domain . the channel map field includes an available channel number ( e . g ., tv channel number ) and a maximum transmit power level corresponding to each available channel ( tv channel ) according to fcc regulations . fig2 illustrates the channel map field of the wsm information element shown in fig1 . as shown in fig2 , the channel map field of the wsm can include a device type field . an enabling sta or a dependent ap that transmits channel map information preferably signals a device type corresponding to a device to be provided with a service from the enabling sta or dependent ap along with a channel map when transmitting the channel map because an available channel and a maximum allowable transmit power level may depend on device type . for example , a fixed device cannot use a channel adjacent to a tv channel being used by an incumbent user . conversely , a personal / portable device can use a channel next to a tv channel being used by an incumbent user on the condition that a maximum allowable power level in the channel is reduced from 100 mw to 40 mw . therefore , the channel map preferably includes the device type field with an available channel number ( e . g . tv channel number ) and a maximum transmit power level corresponding to each available channel according to fcc regulations . the device type field signals the type of a device , which is provided with the service from the enabling sta or dependent ap and can use the wsm , rather than signaling the type of a device that transmits the wsm . specifically , the device type field can signal a spectrum mask value of an sta that can use the wsm with information on a fixed device and a personal / portable device . a fixed device may not be allowed to use a wsm having a device type corresponding to a personal / portable device . this is because a channel unavailable for the fixed device may be signaled as an available channel when the device type field of the wsm is set to a personal / portable device . the channel map shown in fig2 includes a registered location field . the registered location field is geo - location information represented as a three - dimensional coordinate ( latitude , longitude , altitude ). the registered location field may include latitude , longitude and altitude values and their resolutions . the registered location field may further include information indicating whether the corresponding location information corresponds to an enabling sta or a dependent sta . the format shown in fig3 is based on the dse registered location element body field defined in ieee 802 . 11y standard . a dependent enablement identifier , a regulatory class , and a channel number included in the registered location field can be set to reserved values . the above - mentioned wsm information element can signal an available channel list at a specific location indicated by the location information in the format as shown in fig3 . however , if an sta that has received the wsm moves from the location by a predetermined range or more , the sta needs to receive the wsm again and make a channel availability query again to receive the wsm . to solve this problem , according to an aspect of the present invention , there is provided a method of querying available channel information of multiple locations and receiving a wsm according to the available channel information query . for example , an enabling sta can acquire information about channels available in not only the location thereof but also multiple locations around the location . the enabling sta can combine available channel information acquired in this manner to set a geographical area having the same available channel . this geographical area has a boundary defined as a specific cooperate set . even when an sta moves in the geographical area , the available channel is valid so long as the sta is within the boundary , and thus it is not necessary to update the available channel . a geographical area based on a plurality of locations ( points ) will be referred to as a whitespace zone hereinafter . a dependent sta can start to operate by receiving an enable signal from an enabling sta . at this time , it is possible to consider a case in which a plurality of dependent stas enabled by a specific enabling sta is located in a specific geographical range . fig4 illustrates a campus environment for describing an exemplary embodiment of the present invention . referring to fig4 , an enabling sta is present and a plurality of dependent stas enabled by the enabling stas is distributed in the campus . the dependent stas can move to different buildings , different lecture rooms , and different floors in the campus . in a regionally divided service environment , such as the campus or an office / apartment , it is more efficient to use common channel information available in the divided regions . particularly , it is expected that the common available channel information is useful in a rural area because an available channel is hardly changed according to location in the rural area . the whitespace zone range can be represented in various forms . for example , the whitespace zone can be represented as an area within a predetermined radius with the geo - location coordinate point of a registered location as the center . although the whitespace zone can have any form , the physical location of the whitespace zone needs to be calculated in association with registered location information . for example , a location can be registered as a three - dimensional coordinate of ( x 1 , y 1 , z 1 ) and a whitespace range can be set as a radius value . in this case , a spherical whitespace zone having a radius with ( x 1 , y 1 , z 1 ) as the center of the sphere can be set . when an altitude value of registered location information about a personal / portable device is omitted , a whitespace zone can be specified as an area within a predetermined radius from a point designated by latitude and longitude values of the registered location information in a plane . as described above , a common available channel can be used in a specific zone in a campus / rural area . however , the common available channel is not limited to the campus or rural area , and it is possible to calculate and use a common channel valid for all stas located in one whitespace zone as necessary . a method of operating a wsm according to an exemplary embodiment of the present invention will now be described with reference to fig4 . in fig4 , the dependent stas located in the specific range start to operate by being enabled by the enabling sta . here , the enabling sta transmits an enable signal and a wsm . the wsm may have the format shown in fig1 and available channel information may have the channel map shown in fig2 . the dependent stas receiving the wsm from the enabling sta can communicate on the basis of an available tv channel number and a maximum transmit power level signaled through the channel map . the enabling sta according to the current embodiment acquires a channel commonly available in a whitespace zone range , set by the enabling sta , through information on channels available in multiple locations and transmits information on the common available channel . this can be achieved by performing an and operation on sets of channels available in multiple locations to calculate the intersection of the channel sets . while no restriction is imposed on a method used for procedures of deriving optimized location information and available channel information required for the calculation , a common available channel , finally computed in a location selected from a whitespace zone range , needs to be applied to the method . the enabling sta can set a whitespace zone first , and then select multiple locations that can cover the whitespace zone by computing them . alternatively , the enabling sta can calculate an appropriate whitespace zone from locations of dependent stas previously registered in the enabling sta and provided with the service from the enabling sta , or specific location information . the order of the whitespace zone and location may depend on the algorithm of deriving them . fig5 illustrates a whitespace zone formed within a predetermined radius having a specific point as the center according to an exemplary embodiment of the present invention . a boundary as shown in fig5 can be set by a whitespace zone designated by an enabling sta . locating in the whitespace zone means presence of the corresponding coordinate within the boundary of the whitespace zone . the enabling sta can acquire information on channels available in multiple locations from a database or a registered location server ( rls ), calculate a channel commonly available in the whitespace zone , and signal the common available channel to dependent stas located in the whitespace zone . the enabling sta can signal the common available channel through an enable signal and wsm , as described above . a registered location field of the wsm corresponds to geo - location information of the enabling sta and a whitespace zone range of the wsm is represented in the form of a radius from the registered location or a location vector . a dependent sta that has received the wsm can calculate the whitespace zone indicated by a dotted line in fig5 by combining the two fields of registered location field and whitespace zone range . fig6 is a view referred to for describing restrictions on the use of a wsm in a whitespace zone according to an embodiment of the present invention . a dependent sta can operate using the same available channel while freely moving in the calculated whitespace zone . however , if the dependent sta moves out of the whitespace zone set by the enabling sta , channel map information acquired from the enabling sta is not valid any more . accordingly , the channel map information needs to be updated for the dependent sta when the dependent sta moves out of the whitespace zone . the channel map information is updated according to circumstances . in a case that the dependent sta can maintain its enabled state while continuously communicating with the enabling sta although it has moved out of the whitespace zone , the dependent sta can request a new wsm in order to acquire the wsm . if the enabling sta provides only the whitespace zone , the dependent sta is de - enabled when moving out of the whitespace zone , and newly enabled by another enabling sta . a dependent sta can operate as illustrated in fig6 without registering geo - location information thereof . however , a dependent sta that wants to operate as a master device , such as an ap ( access point ), needs to register geo - location information thereof in a location server or a database through the enabling sta . a dependent sta is able to register location information thereof , to query channels available at the coordinate corresponding to the location information , to receive information on a list of channels available at the coordinate in the form of a wsm , and to use the channel list . in this case , the registered location and whitespace zone range in the channel map shown in fig2 can have null values . however , when the dependent sta moves by a predetermined distance ( e . g ., 100 m ) or longer from the registered coordinate , the available channel list is not valid any more . the dependent sta may want to set a whitespace zone and move in the whitespace zone while using the same channel . in this case , the dependent sta transmits a wsm request frame to the enabling sta . fig7 illustrates an operation of a dependent ap to request an enabling sta to provide wsm information according to an exemplary embodiment of the present invention . upon receipt of a wsm request frame , the enabling sta can transmit a wsm response frame including a channel map having the format as shown in fig2 in response to the wsm request frame . here , a registered location field of the wsm response frame corresponds to geo - location of the dependent ap ( sta ). a whitespace zone range of the wsm response frame may correspond to a radius from the registered location or a location vector indicating multiple locations . while the registered location is assumed to be the location of the enabling sta in fig5 and 6 , it is assumed that location information registered when the moving dependent sta requests the wsm is used as the registered location in fig7 . the enabling sta can acquire information on channels available in multiple locations in the whitespace zone on the basis of registered geo - location information of the dependent sta and information on locations around the location of the dependent sta by requesting a database to provide the available channel information , and calculate a common available channel . this is achieved by performing an and operation on sets of channels available in the multiple locations to calculate the intersection of the channel sets . while no restriction is imposed on a method used for procedures of deriving optimized location information and available channel information required for the calculation , a common available channel , finally computed at a location selected from a whitespace zone range , needs to be applied to the method . the dependent sta can operate using the same available channel while freely moving in the calculated whitespace zone . accordingly , the dependent sta needs not newly acquire information about an available channel whenever the geo - location thereof is changed by a predetermined distance ( e . g ., 100 m ) or more when the dependent sta operates while moving . however , when the dependent sta moves out of the whitespace zone set by the enabling sta , channel map information acquired from the enabling sta is not valid any more . accordingly , the wsm needs to be updated . the wsm request frame may include registered location and radius information . in this case , the dependent sta sets the whitespace zone , and the enabling sta calculates the whitespace zone on the basis of the registered location and radius information upon receipt of the wsm request frame . the enabling sta can select appropriate or most suitable multiple locations included in the calculated whitespace zone and acquire information on channels available in the locations from a database ( or registered location server ). similarly to the scenarios illustrated in fig5 and 6 , the enabling sta can compute a common available channel from the acquired available channel information . the enabling sta can configure a channel map with the information on the common channel available in the calculated whitespace zone , include the channel map in a wsm of a wsm response frame , and transmit the wsm response frame to the dependent sta . while the aforementioned embodiments of the present invention have described the scheme of setting a whitespace zone , which is operated using a common wsm , on the basis of a radius having a specific point designated by latitude and longitude as the center ( first type ) and the scheme of designating the whitespace zone based on a location vector indicating information on multiple locations , it is also possible to configure the whitespace zone using both the two types . fig8 is a view referred to for describing a scheme for designating a whitespace zone according to an embodiment of the present invention . as described above , zone information for handling a wsm which is commonly applicable to multiple locations can be configured using specific point p 1 designated based on latitude / longitude and radius r 1 in a plane from the specific point p 1 , or using multiple points p 1 and p 2 . furthermore , these two schemes can be simultaneously applied in an exemplary embodiment of the present invention . for example , in fig8 , ranges within specific radiuses r 1 and r 2 from the points p 1 and p 2 can be used as location information for configuring a whitespace zone . a description will be made of a method of acquiring available channel information based on multiple locations when an sta performs channel availability query ( caq ) in order to obtain an available channel list . as described above , the sta must consider protection of an incumbent user to operate in a whitespace band . accordingly , the sta needs to access a whitespace band database or a location server to register location information thereof and acquire a list of available channels . a procedure of acquiring an available channel list is called a caq procedure . a caq procedure employing a registered location query protocol ( rlqp ) uses a registered location secure server ( rlss ) or an rls in order to register an available channel list . here , although the rlss or rls do not have to transmit / receive wlan signals , the rlss or rls is a functional entity connected with an sta ( e . g . sta 2 of fig9 ) that advertises rlqp through a wired or wireless connection means . sta 2 may be regarded as the same entity as the rlss or rls . referring to fig9 , sta 1 can receive an advertisement protocol element indicating that sta 2 supports rlqp in step s 1210 . that is , sta 1 can receive a management frame having an advertisement protocol id corresponding to rlqp from sta 2 . sta 1 that wants to operate in a whitespace band can transmit a caq request message as a caq requesting sta to sta 2 ( s 1220 ). fig1 shows a channel availability query frame format according to an embodiment of the present invention . referring to fig1 , a caq action field can include a device class , device identity information , device location information , and a wsm . particularly , the device location information field can be repeated according to the present embodiment . accordingly , an sta can signal multiple locations in one frame by repeating device location information . in this case , it is necessary to indicate that the corresponding query relates to the multiple locations . an exemplary channel query information field format for indicating the query about the multiple locations is shown in fig1 . fig1 shows a channel query information field format according to an exemplary embodiment of the present invention . in the case of caq for multiple locations , a device location information present field is set to 1 so as to indicate presence of location information . a field indicating the quantity of device location information represents the number of locations relating to the corresponding query . fig1 shows exemplary device location information according to an embodiment of the present invention . referring to fig1 , device location information includes vicinity information in addition to latitude , longitude and altitude information . the vicinity information may be another expression of the radius described in the above embodiment . in addition , the device location information includes a vicinity present field that represents the presence of the vicinity information . 