Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
a central tire inflation system ( ctis ) in which the air and rotating tires are controlled through an air connection between the trailer air supply and each of the tires on a driven axle and such a disclosure is provided by this invention . referring to fig1 the reference numeral 10 generally indicates a wheel assembly of a driven axle vehicle having a driven axle or spindle within the axle housing 12 upon which a wheel hub 14 is supported therefrom by bearings 16 and 17 . lug bolts 18 extend from the hub 14 for receiving and supporting a wheel and tire ( not shown ), and a brake drum 20 , all of which rotate . a stationary component includes a brake assembly including a mounting plate to which is connected the brake spider , the brake s cam and the brake shoe 28 . the above components of the wheel and brake assembly are conventional . the present invention is directed to providing a rotary air coupling generally indicated by the reference numeral 30 to distribute supply air from an air supply on the vehicle to tires mounted on the drive axle or spindle . existing air distribution systems for tire inflation systems on drive axles direct the supply air through the bearings of the hub which require smaller bearings , additional seals , which causes the seal life to be shortened . one of the features of the present rotary coupling 30 is that it does not interfere with the conventional drive axle and axle housing 12 , bearings 16 and 17 or lubrication as do internal type axle couplings . therefore , there is no interference in the strength of existing vehicle components . it is noted from fig1 that the rotary air coupling 30 of the present invention is positioned around the outside of the axle housing 12 and externally of the hub bearings 16 and 17 . however , the present air coupling 30 consists of a rotary or dynamic component 33 and a stationary or static component 34 . it is important that the components 33 and 34 be closely aligned with tight tolerances ; however , the various components in the wheel assembly 10 have variable and loose tolerances such a quarter of an inch or even greater . nevertheless , the tolerances between the brake drum 20 and the brake shoe 28 must be maintained with close tolerances which requires that the tolerances between the brake mounting plate 22 and the hub 14 is a well defined dimensional relationship since the other brake members are interconnected from the brake mounting 22 and hub 14 . therefore , it is another feature of the present invention to support the stationary components 34 and the rotating component 33 of the coupling 30 from the brake mounting plate 22 and the hub 14 , respectively , thereby allowing the components 33 and 34 to maintain the required close tolerances between themselves . referring now to fig1 and 2 , the stationary component 34 includes a stationary seal chamber 36 which , in conjunction with a pair of high pressure seals 37 and 38 , defines a radially facing opening ( see direction line 40 ). the stationary seal housing 36 is positioned externally of the hub bearing 16 and 17 and the axle housing 12 , and is connected to the brake mounting plate 22 and supported therefrom such as by bolts 42 . the pair of high pressure stationary ring seals 37 and 38 each having a sealing face 37 a , 38 a is positioned in the seal chamber 36 with each sealing face 37 a , 38 a oriented in the radial direction . the high pressure seals 37 , 38 are formed of a metal body portion that is press - fit into the annular opening of the components 33 , 34 . the sealing face 37 a , 38 a is formed with an appropriate spring - loaded rubber sealing member , and preferably teflon or other wear resistant surface is provided at the sealing interface . in the preferred embodiment , the sealing member is designed to withstand a pressure spike of about 125 - 130 psi . of course , the exact sealing specifications may be altered to satisfy the sealing conditions at hand . referring now to fig2 the rotating component 33 and stationary component 34 are illustrated with the wheel and brake assembly omitted . the two radially oriented , high - pressure seals 37 , 38 provide a sealed interface between the rotating and stationary components 33 , 34 ; thereby defining an airflow path shown with a series of arrows 39 in fig2 . referring to fig1 and 2 , an air supply inlet 90 is connected to the stationary component 34 and is adapted to be connected to the air supply on the vehicle thereby placing air in communication with the tire via the air path shown in fig2 . the air outlet port 92 provides a connection via lines ( not shown ) to the pneumatic tires ( not shown ). fig3 is a cross sectional view of the rotational component 33 showing an annular hub portion with seal engaging surfaces 33 a , 33 b , and a cylindrical delivery member 33 c . fig4 and 5 are perspective views of the rotational component 33 of fig3 . fig6 is a cross sectional view of the stationary component 34 showing an annular hub portion with seal mounting surfaces 34 a , 34 b , and a cylindrical delivery member 34 c . the stationary member is mounted to a brake mounting member via mounting holes 34 d receiving the bolts 42 . fig7 and 8 are perspective views of the stationary component of fig6 . in operation , the present air coupling may be conveniently located outside of the axle and connected to known dimension parts ; the stationary component is preferably connected to the brake mounting plate 22 by the bolts 42 , and the rotational component 33 is preferably press - fit onto the hub to thereby rotate with the tire . these components 33 , 34 are mounted with the assurance that the tolerances of these available mounting services are always tightly controlled because it is important that the brake shoes 28 be aligned with the drum 20 . the location of these components also has the advantage of accessibility . the coupling 30 does not interfere with the drive axle or axle housing 12 , bearings 16 and 18 , or lubrication . the rotary union 30 can be accessed as easily as the brake shoes and may be easily reassembled and there is no interference with the existing vehicle components . an airline is connected to the vehicle air supply and connected to the inlet connection 90 to provide a supply air for supplying to the rotatable tires . suitable air lines are connected between the tires and the outlet 92 . the vehicle air supply will now be described . the onboard tire pressure inflation system may comprise a control which will typically be located in the vehicle operator &# 39 ; s cab . the control may have a lever which is selectively movable to two or more positions for selecting a desired tire pressure . typically , in a heavy duty vehicle , in highway ( i . e . over - the - road ) conditions it is desired that the driving tires be inflated to a pressure of about 75 pounds per square inch , in off - the - road conditions it is desired that the driving tires be inflated to a pressure of about 40 pounds per square inch and for desert operating conditions it is desired that the tires be inflated to a pressure of about 8 - 14 pounds per square inch . of course , other pressures and / or other settings may be selected by the control and will fall within the scope of the present invention . the control may also include an infinitely variable control member whereby the operator may select any pressure within a given range of pressures . the control is attached to a pressure regulator by a line which may be hydraulic and / or electric or the like . the pressure regulator is connected to a source of pressurized fluid by a fluid connection and to a vent or exhaust . the pressure regulator will supply selectively pressurized fluid to the inlet 90 which communicates with the tire inflation structure shown in fig1 . pressure regulator is effective to supply pressurized fluid to fluid connections , or to vent fluid connections , in accordance with the setting of control . a pressure gauge may also be provided , preferably in the operator &# 39 ; s cab , indicating the pressure level of pressurized fluid in the system . typically , the pressurized fluid will be pressurized air and the source of pressurized fluid will be the vehicles onboard air system and / or a pressurized air accumulator . therefore , as the wheels rotate , air from the air supply flows through the inlet , into the chamber 36 , past the high pressure seals 37 , 38 while their seal faces engage to the rotational component 33 to prevent escape of the air , into the rotational component 33 , and out of the outlet connection 92 to the tires . as apparent from the foregoing description , the system of this invention consists of two machined pieces ( the rotational component and stationary component ) and two high pressure seals . the rotational component is designed to press fits onto the hub and rotates with the wheel . the stationary component pilots on the axle tube and is mounted using the brake assembly mounting bolts ; the stationary member also holds the two high pressure seals in place . referring now to fig9 and 10 , an alternate embodiment of the present invention will be described . for this alternate embodiment , a first annular component 133 is mounted onto the hub and rotor assembly , and the second annular component 134 is press fit onto axle tube 114 . the first annular component 133 , in conjunction with a pair of high pressure seals 137 and 138 , defines a radially facing sealing chamber . the first annular component 133 is connected to the hub and rotor assembly 120 and supported therefrom such as by bolts 118 . the pair of high pressure stationary ring seals 137 and 138 , each having a sealing face 137 a , 138 a , are positioned in the sealing chamber 136 with each sealing face 137 a , 138 a oriented in the radial direction . the high pressure seals 137 , 138 are formed of a metal body portion that is press - fit into the annular opening of one of the components 133 , 134 . in fig9 and 10 , the seals 137 , 138 are press fit onto the first component 133 . each sealing face 137 a , 138 a is formed with an appropriate spring - loaded rubber sealing member , and preferably a teflon or other wear resistant surface is provided at the sealing interface . in the preferred embodiment , the sealing member is designed to withstand a pressure spike of about 125 - 130 psi . of course , the exact sealing specifications may be altered to satisfy the sealing conditions at hand . referring now to fig1 , the first component 133 and the second component 134 are illustrated with the wheel and brake assembly omitted . the second component 134 is press - fit onto the outer radial surface of the axle tube 114 and that outer radial surface helps define the path of airflow for this tire inflation system . the two radially oriented , high - pressure seals 137 , 138 provide a sealed interface between the rotating and stationary components 133 , 134 ; thereby defining an airflow path shown with a series of arrows 139 in fig1 . referring to fig9 and 10 , an air supply inlet 190 is connected to the second component 134 and is adapted to be connected to the air supply on the vehicle thereby placing air in communication with the tire via the air path shown in fig1 . the air outlet port 192 provides a connection via lines ( not shown ) to the pneumatic tires ( not shown ). to inflate the tire ( s ), a positive pressure is applied to the inboard side of the stationary component . air is thereby delivered to the rotational component through the interface created by the two high - pressure seals . a hose then delivers the air to the tire for inflation . to deflate the tire ( s ), a negative pressure is applied to the inboard side of the stationary component ; thereby reducing the air pressure in the tire ( s ). the present invention , therefore , is well adapted to carry out the objects and attain the ends and advantages mentioned as well as others inherent therein . while a presently preferred embodiment of the invention has been given for the purpose of disclosure , numerous changes in the details of construction , and arrangement of parts will be readily apparent to those skilled in the art and which are encompassed within the spirit of the invention and the scope of the appended claims .	1
embodiments of the present invention will hereinafter be described with reference to the accompanying drawings . it is to be noted that the present invention is not limited to the embodiments . a plain bearing unit as a basic configuration of the present invention will first be described using fig2 . fig2 illustrates a testing portion of a journal type testing machine . the testing portion of the testing machine is configured such that a resin bearing 2 is press fitted into a casing 1 to rotatably carry a shaft 4 . the casing 1 is configured to apply a load to the resin bearing 2 . a rotating - driving motor ( not illustrated ) is connected to one end of the shaft 4 . the testing portion is covered by a protection cover 5 , which is provided with a venting hole 6 at an upper portion as well as with venting holes in the vicinity of the shaft . the resin bearing 2 is made of thermoplastics , polyphenylene sulfide ( pps ), containing 30 wt % carbon fiber . the shaft 4 is made of stainless steel ( sus ). the protection cover 5 is provided with a gas supply tube 3 passed therethrough . a gas flow 7 discharged from the gas supply tube 3 is illustrated . the gas flow 7 moves from the gas supply tube 3 toward a bearing sliding portion between the resin bearing 2 and the shaft 4 . in this case , nitrogen as dry gas was supplied at 20 l / min and relative humidity in the vicinity of the resin bearing 2 was 1 . 5 %, which is a lower limit of a humidity sensor 8 installed in the protection cover 5 . as a result , a minimum friction coefficient is 0 . 08 , which significantly drops from 0 . 25 in damp air . also wear - depth reduces by about 40 % compared in damp air . the wear powder of the resin bearing uniformly transfers onto the sus shaft as a counterpart . a description is given of , as a similar experiment , an example where the resin bearing uses polyether ether ketone ( peek ) containing 30 wt % glass fiber . the others are the same as those of the above - mentioned test . the results of the test are as below . also in this test , the minimum friction coefficient is 0 . 09 , which significantly reduces from 0 . 3 in dump air . in addition , also wear - depth reduces by about 40 %. the wear powder of the resin bearing uniformly transfers onto the sus shaft as a counterpart . a description is given of another gas supply portion adapted to supply gas to a bearing with reference to fig3 . as illustrated in fig3 , this gas supply portion has a hole 3 a which is located on an opposite - load surface of a shaft 4 so as to communicate from a casing 1 to the shaft 4 . in addition , a piping component 9 is secured to the casing 1 and a resin bearing 2 so that the hole 3 a is shared thereby . the others are similar to those of experimental example 1 . in this way , the piping component 9 serves as a lock for the resin bearing 2 . even if the resin bearing 2 shrinks due to changes in ambient temperature , it is possible to prevent the resin bearing 2 from dropping off from the casing 1 and from being turned together with the shaft 4 . a test performed for a block - on - ring type is next described with reference to fig4 . a planar type resin test piece 42 of polyether ether ketone ( peek ) containing 30 wt % carbon fiber is examined which is a resin material used as a bearing portion . this test piece 42 is interposed between a cantilever 41 attached with a weight 40 and a shaft 10 made of stainless steel ( sus ). the shaft 10 performs a swing movement of 90 degrees . a testing portion is circumferentially covered by a protection cover 5 , which is provided with an air supply pipe 3 . in this case , dry air as dry gas was supplied at 20 l / min . the results of the test are as below . the minimum friction coefficient is 0 . 15 , which reduces by about half compared in damp air . in addition , also wear - depth reduces by about 40 %. the wear powder of the resin bearing uniformly transferred onto the swing portion of the sus shaft . in the present experimental example , the device of experimental example 4 is used and gas resulting from gasifying liquid nitrogen is supplied in place of dry air to the inside of the protection cover 5 from the air supply pipe 3 . the supply amount of the gas is controlled so that the temperature inside the protection cover 5 may become − 100 ° c . the other conditions are the same as in the above tests . the results of this test are as below . the minimum friction coefficient is 0 . 05 . in addition , the wear powder of the resin bearing transferring onto the sus shaft is most . referring to fig1 , a description will next be given of an example ( a sixth embodiment ) in which a plain bearing unit of the present invention is applied to a centrifugal compressor . in the centrifugal compressor 11 of this embodiment , a drive device ( not illustrated ) rotates an impeller 12 mounted to a main shaft ( not illustrated ) with the main shaft to compress air passed through a passage 14 provided in a casing 13 and supplied to the impeller 12 . the compressed air is passed through a discharge port ( not illustrated ) and discharged to the outside . incidentally , although not illustrated in fig1 , the main shaft rotating the impeller 12 is provided below the impeller 12 in fig1 . the centrifugal compressor 11 is provided with a plurality of vanes 15 to control a flow rate of gas in a passage adapted to lead the gas to the impeller 12 . the vanes 15 are swung by a gear mechanism that includes a first gear 17 , a third gear 19 and a second gear 20 . the first gear 17 is a drive gear secured to a drive shaft 16 connected to a drive mechanism ( not illustrated ). the third gear 19 is a vane gear secured to a vane shaft 18 connected to the vanes 15 . the second gear 20 is a ring gear interposed between the first and third gears to transmit rotation of the first gear to the third gear . the first , third and second gears 17 , 19 , 20 are housed in the casing 13 . the first and third gears 17 and 19 are mounted to the drive shaft 16 and the vane shaft 18 , respectively . the drive shaft 16 and the vane shaft 18 are rotatably supported by bearings ( plain bearings ) 22 and 24 , respectively , secured inside the casing 13 . in addition , the bearings 22 and 24 are made of polyphenylene sulfide ( pps ) containing carbon fiber . the vane shaft 18 is provided with a seal 25 on the side of the passage 14 to prevent the inflow of gas from the inside of the passage 14 . although a contact seal as the seal 25 is used in the present embodiment , a non - contact labyrinth seal may be used . a gas supply portions 21 are connected to the respective bearings 22 and 24 . nitrogen with a dew point not higher than − 50 ° c . is supplied to the bearings 22 and 24 through the gas supply portions 21 from a gas supply device 33 at a pressure of 0 . 02 mpa . the nitrogen is recovered through a communication hole 23 communicating with the outside and a check valve ( not illustrated ) of the out side into the gas supply device 33 including a cylinder and dehumidification is carried out in the gas supply device 33 . the communication hole 23 is provided at a portion of the casing 13 incorporating the gear mechanism . high pressure air or inert gas such as argon subjected to dehumidification and dust removal may be supplied in place of nitrogen . in addition , a gas production device may be used in place of the cylinder . the nitrogen recovered is returned to the gas supply device 33 via a dust removal device 31 and a pump 32 , and circulated and supplied to the bearings 22 and 24 . referring to fig5 which is an enlarged view illustrating a bearing portion , the bearing 24 has a communicating hole 24 a , which communicates from a bearing surface sliding along the vane shaft 18 to a gas supply hole ( a part of the gas supply portion 21 ) on an outer circumferential surface side . nitrogen is supplied to a sliding portion of the bearing 24 through the communicating hole 24 a . also , nitrogen flows along the drive shaft 16 , and flows into a space between the drive shaft 16 and the bearing 22 from the end of the bearing 22 , and is supplied to a sliding portion of the bearing 22 . in this way , the centrifugal compressor performs predetermined operation while nitrogen are circulated and supplied to the bearings . the temperature of gas flowing in the passage 14 largely ranges from − 160 ° c . to 60 ° c . depending on the type of gas . under various temperature conditions , without using grease or solid lubricant , the torque of the drive shaft 16 can be reduced compared with the case where dry air is not allowed to flow . in the sixth embodiment , nitrogen gas is supplied to the bearing portions from the cylinder and thereafter is recovered , circulated and supplied thereto . in a seventh embodiment as illustrated in fig6 , an excess of supply gas is not recovered but is discharged to the air through a filter ( not illustrated ) from the communication hole 23 and the check valve . in this case , high - pressure air or the like subjected to dehumidification and dust removal may be used in place of nitrogen so that the torque of the drive shaft 16 can be reduced . as described above , it is effective that the gas supplied to the bearings is subjected to dehumidification as well as to dust removal . as a relative example , the same test as that in experimental example 1 or 4 was performed using polyether ether ketone ( peek ) not containing fiber or the like . the results showed the same friction coefficient and wear - depth as those in damp air also in the case where nitrogen was supplied as dry gas . as described above , in the case where the bearing made of resin containing carbon fiber or glass having property similar to carbon fiber is used , the conditions of the sliding portion is controlled . thus , the resin sliding portion in which it is not necessary to supply oil , grease , solid lubricant , etc . thereto can be obtained .	5
fig1 schematically shows a shows a cellular telephony system 1 comprising a first portable telecommunications device 2 coupled to a second telecommunications device 3 , the devices being suitable for at least telephony speech traffic . in the example given the first device 2 is the operated by a calling party and the second device 3 is operated by a called party receiving an incoming call from the calling party . the device 3 can be arranged for supporting calling line identification , well - known in the art . the cellular system comprises radio zones 4 , 5 , 6 covered by radio base stations 7 , 8 , and 9 which are coupled to a public switched telephone network 10 via a mobile switching centre 11 . the calling party can also be a fixed network subscriber of the public switched telephone network 10 . fig2 shows a perspective view of the portable telecommunications device 3 according to the present invention . the device 3 is a portable cellular telephone powered by a rechargeable battery pack 20 . the user interface of the telephone 3 comprises a liquid crystal display 21 , a keypad 22 comprising two sets of keys 23 and 24 of alphanumeric keys associated with alphanumeric data , particularly for dialling of telephone numbers and of function keys for enabling predetermined functions or operations , respectively . according to the present invention a first key 25 is provided for initiating transmission of waiting messages to a calling party when receiving an incoming call , after the telephone call is put in a hold mode , and a second key 26 is provided for halting the transmission of waiting messages and putting the telephone 3 in a normal conversation mode . all functionality is controlled by programmed means to be shown in a block diagram of the telephone , in fig3 . the contents of the waiting message , which can be pre - recorded by the manufacturer of the telephone , or , which can be recorded by means of a phone &# 39 ; s microphone 27 . the telephone 3 can be arranged to support calling line identification , well - known in the art . then , the identification of the calling party is displayed on the display 21 when receiving a call . fig3 shows a block diagram of the portable telecommunications device 3 according to the present invention . the device 3 comprises a reception path and a transmission path coupled to an antenna switch 30 . the reception path comprises a cascade of a tuneable rf - filter 31 , a mixer 32 , a switchable if - filter 33 , a detector 34 , a tdma ( time division multiple access ) controller 35 , a speech codec 36 , and a speaker 37 . the transmission path comprises a cascade of the microphone 27 , the speech codec 36 , the tdma controller 35 , a modulator 38 , an offset oscillator 39 , a mixer 40 , and a power amplifier 41 . a microprocessor 42 is provided for controlling the functionality of the telephone 3 . conventional functionality such as controlling a synthesizer 43 so as to tune to a specific frequency channel , controlling the tdma controller 35 , scanning the keypad 22 , and controlling the display 21 is not described in further detail here , such functioning being well - known in the art . a memory 44 including a non - volatile memory part 45 and a volatile memory part 46 is coupled to the microprocessor 42 . the non - volatile memory part 45 comprises a telephone functionality program and at least one stored waiting message according to the present invention . for alerting the called party alerting means 47 is provided which can be an audible alert , vibration means , or both . a vibration means has the advantage that persons in the vicinity of the called party are not disturbed by a audible alert . fig4 shows a waiting message 50 having the contents “ please , wait a moment ”. if the called party receives an incoming call , he is made aware of this call by the alerting means 47 . if the called party presses the first key 25 , the call is put on hold and the microprocessor periodically retrieves the message 50 from the memory 45 , and periodically forwards the message 50 via the transmission path to the calling party . during transmission of the waiting messages the microphone 27 can be muted , and the alert means are switched off . in the meanwhile , the called party can move to another place from where he wants to make the conversation . after having arrived at the desired location the called party presses the key 26 . then the device 3 enters normal conversation mode and the conversation can be made . the device 3 may also comprise speech recognition means for recognising spoken commands . such speech recognition means can be used , among other use , for recognising a waiting message command such as “ set phone to waiting ”. particularly when miniaturising cellular phones it would be cumbersome to have many additional keys . by using speech recognition , no extra keys are needed for the waiting message procedure . the microprocessor is suitably programmed to carry out the above functionality . fig5 shows a flowchart for illustrating the operation of a preferred method according to the present invention , whereby the portable device is menu driven and the called party has set the portable device in announcement on answer mode so as to transmit waiting messages to the calling party when receiving an incoming call . in the flowchart , respective blocks 60 , 61 , 62 , 63 , 64 , 65 , 66 , 67 , 68 , 69 , and 70 have the following meaning : 60 : “ reception of an incoming call ”, 61 : “ start alerting , in particular ringing or vibrating ”, 62 : “ press any key and check whether a normal conversation answering mode is selected or an announcement of waiting messages answering mode , 63 : “ initiate processing of the incoming call in normal answering mode because a hook key was pressed ”, 64 : “ stop ringing ”, 65 : “ establish communication ”, 66 : “ initiate announcement on answering mode because any other key than the hook key was pressed , periodically transmit waiting messages after having set the incoming call on hold and after having halted alerting ”, 67 : “ check whether a predetermined time - out period , 30 seconds , for instance , has lapsed ”, 68 : “ if so , initiate start alerting ”, 69 : “ if not , check whether the hook key has been pressed ”. if the hook key has not been pressed check lapse of the time out period again . if the hook key has been pressed : 70 : “ halt transmission of waiting messages and go to 65 : “ establish communication ”. fig6 shows a cordless telephone system 80 according to the present invention comprising a cordless radio base station 81 coupled to the public switched telephone network , and cordless handsets 82 and 83 . in an embodiment of the cordless telephone system according to the present invention , the radio base station 80 comprises means 84 for recording , storage , and generation of waiting messages . shown is a radio link 85 between the radio base station 81 and the portable device 82 . when receiving an incoming call , the portable device 82 initiates starting and halting of the transmission of waiting messages when the announcement on answering mode has been set . stating is initiated by the portable device 82 by transmitting a waiting message transmission activation message 86 to the radio base station 81 , and halting is initiated by transmitting a waiting message transmission halting message 87 to the radio base station 81 . the cordless telephone system 80 can be a dect ( digital european cordless telecommunications ) system as standardised by etsi ( european telecommunications standards institute ). in view of the foregoing it will be evident to a person skilled in the art that various modifications may be made within the spirit and the scope of the present invention as hereinafter defined by the appended claims and that the present invention is thus not limited to the examples provided . after a predetermined lapse of time after the beginning of the transmission of waiting messages the initially transmitted message could be replaced by a message like “ please , keep waiting , my phone is still connected to you but i will need some more time to find a suitable room for answering you ”. herewith , it is possibly avoided that the calling party becomes impatient and hangs up . such a variation and similar variations are within the scope of the present invention .	7
a detailed description of the preferred embodiment of the present invention will now be described with reference to fig1 . the framing structure of the present invention , referred to generally with a reference numeral 10 , has a lower frame portion 20 , four vertical telescoping masts 30 having lower ends connected to the lower frame portion 20 , and a roof frame portion 40 attached to the upper ends of the vertical masts 30 . the lower frame portion 20 has two parallel longitudinally extending beams 22 and two parallel transverse beams 24 connecting the longitudinally extending beams 22 so that the lower frame portion 20 is in the form of a horizontal rectangle . one of the upwardly telescoping masts 30 is attached near each end of the two longitudinally extending beams 22 in such a way that four planes defined by the masts 30 form a rectangular box . the masts 30 are of a winch type of upwardly telescoping masts such as those available from the sumner manufacturing company , inc . of houston , tx under the name roust - a - bout . the roof frame portion 40 is attached to the upper ends of the vertical masts 30 and can be raised , lowered , or pitched with the masts 30 . the roof frame portion 40 has four transverse telescoping roof beams 42 , two of which traverse the top end of two of the four masts 30 with the other two traversing the top ends of the other two masts 30 . a description of the connections between the transverse roof beams 42 and the upper ends of the masts 30 is given below in the discussion of fig2 . a plurality of longitudinal roof beams 44 , preferably three , traverse the transverse roof beams 42 . preferably the longitudinal beams 44 are welded to the transverse beams 42 . the telescoping ends 46 of each pair of transverse roof beams 42 telescope in opposite directions . two longitudinal rafter beams 48 are each attached to the telescoping ends 46 of the transverse roof beams 42 which telescope in the same direction . details of the connections between the telscoping ends 46 and the longitudinal rafter beams 48 is given in the discussion of fig4 below . four transverse telescoping intermediate beams 52 are attached in pairs to the non - telescoping portions of the masts 30 with one pair traversing two masts 30 with the other pair traversing the other two masts 30 with the telescoping portions 56 of each pair telescoping in opposite directions . preferably , the telescoping intermediate beams 52 are welded to the vertical masts 30 . the longitudinal intermediate beams 58 are each attached to the telescoping ends 56 of two telescoping intermediate beams 52 which telescope in the same direction . the connections of the longitudinal intermediate beams to the telescoping portion 56 of the intermediate beams 52 will be described in detail below with reference to fig4 . in the preferred embodiment of the present invention jacking means are attached to the lower frame portions 20 to raise , lower , or stabilize the framing structure 10 . four jacks 60 , well known in the art , are each attached near the four corners of the lower frame portion 20 . preferably , a transverse telescoping lower beam 62 which telescopes in both directions is rigidly attached to the lower frame portion 20 with two of the four jacks 60 rigidly attached to the respective telescoping portions of the transverse lower beam 62 . thus , at least two of the jacks 60 can be transversely extended to increase the stability of the framing structure 10 . reference is now made to fig2 which illustrates the connection of each transversely telescoping roof beams 42 to the upper end of each corresponding vertical masts 30 . here , the top end of a tube 32 , dimensioned to fit within each vertical mast 30 , is attached to a horizontal plate 34 which prevents the tube 32 from falling through the vertical mast 30 . a pair of vertical parallel plates 36 , 36 &# 39 ; is attached to the upper face of the horizontal plate 34 with aligned bores 38 , 38 &# 39 ; through both vertical plates 36 , 36 &# 39 ;. a vertical pivot plate 41 is pivotally sandwiched between the pair of vertical plates 36 , 36 &# 39 ; and connected by way of a pin 39 which passes through both aligned bores 38 , 38 &# 39 ; through the pair of parallel vertical plates 36 , 36 &# 39 ; and an aligned bore 43 through the vertical pivot plate 41 . the upper end of the vertical pivot plate 41 is attached to a horizontal sliding plate 45 which slides within a horizontal track 47 connected to the bottom faces of the transversely telescoping roof beams 42 . referring to fig1 in conjunction with fig2 as the roof frame portion 40 is sloped , the distance between the corresponding top ends of the vertical masts 30 increases , just as the hypotenuse of a triangle increases as one of its legs increases . thus , as the roof frame portion 40 is sloped by raising corresponding vertical masts 30 , the sliding plate 45 slides within the track 47 to account for the increased distance between the top ends of the vertical masts 30 . reference is now made to fig3 which illustrates a corresponding track 47 above each vertical mast ( not shown ). each track 47 is in the form of an &# 34 ; l &# 34 ; with each leg of the &# 34 ; l &# 34 ; protruding outward relative to the roof frame portion 40 . when the roof frame portion 40 is completely horizontal , each sliding plate 45 is located near the apex of each track 47 . the legs of the tracks 47 in which the sliding plates 45 will slide depends upon the slope of the roof frame portion 40 . if the roof frame portion 40 has a longitudinal pitch , the sliding plates 45 will slide within the legs of the tracks 47 which protrude longitudinally . if the roof frame portion 40 is pitched transversely , the sliding plates 45 will slide within the legs of the channels 47 which protrude transversely outward . referring again to fig2 it is noted that the sliding plate 45 and the pivot plate 43 pivot about a single axis . thus , the entire joint assembly must be rotated within each vertical mast 30 to align the pivot axis so that the slope of each sliding plate 45 corresponds with the slope of the roof frame portion 40 as well as the slope of each horizontal track 47 . a pressure pin 31 is provided through the vertical mast 30 to lock the joint assembly once it is in the desired position . additionally , pressure pins 33 are provided through the top of the tracks 47 in order to lock the sliding plates 45 to the tracks 47 once the sliding plates 45 are in a desired position . reference is now made to fig4 and 5 which illustrate the connections of the longitudinal rafter beams 48 to the telescoping portions 46 of the transversely telescoping roof beams 42 as well as the connections between the intermediate longitudinal beams 58 and the telescoping portions 56 of the transversely telescoping intermediate beams 52 . here , if a longitudinal beam 48 ( 58 ) is projected at an angle , the distance between the ends of the telescoping portions 46 ( 56 ) increases just as the hypotenuse of a right triangle increases as one of its legs increases . thus , the connection between the longitudinal beams 48 ( 58 ) and the telescoping portions 46 ( 56 ) must accommodate this increase in distance . this is accomplished by providing slots 53 near both ends of each longitudinal beams 48 ( 58 ) in which vertical pins 55 passing through the slots 53 pivotally connects the longitudinal beams 48 ( 58 ) to the telescoping portion 46 ( 56 ) of the transversely telescoping beams 42 ( 52 ). thus , the longitudinal beams 48 ( 58 ) are slidably and pivotally connected to the telescoping portions 46 ( 56 ) to effectively increase the length of the longitudinal beams 48 ( 58 ) when the distance between the ends of the corresponding telescoping portions 46 ( 56 ) increases . additionally , once the beams are in their desired position the pins 55 can be locked down by nuts 57 at each end of each pin , or other means well known in the art to provide a rigid structure . reference is now made to fig6 which illustrates the framing structure of fig1 provided with wheels 105 so that the framing structure 10 can be easily transported from one site to another site . additionally , a telescoping wheel structure 107 , well known in the art , can be provided near the front of the framing structure to stabilize the framing structure 10 when it is supported by its wheels 105 rather than its jacking means . a towbar 108 , well known in the art , is also provided near the front of the framing structure 10 so that the framing structure can be pulled by an appropriate vehicle . bracing beams 27 having one end attached to the lower frame portion 20 and another end attached to the vertical masts 30 can be provided to increase the structural strength of the framing structure 10 . in one embodiment of the present invention the framing structure in its retracted position is approximately 24 feet long , 8 feet high , and 8 feet wide . it is capable of expanding to nearly 24 feet high and 24 feet wide . thus , a wide range of various size buildings can be constructed with the same framing structure . reference is now made to fig7 which illustrates a framing structure similar to the framing structure 10 of fig1 . in this embodiment , longitudinal roof beams 44 are cut and provided with internal splicing beams 144 over which the longitudinal roof beams 44 can slide to effectively increase the length of the roof frame portion 40 as it is sloped longitudinally . the transversely telescoping roof beams 42 are also severed and provided with splicing bars 142 over which the transversely telescoping roof beams 42 slide to effectively increase the width of the roof frame portion 40 as it is sloped transversely . additionally , instead of the track - sliding plate connection of fig2 the roof frame portion 40 is connected to the upper ends of the telescoping beams 30 by way of ball joints or the like so that the roof frame portion can have either a single slope or a double slope without a need for changing the joint . thus , the roof frame portion could be sloped both longitudinally and transversely at the same time . reference is made to fig8 which illustrates a cross - sectional view of a transversely telescoping roof beam 42 with the splicing bar 142 and the telescoping portion 46 . here , each member is dimensioned so that the telescoping portion 46 can slide within the splicing beam 142 which can slide within the transversely telescoping roof beam 42 . pressure pins 143 are provided to lock the members together once they are in the desired position . reference is now made to fig9 which shows a three - dimensional wire matrix panel 70 which is attached to the outside of the framing structure 10 , once the members of the framing structure 10 have been extended to the desired size and shape of the building to be constructed . the wire matrix panel 70 has a polyurethane insulation core 72 with the wire matrix 74 protruding from both faces of the insulation core 72 . panels of this type can be obtained from truss - tech building systems of fontana , ca . fluent concrete 76 , or the like , is then introduced to the outside faces of the wire matrix panels 70 thus forming a reinforced concrete structure . reference is now made to fig1 which shows the attachment of a wire matrix panel 70 to the framing structure 10 . the panel 70 can be removably attached to the framing structure 10 by elastic hooked cords 78 well known in the art . the cords 78 are hooked at one end to the inside face of the panel 70 , wrapped over a member of the framing structure 10 , and hooked at the other end to another portion of the panel 70 . once the panels are in place , fluent concrete , or the like , can be introduced , preferably under pressure by spraying to the outside faces of the panel 70 . after the concrete has hardened in situ the cords 78 can be disconnected and the framing structure 10 can be retracted within the building . one of the walls of the building must remain unassembled until the framing structure 10 is removed . once the framing structure 10 has been removed , the final wall can be assembled and fluent concrete or the like can be introduced to the inside surfaces of the panels 70 . additionally , windows , doors and other openings can be provided in buildings formed by the framing structure 10 by refraining from placing panels 70 where such openings are desired . fig1 through 26 , while not comprehensive , show numerous shaped buildings that can be constructed with the present invention . reference is made to fig1 and 12 which illustrate a rectangular building 90 constructed with a single framing structure similar to the framing structure 10 of fig1 . fig1 and 14 illustrate a building 90 having a pitched roof , formed by a single framing structure similar to the framing structure 10 of fig1 . the pitched roof is formed by raising two masts 30 which are on a single longitudinal side . fig1 and 16 illustrate a building having non - parallel vertical walls . this shape can be accomplished by outwardly telescoping a pair of transversely telescoping roof beams and a pair of transversely telescoping intermediate beams 52 which traverse the same masts 30 such that the longitudinal rafter beams 48 are parallel with the corresponding intermediate beams 58 . fig1 and 18 show a building 90 having a horizontal roof portion 92 , two pitched side roof portions 94 , and two vertical side walls 96 . this shape can be accomplished with a single framing structure , similar to the framing structure 10 shown in fig1 by retracting the transversely telescoping roof beams 44 and outwardly telescoping the transversely telescoping intermediate beams 52 . fig1 and 20 show a rectangular building having a longitudinally pitched roof . the shape of this building 90 can be accomplished with a single framing structure 10 , as shown in fig1 by upwardly telescoping two masts 30 on a single transverse side . fig2 and 22 show a building 90 having a gabled roof . this shape can be accomplished by two framing structures similar to the framing structure 10 of fig1 . here , two framing structures 10 are placed side by side with each roof portion 40 sloped outward . fig2 and 24 show an l - shaped building 90 similar to the framing structure 10 of fig1 . here , two framing structures 10 are positioned in the form of an &# 34 ; l &# 34 ;. fig2 and 26 illustrate a tall building 90 formed with two framing structures similar to the framing structure 10 of fig1 . here , the framing structures 10 are stacked one on top of the other and the members of the structures are extended to form the desired shape of the building 90 . while the principles of the invention have now been made clear in an illustrative embodiment , it will become obvious to those skilled in the art that many modifications in structure , arrangement , portions , materials and components may be used in the practice of the invention and which are otherwise particularly adapted for specific building requirements without departing from those principles . the appended claims are therefore intended to cover and embrace any such modifications , within the limits of only the true spirit and scope of the invention .	4