32 bits following the vicinity present field indicates vicinity information . if the vicinity present field indicates 0 ( off ), the device location information indicates a query about the corresponding specific location point . for example , when vicinity corresponds to a radius , a whitespace zone with a radius of 1 km can be designated for one point . however , it is also possible to set a whitespace zone based on a query about a plurality of point locations at a resolution distance ( 50 m ) or less . in an exemplary embodiment of the present invention , when there is a plurality of pieces of device location information , the device location information may not include vicinity information ( or radius information ). because it can be considered that a zone corresponding to a resolution distance is set at each point when a plurality of points is designated , it is unnecessary to designate additional vicinity information ( radius information ). fig1 shows device location information regarding a personal / portable device . the device location information may not include an altitude value , as described above . in this case , vicinity information can be designated in a plane defined by latitude and longitude values . table 1 shows exemplary device location information presented in tlv form . referring back to fig9 , upon receipt of the caq request message , sta 2 can transmit the caq request message to the rlss or rls . when the database / rls receives a query about multiple locations , the database / rls calculates a channel commonly available in a whitespace zone determined based on combination of the multiple locations ( corresponding to respective areas ) and transmits a caq frame in response to the caq request message . the caq frame is transmitted to sta 1 via sta 2 ( s 1240 and s 1250 ). if sta 2 corresponds to the rlss or rls , the rlss or rls responds to the query of sta 1 about the multiple locations ( s 1240 and s 1250 are omitted ). as described above , when one or more channels commonly available in multiple locations are present , a wsm including information on the channels commonly available in the multiple locations can be received as a caq response message . according to an embodiment of the present invention , however , an available channel list corresponding to the first location of multiple locations is provided while a caq response message provides no information when one or more channels commonly available in the multiple locations are present . in this case , it is impossible to secure a list of channels commonly available in a whitespace zone to eliminate the necessity of updating wsm whenever an sta moves . however , available channel information corresponding to the current location of an sta that requests caq can be provided such that the sta can perform wlan operation at the current location thereof first . to discriminate a caq request and a caq response from each other , an embodiment of the present invention proposes a cause effect code as follows . that is , in an embodiment of the present invention , when caq request is performed as illustrated in fig9 , it is possible to indicate that a corresponding frame corresponds to a caq request message using reason result code 1 . reason result code 8 indicates that a caq response message includes information on a channel commonly available in a zone formed based on multiple locations for the caq request . reason result code 3 represents that a common available channel is not provided but available channel information corresponding to the first location of multiple locations is provided . fig1 is a block diagram illustrating a configuration of an sta capable of implementing the present invention . referring to fig1 , an sta device 100 may include a processor 101 , a memory 102 , an rf ( radio frequency ) unit 103 , a display unit 104 , and a user interface unit 105 . functions of layers including a physical interface protocol layer can be executed by the processor 101 . the memory 102 is electrically connected to the processor 101 and stores an operating system , applications and general files . if the sta device 100 is a user device , the display unit 104 can be implemented using known lcd ( liquid crystal display ), oled ( organic light emitting diode ), etc . and display various information . the user interface unit 105 can be configured in such a manner that it is combined with a known user interface such as keypad , touch - screen , etc . the rf unit 103 is electrically / functionally connected to the processor 101 and transmits / receives rf signals . the rf unit 103 can include a transmission module and a reception module . the rf unit 103 may be referred to as a transceiver . the transmission module can code and modulate signals and / or data that are scheduled by the processor 101 to be transmitted , and then deliver the signals and / or data to an antenna . the reception module can decode and demodulate an rf signal received through the antenna to restore the rf signal to original data and transmit the original data to the processor 101 . the transceiver of the sta 100 can support a channel query procedure , transmit a first message including device location information of one or more locations for caq to a peer sta corresponding to a channel availability query responding sta of the channel query procedure , and receive a second message including channel availability information acquired from an rls or rlss from the peer sta . the processor 101 can be configured to regard channel availability information to be commonly available in multiple locations in a specific zone when the device location information included in the first message corresponds to information on the multiple locations in the specific zone . the detailed description of the preferred embodiments of the present invention has been given to enable those skilled in the art to implement and practice the invention . although the invention has been described with reference to the preferred embodiments , those skilled in the art will appreciate that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention described in the appended claims . for example , an embodiment of the present invention may be constructed by combining components or configurations of the above - described embodiments of the present invention . accordingly , the invention should not be limited to the specific embodiments described herein , but should be accorded the broadest scope consistent with the principles and novel features disclosed herein . while the embodiments of the present invention have been described based on ieee 802 . 11 , the embodiments can be equally applied to various mobile communication systems in which an unlicensed device can perform channel availability query in a whitespace band .	7
in accordance with the present invention , a clamping assembly 10 is disclosed for use in tightening objects , such as hoses and the like . with reference to fig1 the clamping assembly 10 includes a clamp unit or housing 12 that receives portions of a band or strap 14 . the band 14 is positioned about the object to be clamped or tightened . the clamp assembly 10 also includes a worm screw 16 , which is positioned and held in the clamp unit 12 for use in adjusting the tension of the band 14 by movement thereof relative to the clamp unit 12 by turning or rotating the worm screw 16 . the band 14 is , preferably , a roll formed band . with reference to fig2 - 4 , the roll formed band 14 includes a number of alternately spaced ridges 17 and depressions 18 . the depressions 18 define recesses for receiving threads 20 of the worm screw 16 , but are not so deep as to constitute through holes in the band 14 . the important and novel features of the present invention reside in the clamp unit 12 , as best illustrated in fig4 and 6 , which show the clamp unit 12 without the roll formed band 14 and the worm screw 16 . the clamp unit 12 includes a main body 22 , which is shaped somewhat in the form of a semi - circle . one end of the body 22 is open for inserting the screw 16 while the opposite end has a stop wall or cover 24 against which is positioned the tip of the screw 16 , as best seen in fig2 the clamp unit 12 also includes an interior shelf 26 having a portion or side integrally formed with the body 24 . the body 22 and the interior shelf 26 define a chamber 28 for receiving the threads 20 of the worm screw 16 and portions of the band 14 . the interior shelf 26 extends inwardly of the body 22 to define the chamber 28 and terminates to define a free end or edge 30 of the interior shelf 26 . the interior shelf 26 also includes a first or upper surface 32 and a second or lower surface 34 . the upper surface 32 faces the chamber 28 and the lower surface 34 has a number of teeth or projections 38 that extend outwardly from the lower surface 34 . the teeth 38 are spaced from each other to define recesses 40 , as seen in fig2 and 5 . the recesses 40 are of a size to receive ridges 17 of the roll formed band 14 for use in providing a locking engagement between the clamp unit 12 and the roll formed band 14 . the clamp unit 12 also includes a leg 44 connected to that side of the body 22 opposite from the side integrally joined to the interior shelf 26 . the leg 44 extends a short distance and is integrally joined to an exterior shelf 46 . as can be seen in fig6 the free edge 30 of the interior shelf 26 and the leg create a longitudinal gap having a relatively small width . the exterior shelf 46 , like the interior shelf 26 , has a first or inner surface 48 and a second or outer surface 50 . the inner surface 48 faces the locking teeth 38 and provides a support for portions of the band 14 . the inner surface 48 has a substantially relatively smooth face . the outer surface 50 also has a substantially relatively smooth face and is that part of the clamp unit 12 that contacts portions of the object to be held or clamped by the clamping assembly 10 . the exterior shelf 46 is an integral solid or continuous member that has a longitudinal extent essentially the same as that of the interior shelf 26 . the lateral extent or width of the exterior shelf 46 is greater than that of the interior shelf 26 . the exterior shelf 46 also has a free edge 54 , which is located near or below that edge of the interior shelf 26 , which is integrally joined to the body 22 . this construction defines a longitudinally - extending gap or receiving area 56 for use in receiving a selected or desired portion of the roll formed band 14 . unlike known clamping assemblies , the clamp unit 12 and band 14 of the present invention are combined or joined together by using a sidewise movement of one or both of the clamp unit 12 and the band 14 , as will next be explained . in using the clamping assembly 10 , a desired length of the roll formed band 14 is selected and typically cut or disconnected from a larger roll of the band 14 . with reference to fig7 a desired or selected band portion or attachment area on the band 14 , which is spaced from first and second free ends 58 , 60 of the band 14 , is taken and inserted into the longitudinally extending receiving area 56 in a sidewise manner . the clamp unit 12 is joined to this portion of the band 14 by moving the clamp unit 12 substantially perpendicular to the longitudinal extent of the band 14 . in this manner , the locking teeth 38 are caused to engage the depressions 18 of this part of the band 14 . the teeth 38 are configured to function with the ridges 17 and the depressions 18 of the band 14 such that the teeth 38 will not accept the band in a direction along the longitudinal extent of the band 14 . that is , the user is unable to position the free ends 58 , 60 of the band 14 between the interior and exterior shelves 26 , 46 , respectively , in a direction along the longitudinal extent of the band 14 . after the clamp unit 12 and the band 14 are joined together , the next step is to position the band 14 about the object to be constrained . after being positioned about the desired object , the free end 60 of the band 14 is inserted into that end of the clamp unit 12 having the stop wall 24 so that the free end 60 is supported on the first or upper surface 32 of the interior shelf 26 and with the ridges 17 and the depressions 18 of the band 14 facing the chamber 28 . the user pushes or causes a portion or length of the band 14 through the clamp unit 12 so that the band 14 is more closely in contact or adjacent to the object . the threaded portion 20 of the worm screw 16 is then inserted into the chamber 28 whereby the threaded portion 20 overlies portions of the roll formed band 14 and the threads 20 are received by the depressions 18 of the band portion supported on the upper surface 32 of the interior shelf 26 . the worm screw 16 , which has its tip or end abutted against the stop wall 24 can then be turned to cause the band 14 to move relative to the clamp unit 12 and thereby further tighten the band 14 about the object . based on the foregoing detailed description , a number of advantages of the present invention are readily seen . a clamping assembly is provided that can be easily adapted to clamp different sized or diameter objects since the clamp unit is detachable from the band . the clamp unit and the band are readily attached using a novel sidewise engagement whereby locking teeth of the clamp unit engage depressions of a roll formed band . a worm screw received by the clamp unit provides the fine adjustment or tightening of the band about the object . the clamp unit is an integral piece that can be inexpensively manufactured and yet provides the necessary strength and locking capability to reliably clamp hoses or other objects . although the present invention has been described with reference to a particular embodiment , it should be appreciated that variations and modifications can be effected within the spirit and scope of this invention .	8
in the following description , for the purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of exemplary embodiments . it should be apparent , however , that exemplary embodiments may be practiced without these specific details or with an equivalent arrangement . in other instances , well - known structures and devices are shown in block diagram form in order to avoid unnecessarily obscuring exemplary embodiments . in addition , unless otherwise indicated , all numbers expressing quantities , ratios , and numerical properties of ingredients , reaction conditions , and so forth used in the specification and claims are to be understood as being modified in all instances by the term “ about .” the present disclosure addresses and solves the current problems of gate oxide unreliability , large trigger voltage margin , and large chip area requirements attendant upon forming otp esd protection for high voltage devices . in accordance with embodiments of the present disclosure , a poly gate stack is eliminated and a lateral npn is utilized to avoid gate oxide unreliability issues . further esd requirements are met , and device size is reduced . still other aspects , features , and technical effects will be readily apparent to those skilled in this art from the following detailed description , wherein preferred embodiments are shown and described , simply by way of illustration of the best mode contemplated . the disclosure is capable of other and different embodiments , and its several details are capable of modifications in various obvious respects . accordingly , the drawings and description are to be regarded as illustrative in nature , and not as restrictive . fig1 illustrates a traditional stack mos otp esd protection device of the prior art , applied to protect an otp device having a high 9 . 0 programming voltage . reliability of this device is in jeopardy because of the likelihood of gate oxide breakdown with respect to the programming pad and the first gate . moreover , the esd device trigger voltage ( vt 1 ) is likely to be too high to protect internal devices . although a stack pmos esd protection device may be substituted , both alternatives require a large integrated circuit size to attain esd performance normally , the junction breakdown of 3 . 3v devices is around 9 . 7v . for 8 . 5v programming voltage otp application , the vt 1 “ trigger voltage ” of the esd device can &# 39 ; t be lower than the 8 . 5v programming voltage , otherwise the esd device will be false trigger and interfere with normal and programming operation modes . thus the vt 1 trigger voltage of the esd device should be designed to be between 8 . 6v to 9 . 6 . to address the reliability concern with respect to the high programming voltage , a lateral npn transistor can be used in place of the mos implementation . elimination of a poly gate avoids the possibility of gate oxide breakdown . a single stage lateral npn also occupies a significantly smaller size . the schematic diagram and tlp characteristic representation of traditional lateral npn is shown in fig2 a and fig2 b , respectively . as indicated in the tlp characteristic , esd performance ( it 2 ) is around 2 . 7 a , which is good enough to pass 2 kv hbm specification . the vh holding voltage is around 6 . 0v , which is greater than the 3 . 6v maximum operation voltage so there is no latch - up risk . however , the vt 1 trigger voltage is around 13v , which may not meet requirements and is still too high to adequately protect internal circuits . fig3 is a block diagram illustrative of the esd protection device of the present disclosure . esd pipolar transistor 12 is connected to supply terminals vpp and vss . during an esd event , control circuit 14 applies an activation signal at the base of transistor 12 to turn it on and thus divert esd discharge current away from the circuit to be protected . false trigger prevention circuit 16 is connected in series with capacitive downsize circuit 18 across the supply terminals . the output of false trigger prevention circuit 16 is applied to control circuit 14 , providing a positive feedback thereto to prevent false triggering of transistor 12 during rapid noise in the programming mode of the otp device . capacitive downsize circuit 18 provides equivalent capacitance under normal and esd modes , while reducing the area of the integrated circuit . fig4 a is a schematic diagram of the protection device represented in fig3 . control circuit 14 comprises fet q 5 connected in series with resistor r 2 across the supply terminals . junction node n 2 is connected to the base of transistor 12 . resistor r 1 is connected between supply vpp and the gate of fet q 5 . false trigger prevention circuit 16 comprises fet q 4 and fet q 3 . fet q 4 is connected in parallel with resistor r 1 , between vpp and node n 1 . node n 1 is also connected to the gate of fet q 3 . fet q 3 is connected between the gate of fet q 4 at node n 3 and vss . capacitive downsize circuit 18 comprises the series connection of capacitor c ′ and a current mirror between node n 1 and vss . the current mirror comprises fet q 1 and fet q 2 connected in parallel , their gates connected together . the equivalent capacitance of circuit 18 is represented in fig4 a as “ c .” the downsize circuit 18 provides a capacitive multiplication factor m , wherein m = w 2 / w 1 , and c = c ′*( 1 + m ). under normal operation mode , in the absence of an esd event , q 5 is off . node n 1 is at a high state , as it is at the potential of vpp by virtue of its connection to r 1 . fet q 3 is on by virtue of the high state of n 1 . n 3 is thus at the low state of vss and turns fet q 4 on to maintain node n 1 at the high vpp value . node n 2 is at the low state of vss by virtue of its connection through resistor r 2 . non under esd operation mode , node n 1 is at vss level , and both fet q 3 and fet q 4 will be off . fet q 5 is on , so that node n 2 will be high through fet q 5 . transistor qesd is rendered on to bypass esd current through vpp pad . the advantages of the false trigger prevention circuit can be understood in relation to operation during normal programming . ideally , the potential of nodes n 1 and n 2 should be same as in the normal operation described above , i . e ., high and vss , respectively . in the absence of fet q 3 and fet q 4 , programming noise can change the voltage level of node n 1 to vss , and the voltage level of n 2 will change to high , causing transistor qesd to turn on . false triggering then occurs . in the presence of the fet q 3 and fet q 4 in circuit 16 , the following operation takes place during programming . initially , node n 1 is at a high potential . in the presence of noise , fet q 3 and fet q 4 provide positive feedback to node n 1 to maintain it at a high potential state . node n 2 will remain at the vss potential and transistor qesd will not turn on . false triggering is thus prevented . the rc time constant of this exemplified embodiment is designed to be around 2 us . thus , the esd device will not be triggered under a programming operation mode with 50 us pulse width and 10 us rising time . as indicated in the tlp characteristic of fig4 b , esd performance ( it 2 ) is approximately 2 . 8 a , which is within specification . the holding voltage ( vh ) is around 6 . 0v , which is greater than the maximum operating voltage . the trigger voltage vt 1 is reduced , in comparison with that of fig2 b , and meets the requirement of around 9 . v with well - controlled mis - triggering rc elements . the embodiments of the present disclosure can achieve several technical effects , including otp esd protection with robust esd performance for high voltage applications , with no gate oxide reliability concerns , and more efficient use of i / o area . the present disclosure enjoys industrial applicability as , for example , microprocessors , smart phones , mobile phones , cellular handsets , set - top boxes , dvd recorders and players , automotive navigation , printers and peripherals , networking and telecom equipment , gaming systems , digital cameras , or any other devices utilizing logic or high - voltage technology nodes . the present disclosure therefore enjoys industrial applicability in any of various types of highly integrated semiconductor devices , including devices that use esd protection devices to pass esd / latch - up standards specifications ( e . g ., liquid crystal display ( lcd ) drivers , synchronous random access memories ( sram ), one time programming ( otp ), and power management products ). in the preceding description , the present disclosure is described with reference to specifically exemplary embodiments thereof . it will , however , be evident that various modifications and changes may be made thereto without departing from the broader spirit and scope of the present disclosure , as set forth in the claims . the specification and drawings are , accordingly , to be regarded as illustrative and not as restrictive . it is understood that the present disclosure is capable of using various other combinations and embodiments and is capable of any changes or modifications within the scope of the inventive concept as expressed herein .	7
with reference to fig1 the installation instrument of the invention comprises as main parts a frame 1 and an installation part 2 . fig1 also illustrates two needle - like elements 3a , 3b of the surgical installation instrument . the frame 1 comprises a combination of an elongated installation frame 4 and an operational frame 5 . the frame 1 is penetrated by an installation channel 6 . the cross - sectional form of the installation channel corresponds to the shape of the outer surface of the implant i as seen in the direction of the longitudinal axis of the implant . in the embodiment in fig1 the installation frame 4 has a flat cross - sectional form . for example , the installation frame 4 may have a rectangular or oval form . the installation channel 6 is centrally situated in the direction of the greater dimension of the installation frame such that arresting means 7a , 7b are located on both sides thereof in the same direction . the arresting means 7a , 7b can be fixedly mounted or attached or they are placed in corresponding arresting channels 8a , 8b in the frame . the arresting channels 8a , 8b extend in the direction of the installation channel . in the non - operational position , the arresting means 7a , 7b , which are rod - like elements with a sharpened head and a circular cross - sectional form , are inside the installation end 9 or the frame 1 . at the point of the arresting means , there is a longitudinal groove 10a , 10b on both sides of the operational frame 5 . protruding transfer and locking means 11a , 11b are connected with the arresting means . in the embodiment shown above , a transverse grooving 12a , 12b has been formed in the grooves 10a , 10b . transversely grooving 12a , 12b is perpendicular to the longitudinal direction of the grooves 10a , 10b . the transfer and locking means 11a , 11b can be placed in the transfer grooving 12a , 12b when the arresting means is moved into the operational position in the longitudinal direction of the arresting channel 8a , 8b and , thus , to protrude from the installation end 9 of the frame 1 . the arresting means are 7a7b locked by moving the transfer and locking means 11a , 11b around the longitudinal axis of the arresting means into a desired groove of the transverse grooving 12a , 12b . as mentioned above , the other end of the installation channel 6 is placed at the supply end 13 of the operational frame in a manner such that the installation part 2 can , fixed with the power transmission part 14 shown in fig3 be inserted in the installation channel . in the application shown in fig1 the operational frame 5 further comprises a cassette or box 16 that can be changed in connection with the operational frame . a suitable number of implants i can be placed within the box 16 in advance . in fig1 one implant is illustrated inside the box 16 with broken lines . in the embodiment shown , the implant i is an arrow - shaped element having a head and a stem at opposite ends of a body . the head comprises a scutellate or corresponding arresting structure . the radial dimension of the stem is formed to exceed that of the body . in connection with a surgical operation on , for example , a meniscal rupture , as illustrated particularly in fig5 d , the head penetrates the meniscus at least particularly . in this procedure the stem remains outside the meniscus to prevent an unintentional movement of the implant in the direction of installation . on the other hand , the scutellate or corresponding structure of the head cooperates with the stem , exerting a compressing force on the meniscus , particularly the rupture . this contributes to the healing of the meniscus . in this connection , it should be pointed out that although the invention is illustrated with an example that is applicable particularly in surgical operations of the meniscus , it is clear that the surgical instrument of the present invention can be equally well applied in bone surgery , particularly in surgical operations on bone fractures , in connective tissue surgery and other surgery of the tissues of the musculosceletal system . further , with reference to fig1 the box 16 can comprise a spring - loaded plunger 17 . plunger 17 can keep the implants i in such an order in the box 16 that upon pulling a loading device 18 between the box 16 and the operational frame 5 , for example , in the direction of arrow 19 , the next implant i is moved from the box 16 into the installation channel 6 within the operational frame , as shown schematically in fig2 . from this position , the implant i can , for example , by using the installation part 2 , be transferred to the installation end 9 of the installation channel . in an advantageous manner , the surgical installation instrument of the invention is made to be at least partly transparent . in the embodiment shown in fig1 the part at the installation end 9 of the installation frame 4 is made transparent . this transparent part 4a of the installation frame 4 can be advantageously manufactured as a disposable part that can be attached with snap - in fixing means to the stationary part 4b of the installation frame mounted on the operational frame 5 . the snap - in fixing means are shown by the reference numeral 20 in fig2 . the transparent part 4a can be manufactured of a transparent polymer , copolymer or a polymeric mixture . also ceramic materials are feasible materials to form the transparent part . the transparent part 4a naturally comprises a part corresponding to the cross - sectional form of the installation channel as well as parts corresponding to the arresting channel , thereby making it functionally fully compatible with the frame 1 . fig1 further illustrates the installation part 2 pertaining to the surgical instrument of the invention . part 2 is an elongated rod - like formed piece with a cross - sectional form . the part 2 is perpendicular to the longitudinal direction of the installation frame . preferably , the part 2 has a cross - section corresponding to the cross - sectional form and size of the installation channel 6 of the frame 1 . the length of the installation part is selected so that , connected with a power transmission part 14 , it can act on the implant in the installation channel , particularly the stem , for the entire length of the installation channel . the other end part of the installation part 2 is equipped with a means 21 for attaching the installation part to the power transmission part 14 , shown in fig3 . the reciprocating movement of the power transmission part 14 is arranged in a way that the installation part 2 moves backward and forward in its longitudinal direction , as indicated by the arrow l in fig3 ). fig3 illustrates an embodiment of the frame 1 where the implant is fed into the installation channel through an opening in the supply end 13 in the installation channel . using the installation part 2 coupled with the power transmission part 14 , the implant is entered into the installation end 9 of the frame 1 in the installation channel . the power transmission part 14 can be operated on a pneumatic , hydraulic and / or electromagnetic principle . the power transmission part 14 shown in fig3 is arranged to work pneumatically . it has a connecting means 14a for conveying compressed air into a piston arrangement inside the frame 14b of the power transmission part 14 . power transmission parts of this kind are available in different commercial applications , for example , as reciprocating surgical bone saws . these power transmission parts can be applied minor technical modifications for use in combination with a surgical installation instrument of this invention . an example of such power transmission parts are products marketed under the trademark hall r . power transmission parts of this kind , as well as their socket structures , in which the attaching means 21 of the installation part 2 , shown in fig1 is attached , are obvious to an artisan in the field and consequently not described more closely in this context . fig4 shows an alternative application for combining the installation frame 4 , which is preferably transparent , and the operational frame 5 . in this embodiment , the installation frame 4 is entirely formed of a transparent material , and its end is equipped with a flange 16 . the installation frame 4 is attached to the end of the operational frame 5 as indicated by the broken lines in fig4 . the installation frame may be attached to the operation frame with a screw , for example . an advantage of this arrangement is that installation frames 4 of different shapes can be used in connection with the same operational frame 5 . it is a generally known fact that curved or bent forms of the installation frame 4 may be required in certain surgical operations in order to get at the tissue to be operated on . consequently , a solution of this kind can broaden the field of use of the surgical installation instrument . naturally in these cases flexibility is required of the material of the arresting means so that they can adjust to the shape of the installation frame 4 . fig5 a - 5d illustrate schematically the phases of a surgical operation performed using a frame shown in fig3 and 4 . the operation shown in fig5 a - 5b is a surgical repairing operation of a rupture r of the meniscus nk . this is performed preferably by arthroscopy . in the first phase shown in fig5 a , the arresting means 7a , 7b are pushed into the operational position by rising the transfer and locking means 11a , 11b , whereby the arresting means can extend over the rupture . in this manner , the installation end 9 of the frame 1 is locked position and at the same time the rupture r is immobilized and , thus controlled . in the next phase according to fig5 b , a needle - like element 3a is introduced via the installation channel 6 into the meniscus in order to make a preliminary hole . fig5 b illustrates the use of a needle - like element 3a . however in the embodiment shown in fig5 c , a needle - like element ( not shown ) of fig1 can also be used . the needle - like element 3b comprises two needle - like elements , one inside the other . the outer element 3b &# 39 ; has a larger diameter . inside the outer element it is a relatively thin needle - like element 3b &# 34 ;. the preliminary hole is lengthened by the element 3b &# 34 ; after the outer needle - like element 3b &# 39 ; has substantially reached the center of the meniscus and passed the rupture , all the way through the meniscus . thus , a preliminary hole er is formed as shown in fig5 c . the preliminary hole er comprises a part er1 with a wider diameter and a part er2 with a smaller diameter . the diameter of the needle - like element can correspond to the diameter of the body of the implant i , whereby the needle - like element can be moved in the installation channel along the wider middle section of the installation channel . this wider middle section is shown by the reference numeral 6a in fig4 . particularly for the wider wing structure of the stem of the implant i , the installation channel 6 is provided with widenings shown by the reference numeral 6b in fig4 . further , fig5 c illustrates the placement of the implant in the installation channel 6 all the way to the installation end 9 of the installation frame 4 using the installation part 2 , which is coupled with the power transmission part 14 . the implant i is pressed via the preliminary hole er through the meniscus into a position shown in fig5 d . in this phase , the advantages of the surgical installation instrument of the present invention are obvious . the arresting means 7a , 7b ensure that the frame 1 is kept in position . the preliminary hole er facilitates the installation of the implant . the transparent installation frame 4 provides immediate visual control of the position of the implant in the installation frame also during arthroscopy . further , the most important operational advantage in this phase is the fact that the surgeon , while maintaining the stem of the implant i in contact with the head of the installation part 2 , can observe the implant as it proceeds into the preliminary hole and stop the installation of the implant if necessary . thus , the implant can be installed into the tissue in stages by utilizing the reciprocating movement of the installation part and the simultaneous movement in the installation channel feeding the installation part . it is obvious that the advantages presented above apply also to many surgical operations than other meniscal operations . the installation instrument of the invention can be modified even to a high degree . one particular alternative for a frame , especially a transparent installation frame , is to fix the arresting means in connection with the transparent frame in a manner that they protrude from the installation end 9 . thus the arresting means 11a and 11b , which can be moved and locked in relation to the frame 1 , can be eliminated from the frame 1 . it is also obvious that there can be one , or more than two of the arresting means 7a , 7b placed in the same frame 1 to be moved and locked in relation to the frame 1 or to the transparent installation frame protruding from the installation end 9 of the installation frame . obviously , the dimensions and shape of the surgical installation instrument can even vary considerably ; only a few applicable alternatives are shown in the appended drawings . in the embodiment shown in the drawings , the following dimensions can be brought up within the basic dimensions . the total length of the installation frame 4 can vary between 20 and 200 mm . the width and thickness of the flat cross - section of the installation frame 4 can be typically 3 to 6 mm and and 1 to 3 mm , respectively . the length of the operational frame 5 can be 20 to 120 mm , whereby the total length of the frame 1 varies between 40 and 320 mm . the penetration depth of the arresting means can be chosen by the transverse grooving to be 5 - 10 mm , for example . the arrow - shaped implant used , for example , in meniscal surgery has a length of about 14 mm . the diameter of the body is about 1 . 