the following detailed description refers to the accompanying drawings . the same reference numbers in different drawings may identify the same or similar elements . systems and / or methods described herein may integrate resource routing into an infrastructure of a core network , such as a service provider network , by adding application level intelligence in an edge network device of the core network . the application level intelligence may include an application proxy that terminates connections for a given application associated with all or a subset of client device requests for resources . for each resource request , the application proxy may determine a target server that stores resources , may connect to the determined server , and may proxy the resource request and a returned resource between the client device and the determined server . in an example implementation , the systems and / or methods may receive , from a client device , a request for a resource , and may determine , based on ip information of the request , whether to terminate a connection for the request . if the connection for the request is not terminated , the request may be forwarded to a core network , such as a service provider network , for additional routing . if the connection for the request is terminated , a target source device for the resource may be determined , and the request may be provided to the determined target source device . the resource may be received from the target source device , and may be provided to the client device . fig1 is a diagram of an example network 100 in which systems and / or methods described herein may be implemented . as illustrated , network 100 may include a client device 110 ; a cache server device 120 ( referred to herein as “ cache server 120 ”); an origin device 130 , a routing broker server device 140 ( referred to herein as “ routing broker server 140 ”); another device 150 ; a network 160 ; and a network device 170 provided in or attached to network 160 . a shown in fig1 , network device 170 may include an application proxy 172 and a local cache 174 . devices of network 100 may interconnect via wired and / or wireless connections or links . a single client device 110 , cache server 120 , origin device 130 , routing broker server 140 , other device 150 , network 160 , and network device 170 have been illustrated in fig1 for simplicity . in practice , there may be additional client devices 110 , cache servers 120 , origin devices 130 , routing broker servers 140 , other devices 150 , networks 160 , and / or network devices 170 . also , in some instances , one or more of the devices of network 100 may perform one or more tasks described as being performed by another one or more of the devices of network 100 . client device 110 may include any device that is capable of accessing cache server 120 , origin device 130 , and / or other device 150 via network 160 and / or network device 170 . for example , client device 110 may include a radiotelephone , a personal communications system ( pcs ) terminal that may combine a cellular radiotelephone with data processing and data communications capabilities , a personal digital assistant ( pda ) that can include a radiotelephone , a pager , internet / intranet access , etc ., a wireless device ( e . g ., a wireless telephone ), a smart phone , a workstation computer , a laptop computer , a personal computer , or another type of computation or communication device . cache server 120 may include one or more server devices , or other types of computation or communication devices , that gather , process , search , and / or provide information in a manner described herein . in one example implementation , cache server 120 may act as an intermediary for requests from client device 110 seeking resources from origin device 130 . the term resources , as used herein , is intended to be broadly construed to include content , such as video , audio , images , software downloads , etc . ; services , such as delivering high - definition and user - generated content , consumer and business news and information services , an email system , etc . ; and / or a combination of content and services . client device 110 may connect to cache server 120 , via network 160 and / or network device 170 , and may request some resource available from origin device 130 . cache server 120 may evaluate the request ( e . g ., according to filtering rules , such as filtering traffic by ip address or protocol ). if the request is validated , cache server 120 may provide the requested resource by connecting to origin device 130 and requesting the resource on behalf of client device 110 . cache server 120 may serve the request without contacting origin device 130 . in this case , cache server 120 may cache ( or store ) a particular resource previously requested from origin device 130 , and may provide the particular resource to client device 110 , via network device 170 , without involving origin device 130 . origin device 130 may include one or more server devices , or other types of computation or communication devices , that gather , process , search , and / or provide resources in a manner described herein . in one example implementation , origin device 130 may include resources that may be accessed by client device 110 via network 160 and / or network device 170 . in one example , origin device 130 may provide resources to client device 110 ( e . g ., via network 160 and / or network device 170 ). alternatively , origin device 130 may provide particular resources to cache server 120 for storage . cache server 120 may store the particular resources so that cache server 120 may provide the particular resources to client device 110 , when requested by client device 110 , and without involving origin device 130 . routing broker server 140 may include one or more server devices , or other types of computation or communication devices , that gather , process , search , and / or provide information in a manner described herein . in one example implementation , routing broker server 140 may receive information from a variety of sources , and may store the information . for example , routing broker server 140 may receive information from local cache 174 ( e . g ., information about the availability of local cache 174 , information identifying resources stored in local cache 174 , etc . ); information from network 160 ( e . g ., information about the availability of network 160 and / or network device 170 , network topology and costs , etc . ); information from cache server 120 ( e . g ., information about the availability of cache server 120 , information identifying resources stored in cache server 120 , etc . ); information from other device 150 ( e . g ., information about the availability of other device 150 , information identifying resources stored by other device 150 , application - layer traffic optimization ( alto ) service ( e . g ., as set forth in request for comments ( rfc ) 5693 ) information identifying servers with resources provided by service providers other than the service provider associated with network 100 , etc . ); and / or information from origin device 130 ( e . g ., information about the availability of origin device 130 , information identifying resources stored in origin device 130 , etc .). in one example , network device 170 may query routing broker server 140 for a location of a target device to serve resource request ( e . g ., provided by client device 110 ). routing broker server 140 may receive the query , may determine the target device to serve the resource request , and may provide location information , such as an ip address , of the target device to network device 170 . for example , routing broker server 140 may receive the query from network device 170 , and may determine that origin device 130 is the target device since origin device 130 is the closest device with the requested resource . accordingly , routing broker server 140 may provide location information , such as an ip address , of origin device 130 to network device 170 . other device 150 may include one or more server devices , or other types of computation or communication devices , that gather , process , search , and / or provide information in a manner described herein . in one example implementation , other device 150 may be associated with federated service provider networks that provide resources to network 100 in case of failure of network 100 or components of network 100 . other device 150 may store alto service information identifying servers with resources provided by such federated service provider networks . in an example implementation , other device 150 may include resources that may be accessed by client device 110 via network 160 and / or network device 170 , in the event of failure of network 100 or components of network 100 . network 160 may include a service provider network , such as a local area network ( lan ); a wide area network ( wan ); a metropolitan area network ( man ); a telephone network ( e . g ., the public switched telephone network ( pstn ) or a cell network ); the internet ; or a combination of networks . network device 170 may include a traffic transfer device , such as a gateway , a router , a switch , a firewall , a network interface card ( nic ), a hub , a bridge , a proxy server , an optical add - drop multiplexer ( oadm ), or some other type of device that processes and / or transfers traffic ( e . g ., packets ). in one implementation , network device 170 may be an edge network device that provides an entry point to or an exit point from network 160 . in one example , network device 170 may enable client device 110 , cache server 120 , origin device 130 , routing broker server 140 , and / or other device 150 to communicate with one another . in another example , network device 170 may enable client device 110 to request and receive resources from cache server 120 , origin device 130 , and / or other device 150 . as further shown in fig1 , network device 170 may include application proxy 172 and local cache 174 . application proxy 172 may terminate connections for a given application associated with all or a subset of client device 110 requests for resources . application proxy 172 may receive the resource requests substantially concurrently , at different times , etc . for each resource request , application proxy 172 may determine a target server ( e . g ., cache server 120 , origin server 130 , other device 150 , or local cache 174 ) that stores resources . application proxy 172 may connect to the determined server , and may proxy the resource request and a returned resource between client device 110 and the determined server . in an example implementation , application proxy 172 may receive , from client device 110 , a request for a resource , and may determine , based on ip information of the request , whether to terminate a connection for the request . if application proxy 172 determines that the connection for the request should not be terminated , application proxy 172 may forward the request to network 160 for additional routing . if application proxy 172 determines that the connection for the request should be terminated , application proxy 172 may terminate the connection for the request , and may determine a target source device ( e . g ., cache server 120 , origin server 130 , other device 150 , or local cache 174 ) for the resource . application proxy 172 may provide the request to the determined target source device , may receive the resource from the target source device , and may provide the resource to client device 110 . local cache 174 may include one or more storage devices , such as magnetic and / or optical recording media and their corresponding drives , removable memory , a random access memory ( ram ), a read only memory ( rom ), etc . in one example implementation , local cache 174 may store resources that may be accessed by client device 110 . local cache 174 may store the resources so that local cache 174 may provide the resources to client device 110 , when requested by client device 110 , and without involving cache server 120 , origin device 130 , and / or other device 150 . further details of network device 170 , application proxy 172 , and local cache 174 are provided below in connection with , for example , fig3 - 9 . although fig1 shows example devices of network 100 , in other implementations , network 100 may include fewer devices , different devices , differently arranged devices , or additional devices than depicted in fig1 . fig2 is a diagram of example components of a device 200 that may correspond to client device 110 , cache server 120 , origin device 130 , routing broker server 140 , or other device 150 ( fig1 ). in some instances , device 200 may also correspond to network device 170 ( fig1 ). each of client device 110 , cache server 120 , origin device 130 , routing broker server 140 , other device 150 , or network device 170 may include one or more devices 200 . as illustrated in fig2 , device 200 may include a bus 210 , a processing unit 220 , a main memory 230 , a rom 240 , a storage device 250 , an input device 260 , an output device 270 , and / or a communication interface 280 . bus 210 may include a path that permits communication among the components of device 200 . processing unit 220 may include one or more processors , microprocessors , application - specific integrated circuit ( asics ), field - programmable gate arrays ( fpgas ), or other types of processing units that interpret and execute instructions . main memory 230 may include a ram or another type of dynamic storage device that stores information and instructions for execution by processing unit 220 . rom 240 may include a rom device or another type of static storage device that stores static information and / or instructions for use by processing unit 220 . storage device 250 may include a magnetic and / or optical recording medium and its corresponding drive , or a removable memory , such as a flash memory . input device 260 may include a mechanism that permits an operator to input information to device 200 , such as a keyboard , a mouse , a switch , a button , voice recognition and / or biometric mechanisms , a touch screen , etc . output device 270 may include a mechanism that outputs information to the operator , including a display , a speaker , a light emitting diode ( led ), etc . communication interface 280 may include any transceiver - like mechanism that enables device 200 to communicate with other devices and / or systems . for example , communication interface 280 may include mechanisms for communicating with another device or system via a network . in one implementation , communication interface 280 may include a wired interface , such as an ethernet interface , or a wireless interface , such as radio frequency interface . as described herein , device 200 may perform certain operations in response to processing unit 220 executing software instructions contained in a computer - readable medium , such as main memory 230 . a computer - readable medium may be defined as a non - transitory memory device . a memory device may include space within a single physical memory device or spread across multiple physical memory devices . the software instructions may be read into main memory 230 from another computer - readable medium , such as storage device 250 , or from another device via communication interface 280 . the software instructions contained in main memory 230 may cause processing unit 220 to perform processes described herein . alternatively , hardwired circuitry may be used in place of or in combination with software instructions to implement processes described herein . thus , implementations described herein are not limited to any specific combination of hardware circuitry and software . although fig2 shows example components of device 200 , in other implementations , device 200 may include fewer components , different components , differently arranged components , or additional components than depicted in fig2 . alternatively , or additionally , one or more components of device 200 may perform one or more other tasks described as being performed by one or more other components of device 200 . fig3 is a diagram of example components of a device 300 that may correspond to network device 170 ( fig1 ). in some instances , network device 170 may include one or more devices 300 . as shown in fig3 , device 300 may include input components 310 , a switching / routing mechanism 320 , output components 330 , and a control unit 340 . input components 310 may be a point of attachment for physical links and may be a point of entry for incoming traffic , such as packets . input components 310 may process incoming traffic , such as by performing data link layer encapsulation or decapsulation . in an example implementation , input components 310 may send and / or receive packets . switching / routing mechanism 320 may interconnect input components 310 with output components 330 . switching / routing mechanism 320 may be implemented using many different techniques . for example , switching / routing mechanism 320 may be implemented via busses , via crossbars , and / or with shared memories . the shared memories may act as temporary buffers to store traffic from input components 310 before the traffic is eventually scheduled for delivery to output components 330 . output components 330 may store packets and may schedule packets for service on output physical links output components 330 may include scheduling algorithms that support priorities and guarantees . output components 330 may support data link layer encapsulation and decapsulation , and / or a variety of higher - level protocols . in an example implementation , output components 330 may send packets and / or receive packets . control unit 340 may use routing protocols and one or more forwarding tables for forwarding packets . control unit 340 may connect with input components 310 , switching / routing mechanism 320 , and output components 330 . control unit 340 may compute a forwarding table , implement routing protocols , and / or run software to configure and manage device 300 . control unit 340 may determine routing for any packet whose destination address may not be found in the forwarding table . in an example implementation , control unit 340 may include a bus 350 that may include a path that permits communication among a processor 360 , a memory 370 , and a communication interface 380 . processor 360 may include one or more processors , microprocessors , asics , fpgas , or other types of processing units that may interpret and execute instructions . memory 370 may include a ram , a rom device , a magnetic and / or optical recording medium and its corresponding drive , and / or another type of static and / or dynamic storage device that may store information and instructions for execution by processor 360 . memory 370 may also temporarily store incoming traffic ( e . g ., a header of a packet or an entire packet ) from input components 310 , for processing by processor 360 , before a packet is directed back to switching / routing mechanism 320 , transported by switching / routing mechanism 320 , and eventually scheduled to be sent to output components 330 . communication interface 380 may include any transceiver - like mechanism that enables control unit 340 to communicate with other devices and / or systems . as described herein , device 300 may perform certain operations in response to processor 360 executing software instructions contained in a computer - readable medium , such as memory 370 . the software instructions may be read into memory 370 from another computer - readable medium , such as a data storage device , or from another device via communication interface 380 . the software instructions contained in memory 370 may cause processor 360 to perform processes described herein . alternatively , hardwired circuitry may be used in place of or in combination with software instructions to implement processes described herein . thus , implementations described herein are not limited to any specific combination of hardware circuitry and software . for example , switching / routing operations of device 300 may be controlled via external agents using routing protocols ( e . g ., bgp ). although fig3 shows example components of device 300 , in other implementations , device 300 may include fewer components , different components , differently arranged components , or additional components than depicted in fig3 . alternatively , or additionally , one or more components of device 300 may perform one or more other tasks described as being performed by one or more other components of device 300 . fig4 is a diagram of example operations capable of being performed by an example portion 400 of network 100 . as shown , example network portion 400 may include client device 110 , network device 170 , and application proxy 172 . client device 110 , network device 170 , and application proxy 172 may include the features described above in connection with , for example , one or more of fig1 - 3 . as shown in fig4 , client device 110 may provide a request 410 for a resource to network device 170 , and network device 170 may receive request 410 via application proxy 172 . application proxy 172 may receive request 410 , and may determine , based on information provided in request 410 , whether to terminate a connection ( e . g ., a transmission control protocol ( tcp ) connection ) for request 410 at network device 170 . in one example , the information provided in request 410 may include ip information , such as a destination ip address of request 410 , an ip address of client device 110 ( i . e ., a source ip address of request 410 ), a destination port ( e . g ., a network address translation ( nat )) of request 410 , etc . in one implementation , application proxy 172 may extract the destination ip address from request 410 , may extract the ip address of client device 110 from request 410 , and / or may extract the destination port from request 410 . application proxy 172 may determine , based on the extracted destination ip address , client device 110 ip address , and / or destination port , whether to terminate the connection for request 410 at network device 170 . as further shown in fig4 , if application proxy 172 decides to terminate the connection for request 410 , based on the information provided in request 410 , application proxy 172 may provide , to client device 110 , an indication 420 that the connection is terminated . if application proxy 172 decides to not terminate the connection for request 410 , based on the information provided in request 410 , application proxy 172 may provide , to client device 110 , an indication 430 that the connection is not terminated , and may forward request 410 to network 160 for additional routing , as indicated by reference number 440 . in one example implementation , application proxy 172 may terminate connections ( e . g ., tcp connections ) for a given application and for all or a subset of resource requests received from client device 110 . in another example implementation , indication 430 may be omitted since request 410 may be terminated by another downstream device . in one implementation , application proxy 172 may maintain or access a table ( or other data structure ) that provides a list of applications , client device ip addresses , source device ip addresses , etc . the information provided in table may be input by a network administrator to network device 170 , may be generated by application proxy 172 based on prior traffic provided to or received by network device 170 , etc . for example , if network device 170 receives a particular number of requests ( e . g ., that it greater than a threshold ) from a particular client device 110 , application proxy 172 may add the ip address of client device 110 to the table . in another example , if network device 170 retrieves a particular number resources ( e . g ., that is greater than a threshold ) from a particular server , application proxy 172 may add the ip address of the particular server to the table . application proxy 172 may compare the information provided in request 410 to the information provided in the table , and may decide to terminate the connection for request 410 when the information provided in request 410 matches one or more items of information provided in the table . in one implementation , application proxy 172 may establish rules to determine whether to terminate a connection ( e . g ., if there is one match in the table , then terminate the connection ; if there are two or more matches in the table then terminate the connection , etc .). in one example , if request 410 includes a destination ip address of origin device 130 and the table includes the destination ip address of origin device 130 , application proxy 172 may decide to terminate the connection for request 410 . in another example , if request includes a destination ip address of cache server 120 but does not include the ip address of client device 110 , application proxy 172 may decide to not terminate the connection for request 410 . although fig4 shows example components of network portion 400 , in other implementations , network portion 400 may include fewer components , different components , differently arranged components , or additional components than depicted in fig4 . alternatively , or additionally , one or more components of network portion 400 may perform one or more other tasks described as being performed by one or more other components of network portion 400 . fig5 a and 5b are diagrams of further example operations capable of being performed by an example portion 500 of network 100 . as shown in fig5 a and 5b , example network portion 500 may include client device 110 , cache server 120 , origin device 130 , routing broker server 140 , other device 150 , network 160 , and network device 170 . client device 110 , cache server 120 , origin device 130 , routing broker server 140 , other device 150 , network 160 , and network device 170 may include the features described above in connection with , for example , one or more of fig1 - 4 . as further shown in fig5 a , routing broker server 140 may receive information from one or more sources of network portion 500 . for example , local cache 174 may provide local cache information 510 to routing broker server 140 . local cache information 510 may include information about the availability of local cache 174 , information identifying resources stored in local cache 174 , information about the size of local cache 174 , etc . in another example , network 160 may provide network information 520 to routing broker server 140 . network information 520 may include information about the availability of network 160 and / or components of network 160 , topology and costs associated with network 160 , bandwidth available to network 160 , preferred client devices of network 160 , etc . in still another example , cache server 120 may provide cache information 530 to routing broker server 140 . cache information 530 may include information about the availability of cache server 120 , information identifying resources stored in cache server 120 , information about the load on cache server 120 , etc . in one example implementation , routing broker server 140 may enable new cache servers to be added to network 100 without having to explicitly configure the new cache servers into the routing decision , as is required by existing schemes . the new cache servers may provide cache information ( e . g ., similar to cache information 530 ) to routing broker server 140 . in a further example , other device 150 may provide other device information 540 to routing broker server 140 . other device information 540 may include information about the availability of other device 150 , information identifying resources stored in other device 150 , information about the service provider ( s ) associated with other device 150 , alto service information identifying servers with resources provided by the service provider ( s ) associated with other device 150 , etc . in still a further example , origin device 130 may provide origin information 550 to routing broker server 140 . origin information 550 may include information about the availability of origin device 130 , information identifying resources stored in origin device 130 , information about the load on origin device 130 , etc . routing broker server 140 may receive local cache information 510 , network information 520 , cache information 530 , other device information 540 , and / or origin information 550 , and may store ( e . g ., in main memory 230 , rom 240 , and / or storage device 250 , fig2 ) local cache information 510 , network information 520 , cache information 530 , other device information 540 , and / or origin information 550 . as further shown in fig5 a , client device 110 may provide a request 560 for a resource to network device 170 , and network device 170 may receive request 560 via application proxy 172 . request 560 may include ip information , such as a destination ip address of request 560 , an ip address of client device 110 ( i . e ., a source ip address of request 560 ), a destination port of request 560 , etc . in one example , request 560 may include a http get request ( e . g ., requesting resources ), a domain name , and / or a uniform resource locator ( url ). application proxy 172 may receive request 560 , and may determine , based on information provided in request 560 , whether to terminate a connection for request 560 at network device 170 , as described above in connection with fig4 . if application proxy 172 terminates the connection for request 560 at network device 170 , application proxy 172 may determine a target source device for the resource requested by request 560 . application proxy 172 may determine the target source device in a number of ways . for example , as shown in fig5 b , application proxy 172 may provide a query 570 to routing broker server 140 . query 570 may include a request for a location of a target source device that stores the resource requested by request 560 . in one implementation , query 570 may include information associated with request 560 , such as the resource requested by request 560 , the domain name of request 560 , the url of request 560 , etc . routing broker server 140 may receive query 570 , and may determine , based on query 570 , the target source device for the resource requested by request 560 . in one example , routing broker server 140 may determine the target source device based on a variety of factors , such as conditions of network 160 ( e . g ., bandwidth of network 160 , load on network 160 , etc . ), a physical location of the target source device in relation to client device 110 ( e . g ., a device located closer to client device 110 may be selected before a device that is located further from client device 110 ), etc . after determining the target source device , routing broker server 140 may provide a location 580 ( e . g ., an ip address ) of the target source device to application proxy 172 . in one example , the domain name , included in request 560 , may be hosted by a particular server ( e . g ., origin device 130 ) while the url , included in request 560 , may identify a resource that is hosted by a different server ( e . g ., cache server 120 ). in such a scenario , routing broker server 140 may determine that cache server 120 is the target source device since the resource requested by request 560 is hosted by cache server 120 . in contrast , in dns - based systems , request 560 would be unnecessarily routed to origin device 130 first due to the domain name of request 560 . in one example implementation , prior to generating query 570 , application proxy 172 may determine whether the requested resource is stored in local cache 174 . in one example , application proxy 172 may maintain a table ( or other data structure ) that provides a list of resources stored in local cache 174 . application proxy 172 may scan the table to determine whether the requested resource is stored in local cache 174 . if application proxy 172 determines that the requested resource is stored in local cache 174 , application proxy 172 may retrieve the requested resource from local cache 174 . for example , application proxy 172 may provide request 560 to local cache 174 , and local cache 174 may retrieve a resource 590 requested by request 560 . local cache 174 may provide resource 590 to application proxy 172 , and application proxy 172 may forward resource 590 to client device 110 . if application proxy 172 determines that resource 590 is not stored in local cache 174 , application proxy 172 may provide query 570 to routing broker server 140 . application proxy 172 may receive , from routing broker server 140 and based on query 570 , location 580 of the target source device ( e . g ., cache server 120 , origin device 130 , and / or other device 150 ). application proxy 172 may utilize location 580 to connect with the target source device and to retrieve the requested resource from the target source device . as further shown in fig5 b , in one example , if location 580 identifies an ip address of cache server 120 , application proxy 172 may provide request 560 ( e . g ., which may include the ip address of client device 110 ) to cache server 120 , and cache server 120 may retrieve resource 590 requested by request 560 . cache server 120 may provide resource 590 to application proxy 172 , and application proxy 172 may forward resource 590 ( e . g ., which may include the ip address of cache server 120 ) to client device 110 . in another example , if location 580 identifies an ip address of origin device 130 , application proxy 172 may provide request 560 ( e . g ., which may include the ip address of client device 110 ) to origin device 130 , and origin device 130 may retrieve resource 590 requested by request 560 . origin device 130 may provide resource 590 to application proxy 172 , and application proxy 172 may forward resource 590 ( e . g ., which may include the ip address of origin device 130 ) to client device 110 . in still another example , if location 580 identifies an ip address of other device 150 , application proxy 172 may provide request 560 ( e . g ., which may include the ip address of client device 110 ) to other device 150 , and other device 150 may retrieve resource 590 requested by request 560 . other device 150 may provide resource 590 to application proxy 172 , and application proxy 172 may forward resource 590 ( e . g ., which may include the ip address of other device 150 ) to client device 110 . although fig5 a and 5b show example components of network portion 500 , in other implementations , network portion 500 may include fewer components , different components , differently arranged components , or additional components than depicted in fig5 a and 5b . alternatively , or additionally , one or more components of network portion 500 may perform one or more other tasks described as being performed by one or more other components of network portion 500 . for example , network device 170 , via application proxy 172 , may perform one or more functions ( e . g ., determining a target source device ) described as being performed by routing broker server 140 . fig6 is a diagram of still further example operations capable of being performed by an example portion 600 of network 100 . as shown , example network portion 600 may include client device 110 , cache server 120 , origin device 130 , other device 150 , network device 170 , application proxy 172 , and local cache 174 . client device 110 , cache server 120 , origin device 130 , other device 150 , network device 170 , application proxy 172 , and local cache 174 may include the features described above in connection with , for example , one or more of fig1 - 5b . in one implementation , fig6 may depict how network device 170 proxies requests from client device 110 to target source devices , and further proxies resources , retrieved from the target source devices , to client device 110 . by proxying the requests and the resources , network device 170 may ensure that client device 110 and the target source devices are transparent to each other or that cache server 120 is transparent to client device 110 and origin device 130 . for example , client device 110 may be transparent to origin device 130 because network device 170 may use its own ip address , or may spoof addresses of client device 110 and / or origin device 130 , to exchange information ( e . g ., packets ) between client device 110 and origin device 130 . in another example , network device 170 may use an ip address of client device 110 and / or origin device 130 to exchange information with cache server 120 ( i . e ., so that cache server 120 is not visible to client device 110 and / or origin device 130 ). such an arrangement may ensure that client device 110 , cache server 120 , and / or origin device 130 are not visible to each other , which may enhance security for client device 110 and / or the target source devices . as further shown in fig6 , client device 110 may provide a request 610 for a resource to network device 170 , and network device 170 may receive request 610 via application proxy 172 . request 610 may include ip information , such as a destination ip address of request 610 , an ip address of client device 110 ( i . e ., a source ip address of request 610 ), a destination port of request 610 , etc . application proxy 172 may receive request 610 , and may determine , based on information provided in request 610 , whether to terminate a connection for request 610 at network device 170 . if application proxy 172 terminates the connection for request 610 at network device 170 , application proxy 172 may determine a target source device best suited to serve the resource requested by request 610 . for example , application proxy 172 may determine the target source device to be cache server 120 , origin device 130 , other device 150 , and / or local cache 174 . in one example implementation , application proxy 172 may determine the target source device for request 610 in the manner described above in connection with fig5 a and 5b . application proxy 172 may connect to the determined target source device , and may provide a proxy 620 of request 610 to the determined target source device . proxy request 620 may include the features of request 610 , but may be transparently provided by spoofing an ip address of client device 110 to the target source device . via proxy request 620 , client device 110 may be transparent to the target source device because network device 170 may use its own ip address , or may spoof the addresses of client device 110 , to send information to the target source device . this may enable client device 110 to securely communicate with the target source device ( i . e ., without the target source device gaining access to the ip address of client device 110 ). in one example , if the target source device corresponds to cache server 120 , application proxy 172 may provide proxy request 620 to cache server 120 , and cache server 120 may retrieve a resource 630 requested by proxy request 620 . cache server 120 may provide resource 630 to application proxy 172 . in another example , if the target source device corresponds to origin device 130 , application proxy 172 may provide proxy request 620 to origin device 130 , and origin device 130 may retrieve resource 630 requested by proxy request 620 . origin device 130 may provide resource 630 to application proxy 172 . in still another example , if the target source device corresponds to other device 150 , application proxy 172 may provide proxy request 620 to other device 150 , and other device 150 may retrieve resource 630 requested by proxy request 620 . other device 150 may provide resource 630 to application proxy 172 . in a further example , if the target source device corresponds to local cache 174 , application proxy 172 may provide request 610 ( i . e ., no proxy may be required ) to local cache 174 , and local cache 174 may retrieve resource 630 requested by request 610 . local cache 174 may provide resource 630 to application proxy 172 . application proxy 172 may receive resource 630 from one of the target source devices described above , and may provide a proxy 640 of resource 630 to client device 110 . proxy resource 640 may include the features of resource 630 , but may be transparently provided by spoofing an ip address of the target source device to client device 110 . via proxy resource 640 , the target source device may be “ transparent ” to client device 110 because network device 170 may use its own ip address to send information to client device 110 . this may enable the target source device to securely communicate with client device 110 ( i . e ., without client device 110 gaining access to the ip address of the target source device ). although fig6 shows example components of network portion 600 , in other implementations , network portion 600 may include fewer components , different components , differently arranged components , or additional components than depicted in fig6 . alternatively , or additionally , one or more components of network portion 600 may perform one or more other tasks described as being performed by one or more other components of network portion 600 . fig7 is a diagram of example operations capable of being performed by an example portion 700 of network 100 . as shown , example network portion 700 may include client device 110 , cache server 120 , origin device 130 , other device 150 , network device 170 , application proxy 172 , and local cache 174 . client device 110 , cache server 120 , origin device 130 , other device 150 , network device 170 , application proxy 172 , and local cache 174 may include the features described above in connection with , for example , one or more of fig1 - 6 . as shown in fig7 , client device 110 may provide , to network device 170 , multiple requests 710 - 1 , . . . , 710 - 4 for multiple resources ( collectively referred to as “ multiple requests 710 ”), associated with a single connection , and network device 170 may receive multiple requests 710 via application proxy 172 . in one implementation , multiple requests 710 may be provided sequentially via the single connection . in other implementations , multiple requests 710 may be provided at different times via the single connection . application proxy 172 may receive multiple requests 710 , and may determine , based on information provided in multiple requests 710 , whether to terminate the connection for multiple requests 710 at network device 170 . in one implementation , application proxy 172 may determine whether to terminate the connection for multiple requests 710 in the manner described above in connection with fig4 . if application proxy 172 decides to not terminate the connection for multiple requests 710 , application proxy 172 may forward multiple requests 410 to network 160 for additional routing . if application proxy 172 terminates the connection for multiple requests 710 at network device 170 , application proxy 172 may determine target source devices best suited to serve the resources requested by multiple requests 710 . in one example implementation , application proxy 172 may select one or more target source devices for multiple requests 710 . in another example implementation , application proxy 172 may select a separate target source device for each of multiple requests 710 . for example , application proxy 172 may select cache server 120 to be the target source device for request 710 - 1 , may select other device 150 to be the target source device for request 710 - 2 , may select origin device 130 to be the target source device for request 710 - 3 , and / or may select local cache 174 to be the target source device for request 710 - 4 . in one example , application proxy 172 may select the target source devices for multiple requests 710 in the manner described above in connection with fig5 a and 5b . application proxy 172 may provide request 710 - 1 to cache server 120 , and cache server 120 may retrieve a resource 720 - 1 requested by request 710 - 1 . cache server 120 may provide resource 720 - 1 to application proxy 172 . application proxy 172 may provide request 710 - 2 to other device 150 , and other device 150 may retrieve a resource 720 - 2 requested by request 710 - 2 . other device 150 may provide resource 720 - 2 to application proxy 172 . application proxy 172 may provide request 710 - 3 to origin device 130 , and origin device 130 may retrieve a resource 720 - 3 requested by request 710 - 3 . origin device 130 may provide resource 720 - 3 to application proxy 172 . application proxy 172 may provide request 710 - 4 to local cache 174 , and local cache 174 may retrieve a resource 720 - 4 requested by request 710 - 4 . local cache 174 may provide resource 720 - 4 to application proxy 172 . application proxy 172 may receive resources 720 - 1 , . . . , 720 - 4 , and may provide resources 720 - 1 , . . . , 720 - 4 to client device 110 . although fig7 shows example components of network portion 700 , in other implementations , network portion 700 may include fewer components , different components , differently arranged components , or additional components than depicted in fig7 . alternatively , or additionally , one or more components of network portion 700 may perform one or more other tasks described as being performed by one or more other components of network portion 700 . fig8 is a diagram of further example operations capable of being performed by an example portion 800 of network 100 . as shown , example network portion 800 may include client device 110 , cache server 120 , origin device 130 , network device 170 , and application proxy 172 . client device 110 , cache server 120 , origin device 130 , network device 170 , and application proxy 172 may include the features described above in connection with , for example , one or more of fig1 - 7 . as shown in fig8 , client device 110 may provide a request 810 for a resource to network device 170 , and network device 170 may receive request 810 via application proxy 172 . request 810 may include ip information , such as a destination ip address of request 810 , an ip address of client device 110 ( i . e ., a source ip address of request 810 ), a destination port of request 810 , etc . application proxy 172 may receive request 810 , and may determine , based on information provided in request 810 , whether to terminate a connection for request 810 at network device 170 . if application proxy 172 terminates the connection for request 810 at network device 170 , application proxy 172 may determine a target source device best suited to serve the resource requested by request 810 . for example , application proxy 172 may determine the target source device to be cache server 120 . application proxy 172 may provide request 810 to cache server 120 , and cache server 120 may retrieve a portion 820 of a resource requested by request 810 . cache server 120 may provide resource portion 820 to application proxy 172 . however , before the entire resource requested by request 810 is received by application proxy 172 from cache server 120 , application proxy 172 may receive an indication 830 of an event . event indication 830 may provide information regarding changing conditions in a network ( e . g ., network 160 ), such as network congestion , bandwidth constraints , etc . ; information regarding a failure of cache server 120 ; information regarding an overload condition of cache server 120 ; and / or other information indicating that the remaining portion of the requested resource cannot be retrieved from cache server 120 . in response to event indication 830 , application proxy 172 may cease communications with cache server 120 , and may switch target source devices by providing request 810 ( e . g ., a http byte range request ) to origin device 130 or to another target source device of the requested resource . based on request 810 , origin device 130 may retrieve a remaining portion 840 of the resource requested by request 810 . origin device 130 may provide remaining resource portion 840 to application proxy 172 . application proxy 172 may provide resource portion 820 and remaining resource portion 840 to client device 110 . in one implementation , application proxy 172 may provide resource portion 820 to client device before providing remaining resource portion 840 to client device 110 . in another implementation , application proxy 172 may wait to receive both resource portions 820 / 840 , and may deliver resource portions 820 / 840 to client device 110 at the same time . such an arrangement may ensure that a requested resource is completely provided to client device 110 even when one or more target source devices of the requested resource becomes unavailable ( e . g ., due to changing network conditions or target source device conditions ). although fig8 shows example components of network portion 800 , in other implementations , network portion 800 may include fewer components , different components , differently arranged components , or additional components than depicted in fig8 . alternatively , or additionally , one or more components of network portion 800 may perform one or more other tasks described as being performed by one or more other components of network portion 800 . fig9 is a diagram of example functional components of application proxy 172 of network device 170 . as shown , application proxy 172 may include a tcp splicer component 900 , a routing decision component 910 , and an application logic component 920 . in one example implementation , one or more of the functional components described in connection with fig9 may be implemented by one or more of the example components of device 200 ( fig2 ) or device 300 ( fig3 ). tcp splicer component 900 may be responsible for efficient splicing of information provided between client device 110 and target source device connections ( e . g ., tcp connections ). in one example , tcp splicer component 900 may splice information ( e . g ., packets ) by changing headers in the packets , related to tcp sequence numbers , for a particular period of time ( e . g ., long enough to provide a resource request to a target source device and to receive the resource from the target source device ). in one implementation , tcp splicer component 900 may be provided in a forwarding plane of network device 170 in order to scale application proxy 172 to a line rate ( e . g ., in gigabits per second ) of network device 170 . in another implementation , tcp splicer component 900 may be an accelerator for a cache miss / bypass path . application proxy 172 may receive a request 930 for a resource ( e . g ., via tcp splicer component 900 ) from client device 110 , and may determine whether to use tcp splicer component 900 based on information provided in request 930 . in one example , the information provided in request 930 may include ip information , such as a destination ip address of request 930 , an ip address of client device 110 ( i . e ., a source ip address of request 930 ), a destination port of request 930 , etc . when application proxy 172 decides to use tcp splicer component 900 , application proxy 172 may terminate a connection ( e . g ., a tcp connection ) for request 930 at network device 170 , and may invoke tcp splicer component 900 to optimize transfer of the connection . if application proxy 172 terminates the connection for request 930 , based on the information provided in request 930 , tcp splicer component 900 may provide , to routing decision component 910 , an indication 940 that the connection is terminated . if application proxy 172 does not terminate the connection for request 930 , tcp splicer component 900 may forward request 930 to network 160 for additional routing , as indicated by reference number 950 . routing decision component 910 may determine where to route requests for resources or portions of requests for resources . in one example implementation , routing decision component 910 may determine where ( e . g ., to which target source devices ) to route requests for resources in a manner described above in connection with fig5 a and 5b . as shown in fig9 , routing decision component 910 may receive indication 940 from tcp splicer component 900 , and may determine a target source device for the resource requested by request 930 . routing decision component 910 may provide a location 960 of the determined target source device to application logic component 920 . application logic component 920 may handle resource requests , switching of target source devices due to changing network conditions or target source device failure , etc . as shown in fig9 , application logic component 920 may receive location 960 of the determined target source device from routing decision component 910 , and may route request 930 to location 960 of the determined target source device , as indicated by reference number 970 . application logic component 920 may receive a resource 980 from the target source device , and may forward resource 980 to client device 110 . although fig9 shows example functional components of application proxy 172 , in other implementations , application proxy 172 may include fewer functional components , different functional components , differently arranged functional components , or additional functional components than depicted in fig9 . alternatively , or additionally , one or more functional components of application proxy 172 may perform one or more other tasks described as being performed by one or more other functional components of application proxy 172 . in one example implementation , network device 170 , application proxy 172 , and local cache 174 may be deployed as standalone components in a service provider network . in another example implementation , network device 170 , application proxy 172 , and local cache 174 may be integrated into single device ( e . g ., a single server , a single media flow controller , a single network device , etc .). in a further example implementation , the functionality of one or more of application proxy 172 and local cache 174 may be integrated in network device 170 . systems and / or methods described herein may provide fine - grain and dynamic routing , of resource requests and / or resources , which may scale to line rates of network device 170 . additionally , or alternatively , the systems and / or methods described herein may be integrated within the infrastructure ( e . g ., network device 170 ) of a core network ( e . g ., network 160 ), and may not require explicit manual provisioning of an overlay service . additionally , or alternatively , the systems and / or methods may help federate resources among different service providers ( e . g ., via routing broker server 140 ), and may address resource routing for both transparent and reverse proxy deployments . additionally , or alternatively , the systems and / or methods may improve the efficiency of tcp connections from client devices by terminating such connections at network device 170 where latency is at a minimum , and may provide transparent target source device failover especially for large resources , such as video and file downloads . fig1 - 13 are flow charts of an example process 1000 for providing network integrated dynamic resource routing according to an implementation described herein . in one implementation , process 1000 may be performed by network device 170 . in another implementation , some or all of process 1000 may be performed by one or more devices other than network device 170 or in combination with network device 170 . one or more of the process blocks depicted in fig1 - 13 may be performed concurrently and independently of one or more other process blocks . as illustrated in fig1 , process 1000 may include receiving , from a client device , a request for a resource ( block 1010 ), and determining , based on ip information of the request , whether to terminate a connection for the request ( block 1020 ). for example , in an implementation described above in connection with fig4 , client device 110 may provide request 410 for a resource to network device 170 , and network device 170 may receive request 410 via application proxy 172 . application proxy 172 may receive request 410 , and may determine , based on information provided in request 410 , whether to terminate a connection ( e . g ., a tcp connection ) for request 410 at network device 170 . in one example , the information provided in request 410 may include ip information , such as a destination ip address of request 410 , an ip address of client device 110 ( i . e ., a source ip address of request 410 ), a destination port of request 410 , etc . application proxy 172 may compare the information provided in request 410 to the information provided in the table , and may decide to terminate the connection for request 410 when the information provided in request 410 matches one or more items of information provided in the table . as further shown in fig1 , when the connection is not terminated ( block 1020 — do not terminate ), process 1000 may include forwarding the request to a network ( block 1030 ). for example , in an implementation described above in connection with fig4 , if application proxy 172 decides to not terminate the connection for request 410 , based on the information provided in request 410 , application proxy 172 may