5 mm . the maximum radial dimension of the stem is 3 mm . the dimension of the stem length of the wing in the axial direction being is about 1 . 5 mm . one very important detail , is that according to practical measurements , good penetration of the implant into the meniscal tissue is achieved when the maximum rate of a single stroke of the vibrating movement is at least 300 meter per minute ( m / min ) and the frequency of the strokes is higher than 1000 / min or about 17 / s and , preferably about 10000 - 20000 / min or about 170 - 340 / s . if the stroke rate is in the order of 50 to 150 m / min , which is a typical stroke rate when slow vibration is performed manually by hitting a cylindrical piston with a suitable hammer , the piston conveying the stroke to the implant , the rate of the stroke is thus so low that the meniscal tissue reacts in a manner of a soft material , yielding and bending , whereby the implant does not properly penetrate into the tissue . co - pending application &# 34 ; surgical implant &# 34 ; of the same applicant , to which reference is hereby made describes in detail the implant described above .	0
the following description provides embodiments with specific details to one skilled in the art for a better understanding of the present disclosure . however , it should be understood that the present disclosure may be practiced even without these details . in some embodiments , to avoid unnecessarily obscuring the following description , well - known structures and functions are not illustrated or described in detail . in the specification and claims of the present disclosure , terms such as “ including ” and “ comprising ” should be comprehended as an inclusive meaning instead of an exclusive or exhaustive meaning , i . e ., it means “ including but not limited to ” unless specifically described otherwise in the context . in this detailed description section , singular or plural terms include both the plural and singular meanings as well . as shown in fig1 , a patient monitoring system includes a parameter acquiring device 10 , a data processor 30 , and a display device 50 in successive communication . a person of skill in the art will recognize that the patient monitoring system could include or be comprised of a variety of medical devices or systems , such as anesthesiology systems . each component will be described in detail below . the parameter acquiring device 10 acquires data signals indicative of the depth ( sometimes variously referred to as the “ adequacy ”) of anesthesia in real time . awareness , pain strength , and muscle relaxation are three important dimensions of information used to decide the depth of anesthesia . in one embodiment , awareness and muscle relaxation may be reflected by values of bis and nmt respectively ; the pain strength could not be reflected directly by a single value of a monitoring parameter , but the pain strength may be reflected by changes in blood pressure , heart rate , or hormone level . other than awareness , pain strength , and muscle relaxation , the depth of anesthesia may be decided by other information including two or more than three dimensions , and parameters used to reflect the dimensions may be selected according to need . the data processor 30 , such as a cpu , may process the data signals acquired by the parameter acquiring device 10 and generate visualization representation data . the visualization representation data could include multiple dimensions of information used to indicate the depth of anesthesia , and each dimension of information may be reflected by at least one parameter which could characterize the depth of anesthesia . for example , awareness , pain strength , and muscle relaxation are three dimensions of information acquired by data signal , and the visualization representation data includes the three dimensions of information that are awareness , pain strength , and muscle relaxation . awareness and muscle relaxation may be reflected by bis and nmt , and muscle relaxation may be reflected by at least one parameter selected from changes in blood pressure , heart rate , or hormone level . the medical staff could select a number and / or types of parameters which could characterize pain strength ; a number and / or types of parameters which could reflect awareness and muscle relaxation may be preset or selected by a user . the display device 50 , such as a computer monitor , could display the visualization representation data generated by the data processor 30 in an anesthesia depth displaying area 51 . the visualization representation data may include multiple dimensions of information used to indicate the depth of anesthesia , and each dimension of information may be reflected by a corresponding parameter . for example , awareness , pain strength , and muscle relaxation are three dimensions of information used ; awareness and muscle relaxation may be reflected by bis and nmt , and muscle relaxation may be reflected by changes in blood pressure , heart rate , or hormone level . the display device 50 displays these parameters in the anesthesia depth displaying area 51 , as shown in fig3 ( this two - dimensional coordinate is just a schematic diagram displaying each dimension of information ), and the medical staff could determine whether the anesthetic is adequate based on the displayed information . the display device 50 may be a touch screen or non - touch screen . for example , the display device 50 may be a screen of a patient monitor . except for at least one anesthesia depth displaying area 51 , an ordinary displaying area 52 for displaying information of conventional or other physiological parameters , such as pulse rate , temperature , respiratory rate , venous oxygen saturation , and hemodynamics , could also be included . the anesthesia depth displaying area 51 and ordinary displaying area 52 are independent from each other . as shown in fig2 , the ordinary displaying area 52 may be divided into a plurality of sub displaying areas juxtaposed in a horizontal direction , and each sub displaying area may display information of one parameter . in a specific embodiment , the anesthesia depth displaying area 51 may be located at the lower left corner or center of the patient monitor screen . in some cases , the anesthesia depth displaying area 51 and ordinary displaying area 52 do not overlap each other ; in some cases , the anesthesia depth displaying area 51 could cover a part of the ordinary displaying area 52 . in a case , the whole screen of the patient monitor may be viewed as the ordinary displaying area 52 ; in other cases , the anesthesia depth displaying area 51 could cover the whole screen of the patient monitor , or may be located at another screen of a networked or associated patient monitor / patient monitoring system . by displaying parameter information of each dimension used to indicate the depth of anesthesia in the anesthesia depth displaying area 51 , the medical staff could check the parameter information of each dimension and then quickly make a decision of what to do next . in one embodiment , by displaying the parameter information of three dimensions , which are awareness , pain strength , and muscle relaxation , in real time , a comprehensive organization and presentation of the depth of anesthesia are provided by multiple dimensions , which could help the medical staff to decide the depth of anesthesia . in one embodiment , the parameter acquiring device 10 , data processor 30 , and display device 50 included in the patient monitoring system are three components divided by functions . therefore , the number of components or how the functionality is implemented may be set according to specific circumstances . for example , the parameter acquiring device 10 may be a parameter module of a plugin monitor or a parameter board in a non - plugin monitor , and the data processor 30 may be a main control unit of the plugin monitor or a host of the non - plugin monitor . the parameter acquiring device 10 may be an interface of the main control unit , and the parameter acquiring device 10 acquires data signals from sensors , other monitors , or networks ; the parameter acquiring device 10 may be a sensor for acquiring original data signals , and the data processor 30 including one or more sub devices could process the original data signals and generate the visualization representation data . as shown in fig1 and 2 , the patient monitoring system in one embodiment includes the parameter acquiring device 10 , the data processor 30 , and the display device 50 connected successively . how the display device 50 displays the multiple dimensions of information for indicating the depth of anesthesia is specifically described below , and a corresponding method of displaying patient parameters is described . in one embodiment , each anesthesia depth displaying area 51 may include multiple sub areas , the number of the sub areas is equal to the number of the dimensions , and each sub area corresponding to a dimension may display information of the dimension . for example , awareness , pain strength , and muscle relaxation are three dimensions of information used , and the three dimensions of information are displayed on the anesthesia depth displaying area 51 . as shown in fig2 , the anesthesia depth displaying area 51 may be divided into three sub areas 511 , 512 , and 513 . the three sub areas 511 , 512 , and 513 may display awareness , pain strength , and muscle relaxation respectively , and each dimension of information may be reflected by at least one parameter , such that awareness and muscle relaxation may be reflected by bis and nmt , and muscle relaxation may be reflected by changes in blood pressure and heart rate . in one embodiment , the depth of anesthesia may be indicated by physiological parameters and / or psychological parameters . the parameter information of each sub area may include a parameter name , a current monitoring value , a value change trend , and a status indicator , or any combination thereof . the parameter information could include the parameter name and current monitoring value ; the parameter name and value change trend ; the parameter name and status indicator ; the parameter name , current monitoring value , and value change trend ; or the parameter name , current monitoring value , value change trend , and status indicator . the status indicator could indicate whether the current monitoring value falls within a preset threshold of a corresponding parameter . the preset threshold may be set based on experience , and the preset threshold may be based on a system default set or a user set obtained from a human - computer interaction interface . the parameter name ( if displayed ) may be shown as text in various languages , or displayed as icons or diagrams . in one embodiment , the information of each dimension may be displayed in text format on the corresponding sub area . for example , bis information , which may include the current monitoring bis value and bis status indicator , may be displayed in text on the sub area 511 . other sub areas are similar . in another embodiment , the information of each dimension may be displayed in graphic format on the corresponding sub area . for example , bis information may be displayed in graphic format on the sub area 511 . a diagram , such as a histogram , may be used to represent the monitored bis value , and whether the monitored bis value is within a normal range may be represented by a color of the histogram . other sub areas are similar . in this specification , the graphic format may include at least one of a graphic and a combination of a graphic and color or a pattern . that is , the graphic format may be a combination of a graphic and color , a combination of a graphic and a pattern , or a combination of a graphic , color , and a pattern . the graphic may be one of or any combination of a line , a rectangular bar , a pie chart , a meter chart , and a two - dimensional graph . in the embodiment , the information of each dimension may be displayed in a text and graphic format , and the information for each sub area is presented in the same way . for example , as shown in fig4 , the information of the awareness dimension is displayed on the sub area 511 . the name of the dimension ( awareness ) 5111 , the name of the parameter ( bis ) 5112 used in the dimension , and the current monitoring value ( 67 ) 5113 are displayed in text , and a rectangular bar may be used to represent the bis . a preset threshold of bis may be displayed by two lines 5114 in the rectangular bar , the current bis value is represented by a length of a part of the rectangular bar with a pattern , and a bis status may be indicated by the pattern such that if the current bis value falls within the preset threshold of bis , a part of the rectangular bar with a length proportional to the bis value is a painted stripe . if the current bis value does not fall within the preset threshold of bis , a part of the rectangular bar with a length proportional to the bis value is painted plaid . the information of muscle relaxation is displayed on the sub area 512 . the name of the dimension ( muscle relaxation ) 5121 , the name of the parameter ( nmt ) 5122 used in the dimension , and the current monitoring value ( 8 ) 5123 are displayed in text , and a rectangular bar may be used to represent muscle relaxation . a preset threshold value of nmt may be displayed by a line 5124 in the rectangular bar , the current nmt value is represented by a length of a part of the rectangular bar with a pattern , and a nmt status may be indicated by the pattern such that if the current nmt value is smaller than the preset threshold of nmt , a part of the rectangular bar with a length proportional to the nmt value is painted plaid ; if the current nmt value is greater than the preset threshold of nmt , a part of the rectangular bar with length proportional to the nmt value is painted stripe . the information of pain strength is displayed on the sub area 513 . the name of the dimension ( pain strength ) 5131 , the name of the parameters ( changes of blood pressure and heart rate , δbp and δhr ) 5132 used in the dimension , and the current changes of blood pressure and heart rate (+ 35 , + 10 ) 5133 are displayed in text , and two rectangular bars may be used to represent the two parameters respectively . preset thresholds of δbp and δhr may be displayed respectively by lines 5134 in the rectangular bars . for each parameter , the current value is represented by a length of a part of the rectangular bar with a pattern , and the corresponding parameter status may be indicated by the pattern such that if the current δbp is smaller than the preset threshold of δbp , a part of the rectangular bar with a length proportional to the δbp value is painted plaid ; if the current δbp value is greater than the preset threshold of a bp , a part of the rectangular bar with length proportional to the δbp value is painted stripe . if the current δhr is smaller than the preset threshold of δhr , a part of the rectangular bar with a length proportional to the δhr value is painted plaid ; if the current δhr value is greater than the preset threshold of δhr , a part of the rectangular bar with a length proportional to the δhr value is painted stripe . one skilled in the art knows current values of parameters , parameter thresholds , and parameter statuses may be represented by other ways ; for example , a current value of a parameter may be indicated by a mark , such as a triangle or an arrow . as shown in fig4 , a spider chart is formed by the three sub areas 511 , 512 , and 513 . in other embodiments , the three rectangular bars may be juxtaposed ( as shown in fig5 ) or placed side by side vertically , or the three rectangular bars could constitute a triangle . other than rectangular bars , the dimensions may be