provide , to client device 110 , indication 430 that the connection is not terminated , and may forward request 410 to network 160 for additional routing , as indicated by reference number 440 . returning to fig1 , when the connection is terminated ( block 1020 — terminate ), process 1000 may include determining a target source device for the resource ( block 1040 ) and providing the request to the determined target source device ( block 1050 ). for example , in an implementation described above in connection with fig5 b , if application proxy 172 terminates the connection for request 560 at network device 170 , application proxy 172 may determine a target source device for the resource requested by request 560 . in one example , application proxy 172 may provide query 570 to routing broker server 140 . query 570 may include a request for a location of a target source device that stores the resource requested by request 560 . routing broker server 140 may receive query 570 , and may determine , based on query 570 , the target source device for the resource requested by request 560 . after determining the target source device , routing broker server 140 may provide location 580 ( e . g ., an ip address ) of the target source device to application proxy 172 . in one example , if location 580 identifies an ip address of cache server 120 , application proxy 172 may provide request 560 to cache server 120 , and cache server 120 may retrieve resource 590 requested by request 560 . as further shown in fig1 , process 1000 may include receiving the resource from the target source device ( block 1060 ), and providing the resource to the client device ( block 1070 ). for example , in an implementation described above in connection with fig5 b , cache server 120 may provide resource 590 to application proxy 172 , and application proxy 172 may receive resource 590 and may forward resource 590 to client device 110 . process block 1020 may include the process blocks depicted in fig1 . as shown in fig1 , process block 1020 may include extracting a destination ip address from the request ( block 1100 ); extracting a client device ip address from the request ( block 1110 ); extracting a destination port from the request ( block 1120 ); and determining , based on one or more of the destination ip address , the client device ip address , and the destination port , whether to terminate the connection for the request ( block 1130 ). for example , in an implementation described above in connection with fig4 , application proxy 172 may extract the destination ip address from request 410 , may extract the ip address of client device 110 from request 410 , and / or may extract the destination port from request 410 . application proxy 172 may determine , based on the extracted destination ip address , client device 110 ip address , and / or destination port , whether to terminate the connection for request 410 at network device 170 . in one example , application proxy 172 may maintain or access a table ( or other data structure ) that provides a list of applications , client device ip addresses , source device ip addresses , etc . application proxy 172 may compare the information provided in request 410 to the information provided in the table , and may decide to terminate the connection for request 410 when the information provided in request 410 matches one or more items of information provided in the table . process block 1040 may include the process blocks depicted in fig1 . as shown in fig1 , process block 1040 may include determining whether the resource requested by the request is stored in a local cache ( block 1200 ). if the resource is stored in the local cache ( block 1200 — in local cache ), process block 1040 may include retrieving the resource from the local cache ( block 1210 ). for example , in an implementation described above in connection with fig5 b , application proxy 172 may determine whether the requested resource is stored in local cache 174 . in one example , application proxy 172 may maintain a table ( or other data structure ) that provides a list of resources stored in local cache 174 . application proxy 172 may scan the table to determine whether the requested resource is stored in local cache 174 . if application proxy 172 determines that the requested resource is stored in local cache 174 , application proxy 172 may retrieve the requested resource from local cache 174 . for example , application proxy 172 may provide request 560 to local cache 174 , and local cache 174 may retrieve resource 590 requested by request 560 . local cache 174 may provide resource 590 to application proxy 172 , and application proxy 172 may forward resource 590 to client device 110 . as further shown in fig1 , if the resource is not stored in the local cache ( block 1200 — not in local cache ), process block 1040 may include providing a query to a routing broker server for the requested resource ( block 1220 ), receiving , from the routing broker server and based on the query , an identification of the target source device ( block 1230 ), and retrieving the resource from the target source device based on the identification ( block 1240 ). for example , in an implementation described above in connection with fig5 b , if application proxy 172 determines that resource 590 is not stored in local cache 174 , application proxy 172 may provide query 570 to routing broker server 140 . application proxy 172 may receive , from routing broker server 140 and based on query 570 , location 580 of the target source device ( e . g ., cache server 120 , origin device 130 , and / or other device 150 ). application proxy 172 may utilize location 580 to connect with the target source device and to retrieve the requested resource from the target source device . process blocks 1050 - 1070 may include the process blocks depicted in fig1 . as shown in fig1 , process blocks 1050 - 1070 may include connecting to the determined target source device ( block 1300 ), providing a proxy of the request to the determined target source device ( block 1310 ), receiving the resource from the target source device based on the proxy of the request ( block 1320 ), and providing a proxy of the resource to the client device ( block 1330 ). for example , in an implementation described above in connection with fig6 , application proxy 172 may connect to the determined target source device , and may provide proxy 620 of request 610 to the determined target source device . the target source device may retrieve resource 630 requested by proxy request 620 , and may provide resource 630 to application proxy 172 . application proxy 172 may receive resource 630 from the target source device , and may provide proxy 640 of resource 630 to client device 110 . systems and / or methods described herein may integrate resource routing into an infrastructure of a core network , such as a service provider network , by adding application level intelligence in an edge network device of the core network . the application level intelligence may include an application proxy that terminates connections for a given application associated with all or a subset of client device requests for resources . for each resource request , the application proxy may determine a target server that stores resources , may connect to the determined server , and may proxy the resource request and a returned resource between the client device and the determined server . the term component , as used herein , is intended to be broadly construed to include hardware ( e . g ., a processor , a microprocessor , an asic , a fpga , a chip , a memory device ( e . g ., a rom , a ram , etc . ), etc .) or a combination of hardware and software ( e . g ., a processor , microprocessor , asic , etc . executing software contained in a memory device ). the term packet , as used herein , is intended to be broadly construed to include a frame , a datagram , a packet , or a cell ; a fragment of a frame , a fragment of a datagram , a fragment of a packet , or a fragment of a cell ; or another type , arrangement , or packaging of data . the term edge device , as used herein , is intended to be broadly construed to include any device that provides an entry point to or an exit point from a network , such as network 160 . in one example implementation , network device 170 may correspond to an edge device . the foregoing description of implementations provides illustration and description , but is not intended to be exhaustive or to limit the implementations to the precise form disclosed . modifications and variations are possible in light of the above teachings or may be acquired from practice of the implementations . for example , while series of blocks have been described with regard to fig1 - 13 , the order of the blocks may be modified in other implementations . further , non - dependent blocks may be performed in parallel . it will be apparent that example aspects , as described above , may be implemented in many different forms of software , firmware , and hardware in the implementations illustrated in the figures . the actual software code or specialized control hardware used to implement these aspects should not be construed as limiting . thus , the operation and behavior of the aspects were described without reference to the specific software code -- it being understood that software and control hardware could be designed to implement the aspects based on the description herein . even though particular combinations of features are recited in the claims and / or disclosed in the specification , these combinations are not intended to limit the disclosed implementations . in fact , many of these features may be combined in ways not specifically recited in the claims and / or disclosed in the specification . although each dependent claim listed below may directly depend on only one other claim , the disclosed implementations include each dependent claim in combination with every other claim in the claim set . no element , act , or instruction used in the present application should be construed as critical or essential to the disclosed implementations unless explicitly described as such . also , as used herein , the article “ a ” is intended to include one or more items . where only one item is intended , the term “ one ” or similar language is used . further , the phrase “ based on ” is intended to mean “ based , at least in part , on ” unless explicitly stated otherwise .	7
[ 0013 ] fig1 - 3 show the parts of the compressor main body 10 in the various stages of processing . as can be seen , the spray head 11 from the thermal sprayer apparatus is shown applying the metallic coating layer 12 onto the surface of the compressor . the coating system of the present invention provides a strong “ barrier ” property because of the sprayed metallic layer 12 . the form and composition of the sprayed metallic layer 12 described herein is ductile and very adherent to the underlying steel . therefore , if accidental impact occurs , such as with a wrench , the aluminum will just dent and smear and still remain basically in tact and still cover or protect the steel . the sprayed metallic layer 12 , of course , must be thick enough to supply this property . moreover , the electrochemical galvanic potential relationship between the sprayed metallic layer 12 and steel are such that the steel or iron compressor housing 10 becomes protected even when bare steel or iron regions are locally exposed to the corrodant . the sprayed metallic , which is preferably an aluminum coating , is sacrificial to the steel and therefore protects the steel from corroding . the approximate relationship describing this is as follows : service life in years =( 0 . 64 × aluminum coating thickness ( micrometers ))/ percent surface area as bare steel . the first step in the present invention is to clean the outer surfaces of the compressor body 10 to be coated of all grease , oil or other organic contamination . an aqueous alkaline cleaning system will suffice . in the case of gray cast iron an additional step may be needed depending upon condition of the cast iron surface . graphite present on the surface of the cast iron may inhibit adhesion of the metallic coating . a special chemical treatment may be necessary to remove some or most of the exposed surface graphite . one such method is known in the industry as kolene electrolytic salt process . it is understood that there may be other methods that are more economical in the industry that will serve the same purpose . in certain cases , this graphite removal step may not be necessary depending upon the quality of the casting surface and the effectiveness of the grit blasting . it is preferable that the compressor &# 39 ; s outer surface is first thoroughly treated by abrasive grit blasting . the blasting must be sufficient enough to satisfy the surface finish requirements of sspc sp 5 or nace # 1 “ white metal ”. proper surface preparation by blasting is critical to produce a well adhering thermally sprayed metallic coating . this roughened surface texture not only removes surface contamination by exposing fresh steel or iron , but also serves to mechanically anchor the aluminum coating firmly to the substrate . angular hard steel grit of mesh size of about 25 - 40 can be used , but the preferred grit media is aluminum oxide with a mesh size of about 16 - 30 . it is preferred that the indentation that the shot makes on the surface of the steel or iron is angular in shape and not spherical . better adhesion of the aluminum occurs with an irregular surface texture formed by angular - shaped grit particles . the resulting surface finish of the substrate after blasting shall have an anchor tooth pattern with a surface profile of about 50 - 75 micrometers ( 0 . 002 - 0 . 003 inch ) measured by astm d 4417 method a or b . the use of steel shot , typically used in shot peening or for other routine cleaning purposes may not supply the needed angular surface finish defined herein and may cause lack of good adhesion of the aluminum coating . blasting shall not be so severe as to distort any part of the compressor . it is critical that 100 % of the surfaces to be metallized be cleaned . regions of the compressor body 10 that should not be blasted should be masked . an example of such a component would be an electrical connection , a site glass , or internal coupling threads . after the compressor body 10 is blasted , it must be thermally sprayed within a certain maximum time limit of four hours to obtain the best coating adhesion . this is to avoid the formation of flash rust or other forms of surface contamination that would otherwise inhibit adhesion of the aluminum . the surface quality of the ferrous substrate must be sspc sp 5 “ white metal ” just prior to spraying . the substrate to be sprayed may be sprayed at room temperature , but to assure no moisture is present , local heating of the area to be sprayed shall be done . the surface temperature of the substrate should not exceed 250 fahrenheit . as an alternative , the compressor body 10 may be placed in an oven at 250 f . to eliminate any surface moisture prior to aluminizing . the ambient air temperature shall be about 5 degrees fahrenheit minimum above the dew point . as shown in fig1 - 3 , the incident angle of the metallic spray should be as close to 90 degrees as possible . the angle should not be less than 45 degrees . it has been shown that coating porosity increases as the incident angle is reduced below 90 degrees . distance of the spray gun to compressor body 10 shall not farther than 8 inches for similar reasoning . the most preferred composition is pure aluminum ( 99 . 9 % minimum purity ). the metal system deposited on the steel may be an aluminum alloy , having less than about 10 % magnesium . an alloyed aluminum metal system preferably has less than about 5 % magnesium , which has good corrosion resistance . aluminum / zinc alloys should be avoided in marine corrosion conditions , because they have less corrosion resistance because of its solubility in salt water . the thickness of the aluminum shall be such that there is no interconnected porosity from the atmosphere to the base steel or iron substrate . this condition helps to prevent corrosion of the substrate . to help avoid this porosity problem , the thickness of aluminum must be about 0 . 010 to 0 . 015 inch in thickness . the aluminum coating thickness should be measured with an eddy current , ultrasonic or magnetic induction type instruments . the tensile bond adhesion strength of the aluminized coating must be 1000 psi minimum as checked with the elcometer model 106 adhesion tester in accordance with astm d 4514 . the wire diameter of the aluminum shall be about 0 . 0625 inch . the nozzle gas pressure during aluminizing shall be about 55 psi . the metallic coating can be powder flame sprayed or wire flame sprayed , but the preferred method is by electric arc wire spraying . electric arc wire spraying exhibits a higher quality coating and is more economical than flame spraying for this application . electric wire arc spraying is performed by contacting two aluminum wires which are at a potential to each other and generating a melt inducing arc . this arc is in proximity to a forced gas or air jet . the gas may be an inert gas , but for economic reasons , dry and cleaned compressed air may be used . the aluminum wire becomes molten in the vicinity of the arc and the gas jet atomizes the aluminum and forces the droplets to impinge upon the steel or iron substrate . the droplets of aluminum impinge upon the steel and build up layer - by - layer until the desired thickness is achieved . the droplets start to cool and partially solidify prior to impingement . the kinetic energy of the droplets cause deformation and flattening of the aluminum particles as they hit the steel forming a uniform layer of aluminum on the steel or iron surfaces . because of the nature of this deposition process , a small amount of porosity forms between the particles of aluminum . to maximize corrosion resistance , interconnected porosity ( porosity that connects the marine atmosphere with the underlying ferrous substrate ), must not exist . to prevent this , a sufficient amount of aluminum must be deposited and an adequate sealer must be employed to block the pores . the coating must be applied in multiple , thin even coatings and not heavily applied in one spray . it has been found advantageous , for completeness of coating , to perform spray strokes at 90 degrees from each other and to allow some overlap for each subsequent spray stroke . the practical application of this process dictates that it be automated and applied by a robot or similar technology . this will assure consistency and completeness of the coating . the grit blasting , described above , shall also be automated for the same reasons . the complex shape of a compressor makes it difficult to consistently coat or blast manually . automation assures that all areas of the compressor are adequately treated . after thermal spraying the compressor , a seal coating is applied . the purpose of a sealing step is to fill any porosity present in the thermally sprayed metal coating and to further enhance corrosion resistance . if a sealer is used without a top coat finish , it shall exhibit ultraviolet radiation stability from exposure to the sun . this step enhances the corrosion resistance of the metallized coating and increases the useable life of the aluminized compressor . when only a sealer is used , the sealer also serves to produce a cosmetically acceptable aluminized compressor . the aluminized compressor must not exhibit dark blotches , which occur if improperly sealed or if an inadequate sealer is used . several properties of the sealer must be unique to this compressor application . therefore a special custom formulated sealer has been invented . the viscosity of the seal must be low enough so that the coating wicks into the pores and does not agglomerate on the surface . the thickness of the seal coat should not be greater than about 0 . 002 inch dry film thickness over the top of the aluminized coating . no moisture should be present on the surface of the metallized compressor prior to sealing unless the sealer is a water - based type . if moisture is present , the compressor shall be heated to 250 ° f . to remove moisture prior to the application of the sealant . application of the seal coat should take place within about 24 hours of metallizing for optimal results . ultraviolet protection properties should also be incorporated into the seal coat if no topcoat is used . in addition , the chosen seal coat type must be such that it will withstand a constant compressor operating temperature of 300 ° f . only certain regions of the compressor &# 39 ; s surface may reach this magnitude of temperature , therefore the sealer must not discolor in the heated region and remain uncolored in the non - heated region so as to produce a two - tone appearance . after long term exposure to 300 f ., the sealant must not degrade it &# 39 ; s corrosion preventing sealing properties . moreover , the sealer must retain it &# 39 ; s all of the stated properties after exposure to normal compressor oils such as ; polyol ester , mineral oils , etc . accidental spillage of these oils may occur that exposes the aluminized and sealed surface to such oils . the application of the sealant may be by brushing , spraying or dipping into the sealant . for the same reasons as above , the sealer shall be applied in a consistent manner that preferably utilizes automation . the curing process for the sealant should not exceed 300 f . as to not damage the internal components of the compressor due to excessive thermal degradation . the sealant should coat the compressor uniformly without agglomeration , which exceeds the required sealer thickness . there are several chemical families that will meet the aforementioned requirements . generally , the customized sealant described herein will have a carrier , an organic component , and an inorganic component . the first sealer consists of a silicon resin acrylic sealant containing : parachlorobenzotriflouride , phenyl propyl silicone , mineral spirits , high solids silicone , acrylic resin and cobalt compounds . additionally , particulates such as aluminum and / or silica can be incorporated . the silicon resin coating has good u . v . stability and is stable at 300 ° f . applying two coats of about 0 . 001 inch dry film thickness each has been found to achieve better results than one coat at about 0 . 002 inch thickness . another possible sealant coating is an epoxy polyamide with n - butyl alcohol , c8 , c10 aromatic hydrocarbons , zinc phosphate compounds and amorphous silica . the final coating considered acceptable for this application is a cross - linked epoxy phenolic with an alkaline curing agent . the adherence and performance of this sealant shall be enhanced by first applying an aluminum conversion coating on top of the thermally sprayed aluminum . two such conversion coatings known in the industry are alodine or iridite . the epoxy phenolic is then applied over the conversion coating . top coat finishes shall be of higher viscosity and similar in nature to paints . the maximum topcoat thickness shall be about 0 . 004 inch . the topcoat is applied over the sealer . the topcoat shall not be too thick as to negate the cathodic protective properties of the underlying thermally sprayed coating . for cosmetic reasons , it is preferable that dark coloring agents such as carbon black be added to the sealant or top coat to achieve a black or gray color . moreover , the topcoat must be compatible with the sealer to maintain good adhesion . top coat finishes should not be applied over an un - sealed aluminized coating . the following are topcoat finishes that comply with the cosmetic and functional requirements set forth herein : the first topcoat finish is a polyurethane polymer with curing agents containing ethyl acetate , hexamethylene diisocyanate , homopolymer of hdi , n - butyl acetate and fine aluminum particles . this sealant also complies with the requirements of this application . the color of this top coat is gray - black . yet another top coat coating is a neutral urethane base acrylic with ethyl benzene , methyl ketone , xylene , aromatic naphtha , barium sulfate , and 1 , 2 , 4 trimethyl benzene and a polyisocyanate curing agent . the color of this product is black . the final top coat finish considered is an epoxy polyamide which contains magnesium silicate , titanium dioxide , black iron oxide , butyl alcohol and naptha . the color of this product is haze gray . a wide variety of features can be utilized in the various materials disclosed and described above . the foregoing discussion discloses and describes a preferred embodiment of the present invention . one skilled in the art will readily recognize from such discussion , and from the accompanying drawings that various changes , modifications , and variations can be made therein without departing from the true spirit and fair scope of the invention .	5
fig1 shows a perspective representation of a cable outlet 1 on a plug - and - socket connector 11 . the cable outlet 1 consists of two hermaphroditic half shells 4 a / 4 b of the same kind , which , together , form a body 4 . in this example , the plug - and - socket connector 11 is designed as a round plug - and - socket connector . a cable 2 is introduced into the cable outlet 1 from the back side of the body 4 , which cable outlet is connected in the plug - and - socket connector 11 . the front side of the body 4 has been inserted onto the plug - and - socket connector 11 . in fig2 , the cable outlet from fig1 is shown in a perspective , exploded representation . in this case , the two half shells 4 a / 4 b are shown pulled apart from one another . a cable outlet connecting piece 3 of the plug - and - socket connector 3 is apparent here , on which cable outlet connecting piece the half shells 4 a / 4 b of the cable outlet 1 are retained . the cable 2 , which is connected to the plug - and - socket connector 1 on the back side , has been introduced into the cable outlet connecting piece 3 of the plug - and - socket connector 1 . a curable polymer 8 is evident on the inside of the half shells 4 a / 4 b , which polymer is intended to be distributed around the cable outlet connecting piece 3 and the cable 3 . when the half shells 4 a / 4 b are assembled to form a body 4 ( fig1 ), the curable polymer 8 fills the open space between the cable outlet connecting piece 3 , the cable 2 , and the body 4 in a form - fitting manner . the curing of the polymer 8 after assembly results in a mechanical fixation between the cable outlet 1 , the cable outlet connecting piece 3 , and the cable 2 . advantageously , the curable polymer 8 is provided in the body 4 in such a way that it is applied in the region of the rear end of the cable outlet connecting piece 3 . fig3 shows a perspective representation of one half shell 4 a / b of a body 4 of the cable outlet 1 . in the front region , shown on the left , the half shell 4 a / b has a form - fit opening 5 which is adapted to the cable outlet connecting piece 3 . the cable outlet 1 is thereby prevented from being rotated on the cable outlet connecting piece 3 . in one advantageous embodiment , the form - fit opening 5 can also be designed as a thread which can be screwed onto the cable outlet connecting piece 3 . the central region of the half shell 4 a / b is designed as a cable guide 6 and is used for guiding a cable 2 in the cable outlet 1 . a cable inlet opening 10 is integrally formed on the back side — shown on the right here — of the half shell 4 a / b . this taper is used for sealing the interior of the cable outlet 1 , with respect to the environment , in the region of the cable introduction . depending on the type of material used for the half shell 4 a / b , this region or the entire half shell 4 a / b can be formed from flexible material . in the region between the form - fit opening 5 and the cable guide 6 , a groove 7 is formed in the inside of the half shell 4 a / b , which groove is provided for accommodating the curable polymer 8 . the groove 7 is advantageously disposed in such a way that is covered , in the installed state , by the cable outlet connecting piece 3 . as a result , the cable outlet connecting piece 3 which is guided into the cable outlet 1 , displaces the curable polymer 8 and distributes said polymer in the interior of the cable outlet 1 . the half shell 4 a / b from fig3 is shown again in fig4 , although with a protective film 9 , which is shown removed from the half shell 4 a / b . the protective film 9 is provided for sealing the curable polymer 8 so that said polymer does not cure before assembly . in this case , the protective film 9 can be a removable element which must be removed from a cable outlet connecting piece 3 before the cable outlet 1 is assembled . according to one advantageous embodiment of the protective film 9 , said protective film must be designed very thin , so that the protective film 9 is destroyed when the cable outlet 1 is installed on a cable outlet connecting piece 3 and the curable polymer 8 can become distributed in the cable outlet 1 . the cable outlet 1 from fig1 is shown again in fig5 , in a partially opened representation , wherein one half shell 4 a is not shown , in order to allow for a view into the interior of the cable outlet 1 . it is apparent that the cable outlet connecting piece 3 has penetrated the curable polymer 8 and has displaced it . as a result , the curable polymer 8 has become distributed from its original position in the groove 7 ( see fig3 and fig4 ) in the entire interior space of the cable outlet 1 . the curable polymer 8 is thus displaced from the form - fit opening 5 up to the cable guide 6 and has surrounded the cable 2 . a further cable outlet 1 is represented in fig6 . in this embodiment , the body 4 is designed as one part . in this case as well , the curable polymer 8 is provided on the inside of the body 4 , in a groove 7 . in contrast to the embodiment from fig1 to 5 , in this case , the cable outlet 1 must be placed onto the cable 2 before assembly , before the cable 2 is introduced into the cable outlet connecting piece 3 . the two - part design of the body 4 from fig1 to 5 makes it possible to also install the cable outlet 1 after the cable 2 has been installed . the cable outlet 1 from fig6 is shown in a sectional view in fig7 in the partially installed state . a section through the plug - and - socket connector 11 and its cable outlet connecting piece 3 , into which the cable 2 has been introduced , is represented . the cable outlet 1 has already been placed onto the cable 2 , but has not yet been pressed onto the cable outlet connecting piece 3 . the curable polymer 8 is provided in the shape of a ring on the inside of the body 4 , in the groove 7 , wherein the cable 2 is not yet in contact with the curable polymer 8 . fig8 shows the fully assembled cable outlet 1 on the cable outlet connecting piece 3 of the plug - and - socket connector 11 , also in a sectional view . the penetration by the cable outlet connecting piece 3 into the curable polymer 8 has destroyed the protective film on the curable polymer 8 and has distributed the curable polymer 8 into the intermediate spaces between the cable outlet connecting piece 3 , the body 4 , and the cable 2 . more or less curable polymer 8 extends into the intermediate space , depending on the thickness of the introduced cable 2 . as a result , the cable outlet 1 according to the invention can be used in a highly flexible manner for different cable thicknesses . the thicker the cable 2 is , the more material can extend into the intermediate space of the cable guide 6 . when a thin cable 2 is introduced , the curable polymer 8 is sufficient for establishing a connection between the cable outlet connecting piece 3 , the body 4 , and the cable 2 without a great deal of material being pressed into the cable guide 6 .	7
in order that effective bonds can be formed between the heterocrystallites , the degree of polymerisation dp ( p ( i )) is about & gt ; 500 , preferably & gt ; 1000 , more preferably & gt ; 3000 , most preferably & gt ; 5000 where the degree of polymerisation is understood as the number of the smallest repeating unit and in polyethylene ( pe ) this is the unit ( ch2 )-. the quality of the network , especially the yield stress and the breaking elongation increases with the degree of polymerisation . the degree of polymerisation of the crystallisable sequences of p ( i ), dps ( p ( i )) is & gt ; 20 , preferably & gt ; 30 , more preferably & gt ; 40 , most preferably & gt ; 50 . with increasing dps ( p ( i )), the crystallinity of p ( i ) and the melting point tm of these crystallites increases . for pe the following correlation roughly applies . up to dps ( p ( i )) of around 150 , the sequences are incorporated into the crystallites in the stretched conformation where the melting point increases with the lamella thickness l . at higher dps ( p ( i )), tm increases only minimally under the usual crystallisation conditions since folding back of the sequences takes place , that is the sequence length can be a multiple of the lamella thickness . thus , the melting point is approximately determined with the choice of a specific sequence length . with regard to pe , basically all types satisfying the above conditions can be used , i . e . vldpe , lldpe , ldpe , hdpe , hmwpe and uhmwpe as well as copolymers such as , for example , eva or terpolymers and higher polymers . in the case of vldpe dps lies in the range of 7 - 25 so that only vldpe with dps & gt ; 20 can appropriately be used . in the case of lldpe , dps lies in the range of 25 - 100 so that the entire spectrum can be used here . this is also the case with ldpe and hdpe . however , typical hdpe crystallises very well because of the very small fraction of side chains ( only around 2 per 1000 c atoms in the chain ) so that the positive effects relating to the mechanical properties which occur with the other pe are less applicable to hdpe . however , the technology can also be suitable for hdpe in order to increase its mfi and therefore the processability , or for special applications where the fraction of p ( j ) is very high , for example , 50 % so that the melt of the mixture has a very low viscosity and is freely pourable and this mixture can be used as casting resin which hardens on cooling without any chemical cross - linking needing to take place , as is the case with the usual casting resins ( e . g . polyester resins , epoxide resins ). the degree of polymerisation dp ( p ( j )) is & gt ; 20 , preferably & gt ; 30 , more preferably & gt ; 40 , most preferably & gt ; 50 where the degree of polymerisation is also understood here as the number of the smallest repeating unit . the maximum degree of polymerisation dp ( p ( j )) is around & lt ; 500 . for p ( j ) the sequence length in cases of complete linearity , which is preferred , is identical to the degree of polymerisation . for p ( j ) tm increases continuously with dp ( p ( j )) but the melting points have lower values than for p ( i ) if dps ( p ( i )) is comparable to dp ( p ( j )), in the case of pe for example the values are around 10 ° c . lower . this is probably attributable to the different interfacial tensions . advantageous synergistic effects as a result of the heterocrystallisation of p ( i ) and p ( j ) occur especially if dps ( p ( i )) is approximately comparable to dp ( p ( j )), i . e ., preferably 0 . 1 × dp ( p ( j ))& lt ; dps ( p ( i ))& lt ; 10 × dp ( p ( j )), more preferably 0 . 3 × dp ( p ( j ))& lt ; dps ( p ( i ))& lt ; 7 × dp ( p ( j )), most preferably 0 . 5 × dp ( p ( j ))& lt ; dps ( p ( i ))& lt ; 5 × dp ( p ( j )). an exception is found , for example , for casting resins where dps ( p ( i )) can still be very much greater than dp ( p ( j )). on the one hand , a lower dp ( j ) is advantageous since the mobility of the macromolecules and therefore the rate of crystallisation and the degree of crystallisation increase with decreasing molecular weight . combined with the slow crystallising p ( i ), the crystallisation behaviour of p ( j ) to p ( i ) is induced . it was astonishingly found that if tm ( p ( i ))& gt ; tm ( p ( j )), the heterocrystallites then have a melting point around tm ( p ( i )), i . e . the advantage of the high rate of crystallisation and the high degree of crystallisation of p ( j ) is then combined with the advantage of the higher melting point of p ( i ). conversely , if tm ( p ( i ))& lt ; tm ( p ( j )), a heterocrystallite melting point around tm ( pj ) can be obtained , i . e . the heterocrystallites then approximately have the melting point of the higher - melting component . thus , tm ( p ( i )) can be increased by a fraction of p ( j ). p ( j ) is used relative to p ( i ) and p ( j ) in fractions in wt . % in the range of about 1 - 50 , preferably 2 - 40 , more preferably 3 - 30 , most preferably 4 - 25 . in the case of freely pourable casting resins , the fraction is approximately in the range of 10 - 95 , preferably 15 - 90 , more preferably 20 - 85 , most preferably 25 - 80 . in an embodiment of the polymer mixture , under comparable processing conditions of p ( i ) and of p ( i )+ p ( j ), a ) the quotient of the modulus of elasticity e ( i , j ) of p ( i ) + p ( j ) and the modulus of elasticity e ( i ) of p ( i ), e ( i , j )/ e ( i ) is & gt ; 1 . 1 and & lt ; 4 ; and / or b ) the quotient of the yield stress sy ( i , j ) of p ( i )+ p ( j ) and the yield stress sy ( i ) of p ( i ), sy ( i , j )/ sy ( i ) is & gt ; 1 . 1 and & lt ; 3 . 0 ; and optionally ; c ) if there is a fraction a ( j ) of p ( j ) relative to p ( i )+ p ( j ) in wt . % within the range 1 & lt ; a ( j )& lt ; 15 , the quotient of the breaking elongation eb ( i , j ) of p ( i )+ p ( j ) and the breaking elongation eb ( i ) of p ( i ), eb ( i , j )/ eb ( i ) is & gt ; 1 . 01 and & lt ; 1 . 5 . a necessary condition so that p ( i ) and p ( j ) can form advantageous networks under heterocrystallisation is the preparation of a melt where the components are present in a molecularly dispersed distribution . since p ( i ) and p ( j ) usually have extremely different viscosities in the molten state , where p ( i ) typically forms a highly viscous thermoplastic melt and p ( j ) is present with a viscosity of the order of magnitude of water , it is difficult to prepare a molecularly dispersed mixture of these components . if the mixing is insufficient , the advantages of the combination of p ( i ) and p ( j ) are only partly retained or are not retained at all , in particular separate phases are formed , as a result of which the breaking elongation for example is massively reduced . the polymers p ( i ) and p ( j ) are typically present as powder or granules . if these components are supplied to thermoplastic processing , for example , by means of extrusion , p ( j ) usually melts first and thin - liquid fluid , comparable to molten candle wax is formed . on the other hand , p ( i ) also requires shear forces for the melting process where mechanical energy is converted into thermal energy and a highly viscous thermoplastic melt is thus obtained . if p ( i ) and p ( j ) are supplied to the mixing process together , the thin - liquid p ( j ) forms a film around the granule grains or the powder particles of p ( i ) as a result of which scarcely any more shear forces can be transferred to p ( i ). this problem is more marked when using granules than with powder and in both cases , increases with the fraction of p ( j ). in order to achieve sufficient mixing despite this , long mixing times are required and special extruder configurations need to be used , e . g . double - screw extruders with kneading blocks and / or return elements . a sufficiently molecularly dispersed mixture cannot be achieved using simple single - screw extruders such as forming extruders for example , which are sufficient for the usual plasticization processes and are not fitted with special mixing parts . however , even with specially designed extruders , the mixing of p ( i ) and p ( j ) is problematical , especially with high fractions of p ( j ). it is then advantageous to first plasticise p ( i ) separately , at least partly and supply p ( j ) to the already existing melt of p ( i ) or to supply p ( j ) in stages , for example , a first fraction together with p ( i ) and then a second fraction to the first melt of p ( i ) and the first fraction of p ( j ), where the viscosity of the first melt is already severely reduced as a result compared with a melt of p ( i ) and the incorporation of the second , typically larger , fraction is made easier . a further processing possibility consists in preparing from p ( i ) and p ( j ) on a specially equipped mixer a master batch having a high fraction of p ( j ) which is then granulated for example . these granules ( or powder ) can then be simply processed together with granules or powder of p ( i ) since the viscosity of the master batch of the material is very much closer to the viscosity of p ( i ) than to p ( j ). the polymer p ( i ) was first plasticised at a chamber temperature of 170 ° c . and then the polymer p ( j ) was added to the melt of p ( i ) over a period of about 2 min . the speed was 100 rpm and the total mixing time was varied between 5 and 10 min . the mass temperatures were in the range of 170 - 195 ° c ., with increasingly lower mass temperatures being achieved with increasing fraction of p ( j ). the mixture was pressed into 0 . 5 mm films in a plate press at 180 ° c ., left at this temperature for 5 min after which the press was cooled rapidly with a maximum throughput of cooling water . in fig8 - 11 discussed below , the reference numerals 1 through 8 refer to the following : 1 ) preparation extruder ; 2 ) solid dosing device for p ( i ); 3 ) solid dosing device for p ( j ); 4 ) extrusion nozzle ; 5 ) second solid dosing device for p ( j ); 6 ) pre - compound or master batch of p ( i ) and p ( j ); 7 ) single - screw extruder ; and 8 ) solid dosing device for a powder mixture of p ( i ) and p ( j ). a 30 mm co - rotational close - combing double - screw extruder with 36l / d was used with an extrusion nozzle ( see fig8 ). the housing temperatures were g1 = 60 ° c . ( feed zone for p ( i )), g2 = 150 ° c . ( feed zone for p ( i )), g3 − g4 = 180 ° c . ( melting zone ), g5 = 180 ° c . ( feed zone for p ( j )), g6 − g7 = 180 ( mixing zone ), g8 = 180 ° c . ( discharge zone ), nozzle = 185 ° c ., the speed was 300 rpm . p ( i ) was added as granules and a homogeneous melt of p ( i ) was present from g4 . in the housing 5 the polymer p ( j ) was added in the form of granules which melted rapidly and in g6 − g7 were mixed with p ( i ) to form a homogeneous melt . the addition of p ( j ) in powder form caused no significant change in the product properties , likewise the addition of p ( j ) in the already molten state . for the preparation of a 7 % mixture , the dosing rates were 22 kg / h for p ( i ) and 1 . 655 kg / h for p ( j ). the melt obtained was shaped to pressure plates as described in the brabender method . also studied was the granulation of the strand which was then cooled over a water bath and could be granulated using a strand granulating device . the melt was then shaped into strips using a slotted nozzle . overall homogeneous molecularly dispersed mixtures with up to a 30 % fraction of p ( j ) could be obtained relatively simply . in the case of higher fractions of p ( j ), the dosed addition of p ( j ) was split ( see fig9 ). in this case , a first part of p ( j ) was mixed homogeneously with p ( i ) and then the second part of p ( j ) was added to this mixture and thus mixed homogeneously . by reducing the viscosity of the melt after the first mixing process , the second mixing process was made significantly easier . alternatively thereto , a first mixture was prepared in a first step and granulated to form a pre - compound or master batch ( see fig1 ) whereafter this pre - compound was plasticised again in a second step and a second fraction of p ( j ) was added . high fractions of p ( j ) could also be obtained with this process variant , such as is especially required for the preparation of ( low - viscosity ) casting resins . a 40 mm single - screw ( forming extruder ) was used ( see fig1 ). the feed zone was at room temperature , the other zones were at 180 ° c . and the speed was 250 rpm . the polymers p ( i ) and p ( j ) were preliminarily mixed in powder form using a drum mixer and this mixture was then metered at 12 . 4 kg / h . the components are melted and mixed over the metering and mixing zone . the melt was obtained as a strand by means of a hole - type nozzle and pressed into films as described in the brabender method . the properties of the products were significantly inferior to those obtained using a double - screw extruder . when using a single - screw extruder with a metering and mixing section , the results were approximately comparable to the products obtained using the brabender method with a longer mixing time . an instron tensile tester 4500 was used to analyse the mechanical properties . the samples were punched from films . the measuring length was 13 mm , the width 2 mm and the strain rate 100 mm / min . the melting points were determined using a perkin - elmer 7 dsc for film samples as peak temperatures during a first heating process , the heating rate was 20 ° c ./ min . fig1 gives the moduli of elasticity as a function of the fraction of p ( j ) ( pe wax with a molecular weight of 500 and a polydispersivity p of 1 . 1 ) for ldpe ( p ( i )) having a density of 0 . 917 g / cm 3 for the various mixing methods . in all cases , an increase in the modulus of elasticity with the fraction of p ( j ) can be determined , this increase being significantly more marked when the polymer mixture is prepared using a double - screw extruder with a mixing section compared with the other mixing methods . if the mixture is prepared using a brabender kneader , a clear dependence on the mixing time can be determined . after a mixing time of 15 min , comparatively high moduli of elasticity are obtained whereas after a mixing time of 5 min , the moduli of elasticity are significantly lower and comparable to the moduli of elasticity when extrusion is performed using a single - screw extruder . these differences in the modulus of elasticity and the other mechanical properties are attributable to the more or less marked homogeneity of the mixture of p ( i ) and p ( j ) and clearly show the influence of the mixing method used . a further advantage when using a double - screw extruder is that the typical mixing times of 0 . 5 - 3 min are relatively short and thus the influence of thermal degradation is minimal . the difference between the mechanical properties and those of mixtures prepared using a brabender kneader during a mixing time of 15 min must be at least partly attributable to the thermal degradation during the long mixing time . fig2 shows the yield stresses for the various prepared mixtures . this parameter is clearly more markedly dependent on the mixing method used . after preparing the mixture using a double - screw extruder and somewhat less markedly after preparation using a brabender kneader with a mixing time of 15 min , a marked increase in the yield stress can be identified whereas this effect is comparatively small with other mixing methods . fig3 shows the breaking elongations of the various prepared mixtures . in the better mixing methods an increase in the breaking elongation was surprisingly found with the fraction of p ( j ). this is astonishing since an increase in the modulus of elasticity and the yield stress is usually associated with a reduction of the breaking elongation . this effect is probably attributable to the fact that the heterocrystallites are formed with a highly dispersed distribution from a molecularly dispersed mixture of p ( i ) and p ( j ) and are well cross - linked among one another , a fine - grained structure is present in relation to the crystalline and amorphous phases and no phase separation of p ( i ) and p ( j ) exists . the advantage of preparing the mixture using a double - screw extruder becomes particularly clear from the behaviour of the breaking elongation of the mixture . further similar tests were carried out using a selection of different pe waxes and paraffins , where basically similar behaviour could be observed but the influence on mfi and the mechanical and thermal properties was dependent on the individual wax . similar modifications of the property profile were also obtained for other pe and pp ( polypropylene wax was used here ). fig4 shows the influence of p ( j ) ( pe wax with a molecular weight of 500 and a polydispersivity p of 1 . 1 ) on the mfi of p ( i ) ( ldpe ). the type of preparation of the polymer mixture is of less importance with regard to the mfi and comparable results were obtained in each case . the measured values for p ( j )= 30 and 40 % were measured at a weight of 1 kg and converted to 3 . 8 kg , they are thus only approximate values . it was particularly difficult to measure the mfi for p ( j )= 40 % since the mixture of p ( i ) and p ( j ) had a viscosity almost in the range of water at 180 ° c . the mfi is not a suitable method of characterisation for such mixtures but it can nevertheless be shown that the mfi increases by orders of magnitude , by a factor of about 70 for p ( j )= 40 %. thus , freely pourable resins can be obtained . the increase in the mfi however is already substantial for small fractions of p ( j ). for p ( j )= 3 % the mfi increases by a factor of 1 . 5 , for p ( j )= 7 % by a factor of around 2 . a new degree of freedom can thereby be obtained in the processing of polymers , especially polymers having high molecular weight and correspondingly high viscosity , corresponding to a low mfi , i . e ., a high - molecular melt p ( i ) can be processed by adding p ( j ) having a viscosity of a melt of significantly lower molecular weight whereby the melting point , for example , can be better controlled , especially can be reduced and shorter process times are possible , for example during injection moulding where lower pressures can also be used . thus , a polymer p ( i ) having a high or very high molecular weight can be processed under conditions typical of a similar polymer having a significantly lower molecular weight whilst the advantageous mechanical properties in the end product of the polymer having high or very high molecular weight are retained or even improved ( see fig1 to 3 ). fig5 shows the influence of the molecular weight on the increase in the mfi [ g / 10 min ] measured at 3 . 8 kg and 180 ° c . with a p ( j ) fraction of 7 %. the measured values were obtained for ldpe ( p ( i ) and pe wax ( p ( j )) with polydispersivities of around 1 . 1 , i . e . for an almost monodisperse molecular weight distribution . as the molecular weight of p ( j ) decreases , a substantial increase in the mfi can be observed . many pe waxes and paraffins have a relatively broad molecular weight distribution with polydispersitivities up to around 20 , their influence on the mfi is approximately comparable to the relationship in fig5 if the weight average ( ideally the viscosity average ) is used for the molecular weight . whereas the influence of the molecular weight of p ( j ) on the mfi is very marked , the mechanical properties for polymer mixtures containing pe wax having a low dispersivity are only comparatively slightly influenced by the molecular weight of this wax , almost no influence of the molecular weight can be identified with a p ( j ) fraction of 7 % and molecular weights up to around 2000 , and the modulus of elasticity , yield stress and breaking elongation only increase further above 2000 . with higher fractions of pe waxes , higher molecular weights are increasingly advantageous which can probably be attributed to the fact that as a result of the higher molecular weight , phase separation of p ( i ) and p ( j ) is more difficult as the melt solidifies . this relationship also applies to other waxes such as paraffins . fig6 shows the influence of a spectrum of various types of pe waxes and paraffins on mfi and the modulus of elasticity of lldpe having a density of 0 . 92 g / cm 3 . the corresponding mixtures were obtained with p ( j )= 7 % using a brabender kneader with a mixing time of 10 min , i . e ., the absolute values of the modulus of elasticity are typically higher for the extrusion of mixtures but a comparison of the effects of the various types is also quite possible under these conditions . the types studied had molecular weights in the range of 300 - 7000 g / mol with very broad molecular weight distributions in some cases , densities in the range of 0 . 89 - 0 . 99 g / cm 3 , melting points in the range of 50 - 132 ° c . ( waxes can also have different melting points ) and viscosities at temperatures of 140 - 150 ° c . in the range of 6 - 30 , 000 cp . the influence of the molecular weight of the polymer p ( j ) on the mfi has already been mentioned and the influence of the viscosity is similar . for the same p ( j ) the influence on the relative increase in the mfi for various p ( i ) such as hdpe , ldpe , lldpe , vldpe , eva , pp etc . is comparable . with regard to the mechanical properties however , in some cases there are major differences in the effect of different p ( j ) for the same p ( i ) as well as in the effect of an individual p ( j ) for different p ( i ). an investigation of the basic relationships revealed the following tendencies although deviations therefrom and exceptions can always occur and the processing and crystallisation conditions also play a role . a high density of p ( j ) especially correlates with the melting point when the molecular weight distribution of p ( j ) is narrow and results in a significantly increased crystallinity of the mixture with p ( i ), as a result of which the modulus of elasticity and yield stress increase and astonishingly , this is also the case with a broad molecular weight distribution although the effect is usually less strongly defined which is why molecular weight distributions having polydispersivities & lt ; 20 , especially & lt ; 15 , most preferably & lt ; 10 are preferred . the molecular weight distribution is frequently not known for waxes but is reflected in the width of the melting or softening range where narrower intervals are preferred . in the combination of a p ( j ) with different p ( i ), the ratio of the degree of polymerisation of the sequence length of p ( i ), dps ( p ( i )) to the degree of polymerisation of p ( j ), dp ( p ( j )), for example , or equivalent to this , the ratio of the molecular weight of the sequence length of p ( i ) to the molecular weight of p ( j ) is a central parameter as well as the width of the distributions of dps ( p ( i )) and dp ( p ( j )). if dps ( p ( i )) and dp ( p ( j )) are monodisperse and identical , the conditions for an advantageous heterocrystallisation are clearly given , likewise if the polydispersivities are similar , as long as the polydispersivity is not too high . if 1 & lt ; q & lt ; 10 where q = dps ( p ( i ))/ dp ( p ( j )), heterocrystallisation can likewise take place , where the melting point of the heterocrystallites approximately corresponds to the melting point of p ( i ), i . e ., the heterocrystallites can also have a very much higher melting point than p ( j ), the difference can be 30 or 40 ° c . or more . when q & gt ; 10 , heterocrystallisation is still possible but the tendency towards phase separation increases , especially with larger fractions of p ( j ). the phase separation can be at least partially suppressed by a high cooling rate but can optionally still take place at room temperature , especially with high fractions of p ( j ) and low molecular weights of p ( j ), which is why paraffins having high very short - chain fractions are disadvantageous . of particular interest are values of q & lt ; 1 . in this case , p ( j ) forms crystallites of larger lamella thickness than p ( i ) where the longer - chain sequences of the sequence length distribution of p ( i ) preferably form heterocrystallites with p ( j ). the melting point of p ( i ) is thereby increased since the melting point tm increases with the lamella thickness . fig7 shows the melting points for pe wax as a function of the molecular weight and the melting points for pe as a function of the molecular weight of the sequences of pe . from this it is possible to read off the conditions under which the melting point of pe can be increased by adding p ( j ).	2