represented by other shapes or charts , such as sectors 611 - 613 ( as shown in fig6 ) or meter charts 711 - 713 ( as shown in fig7 ). in addition , the information of each dimension may be represented by a rectangular bar and a two - dimensional coordinate . one skilled in the art could know how to present a parameter trend in a two - dimensional coordinate or tabulation , as the way of presenting ecg in a patient monitor . as shown in fig6 , the name of each dimension is shown in each sector , and the corresponding parameter information is shown by each rectangular bar . in addition , the value of each parameter may be represented by the area size of the corresponding sector , and the corresponding threshold line may be shown in the sector . in one embodiment , as shown in fig7 , the parameter information may be represented by a meter chart . the current value of the parameter may be indicated by a pointer and displayed in text ; the threshold range of the parameter may be indicated by a part of the outer ring painted with a pattern such that for each meter chart , the part of the outer ring corresponding to the threshold range is painted plaid . how to place the meter charts may be changed according to the number of the dimensions . in some embodiments , more than two parameters may be used to reflect pain strength , and then more rectangular bars may be used in the pain strength dimension . the rectangular bars may be juxtaposed , be placed side by side vertically , distributed symmetrically around a center point , and so on . in one embodiment , in order to indicate the depth of anesthesia , dimensions , such as awareness , muscle relaxation , and pain strength , and the corresponding parameter information are displayed in graphic format . on one side , the depth of anesthesia is depicted by three dimensions , with each dimension corresponding to a sub area , and the parameter information used to reflect the corresponding dimension is displayed in the corresponding sub area . the number of dimensions , names , and parameters corresponding to each dimension may be determined by the medical staff ( as described in embodiment three ). on another side , the parameter information used is displayed in graphic format ; for example , the current value of the parameter is represented by the height of a corresponding rectangular bar , and whether the parameter is in normal status or abnormal status may be represented by the color of the pattern of the rectangular bar . the medical staff could get general information and specific information at a glance , and the medical staff does not need to look for a variety of related information from the whole screen to find out the depth of anesthesia . so the convenience and maneuverability of the monitoring system may be improved to a certain extent . in one embodiment , whether the parameter is in normal or abnormal status may be distinguished by the pattern or color used to paint the rectangular bar . in addition , the threshold value of each parameter may be set by the medical staff or by a default value ( an experience value ). the name of each dimension may be displayed by text , symbol , schematic , a thumbnail , and so on . the name of each dimension may be displayed in the corresponding sub area or a concentrated information area . as shown in fig8 , except for the parameter acquiring device 10 , the data processor 30 , and the display device 50 , a patient monitoring system may also include a setting device 70 connecting to the data processor 30 . the setting device 70 could set information to be displayed automatically or by user input . the information to be displayed may include information of multiple dimensions for reflecting the depth of anesthesia , the name of each dimension , the number of parameters for indicating each dimension , and information of each parameter . the dimensions for reflecting the depth of anesthesia and the parameter for indicating each dimension may be preset in the patient monitoring system . in an automatic setting mode , the dimensions used and the parameters used for each dimension may be automatically set by parameters monitored by the patient monitoring system . in a user setting mode , the dimensions used and the parameters used for each dimension may be set according to user input . in other words , the medical staff could decide the dimensions and parameters used to reflect the depth of anesthesia . the above - described patient monitoring systems may include the setting device that could set the information to be displayed automatically , such that awareness , muscle relaxation , and pain strength are the three dimensions used . in one embodiment , the setting device 70 could set information to be displayed by user input according to needs . one skilled in the art could know that the patient monitoring system could provide a human - computer interaction interface for the medical staff . as shown in fig9 , a value setting area 519 within the anesthesia depth displaying area 51 may be provided by the display device 50 , and the information to be displayed may be set by the medical staff in the value setting area 519 . one skilled in the art could know how to implement the value setting area 519 and establish the association between the value setting area 519 and the setting device 70 . in one embodiment , the setting device 70 may set a length of time involved in the parameter trend . the length of time could change automatically according to system time or be set by the medical staff . in yet another embodiment , a patient monitoring system could also indicate baseline levels of vital sign parameters before anesthesia . as shown in fig9 , the anesthesia depth displaying area 51 may further include a reference value area 518 . the baseline levels of vital sign parameters may be displayed in the reference value area 518 . the baseline levels of vital sign parameters may be set by the following method : a ) the baseline levels of vital sign parameters may be set according to average values of the vital sign parameters during a period of time after the system starts running ; b ) the baseline levels of vital sign parameters may be set according to values of the vital sign parameters at specific times decided by the medical staff ; or c ) the baseline levels of vital sign parameters may be set by the medical staff . in one embodiment , the baseline levels of vital sign parameters before anesthesia and the trend of parameters related to the depth of anesthesia are displayed in graphic format , so the medical staff could easily determine whether the trend of parameters and the depth of anesthesia are appropriate . in one embodiment , the baseline levels of vital sign parameters before anesthesia may be replaced by vital sign parameters during anesthesia , or both the baseline levels of vital sign parameters before anesthesia and the vital sign parameters during anesthesia are used . in each of the aforementioned embodiments , indicating the depth of anesthesia by multiple dimensions , such as awareness , pain strength and muscle relaxation , may be applied to various monitoring equipment , such as an anesthesia machine or respirator with a monitoring function . for each dimension , one or more parameters may be used . for example , no parameter could indicate pain strength directly , but changes of at least two parameters , such as changes of hr and bp , could indicate pain strength . in order to visually indicate the depth of anesthesia , current values of parameters , parameter thresholds , and parameter statuses may be represented in the anesthesia depth displaying area 51 . by displaying the parameter information of each dimension used to indicate the depth of anesthesia in the anesthesia depth displaying area 51 , the medical staff could check the parameter information of each dimension and then quickly make a decision of what to do next . in addition , one skilled in the art could know how to display the information of each dimension and the parameter information of each dimension may be changed . for example , the parameter information , including current parameter value and threshold line , may be displayed only in abnormal status , detailed information of only one dimension and part of information for other dimensions are displayed , and so on . as shown in fig1 , a patient monitoring system may include a signal acquiring device 801 , a processor 803 , and a display device 805 . the signal acquiring device 801 may be connected to a patient and acquire parameter signals ; the processor 803 , connected with the signal acquiring device 801 , may process the parameter signals received from the signal acquiring device 801 and generate visualization parameter information ; the display device 805 , including a displaying area , could display the visualization parameter information in a display interface 800 as shown in fig1 . the display interface 800 may include an anesthesia depth displaying area 81 , a short trend displaying area 82 , and a general parameter displaying area 83 . the anesthesia depth displaying area 81 may account for one - ninth to one - third , or one - tenth to one - half of the display interface 800 . the anesthesia depth displaying area 81 may be located at the lower left corner , lower right corner , upper left corner , upper right corner , or center of the display interface 800 . in some embodiments , the short trend displaying area 82 and anesthesia depth displaying area 81 may be called an anesthesia information displaying area . in some embodiments or conditions , part of all of the general parameter displaying area 83 may be overlapped by the anesthesia depth displaying area 81 . general parameters , such as non - invasive blood pressure ( nibp ), saturation of peripheral oxygen ( spo 2 ) and central venous pressure ( cvp ), are displayed in the general parameter displaying area 83 . in this disclosure , the general parameters may include parameters monitored in special situations , and anesthesia - related parameters are not excluded . the general parameter displaying area 83 may display waveforms and values of each general parameter using known techniques . that means each general parameter representing a single sign status or change of physiological status may be displayed in the general parameter displaying area 83 side by side . short trends of anesthesia - related parameters , such as 5 - or 10 - second short trends of bis , nmt , bp , hr , and hormone , are displayed in the short trend displaying area 82 . reference values of the anesthesia - related parameters could also be displayed in the short trend displaying area 82 . a reference value of an anesthesia - related parameter may be a mean value of the anesthesia - related parameter during a preset period before and / or after anesthesia , or a value inputted by the medical staff . in a specific embodiment , the anesthesia depth displaying area 81 could also include a reference value setting area 813 . the reference value setting area 813 may be an operation button . if the medical staff presses the operation button , parameter values measured on that day may be set as the reference value of the corresponding parameter . a set of stored values measured earlier could also be set as the reference value of the corresponding parameter . trends of each general parameter displayed in the general parameter displaying area 83 may be stored in the patient monitoring system , and the trends of each general parameter may be viewed by specialized trend viewing pages . the visualization parameter information related to the depth of anesthesia may be displayed in the anesthesia depth displaying area 81 . the visualization parameter information may include at least two parameters representing the depth of anesthesia and the corresponding values , and may be displayed by at least two dimensions in the anesthesia depth displaying area 81 . in one embodiment , as shown in fig1 , the dimensions could include sedation , analgesia , and muscle relaxation . each of the three dimensions is indicated by a parameter , such as bis , δhr , and nmt . in addition , the sedation could also be indicated by minimum alveolar concentration ( mac ), and the analgesia could also be indicated by δbp . or each dimension may be indicated by two or more parameters , such as the sedation may be indicated by two parameters , δbp and δhr . the visualization parameter information could also include graphs corresponding to each dimension , that is , values of the parameters corresponding to each dimension may be visually displayed , such as by rectangular bars . marks of thresholds for each parameter , such as one or two lines , may be further included in the graphs . whether parameter values fall within the corresponding threshold may be indicated by colors , patterns , or a combination thereof in the graphs such that a rectangular bar is colored red to attract the attention of the medical staff if the corresponding parameter value does not fall within a threshold range thereof , and the rectangular bar is colored green if the corresponding parameter value falls within the threshold range thereof . the medical staff could quickly view the information displayed in the anesthesia depth displaying area 81 , determine the depth of anesthesia , and then quickly decide whether any action should be taken . in one embodiment , each dimension is represented by a shape or chart , such as a rectangular bar , and all shapes or charts are distributed symmetrically around a center point . information of each dimension is displayed in a centralized manner , so the medical staff could know that the information displayed in the anesthesia depth displaying area 81 is associated and used for indicating the depth of anesthesia . this could enhance the user experience . the display interface 800 may also include a first setting area 811 and a second setting area 831 . the first setting area 811 may be located in the anesthesia depth displaying area 81 , and specifically the first setting area 811 may be located below the dimension information . the first setting area 811 may receive dimension information and parameter information corresponding to each dimension , such as a number of dimensions used to indicate the depth of anesthesia , selected dimensions , and parameter information corresponding to each dimension . in some embodiments , in order to avoid incorrect input , the system could just limit the dimension information and / or parameter information inputted by the medical staff to specific ranges . the second setting area 831 may be located in the general parameter displaying area 83 . the medical staff could set the display mode or thresholds of parameters displayed in the general parameter displaying area 83 thorough the second setting area 831 . in one embodiment of a method of showing a depth of anesthesia , an awareness index and a pain index are displayed in two - dimensional coordinates , as shown in fig1 . a horizontal axis in the coordinates represents the awareness index and a vertical axis in the coordinates represents the pain index . if a threshold range for the awareness index , for example from i h1 to i h2 , and a threshold range for the pain index , for example from i n1 to i n2 , are given , the coordinates may be divided into several regions . at the same time , if an awareness index value of a patient falls within the threshold range of the awareness index and a pain index value of the patient falls within the threshold range of the pain index , it means the anesthetic given to the patient is suitable ; if the awareness index value falls below the threshold range of the awareness index and the pain index value falls below the threshold range of the pain index , it means the anesthetic given to the patient is too much ; otherwise , it means the anesthetic given to the patient is not suitable . as shown in fig1 , in one embodiment , a method of displaying clinical parameters includes the following steps . in step 1302 , values of at least three clinical parameters are detected . specifically , the values of the at least three clinical parameters may be detected at the same time . a patient &# 39 ; s physiological condition , such as depth of anesthesia or atelectasis , may be determined by the values of clinical parameters . when the method is used to display the depth of anesthesia , the number of detected clinical parameters , which characterize the depth of anesthesia , may be set according to clinical needs , such as three , four , five , and so on . the clinical parameters characterizing the depth of anesthesia may include bispectral index ( bis ), train of four ( tof , also known as neuromuscular monitoring ), minimum alveolar concentration ( mac ), systolic ( sys ), heart rate ( hr ), drug concentration , index of hypnosis ( also known as consciousness parameter ), index of nociception ( also known as pain index ), and so on . when this method is used to reflect atelectasis , the clinical parameters detected may be at least three hemodynamic parameters , which may be chosen from saturation of peripheral oxygen ( spo 2 ), pulse rate ( pr ), cardiac output ( co , units of l / min ), mean arterial pressure ( map ), systolic blood pressure ( sbp , units of mmhg ), heart rate ( hr , units of beats per minute , bpm ), and so on . in step 1304 , detected values of the at least three clinical parameters are compared with preset threshold ranges , wherein each threshold range corresponds to one clinical parameter . in one embodiment , the threshold ranges corresponding to each clinical parameter are preset . the threshold ranges may be set according to user needs or a default threshold range . fig1 is a schematic diagram of a user interface for setting threshold ranges of clinical parameters . as illustrated , the default threshold of the bis could range from 40 to 60 , the default value of the tof may be 30 , the default threshold of the end - tidal desflurane concentration ( etdes ) could range from 4 . 0 to 8 . 0 , the default threshold of the mac could range from 0 . 6 to 1 . 5 , the threshold of the hr in hemodynamics could range from 60 to 90 bmp ), the threshold of the pr could range from 60 to 90 bmp , the threshold of the sys ( nibp ) could range from 90 to 140 mmhg , and the threshold of the sys ( ibp ) could range from 90 to 140 mmhg . these clinical parameters may be set according to user needs , and the threshold ranges to each clinical parameter may be adjusted as shown below in table 1 . the detected values of the clinical parameters are compared with the corresponding threshold ranges . for example , the detected value of the bis is compared with the threshold range of the bis , which ranges from 40 to 60 , then whether the value of the bis is out of the range , within the range , or below the threshold range may be determined . in step 1306 , a chart is invoked , wherein the number of variables represented in the chart is decided by the number of the at least three clinical parameters . specifically , a chart with three variables is invoked if values of three clinical parameters are detected , a chart with four variables is invoked if values of four clinical parameters are detected , and so on . the chart may show whether each detected value of the clinical parameters is within the corresponding threshold range . in step 1308 , comparison results corresponding to each detected value may be shown in the chart . the method of displaying clinical parameters described above detects at least three clinical parameters . the detected values of the clinical parameters are compared with the corresponding threshold ranges , the chart with the corresponding variables is invoked , and then the comparison results corresponding to each detected value may be shown in the chart . using at least three clinical parameters , the patient &# 39 ; s physiological condition may be indicated more accurately during anesthesia or atelectasis . this could help a doctor to quickly and accurately understand the patient &# 39 ; s condition , such as the depth of anesthesia , atelectasis , and so on . in one embodiment , the chart may be a spider chart . each spoke of the spider chart represents one clinical parameter , and each spoke is divided into three sections . the three sections depict that detected values fall within , above , or below the corresponding threshold ranges . referring also to fig1 , step 1308 may include the following steps . in step 1502 , for each spoke , which section a corresponding detected value belongs to may be determined according to the corresponding comparison result . in step 1504 , all determined sections in the spider chart are connected by lines . in the following example , the spider chart is used to display the depth of anesthesia , wherein the five clinical parameters may be bis , tof , mac , sys , and hr . fig1 a is a schematic diagram displaying the depth of anesthesia , wherein five detected values respectively fall within their threshold ranges ; fig1 b is another schematic diagram displaying the depth of anesthesia , wherein one detected value falls below the corresponding threshold range ; and fig1 c is another schematic diagram displaying the depth of anesthesia , wherein one detected value falls above the corresponding threshold range . as shown in fig1 a , 16 b , and 16 c , each spoke in the spider chart , displayed as a bar , represents one clinical parameter . each bar may include three sections : a middle section representing whether a detected value of a corresponding clinical parameter falls within the corresponding threshold range , a section near the center of the spider chart representing whether a detected value of the corresponding clinical parameter falls below the corresponding threshold range , and a section far away from the center of the spider chart representing whether a detected value of the corresponding clinical parameter falls above the corresponding threshold range . a length of each spoke may be fixed , and a length of each section may be fixed . if all detected values fall within the corresponding threshold ranges , the lines connected to all determined sections form an equilateral pentagon , or the lines connected to all determined sections may not form an equilateral pentagon . in addition , in other embodiments , each spoke may be displayed as other shapes , such as an inverted triangle . in the following example , the spider chart is used to display atelectasis , wherein the five clinical parameters may comprise spo 2 , co , map , sbp , and hr . fig1 a is a schematic diagram reflecting atelectasis , wherein five detected values of the clinical parameters respectively fall within the corresponding threshold ranges ; fig1 b is another schematic diagram reflecting atelectasis , wherein the detected co value falls below the corresponding co threshold range ; and fig1 c is another schematic diagram reflecting atelectasis , wherein the detected hr value falls above the corresponding hr threshold range and the detected co value falls below the corresponding co threshold range . thereafter , the detected values of the at least three clinical parameters are displayed in the chart . in one embodiment , as shown in fig1 a , the depth of anesthesia is shown in the chart , wherein the clinical parameters may include bis ( the value of the bis is 55 ), tof ( the value of the tof is 20 ), hr ( the value of the hr is 88 ), mac ( the value of the mac is 1 . 2 ), and sys ( the value of the sys is 120 ). the number and kinds of the at least three clinical parameters may be preset in some embodiments . for example , the method is used to display the depth of anesthesia , if four clinical parameters are used to reflect the depth of anesthesia , the number of the at least three clinical parameters , which is four , may be set and the kinds of the at least three clinical parameters may be selected on corresponding configuration interfaces . in another embodiment , after step 1504 , the method may continue as follows : each determined section may be colored according to the corresponding comparison result ; and / or for example , if a detected value of a clinical parameter does not fall within the corresponding threshold range , the section that the detected value of the clinical parameter belongs to is colored yellow ; if the detected value of the clinical parameter falls within the corresponding threshold range , the section that the detected value of the clinical parameter belongs to is colored red . in one embodiment , the step of coloring the lines according to the comparison results may be the lines are colored according to a number of the detected values that do not fall within the corresponding threshold ranges . specifically , a relationship between colors of the lines and the comparison results may be preset . for example , if all detected values of the clinical parameters fall within the corresponding threshold ranges , the lines are colored green ( indicating that the number of the detected values that do not fall within the corresponding threshold is 0 ); if one of the detected values of the clinical parameters does not fall within the corresponding threshold range , the lines are colored yellow ( that means the number of detected values that do not fall within the corresponding threshold ranges is 1 ); if at least two detected values of the clinical parameters do not fall within the corresponding threshold ranges , the lines are colored red ( that means the number of detected values of the clinical parameters that do not fall within the corresponding threshold ranges is 2 or larger than 2 ), and sections corresponding to the clinical parameter values that do not fall within the corresponding threshold ranges are marked by red . this is an example , and one skilled in the art could know other ways that may be used to color the lines or sections . in one embodiment , the chart is a spider chart , and each spoke is divided into three sections . referring also to fig1 , step 1308 may include the following steps : in step 1902 , for each spoke in the spider chart , which section a corresponding detected value belongs to may be determined according to the corresponding comparison result ; in step 1904 , all determined sections in the spider chart are colored according to the corresponding comparison result . by coloring the sections that the corresponding detected values belong to , the spider chart could reflect the depth of anesthesia and atelectasis directly , making it easy for the doctor to make a decision quickly . in one embodiment , the chart may be a combination chart with multiple independent diagrams , and each diagram represents one clinical parameter . in this embodiment , the chart may include multiple bar graphs . colors and / or detected values of the at least three clinical parameters may be displayed in the chart according to the comparison results . in addition , for each bar graph showing the value of one clinical parameter , a fixed or variable scale may be set , and corresponding threshold ranges may be displayed . as shown in fig2 a , the depth of anesthesia is displayed by bar graphs . in this example , the detected value of the bis is 100 , the detected value of the tof is 65 , the detected value of the hr is 100 , and the detected value of the mac is 3 . 0 . as shown in fig2 b , atelectasis may be reflected by bar graphs . in this example , the detected value of the spo 2 is 98 , the detected value of the sbp is 80 , the detected value of the hr is 120 bmp , and the detected value of the co is 12 l / min . a system for displaying clinical parameters is shown in fig2 . the system includes a detecting device 2110 , a comparing device 2120 , an charting device 2130 , and a display device 2140 . the detecting device 2110 , including sensors , could detect values of at least three clinical parameters . the system in this embodiment may be used to indicate the physiological status of the patient , for example , the system is used to indicate the depth of anesthesia , atelectasis , and so on . if the system is used to indicate the depth of anesthesia , the clinical parameters to be detected may be clinical signs and / or drug concentration , and the number of the clinical parameters to be detected , such as three , four , or five , may be set according to need . in this embodiment , the clinical parameters used to indicate the depth of anesthesia may be selected from bis , mac , sys , hr , drug concentration , index of hypnosis , index of nociception , and so on . the detecting device 2110 could include different types of sensors , and each type of sensor detects one clinical parameter ; or the detecting device 2110 could include one type of sensors , and the sensors could detect all the clinical parameters . if the system is used to indicate atelectasis , the clinical parameters to be detected may be hemodynamic parameters . the at least three clinical parameters could selected from spo 2 , pr , co ( units of l / min ), map , sbp ( units of mmhg ), hr ( units of beats per minute , bpm ), and so on . in addition , the detecting device 2110 could detect values of the at least three clinical parameters at the same time . the comparing device 2120 compares detected values of the at least three clinical parameters with preset threshold ranges , wherein each threshold range corresponds to one clinical parameter . specifically , the threshold ranges corresponding to each clinical parameter may be preset according to need or by default threshold ranges . the detected values of the clinical parameters are compared with the corresponding threshold ranges ; for example , the detected value of bis is compared with a threshold range of bis , which ranges from 40 to 60 , and then whether the detected value falls within , above , or below the threshold range is determined . the charting device 2130 generates a chart , wherein the number of variables represented in the chart is decided by the number of the at least three clinical parameters . specifically , the charting device 2130 generates a chart with three variables if values of three clinical parameters are detected , and the charting device 1130 generates a chart with four variables if values of four clinical parameters are detected . the chart may show whether each detected value of the clinical parameters is within the corresponding threshold range . the display device 2140 displays comparison results corresponding to each detected value in the chart . in the method or system for displaying clinical parameters , values of at least three clinical parameters are detected , detected values of the clinical parameters are compared with the corresponding threshold ranges , and then a chart with the corresponding number of variables is invoked to display the comparison results . using at least three clinical parameters , the patient &# 39 ; s physiological condition may be indicated more accurately during anesthesia or atelectasis . this could help the doctor to quickly and accurately understand the patient &# 39 ; s condition , such as the depth of anesthesia , atelectasis , and so on . in one embodiment , the chart is a spider chart . each spoke of the spider chart represents one clinical parameter , and each spoke is divided into three sections . for each spoke , the display device 2140 could determine which section a corresponding detected value belongs to according to the corresponding comparison result , and then the display device 2140 connects all determined sections in the spider chart by lines . the lines connecting the determined sections could form a shape , and the depth of anesthesia may be directly and accurately indicted by the shape . in addition , the display device 2140 could color the determined sections and / or the lines according to the corresponding comparison results in the chart . specifically , a relationship between colors of the lines and the comparison results may be preset . for example , if all detected values of the clinical parameters fall within the corresponding threshold ranges , the lines are colored green ( that means the number of the detected values that do not fall within the corresponding threshold ranges is 0 ); if one of the detected values of the clinical parameters does not fall within the corresponding threshold range , the lines are colored yellow ( that means the number of detected values that do not fall within the corresponding threshold ranges is 1 ); if at least two detected values of the clinical parameters do not fall within the corresponding threshold ranges , the lines are colored red ( that means the number of detected values of the clinical parameters that do not fall within the corresponding threshold ranges is 2 or larger than 2 ), and sections corresponding to the clinical parameter values that do not fall within the corresponding threshold ranges are marked by red . this is an example , and one skilled in the art could know other ways that may be used to color the lines or sections . in another embodiment , the chart is a spider chart , and each spoke is divided into three sections . for each spoke , the display device 2140 could determine which section a corresponding detected value belongs to and color the determined section according to the corresponding comparison result . by coloring the determined sections that the detected values belong to , the depth of anesthesia may be indicated directly , making it is easy for the doctor to make a decision quickly . in addition , the display device 2140 could further display the detected values of the clinical parameters in the chart . in another embodiment , the chart may be a combination chart with multiple independent diagrams , and each diagram represents one clinical parameter . the display device 2140 could color the determined sections and / or display the detected values of the clinical parameters in the combination chart . even though the patient monitoring systems or other medical devices discussed above may indicate the depth of anesthesia , one skilled in the art could know the systems or devices could also indicate other kinds of information if the information of each dimension and corresponding parameters are replaced with other appropriate information . the systems discussed herein may be implemented by known devices , such as general computers , computer programming tools , digital storage media , and computer networks . the computers could include microprocessors , microcontrollers , logic circuits , and other processing units , and the processing units could include dedicated processors , such as application specific integrated circuit ( asic ), programmable array logic ( pal ), programmable logic array ( pla ), programmable logic device ( pld ), and field programmable gate array ( fpga ). the computers could also include a readable storage medium , such as a non - transitory storage medium , a static ram , a dynamic ram , a rom , a cd - rom , a disk , a tape , and a magnetic / optical / flash memory card . the foregoing specification has been described with reference to various embodiments . however , one of ordinary skill in the art will appreciate that various modifications and changes can be made without departing from the scope of the present disclosure . accordingly , this disclosure is to be regarded in an illustrative rather than a restrictive sense , and all such modifications are intended to be included within the scope thereof . likewise , benefits , advantages , and solutions to problems have been described above with regard to various embodiments and are not to be construed as critical , required , or essential features or elements . the scope of the present disclosure should , therefore , be determined by the following claims .	6