white space devices need to implement an extremely sensitive spectrum sensing technology ( e . g . listen before talking ). examples are shown in fig1 and fig2 . this spectrum sensing technology detects the presence of a licensed service and determines if the channel can be used ( i . e . vacant ). also , if a licensed service starts to operate ( i . e . wireless microphone ) on a previously available channel ( i . e . vacant ), the device needs to sense the change and immediately vacate the channel ( see fig7 ). referring to fig1 there are illustrated typical white space devices . in this figure , two devices 10 and 12 are completing the spectrum sensing function independently and then communicate with each other . in this example , the devices 10 and 12 are equivalent . in this example , the spectrum detection is on the tv band , geo - location is performed using gps 14 , spectrum sensing / monitoring uses tv antennas 16 or 17 and a common database lookup is performed over a wired connection 18 or 19 . although shown with this example any permutation of ways of performing these functions or variety of functions is equally valid . referring to fig2 there is illustrated in a flow chart a typical spectrum sensing process used by the devices of fig1 . this figure is an example of the flow 20 of a typical system shown in fig1 as it performs the spectrum sensing function . after starting 22 white space process steps 24 including measuring channels 26 , performing geolocation 28 and doing a database location lookup 30 . determining the vacant channel 32 can involve an algorithm to determine which channel ( s ) to use . negotiation with another device determines 34 which channel to use . the transmission 36 of the information can include certain messaging and protocol . however spectrum monitoring 38 continues to ensure that the channel may continue to be used . currently , the spectrum sensing technology needs multiple components . one is a spectrum detection function to determine which frequencies / channels are available . another component is a geo - location function . the third function is a common database containing a list of devices at the various frequencies ( i . e . channels ). a common geo - location device can be gps . the common database can be stored on line to facilitate updates to that database . the detection and geo - location and database lookup functions can occur concurrently , in series , or in any order . when the detector detects an available channel , the geo - location detects the location that the database clears as an available channel . the white space device is now cleared to transmit on the available channel . the quality of the results of the functions do not aid or diminish the spectrum sensing or monitoring . for example , a simpler spectrum detection function implementation that detects only the energy in the frequency / channel may result in a detection function that gives false alarm when an unlicensed service exists in the frequency / channel . therefore , it would invalidate many frequency / channels that would be available with a more complete spectrum detection implementation . to utilize the potentially vast available spectrum the cost and complexity associated with the spectrum sensing and spectrum monitoring technology must be implemented . though the examples in this application are often shown involving spectrum sensing and spectrum monitoring for white space channels , the examples are also valid with any resource ( e . g . frequency / channel , time ) one has to perform certain functions before being allowed to access the resource ( e . g . frequency / channel , time ). although shown with the specific functions , we can generalize to more or fewer functions required to be performed before being allowed to access the resource ( e . g . frequency / channel , time ). also , though shown with the specific functions , we can generalize to more or fewer functions required to be performed while accessing the resource ( e . g . frequency / channel , time ). though most likely to be utilized in the same system , a system may use shared spectrum sensing without shared spectrum monitoring or vice versa . referring to fig3 there is illustrated in in a flow chart a typical spectrum monitoring process used by the devices of fig1 . this figure is an example of the flow 40 of a typical system shown in fig1 as it performs the spectrum monitoring function 38 of fig2 . after starting 42 the current channel is remeasured 44 and if yes optionally scan other channels 48 . if no transmission is ceased 50 and then it is determined if another channel is available 52 . if yes the new channel is negotiated 54 and transmission is restarted 56 . if no , the process is stopped 58 . the optional step 48 in the flow 40 involves scanning other channels to measure channels that is not currently used in the transmission . these results can be useful if a licensed device begins transmission on the current channel , or if another channel can be better utilized . the flow 40 is equally valid if the optional step is skipped . referring to fig4 there is illustrated a centralized shared spectrum sensing and monitoring process in accordance with a first embodiment of the present invention . this figure is an example of a system 60 utilizing shared spectrum sensing and spectrum monitoring . in this example , one device performs 62 the spectrum detection , geo - location , and common database lookup functions and then informs the results to the other devices 64 and 66 via a sideband channel 68 . the sideband channel 68 is any way of communication except the channels that the device is sensing and including wired or wireless channels . examples are wi - fi , cellular , or any available channel ( e . g . white space channel on a different available carrier ). in one example , a cellular terminal is used to communicate to the other device via control channel , traffic channel , or short message service . although shown with these examples any permutation of ways to perform spectrum sensing and communications , any ways to perform these functions are equally valid . the device that does the detection does not necessarily have to participate in the traffic ( i . e . network ) after the vacant channel is detected and communicated . the results of spectrum sensing and spectrum monitoring are valid for a localized proximity . devices connected via a lan ( e . g . wi - fi ) are bound by distance and under the localized proximity . furthermore , devices or the system can determine their proximity and location by other means ( e . g . cellular basestation , overhead messages ). any other means , to determine that the devices are in local proximity are equally valid . for example , a home base unit can perform the channel measurement and the geo - location . furthermore , the home base unit can have an internet connection to access the location database . since all devices are communicating to the home base unit , they will be in a local proximity . after communicating with the devices ( e . g . a security camera and a security monitor ), the home base unit will not have to be part of the traffic between the devices ( e . g . camera and monitor ) associated with the home base unit . the communicating of the vacant channel can also occur on the white space . since the devices that determine the available channel will know which channel is available , the device can transmit with a pre - determined pattern on that channel after receiving / determining the results of the spectrum sensing . this transmission will be a beacon . the “ listening ” devices then need to monitor the entire available channel to see this beacon . if the beacon is detected , the “ listening ” device can now transmit on this channel and the devices will now be paired . the algorithm for the “ listening ” device can be as simple as the device cycling through all the available channels . moreover , all the devices do not have to use the same means of communication . as long as the coordination information is sent and received , the shared spectrum sensing can occur . for example , one device can use a physical wire , and another can use wireless with a central device perform the spectrum sensing . furthermore , embodiments of the present invention can also be utilized to monitor for new licensed devices appearing on the channel . an example flow is shown in fig7 . when detected , it can use the same mechanism to update the other devices . the devices can also use any other available connection to update the other devices . furthermore , embodiments of the present invention can also be used to determine which channel would be more appropriate for the devices to occupy . one example is to inform the devices using this scheme to move to a channel with a lower interference level . since the device embodying the present invention continues to monitor for new licensed devices , it also has the capability to measure the interference on the channels as it conducts the scan . therefore , if a channel is available that is more appropriate or advantageous ( e . g . less noise ), the system can inform the communicating devices to relocate to that channel . also , embodiments of the present invention can be used to move the devices to frequencies to allow a larger contiguous band to be made available for other services . for example , a home base unit can coordinate the allocation and re - allocation of resources between the devices . referring to fig5 there is illustrated a distributed shared spectrum sensing and monitoring process in accordance with a second embodiment of the present invention . the embodiment of fig5 shows a system in which each device 72 , 74 and 76 is responsible for performing a part of the method of determining whether a channel is available . once determined , the available channel may be used by all devices including devices 78 that were not involved in determining channel availability . this figure is an example of the flow of a spectrum sensing system shown in fig6 and fig7 . determining the vacant channel can involve algorithm to determine which channel ( s ) to use . the transmission of the information can include certain messaging and protocol . referring to fig6 there is illustrated a process for shared spectrum sensing in accordance with a third embodiment of the present invention . this figure is an example of the flow of a shared spectrum monitoring system shown in fig4 and fig5 . the flow is similar to that shown in fig2 as indicated by the use of the same reference characters for the first part of the flow chart . however , once a vacant channel has been identified at 32 , that information is shared with other devices at step 82 so that the devices in the system can begin access and transmission at 84 . the process includes the step of monitoring 38 to ensure that of the channel found remains available . the flow is equally valid with or without the optional step as described in fig7 . referring to fig7 there is illustrated a process for shared spectrum monitoring in accordance with a fourth embodiment of the present invention . this figure is an example of the flow of a shared spectrum monitoring system shown in fig4 and fig5 . the flow is equally valid with or without the optional step as described in fig7 . the flow 90 is similar to that of fig3 , with the addition of steps 92 and 94 to inform other devices that the channel is no longer vacant 92 and that another channel is available 94 . referring to fig8 there is illustrated an example of devices with sideband channel and newly available air interface with multiple protocols . this figure is an example of a system where the devices 100 and 102 communicate on an available sideband channel 104 to coordinate before the limited / restricted resource ( s ) is available or when the limited / restricted resource ( s ) 106 is / are available . examples of sideband channels include wi - fi , and cellular . examples of limited / restricted resources include white space frequencies / channels , and resources available to cognitive radios . these resources can be frequency , channels , and time . afterwards , the devices 100 and 102 communicate with the new protocol 108 as dictated by standard . these standards can be the white space standard or cognitive radio standard . referring to fig9 there is illustrated an example of devices 110 and 112 with sideband channel 114 and newly available air interface 116 with one protocol 118 . this figure is an example where the same protocol but different rf carrier frequencies bands . for example , white space standard can operate on 2 . 4 ghz band for the sideband communication , and then switch to white space frequency / channel after spectrum sensing and negotiation . in another example , lte air - interface can operate on licensed spectrum then switch to the newly available resource ( s ) ( i . e . white space ). likewise , wi - fi air - interface can operate in 2 . 4 ghz and to the newly available resource ( s ) with the same protocol . the communications of the two interfaces can occur with the same protocol . as shown in fig9 , in scenario ( a ) the first interface 114 is used to coordinate the spectrum sensing information . in scenario ( b ), the devices 110 and 112 use the newly available channel 116 to communicate . the communication in scenarios a and b can occur utilizing the same protocol 118 . furthermore , the interface 114 can continue to be utilized even though the interface 116 is available . referring to fig1 there is illustrated an example of devices 120 . this figure is an example of a system where the method of spectrum sensing and spectrum monitoring is different than a prior example ( i . e . fig1 ). in this example , the common database lookup is provided by a data connection via a wireless link 124 . once again , the way that each function in the spectrum sensing and spectrum monitoring is provided can be substituted for another valid way to perform the function . referring to fig1 there is illustrated an example of devices 130 and 132 with sideband channel 134 and 136 . this figure is an example where a specific function of spectrum sensing / monitoring is shared or coordinated among a plurality of devices . in this example , both devices of the system perform spectrum detection . in this example , both devices communicate / coordinates using a sideband channel . the devices are allocated the channel list or order so that one device scans one set of channels and another device scans another set of channels . the list or order may overlap . doing so , the scanning will occur more quickly or the results will be enhanced or cost reduced . though shown as the spectrum detection function , any spectrum sensing function or a multiple of the functions may be allocated to multiple devices . also , though shown to be identical , the device with the allocation of the function need not perform the function using the identical means . another application of the invention will be to facilitate or accelerate the spectrum sensing and spectrum monitoring functions ( i . e . fig1 ). for example , the scanning of the frequency can take a measurable amount of time . also , geo - locations may take some measurable time . both of these functions &# 39 ; performance is a function of location and channel conditions that may vary by location . the common database lookup may be bandwidth limited or may be stored on storage ( e . g . disk ). the function of one or multiple of these tasks can be broken up into smaller segments with the information or results exchanged between the devices . for example , there may be two devices with the spectrum detection circuitry . these two devices coordinate such that one device scans one set of channels and the second device scans another set of channels . its results will be exchanged ( i . e . on the first , second , or potentially on a third device ) to decide which channel is appropriate to utilize . numerous modifications , variations and adaptations may be made to the particular embodiments described above without departing from the scope patent disclosure , which is defined in the claims .	7
an embodiment according to the present invention will be explained below with reference to the accompanying drawings . fig2 illustrates one construction of the recording parts of a liquid jet recording apparatus ( referred to as &# 34 ; ink jet printer &# 34 ; hereinafter ) to which the present invention can be applied . this example of construction illustrates application of the present invention to an ink jet printer where a head unit is fitted to a carriage which moves in a determined direction across the recording surface . in fig2 hu indicates a liquid jet unit mounted on carriage c and the number of liquid jet units may correspond to the number of ink colors used . fc indicates a flexible cable which collects signal lines , etc . which controls the discharging of ink from the liquid jet recording unit hu . carriage c is fixed , for example , to a belt and moves in the direction s by a driving means such as a motor . r indicates guide rails which guide the movenent of carriage c in the s direction . p indicates a recording material such as a paper carried in the direction f and pl indicates a platen . thus , carriage c moves by a driving means in the direction s along guide rails r and records on the recording surface . st indicates a sub - tank provided in carriage c and tb1 and tb2 indicate an ink supply pipe which communicates a main tank ( not shown ) with sub - tank st and an ink supply pipe unit which communicates sub - tank st with a liquid chamber ( not shown ) in head unit hu , respectively . fig3 shows one construction example of a control device of the ink jet printer according to the present invention . this control device , for example , receives printing data from host computer 7 , stores printing data corresponding to one line printing and controls the printing head by driver 6 of head unit hu to perform printing . 5 indicates a peripheral interface adapter ( abbreviated as pia hereinafter ), which receives recording data transmitted from host computer 7 for printer 1 according to the present invention and transmits the recording data to cpu2 . cpu2 controls each part in printer 1 and conducts the procedure referred to hereinafter with reference to fig4 and may be , for example , in the form of a microcomputer . 4 indicates ram as a line buffer memory which stores recording data of one line received at pia5 and 3 indicates rom in which font of recording output letters or procedures of fig4 etc . carried out by cpu2 are stored . these parts are connected through address data base 9 . 6 indicates a driver which controls head unit hu and drives it . fig3 illustrates one example of a recording procedure of the ink jet printer according to the above embodiment . in the printer of this kind , the patterns for recording are roughly classified into characters previously stored in rom3 for formation of font and bit image which constitutes an image based on the data corresponding to individual dots and transmitted from the host side . furthermore , the character stored in rom3 may be roughly classified into letter patterns such as english letters , numerals , marks , etc . and graphic patterns for formation of frames of tables , graphs , etc . among these patterns , generally , the letter patterns use a small number of liquid droplets simultaneously discharged . for example , in case of a recording head having twenty - four orifices , the number of orifices used in about five . on the other hand , for graphic pattern or bit image , sometimes , liquid droplets are simultaneously discharged from all orifices . in such a printer , the maximum driving frequency must be set so that a good discharging state can be obtained even when liquid droplets are simultaneously discharged from all orifices in order to make a good recording for all kinds of patterns . therefore , in the embodiment , two maximum driving frequencies are set , namely , when a pattern such as a letter for which a small number of liquid droplets are simultaneously discharged is recorded , a higher driving frequency is employed than for recording a graphic pattern or bit image , whereby high - speed recording was contemplated . the generation and selection of the two maximum driving frequencies are executed by c , for example , the construction of a block diagram shown in fig6 . the maximum driving frequencies are generated in mpu 220 according to the programs stored in mpu 220 , and the generated driving frequencies are selected on the basis of the kind of the printing data , which show the character or the pattern to be printed , input to mpu 220 . so , the selected maximum driving frequency is applied to unit controller 210 to drive printing unit 200 at the selected maximum driving frequency . in fig4 ink jet printer 1 receives a recording signal from host computer 7 ( step s1 ) and judges whether the signal is a letter or not ( step s3 ), when it is judged to be letter , the driving frequency is set , for example , at 3 khz ( step s5 ) and when it is judged not to be letter , namely , when it is graphic pattern or bit image , the driving frequency is set , for example , at 2 khz ( step s7 ) and then the recording procedure is carried out ( step s9 ). furthermore , the optimum diameter of liquid droplets discharged in recording graphic patterns is generally different from that in recording letters . when so - called solid portion graphic patterns are recorded , the diameter of dots is desirably such that adjacent dots overlap each other leaving no space , while when letters are recorded with dots of such diameter , small letters are rather difficult to read and so use of a somewhat smaller dot diameter is suitable for recording of letters . thus , as shown in fig5 if the driving frequency in recording letters is set at a higher than response frequency , the next driving pulse is applied before restoration of meniscus in the area where driving frequency is higher than response frequency fr and hence the diameter of discharged liquid droplets can be made smaller . considering the above fact , in other examples of the present invention , the driving frequency set in step s5 in the procedure shown in fig4 is set at higher than response frequency . as a result , recording speed was further increased and simultaneously the diameter of liquid droplets decreased and recording quality was further improved . besides , in the above embodiments , the mode under which the driving means is driven at lower maximum driving frequency may be referred to as a graphic mode and the mode under which the driving means is driven at higher maximum driving frequency may be referred to as a letter mode . as explained hereabove , according to the present invention , further higher speed recording becomes possible by changing driving frequency depending on the patterns to be recorded .	1
in the following detailed description of the present invention , five types of the smart start - up circuits , numerous specific details are set forth in order to provide a thorough understanding of the present invention . however , it will be obvious to one skilled in the art that the present invention may be practiced without these specific details . in other instances , well known methods , procedures , cmos digital gates , components , and metal - oxide - semiconductor field - effect transistor ( mosfet ) device physics have not been described in detail so as not to unnecessarily obscure aspects of the present invention . fig2 illustrates two types of the smart start - up circuits for switching regulators in accordance with the present invention . one type of the smart start - up circuit is applied for switching regulators driving a load 216 connected between v out and ground , as seen in the switching regulator system 210 shown in fig2 . the other type of the smart start - up circuit called “ p - type smart start - up circuit ” is applied for switching regulators driving a load 226 connected between v dd and v out , as seen in the switching regulator system 220 shown in fig2 . to reduce the difference between the initial output voltage level and the expected output voltage level of the switching regulator , the output of all the smart start - up circuits is coupled to the output terminal of switching regulators , as shown in fig2 . the switching regulator 212 represents all types of the switching regulators ( i . e ., dc - to - dc converter ) driving a load 216 connected between v out and ground without regard to the types of switching regulators because the applications of the smart start - up circuit 214 are independent of architectures and types of switching regulators . the switching regulator 222 represents all types of the switching regulators ( i . e ., dc - to - dc converter ) driving a load 226 connected between v dd and v out without regard to the types of switching regulators because the applications of the p - type smart start - up circuit 224 are independent of architectures and types of switching regulators . if loads 216 and 226 are multiple - order , then they will be approximated to the first - order load with neglecting resistor and inductor in the load for simplicity . fig3 illustrates a basic smart start - up circuit according to the present invention . this basic smart start - up circuit 300 does not have power - down mode in order to show the fundamental concept of the invention clearly . the basic smart start - up circuit 300 is a feedback circuit that consists of lower - voltage sensing inverters 302 and 312 ( i . e ., an even number of inverters ), higher - voltage sensing inverters 304 and 324 ( i . e ., an even number of inverters ), two stacked pmos transistors 306 and 308 , two stacked nmos transistors 326 and 328 , and a feedback line 310 . the gate terminal of a pmos transistor 308 is connected to a proper fixed - bias voltage ( not shown ) or ground ( e . g ., “ 0 ”, low , etc .). the gate terminal of a nmos transistor 326 is connected to a proper fixed - bias voltage ( not shown ) or power supply voltage ( e . g ., v dd , “ 1 ”, high , etc .). it is assumed that the output of the basic smart start - up circuit 300 is at ground . since the first lower - voltage sensing inverter 302 initially senses a voltage less than the lower midpoint voltage of the first lower - voltage sensing inverter 302 , the output voltage of the second lower - voltage sensing inverter 312 is low enough to turn on the pmos transistor 306 . at the same time , the output voltage of the second higher - voltage sensing inverter 324 is low enough to turn off the nmos transistor 328 . thus , the pmos transistor 306 provides a current ( i . e ., i p ,) to the output until the output voltage ( i . e ., v out ) goes up to the lower midpoint voltage of the first lower - voltage sensing inverter 302 . the time to reach the lower midpoint voltage at the load connected between v out and ground is as follows : δ ⁢ ⁢ t = v m ⁢ c p i p where v m is the lower midpoint voltage determined by the device aspect ratios of the first lower - voltage sensing inverter 302 and c p is the value of the capacitor in the load . also , assuming that v m is closer to the output voltage level that reaches the equilibrium in switching regulators , the start - up time of the switching regulators is approximately given by this start - up time is varied by the current i p depending on the size of the pmos transistor 306 . it is assumed that the output of the basic smart start - up circuit 300 is at power supply . since the first higher - voltage sensing inverter 304 initially senses a voltage greater than the higher midpoint voltage of the first higher - voltage sensing inverter 304 , the output voltage of the second higher - voltage sensing inverter 324 is high enough to turn on the nmos transistor 328 . at the same time , the output voltage of the second lower - voltage sensing inverter 312 is high enough to turn off the pmos transistor 306 . thus , the nmos transistor 328 provides a current ( i . e ., i n ) to the output until the output voltage ( i . e ., v out ) goes down to the higher midpoint voltage of the first higher - voltage sensing inverter 304 . the time to reach the higher midpoint voltage at the load connected between v out and power supply is as follows : δ ⁢ ⁢ t = ( v dd - v m ⁡ ( h ) ) ⁢ c p i n where v m ( h ) is the higher midpoint voltage determined by the device aspect ratios of the first higher - voltage sensing inverter 304 and c p is the value of the capacitor in the load . also , assuming that v m ( h ) is closer to the output voltage level that reaches the equilibrium in switching regulators , the start - up time of the switching regulators is approximately given by ( v dd - v m ⁡ ( h ) ) ⁢ c p i n this start - up time is varied by the current i n depending on the size of the nmos transistor 328 . the midpoint voltage is a voltage where the input voltage and the output voltage of the inverter are equal in the voltage transfer characteristic . at the midpoint voltage , the transistors of the inverter operate in the saturation mode . this midpoint voltage of inverter is expressed as v dd - v t n -  v t p  1 + k n k p + v t n ⁢ ⁢ where k n k p = μ n ⁢ c ox ⁡ ( w l ) n μ p ⁢ c ox ⁡ ( w l ) p in design of the basic smart start - up circuit of fig3 , it is also desirable to use a value for the lower midpoint voltage , v m , less than v out ′ and a value for the higher midpoint voltage , v m ( h ) , greater than v out ′. v out ′ is the output voltage level that reaches the equilibrium in switching regulators . fig4 illustrates a smart start - up circuit 400 according to the present invention . a power - down input voltage , v pd , is defined as the input voltage for power - down mode . the power - down enable system is in power - down mode when v pd is v dd and it is in normal mode when v pd is zero . the smart start - up circuit 400 is a feedback circuit that consists of lower - voltage sensing inverters 402 and 412 ( i . e ., an even number of inverters ), two stacked pmos transistors 406 and 408 , two stacked nmos transistors 426 and 428 , a feedback line 410 , and a power - down nmos transistor 442 . in addition , the gate terminal of a pmos transistor 408 is connected to a proper fixed - bias voltage ( not shown ) or ground ( e . g ., “ 0 ”, low , etc .). the gate terminal of a nmos transistor 426 is connected to a proper fixed - bias voltage ( not shown ) or power supply voltage ( e . g ., v dd , “ 1 ”, high , etc .). furthermore , the gate terminal of a nmos transistor 428 is shorted and thus no current flows into the drains of the nmos transistors 426 and 428 . the circuit mode changes from power - down mode to normal mode in fig4 . since the first lower - voltage sensing inverter 402 initially senses a voltage less than the lower midpoint voltage of the first lower - voltage sensing inverter 402 , the output voltage of the second lower - voltage sensing inverter 412 is low enough to turn on the pmos transistor 406 . the pmos transistor 406 generates a current ( i . e ., i p ) to the output until the output voltage ( i . e ., v out ) goes up to the lower midpoint voltage of the first lower - voltage sensing inverter 402 . furthermore , assuming that v m is closer to the output voltage level that reaches the equilibrium in switching regulators , the start - up time of the switching regulators is approximately given by also , v m is the lower midpoint voltage determined by the device aspect ratios of the first lower - voltage sensing inverter 402 and c p is the value of the capacitor in the load . the start - up time is varied by the current i p depending on the size of the pmos transistor 406 . in design of the smart start - up circuit of fig4 , it is also desirable to use a value for the lower midpoint voltage , v m , less than v out ′. v out ′ is the output voltage level that reaches the equilibrium in switching regulators . the smart start - up circuit 400 is used for all types of switching regulators driving the load connected between v out and ground . since the power - down nmos transistor 442 is on during power - down mode , it provides an output pull - down path to ground . thus , v out of the smart start - up circuit 400 is zero so that no current flows into the circuits during power - down mode . fig5 illustrates a dual smart start - up circuit 500 in accordance with the present invention . the dual smart start - up circuit 500 is a modification of the circuit described in fig4 . the gate terminal of a pmos transistor 508 is connected to a proper fixed - bias voltage ( not shown ) or ground ( e . g ., “ 0 ”, low , etc .). the gate terminal of a nmos transistor 526 is connected to a proper fixed - bias voltage ( not shown ) or power supply voltage ( e . g ., v dd , “ 1 ”, high , etc .). furthermore , compared to fig4 , the first difference to note is that the higher - voltage sensing inverters 504 and 524 ( i . e ., an even number of inverters ) are added into fig5 in order to provide the higher - voltage sensing function . the second difference to note is that the output of the second higher - voltage sensing inverter 524 is connected to the gate terminal of a nmos transistor 528 . therefore , the dual smart start - up circuit 500 is able to sense the lower - voltage as well as the higher - voltage while the smart start - up circuit 400 is able to sense only the lower - voltage . no current flows into the drains of the nmos transistors 526 and 528 assuming v out & lt ; v m ( h ) where v m ( h ) is the higher midpoint voltage decided by the device aspect ratios of the first higher - voltage sensing inverter 504 . if v out is greater than v m ( h ) , the gate voltage of the nmos transistor 528 is v dd . as a result , a current flows into the drains of the nmos transistors 526 and 528 until v out goes down to v m ( h ) . in design of the dual smart start - up circuit of fig5 , it is also desirable to use a value for the lower midpoint voltage , v m , less than v out ′ and a value for the higher midpoint voltage , v m ( h ) greater than v out ′ . v out ′ is the output voltage level that reaches the equilibrium in switching regulators . v m is the lower midpoint voltage decided by the device aspect ratios of the first lower - voltage sensing inverter 502 . the dual smart start - up circuit 500 is used for all types of switching regulators driving the load connected between v out and ground . zero dc volt at v out ensures that no current flows into the circuits during power - down mode . fig6 illustrates a p - type smart start - up circuit 600 according to the present invention . the power - down input voltage , v pd , is defined as the input voltage for the p - type power - down mode as well as for the power - down mode . the p - type power - down enable system is in power - down mode when v pd is v dd and it is in normal mode when v pd is zero . the p - type smart start - up circuit 600 is a feedback circuit that consists of a higher - voltage sensing inverters 604 and 624 ( i . e ., an even number of inverters ), two stacked pmos transistors 606 and 608 , two stacked nmos transistors 626 and 628 , a feedback line 610 , a power - down inverter 614 , and a power - down pmos transistor 642 . in addition , the gate terminal of a pmos transistor 608 is connected to a proper fixed - bias voltage ( not shown ) or ground ( e . g ., “ 0 ”, low , etc .). the gate terminal of a nmos transistor 626 is connected to a proper fixed - bias voltage ( not shown ) or power supply voltage ( e . g ., v dd , “ 1 ”, high , etc .). furthermore , since the pmos transistor 606 is turned off , no current flows out of the drains of the pmos transistors 606 and 608 . the circuit mode changes from p - type power - down mode to normal mode in fig6 . since the first higher - voltage sensing inverter 604 initially senses a voltage greater than v m ( h ) , the output voltage of the second higher - voltage sensing inverter 624 is high enough to turn on the nmos transistor 628 . v m ( h ) is the higher midpoint voltage decided by the device aspect ratios of the first higher - voltage sensing inverter 604 . the nmos transistor 628 generates a current ( i . e ., i n ) to the output until the output voltage ( i . e ., v out ) goes down to v m ( h ) . assuming that v m ( h ) is closer to the output voltage level that reaches the equilibrium in switching regulators , the start - up time of the switching regulators is approximately given by ( v dd - v m ⁡ ( h ) ) ⁢ c p i n also , c p is the value of the capacitor in the load . the start - up time is varied by the current i n depending on the size of the nmos transistor 628 . in design of the p - type smart start - up circuit of fig6 , it is also desirable to use a value for the higher midpoint voltage , v m ( h ) , greater than v out ′. v out ′ is the output voltage level that reaches the equilibrium in switching regulators . the p - type smart start - up circuit 600 is used for all types of switching regulators driving the load connected between v out and power supply . the output voltage of the power - down inverter 614 , v pdb , is zero during power - down mode . as a result , the power - down pmos transistor 642 is turned on and thus provides an output pull - up path to v dd . therefore , v out of the p - type smart start - up circuit 600 is v dd so that no current flows into the circuits during power - down mode . on the contrary , it was stated earlier that v out , must be zero when power - down mode occurs in fig4 and fig5 . fig7 illustrates a p - type dual smart start - up circuit 700 in accordance with the present invention . the p - type dual smart start - up circuit 700 is a modification of the circuit described in fig6 . the gate terminal of a pmos transistor 708 is connected to a proper fixed - bias voltage ( not shown ) or ground ( e . g ., “ 0 ”, low , etc .). the gate terminal of a nmos transistor 726 is connected to a proper fixed - bias voltage ( not shown ) or power supply voltage ( e . g ., v dd , “ 1 ”, high , etc .). compared to fig6 , the first difference to note here is that the lower - voltage sensing inverters 702 and 712 ( i . e ., an even number of inverters ) are added into fig7 in order to sense the lower - voltage . the second difference to note here is that the output of the second lower - voltage sensing inverter 712 is connected to the gate terminal of the pmos transistor 706 . the p - type dual smart start - up circuit 700 is able to sense the lower - voltage as well as the higher voltage while the p - type smart start - up circuit 600 is able to sense only the higher voltage . no current flows out of the drains of the pmos transistors 706 and 708 if v out is greater than v m . v m is the lower midpoint voltage decided by the device aspect ratios of the first lower - voltage sensing inverter 702 . if v out is less than v m , the pmos transistor 706 is turned on until v out goes up to v m . in design of the p - type dual smart start - up circuit of fig7 , it is also desirable to use a value for the higher midpoint voltage , v m ( h ) , greater than v out ′ and a value for the lower midpoint voltage , v m , less than v out ′. v out ′ is the output voltage level that reaches the equilibrium in switching regulators . the p - type dual smart start - up circuit 700 is used for all types of switching regulators driving the load connected between v out and power supply . v out = v dd in the p - type dual smart start - up circuit 700 ensures that no current flows into the circuits during power - down mode . in summary , the five smart start - up circuits of the present invention within switching regulators simply control how fast the output voltage level reaches the equilibrium from an initial output voltage level . the balance between pmos output resistance and nmos output resistance is important to obtain high output resistance . furthermore , the cmos process variations usually must be considered so that the proper value of the midpoint voltage is chosen for all the smart start - up circuits 300 , 400 , 500 , 600 , and 700 . each bulk of two stacked pmos transistors can be connected to its own n - well to obtain better immunity from substrate noise in all the smart start - up circuits 300 , 400 , 500 , 600 , and 700 . the smart start - up circuit 214 shown in fig2 represents the basic smart start - up circuit 300 , the smart start - up circuit 400 , and the dual smart start - up circuit 500 , as shown in fig3 , fig4 , and fig5 , respectively . also , the p - type smart start - up circuit 224 shown in fig2 represents the basic smart start - up circuit 300 , the p - type smart start - up circuit 600 and the p - type dual smart start - up circuit 700 , as shown in fig3 , fig6 , and fig7 , respectively . the conventional switching regulator 100 and the switching regulator system 210 including the basic smart start - up circuit 300 are simulated using the same components . as a result , the total simulation time of the conventional switching regulator 100 is 40 hours and that of the switching regulator system 210 using ( w / l ) mp1 = 6u / 1u of the pmos transistor 306 is 3 hours . this improvement can be accomplished by simply inserting a proper one of the smart start - up circuits into any conventional switching regulator , and the simulation time can be reduced by a factor of 13 . it should be noted that the same time step has been used for the spice simulation in order to accurately measure and compare the simulation time of all circuits . all the smart start - up circuits of the present invention are very efficient to implement in system - on - chip ( soc ) or integrated circuit ( ic ). the present invention provides five different embodiments which achieve a drastic improvement in a very fast start - up time , start - up time controllability , performance , time - to - market , power consumption , power and time management , efficiency , cost , and design time . while the present invention has been described in particular embodiments , it should be appreciated that the present invention should not be construed as being limited by such embodiments , but rather construed according to the claims below .	8