according to the present invention , an alloy material has been developed which has a high degree of resistance to both wear and corrosion . the alloy is especially suitable for thermal spraying onto metallic substrates by conventional thermal spray equipment . the aloy composition of the present invention is broadly in the range of , by weight : balance incidental impurities and at least 30 % iron ; the molybdenum being at least 10 % if the boron is greater than 2 %. in one embodiment , in which the alloy is relatively low in boron content and is capable of being in the amorphous form , the ranges are as follows : balance incidental impurities and at least 30 % iron ; the total of boron and carbon being less than about 3 . 0 %. in a second embodiment , that contains more boron and may have less tendency toward the amorphous form , the composition is as follows : as indicated for the second embodiment the amount of molybdenum is not as low as for the first , in conjunction with the higher amount of boron . thus if the boron content is higher than about 2 %, the molybdenum content is higher than 10 % in order to maximize the combination of abrasive wear resistance and frictional ( sliding ) wear resistance . optional elements are nickel , cobalt and manganese , totalling up to about 20 %, and preferably less than 15 %, by weight , to improve corrosion resistance and ductility . other optional elements that may be included in the composition are zirconium , tantalum , niobium , tungsten , yttrium , titanium , vanadium and hafnium , totalling up to about 30 %, and preferably less than 10 %, by weight , to form carbides and further improve wear and corrosion resistance . further optional elements may be phosphorous , germanium and arsenic , totalling up to about 2 %, and preferably less than 1 %, to reduce melting point . otherwise incidental impurities should be less than about 2 % and preferably 0 . 5 %. alloys having compositions according to the present invention , particularly in coating form , such as produced by a welding or thermal spray process , are surprisingly low in oxide content , even when prepared in air . they have a combination of resistance to abrasive wear , adhesive ( sliding ) wear and corrosion , that is especially unique for iron based alloys . alloys of the first embodiment described hereinabove having lower boron content also are quite likely to exist in amorphous form if produced by quenching . such form further enhances the above combination of favorable properties . although the composition of the present invention may be quite useful in cast , sintered , or welded form , or as a quenched powder or ribbon or the like , it is especially suitable for application as a coating produced by thermal spraying . as a thermal spray material the composition should be in alloy form ( as distinct from a composite of the constituents ) since the desirable benefit is obtained with the maximum homogeneity available therefrom . alloy powder of size and flowability suitable for thermal spraying is one such form . such powder should fall in the range between 100 mesh ( u . s . standard screen size ) ( 149 microns ) and about 2 microns . for example , a coarse grade may be - 140 + 325 mesh (- 105 + 44 microns ), and a fine grade may be - 325 mesh (- 44 microns ) + 15 microns . the thermal spray material may be used as is or , for example , as a powder blended with another thermal spray powder such as tungsten carbide . when used for thermal spraying the alloy thermal spray material need not have the amorphous structure and even may have the ordinary macro - crystalline structure resulting from the normal cooling rates in the usual production procedures . thus the thermal spray powder may be made by such standard method as atomizing from the melt and cooling the droplets under ambient condition . the thermal spraying then melts the particles which quench on a surface being coated , providing a coating that may be substantially or entirely amorphous , particularly if the composition is within the first , low - boron embodiment described hereinabove . by using the usual manufacturing procedures the production of the thermal spray powder is kept relatively simple and costs are minimized . the powders are sprayed in the conventional manner , using a powder - type thermal spray gun , though it is also possible to combine the same into the form of a composite wire or rod , using plastic or a similar binder , as for example , polyethylene or polyurethane , which decomposes in the heating zone of the gun . alloy rods or wires may also be used in the wire thermal spray processes . the rods or wires should have conventional sizes and accuracy tolerances for flame spray wires and thus , for example , may vary in size between 6 . 4 mm and 20 gauge . alloy coatings of the present invention show significant improvements in both wear resistance and corrosion resistance over prior coatings . the coatings are excellently suited as bearing and wear surfaces , particularly where there are corrosive conditions as , for example , for coating yankee dryer rolls ; automotive and diesel engine piston rings ; pump components such as shafts , sleeves , seals , impellors , casing areas , plungers ; wankel engine components such as housing , end plates ; and machine elements such as cylinder liners , pistons , valve stems and hydraulic rams . a thermal spray alloy powder of the following composition by weight according to the present invention was prepared by nitrogen atomization from the melt : the powder was sized to about - 170 + 325 mesh (- 105 + 44 microns ) and was macrocrystalline in structure . it was thermal sprayed with a plasma gun of the type described in u . s . pat . no . 3 , 145 , 287 and sold by metco inc . as type 7mb with a # 6 powder port and gp nozzle , using the following parameters : argon primary gas at 6 . 7 bar pressure and 72 standard l / min flow , hydrogen secondary gas at 3 . 3 bar pressure and 9 l / min flow , arc at 80 volts and 500 amperes , powder feed rate 3 kg per hour using argon carrier gas at 9 l / min , and spray distance 15 cm . a pair of air cooling jets parallel and adjacent to the spray stream were used . the substrate was cold rolled steel prepared by grit blasting in the normal manner . coatings up to 1 . 3 mm thick were produced that were about 60 % amorphous according to x - ray diffraction measurements . porosity was less than about 0 . 5 %, and oxide content was less than about 2 %. macrohardness was rc 32 . a second thermal spray alloy powder of the following composition was similarly prepared : the powder was of similar size and was thermal sprayed in substantially the same manner as the powder of example 1 . porosity was less than about 1 %, and oxide content was not detected metallographically . macrohardness was rc 45 ; microhardness averaged dph ( 300 ) 700 to 800 . powder of the same composition as example 2 was prepared except the size was - 325 mesh ( 44 microns ) + 15 microns . spray gun parameters were the same as given in example 1 . porosity was less than about 1 %, and oxide content was not detected metallographically . macrohardness was rc 40 ; microhardness averaged dph ( 300 ) 700 to 800 . the alloy powders set forth in table 1 , not within the scope of the present invention , were similarly prepared and sprayed with the parameters of example 1 . powder alloy nos . 4 , 5 , 6 and 7 were of the size given in example 1 . powder alloy no . 8 was finer , as given in example 3 . table 1__________________________________________________________________________alloyelements wt % no . fe ni mn cr b si c cu mo v__________________________________________________________________________4 55 . 0 8 . 51 7 . 5 19 . 0 -- 4 . 0 0 . 2 2 . 0 3 . 5 -- 5 83 . 72 -- 0 . 88 -- 0 . 017 0 . 60 0 . 9 2 . 64 10 . 6 0 . 666 83 . 0 -- 0 . 8 -- 0 . 60 -- 1 . 0 -- 11 . 0 0 . 87 69 . 0 -- -- 16 . 5 4 . 0 4 . 0 0 . 5 3 . 0 3 . 0 -- 8 * 69 . 0 -- -- 16 . 5 4 . 0 4 . 0 0 . 5 3 . 0 3 . 0 -- __________________________________________________________________________ 8 * fine size powder the coatings of the examples were tested for corrosion resistance by removing the coatings from the substrates and exposing them to 25 % hydrochloric acid solution at about 25 degrees centigrade for 3 hours . results were determined in mm / year corrosion rate . abrasive wear resistance for the example alloys was measured by placing coated samples in sliding motion against a cast iron plate with a slurry of 150 gms of between 53 and 15 micron aluminum oxide abrasive powder in 500 ml of water . a load of 3 . 3 kg / cm was applied and the surface motion was about 122 cm / sec for 20 minutes . wear resistance is presented as a ratio of loss for a similarly tested fused coating of thermal sprayed ams 4775a , which is considered an industry standard , to the coating loss for each example . sliding wear resistance for the alloy of the example was determined with an alpha lfw - 1 friction and wear testing machine sold by fayville - levalle corp ., downers grove , ill ., using a 3 . 5 cm diameter test ring and 45 kg load at 197 rpm for 12 , 000 revolutions . coefficient of friction is given , as is an indication of seizure ( if any ). results are given in table ii for all of the example alloys for the above - indicated tests . table ii__________________________________________________________________________ abrasive wear metal - metal wearalloy resistance relative to ( lfw ) acid corrosionno . fused ams 4775a (%) coeff . of friction 10 % hcl ( mm / yr ) comments__________________________________________________________________________ 1 * 95 ( excellent ) . 17 ( good ) 63 ( good ) min . oxide 2 * 80 ( very good ) . 18 ( good ) 38 ( good ) no oxide 3 * 80 ( very good ) . 15 ( very good ) 38 ( good ) no oxide4 39 ( poor ) . 34 ( seized - poor ) 127 ( poor ) high oxide5 56 ( poor ) . 17 ( good ) 163 ( poor ) high oxide6 95 ( excellent ) . 18 ( good ) 216 ( poor ) overall poor corrosion7 47 ( poor ) . 17 ( good ) 51 ( good ) porous , brittle8 80 ( very good ) . 21 ( seized - poor ) 51 ( good ) dense abrasive__________________________________________________________________________ * examples 1 , 2 and 3 according to present invention . while the invention has been described above in detail with reference to specific embodiments , various changes and modifications which fall within the spirit of the invention and scope of the appended claims will become apparent to those skilled in this art . the invention is therefore only intended to be limited by the appended claims or their equivalents .	2
referring to the drawings in detail , and more particularly to fig1 there is shown a device which consists of a frame 1 , which has mounted thereon , a pair of supports 2 and 3 , an arrangement of bearers , 4 and 5 , for a pair of driving shafts , 6 and 7 , respectively . the driving shafts , 6 and 7 , are seated at the rear of the device . each driving shaft , 6 and 7 , has a chain - wheel 8 and 9 , around which is wound a drive - chain 10 . the drive chain 10 also runs over a drive chain wheel 11 of a motor 12 and a guide sprocket 13 , whereby a corresponding looping around the chain wheels , 8 and 9 , ensures that the drive shafts 6 and 7 rotate in opposite directions . the drive chain 10 moves in accordance with the arrows shown in fig1 . the direction of rotation of the drive shafts , 6 and 7 , is also indicated by arrows . the drive shafts , 6 and 7 , have a pair of operating cams , 14 and 15 , disposed therearound . the cams , 14 and 15 , are secured against rotation in relation to the drive shafts , 6 and 7 , by an arrangement of key wedges , 16 and 17 . the operating cams , 14 and 15 , rotate in corresponding bearings , each in a processing member , 18 and 19 , and these can be either slide bearings or roller bearings . the bearings are not shown in detail in fig1 . with the rotation of the drive shafts , 6 and 7 , the processing members , 18 and 19 , execute according to the function of the cams 14 and 15 , both a to - and - fro movement in the direction towards and away from each other , besides moving up and down in the sense of an advance - and - return movement . these two directions of movement naturally superimpose themselves upon each other . the inner side of the processing members , 18 and 19 , have an arrangement of projections , 20 and 21 , facing each other , as shown in fig6 . the processing members , 18 and 19 , are held substantially parallel to each other . an arm , 22 or 23 , directed from each cam - mounting and a link , 24 or 25 , arranged at an angle thereto , permits the general parallelism between the processing members , 18 and 19 . each link , 24 or 25 , is rotatably articulated to its respective arm , 22 or 23 , through a lug , 26 or 27 . the link , 24 or 25 , ends with its end remote from the arm , 22 or 23 , in a pivot - bearing , 28 or 29 . the pivot - bearing , 28 or 29 , is fitted rigidly , but subsequently adjustable , to the support , 2 or 3 . details will be given below about the effects of an adjustment of the pivot - bearing , 28 and 29 . the adjustability is permitted because the pivot - bearing , 28 and 29 , is secured through an arrangement of bolts 30 , to the support , 2 and 3 . the pivot - bearings , 28 and 29 , can be either raised or lowered in respect to the position of their point of rotation after the bolts 30 , are loosened , permitting changing spacers . before the cycle of movement of the processing members , 18 and 19 , is discussed in more detail , it might be first explained how the workpiece , in this case , leather , is fed through the device . the leather , 31 , may be fed through the machine in either direction depending upon the orientation of the particular camming elements and the like . a 180 ° turn of these elements would permit the leather , 31 , to be fed through the machine in the direction opposite that described below . as shown in fig1 a piece of leather , 31 is guided from above over the feed table , 32 into a processing gap 33 , here shown in vertical arrangement , between the processing members , 18 and 19 , until it issues from their outlet end . here it is received by a chute 34 and is passed on . instead of the chute 34 , a conveyer belt 35 , shown in broken lines , may also be provided to carry off the processed leather . the movement of the processing members , 18 and 19 , resulting from their special mounting , is now explained by reference to fig2 to 5 , which show only those construction components presented to aid the understanding of the cycle of movement . in fig2 the open position of the processing members , 18 and 19 , is shown , in which the working cams , 14 and 15 , by their corresponding position , have brought the processing members , 18 and 19 , into the engine position of withdrawal from each other . in this position , the key wedges , 16 and 17 , are pointing away from the processing gap 33 . the latter is thereby opened upwards in a slight wedge - shape , so that in this position the leather can easily be guided into the processing gap 33 from above . fig3 shows the next operating phase in which the drive shafts , 6 and 7 , and with them the working cams , 14 and 15 , are rotated about 90 ° into a position in which the key wedges , 16 and 17 , have moved upward . with this rotation of the working cams , 14 and 15 , the processing members , 18 and 19 , execute a substantially upwards movement as return movement and a forward movement in the direction of the other processing member , whereby the respective levers , 24 and 25 , and pivot - bearings , 28 and 29 , are displaced slightly upwards . the arms , 22 and 23 , thereby execute a slight outwardly directed pivoting movement , whereby the processing gap approaches more the parallel position of the processing members , 18 and 19 . in fig4 the operating phase is represented , in which the drive shafts , 6 and 7 , have rotated about a further quarter revolution , and together with the working cams , 14 and 15 , are thereby pointing in the direction of the processing gap 33 . in this position , the working cams , 14 and 15 , have pushed the processing members , 18 and 19 , into their foremost position , in which the projections , 20 and 21 , are thus most deeply engaged in each other . the processing members , 18 and 19 , are also parallel to each other . the following operating position , represented in fig5 shows the drive shafts , 6 and 7 , together with the working cams , 14 and 15 , rotated about a further quarter revolution in which the key wedges , 16 and 17 , are pointing downwards . in this position , the processing members , 18 and 19 , are again moved a certain distance away from each other , owing to the effect of the cam . they are also displaced downwards , whereby the processing gap 33 between the processing members is again opened in a slight wedge - shape . in the movements of the processing members , 18 and 19 , from the operating phase represented in fig3 to the operating phase according to fig5 the levers , 24 and 25 , execute a pivoting movement downwards , as the processing members , 18 and 19 , are moved downwards by the cams , 14 and 15 . in this pivoting of the levers , 24 and 25 , the arms , 22 and 23 , rotate outwards relatively to the working cams , 14 and 15 , so that the parallel position of the processing members , 18 and 19 , as shown in fig4 occurs . if the processing members , 18 and 19 , are displaced further downwards by further rotation of the working cams , 14 and 15 , and again drawn apart from each other , the levers , 24 and 25 , likewise swing downwardly but exert a certain amount of pressure on the arms , 22 and 23 , by the separating action of the processing members 18 and 19 , so that the arms , 22 and 23 , are swung inwardly which permits the slight wedge - shape of the processing gap 33 , as represented in fig5 . in fig6 there is illustrated the sequences of movement of the projections , 20 and 21 , a second pair of projections , 54 and 55 , and also a third pair of projections , 36 and 37 . the projections , 36 and 37 , are situated at the entry end of the processing members , 18 and 19 . the ellipses depicted in connection with a projection represent