this definition includes bacterial cellulose or nanocellulose spun with either traditional spinning techniques or then with electrostatic spinning . in these cases , the material is preferably a polysaccharide but not limited to solely a polysaccharide . also whiskers , microcrystalline cellulose or regenerated cellulose and nanocellulose crystals is included in this definition . the microfibrillated cellulose ( mfc ) is also known as nanocellulose . it is a material typically made from wood cellulose fibers , both from hardwood or softwood fibers . it can also be made from microbial sources , agricultural fibers such as wheat straw pulp , bamboo or other non - wood fiber sources . in microfibrillated cellulose the individual microfibrils or elementary fibrils have been partly or totally detached from each other . a microfibrillated cellulose fibril is normally very thin (˜ 20 nm ) and the length is often between 100 nm to 10 μm . however , the microfibrils may also be longer , for example between 10 - 200 μm , but lengths even 2000 μm can be found due to wide length distribution . fibers that has been fibrillated and which have microfibrils on the surface and microfibrils that are separated and located in a water phase of a slurry are included in the definition mfc . furthermore , whiskers are also included in the definition mfc . even though it is known that microfibrillated cellulose ( mfc ) increase elastic modulus of paper , microfibrillated cellulose ( mfc ) is not good for top ply of board due to reduced porosity ( poor porosity / elastic modulus ratio ) and increased drying shrinkage . however there is a need to increase whiteness of board grades , but this has not been possible previously efficiently with fillers due to reduction of elastic modulus . in duplex type boards ( 3 ply board with brown middle ply ) this is done mainly with top ply grammage increase ( and 3 % filler ). almost all pcc is made by direct carbonation of hydrated lime , known as the milk of lime process . lime ( cao ) and carbon dioxide , which can be captured and reused is formed in this process . the lime is slaked with water to form ca ( oh ) 2 and in order to form the precipitated calcium carbonate ( insoluble in water ) the slaked lime is combined with the ( captured ) carbon dioxide . the pcc may then be used in paper industry as a filler or pigmentation , mineral or coating mineral or in plastic or barrier layers . it can also be used as filler in plastics or as additive in home care products , tooth pastes , food , pharmaceuticals , paints , inks etc . by “ in - line production ” is meant that the precipitated calcium carbonate ( pcc ) is produced directly into the flow of the paper making stock , i . e . the captured carbon dioxide is combined with slaked lime milk inline , instead of being produced separately from the paper making process . separate production of pcc further requires the use of retention chemicals to have the pcc adsorbed or fixed onto the fibers . an in - line pcc process is generally recognized as providing a clean paper machine system , and there is a reduced need of retention chemicals . an in - line pcc process is for instance disclosed in wo2011 / 110744 . fig1 shows a prior art method for inline production of precipitated calcium carbonate , as disclosed in us2011 / 0000633 and a schematic process arrangement for a paper making machine 2 . the white water f , is carried to e . g . a mixing tank or filtrate tank 4 , to which various fibrous components are introduced for the paper making stock preparation . from fittings at least one of virgin pulp suspension ( long - fiber pulp , short - fiber pulp , mechanical pulp , chemomechanical pulp , chemical pulp , microfiber pulp , nanofiber pulp ), recycled pulp suspension ( recycled pulp , reject , fiber fraction from the fiber recovery filter ), additive suspension and solids - containing filtrate is carried to the mixing tank , and from there conveyed by a mixing pump 14 to a vortex cleaner 16 , where heavier particles are separated . the accept of the vortex cleaning continues to a gas separation tank 18 , where air and / or other gases are removed from the paper making stock . the paper making stock is then transported to a feed pump 20 of the headbox , which pumps the paper making stock to a so - called headbox screen 22 , where large sized particles are separated from the paper making stock . the accept faction is carried to the paper making machine 2 through its headbox . the short circulation of fiber web machines producing less demanding end products may , however , not have a vortex cleaner , gas separation plant and / or headbox . in the prior art process the pcc production is performed in the short circulation of the paper making machine , before the vortex cleaning plant 16 . the carbon dioxide ( co 2 ) is injected on the pressure side of the vortex cleaner and the lime milk ( mol ) is injected a few meters after the carbon dioxide has dissolved in the same pipe . it is however conceivable that this pcc production could take place closer to the headbox , or that the distance between the injectors is very small , virtually injecting carbon dioxide and lime milk at the same location in the short circulation . this depends on the requirements of the end product and the design of the paper making machine . according to the invention there is provided an inline production method where additives , such as carbon dioxide , milk lime etc ., are fed into the short circulation of the paper making machine , i . e . into the fibrous web or paper making stock , and where a suitable amount of a microfibrillated cellulose , mfc , is provided substantially simultaneously as these additives are being fed into the short circulation . what is meant by “ substantially simultaneously ” may vary as described below , however in this context it is to be understood that the mfc is provided such that the additive , such as e . g . pcc may be formed , i . e . crystallized onto or into the mfc . where two or more additives are fed into the short circulation these are preferably allowed to react with one another , which means that they are fed into the short circulation in a manner which allows for the additives to react , in the case of lime milk and carbon dioxide , such that precipitated calcium carbonate is formed onto or into the mfc . according to one embodiment of the present invention , an in - line pcc process is combined with the dosage of mfc into the in - line pcc process . this provides for a completely new way of providing pcc to for instance a fibrous web in a paper making process . in one embodiment of the present invention , as shown in fig2 lime milk , carbon dioxide and mfc are injected separately into the short circulation and fibrous web of the paper making machine . in an alternative embodiment , as shown in fig3 a and 3 b the mfc is provided e . g . in the preparation of the paper making stock , and thus is present in the paper making stock and the carbon dioxide and lime milk are injected separately ( fig3 a ) or simultaneously ( fig3 b ) into the short circulation . in yet an alternative embodiment , as shown in fig4 the lime milk and the mfc are mixed before the injection into the short circulation and the carbon dioxide is injected separately from this mixture . in yet another alternative embodiment the , as shown in fig5 , the mfc is mixed with other additives and this mixture is injected separately from the lime milk and carbon dioxide . in all of the above described embodiments it is to be understood that the order of injection of the additives , i . e . lime milk , carbon dioxide , mfc and possibly other additives may occur in a different order or at a different stage in the short circulation . it is conceivable that the injection occurs very close to the headbox , or that the mfc is dosage prior to the addition of the carbon dioxide or that the distances between the “ injection points ” is shorter or longer than described above . thus the mfc , lime milk and carbon dioxide may be injected into the short circulation substantially at the same injection point . the point or point where the injection takes place thus forms a “ pcc reaction zone ”. according to one embodiment the mfc provides for an increased fiber surface area onto which the lime milk can adsorb and / or pcc may precipitate . by modifying and adjusting the surface energy , reaction sites , ph and surface chemistry of the mfc there is provided a completely new way of controlling how the pcc crystals are formed on the surface of the mfc . the crystals formed on the surface of the mfc particle may take on different shapes and configurations . by combining the in - line pcc process with a dosing or introduction of mfc there is provided a new way of controlling the paper making process without , e . g . modifying the entire white water circulation . further in the application of the fibrous web forming a top ply , several improvements have been observed , such as an increased whiteness of board and also decrease cloudiness of white surface and an increase of the board smoothness . there is also an increased elastic modulus in the same porosity and improved whiteness . by using pcc there is a reduced cost for process chemicals , and an increase in board machine process purity , such as less web brakes , less dirty spots , no accumulations on pipelines . in ep1219344 b1 there a method and apparatus which are particularly well applicable to homogeneous adding of a liquid chemical into a liquid flow are disclosed . in this method a mixer nozzle is utilized , and the liquid chemical is fed into the mixer nozzle and a second liquid is introduced into the same mixer nozzle , such that the chemical and second liquid are brought into communication with each other substantially at the same time as the chemical is discharged together with the second liquid from the mixer nozzle at high speed into the process liquid , and transverse to the process liquid flow in the flow channel . the chemical and second liquid may be discharged directly into the fiber suspension flowing towards the headbox of the paper machine . the second liquid may be a circulation liquid from the paper process , such as white water , or may be fresh water depending on the requirements of the liquid chemical to be added to the fiber flow . the flow speed from the mixer nozzle may be around five times the flow speed of the fiber suspension into which the chemical and second liquid is discharged . by using this type of fast addition of the pcc and mfc there is provided a way of forming the pcc crystals on the mfc very quickly . this fast formation of the pcc crystals provides for new pcc - fiber complexes in which the pcc grows in a cubic formation around the strings and wires of the mfc . this provides for less steric hindrance and provides great strength for the structure . a further advantage of this new crystal formation is that it provides for a very clean process without any up - build of pcc in pipes etc . also as the pcc is formed around the mfc or nanocellulose , and is bound very tightly to the fibre the hazards of using such small particles as the mfc is greatly reduced . according to one embodiment the amount of precipitated calcium carbonate in the ply is less than 25 wt -%, more preferred less than 15 wt -% and even more preferred less than 8 wt -% and most preferred below 6 wt -%. a trial was performed in a pilot paper machine . target of the trial was to simulate top ply of multi ply board . furnish was 100 % bleached birch refined to 26 sr level . running speed was 80 m / min and grammage 65 gsm . conventional paper making chemicals used in board production were used , such as retention chemicals , hydrophobic sizing etc . these parameters were kept the same during the trial . table 1 below shows an overview of how the trials were performed and the chemicals used therein . the addition of cmc ( carboxymethyl cellulose ) is not essential , however a slight improvement in strength could be noticed . cmc does however have negative effect on wire retention and brightness . starch is typically added as it gives some strength without major negative effects . in ex1 mixing of mfc and starch to the milk of lime was done and that was dosage or introduced into the in - line pcc reactor , where co 2 was also introduced for the formation of precipitated calcium carbonate , pcc directly into the short circulation . in ex2 the mfc and starch were dosage to the mixing chest ( thick stock ) were only birch fibers are present and an in - line pcc reactor was used as it normally used ( pure milk of lime was dosaged without any additives ). as a reference ( ref1 ) an off - line pcc was used , which was produced and transported from a paper mill for these pilot trials . in ref2 ( and ex1 and ex2 ) “ in - line pcc ” referrers to the pcc reactor , i . e . in the short circulation of the paper machine , into which pulp and white water goes just before centrifugal cleaners , but in ref2 no mfc was added . from these trials is clear that it is not possible to replace the 5 % off - line pcc with 7 . 5 % in - line pcc because strength values goes down too much with regards to tensile strength , burst index etc . it is possible to replace 5 % off - line pcc with 7 . 5 % in - line pcc if an addition of 2 . 3 kg / t of mfc and starch with milk of lime is performed according to the invention ( ex1 ). the mfc and starch dosage levels are very low 2 . 3 kg / t , which means that based on these dosages the costs can be kept low , while still getting very big improvements in strength properties of the ply . for board top ply the porosity must be kept high ( in order to make possible to dry the board fast ) and in this way ( mixing mfc and milk of lime ) one can keep mfc amount low a keep high porosity level . ex2 shows that if mfc and starch instead are dosaged into the thick stock much higher amounts are needed for the same strength levels and the high porosity is lost . the gurley hill porosity of 31 s / 100 ml shows a low porosity of this paper ply .	3
when referred to hereafter , the term “ wireless transmit / receive unit ( wtru ) includes , but is not limited to , a user equipment ( ue ), a mobile station , a fixed or mobile subscriber unit , a pager , a cellular telephone , a personal digital assistant ( pda ), a computer , or any other type of user device capable of operating in a wireless environment . when referred to hereafter , the term “ base station ” includes , but is not limited to , a node b , a site controller , an access point ( ap ), or any other type of interfacing device capable of operating in a wireless environment . fig2 shows a wireless communication system / access network of long term evolution ( lte ) 200 , which includes an evolved - universal terrestrial radio access network ( e - utran ). the e - utran , as shown , includes a wtru 210 and several evolved node bs , ( enbs ) 220 . as shown in fig2 , the wtru 210 is in communication with an enb 220 . the enbs 220 interface with each other using an x2 interface . the enbs 220 are also connected to a mobility management entity ( mme )/ serving gateway ( s - gw ) 230 , through an s1 interface . although a single wtru 210 and three enbs 220 are shown in fig2 , it should be apparent that any combination of wireless and wired devices may be included in the wireless communication system 200 . fig3 is an example block diagram 300 of the wtru 210 , the enb 220 , and the mme / s - gw 230 of wireless communication system 200 of fig2 . as shown in fig3 , the wtru 210 , the enb 220 and the mme / s - gw 230 are configured to perform a method of si change and rach procedure . in addition to the components that may be found in a typical wtru , the wtru 210 includes a processor 316 with an optional linked memory 322 , transmitters and receivers together designated as transceivers 314 , an optional battery 321 , and an antenna 318 . the processor 316 is configured to perform a method of handling si change and rach procedure . the transceivers 314 are in communication with the processor 316 and antenna 318 to facilitate the transmission and reception of wireless communications . in case a battery 320 is used in wtru 210 , it powers the transceivers 314 and the processor 316 . in addition to the components that may be found in a typical enb , the enb 220 includes a processor 317 with an optional linked memory 315 , transceivers 319 , and antennas 321 . the processor 317 is configured to perform a method of si change and rach procedure . the transceivers 319 are in communication with the processor 317 and antennas 321 to facilitate the transmission and reception of wireless communications . the enb 220 is connected to the mobility management entity / serving gateway ( mme / s - gw ) 230 which includes a processor 333 with an optional linked memory 334 . a si change can be triggered by network congestion which may cause a typical priority wtru access class ( e . g ., 0 - 9 ) to be barred from the network . in one embodiment , this is handled by allowing a high priority class wtru ( e . g ., greater than 10 ) to continue with the rach procedure after a si modification command is received or to continue the rach procedure beyond the new si mp boundary . the network might accept a rach request from a wtru in a higher priority access class , even if the si is about to change or has changed . a typical priority class wtru immediately stops the rach procedure after the si change modification command is received . alternatively , the rach procedure may be stopped or delayed until the relevant si has been read , as it is possible that the network might not listen to the rach from the typical ( lower ) access class wtrus if the si has changed or is about to change . in general , wtrus with low priority access classes would give higher priority to si messages over any rrc procedures while high priority access class wtrus may give priority to continuing the rrc procedure over reading the si . in another embodiment , a grace period may be defined where a rach procedure initiated prior to the si boundary 410 may run beyond that si boundary 410 as shown in fig4 . during the grace period , the old system configuration or the previous rach access configuration remain valid . the grace period may be defined by the e - utran : ( 1 ) the grace period is based on the t300 timer which is the rrc connection timer and related to the rach procedure ; and ( 2 ) the grace period may also be based on the minimum sib - 2 acquisition time , i . e ., the time for a wtru to complete reception of the new sib - 2 from the beginning of the new modification period , to the minimum sib - 2 acquisition time . the grace period may also be signaled by the e - utran to all the wtrus in the systeminfomodification information element ( ie ) at the paging message , which contains the si change notification . during the grace period , the old configuration continues to be used by the cell / e - utran . the wtru may also continue to apply the old configuration for a rach procedure initiated just after the new si mp boundary but before the new si has been acquired , while the cell / e - utran has started transmitting the new configuration from the mp boundary . once the grace period is over , the cell - e - utran applies the new configuration and all wtrus must use the new configuration . in one embodiment , a partial si read ( reception or acquisition ) is performed in idle mode ( or other modes ) to avoid stopping the rach procedure for too long while the new si is being acquired . in this embodiment , the rach procedure may be allowed to resume in idle mode just after critical si associated with admission control and the rach procedure have been acquired . once the new si is acquired ( i . e ., sib 1 cell barring , sib2 access class barring ) or some of the most important si has been read ( mib , sib 1 , and sib 2 ), the rach procedure resumes in parallel with acquiring the other ( additional ) si . in conventional methods , the paging notification does not differentiate a high priority si change ( such as a rach access parameter change or a cell selection criteria parameter change , etc .) from a minor si change ( such as a neighbor cell list change ). any si change requires a complete si read and could impact the wtru behavior as previously described . therefore , a method to differentiate between si changes that impact cell selection admission or a rach access procedure , versus minor si changes in the network configuration is desirable . in one embodiment , this may be implemented by adding a priority bit field ( one or more bits ) in the systeminfomodification information element ( ie ) in the paging message . specific wtru behavior may be defined based on the bit field . by way of example , when the priority bit field is set , it means that the sib - 1 , the sib - 2 , or both sib - 1 , and sib - 2 contents are to be changed . the wtru &# 39 ; s operation may be modified based on the priority bit field . continuing the example , the wtrus in either idle state or connected state must immediately prepare to receive the sib - 1 and sib - 2 . if the priority bit field is not set , it means that neither sib - 1 nor sib - 2 is to be changed . therefore , the new si is not affecting cell - access , sib - scheduling , the rach access , and rrc connection configurations . in this case , ongoing wtru activities can continue without interruption . the wtru may schedule a read of the rest of the sibs ( sib - 3 to sib - 9 ) for the si change and adjust the cell reselection , intra - frequency , inter - frequency , or inter - rat neighboring cell measurement activities accordingly with less time contingency . as known by those skilled in the art , specific bit field settings may have alternative meanings . another way to differentiate a high priority si change is to define distinct system change radio network temporary identifiers ( sc - rnti ) for the si change , depending on the priority of the change . for example , the network may use one sc - rnti value for high priority changes and another sc - rnti value for low priority changes . the wtru monitors for both sc - rnti values . when the sc - rnti corresponding to a high priority change is decoded , the wtru may behave accordingly , for example , by interrupting any rach procedure . conversely , when the sc - rnti corresponding to a low priority change is decoded , the wtru may continue with the rach procedure . several of these schemes described above may be combined to provide a simple and efficient way to handle situations when si changes collide with a rach procedure . for example , a low priority si change may allow the rach procedure to run beyond the new si mp boundary up to a grace period . the grace period is defined to allow the wtru to acquire the complete set of new si . a high priority si change blocks a low priority class wtru from running a rach procedure beyond the new si mp boundary . a high priority class wtru is allowed to run a rach procedure up to a grace period . the grace period is defined to allow the wtru to read critical si related to admission control and the rach procedure . all of the methods and techniques described above could be used alone or in combination with each other . also , all the solutions described above may be applied to any rrc procedure , i . e ., all the solutions could be applied in the case of collisions ( mp boundary ) between any rrc procedure and a si modification indication or the new si itself . also , all the parameters and methods above could be cell - specific or wtru specific . although features and elements are described above in particular combinations , each feature or element can be used alone without the other features and elements or in various combinations with or without other features and elements . the methods or flow charts provided herein may be implemented in a computer program , software , or firmware incorporated in a computer - readable storage medium for execution by a general purpose computer or a processor . examples of computer - readable storage mediums include a read only memory ( rom ), a random access memory ( ram ), a register , cache memory , semiconductor memory devices , magnetic media such as internal hard disks and removable disks , magneto - optical media , and optical media such as cd - rom disks , and digital versatile disks ( dvds ). suitable processors include , by way of example , a general purpose processor , a special purpose processor , a conventional processor , a digital signal processor ( dsp ), a plurality of microprocessors , one or more microprocessors in association with a dsp core , a controller , a microcontroller , application specific integrated circuits ( asics ), application specific standard products ( assps ), field programmable gate arrays ( fpgas ) circuits , any other type of integrated circuit ( ic ), and / or a state machine . a processor in association with software may be used to implement a radio frequency transceiver for use in a wireless transmit receive unit ( wtru ), user equipment ( ue ), terminal , base station , mobility management entity ( mme ) or evolved packet core ( epc ), or any host computer . the wtru may be used in conjunction with modules , implemented in hardware and / or software including a software defined radio ( sdr ), and other components such as a camera , a video camera module , a videophone , a speakerphone , a vibration device , a speaker , a microphone , a television transceiver , a hands free headset , a keyboard , a bluetooth ® module , a frequency modulated ( fm ) radio unit , a near field communication ( nfc ) module , a liquid crystal display ( lcd ) display unit , an organic light - emitting diode ( oled ) display unit , a digital music player , a media player , a video game player module , an internet browser , and / or any wireless local area network ( wlan ) or ultra wide band ( uwb ) module .	7
it is noted that , as used in this specification and the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include plural referents unless expressly and unequivocally limited to one referent . the method of diagnosis of traumatic brain injury according to one aspect of the invention comprising the steps of : providing at step 50 a stimulus generating eye tracking unit 10 , such as a head mounted goggle based eye tracking unit that can present virtual reality based visual targets to the subject . the unit 10 coupled to the subject ; presenting a plurality of virtual reality based visual stimulus to the subject , wherein at least one visual stimulus is at a simulated distance in the eye tracking unit , wherein each visual stimulus provides a target stimulus for a visual based neurologic test ; obtaining at step 70 objective physiologic response of the subject from the eye tracking unit based upon each of neurologic test associated with each visual stimulus presented to the subject ; and using the objective physiologic responses to the neurologic tests to diagnose at step 80 the presence of traumatic brain injury . virtual environment exposure , also called virtual reality or vr , has proven highly efficient and effective in vestibular rehabilitation since the experience gained during vr exposure is transferable to the real world . the vr technology in the present invention is used to accurately provide a simulated distance to a visual target for performing a variety of standard neurologic tests on the subject . additionally , the vr use in the rehabilitation of tbi accelerates the compensation of an acute loss of peripheral or central vestibular function by improving adaptive modifications of the vestibulo - ocular reflex . this device has the substantial and tremendous potential of being used bedside and in the home to increase rehabilitation compensation speed and degree . innovations of this portable device include : efficient pre - screening of military personnel . immediate post - accident screening of soldiers for tbi or mtbi in forward deployed areas of operation . follow - up screening for assessing prescribed tbi or mtbi treatment . use as a portable rehabilitation tool for mtbi patients . the device provides combined vr and visual stimulus with eye tracking technology in portable package . remote data access from forward deployed facilities to other medical personnel for triage can be implemented . current development in 3 - d and vr has produced continuous breakthroughs in the areas of science , medicine and military applications . at the heart of vr is the accelerated 3 - d graphics hardware that has been doubling in performance every six months . the cost of pc hardware has also continued to decline . in the area of vr software , the landscape has greatly improved with new tools , web integration and a general acceptance of the new technology . new display technology aids vr in the areas of projection , screen technology and micro displays for head - mounted displays . new oled micro displays are low power , easy to view , and compact . these improvements allow for a goggle based vr that can produce moving visual stimulus at simulated distances for a variety of neurologic tests of the present invention . the figure is a schematic design of vretg that includes the head - mounted goggles with the built - in 940 nm infrared micro led 22 for illumination of the eyes 24 and the beam splitter plastic coated optic 14 that reflects visible light from oled micro display 12 . the setup allows reflected ir light from the eyes to be sent directly to the eye tracking miniature digital cameras 20 behind the mirrors 20 . simply , the vr screen provides the visual stimulus and the cameras capture eye response for quick analysis and triage . the details of the vr display are believed to be known to those or ordinary skill in the art and it allows the system to present visual images or targets to the user that have a perceived or simulated distance much greater than the actual distance in the goggles . as a simple example the target could be a standard eye chart that is typically spaced 20 feet from the subject . the goggle unit 10 of the present invention allow such a chart to be present to the subject on the goggle and would allow the operator to perform testing on such a chart without setting up an actual full scale system . the eye tracking technology is also known in the art , also called video oculography . the camera based eye tracking may use the eye portal ® brand goggle based eye tracking cameras and software available from the assignee of this invention . the combination of the eye tracking and the display of simulated distanced visual targets allows the unit 10 to automatically run a number of preprogrammed neurologic tests and to record the physiologic responses thereto . essentially the unit provides a full room sized visual testing platform in a single goggle mounting unit 10 . the rational / purpose of the proposed system is to rapidly assess field - deployed personnel for potential tbi or mtbi . the technician in the field merely needs to put the unit on the subject and run the pre - identified tests . the contemplated system design will incorporate over 15 standard neurological tests simplified for a pass / refer criterion , that will facilitate rehabilitation and the monitoring of recovery and the compensation process . the device will provide a cost effective means to pre - screen soldiers prior to deployment to establish baseline brain function for future comparison if a future mtbi occurs . the device will allow full vestibular diagnostics and vor rehabilitation for more in depth usage and follow up care . this portable vr device will consist of : ( a ) rugged tablet pc , preferably meeting military specifications to provide for rugged use , equipped with software used to control the vr stimuli as well as to collect and analyze eye response data ; ( b ) head mounted goggle with vr display used to present stimuli at the designated simulated distance for the test and integrated binocular eye tracking cameras . the present invention provides a solution to overcome the limitations of existing screening , diagnostic and rehabilitation methods for mtbi patients . the proposed new system employs portable , head mounted vr eye tracking goggles from field to post - deployment . the system will incorporate efficient clinical diagnostic and screening methodologies for detecting mtbi related vestibular and neurological abnormalities . this technology will be instrumental in pre - screening , diagnosing and monitoring the progression of mtbi in soldiers who are deployed in remote locations , as well as those seeking post - deployment clinical services . having the ability to collect objective , functional data will aid the clinicians in the diagnosis between mtbi and other psychological disorders . the present invention uses analytical and 3 - d design methods , in the development of anatomically and functionally correct head - mounted goggle that can accommodate existing vr optics and miniature digital cameras . the vr stimulus software is integrated into existing vestibular / neurological software for protocol setup , test results analysis , and to create vr stimulus . the screening protocols of the googles 10 is anticipated to include the following standard tests horizontal and vertical calibration of subject eyes , nystagmus tests ( horizontal , vertical and spontaneous ), horizontal and vertical smooth pursuit , horizontal and vertical saccades , optokinetic tests , subjective visual horizontal and vertical and two rehabilitation protocols ( exercises ), one vor and second optokinetic . the invention may include the step of obtaining at step 60 pre - trauma objective physiologic responses of the subject from the head mounted goggle unit based upon each of the visual stimulus presented to the subject , wherein the pre - trauma objective physiologic responses form a baseline for the subject . with a baseline the step of using the objective physiologic responses to diagnose the presence of traumatic brain injury at step 80 includes a determining whether at least one post - trauma objective physiologic responses of the subject differs from the associated pre - trauma objective physiologic response by greater than a preset threshold for that response . alternatively the invention may utilize a normative database of similar subjects ( e . g . all men in their 20s , etc ) in place of step 60 whereby the step of using the objective physiologic responses to diagnose the presence of traumatic brain injury at step 80 includes determining whether at least one post - trauma objective physiologic responses of the subject differs from an associated objective physiologic response of a normative database of similar subjects by greater than a preset threshold for that response . the baseline approach is preferred , but may not always be available . it is understood , therefore , that this invention is not limited to the particular embodiments disclosed , but it is intended to cover modifications that are within the spirit and scope of the invention , as defined by the appended claims and equivalents thereto .	6
various embodiments of the present invention are directed to illumination devices and systems for providing high density illumination in submerged environments . for example , the environments may comprise large bioreactors comprising tanks filled with water in which algae is growing and into which carbon dioxide is provided . while certain embodiments of the present invention and certain figures focus on a single illumination device comprising a single light tube , the illumination systems of the present invention may comprise many illumination devices spaced by distances equal to or less than the diameter of the illumination tube itself . therefore , large tanks used to grow algae may comprise hundreds or thousands of the disclosed illumination devices . for example , if only one tube is used in each square meter of the cross section of a circular cylindrical tank having a diameter of 80 meters , approximately 5 , 000 tubes extending the full depth of the tank would be required . closer positioning , i . e . increasing the density of the illumination tubes and therefore providing more illumination , will increase the number of illumination devices needed . according to other embodiments of the present invention , at least some tubes in an illumination system are positioned at different depths and do not extend substantially the full depth of the tank . for example , it may be desirable to provide more illumination in the top portion of a tank where algae may be present in a higher concentration or density . fig1 illustrates a single light illumination tube of the present invention positioned within a water environment in a large tank . as used herein , the term “ water environment ” is used to indicate an environment comprising liquid water and may also comprise other components such as algae , other liquids and / or gases , either in solution and / or in a suspension with the water . one embodiment of the present invention utilizes a large number of illumination devices positioned , preferably generally vertically , within a tank containing a water environment comprising algae and carbon dioxide . in other embodiments described below , the light distributing tubes are not positioned vertically , but are generally horizontal . with reference to fig1 , this embodiment comprises a light source 10 connected to a light injector housing 30 by a fiber optic cable 20 . the light injector housing can optionally be provided with a lens for collimating the light and / or filtering the light as desired . this embodiment also comprises a tube 40 substantially filled with a liquid 50 , e . g . distilled water . a transparent , conical end cap 60 is positioned at the bottom of tube 40 in this illustrated embodiment . while the illustrated end cap is preferably transparent and conical , the end cap need not be transparent and can have other shapes . in this embodiment where the bottom of the tube 40 is spaced somewhat from the bottom of the tank 101 , a transparent end cap advantageously allows illumination of the water environment in the area generally below the illumination device . the tube 40 of fig1 is suspended from the top of the tank 100 by support 90 . in this illustrated embodiment , the entire illumination portion is submerged in the water environment 110 . a mirror or partial mirror 70 is provided proximate the end cap 60 in order to reflect light back up into tube 50 . this embodiment also advantageously comprises a fluid feed tube 80 and a fluid egress tube 81 which connect with an ingress port and an egress port , respectively , and which are used to fill and maintain the level of water in tube 40 . the structural details of various embodiments of tube 40 are described below in connection with other figures . fig2 shows some additional detail of the illumination device and tank of fig1 . with reference to fig2 , the illustrated light source 10 comprises a housing 11 , a bulb 12 and a reflector 13 , e . g . an elliptical reflector , which directs light onto the proximal end 21 of fiber optic cable 20 as indicated by the dashed arrowed lines . since a major portion of the tube 40 will be filled with water according to this embodiment , and since tube 40 may have a diameter of , for example , about 6 to 10 inches and a length of , for example , 18 meters , the water filled tube would be very heavy and would require special handling . therefore , it is desirable to fill tube 40 while the bioreactor tank is , being filled . from the present description and drawings , it will be appreciated that the tube structure will not be required to support all of the weight of the interior water if the water pressure is simultaneously applied to the exterior of the tube . this can be accomplished by filling the tube and the tank simultaneously . water ingress tube 80 provides for the supply of water or other suitable liquid while egress tube 81 allows air and / or other fluids to flow out of the tube . ingress tube 80 and egress tube 81 thus allow the tube to be filled while tank 100 is being filled . tubes 80 , 81 also allow the fluid level in the tube to be monitored and for the tube 40 to be pressurized or depressurized as desired , if the structure of the tube otherwise permits pressurization and or depressurization . the tubes are preferably filled until water flows smoothly out of egress tube 81 . additionally , after some period of use , the level of water in the tube should be checked since the tube may move during use and unintended air pockets which were not totally filled during initial filling may have been dislodged . as noted below , according to this embodiment of the present invention , care is taken to minimize the likelihood of unintended air pockets within the tubular structure . fig2 and 3 shows a pair of hangers 93 , shock absorbing springs 91 and a collar flange 92 which connect an upper support housing , e . g . a steel tubular sleeve , to the top of the tank 100 . upper support 95 extends downwardly to approximately the distal end 22 of fiber optic cable 20 and is secured to light injector housing 30 . as best illustrated in fig4 , light exiting the distal end 22 of the fiber optic cable 20 is directed through an optical lens 32 and thereafter into the tube 40 in this illustrated embodiment of the present invention . light injector housing 30 of this embodiment comprises an outer housing 34 and an inner housing 36 . a space is provided between outer shell 34 and inner shell 36 to allow the ingress and egress of water , air and other fluids as indicated by the arrows in fig4 . the interior surface 37 of inner housing 36 may be provided with a reflective coating to better direct light downwardly into the tube 40 . the external surface 35 of outer housing 34 is preferably provided with a teflon ® other nonstick coating in order to minimize adherence of the algae or other organic or inorganic material in the water environment . according to this embodiment of the present invention , the space between the distal end 22 of fiber optic cable 20 and the top of optical lens 32 is preferably air but could also be water , e . g . distilled water . in order to seal this space , a gasket 31 is positioned below optical lens 32 to secure optical lens 32 to inner shell 36 . illustrated lens 32 is a planar convex lens which substantially collimates the light which strikes the top of lens 32 at an angle of incidence no greater than about 30 ° to provide a substantially collimated beam of light to tube 40 . as used herein , the term “ substantially collimated ” is used to indicate that at least 90 % of the light is entering the tube is at an angle of less than 10 ° to the longitudinal axis . a ring 33 , preferably formed of a rigid material allows screws ( not shown ) or other fasteners to be used to secure gasket 31 to inner housing 36 . sealant may also be used . in the embodiment of the present invention shown in fig4 , the lower portion of inner housing 36 is generally vertical and spaced from the similarly shaped inner walls of outer housing 34 . spacers 39 are placed intermittently around the circumference of the illumination device and also receive fasteners for securing the outer housing 34 and the upper portion of tube 40 to the lower portion of inner housing 36 . a flat glass disc 38 or optionally a lens is preferably positioned below optical lens 32 in order to provide an additional seal . if an air pocket is provided in the light injector housing 30 , added buoyancy is provided to the illuminator , particularly to the upper portion of the illuminator . fig5 shows an alternative embodiment of light injector housing and is similar to the view of fig4 with the exception of the type of lens utilized . in the embodiment shown in fig5 , a fresnel lens 132 replace the planar convex optical lens 32 shown in fig2 and 4 . alternatively , a bi - convex optical lens may be utilized . in this embodiment , a liquid is not utilized in the space between the distal end 22 fiber optic cable 20 and fresnel lens 132 . a liquid , such as water , would interfere with the functioning of the fresnel lens . fig6 shows a third embodiment of the light injector housing . according to the embodiment of fig6 , a lens is not utilized . some commercially available fiber optic cables emit light at an angle of about 30 degrees from the axis of the fiber optic cable . as described below , certain applications of the present invention will not require and / or will not benefit from light which is collimated by a lens such as those shown in fig4 and 5 . therefore , some embodiments will not utilize a lens in the light injector housing . fig7 shows an enlarged view of the bottom portion of the illumination device shown in fig2 wherein the bottom of tube 40 is provided with an end cap 60 comprising a diffusing , preferably translucent and most preferably transparent , conical lower portion 61 which allows light to pass into the water environment . a mirror 65 is supported by a gasket 66 which is held in place by fasteners ( not shown ) which pass through support ring 67 , gasket 66 , spacers 68 , tube 40 and the upper , substantially vertical portion 69 of end cap 60 . spacers 68 positioned between mirror support 66 and the upper , interior surface of end cap 60 are not continuous around the circumference of the tube and therefore provide gaps for fluid to flow between end cap 60 and mirror support 66 . thus water , other suitable liquids , air or other gases are permitted to flow relatively freely into and out of the space below mirror 65 inside end cap 61 . in this illustrated embodiment , mirror 65 is partially reflective thereby reflecting only a percentage , e . g . 20 %, of the light back up into the tube and allowing substantially the remainder of the light to be transmitted downwardly through the conical portion 61 of end cap 60 . as an alternative to a partially reflective mirror , mirror 65 could simply be provided with a noncontinuous structure which covers only a portion of the area defined by the bottom of tube 40 . if desired , some or all of the structure used at the bottom of the tube , such as for the mirror support 66 , support ring 67 , and / or spacer 68 can be formed of relatively heavy materials in order to assist in weighing the bottom of the illumination device down . the water environment may not be stable and may be somewhat turbulent in order to facilitate mixture of gases , algae and other constituent components , and or to accommodate a large flow of co 2 . therefore , extra weight near the bottom of the illumination device will tend to keep the device more vertical in the tank . additionally , end cap 60 is preferably coated with or made from a nonstick material , such as teflon ® fep , in order to minimize adhesion by dirt , algae , or other matter which would block the desired transmission of light . the following is a description of various embodiments of tubular structures which are useful with the illumination devices and illumination systems of the present invention . while each of these embodiments is illustrated in the form of substantially circular cylinders , other shapes and configurations may be utilized . circular cylinders are believed to be preferred because they have a minimal surface area and are more readily made such that they are structurally sound . each of the illustrated illumination devices comprises a body portion , preferably in the form of a circular cylinder , which emits light over substantially its entire length . in certain applications , for example when utilized in a tank having a depth of about 20 meters , it may be preferable to form tubes in segments for ease of manufacture and shipping . it may also be desirable in certain applications to utilize segmented tubes wherein different segments have different characteristics in order to provide different amounts of illumination at different positions outside the tube . the tubes 40 are not necessarily uniform along their entire length . for example , it may be desirable to permit more light to emanate from an upper portion of the tube 40 where the concentration of algae in the water may be greater than at a lower region of the tank where the algae concentration may be lower . each of the illustrated tubular light tubes is filled with a column of water , e . g . distilled water , or another fluid which readily transmits light . for most applications it is currently believed that a clear liquid is preferred , however , it may be desirable in certain applications to use fluids which provide advantageous effects to the wavelength of the light emitted from the illumination device . fig8 and 9 are cross - sectional top and side views , respectively , of a first embodiment of a tube of the present invention . according to this illustrated embodiment , tube 40 is in the form of a twin walled tube comprising an outer wall 41 , an inner wall 42 and a plurality of ribs 44 . in the illustrated embodiment , tube 40 is formed as an integrally extruded tube . hollow portions 43 of the tube 40 between spacers 44 can be left hollow or can receive inserts 45 . the inserts can be formed of the same material as the inner wall 42 and outer wall 41 . one preferred material is teflon ® fep , made by dupont which is a fluorinated ethylene propylene . other inserts can be liquid , e . g . water , which has an index of refraction close to fep . depending upon the material used to form the tube , light striking interfaces , e . g . the interface between the inner wall 42 and the hollow cavity 43 , at an angle of incidence below a predetermined critical angle will be internally reflected back into the tube interior at locations where there is no insert 45 in a hollow cavity 43 . however , where an insert 45 is positioned within the hollow spaces , light will pass through the sidewall of tube 40 to the exterior water environment . the hollow central tubes shown in fig8 and 9 are filled with water , preferably distilled water , and are positioned in a water environment . water has an index refraction of about 1 . 33 while teflon ® fep made by dupont has a very close index of refraction of about 1 . 35 . the index of refraction of the teflon ® fep is close to that of water when compared with that of air which has an index of refraction of about 1 . 0 and common , transparent polycarbonate which has an index of refraction of about 1 . 58 . common glass has an index of refraction of about 1 . 5 , while borosilicate has an index of refraction of about 1 . 47 and that of crown glass ( pure ) can be 1 . 54 . in light of the similar indices of refraction of water and fep , light traveling through a portion of the illustrated tube which contacts the fep insert , i . e . not a hollow cavity , will be less likely to be internally reflected . fig9 generally illustrates a beam of light being internally reflected on the left interior side of tube 40 which does not have an insert in a hollow portion 43 , while a beam of light impinging at the same angle on the right side of the tube passes through the sidewall of the tube in an area corresponding to an insert 45 . fig1 and 11 illustrate either an alternative embodiment of the present invention or a different segment of tubing used as part of a segmented tube , but wherein more of the hollow portions 43 have been filled with inserts 45 . compared to the section of tube illustrated in fig8 , from the present description , it will be understood that light is permitted to pass through more areas of tube sidewalls of tube 40 in the tube segments illustrated in fig1 and 11 which are filled with more inserts 45 . since most light which travels up and down the tube will preferably be traveling at an angle of less than 30 ° to the longitudinal axis of the tube , the use of inserts in this embodiment will generally prescribe where light is transmitted from the tube and where light is internally reflected . fig1 and 13 illustrate another embodiment of the present invention . in this embodiment , tube 140 comprises an outer wall 141 preferably formed of a nonstick material such as teflon ® fep . outer wall 141 can also be formed of material such as polycarbonate , pvc , acrylic or glass . a plurality of spacers 142 , preferably formed of a plastic material in an arcuate shape , separate an inner wall 143 from outer wall 141 . spacers can be formed of other materials such as metals , e . g . aluminum , wood or ceramics . inner wall 143 can be formed of materials such as those described above for outer wall 141 and is , most preferably , formed of the same material as outer wall 141 . spacers 142 therefore define a space 144 between outer wall 141 and inner wall 143 . additionally , an extractor 145 which is preferably an opaque , textured material is positioned inside inner tube 143 . for example , one preferred extractor is made by the 3m company of st . paul , minn . and is a matte white scotchcal ® which is preferably adhered to a textured substrate . according to this embodiment of the present invention , light traveling down tube 140 which strikes an extractor 145 will be scattered and will thereby strike another portion of interior tube 143 at an angle of incidence greater than the critical angle of refraction and will therefore pass through the tube to the exterior environment . extractors 145 can be tapered as desired . fig1 and 15 illustrate a further embodiment of the present invention wherein tube 240 comprises an outer tube 241 and a spaced inner tube 244 which can both be formed of the same material as outer tube 141 of fig1 . positioned interiorly of outer tube 241 is a diffusing film 242 which can be formed of , for example , one or more of polycarbonate velvet , matte or suede textured films . diffusing film 242 is preferably continuous and scatters light . positioned interiorly of the diffusing film 242 and outside of inner tube 244 is at least one and preferably a plurality of intermediary film spacers 243 . spacers 243 can be formed of a film , e . g . a transparent polished / polished polycarbonate film , or a rigid , clear , arcuate segment , e . g . a polycarbonate . air gaps 245 exist between spacers 243 . according to this embodiment of the present invention , when light traveling down tube 240 strikes a portion of the interior tube 244 corresponding to both an intermediary film spacer 243 and the diffusing film 242 , some of the light will be directed out of the tube . specifically , most of the light which is not internally reflected by the interior surface of the inner tube will be directed out of the tube in these portions of the tube . fig1 is a diagrammatic illustration of how light passes through components of the present invention . according to this illustration , 401 illustrates a column of liquid , for example distilled water . column 402 is an fep tube . column 403 represents a space , i . e . an air gap . column 404 represents a diffusing film and column 405 represents an exterior tube formed of fep . column 406 represents a water environment outside of exterior tube 405 . material 407 represents a spacer . the space ( s ) between spacers 407 define the air gaps 403 . as indicated by the downwardly directed arrow on the right in fig1 , light traveling down the interior column of water 401 will pass through the interior tube 402 of fep since water and fep have a very close index of refraction . however , when the light hits the interface between interior tube 402 and air space 403 , since the light would be passing from a medium having a higher index of refraction to a medium having a lower index of refraction ( air ), light which is incident at an angle below the critical angle is internally reflected . the downward arrow on the left of this figure represents light which passes through the interior tube 402 to the spacer 407 which has a higher index of retraction than interior tube 402 . this light continues outwardly to diffusing layer 404 where it is then scattered in different directions including directions which cause it to travel through exterior tube 405 and into the water environment 406 . the light supplied to the light distributing tubes of the embodiments shown in fig8 - 18 is not necessarily substantially collimated , however for light distributing tubes having large aspect ratios , e . g . a 60 foot long tube having a diameter of 6 inches , it may be desirable to supply a substantially collimated beam of light . fig1 illustrates one embodiment of the present invention which is useful with a liquid filled light distribution tube of the type disclosed in applicants &# 39 ; co - pending u . s . provisional patent application ser . no . 61 / 215 , 368 filed on may 4 , 2009 . according to this embodiment of the present invention , light from a first laser light source 510 and a second laser light source 511 are transmitted , via a fiber optic light carrier , to a light distribution tube . laser light sources 510 and 511 can be used simultaneously , sequentially and / or alternatively to provide light of different wavelengths to the light distribution tubes . fig1 and 19 illustrate an alternative embodiment of the present invention wherein a liquid filled light distribution tube comprises a tube within a tube . according to this embodiment of the present invention , the light distribution tube whose interior is substantially filled with a liquid 605 as describe above comprises exterior wall 610 , an optical light film 620 , a plurality of extractors 630 and an inner wall 640 . this embodiment of the present invention does not depend upon a collimated source of light in order to efficiently transmit light along substantially its entire length but preferably has an angle of divergence not greater than about 28 °. light directed into the tube will be internally reflected by the optical light film if it strikes the optical light film at an angle of incidence of less than about 28 °. the extractors 630 have an effect similar to the extractors described above wherein light striking extractor 630 will be reflected toward sides of tube 600 at angles greater than the maximum angle of internal reflection as shown by arrows p and will pass through the optical light film 620 and outer walls 610 . light striking optical light film 220 at lesser angles of incidence will be internally reflected as shown by arrows r until reaching a mirror end cap ( not shown ) or subsequently striking extractor 230 . fig2 and 21 illustrate another liquid filled light distribution tube comprising an outer wall 750 formed of teflon fep ( hereinafter “ fep ”), an inner wall 760 formed of fep and a plurality of spacer rings 770 also formed of fep . rings 770 preferably extend around the entire circumference of inner wall 760 . the spaces 780 between the spacer rings 770 are preferably filled with air . the interior of the tube , i . e . interior of inner wall 760 , is filled with a liquid , e . g . water . since fep has an angle of refraction close to that of water , light striking areas of the tube which have a spacer ring 770 , i . e . which are formed of three layers of fep , will generally continue on its path out of the tube . however , light striking the interface between inner tube 760 formed of fep and the air between the spacer rings 770 will be internally reflected since the index of refraction of air is substantially less than that of fep . arrows r and p in fig2 and 21 indicate light being internally reflected and passing through the tube walls , respectively . according to an alternative to the embodiment shown in fig2 and 23 , the spacer rings are formed of a reflective material and the spaces between the spacer rings are filled with water . in this embodiment , the light will pass through the tube in the areas between the spacer rings and be reflected in the areas of the spacer rings . fig2 - 24 illustrate a liquid filled light distribution tube of one embodiment of the present invention wherein tube 800 is substantially filled with a liquid 805 , preferably a clear liquid such as water , and is provided with a light extractor 810 , such as matte white scotchcal ® made by the 3m company of st . paul , minn ., positioned on the inside of tube 800 . as best shown in fig2 , a fiber optic light carrier 820 is connected to a lens housing 840 by a ferrule 830 . light exiting fiber optic light carrier 820 is directed through a lens 850 , such as the illustrated fresnel lens , which substantially collimates the light for transmission down the length of tube 800 . light striking extractor 810 will be reflected toward sides of tube 800 at angles greater than the maximum angle of internal reflection as shown by arrows p and will pass through the walls of tube 800 . most of the light which does not contact the extractor 810 will either go directly to mirror end cap 860 for reflection back up the tube or will strike interior walls of tube 800 at angles less than the maximum angle of internal reflection as shown by arrows r and will be internally reflected by the walls of tube 800 . exterior tube 800 can be formed of acrylic , glass , polycarbonate , pvc and / or fep . the indices of refraction of the liquid inside the tube and the tube wall are preferably as close as possible . additionally , the exterior of outer wall 40 is preferably either formed of or provided with a coating which has low - friction and low - reactivity properties , as well as high light transmission . while the interior liquid is preferably water , other liquids such as mineral oil or silicone oil , or the like could also be utilized . it is also within the scope of the present invention to use light sources which are not carried by fiber optics . the extractor 810 of the embodiment shown in fig2 - 24 can be replaced by a distributor of the type disclosed in u . s . pat . no . 6 , 014 , 489 entitled light distributing tubes and methods of forming same . a light distributor 1200 which is illustrated in fig2 is preferably spaced a certain distance from the light input end of the tube 1210 ( depending on the beam spread angle of the light beam ). the illustrated distributor 1200 can include a light scattering lamination carried on a substrate formed of polycarbonate with a rough or textured surface . one suitable substrate material is sold under the trademark lexan ® suede by the ge company . such a lamination is preferably tightly mated to the rough or textured surface of the substrate and is a thick , white matte film such as scotchcal sold by the 3m company . the light distributor 1200 is preferably gradually tapered over its full length , most preferably symmetrically on both edges from a narrow width toward the end of the tube into which light is injected to a width at the distal end which is close to but not greater than one half of the internal circumference of the tube . a relatively inexpensive embodiment of a liquid - filled light distribution tube of the present invention comprises a clear pvc tube with a distributor of the type disclosed in u . s . pat . no . 6 , 014 , 489 disposed in the tube and the tube substantially filled with a clear liquid such as water . the tube is connected to a source of substantially collimated light which is beamed into the tube parallel to the longitudinal axis of the tube . light striking the distributor will be reflected at the inner tube wall at an angle which will cause most of that reflected light to pass through the tube wall . the embodiments of the present invention shown in fig1 - 26 are liquid filled light distribution tubes designed to operate in a submerged environment such as a bioreactor used to grow organisms such as algae . these embodiments can advantageously distribute light over substantially their entire lengths while having an internal pressure and buoyancy closely compatible with their external environment . fig2 - 30 illustrate a bioreactor of another embodiment of the present invention . fig2 and 28 are cross - sectional views of a continuous bioreactor wherein a plurality of liquid filled light distributing tubes 910 are positioned generally horizontally in a bioreactor tank 900 . carbon dioxide is supplied to the bottom of the reactor via supply tubes 920 . desired additional compounds or organisms , such as algae , can also be supplied to bioreactor 900 via supply tubes 920 . as algae grows and accumulates at the top of the tank 900 , it is moved by a movable skimmer 930 mounted on wheels / rollers 935 and having at least one skim tab 937 , into collection troughs 940 positioned on either side of the tank 900 as best illustrated in fig2 . skimmer 930 is supported by a support , e . g . a monorail proximate the top of the tank . skimmer 930 can be positioned at , above or below the surface of the liquid mixture in the tank . fig2 and 30 are partial views of the tanks shown in fig2 and 27 respectively . with reference to fig2 , according to this embodiment of the present invention , the light distributor tubes can conveniently be supplied with light from light sources 950 mounted on one or both sides of the light distributor tubes , as desired . the arrows p in fig3 illustrate light passing from the tubes into the algaeco 2 mixture in the tank . fig3 illustrates an alternative embodiment of the present invention wherein an illuminator 1000 is positioned outside the top of a tank 1001 and a rigid tube 1005 , for example formed of steel or other durable material , extends partially into the water environment in order to support light distribution tube 40 in water environment 50 . fig3 is similar to fig3 , however , according to this embodiment of the present invention a single illuminator 1000 is connected to a plurality of rigid tubes 1015 and light is directed into tubes 40 utilizing a partially reflective mirror 1020 which directs 50 % of the incident light from illuminator 1000 down into right side tube 40 while fully reflective mirror 100 directs 100 % of the remaining light down into the tube 40 on the left side of the drawing . fig3 illustrates an alternative embodiment of the present invention wherein tubes 1300 are supported at the bottom of a tank . these tubes are also illuminated from the bottom with illuminators 1310 . according to an alternative embodiment shown in fig3 - 36 , a tubular bioreactor 1110 is supported in a support trough 1120 . the interior side of the trough 1120 is provided with a reflective surface 1130 , such as a reflective film . the exterior wall 1140 of the bioreactor is at least partially translucent to allow natural sunlight and / or artificial light to pass through the exterior wall ( s ) and into the interior 1150 for use in the bioreactor , such as for photosynthesis by algae . the interior of outer wall 1140 preferably has low - friction and low - reactivity properties , as well as high light transmission . according to one preferred embodiment of the present invention , the outer wall comprises ptfe and / or teflon - fep which is a fluorinated ethylene propylene ( herein after “ fep ”). fep has low - friction properties to reduce the amount of algae growing on the interior walls . additionally , the interior light distribution source 1160 , supports 1180 , and wires 1171 ( described below ) are also preferably coated with a low - friction material and / or a protective , low - friction tube in order to minimize the adherence of algae or other biological organisms which could impede the transmission of light from the interior light source to the desired working area of the bioreactor and / or the flow of algae through the bioreactor . while teflon - fep is currently believed to be preferred , other materials can be utilized for the outer ( walls ) or for covering the inner source of illumination , such as acrylics , polycarbonates , pvc and / or glass . in fig3 and 36 , it will be understood that the reaction portion 1150 of the tube 1110 is the space between the outer surface of the inner tube 1164 which surrounds the interior light distribution source 1160 and the interior surface of the outer wall 1140 . in this illustrated embodiment tubes 1140 and 1160 are formed of fep or are internally and externally , respectively , coated with fep or another coating having low friction properties in the bioreactor environment . the interior light distribution source 1160 is preferably a substantially continuous light distribution tube or non - smooth light emitting rod which emits illumination along substantially the entire length of the light distribution tube or light emitting rod . if a light distribution tube is utilized , it can be a liquid filled light distribution tube such as one of those described above . fig3 illustrates a light emitting rod 1162 comprising a non - smooth cast acrylic rod e . g . scored , etched or grooved , surrounded by an interior tube 1165 , e . g . an fep tube . fig3 illustrates one method of connecting an exterior source of illumination to light emitting rods 1162 . according to this illustrated embodiment , a fiber optic cable 1182 is supplied with illumination from a source ( not shown ). fiber optic cable 1182 enters the outer tube 1140 and inner tube 1165 through a support 1180 and then passes into a ferrule 1183 which is connected to a lens housing 1184 . lens housing 1184 supports a fresnel lens 1185 which collimates light emitted from the distal end 1181 of fiber optic cable 1182 . in the embodiment illustrated in fig3 , a support 1180 is connected to exterior wall 1140 and interior tube 1165 in order to provide a water tight conduit for fiber optic bundles 1182 , as well as to provide positional support for interior tube 1165 . the arrows pointing to the right in the reaction portion 1150 of the bioreactor indicate the flow of algae and / or other organisms or compounds , such as carbon dioxide , which will flow through the tubular reactor . fig3 illustrates an alternative embodiment of the present invention wherein the interior light distribution source is in the form of a light emitting rod which is illuminated from both ends . the connectors which are positioned at either end of light emitting rod 2162 are similar to those described above in connection with fig3 , however instead of using fresnel lenses , planar - convex lenses 2185 are illustrated . while the embodiment of fig3 illustrates a light emitting rod , it is also within the scope of present invention to use a light distribution tube , e . g . a liquid filled light distribution tube . additionally , while each of the illustrated embodiments show a single interior source of illumination , it is within the present invention to use a plurality of elongated light sources which emit light along substantially their entire length . fig3 and 39 illustrate an alternative embodiment of the present invention wherein interior light distribution source 3160 comprises led 3172 connected to parabolic reflector 3174 which collimates the led light and directs it into light emitting rod 3162 . this embodiment comprises a single led 3172 within reflector 3174 . rod 3162 and led 3172 are housed in an outer protective tube 3164 , also preferably made of fep . in this embodiment , electrical wires 3171 provide electrical energy to led 3172 . fig4 and 41 illustrate a similar embodiment to that shown in fig3 and 39 , however instead of a single led 3172 within a single reflector 3174 , this embodiment comprises a plurality of leds 3272 and a corresponding reflector 3274 for each led 3272 , all of which are housed within a single outer protective tube 3264 . while this embodiment illustrates three leds , it is also within the scope of the present invention to use a greater number of leds to provide either more light or to provide different wavelengths of light . thus , each of the leds can emit light of a different wavelength , if desired . while the illustrated tubular bioreactors of the present invention have been illustrated in a generally horizontally orientation , it is also within the scope of the present invention to orient the tubular bioreactor vertically or at some intermediate angle . it will also be understood that while the illustrated tubes are cylindrical and have circular cross sections , other cross - sectional shapes can be utilized for the tubes without departing from the scope of the present invention , though generally circular cross - sections are presently deemed preferred . these tubular bioreactor embodiments of the present inventions provide the advantage of allowing illumination to be provided to the bioreactor from the sun during daylight hours and alternatively or simultaneously to the interior of the reactor either while the sun is not shining such as during the night and / or on cloudy days . additionally , the ability to illuminate the reaction area of the bioreactor with different light sources such as leds , metal halide lamps and plasma lamps provides the ability to separately provide different wave lengths of light and / or different light stimuli such as pulsed light to the bioreactor . according to another embodiment of the present invention , a tube - within - a - tube bioreactor comprises only an internal light source such as an ldt , liquid filled ldt or ler . providing an outer wall which is not translucent provides greater control of the light reaching the reaction area of the bioreactor .	6
according to the present invention , here it is provided a dismountable , ultra light stations system to exhibit items and attend customers , which comprises at least one light , easy to assemble universal module , without mechanical interlocking elements and very solid , which may optionally be attached to a connecting module , or optionally be attached to an ear module , or optionally be attached to multiple exhibiting applications ; all above act as basic pieces to create a plurality of forms of exhibit stations , that may grow in horizontal and / or vertical direction according t the needs and preferences of the user . the universal module of the present invention is illustrated in fig1 with the reference number 10 ′, which may be associated as one unit of the general structure of the exhibit station of commercial items or for other purposes of stations for public attention . the cited universal module 10 ′ comprises in its structure a plate or cover lid 12 , or rigid material , i . e ., from formica , in elliptic way . as illustrated in fig5 , cover lid 12 is provided , in the margin edge of its inferior surface , of a nervure 20 parallel to its edge . nervure has fixedly joined around its exterior wall , extending vertically down , one of the two bands or strips , cooperating each other to form a velcro union ( registered brand from velcro usa ®), being the other strip cooperating to form said union firmly adhered along the internal surface area of the cross section edges 32 ( fig2 and 3 ), of a flexible partition wall 30 , ( fig2 ) forming the vertical side wall 10 of the universal module 10 ′. flexible partition wall 30 is formed by a series of elongated wood members joined each other longitudinally in side to side relation by the action of a glue able to form a flexible union between the sides which are in contiguous relation of two of said adjacent elongated members . elongated wood members forming said flexible partition wall 30 have a cross section of regular trapezoidal shape with its lower base directed toward the inside of the room to be formed , and with its higher base joined by an adhesive , to a layer of cloth ( fig4 ) of textile material . elongated wood member 33 ( fig4 ) located in the edges is wider than that of elongated elements disposed in the remainder area of said partition wall , since said member 33 will support the stresses derived from the installation of the door 8 ( fig1 ) of the cabin . given the trapezoidal form of the cross section of said elongated elements , between each pair of them , it is defined an empty space 28 of angular shape ( fig4 ), space which allows a degree of turn for mutual closing of oblique side walls of elongated adjacent elements 34 ( fig2 and 4 ). the above described flexible laminar material , is designated along the present specification , for purposes of easy reference , with the term “ tensaflex ”. continuing with the construction of the universal module 10 ′, its vertical side wall 10 is formed by a partition wall 30 ( fig1 and 2 ) of material tensaflex , superimposing its upper cross section 32 , ( fig2 ), on a union strip velcro 31 arranged firmly around the peripheral exterior surface of the nervure 20 ( fig5 and 6 ) and applying pressure to form the velcro union between the before cited strips 31 and 32 . additionally , since the structure of the universal module 10 ′ comprises also a bottom board or partition wall 14 ( fig7 and 8 ), it is also similarly joined , by a velcro union , to the flexible partition wall 30 , forming the vertical wall 10 , which along its inferior cross sectional strip 32 , under its assembled condition , will be faced to join a respective band of velcro arranged firmly around the exterior vertical surface 32 ′ of a nervure which is projected outside of the board from its base 14 . universal module 10 ′ of the system of the present invention , may have its vertical body for deposit without any other additional element adhered to the interior of its structure , or may also include along its height , one or more internal cross sectional shelves or partition walls 16 ( fig1 and 10 ), which are fixedly joined to the internal surface of the vertical wall 10 of the universal module , by a velcro union which is achieved by the cooperation of a strip section of velcro union 32 joined around the external edge of the shelf 16 which , under its installed condition , is facing a cross section of velcro strip 32 ′ arranged cross sectionally at a convenient desired height on the internal wall of the side wall 10 formed by a partition wall 30 of tensaflex , as illustrated in fig3 . side wall 10 of the universal module 10 ′ formed with the partition wall of tensaflex 30 , may form a vertical body for totally closed deposit , or may define a rectangular opening along its height , through which these is access to the interior space of said universal module 10 ′. in said rectangular opening it is normally installed a door 8 ( fig1 ) by conventional means . shelves 16 ( fig1 and 10 ) installed cross sectionally at different levels along the height of the universal module 10 ′ have a edge section cut in straight line , of length substantially equal than the size of the width of said door , to which cut edge of said shelves is faced . lid or cover 12 making part of the universal module illustrated in fig1 , may be elliptic as in the case of fig7 and 8 , or rectangular as in the case of fig1 , 12 and 35 , or may comprise all the non limiting possibilities of lid or cover that were described here previously . as indicated before , the system of the present invention comprises not only the use of at least one universal mode , described before , but also it comprises the installation of one or more specially configured connecting modules , between universal modules described above . said connecting modules comprise several types allowing to join two , three or more universal modules , and which are designated in the present invention as two - way , three - way or more connecting modules , as explained before . in the case of two - way connecting modules , they may be curved as that indicated in the reference numeral 17 in fig1 , or straight ones as that observed in fig1 . said curved connecting modules are formed by a cover lid board 18 ( fig1 , 14 , 15 and 16 ), of elongated form which extends in longitudinal way along a curvature arch formed to the curvature in which universal modules 10 ′ are installed , in an exhibit station of circular installation , as that illustrated according to the fig2 . against the inferior surface of the cover lid board 18 ( fig1 , 15 and 16 ) a board 17 ′ is arranged , being the arranged in such way that between elongated edges of the cover lid board 18 and of the board 17 ′, joined on their inferior surface , it is defined a rabbet on the vertical surface from which one of the velcro strips is joined , which will cooperate with the other one of the velcro strips joined along the upper cross sectional edge of the partition wall of vertical side wall 15 , constituted by the material designated , and already described as tensaflex . in similar way , against the upper surface of the bottom board 18 ′( fig1 and 18 ) there is a board 17 ″, being said board 17 ″ less wide than the bottom board 18 ′, so that along their higher sides , there is a rabbet 19 ′ on the vertical surface from which one of the velcro strips is joined , and cooperates with a velcro strip disposed along the inferior cross sectional edge of the board of material tensaflex forming the vertical side wall 15 of said connecting module 17 . curvature arch formed in the opposite ends of the cover boards 18 and of bottom boards 18 ′( fig1 ), is geometrically configured to cover tightly the surfaces of each end of vertical walls 15 of universal modules 10 ′, in a simple exhibit station in circumferential arrangement , as that illustrated in fig2 , so that vertical side wall 15 opposite each other , of the connecting modules 17 , will be located in the same circumferential arrangement than said universal modules 10 ′. two - way connecting modules 17 illustrated in fig1 and 14 , allow to create simple basic exhibit stations as those illustrated in fig1 or 20 , or more complex exhibit stations based on said simple exhibit stations illustrated in fig1 or 20 . two - way connecting modules 17 ( fig1 and 14 ) are different from three - way connecting modules 40 ( fig2 ) basically in the number of side walls . indeed , while in two - way connecting module two side walls of material named as tensaflex are used , in the three - way connecting module , three side walls are used . a three - way connecting module 40 as that illustrated in fig2 , is formed by a cover lid board 42 and a base boards 43 , both of irregular shape in way of triangle , that instead of vertices or tips , present some curvature arches which are formed and follow the same curvature of the side wall of universal modules 10 ′ of the system of the present invention . along the opposite exterior longitudinal edges of the cover boars 42 of the three - way connecting module 40 , there is a rabbet , on the vertical surface from which one of the velcro strips is joined , that will cooperate with the other of the velcro strips joined along the upper cross sectional edge of the partition wall of vertical side wall 41 , constituted by the material designated , and already described as tensaflex . in similar way , along the three higher sides of the board 43 there is a rabbet on the vertical surface from which one of the velcro strips is joined , that cooperate with a velcro strip arranged along the inferior cross sectional edge of the board of material tensaflex , forming the vertical side wall 41 of said three - way connecting module 40 . three - way connecting modules 40 illustrated in fig2 , allow to create basic exhibit stations with “ y ” shape as that illustrated in fig2 , or more complex exhibit stations based on the basic exhibit station with “ y ” shape . alternatively , universal modules , as well as connecting modules , and in general any element making part of the system of the present invention , may use for assembling signals or guide points , as those indicated with the reference number 44 in fig2 , on the cover boards , base boards and side wall indicating the user the most appropriate way to join the different pieces of the units and modules integrating the system of the present invention . as indicated before , to form the exhibit stations of the stations system of the present invention , there are used as basic elements , above mentioned universal modules and connecting modules . to achieve this objective , side walls of two , three or more ways connecting modules have a vertical band of velcro in their ends , which allow to join in detachable way , connecting modules to the textile cloth that is in the exterior surface of the side walls of the universal modules . by alternating connecting modules between the universal modules , an user may create a plurality of designs and shapes of exhibit stations which goes from a simple set composed by two universal modules and a two - way connecting modules joining said universal modules , to much more complex exhibit stations that use several universal modules joined by straight or curved , two - way or three - way or more ways connecting modules , forming circular , elliptical , rectangular and y stations , and any other type of exhibit station that the user desires , including stations with ear modules as those described below . the exhibit stations system of the present invention also envisages , in one of their modes , the provision of means to extend , either in straight line or arched line , universal modules 10 ′ in the formed exhibit stations , as observed in example in fig3 and 35 . thus , in example , to provide an exhibit station with their units 10 ′ in straight line , the present invention envisages to install ear modules 11 ′, fig2 and 34 , consisting on units formed by a cover lid board 9 ( fig2 , 26 , 27 and 34 ), which is essentially a general elliptic contour board having in one of their ends a rabbet area according to a curvature arch 7 , which is developed according to a curvature arch that is adapted to be formed to the curvature arch of the end zone of the side wall of the basic unit 10 ′. ear module 11 ′, may be provided alternatively of a cover or cover board 9 ′ of rectangular shape , as illustrated in fig2 , 29 , 30 and 35 . also , ear module 11 ′ is provided of a rigid bottom board 14 , ( fig2 , 31 , 32 and 33 ), having in its side region of edge , supported on a nervure 6 ′ projected vertically toward the inside of it . vertical wall 11 of the ear module 11 ′ is formed by a laminar section of above described material tensaflex ( fig2 ). height of ear module 11 ′ diminishes preferentially progressively as each module is installed far from said universal module 10 ′ which is in the exhibit station formed with the system of the present invention . ear modules 11 ′ are generally joined to a universal module 10 ′ as illustrated in fig3 and 35 , but also they may be joined each other by two - way , three - way or more way connecting modules as those described before . vertical wall 11 of the ear module 11 ′ is joined , both to the cover board 9 and the bottom board 14 ′, by velcro unions made by cooperating strips 32 installed in faced way as well in regions of cross sectional , upper and inferior edge , of the partition wall of material tensaflex 30 forming the vertical wall 11 , as in appropriate places of both cover 9 and bottom 14 ′ boards . ear modules 11 ′ may be used in any type of exhibit station formed with the system of the present invention , including those using two - way , straight or curved connecting modules or three - way or more way modules . as indicated before , the dismountable , ultra light stations systems to exhibit items and attend customers of the present invention , also comprises multiple exhibiting applications , which are selected from the group consisting of showcase modules ; light modules to place advertisement or similar objects that may be lighted ; parasols ; advertisement pennants ; cd exhibitors ; books exhibitors ; diverse item exhibitors ; perforated and non perforated trays holding each other or that are slopped by a supporting element joined to the tray by a hinge ; being these multiple exhibiting applications placed only on the flat cover of the universal module , of the connector module or the ear module , or being these multiple exhibiting applications supported on the modified cover of the universal module , from the connecting module or the ear module , or on the cover of another multiple exhibiting application , that may exhibit grooves , velcro strips or similar adaptations . one of the multiple exhibiting applications making part of the system of the present invention , consists on a showcase module indicated with the reference number 45 in fig3 . said showcase module 45 has a vertical body for deposit of general elliptic shape cross section , which is provided of a cover lid 46 and , vertically separated of it , from a base board 47 , being provided the upper surface of said base board , toward the center and around its external edges , of a groove receiving two side beams 48 as posts , which have grooves adapted to receive one , two or more shelve boards 49 of transparent material , each with a separator ( non illustrated in fig3 ), located under each shelf , to provide stability to the structure of the shelf , and an upper beam ( non illustrated in fig3 ), joining the two beams to give stability to the structure and to support the cover lid 46 of the showcase module 45 to which it is joined by a velcro type union , having said showcase module a frontal panel 50 of transparent material , and two posterior panels 51 of transparent material matching in the groove of the base board , being said posterior panels separated each other to define a door opening . showcase module 45 illustrated in fig3 , may additionally include a door installed by conventional means , in the door openings giving access to the internal storage space of the showcase module . another of the multiple exhibiting applications making part of the system of the present invention consists on a light module as those illustrated in fig3 , 38 and 39 . light module 52 illustrated in fig3 has a vertical body of deposit of general elliptic shape cross section , which is provided of a cover lid 53 and , vertically separated from it , of a base board 54 , having the upper surface of said base board 54 , toward the center and around its external edges , a groove receiving two side beams 55 in way of posts , joined in the upper part by a beam 56 giving stability to the structure and supporting the cover lid 53 of the light module 52 to which it is attached by a velcro type union or any other type of union , being said base board also adapted to install one or more bulbs 57 or similar objects , and having said light module a frontal panel and a posterior panel , both of transparent material matching in the groove of the base board and allowing to place any type of advertisement or similar objects that may be lighted . another mode of before described light . module is appreciated in fig3 and 38 , wherein the base of said module 58 is composed by a universal module 10 ′ as that described before , having its lid or upper cover of square type , and being the side wall of said module totally closed . this type of light module 58 has a structure to be matched in a groove , or that may be adhered to the rectangular lid or cover by a velcro union strip . said light module comprises a frontal panel 59 and a posterior panel 60 , both or only one of them of transparent material , that are either supported by pressure executed each other , or they are joined in their upper part by a velcro union strip . also , two side panels 61 make part of this kind of light module , with shape of triangle supported by the frontal 59 and posterior 60 panels by the pressure executed on them , or adhered to said posterior 60 and frontal 59 panels by a velcro type union . in the space formed by posterior 60 and frontal 59 panels , there are normally installed one or more bulbs 52 or similar objects , which allow to light an advertisement or similar object that may be lighted , and which is placed on one or two posterior and frontal panels . an item exhibitor constitutes another of the multiple applications making part of the system of the present invention . an item exhibitor 63 such as cd &# 39 ; s , illustrated in fig4 has a structure that may be matched in a groove , or may be adhered to the lid or cover 12 of rectangular type of a described before universal module 10 ′, by a union velcro strip . this exhibitor 63 comprises a frontal panel 64 and a posterior panel 65 that are either supported by pressure executed each other , or they are joined in their upper part by a velcro union strip . said exhibitor 63 also includes two side panels 66 with shape of triangle supported by the frontal and posterior panels by the pressure executed on them , or be adhered by said posterior and frontal panels by a velcro type union . posterior and frontal panels of the exhibitor 63 , illustrated in fig4 have a series of shelves 67 allowing to support cd &# 39 ; s or similar objects . nevertheless , distance between said shelves 67 may be higher as in the case of exhibitor 63 illustrated in fig4 , to receive books or similar objects ; or the exhibitor 63 may just not have shelves , but being constituted by a special cloth to which products to be exhibited are adhered , as in the case illustrated in fig4 . another multiple exhibiting application making part of the system of the present invention consists on a diverse items exhibitor 68 illustrated in fig4 which has a structure that may be matched in a groove , or that may be adhered to the lid or cover 12 of rectangular type of a before described universal module 10 ′, by a velcro union strip . said exhibitor 68 comprises a central panel 69 matching in the central vertical grooves of two side panels 70 , forming a “ h ” shape structure from an upper view , and a plurality of shelves , matching in horizontal way corresponding grooves specially arranged in the interior part of side panels 70 to form a series of shelves to receive any type of items which adapt to the size of said shelves , having also , side panels a plurality of shelves 72 in their external part . another mode of diverse items exhibitors is illustrated in fig4 . this diverse items exhibitor 73 has a pyramidal structure that may be matched in a grooves , or that may be adhered to the lid or cover 12 of rectangular type of a before described universal module 10 ′, by a velcro union strip . this exhibitor 73 comprises a frontal panel 74 and a posterior panel 75 of trapezoidal shape that are either supported by pressure executed each other , or they are joined in their upper part by a velcro union strip . said exhibitor 73 also includes two side panels 76 of shape of triangle supported by the frontal and posterior panels by the pressure executed on them , or adhered to said posterior and frontal panels by a velcro type union . posterior , frontal and side panels of exhibitor 73 illustrated in fig4 have a series of shelves 77 , totally surrounding the structure formed , and which allow to support any type of items adapted to the size of shelves formed by said shelves 77 . another multiple exhibiting application making part of the present invention consists on exhibitors composed by perforated or non perforated trays as those illustrated in fig4 , 46 and 47 . fig4 and 46 , for example , illustrate a before described universal module 10 ′, which lid or cover 12 has been adapted to the shape of a tray , being said tray of a size reaching the edge of the lid or cover 12 as in the case of the exhibitor illustrated in fig4 , or being said tray of a size lower than the size of the lid or cover 12 . this type of exhibitors composed by trays may also be a structure as that described in fig4 , which must be matched to a groove or may be adhered to the lid or cover 12 of rectangular type of the above described universal module 10 ′, by a velcro type union . this type of exhibitor 81 comprises a frontal tray 78 , a posterior tray 79 and side trays 80 that are either supported by pressure executed each other , or they are joined by velcro union strips , as illustrated in fig4 . this type of exhibitors composed by trays may also be a structure ( fig4 ) composed by a sole tray which is slopped by a supporting element joined to said tray by a hinge that may be supported in a groove or that may be adhered to a specially arranged velcro strip on the rectangular lid or cover of a universal module . another multiple exhibiting application making part of the system of the present invention consists on a clothing exhibitor 82 illustrated in fig4 and which has a structure in way of coat rack that may be matched in a groove or that may be adhered to the lid or cover 12 of rectangular type of an above described universal module 10 ′, by a velcro union strip . said clothing exhibitor 82 comprises a central panel 83 , two triangle shape panels 84 and two beams 85 , that when they are joined form a structure in way of coat rack allowing to receive clothing on beams 85 . other multiple exhibiting applications making part of the system of the present invention comprise the modification of the storage space of the above described universal module 10 ′. thus , in a preferred mode illustrated in fig4 and 50 , the multiple exhibiting application comprises a universal module 10 ′ in which internal storage space it has been installed a polystyrene refrigerator 86 illustrated on fig5 , of cross section in general elliptic way , and having an access door 87 . in other preferred mode illustrated in fig5 and 52 , the multiple exhibiting application comprises a universal module 10 ′ in which lid or cover 12 has a gate 89 allowing to introduce inside the module tickets , envelopes or any other object inside a box 88 which is located on a flange of the opening of the gate 89 of the lid or cover 12 of the universal module 10 ′. several modifications may be done regarding the structural arrangement described in specific way previously , without departing from the scope and spirit of the present invention , which is defined by the following claims .	0
referring to fig1 of the drawings , a disperser 18 is attached to the side of a building 10 on vertical facia board 12 below the edge 16 of roof 14 . the disperser 18 is positioned adjacent the base of facia board 12 spacing it below roof edge 16 a limited distance in the path of water falling therefrom and , as shown , spacing it substantially above the ground . disperser 18 includes mounting means 20 having a vertical base 22 positioned against facia board 12 and secured thereto by screws 24 , best shown in fig2 and 4 . in the embodiment illustrated in fig1 - 4 , mounting means 20 comprises a plurality of mounting brackets ( one only is illustrated ) having , in addition to bases 22 , support arms 26 extending outwardly from bases 22 in a generally horizontal direction . arms 26 each include an upper straight supporting edge 28 set at a slight angle downwardly from the horizontal , about 10 °, in a direction outwardly from base 22 and include a pair of spaced edges 30 , 32 at right angles to straight support edge 28 . disperser 18 also includes a planar member 34 including generally planar , upwardly directed intercepting surface 36 elongated in its dimension parallel to building 10 . planar member 34 is positioned with the elongated dimension of intercepting surface 36 horizontally aligned with roof edge 16 . intercepting surface 36 extends widthwise , away from board 12 , a distance into and intercepting the path of water falling from roof edge 16 . member 34 is supported on support edges 28 of mounting means arms 26 . thus , intercepting surface 36 is angled downwardly away from building 10 . spaced flanges 38 , 40 on the elongated outer and inner edges of support surface 36 frictionally engage edges 30 , 32 of arms 26 to retain member 34 in place , see fig3 . supplemental fasteners , not shown , may additionally be employed to retain member 34 on arms 26 , if desired . intercepting surface 36 is interrupted by a plurality of apertures 42 interrupting the width of surface 36 in cross section best shown in fig3 and 4 . deflecting surfaces 44 , louvers in the illustrated embodiment , are connected to intercepting surface 36 at each aperture 42 . the apertures 42 and deflecting surfaces 44 are elongated in the same direction as intercepting surface 36 . the deflecting surfaces 44 are inclined downwardly in one direction from intercepting surface 36 , at an angle of about 35 ° in the preferred embodiment , the deflecting surfaces 44 connected to the side of apertures 42 adjacent mounting means 20 defining channels directed downwardly , at an angle of about 45 ° from the horizontal , and outwardly from building 10 . sets of louvers 44 are interrupted by narrow widthwise extending portions of intercepting surface 36 to provide structural integrity to the member 34 and to receive and locate arms 26 therebetween , preventing transverse dislocation thereof . in fig5 is illustrated an alternate embodiment in which the mounting means 20 comprises an integral upturned flange 46 of disperser 18 . flanges 38 , 40 of the embodiment of fig1 - 4 , are unnecessary and are omitted in this embodiment . in this embodiment a heating cable 47 to melt ice or snow is shown secured to the disperser 18 against the intercepting surface 36 by a tab 48 in flange 46 and the disperser is made of conductive material , e . g . aluminum . in fig6 is illustrated an alternate mounting means 20 , comprising a bracket 50 having a vertical portion 52 for connection to a facia board , an integral support arm 54 having an upwardly and forwardly extending first tab 56 thereon and a leg 58 at the end thereof remote from vertical portion 52 with a second tab 60 facing downwardly and toward vertical portion 52 . the inner edge 35 of member 34 fits under first tab 56 , which locates the inner edge , and leg 58 is received in an aperture 62 in primary surface 36 , second tab 60 locking over primary surface 36 . in fig7 yet another alternate mounting means 20 is illustrated , comprising a bracket 70 in which the support arm 72 is divided into three segments 74 , 76 , 78 , the middle element 76 spaced slightly above elements 74 , 78 to frictionally receive and engage member 34 therebetween . in fig8 disperser 18 is shown in combination with rain guide 80 which may be integral therewith , as illustrated or which may be separate . guide 80 comprises an arcuate surface 82 abutting roof 14 at edge 16 , roof 14 essentially tangent to the arc of surface 82 . surface 82 curves downwardly from roof edge 16 as a curved extension of roof 14 and terminates over disperser 18 . water from roof 14 will follow the curved surface 82 of guide 80 to fall upon disperser 18 in a more controlled fashion than if permitted to follow a trajectory from roof edge 16 . in fig9 is illustrated an embodiment , presently preferred , of a disperser comprising longitudinal , parallel stringers 84 , positioned and retained by structural supporting elements 86 which run transverse to the stringers 84 . typical mounting means is shown as the bracket 88 which is attached to the facia by screws through holes as shown . in practice , stringers 84 preferably consist of aluminum strips 0 . 600 inch wide , 0 . 032 inch thick , and 6 feet long . however , these are stated as preferred dimensions , but other values can serve as well within the spirit of this invention . as shown in fig1 , stringers 84 are supported by , and bonded to , tabs 90 , said tabs being integral parts of transverse element 86 . in preferred embodiments stringers 84 and tabs 90 are bonded by resistance or ultrasonic welding means , but other means such as epoxy may also be used . in fig1 is shown an end view of the bracket 88 supporting disperser stringers 84 on bearing surface 94 by means of the inherent rigidity of the disperser assembly . preferably , end tab 96 engages a stringer other than the leading stringer 106 , the second stringer being shown engaged by said end tab as an example , impeding forward and upward movement of said engaged stringer ; the most rearward stringer 107 lies along inclined surface 98 , thereby being impeded in rearward movement , and being engaged by lip 92 is thus impeded from upward movement as well . as a consequence , the disperser assembly , by virtue of its rigidity , is advantageously locked into position . the mounting means illustrated allows a disperser assembly to be snapped into , and unsnapped from , its mounted position by application of force transversely to the stringers at or near the mounting point , said application of force causing transverse flexure of the stringers sufficient to allow passage of stringer 107 past lip 92 after previous engagement by tab 96 such that , upon release of said force element 107 is forcibly retained by said lip , thereby effecting advantageous restraint of the entire disperser assembly . fig1 illustrates the preferred structure assembly of supporting element 86 and a stringer 84 . tabs 90 are typically cut from element 86 and bent at right angles as shown providing surface portions 102 suitable for bonding stringers 84 thereto . in preferred embodiments stringers 84 are slotted , a typical slot 100 being shown , to engage the adjacent leading wall 103 when assembled on a tab 90 , thereby providing advantageous compactness to the disperser assembly . the leading tab 104 preferably engages corresponding leading stringer 106 , shown in fig1 and 11 , such that said leading stringer need not be slotted , being held solely by its bond to said tab 104 , thereby presenting a preferred continuous appearance as illustrated in fig9 . fig1 illustrates another embodiment of a structural supporting element in two parts 108 , 109 associated with the disperser assembly of fig9 . in this embodiment two identical members 108 and 109 are used in opposing fashion , element 109 being element 108 rotated 180 °, the while remaining substantially parallel to the latter . members 108 and 109 contain slots 110 , 111 positioned so as to receive stringers , typically shown as 112 . slots 110 and 111 are positioned opposite each other and engage corresponding stringer slots 113 and 114 , respectively , upon mutual and opposing closure , said closure being touching and substantially parallel contact of 108 and 109 . stringer 112 is thereby mechanically retained between 108 and 109 by aforesaid slotting means , said elements 108 and 109 being bonded together by welding , crimping , or epoxy means . leading and trailing stringers , 106 and 107 , respectively , are bonded to tabs 104 and 105 integrally formed from members 108 , 109 to complete the assembly . in use , mounting means 20 or 88 are secured to facia board 12 to position members 34 or 84 a limited spaced distance below roof edge 16 . rain water run - off from roof 14 falls freely from roof edge 16 to members 34 or 84 and deflecting surfaces 44 or 84 . the force of impact of the stream with surfaces 44 or 84 causes the stream to be broken up . some splashing may occur causing a random dispersal of some water over the disperser outer edge . a major portion of the water , however , passes through the apertures between surfaces 44 or 84 in a multiplicity of separate paths outwardly away from building 10 . thus , the initial stream of water from roof 14 is separated and directed by such means away from the building to fall in a shower of separate sprays in a random dispersal pattern on the ground over an extended area . the dispersal effect is enhanced as adjacent sprays from deflectors 44 or from elements 84 typically collide with each other from time to time . the deleterious effects of water falling directly to the ground from roof edge 16 are avoided without the necessity of employing gutters with their several disadvantages . other embodiments of this invention will occur to those skilled in the art which are within the scope of the following claims .	4