the path of movement of a specified point on the relevant projection . thus the projection 37 describes an ellipse 39 made by a point 38 thereon . a corresponding statement applies for the other projections , 36 , 54 , 20 and 21 . fig6 plainly shows that the ellipses , from above downwards in the pass - through direction , progressively conform more and more to the vertical with their longest axes , and increasingly overlap a middle demarcation line 40 . the overlapping of the middle line 40 by the ellipses indicates that the processing members engage in each other to a corresponding depth and length . it can also be seen from fig6 that the section of ellipse overlapping in each case the middle line 40 increased from above downwards . this signifies that the workpiece is processed for a correspondingly increasing duration by the relevant projections . this promotes an increase in processing intensity in the pass - through direction . the device depicted in fig7 exhibits a horizontally situated processing gap , 41 . otherwise the device works like that shown in fig1 and the explanations according to fig2 to 6 apply as well . analogously to the arrangement of the pivot bearings , 28 and 29 , as shown in fig1 on the device according to fig7 a pair of pivot bearings 42 , are arranged with a pair of working cams 43 , in the forward feed direction , this direction being indicated by arrow pointing towards the processing gap , 41 . this arrangement of the pivot bearings 42 permits the desired effect in that the entry side of the processing gap 41 opens wider than on the outlet side . a pair of flexible covers , 44 and 45 , are stretched over the projections , 20 and 21 , of processing members , 18 and 19 , to prevent the projections , 20 and 21 , from forming an obstacle for the edge of the workpiece when the latter is being inserted into the processing gap 41 . the covers , 44 and 45 , may be comprised of for example , an elastic foil . the covers , 44 and 45 , stretch in such a way over the projections , 20 and 21 , that they present substantially flat surfaces so that the workpiece ( here , the leather 31 ) can be pushed without hindrance into the processing gap 41 as the processing members , 18 and 19 , are drawn apart , out of engagement with each other . the covers , 44 and 45 , end on both sides of the processing members , 18 and 19 , each in an upper roller , 46 and 47 , respectively , and also in a pair of lower rollers , 48 and 49 , respectively . the covers , 44 and 45 , are held stationary during the operating of the device . if a cover becomes damaged during machine operation , the machine operator needs only to wind it from one roller on to the other until a complete , undamaged section of the cover stretches over the relevant processing member . in this , practically no interruption of the operating of the device is required . a selectable adjustment of the processing depth of the processing members is made possible by utilization of an adjustable cam 50 , which comprises the axis portion of the processing member , 18 , as depicted in fig8 . in practical terms , the adjustable cam , 50 , represents the outer bearing for the working cam 14 . by the rotation of the adjustable cam 50 , the working cam , 14 , assumes a specific position relative to the processing member 18 . this position being determined by the amount of rotation of the adjustable cam 50 . the adjustable cam 50 is held in fixed relation to the processing member 18 by an adjusting screw 51 . a number of borings , 52 , are provided for the different adjustments of the adjustable cam , 50 . in the position depicted of the adjustable cam , 50 , the latter has moved the processing member 18 , in the direction of the greatest depth of engagement . it can be seen from fig2 to 5 that the processing members , 18 and 19 , continually travel downwards , in relation to a broken reference line extending above the figures , out of the position shown in fig3 to the one in fig5 . the broken reference line represents a distance from the frame 1 of the device , which remains constant . the increasing distance of the entry side of the processing members , 18 and 19 , on the way through the working phases according to fig3 to 5 , shows that over these processing phases a piece of leather held by the processing members , 18 and 19 , is carried downwardly with it . a forward feed movement is thus imparted to the leather . when the processing phase , as shown in fig5 commences , the processing members , 18 and 19 , again move away from each other and execute the return movement which consists of the path through the processing phases according to fig5 and 3 . the leather then remains , relative to frame 1 of the machine , in substantially the position that it has reached , since it is prevented by its own inertia from participating in the return movement . moreover , according to the law of inertia , it actually tends to follow its previously enforced forward feed movement . in addition , there is also the force of gravity which helps the further downward movement of the leather . applying these considerations to the device , as shown in fig7 the same forward feed effect occurs . the leather is pushed in the direction of the arrow during the coming together of the processing members , 18 and 19 , until it is again released from them . they then execute the return movement , as described above . by reason of its inertia , the leather does not participate in this return movement . this effect is further supported here by the covers , 44 and 45 , stretched over the projections , 20 and 21 , as the smooth surface of the covers does not give rise to any significant friction upon the leather on the return movement of the processing members , 18 and 19 . there also occurs , with the horizontal processing gap , 41 , as shown in fig7 an automatic foward feed effect without any need of conveyer belts . the forward feed effect is caused solely by the movement of the processing members , 18 and 19 , which execute not only an up - and - down movement but also a to - and - fro movement .	2
the manner in which a method according to an inventive arrangement employs different technologies to establish conditions that clearly inform the client or end user when and how to speak during a fairly complex situation , the interview , is explained in connection with fig1 and 2 . the functions of the technologies can be advantageously allocated to support a complex computer conversational interface such as the interview . fig1 illustrates an advantageous arrangement of information and visual cues on a video display screen . with reference to fig1 a computer apparatus 2 comprises a monitor 4 having a video display screen 10 , generated by at least one graphical user interface in the computer apparatus , generated for example by a graphics adapter 6 in a central processor 30 . at least one audio output interface is generated by a sound card 8 in the processor and a speaker 22 . at least one audio input interface is generated by a microphone 24 and the sound card 8 . the display screen 10 is divided into a first section 12 and second section 14 , divided by the dashed line . the first section 12 is for the video environment 16 . the second section 14 has a first portion 18 for text , for example questions . the second section 14 has a second portion 20 for the synthesized environment . the video environment portion 16 is for pictures of real people in a real setting , for example , doctors in a clinic setting or a psychiatrist in an office . the doctor can refer to questions which appear below , in a second portion 18 . the doctor &# 39 ; s speech can include references to real world contexts . the synthesized environment 20 can show a synthesized actor with text to speech capability . the goal is to complete the interview questions and the scope of the synthesized actor &# 39 ; s comments are limited to the interview questions . although fig1 shows the display screen divided into upper and lower sections , it should be appreciated that the video and synthesized actors can appear in any location on the display screen , or even as a substantially transparent foreground figure . the format of the screen layout can be arranged differently for different kinds of interactive sessions . the computer apparatus is further provided with input devices , for example , in the form of a keyboard 26 , a mouse 28 and a touch screen 32 , indicated schematically by a small , partial cross hatch pattern . a computer apparatus in the general configuration illustrated in fig1 is well known and available from numerous manufacturers . speech recognition software for programming such computer apparatus is also available from numerous manufacturers . it is important to appreciate the differences between the various parameters of the respective video and synthesized environments , as well as the allocation of functions between these environments . these parameters and allocations include : content ; purpose ; role of client or end user ; role of interviewer ; and , turn taking rules . reference should be made to the conversation flow diagram 40 in fig2 in connection with the following explanation of the parameters and allocations . flow diagram 40 includes a block 42 for the video actor &# 39 ; s turn , a block 44 for the synthesized actor &# 39 ; s turn and a block 46 for the client &# 39 ; s or end user &# 39 ; s turn . in the screen arrangement of fig1 the video actor &# 39 ; s turn takes place in 16 and the synthesized actor &# 39 ; s turn takes place in portion 20 . in accordance with this arrangement , control can be passed between blocks 42 and 44 and between blocks 44 and 46 . blocks 42 and 46 can interrupt one another and blocks 44 and 46 can interrupt one another , but blocks 42 and 44 do not interrupt one another . the flow diagram in fig2 assumes that the client or end user will initiate the conversation . this means that the video and synthesized actors are , in effect , listening until the client or end user speaks or otherwise undertakes an initiating action . in accordance with the flow diagram , the client or end user interacts primarily with the synthesized actor . the synthesized actor controls the conversation and gathers information . the video actor provides information such as welcoming , setting , purpose , direction and debriefing . a turn consists of verbal and non verbal behavior used to accept the turn , contribute to the conversation , by a statement or question , and pass control to the next party in the conversation . non verbal behavior can consist of actions , for example the actor or client or end user presses a button , and other body movements , for example head , eye , facial , hand and body position movement , to cue the start , continuation or end of a statement or question . non verbal behavior can be combined with verbal behavior , that is speaking , to provide non verbal cues such as raising the eyebrows to signal speech onset , looking towards the target of the speech and changing the voice to signal completion . interrupting is a forced turn taking . if the video actor is interrupted by the client or end user , the video actor will pass control to the synthesized actor , which can return control to the video actor , respond to the interruption or return control back to the client or end user . the content of the video environment is in captured files , for example , . avi and . wav , or live video transfer . the content of the synthesized environment is provided by the services of an actor and text - to - speech conversion . the purpose of the video environment is to set the context or environment , as for example , in a doctor &# 39 ; s office , in a clinic , in the forest and the like . the audio portion also supports the context . the video environment may be used , for example , to tell a story or describe administrative details . the video environment is intended to make the client or end user feel at ease . the video environment is primarily an output mode , being the source of the interview and the test . the purpose of the synthesized environment is to control the content of the assessment tool . this can be accomplished by providing examples of how to speak and the proper vocabulary to use . for example , the synthesized actor will use simple words in asking a question with the expectation of a simple answer . an example of a limited question is , “ do you want to go back to another information about question ?” this can be contrasted with a more open and problematic question , such as , “ which question or questions would you like to revise ?” the role of the client in the video environment is to listen to instructions , as well as to watch and learn about the situation and the test . the role of client in the synthesized environment is to answer questions and interact with the system , controlling the flow of the interview . the role of the interviewer in the video environment , who is a real person , is to follow the rules of human - to - human conversation in a lecture format , in the nature of a television - like interaction . the role of the interviewer in the synthesized environment , who is a synthesized actor , is to follow the rules for human - to - computer conversation . in an ideal situation , the synthesis would be so complete as to appear to be like a human - to - human interaction . the turn taking rules for the video environment include : initiates new topics ; taking turns from the actor ; and , giving speaking turns to the actor . the turn taking rules for the synthesized environment include : completing interview ; managing navigation through the assessment ; taking turn from the video and from the client or end user ; and , giving turns to the video and the client or end user . it should also be appreciated that these concepts can also be applied to situations other than interviews , for example distance education , in which the client , for example a student , must work within a conversational context and the test content can be separated from it . since it is known that people will respond with language similar to that used by the interviewer and that the vocabulary of voice recognition systems is limited , the actor would use a restricted language and speak discretely to be an example of how the client or end user should talk to the system . the language of the actors in the video segment could be more formal or more colloquial , more relaxed or more animated , depending on the context . these concepts could also be applied in similar situations , for example , distance education , in which the client ( e . g ., student ) must work within a conversational context and the test content can be separated from it , and job skills sessions , just to name two . a job skills session managed in accordance with the inventive arrangement can be conducted as follows . suppose a client or end user is interested in learning about skills required to enhance their career . when the client or end user initiates the session , the video actor would welcome the client or end user , record non recognizable information , explain about the company &# 39 ; s career enhancement program and describe the manner in which the synthesized actor would help the client or end user complete several skill inventories . non - recognizable information includes those items that have too large a domain for present speech recognition systems . this can include information such as name , address , and place of birth . the video actor would ask for the information , which would be recorded . the video actor passes control to the synthesized actor , which could ask for verification . the synthetic actor might say , for example , “ please listen to the recording of your name and address . say or press “ ok ” if it is clear and correct . say or press “ retry ” if you want to record your name and address again .” when the client or end user responds , the synthesized actor says “ thank you .”, and passes control back to the video actor . the video actor responds appropriately , either asking for the information again or continues . the synthesized actor has the vocabulary for completing each test , for example the myers - briggs test or one of the many vocational guidance tests , as well as some of the terminology of the specific industry . accordingly , the synthesized actor can then recognize navigation words , words in the test and alternative ways to answer a question , such as “ b ”, “ the second one ” or “ fourteen ninety two ”. when general , non test information is needed , the synthesized actor would pass control back to the video actor . this might be between sections of a test , between tests , or very likely , after completion of the tests . a simple method to do this is to have the synthesized actor look towards the video actor , say his or her name , and continue looking at the video actor until the video actor begins to speak . it can be noted that this is the same general etiquette that a speaker at a lectern uses to pass control to another speaker . the old speaker looks at the new speaker , announces his or her name , waits for the new speaker to get to the lectern , and recognizes that the new speaker now has control of the meeting , for example with a handshake . the interface can be seen to encourage interaction between the actors and the client or end user . when the testing is completed , the synthesized actor returns control back to the video actor . the video actor then closes the session with the client or end user . in a speech recognition system , managing the human - computer conversation requires more than just knowing what was said . the inventive arrangement taught herein advantageously separates the context from the content , for example in a complex interaction such as an interview situation , by providing video and synthesized environments having different but complementary functions .	6

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.