refer now to the drawings wherein depicted elements are , for the sake of clarity , not necessarily shown to scale and wherein like or similar elements are designated by the same reference numeral through the several views . referring to fig2 of the drawings , the reference numeral 200 generally designates a driver in accordance with a preferred embodiment of the present invention . the driver 200 generally comprises a main driver 202 that receives data over a several main input channels in and outputs data through several main output channels out . the driver 200 also includes circuitry that communicates over an auxiliary channel , namely , decoder 204 and auxiliary logic 206 . the decoder 204 generally comprises a synchronizer 208 , a data counter 210 , a state machine 212 , a bit counter 216 , an error / status register 214 , and registers 218 and 220 . preferably , the synchronizer 208 is generally comprised of flip - flops that are used to reduce the probability of the meta - stability due to the asynchronous inputs . turning to fig2 and 3 , an example of the general operation of the decoder 204 can be seen . the decoder 204 begins in a default state default when an enable signal ena is asserted . in the default state default ( which is reflected in the error / status register 218 ), the state machine 212 clears its unit interval ( ui ) counter and its sum counters , and the state machine 212 monitors the output of data counter 210 . preferably , data counter 210 receives the auxiliary clock aclk and input signal adin and is able to measure whether a valid ui is received . data counter 210 does this by incrementing a one - counter value by one for each cycle of the auxiliary clock aclk when the input signal adin is “ 1 ” and by incrementing a zero - counter value by one for each cycle of the auxiliary clock aclk when the input signal adin is “ 0 .” based on the one - counter value , the zero - counter value , and the input signal adin , the state machine 212 can determine when to enter into an acquisition state acq . preferably , the state machine 212 transitions from the default state default to the acquisition state acq when : ( 1 ) the input signal is “ 1 ” and the zero - counter value is between a ui lower bond value and an ui upper bound value ; or ( 2 ) the input signal is “ 0 ” and the one - counter value is between a ui lower bond value and an ui upper bound value . both the iu upper bound value and the ui lower bound value are input into the decoder 204 based at least in part on the operating frequency jitter / variance across the entire operating time , corresponding to a signal ui bit duration . in the event that the one - counter value or the zero - counter value is outside of the interval between the ui upper bound value and the lower ui value , an error condition error 1 or an error in the receipt of a ui is determined ( and recorded in error / status register 218 ), and the decoder 204 remains in the default state default . if the error condition error 1 is not present in the default state default , the state machine 212 updates the error / status register 218 to reflect a change to acquisition state acq . in the acquisition state acq , the state machine 212 acquires the initial 28 uis . preferably , the state machine 212 acquires a set of 0 . 5ui , 1 . 5ui , 2 . 5ui , 3 . 5ui , 4 . 5ui , and 5 . 5 ui . at the same time , the state machine 212 determines whether the error condition error 1 is present . if the error condition error 1 is present , then the state machine 212 would revert back to the default state default ; otherwise , a synchronization state synchigh is assumed . when the decoder 204 enters the synchronization state synchigh , the state machine 212 also updates the status / error register 214 to reflect the change in state . in the synchronization state synchigh , a determination is made as to whether the error condition error 1 is present . also , a determination is made as to whether one - counter value is between a 5 ui lower bound value and a 5 ui upper bound value when the input signal is “ 0 .” both the 5iu upper bound value and the 5 ui lower bound value are input into the decoder 204 based at least in part on the operating frequency jitter / variance across the entire operating time , corresponding to a five ui bit duration . in the event that the error condition error 1 is present or the one - counter value is outside of the interval between the 5 ui upper bound value and the lower 5 ui value and a the sync signal sync is not asserted within 69 uis ( error condition error 2 ), the state machine reverts to the default state default . when the state machine is in the acquisition state acq and the synchronization state synchigh state , the state machine 212 is able to obtain multiple ui counts without averaging , which can be seen in fig5 . for the displayport standard , the standard protocol calls for no more than 5 uis without toggling . ideally , counts are desirable at 0 . 5ui , 1 . 5ui , 2 . 5ui , 3 . 5ui , 4 . 5ui , and 5 . 5ui so that the data can be decoded without aliasing . normally , for a single ui sample ( even if averaged and for the case of 5 . 5ui ), there will be an accumulated error of 5 . 5 times the round off error per ui , which is undesirable . thus , to avoid this problem , the state machine 212 counts 0 . 5ui , 1 . 5ui , 2 . 5ui , 3 . 5ui , 4 . 5ui , and 5 . 5ui directly . to perform these counts in a digital domain for half - integer uis , integers that are divisible by two , which are derived from sum counters and ui counter within the bit counter 216 , are used to generally avoid a loss of resolution . as can be seen in fig5 , state machine 212 uses one ui counter and five sum counters 51 through s 5 to perform the counting . initially , when the state machine 212 enters the acquisition state acq ( or when the ui counter is at 0 ), sum counter s 1 begins counting cycles of the auxiliary clock aclk , while sum counters s 2 , s 3 , s 4 , and s 5 begin counting when the ui counter is at 8 , 16 , 24 , and 32 , respectively . preferably , when the ui counter reaches 32 , sum counter s 1 is cleared and reused as sum counter s 5 . the 0 . 5ui can then be updated by dividing the value of sum counter s 1 , s 2 , s 3 , s 4 , or s 5 by 32 when the ui counter reaches 16 , 24 , 32 , 40 , or 48 , respectively . by dividing by 32 , the lower five bits of 0 . 5ui can be dropped . the 4 . 5ui can then be updated by dividing the value of sum counter s 1 , s 2 , s 3 , s 4 , or s 5 by 4 when the ui counter reaches 18 , 26 , 34 , 42 , or 50 , respectively . by dividing by 4 , the lower two bits of 4 . 5ui can be dropped . the 2 . 5ui can then be updated by dividing the value of sum counter s 1 , s 2 , s 3 , s 4 , or s 5 by 8 when the ui counter reaches 20 , 28 , 36 , 44 , or 52 , respectively . by dividing by 8 , the lower three bits of 2 . 5ui can be dropped . the 5 . 5ui can then be updated by dividing the value of sum counter s 1 , s 2 , s 3 , s 4 , or s 5 by 4 when the ui counter reaches 22 , 30 , 38 , 46 , or 54 , respectively . by dividing by 4 , the lower two bits of 5 . 5ui can be dropped . the 1 . 5ui can then be updated by dividing the value of sum counter s 1 , s 2 , s 3 , s 4 , or s 5 by 16 when the ui counter reaches 24 , 32 , 40 , 48 , or 56 , respectively . by dividing by 16 , the lower four bits of 1 . 5ui can be dropped . the 3 . 5ui can then be updated by dividing the value of sum counter s 1 , s 2 , s 3 , s 4 , or s 5 by 8 when the ui counter reaches 28 , 36 , 44 , 52 , or 60 , respectively . by dividing by 8 , the lower three bits of 3 . 5ui can be dropped . as detailed above multiple overlapping sum counters s 1 through s 5 are employed , where the latest measurement would have priority over earlier measurements . additionally , as the limit of the width of ui can generally be 7 bits , each of the sum counters s 1 through s 5 is generally 144 bits wide to count up to 28 ui widths . the ui counter may also count up to 69 uis . turning back to fig3 and 4 , the state machine 212 is able to decode the incoming manchester - ii encoded data using the window lengths . following the synchronization state synchigh , the decoder 204 can enter a synchronization state synclow . in the synchronization state synclow , the ui counter and sum counters s 1 through s 5 are cleared , and the state machine 212 determines whether one of two conditions is present . preferably , the state machine 212 determines whether one condition ( synchronization followed by a “ 0 ”) is satisfied by determining , for the input signal adin being a “ 1 ,” whether the value of zero - counter is between the 5 ui upper bound and 5 ui lower bound and between the window lengths of 4 . 5ui and 5 . 5ui ( which were calculated above ). if this condition is satisfied , then the state machine 212 determines that there is a valid “ synch - low ,” and the state machine reflects a change to acquisition state acqdatahigh with an assigned carry bit of less than or equal to one . preferably , the state machine 212 also determines whether the other condition ( synchronization followed by a “ 1 ”) is satisfied by determining , for the input signal adin being a “ 1 ,” whether the value of zero - counter is between the 4 ui upper bound and 4ui lower bound and between the window lengths of 3ui and 4ui . if this second condition is satisfied , then the state machine 212 determines that there is a valid “ synch - low ,” and the state machine reflects a change to acquisition state acqdatahighui with no assigned carry bit . otherwise , if neither the condition is satisfied , then the state machine reflects an error condition error 2 in the error / status register 214 and reverts to the default state default . in the acquisition states acqdatahighui and acqdatalowui , the state machine 212 decodes data input through the data counter 212 . preferably , the state machine 212 uses the window lengths of 0 . 5ui , 1 . 5ui , 2 . 5ui , 3 . 5ui , 4 . 5ui , and 5 . 5ui to determine whether valid data bits are present , which are transferred to or registered in registers 218 and / or 220 , or whether there is a stop condition or an error . valid data bits are generally registered in registers 218 and / or 220 in both acquisition states acqdatahighui and acqdatalowui , and after receiving 8 data bits , the state machine 212 asserts that valid data signal valid for one cycle of the auxiliary clock aclk . in acquisition state acqdatahighui , the state machine 212 determines whether one of four states is present ( all when the input signal adin is “ 0 ”): “ 0 ” as a data bit before a stop condition ; “ 1 ” as a data bit before a stop condition ; a “ 01 ” as two successive data bits ; or “ 11 ”/“ 00 ” as two successive data bits . to measure whether the first of these conditions is present , the state machine 212 determines whether the one - counter value is between 5ui lower bound and 5ui upper bound and between window lengths of 4 . 5ui and 5 . 5ui . under this condition , a valid “ stop - high ” is present ( which allows the state machine 212 to enter the stop state stop ), and a data bit ( which is less than or equal to zero ) corresponds to the carry bit . to measure whether the second of these conditions is present , the state machine 212 determines whether the one - counter value is between 4ui lower bound and 4ui upper bound and between window lengths of 3 . 5ui and 4 . 5ui . under this condition , a valid “ stop - high ” is present ( which allows the state machine 212 to enter the stop state stop ). to measure whether the third of these conditions is present , the state machine 212 determines whether the one - counter value is between 2ui lower bound and 2ui upper bound and between window lengths of 1 . 5ui and 2 . 5ui . additionally , if the carry bit is “ 1 ,” then the data bit is “ 0 ” or an error condition error 3 is present . otherwise , under this condition , the state machine progresses to the acquisition state acqdatalowui . to measure whether the fourth of these conditions is present , the state machine 212 determines whether the one - counter value is between ui lower bound and ui upper bound and between window lengths of 0 . 5ui and 1 . 5ui . under this condition , a valid “ 0 ” as a data bit is present ( which allows the state machine 212 to enter the acquisition state acqdatalowui ). if none of these conditions are present , an error condition error 4 is recorded in the error / status register 214 , and the state machine 212 reverts to the default state default . in acquisition state acqdatalowui , the state machine 212 determines whether one of two states is present ( all when the input signal adin is “ 1 ”): two successive data bits are “ 10 ”; or two successive data bits are “ 11 ” or “ 00 ”. to measure whether the first of these conditions is present , the state machine 212 determines whether the zero - counter value is between 2ui lower bound and 2ui upper bound and between window lengths of 1 . 5ui and 2 . 5ui . additionally , if the carry bit is “ 1 ,” then the data bit is “ 0 ” or an error condition error 3 is present . otherwise , under this condition , the state machine 212 enters the acquisition state acqdatahighui . to measure whether the second of these conditions is present , the state machine 212 determines whether the zero - counter value is between ui lower bound and ui upper bound and between window lengths of 0 . 5ui and 1 . 5ui . under this condition , a valid “ 1 ” is present , and the state machine 212 enters the acquisition state acqdatahighui . otherwise , a error condition error 4 is noted in the error / status register 214 , and the state machine 212 reverts back to the default state default . error conditions may also be present in the stop state stop . preferably , for input signal adin being “ 0 ,” the state machine 212 determines whether the zero - counter value is greater than 4ui lower bound and greater than 3 . 5ui and determines if the number of valid bit is seven . if these conditions are met , then a valid stop condition is present ; otherwise , an error condition error 5 is noted in the error / status register 214 , and the state machine 214 reverts back to the default state default . having thus described the present invention by reference to certain of its preferred embodiments , it is noted that the embodiments disclosed are illustrative rather than limiting in nature and that a wide range of variations , modifications , changes , and substitutions are contemplated in the foregoing disclosure and , in some instances , some features of the present invention may be employed without a corresponding use of the other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention .	7
the following is detailed description of the present invention . in the description of semiconductor production in the following , the complete process of exposure and of producing products is not included . the prior arts used continually by the present invention are only summarized to support the description of the present invention . all the diagrams used in the present invention are only to illustrate the mask layout and feature of exposing method in the present invention and not made in practical proportions . the present invention first provides a mask layout that reduces diffraction effects in semiconductor production , on which are two equally divided symmetrical patterns located on two sections of the same mask substrate . the present invention further provides an exposing method that reduces diffraction effects in the process of semiconductor production , comprising : providing a mask having two sections with pattern matching being equally divided on the mask , only the light of specific energy produced by an exposer being able to go through according to the layout pattern on the mask section in exposing process ; exposing a chip , the exposing procedure using the mask , one exposure being made to a first shot by the exposer to expose pattern of second section of the mask on the right half of the first shot ; then the exposer moving for a distance of half shot in continual exposing procedure ; then , exposing said chip for the second time , the second exposing procedure using the mask , another exposure being made to said first shot by said exposer to expose pattern of first section of the mask on the right half of said first shot to make a complete pattern . in order to disclose the difference between the present invention from the prior technique , the process of producing idt of saw filter is mainly used to illustrate the difference in the following detailed description . what is shown in fig2 a and fig2 b is layout on a mask of the present invention . the mask is equally divided into two sections , including the first section and the second section , in which are a plurality of identical patterns . furthermore , patterns in the first section and second section are symmetrical but not identical patterns . a complete pattern can be created after stack exposing procedure of the first and second section is finished . take saw filter for example . after the stack exposure of patterns on the first and second sections is finished , a complete pattern of idt can be obtained . besides , in the layout of mask of the present invention , the symmetrical pattern in each section is not confined to oblong . for example , in order to equip surface acoustic wave element with larger amplitude , the shape of idt can be designed as symmetrical pattern with appropriate radian . for another example , in order to make a circle or square spiral inductor on an active element ( such as power amplifier ; pa ), the pattern can be designed to be symmetrical with circle or square . [ 0034 ] fig3 a is a procedure for producing idt of saw filter of the present invention , and fig3 b is a detailed sub - procedure of exposing procedure 300 in fig3 a , describing exposing method of the present invention . generally speaking , in the lift - off process of producing metal thin - film , usually the process of two layers of photoresist is chosen to achieve the undercut profile . first , a lower photoresist 100 is coated on a wafer . in order to achieve lift - off effect , the lower photoresist 100 is usually pmma or pmgi . after soft - baking , a photoresist layer 200 , usually being positive photoresist , is coated . the wafer is then set in the wafer stage and carried to the exposing position . after layout direction of the mask is decided , an exposing procedure 300 is proceeded . exposing procedure is illustrated by fig3 b and fig4 . the exposing method of the present invention sets the distance that each time the exposer &# 39 ; s stage ( which is not displayed in the fig4 ) carries wafer 10 to move to be “ half of a shot 20 .” take the exposure of idt for example . procedure 310 is first carried out after an exposer receives exposing command , one exposure being made to a first shot . therefore on the left half of the first shot is exposed through pattern of the first section 31 on a mask 30 , and on the right half of the first shot is exposed through pattern of the second section 32 on mask 30 . a procedure 320 is then carried out , the exposer moving for a distance of half of the shot in the direction of x axis and another exposure being made ; at this time , on the right half of first shot is exposed through pattern of the first section 31 on mask 30 , a complete pattern of idt being finished on the right half of first shot , and on the left half of second shot is exposed through pattern of the second section 32 on mask 30 ; after the exposer makes another displacement along the x axis ( or moving a distance of half of the shot to the right ) and carries out another exposure , on the left half of second shot is exposed through pattern of first section 31 on mask 30 , the idt being completed , and on the right half of second shot is exposed through pattern of second section 32 on mask 30 . then with this method , a continual exposing procedure is carried out by using the controlling precision of the displacement of exposer itself , and the exposing procedure of idt pattern on the whole wafer is completed in a way similar to stake exposure . since the present invention carries out continual exposing procedure by controlling precision of displacement of exposer itself , the problem of overlaying and alignment of the first section 31 and the second section 32 in the exposing process can be completely solved . besides , the total moving distance of exposer for the exposure of whole wafer is not increased , so production time is still controllable . therefore , the exposing method of the present invention effectively reduces the diffraction effects without the problem of overlaying and alignment of pattern or need of extending production time . in other words , the process capability of line width can be reduced to a half , and idt with smaller line width can be produced by using the original equipment with the mask layout and operation of exposing method described by the present invention . after the exposure of wafer 10 is completed , development 500 is then carried out for an upper photoresist . wafer 10 is then sent to deep uv aligner for flood exposure process 600 and developed by process 700 . since the diffraction effects have been reduced , after the development of upper / lower photoresist is completed , overhang or t - top profile on upper photoresist can be observed from a microscope or scanning electron microscope ( sem ). an appropriate undercut is suitable for lift - off process . hence , after the evaporation of a metal thin - film layer 800 is completed , upper / lower photoresist 900 can be easily removed to create a fine idt pattern on wafer 10 . in the mask layout and exposing method described in the present invention , a continual stack exposure is carried out on the upper photoresist based on the controllable precision of exposer itself , so there is no problem of overlaying and alignment of pattern . in fig1 a , two times of exposure are carried out on the upper photoresist , therefore , not only the time of exposure is longer , but there is also a problem overlaying and alignment of pattern . in fig1 b , although the problem of overlaying and alignment of pattern is solved , the time of production is longer than that of fig1 a . therefore , the present invention , comparing with the prior technique , is obviously more advanced and commercially applicable . although the producing method of idt of specific frequency , of specific linewidth , and of saw is described in the present invention , the method of the present invention is not limited in these descriptions . the mask layout and exposing method described in the present invention can also be applied in the process of producing other products . the preferred examples include : illuminant elements , such as vertical cavity surface emitted laser ( vcsel ), laser diode ( ld ), and light emitted diode ( led ) of high illumination , positive and negative electrodes on these elements already using structure of idt to achieve the best uniform distribution of electric currents and thus enhance radiation effects of elements . besides , square or circle coiling and higher coiling density are used in the process of producing spiral inductor on microwave element to achieve higher inductor value and higher q factor . all mentioned above are several preferred embodiments of the present invention and they are not to be confined to what is claimed by the present invention . to those who are skilled in this technological field , it is easy to understand and to put into practice . therefore , those equal - effect changes or modifications completed within the spirits displayed in the invention should be included in what is claimed as follows .	6
fig1 shows a ( 100 )- silicon wafer 1 with a thickness of approx . 300 to 500 μm , the top side of which is covered with a silicon oxide layer 2 and the underside of which is covered with a silicon oxide layer 3 , for example by thermal oxidation , these layers having a thickness of a few 100 nm . next , a mask for production of the holding element 4 is fabricated by photolithography . for this purpose , a photoresist is applied to the wafer underside and patterned . then , the silicon oxide layer 3 on the wafer underside is removed at the uncovered locations , so that only the region 5 remains in place on the wafer underside . the wafer top side had previously been covered by a protective resist . all the photoresists are removed again after the photomask has been transferred into the silicon oxide . these are generally standard , conventional processes . by way of example , in this case the photoresist is applied by the spinning process and is removed by means of standard solvents . the silicon oxide layer is removed by means of buffered hydrofluoric acid ( hf ). the result is illustrated in fig2 . in the next step , which is shown in fig3 , a wet - chemical etching process , for example by means of aqueous potassium hydroxide ( koh ) solution , is used to thin the substrate material from the wafer underside and thereby to produce the holding element 4 . the thickness of the silicon membrane 6 which is formed in the process is selected in such a way that it at least corresponds to the sum of the desired height of the sensor tip which is to be formed and of the desired final thickness of the spm sensor cantilever which is to be formed . next , both sides of the wafer are oxidized , and a silicon nitride layer is applied to the wafer top side in a pecvd ( plasma enhanced chemical vapor deposition ) process . in fig4 , the silicon oxide layer on the underside is denoted by reference numeral 7 , and the silicon nitride layer on the top side is denoted by reference numeral 8 . next , a mask is fabricated for the purpose of producing boundary surfaces of the free end of the cantilever which is to be formed , these surfaces simultaneously defining two faces of the sensor tip which is to be produced . for this purpose , a photoresist is applied to the pre - patterned wafer underside and is patterned . in the exemplary embodiment , the photoresist is applied in a spray - coating process and is patterned by means of projection lithography . in principle , however , other known measures are also possible . the photomask is transferred to the silicon oxide layer 7 , so that partial removal takes place in the region 9 . the silicon nitride layer 8 on the top side of the wafer is thinned slightly in the process . then , the photoresist is removed . next , the mask for production of the cantilever is fabricated as a result of a photoresist once again being applied to the pre - patterned wafer underside and being patterned in accordance with the desired shape . in this case too , the application is preferably carried out using the spray - coating process and the patterning is preferably carried out by means of projection lithography . then , this photomask is likewise transferred to the silicon oxide layer 7 , so that the silicon oxide is partially thinned . then , the photoresist is removed . as a result , a step is formed in the silicon oxide layer on the underside . in this context , fig5 a shows a perspective view of the wafer underside with the silicon oxide layer 7 , which has various thickness regions , with the result that the step 10 in fig5 is formed . the regions 5 and 11 are thicker than the remaining region 12 . the region 9 is uncovered silicon . the next process step is a deep silicon etch , preferably using the known ase ( advanced silicon etching ) process , producing vertical side walls on the back surface of the silicon wafer 11 , so that a recess 13 is formed in the silicon membrane 6 in the region 9 shown in fig5 . the etching mask used is the above - described silicon oxide mask for production of the boundary surfaces 14 and 15 ( fig5 a ) of the free end of the cantilever which is to be formed . the depth of the recess 13 at least corresponds to the sum of the desired height of the sensor tip to be formed and the thickness of the spm sensor cantilever to be formed . the thickness of the silicon membrane 6 is selected in such a way that the silicon membrane is not completely etched through in this step , as shown in fig6 . then , the silicon wafer is oxidized on the wafer underside , during which step the side walls 16 and the base surface 17 of the recess 13 are covered by silicon oxide 20 ( fig7 ). next , the wafer underside is subjected to a targeted dry - etching process , which operates selectively with respect to silicon , and the silicon oxide layer on the base surface 17 of the recess 13 and also in the region 12 ( fig5 a ) is removed . in the process , the cantilever mask is transferred to the underside of the wafer . this is followed by a wet - chemical etching step , for example carried out by means of koh , in which a cantilever 18 is pre - patterned on the basis of the mask which has just been transferred . the etching depth and therefore the thickness of the pre - patterned cantilever 18 is selected to be greater ( for example by 20 %) than the final cantilever thickness of the spm sensor to be produced . the result of this operation is illustrated in fig7 a and 7 b , fig7 a showing the underside of the silicon substrate with a cantilever 18 which rises up from the surface 19 of the substrate material and has the perpendicular surfaces 14 and 15 . fig7 b shows a sectional illustration . the surfaces 14 and 15 are covered with a silicon oxide layer . the silicon oxide layer 11 is also present on the cantilever 18 . then , all the oxide and nitride layers 2 , 20 and 8 are removed in hydrofluoric acid . then , a further oxidation step is carried out , in order to completely cover the underside of the wafer with a silicon oxide layer 20 a . then , the silicon oxide layer 2 on the top side of the wafer is removed by means of a dry - etching step which is chosen to be selective with respect to silicon . the result of this operation can be seen from fig8 . finally , the wafer 1 is subjected to a wet - chemical etching step . in the process , the silicon membrane 6 is thinned from the top side of the wafer . this process is stopped when the pre - patterned cantilever 18 has been thinned to the desired thickness . a tip 21 has formed on the open side , which is not covered by silicon oxide , of the cantilever 18 , this tip being defined by the surfaces 14 and 15 and a ( 111 )- crystal plane 23 . the height of the tip 21 corresponds to the recess 13 ( fig9 ) and is typically 5 – 25 μm . the thickness of the cantilever 18 is typically 0 . 5 – 10 μm . finally , the remaining silicon oxide layers are removed by wet - chemical means , so that an spm sensor 22 , as illustrated in fig1 , having a holding element 4 , a cantilever 18 and a sensor tip 21 is formed . the tip which has been formed can be sharpened by means of a further low - temperature oxidation , for example carried out at below 1000 ° c ., and final removal of the oxide layer which has grown on . the materials which are preferred in connection with the process described above can also be replaced by materials which have a corresponding action and with which the person skilled in the art is familiar .	6
referring to fig1 , a system 10 includes a transducer 12 , such as a loudspeaker , that converts electrical signals into audible sound waves . an original source 14 of an audio signal is coupled to the transducer 12 . the source 14 is typically a microphone or a device storing audio information , such as a cd , mp3 or tape player . signals from the source 14 are processed by a digital signal processor ( dsp ) 16 . the dsp 16 modifies the frequency profile of the signal from the source 14 and inputs the modified signal to an amplifier 18 , which generates an amplified signal input to the transducer 12 . the dsp 16 modifies the signal to compensate for environmental conditions and the distance the sound waves emitted by the transducer 12 will travel . in one embodiment , the dsp 16 uses a plurality of equalization tables ( eq 1 , eq 2 . . . eqi ) stored in a database 20 . the equalization tables store multipliers corresponding to a frequency or band of frequencies within the audible range of sound waves . the multipliers describe how much the intensity of a sound wave must be amplified at a given frequency in order to compensate for frequency dependent attenuation as the sound wave travels through air . in one embodiment , equalization tables have a form similar to table 1 below . the values for the multipliers are calculated according to known principles of sound propagation in air . the attenuation of sound in air due to viscous , thermal and rotational loss mechanisms is proportional to f 2 . however , losses due to vibrational relaxation of oxygen molecules are generally much greater than those due to the classical processes , and the attenuation of sound varies significantly with temperature , water - vapor content and frequency . a method for calculating the absorption at a given temperature , humidity and pressure can be found in iso 9613 - 1 ( 1993 ). the table gives values of attenuation in db km − 1 for a temperature of 20 ° c . and a pressure of 101 . 325 kpa . the uncertainty is estimated to be ± 10 %. values used to calculate the attenuation of sound waves in air include : pa ambient atmospheric pressure in kpa pr reference ambient atmospheric pressure : 101 . 325 kpa psat saturation vapor pressure ca equal : international meteorological tables wmo - no . 188 tp94 world meteorological organization - geneva switzerland t ambient atmospheric temperature in k ( kelvin ): k = 273 . 15 + temperature in ° c . ( by us known as centigrade , europe as celsius ) to reference temperature in k : 293 . 15 k ( 20 ° c .) tol triple - point isotherm temp : 273 . 16 k = 273 . 15 + 0 . 01 k ( 0 . 01 ° c .) h molar concentration of water vapor , as a percentage hr relative humidity as a percentage f frequency fro oxygen relaxation frequency frn nitrogen relaxation frequency the equalization tables each correspond to multipliers substantially compensating for attenuation that occurs at a value or range of values of one or more sensed environmental condition such as temperature , humidity or other environmental conditions such as ambient atmospheric pressure . in embodiments where equalization tables compensate for more than one environmental condition , each equalization table corresponds to a unique combination of environmental conditions or a unique combination of ranges or values for each environmental condition . for example , the range of likely temperature may be divided into a plurality of subranges represented as values t 1 , t 2 , . . . t i , . . . t n and the range of possible humidity may be divided into subranges represented as h 1 , h 2 , . . . h j , . . . h n . an equalization table may be provided for each of a plurality of unique combinations t i and h j . in a similar fashion , the range of likely ambient pressure may be represented by a series of subranges p 1 , p 2 , . . . p k , . . . p n . where ambient pressure is considered , an equalization table may be provided for each of a plurality of unique combinations t i , h j and p k . in an alternative embodiment , the equalization tables are replaced by an equation describing the desired frequency profile as a function of frequency ( f ). accordingly , an equation g ijk ( f ) may be provided for each of a plurality of unique combinations of subranges t i , h j and p k of one or more environmental conditions . in an additional alternative embodiment , the equalization tables are replaced by a multivariable equation , function or algorithm : g t , h , p ( f ) describing the desired frequency profile as a function of frequency ( f ) and one or more environmental variables of temperature ( t ), humidity ( h ) and pressure ( p ). the function g t , h , p ( f ) may evaluate to a real or imaginary number that may have a continuous or a discrete number of values . the variables f , t , h , and p may be a real number and have a continuous or a discrete number of values . in certain embodiments , the equalization tables also compensate for the distance that sound will travel . the further sound travels , the greater the impact of frequency dependent attenuation . accordingly , equalization tables for each combination of subranges of the environmental conditions may be provided for a plurality of distances d 1 , d 2 , . . . d j , . . . d n . in certain embodiments , simple range divisions may be used , for example , near and far ranges . in such embodiments , only two sets of equalization tables for each combination of subranges of the environmental conditions need be provided . for example , the near range may be defined as a distance of less than 400 yards and the far range as a distance of 400 yards or more . in the preferred embodiment , a user provides an input indicating the desired range . various types of user input devices may be incorporated into the present system . for example , the system may provide a dial , discrete buttons each corresponding to a range of distances , a number pad , touch screen , or the like , enabling a user to input the range . in some embodiments , a range finder using a laser , radar , or like means , is used to determine the range . the use of any one parameter including temperature , humidity , pressure and range is optional . alternative embodiments of the invention may use less than all of these parameters . in systems not mapping equalization tables to all of these parameters , a typical or known value for the unused parameter may be considered to calculate the equalization tables . for example , where the expected distance is known , the equalization tables compensates for attenuation that is likely to occur for the known distance across a range of environmental conditions such as temperature , humidity and / or pressure . with reference again to fig1 , in the preferred embodiment , the equalization table used by the dsp 16 is selected by a processor 22 that receives inputs from a range finder / controller 24 , a temperature sensor 26 and a humidity sensor 28 . the range finder / controller may permit a user to input the value for the range . the range finder may also automatically determine a range . in the preferred embodiment , the range finder is omitted and a user manually indicates a range . the humidity sensor may include any humidity sensor known in the art , such as a resistive , capacitive , thermal conduction or infrared humidity sensor . the outputs of the temperature sensor 26 and humidity sensor 28 may be conditioned by a temperature circuit 30 and a humidity circuit 32 , respectively . the temperature and humidity circuits 30 , 32 convert a signal from the sensors 26 , 28 into a form readable by the processor 22 . the circuits 30 , 32 may therefore scale the output , remove noise , or convert the output to a digital signal . in embodiments using ambient pressure to select an equalization table , a pressure sensor and a corresponding signal conditioning circuit may provide an input to the processor 22 . in the preferred embodiment , the processor 22 receives the inputs from the sensors 26 , 28 and determines which of the equalization tables in a database 20 corresponds thereto . the processor 22 and dsp 16 may be modules of the same program or processor chip . alternatively , the processor 22 and dsp 16 may be separate software applications or distinct processor chips . the components of the system 10 illustrated in fig1 may be discrete components . alternatively , the functionality of two or more of the illustrated components may be combined in a single device providing equivalent functionality . for example , the functionality of the processor 22 , database 20 and dsp 16 may be incorporated in a single processing chip or a single application executed by a general purpose computer chip . in embodiments where less than all of the distance , temperature and humidity factors are used , the structure used to input these parameters to the processor 22 may be omitted . for example , in embodiments where the distance is known or assumed , the range finder / controller may be omitted . in embodiments where ambient pressure is used to select the equalization table , the system of fig1 may further include additional components necessary to determine ambient pressure , preferably controlled by the processor 22 . in other embodiments , different configurations may be used , such as systems that implement analog , digital or a hybrid of analog and digital components ( e . g . processor controlled digital potentiometers that control an analog equalizer ). also , the processor 22 and the dsp 16 may be the same device . referring to fig2 , the phenomenon for which the system 10 compensates is evident in the plot lines corresponding to different temperatures and humidities . particularly at high frequencies , the amount of attenuation over a one kilometer distance is extremely temperature and humidity dependent . equalization curves corresponding to the temperatures and humidities corresponding to the plot lines would , therefore , boost higher frequencies according to the anticipated attenuation . referring to fig3 , a method for using the system 10 may include sensing the temperature at block 34 and sensing the humidity at block 36 . sensing the temperature at block 24 may include use of one or more thermistors in an analog tone control circuit to change the frequency response of the system 10 in response to a temperature change to compensate for temperature dependent attenuation in air . in the preferred embodiment , the temperature is sensed at block 24 and the sensed value is used to select an equalization table . the anticipated or desired distance that the sound will travel is input at block 38 . at block 40 the equalization table corresponding to the conditions determined at blocks 34 , 36 and 38 is selected . at block 42 , audio signals from the audio source 14 are equalized according to the compensation information obtained from the equalization table selected at block 40 . in embodiments where ambient pressure is used to select the equalization table the method of fig3 may further include sensing the pressure . in an alternate embodiment , the processor 22 / dsp 16 analyzes the frequency spectrum of the output from the audio source 14 and adjusts the equalizer settings ( power supplied to frequencies in the spectrum ) based on the analysis . for example , if the output from the audio source 14 is below a predefined threshold in a certain frequency range , the system reduces or does not increase power to that frequency range in the amplifier even if analysis of the environmental conditions indicates an increase is warranted . in another embodiment , the capabilities of the amplifier are taken into consideration before the audio signal is altered . the degree of frequency response modification is varied according the amplifier power that is available . for example , the solution determined at a particular rh , t , and range may call for a 41 db boost at 4 khz . if only 25 db of amplifier headroom is available at that time , the system will limit the amount of boost to 25 db to avoid distortion and / or amplifier overload . while the preferred embodiment of the invention has been illustrated and described , as noted above , many changes can be made without departing from the spirit and scope of the invention . accordingly , the scope of the invention is not limited by the disclosure of the preferred embodiment .	7
as required , detailed embodiments of the present disclosure are disclosed herein . the disclosed embodiments are merely examples that may be embodied in various and alternative forms , and combinations thereof . as used herein , for example , exemplary , and similar terms , refer expansively to embodiments that serve as an illustration , specimen , model or pattern . the figures are not necessarily to scale and some features may be exaggerated or minimized , such as to show details of particular components . in some instances , well - known components , systems , materials or methods have not been described in detail in order to avoid obscuring the present disclosure . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a basis for the technology foci ( e . g ., claims ), listed below , and as a representative basis for teaching one skilled in the art to variously employ the present disclosure . while the description includes a general context of computer - executable instructions , the present disclosure can also be implemented in combination with other program modules and / or as a combination of hardware and software . the term application , or variants thereof , is used expansively herein to include routines , program modules , programs , components , data structures , algorithms , and the like . applications can be implemented on various system configurations , including single - processor or multiprocessor systems , microprocessor - based electronics , combinations thereof , and the like . the present disclosure describes an ultrasonic welding technique for joining workpieces , such as polymeric composites . one aspect of the disclosure relates to systems and methods for improved ultrasonic welding . the system includes at least one multi - height energy - directing device that , in use , is positioned between the workpieces during application of high - frequency ultrasonic vibrations from an ultrasonic energy application horn . the system components , algorithm , and operations are described further below with reference to fig1 - 9 . the present technology is now described with reference to example systems , tooling , and workpieces . the figures are referenced to facilitate understanding of the technology , and not to limit scope thereof . reference to directions herein , such as upper , lower , up , down , and lateral , are provided to facilitate description of the present technology but does not limit scope of the technology . a description in which a servo horn is described as descending down upon a proximate workpiece is not limited , for example , to the horn moving vertically downward in the earth , or environment , frame . the horn in this case can be moving from left to right , for example , in the environment frame . now turning to the figures , and more particularly , the first figure , fig1 shows an example welding system , indicated generally by reference numeral 100 . the system 100 is used to weld together two workpieces 101 1 , 101 2 . the system 100 includes a supporting , or under , structure 102 . the system also includes a welding arm 104 terminating in a welding energy application tip , or horn 106 . the horn can include , for instance , an ultrasonic servo horn , configured to apply energy , in the form of high - frequency vibrations , to the workpieces for welding them together . the welding arm 104 extends from a second , or application - side , structure , or mass 108 . in operation , an application - direction force 110 can be applied by and / or at the mass 108 . the force 110 pushes the arm 104 and horn 106 toward the workpieces 101 being welded together . a counterpart force 112 pushes the supporting structure 102 toward the workpieces . with the mass and application - direction force pushing toward the workpieces 101 from a first , application , direction , and the counter force 112 pushing toward the pieces 101 from an opposite direction , the workpieces 101 are kept at a desired compression during welding . fig2 shows an energy - directing device , or energy director 200 . the energy director 200 can include any material described herein , including in connection with the workpieces . in one embodiment , the energy director 200 is generally annular — e . g ., has a generally annular , or ring - like , plan - view ( e . g ., top ) profile . with reference to the figure , an upper portion of the annular configuration is identified by reference numeral 202 . importantly , it has been found that an annular weld can be as strong as continuous welds ( i . e ., welds not having a central void )— in one present finding , this is especially true when a ratio of an internal diameter to an external diameter is less than about 0 . 6 . more specifically , under an applied tensile load , a predominant amount of the holding force created by a solid or continuous weld is provided by an outer annual portion of the weld , with a central portion of the weld contributing little holding force in comparison . a weld lacking the central portion , thus , can be formed with less energy than a continuous weld ( one lacking a central void ), and perhaps less time , without sacrificing joint strength . while the energy director 206 , whether annular or other shape , can have other widths 208 without departing from the scope of the present technology , in one embodiment each director has a width 208 ( e . g ., diameter , or maximum width ) between about 3 mm and about 20 mm . in one embodiment , the width 208 can be smaller , such as down to about 1 mm , and still possibly up to about 20 mm . the upper portion 202 defines a central hole , or void 204 . while the void 204 , whether circular , oval , rectangular , or other , can have other internal widths 210 without departing from the scope of the present technology , in one embodiment each director 200 has one or more internal widths 210 between about 1 . 5 mm and about 12 mm . in one embodiment , the internal width 208 can be smaller , such as down to about 0 . 6 mm , and still possibly up to about 12 mm , for instance . while the illustrated director 200 has a generally annular plan , or top , profile shape , the director can have other plan profile shapes . other example shapes include oval , square , or other rectangular shapes , with a central void . the energy director 200 includes a plurality of energy - director ( ed ) elements 206 . the elements may be referred to by other names such as a height - control ed element , protrusion , or ridge , or an elevation - control element , protrusion , or ridge . the ed elements 206 extend , or protrude ( e . g ., protrude downward ), from the upper portion 202 of the director 200 , such as shown in fig2 . in one embodiment , the ed 200 is formed during compression molding of one of the workpieces ( e . g ., proximate workpiece 101 1 ), and so is a contiguous part of that workpiece . while the ed element 206 can have other shapes , in the illustrated embodiment , each director has a generally triangular side profile . other example shapes include square , otherwise rectangular , or rounded — e . g ., semi - circle or ovular . in the illustrated embodiment , each ed element 206 includes an upper , or first , side , or base , connecting to the upper portion 202 of the element 206 . in the embodiment in which the ed 200 is formed during compression molding of one of the workpieces ( e . g ., proximate workpiece 101 1 ), and so is a contiguous part of that workpiece , the upper portion 202 of the element 206 includes the workpiece 101 1 . the sides extend from the base to a point opposite the upper portion 202 . importantly , the ed elements 206 do not all have the same characteristics . in one embodiment , at least one characteristic differing amongst at least some of the ed elements 206 is a height 212 of the elements . benefits of this feature are described further below in connection with the welding sub - process of the method 400 of fig4 . generally , the benefits relate to an advantageous channeling of welding energy — e . g ., ultrasonic vibrations — through primary ed elements initially , while passing less or not at all through secondary ed elements , in an early stage of welding , and through the secondary elements , while passing less or not at all through the primary ed elements in a subsequent stage of the welding . fig3 shows a side view of any of the ed elements 206 of fig2 . along with the height 212 indicated in fig2 , fig3 shows that the ed elements 206 can be defined by other features , such as width 302 . while the ed elements 206 can have other widths 302 without departing from the scope of the present technology , in one embodiment each ed element 206 has a width 302 between about 1 . 0 mm and about 4 . 0 mm . in one embodiment , the width 302 can be smaller , such as down to about 0 . 2 mm , and still possibly up to about 4 . 0 mm . continuing with the triangular embodiment of fig2 and 3 , fig3 shows a vertical side length 304 as another size characteristic of the ed director . in one embodiment , a ratio of the height 212 to the width 302 ( h / w ) is between about 0 . 3 and about 1 . 0 . in one embodiment , each primary element 206 1 of the elements 206 has a height of between about 0 . 5 mm and about 6 . 0 mm , and each secondary element 206 2 has a height between about 0 . 4 mm and about 4 . 0 mm . the ed elements 206 can have any appropriate thickness , and , related , any desired three - dimensional shape , and each element can have any desired size — e . g ., thickness or thicknesses . the elements 206 can have a generally pyramid shape . for ed elements having rounded sides , the three - dimensional shape can be prismatic ( e . g ., rectangular or triangular prism ), cylindrical , conical , frustoconical , pyramid ( e . g ., triangle pyramid , or tetrahedron ), partial sphere ( e . g ., semi - sphere , demi - sphere , or hemisphere ), etc . ed elements 206 can have straight and / or curbed sides . as mentioned , the ed elements 206 do not all have the same characteristics . in a contemplated embodiment , along with or instead of varying heights , not every one of the ed elements 206 on a single energy director 200 has the same shape . again , as with varying heights , benefits of varying the shape amongst the ed elements 206 are described further below in connection with the welding sub - process of the method 400 of fig4 . and again , generally , the benefits relate to an advantageous channeling of welding energy — e . g ., ultrasonic vibrations — through primary ed elements initially , while passing less or not at all through secondary ed elements , in an early stage of welding , and through the secondary elements , while passing less or not at all through the primary ed elements in a subsequent stage of the welding . now turning to the fourth figure , fig4 shows an exemplary algorithm , by way of a flow chart 400 , defining a method for ( a ) locating an energy director , such as the energy director 200 of fig2 , and ( b ) welding workpieces together by applying welding energy to a proximate workpiece at the identified location so that it channels through , and melts , the novel energy director as desired . the result is effective and efficient welding , and a more accurate and robust weld formed with less overall cycle time , energy , and energy - director material as compared to traditional techniques . in some embodiments , the algorithm controls only some aspects of the method , such as the sub - process associated in fig4 with reference numeral 406 . in another , it controls operations 406 and 408 , and in another operations 404 , 406 , 408 , and 410 , for example . the operations are described further below , in turn . while joining two workpieces is described primarily herein , the number is presented as an example , and more than two pieces may be joined according to the teachings of the present disclosure . it should be understood that the steps of the method 400 are not necessarily presented in any particular order and that performance of some or all the steps in an alternative order is possible and is contemplated . the steps have been presented in the demonstrated order for ease of description and illustration . steps can be added , omitted and / or performed simultaneously without departing from the scope of the appended technology foci ( e . g ., claims ). and it should also be understood that the illustrated method 400 can be ended at any time . in certain embodiments , some or all steps of this process , and / or substantially equivalent steps are performed by , or at least initiated by a computing device , such as a processor executing computer - executable instructions stored or included at a computer - readable medium . and any one or more steps of the process can be performed , initiated , or otherwise facilitated by automated machinery , such as robotics . the method 400 outlined by the flow chart of fig4 is described now with additional reference to the tools and components of fig5 - 10 . characteristics of the elements shown , e . g ., shape , size , and number , are presented to facilitate the present description and not to limit scope of the present technology . the method 400 begins 401 and flow proceeds to block 402 , whereat an energy director , such as the director 206 shown in fig2 , is positioned between the workpieces . fig5 shows an example positioning of the energy director between adjacent workpieces . in a contemplated embodiment , the energy director is formed in a sub - process of molding at least one of the workpieces . for instance , a mold in which the first workpiece is compression molded can include recesses and / or protrusions configured ( e . g ., sized and shaped ) to form the energy director at a desired location of the workpiece . as provided , the workpieces being welded together can be similar or dissimilar . regarding dissimilar workpiece materials , one workpiece can be a plastic or other polymer , for instance , and the other can be steel , aluminum , an alloy , or other metal , etc . thus , the teachings of the present disclosure can be used to join a polymer ( e . g ., polymer composite ) to another polymer , or to join a polymer to a metal , for instance . in one embodiment , the material includes polyethylene . in one embodiment , the material includes polyethylene terephthalate ( pet ), high density polyethylene ( hdpe ) and / or ethylene vinyl alcohol ( evoh ). in one embodiment , at least one of the workpieces being joined includes a polymer . at least one of the workpieces can include synthetic , or inorganic , molecules . while use of so - called biopolymers ( or , green polymers ) is increasing , petroleum based polymers are still much more common . material of one or both workpieces may also include recycled material , such as a polybutylene terephthalate ( pbt ) polymer , which is about eighty - five percent post - consumer polyethylene terephthalate ( pet ). in one embodiment one or both of the workpieces includes some sort of plastic . in one embodiment , the material includes a thermo - plastic . in one embodiment one or both of the workpieces includes a composite . for example , in one embodiment one or both of the workpieces includes a fiber - reinforced polymer ( frp ) composite , such as a carbon - fiber - reinforced polymer ( cfrp ), or a glass - fiber - reinforced polymer ( gfrp ). the composite may be a fiberglass composite , for instance . in one embodiment , the frp composite is a hybrid plastic - metal composite . the material in some implementations includes a polyamide - grade polymer , which can be referred to generally as a polyamide . material of one or both workpieces may also include includes polyvinyl chloride ( pvc ). material of one or both workpieces may also comprise a type of resin . example resins include a fiberglass polypropylene ( pp ) resin , a pc / pbt resin , and a pc / abs resin . the workpieces may be pre - processed , such as heated and compression molded prior to the welding . in most manufacturing processes , more than one weld will made to connect two adjacent workpieces . the positioning of step 402 can thus include positioning multiple energy devices between the workpieces . with continued reference to fig4 , with the energy director ( s ) positioned between the workpieces , flow proceeds to step 404 whereat the arrangement is positioned adjacent the weld system . this operation can include moving the workpiece / ed arrangement toward the welding system , and or moving aspects or an entirety of the welding system toward the arrangement . the initial , coarse , positioning of step 404 can include positioning an ultrasonic horn of the system close to an estimated or believed location of the energy director to be used in the first weld . flow proceeds to the fine energy - director locating sub - process , or routine 406 . as shown in fig4 , the locating routine 406 includes multiple sub - steps , distinguished by superscripts — i . e ., 406 1 - 5 . from step 404 , the method turns particularly to the first routine step 406 1 whereat the welding head , or horn ( e . g ., ultrasonic servo horn , like the sonotrode tip of the example of fig1 ) is lowered . the horn is lowered toward the proximate workpiece — i . e ., the workpiece closest to the horn , such as in fig1 and 5 . the descending is illustrated in fig6 . the coarse positioning of step 404 does not usually position the horn directly over the energy director . instead the horn usually ends up initially positioned only partially over the energy director , as indicated by path 604 in fig6 , or not over the director at all , as indicated by path 602 in fig6 . the target path is the third 606 , which is reached by one or more iterations of the routine 406 1 - 5 , as further described below . the descending operation 406 1 is performed under the operation of a controller connected directly or indirectly to the welding horn . features of an example controller is shown in fig1 , and described further below . the controller controls , e . g ., a rate at which the horn is lowered toward the proximate workpiece . the controller can , for instance , control or be a part of a robotic apparatus , or robot , controlling movement of the welding horn . at the next step 406 2 of the routine 406 , the controller determines whether a push - back force being received at the weld horn from the workpiece , indicates that the horn has been lowered to a local terminal point . the controller determines this based on feedback ( e . g ., from a load cell ) indicating a force , exerted by the workpiece 101 1 , on the welding horn . the control receives the force indications from a sensor ( not shown in detail ) that may be part of , or connected to , the welding system , or part of , or connected to , automated robotic apparatus controlling movement of the welding horn . if it is determined at step 406 2 that the horn has not reached its local terminal point , then flow of the algorithm returns back to the first routine step 406 1 , as shown in fig4 . this will occur , for instance , while the horn is being lowered and had not yet contacted the workpiece . it will also occur when the horn has contacted the workpiece but not been lowered enough to receive a sufficient amount of push - back force from the workpiece . when it is determined at step 406 2 that the horn has reached its local terminal point , then flow of the algorithm proceeds to step 406 3 , whereat the controller determines a displacement that the horn traveled in order to reach the point , or otherwise determines a location of the terminal point — e . g ., a vertical distance from any reference frame . the displacement can be determined by , e . g ., an encoder connected directly or indirectly to the horn . in one embodiment , the system is configured to take horn displacement measurements continually , at short intervals , or otherwise quickly as the horn descends . the system is further configured to compare the regular displacement values determined with a target displacement value continuously or at short regular intervals or otherwise quickly as the horn descends . at step 406 4 , the controller determines whether the displacement , or vertical position , of the horn corresponding to the local terminal point is indicative of the horn having been lowered to a target location of the workpiece arrangement — i . e ., the location of the arrangement having the energy director between the workpieces and directly , fully , below the welding horn . the controller is programmed , or calibrated , with data identifying values , or ranges , of horn displacements , or positions , corresponding to expected , or likely , positions of the horn with respect to the target location of the workpiece arrangement . the data indicates , for instance , that the horn will be at a predetermined vertical position , within an error window , or range , when the horn has contacted the target position , because the horn will be opposed by the threshold force earlier . this is because the workpiece arrangement is thicker where the energy director is , or at least the top workpiece will not give as much to the horn when the energy director is there . when the horn pushes on a location of the workpiece that is not over the energy director , the horn is able to push down farther on the workpiece before the horn finally experiences the threshold push - back force . the data indicates , based on the horn displacement to the threshold force , where the horn is — e . g ., over or not over the energy director , can be generated in lab testing , for instance . the data can also provide an indication , based on the horn displacement to the threshold force , of how far the horn is from the energy director . this concept is described further with reference to fig6 and 7 . as referenced , fig6 shows three example paths 602 , 604 , 606 . at a first lateral position over the proximate workpiece 101 1 , the horn descends along the first example path 602 . because the energy director 200 is nowhere near a line of the path 602 , when the horn contacts the workpiece 101 1 , the workpiece , not being restricted by any energy director , there , will give , or displace more than it would if the director were there . the horn is thus able to move farther downward before the predetermined threshold force , from the workpiece 101 1 , opposes the horn &# 39 ; s downward movement . fig7 is a graphical representation corresponding to the three paths shown in fig6 . more particularly , fig7 shows a graph 700 having an y - axis 702 representing welding horn displacement and an x - axis 704 indicating horn lateral , or orthogonal , position . the first bar 706 corresponds to the first path 602 of fig6 . accordingly , the displacement is very high because the path 602 is not over , and not relatively near to , the energy director 200 in fig6 . the second bar 708 in fig7 corresponds to the second path 604 of fig6 . accordingly , the displacement is lower , but still not as low as it should be because the path 606 is still not directly and completely over the energy director 200 . in some embodiments , the energy director is not rigid , and rather has some flexibility . the horn thus is opposed by less force when lowered on a portion of the workpiece 101 1 that is not completely over the energy director ( e . g ., the second path 604 ), because less of the director is acting to resist the downward movement of the horn . when the horn is lowered directly over the horn ( e . g ., the third path 606 ), more ( i . e ., all ) of the energy director is beneath the workpiece where the horn is lowered , and so more of the director opposes the downward movement of the horn , and the workpiece thus displaces less before experiencing the threshold feed - back force . the third bar 710 in fig7 corresponds to the third path 606 of fig6 . accordingly , the displacement is relatively low because the path 606 is directly over the energy director 200 , which limits the horn from descending further . with continued reference to fig4 , assuming the welding horn is , in a first iteration of the routine 406 , at a first lateral position corresponding to the first path 602 , then at step 406 3 , the controller would determine that the horn has displaced a relatively - large amount to reach the termination point — e . g ., the first relatively - large displacement 706 . at the next step 406 4 , the controller determines whether the displacement ( e . g ., displacement 706 corresponding to the first path 602 ) indicates that that horn is directly over the energy director . because the displacement is relatively high in this first iteration ( e . g ., displacement 706 ), the controller , based on the pre - programmed data ( e . g ., from previous lab testing ) concludes that the horn is not directly over the director . thus , from the decision 406 4 , flow of the algorithm continues to step 406 5 whereat the controller determines a next lateral location to move the horn to for a next descent and measuring . determining , in step 406 5 , where the horn should be moved for the next horn drop , in one embodiment includes consideration of the displacement determined in the last step 406 4 . for instance , if the last displacement ( e . g ., displacement 706 ) is very high , then the lateral distance to move the horn for the next drop would be greater . if the last displacement is low — e . g ., very close to what it would be if the horn was directly over the energy director , then the later distance , to move the horn for the net drop , would be much less . following repositioning of the horn at step 406 5 , steps 406 1 to 406 5 are repeated . once the iteration results at step 406 4 with a horn displacement at or below a threshold , or target displacement , then the controller concludes that the horn has been lowered directly over the energy director . with reference to fig6 and 7 , for instance , when the horn is lowered along the third path 606 of fig6 , the horn will only travel a minimal displacement 710 , being below a threshold displacement 712 also indicated in fig7 . the displacement values at or below the threshold displacement 712 can be referred to as a displacement tolerance range . in response to determining , at 406 4 that the horn moved only a target displacement ( e . g ., 710 ) to reach the threshold push - back force , and so that the horn was lowered onto the workpiece 101 1 directly over the workpiece , then flow of the algorithm proceeds from the energy - director - locating routine 406 to welding step 408 . at step 408 , welding energy is applied from the to the proximate work piece 101 1 at the determined location , directly above the energy director . for ultrasonic welding , the energy includes high - frequency ultrasonic vibrations excited and passing from the welding horn . as described above , the energy director is designed so that the welding energy passes initially more or completely through some of the energy - director ( ed ) elements ( 206 ) than others . for instance , in the multi - height embodiments , the energy would pass through the taller ed elements 206 1 initially , and not through the shorter elements 206 2 , because the taller elements contact the distal workpiece 101 2 creating a path between the workpieces 101 1 , 101 2 . the energy would not flow freely through the shorter ed elements at this point because the shorter elements do not touch the distal piece 101 2 , and so there is not path through the shorter elements to the distal piece 101 2 for the energy . with the welding energy passing through the taller ed elements 101 1 , the taller elements are melted first , as well as the workpieces adjacent the taller elements . this stage is shown in fig8 . regarding the welding operation , more particularly , for ultrasonic welding , heat is generated from intermolecular friction at and between the energy directors and the workpieces where the welding energy ( e . g ., hf vibrations ) are passing . the heat causes the director and workpieces to melt , creating the joining weld . the arrangement is under some compression , at least due to the weight of the proximate workpiece 101 1 , and by downward force of the horn . in some embodiments , the horn is configured ( e . g ., spring loaded ) and / or controlled to apply a downward force on the proximate piece 101 1 during welding . thus , as the ed elements melt , the top workpiece 101 1 lowers . after the taller elements are melted further , a subsequent stage , shown in fig9 , is reached whereby the taller ed elements 206 1 have melted sufficiently for the shorter ed elements 206 2 to contact the distal workpiece 101 2 . at this point , because the taller ed elements 206 1 have been at least partially melted , and the shorter ed elements 206 2 have not yet been melted and not contact the lower workpiece 101 2 , the shorter ed elements 206 2 now present a lower - resistance path for the welding energy ( e . g ., hf vibrations ) than the taller ed elements 206 1 . thus , from the stage shown in fig9 of the welding sub - process 408 , the welding energy channels mostly , or at least more , through the shorter elements , melting them and the workpieces 101 1 , 101 2 adjacent the shorter elements . upon solidification , the melted portions form weld nuggets between the workpieces , and these welds will hold the workpieces 101 1 , 101 2 together . for embodiments in which a generally annular energy director is used ( e . g ., the director 206 of fig2 ), the resulting weld can be generally annular , likewise . an example weld is shown in fig1 ( the weld is shown without the workpieces 1011 , 101 2 that the weld holds together ). as provided , it has been found that an annular weld can be as strong as continuous welds ( i . e ., welds not having a central void ). more specifically , a predominant amount of the holding force created by a solid or continuous weld is provided by an outer annual portion of the weld , with a central portion of the weld contributing little holding force in comparison . a weld lacking the central portion , thus , can be formed with less energy than a continuous weld ( one lacking a central void ), and perhaps less time , without sacrificing joint strength . after a pre - set amount of time , application of welding energy is ceased , and the horn retrieved from the proximate workpiece 101 1 . the system is pre - programmed with the amount of time to apply the welding energy . the timing can be determined in lab testing , for instance . with final reference to fig4 , at step 410 , the controller determines whether there are any other welds to make . if so , then flow returns to step 404 whereat the horn is repositioned for locating a next energy director in the locating routine 406 . once the next energy director is located , flow proceeds again to the welding operation 408 , and so on . while two ed element heights are disclosed , in a contemplated embodiment , the energy director includes more than two heights , and so a corresponding number of welding stages greater than two . as referenced above , instead of or along with height difference between ed elements 206 , the elements can have shape difference controlling where and when the welding energy is channeled , thereby controlling what parts of the energy director melt in a first stage and which in a second stage . while two ed shapes are presented as a primarily example , here , more than two ed shapes is possible , and so a corresponding number of welding stages . while two primary welding stages are described — e . g ., a first stage during which the taller ed elements 206 1 channel the weld energy and melt , and a second stage during which the shorter ed elements 206 2 channel the weld energy and melt . as referenced , while the energy transfers through the shorter element more in the second stage , energy may still transfer , to a lesser degree , through the taller elements since they are still intact between the workpieces 101 1 , 101 2 . the present welding technique 408 results in the ed elements , tall and then short , melting progressively , at a desired time interval . the technique 408 also allows use of less energy to perform the welding than would be required if the energy director was solid with no ed elements , or if every ed element was the same height and shape . for instance , if the energy director had ten ( 10 ) equal ed elements , energy sufficient to channel the energy through all ten elements simultaneously would be needed throughout one long , single stage . if the energy director , though , included five taller ed elements and five shorter ed elements , then in the first stage , only energy sufficient to channel the energy through the five taller elements is needed , that energy level being less than the energy level of the previous example in which the energy had to be channeled through all ten equal ed elements . in the second stage , generally , only energy sufficient to channel the energy through the five smaller elements is mostly needed , that energy level also being less than the energy level of the previous example in which the energy had to be channeled through all ten equal ed elements . in theory , further , a sum of the first - stage and second - stage energy application is less than the total energy that would be required for the arrangement having the ten identical ed elements . fig1 illustrates schematically features of an example controller , such as computing device . the controller is indicated in fig1 by reference numeral 1100 . as provided , the controller 1100 can control or be part of a robotic apparatus 1102 . as shown , the controller 1100 includes a memory , or computer - readable medium 1104 , such as volatile medium , non - volatile medium , removable medium , and non - removable medium . the term computer - readable media and variants thereof , as used in the specification and technology foci ( e . g ., claims ), refer to tangible , non - transitory , storage media . in some embodiments , storage media includes volatile and / or non - volatile , removable , and / or non - removable media , such as , for example , random access memory ( ram ), read - only memory ( rom ), electrically erasable programmable read - only memory ( eeprom ), solid state memory or other memory technology , cd rom , dvd , blu - ray , or other optical disk storage , magnetic tape , magnetic disk storage or other magnetic storage devices . the controller 1100 also includes a computer processor 1106 connected or connectable to the computer - readable medium 1104 by way of a communication link 1108 , such as a computer bus . the computer - readable medium 1104 includes computer - executable instructions 1110 . the computer - executable instructions 1110 are executable by the processor 1106 to cause the processor , and thus the controller 1100 , to perform any combination of the functions described in the present disclosure . these functions are described , in part , above in connection with fig4 , and supporting illustrations of fig1 - 3 and 5 - 10 . in a contemplated embodiment , the controller is in communication with one or more remote devices 1112 . for instance , a central computer or service in the manufacturing plant can communicate with the controller 1100 , such as to provide instructions to and / or receive feedback ( e . g ., operations reports ) from the controller 1100 . the computer processor 1106 is also connected or connectable to at least one interface 1112 for facilitating communications , between the controller 1100 and any other local components 1114 , such as , for instance , sensor devices like the force sensors referenced above . the interface 1112 can also be configured to facilitated communications with any remote device 1116 . for communicating with the local components 1114 , the interface 1112 can include one or both of wired connections and wireless components — e . g ., transceiver , transmitter , and / or receiver . for communicating with the remote components 1116 , the interface 1112 includes one or both of a short - range transceiver ( or transmitter and / or receiver ) and a long - range transceiver ( or transmitter and / or receiver ). the remote components 1116 can include databases , servers , other processors , other storage mediums , and / or other computing devices , such as other systems in a manufacturing plant communicating instructions to and / or receiving data from ( e . g ., performance reports ) the controller 1100 . although shown as being a part of the controller 1100 , completely , the interface 1112 , or any aspect ( s ) thereof , can be partially or completely a part of the controller 1100 . the interface 1112 , or any aspect ( s ) thereof , can be partially or completely external to and connected or connectable to the controller 1100 . only select features of the implementation are summarized here by way of example . the techniques taught herein result in stronger ultrasonic welds . the strength is improved , for instance , through use of a generally annular , or ring - shaped , energy director . the techniques can also result in savings in energy director material , as material is not needed or included in the central region of the energy director . another benefit of the present technology is energy savings , as less energy is needed to initiate the initial - stage and subsequent - stage welding , as described above in connection with the welding sup - process 408 of fig4 . the technology can also result in reduced welding cycle times , as also referenced above . such efficient , effective , and robust joining solutions support increased use of polymeric components to be joined to similar materials ( e . g ., polymeric composite / polymeric composite connection ) or dissimilar materials ( e . g ., a polymeric / metal connection , etc .). related benefits including weight reduction , performance enhancements , and corrosion resistance follow . the above - described embodiments are merely exemplary illustrations of implementations set forth for a clear understanding of the principles of the disclosure . variations , modifications , and combinations may be made to the above - described embodiments without departing from the scope of the technology foci ( e . g ., claims ). all such variations , modifications , and combinations are included herein by the scope of this disclosure and the following technology foci ( e . g ., claims ).	1
the invention provides a multi - segment handle that can be advantageously connected to mop heads or other devices such as paint rollers . the handle consists of several short ( preferably less then one foot in length ) sections that can be shipped and sold in small packages that can be displayed on conventional horizontal shelving and easily toted home by consumers . referring to fig1 the handle 10 has an upper grip section 12 , a lower accessory section 14 and one or more ( preferably four ) pole sections 16 . the components are preferably molded of a suitable rigid plastic , such as a nylon , preferably glass - filled nylon , however other materials could be used , for example a low cost metal . referring to fig4 - 9 , the grip section 12 is preferably molded hollow to approximately 10 - 30 cm ( 4 - 12 inches ) in length and about 2 . 5 cm ( 1 inch ) in diameter . it may also have an ergonomic contour for grasping by a hand . the upper end of the grip section 12 has an opening 18 for hanging the handle 10 on a hook , nail or the like inserted either directly through the opening 18 or through a suitable strap ( not shown ) looped through the opening 18 . the downward end of the grip section 12 may have either a female or a male connection end 20 . it is only important that the portion of the pole section 16 to be adjacent to it has the opposite type of end . referring next to fig1 and 14 - 16 , at the opposite end of the handle 10 is the accessory section 14 to which can be attached various accessories 22 such as a bristled head ( as in a broom or brush ) or wet or dry mop heads . the accessory section 14 defines a yoke 24 at its lower end . the yoke 24 includes two arms 26 each preferably having a recess 28 ( one shown ) that can receive a hinge pin 29 extending through or from a side of a upstanding member 30 ( see fig1 ) of the accessory 22 . opposite the yoke 24 , the accessory section 24 defines an enlarged connection end 32 . again , the end can be either a male end , or a female end , with it merely being important that the portion of a pole section to adjoin it must have the opposite type of end . referring next to fig2 - 3 and 10 - 13 , between the grip 12 and accessory 14 sections are one or more interconnected pole sections 16 . the number of pole sections 16 will depend on the desired length of the handle 10 when assembled and the desired size of the unassembled handle with consideration for intended size of the product package . in the preferred form shown in fig1 the handle 10 includes four identical pole sections 16 . together , the overall handle is of a typical length for a mop handle . each pole section 16 is preferably hollow with an outer diameter of one size , approximately 2 . 5 cm ( about 1 inch ), for most of its length , albeit with a narrower diameter female connection end 34 . the female connection end has an internal cavity 36 ( see fig3 ) suitable to receive an opposite male connection end 38 of decreased diameter . the male and female ends will be described herein with respect to the pole sections . however , it should be appreciated that the male end of the grip section ( see fig7 - 9 ) and the female end of the accessory section ( see fig1 and 16 ) are configured identically to the corresponding ends of the pole sections . figures showing the ends of the grip and accessory sections will be used to aid in the description of the ends of the pole sections . the male connection end 38 is formed with two sets or pairs of radially projecting elements , namely bosses 40 and ratchets 44 . the boss and ratchet in each set are generally axially aligned and spaced apart , the boss being spaced in from the terminal end of the male end and the ratchet being axially spaced in further , at the shoulder . each set is spaced from the other set preferably 180 degrees . the bosses 40 are shallow circular projections projecting radially outward with tapered circumferences . as can best be seen in fig2 and 8 - 9 , the ratchets 44 project radially outward and extend axially a short distance , approximately 5 mm ( slightly less than ¼ ″). each ratchet 44 has a flat side 42 and a ramped side 46 sloping downwardly away from the flat side . referring to fig3 and 13 , the female connection end 34 includes two d - shaped openings 48 in communication with the internal cavity 36 spaced apart 180 degrees and oriented with the flat side being axial and its bottom being nearest the terminal edge of the female connection end 34 . the openings thus extend in a circumferential direction to the grooves . as shown in fig1 , 11 and 13 , the female connection end 34 is formed with two shallow parallel grooves 50 extending axially from the terminal edge to the openings 48 , being axially offset but adjacent to the openings . the female connection end 34 is also formed with two pockets 52 generally axially aligned with the openings 48 and spaced circumferentially from the grooves 50 . the pockets 52 are sized and configured to accommodate the ratchets , including a flat , radial surface 54 . intermediate regions 58 lie between the grooves and the ratchets at the inner diameter of the female connection end and thus extend radially inward more than the pockets and the grooves . this interrupts free rotation of the male connection end in the female connection end by interfering with the ratchets . locking rotation is eased by ramped surfaces 56 of the intermediate regions 58 that slope down toward the grooves . the grip section 12 preferably has a male connection end 20 sized and is configured identically to the male connection ends 38 of the pole sections 16 , and the accessory section 14 preferably has a female connection end 32 identical to the female connection ends 34 . accordingly , the grip section 12 interlocks with an adjacent pole section 16 by mating end 20 of the grip section 12 with the female connection end 34 . end 32 of the accessory section 14 interlocks with the male connection end 38 of an adjacent pole section 14 . two additional pole sections 16 interlock together and to the pole sections 16 mated with the grip 12 and accessory 14 sections . preferably , the male connection ends are sized so that there is approximately 3 . 8 cm ( 1 . 5 inches ) of overlap at the joints . as shown in fig1 - 23 , adjacent sections are mated by inserting a male end into a female end . the bosses 40 and the ratchets 44 are aligned with the axial grooves 50 and the adjacent sections are brought together until the bosses 40 reach the ends of the grooves , as shown in fig1 and 21 . rotating the male connection end with respect to the female connection , in this case in a clockwise direction , drives the bosses and the ratchets into the d - shaped openings and the pockets , respectively , as shown in fig1 , 20 and 23 . as shown in fig2 , this rotation results in radial deflection of either or both of the male and female connection ends such that the ratchets and the bosses can pass by surfaces at the inner diameter of the female connection end radially inward further than the groove , namely the intermediate regions 58 and the small lipped area between the grooves and the d - shaped openings . the considerable force required for deflection is created by a simple twisting action by virtue of the mating ramp surfaces 46 and 56 as well as the tapered circumference of the bosses . at this point , the built up spring force drives the bosses and the ratchets radially outward to “ snap ” into the d - shaped openings and the pockets , respectively ( as shown in fig2 ). twisting and separation of the sections is resisted at the joints because of the engagement of the bosses with the walls of the d - shaped openings and more so the flat sides 42 and 54 of the respective ratchet and pocket as shown in fig2 . thus , the bosses and ratchets act to properly align the mating section and also to prevent their relative rotation , particularly in the loosening direction in which the bosses would move back within the grooves . note also that the bosses 40 are more shallow than the thickness of the d - shaped openings 48 such that they are recessed within the openings . this , and the rigidity of the plastic , makes it difficult to compress the male ends to separate the sections . thus , the handle is not only rigidly connected at the joints but its sections are substantially permanently connected once joined . this structure thus provides a handle in multiple smaller sections that can be shipped and sold in a compact package while at the same time providing a handle that is rigid and seems nearly monolithic when assembled . it should be noted , however , that the sections could be made more easily separable . an alternate version of a male connection end 38 a for the grip 12 and pole 16 sections is shown in fig2 and 25 . like the prior embodiment , here the male connection end 38 a is of a decreased diameter from the body of the section and includes two sets of bosses 40 a and ratchets 44 a . the ratchets are as described above , except that here the bosses are a d - shaped , like the openings 48 a . in particular , each boss 40 a extends at a first thickness from a flat side to an intermediate point , from which it tapers downwardly to a curved edge opposite the flat side . using a rigid plastic , this embodiment can provide an essentially permanent connection . the d - shape enhances the anti - rotational effect ( in the loosening direction ) of the bosses because of the engagement of the abutting flat surfaces of the d - shaped bosses and openings . thus , this alternate embodiment of the male connection end could be employed to make the handle even more robust and difficult to disassemble . preferred embodiments of the invention have been described above in considerable detail . other modifications and variations to the preferred embodiments will be apparent to those skilled in the art , which will be within the spirit and scope of the invention . for example , although multiple short pole sections are preferred , the assembly could comprise only one pole section ( of any length ) and one accessory section , without departing from the scope of the invention . moreover , the projections could be any suitable shape , other than round and d - shaped , such as rectangular , as could the openings , which could be internal grooves or recesses that do not extend through the thickness of the section walls . therefore , the invention should not be limited to the described embodiments . to ascertain the full scope of the invention , reference should be made to the following claims .	8
referring first to fig1 of the drawings , it will be noted that this figure is a plan view of the basic layout of the store . the store is generally indicated by the numeral 10 and includes opposed perimeter walls 11 and 12 , a rear wall 13 , a floor f and a ceiling c ( see fig6 ). this particular embodiment of the invention is intended for installation in or along with a series of stores arranged side by side wherein the perimeter walls 11 and 12 frame an entrance way . the operative or sales area of the store itself is essentially framed by the perimeter walls 11 and 12 and rear wall 13 and a line drawn between the ends of the perimeter walls 11 and 12 . this type of store has particular utility in a shopping center or mall wherein a common central corridor is disposed adjacent the open end of the overall store although it could be used in a freestanding situation also . referring in general then to fig1 again , it will be noted that the floor space is essentially divided into two sections by dividing wall 14 and cash and wrap counter 50 . these components divide the store into a basic selling area and a basic office , storage and miscellaneous area . it is the selling area which is of primary importance in the present application . again , in general terms , the selling area , bounded by perimeter walls 11 and 12 and dividing wall 14 and counter 50 , includes end display units 20 and 21 , wall display units 30 , 30 , free standing display units 40 , 40 and counters 50 and 60 . overhanging all of this structure is a canopy or drop ceiling arrangement 70 . for purposes of general description , reference is made to fig1 and 7 and particular attention is called to the fact that the freestanding display units , which are generally indicated by the numeral 40 , include a plurality of individual display cases 41 , 42 , 43 which are arranged in end to end relationship , but which have various configurations so that an irregular or angular overall arrangement can be presented . at an intermediate point between the ends of the overall display 40 a door 40a can be provided with the exact location of this door not being critical , but some means of access from the front to the rear of the display cases being necessary . it will be noted that on opposed sides of the store these freestanding display units 40 are similar , although not necessarily quite identical . the similarity is that they are similarly constructed and are arranged in end to end relationship stretching from the open or access end of the store to the dividing structure of wall 14 and counter 50 and that they are arranged in angular relationship . the exact angular arrangement , however , is not identical on opposed sides of the store although they do complement each other and create a harmonious pattern while maximizing the available floor space . also received interiorly of the store is a &# 34 ; cash and wrap &# 34 ; counter 50 , which is essentially the sales counter , and a repair counter 60 . referring to fig2 then for a more detailed description of the freestanding display units such as unit 41 , it will be noted that this unit includes support legs 41a , a base 41b for receipt of the articles to be displayed and a glass enclosure 41c which permits , of course , the articles to be readily viewed . all of the various counters 40 , 43 , 43 , etc . have essentially similar components although the exact planar configuration will vary as is clearly evident from fig1 in order to achieve the unique angular relationship therebetween and to present the unique visual effect achieved thereby . referring to fig3 for a description of the wall display units 30 , it will be noted that these essentially include storage units 31 , 31 which project upwardly from the floor surface f . these are relatively conventional and include sliding doors so that articles can be stored therein . directly above the store units 31 , 31 are display units 32 , 32 . these display units essentially comprise a vertical wall surface 32a upon which the articles can be displayed by means of shelves , hooks or any other suitable device and sliding glass doors 32b which permit ready access to the articles which are displayed and also permit , of course , the articles to be readily viewed . the wall surface 32a can be of any desirable material , but will be colored with what will be referred to as the &# 34 ; first &# 34 ; color . disposed above , the display areas 32 is a vertical wall surface . this wall surface is essentially divided into various components such as suede covered panels or sections 33 and mirror or reflective sections 34 . the panels 33 are preferably all of one color which will be referred to herein as the &# 34 ; second &# 34 ; color . the reflective surfaces , when displayed and disposed in conjunction with the remaining components of the overall store layout , provide a sense of spaciousness and also enhance the overall appearance of the store . the ceiling c is illustrated in fig6 and includes a reflective surface 80 of polished aluminum or similar material covering substantially all of the selling area . a number of light fixtures 81 , 81 are also provided with the precise number and type of such fixtures being determined by the desires and requirements of the individual store site . referring then again to fig1 and 5 , it will be noted that a canopy 70 depends from the ceiling ( not shown in fig1 ). this canopy has vertical walls 71 , 72 . an important feature of the canopy 70 is that , to a certain degree , it conforms to the configuration of at least a part of the freestanding display units 40 . reference to fig1 and to fig7 will clearly show this . in that regard , it will be noted that the canopy 70 is essentially triangular in plan with its point corresponding to the point or corner formed on display unit 45 . furthermore , the legs of the triangle of the canopy 70 are on the same plane as the front surfaces of the unit 45 and the door 40a so that they present a harmonious overall appearance and complement and accentuate . the walls 70 and 71 are preferably covered with suede and have the &# 34 ; second &# 34 ; color so as to coordinate with the vertical surfaces 33 . the end display units 20 and 21 project from the perimeter walls 11 and 12 and effectively frame the entrance way leading to the common hall or passageway of the shopping center or malls . these units , it will be noted ( see fig2 and 7 ), consist of a floor to ceiling pedestal of generally rectangular cross section . it will be noted that these units are disposed so that at least one wall thereof will lie in a parallel plane to at least one of the faces of the cabinets 40 . in this way , the angular or irregular configuration and the impression created by the display units 40 will be carried out and complemented by the end display units 20 and 21 . these units 20 and 21 also have a display area 20a and 21a . there is a glass enclosed area having suitable lighting 23 behind or within it so that articles can be readily displayed therein . also ( see fig2 ) suitable signage 22 , 22 is provided . this is &# 34 ; back lighted &# 34 ; or illuminated and portrays the name of the store . a similar treatment is provided in the wall 72 of the canopy 70 so that a consistent presentation of the proprietor &# 39 ; s identification is included throughout the store . the outer walls of end display units 20 and 21 are also covered with suede as at 20b and 21b and have the &# 34 ; second &# 34 ; color while the vertical surfaces within display areas 20a and 21b have the &# 34 ; first &# 34 ; color . part of the present invention involves color . in this regard specific colors are not involved or claimed as being relevant to patentability , however , relative colors and their use in conjunction with the other structural features are considered to contribute to the creation of a new and useful structure . thus , it has been found that by providing the vertical display surfaces 32a of the wall units 30 and the vertical display surfaces of the display areas 20a and 20b of the end display cases 20 and 21 of the floor surface f with one color ( the &# 34 ; first &# 34 ; color ) and the remaining vertical wall surfaces of the canopy 70 and the balance of the perimeter walls and wall cases a &# 34 ; second &# 34 ; color that , in combination with the mirror effect achieved by the reflecting ceiling and the mirrors 34 mounted on the perimeter walls above and about the wall display cases , that a unique sensation of spaciousness and unity can be achieved . to maintain consistency in this pattern , the dividing unit which includes counter 50 and wall 14 are treated in similar fashion as can be seen by fig5 . thus the face 54 of counter 50 is mirror covered while door 14a has the &# 34 ; first &# 34 ; color . wall 14 has mirror surface 14b and a &# 34 ; first &# 34 ; color surface 14c . also , the face of repair counter 60 is suede covered with the &# 34 ; second &# 34 ; color . the area between partition or dividing wall 14 and counter 50 and the rear perimeter wall 13 has not been described in detail . this area is primarily intended to be used for office and storage purposes and really forms no part of the basic selling area which is the primary subject of this invention . turning next then to fig8 through 14 for a discussion of a modified form of the invention , it will be noted that this form of the invention essentially is intended for utilization in a corner location as contrasted to the form of the invention shown in fig1 through 7 . however , most of the essential components of the store are either identical or quite similar and essentially differ only in two respects . first , the second perimeter wall does not extend along the entire length of the store , and second , certain freestanding display islands are employed in addition to the wall display units and freestanding display units . in discussing the form of the invention illustrated in fig8 through 14 , an attempt has been made to utilize similar reference numbers of the 100 series so that , for example the overall store layout referred to by the numeral 10 in fig1 becomes the layout 110 in fig8 . turning then to fig8 perimeter walls 111 and 112 are employed as is a rear wall 113 . the perimeter walls frame an entrance way , although that entrance way is somewhat larger than that shown in fig1 through 7 due to the fact that the store is installed on a corner location and perimeter wall 112 is a relatively short &# 34 ; stub .&# 34 ; for security purposes , sliding glass doors 201 , 201 can be provided to close off the entranceway as illustrated along the side of the store which includes wall 112 as shown in fig1 . again , the overall store layout 110 is divided into a selling area and a storage and office area by the cash and wrap counter 150 and the repair counter 160 . the ends of the perimeter walls 111 and 112 again include end display units 120 and 121 . these differ slightly in cross section from end units 20 and 21 , but do present vertical faces which lie in planes parallel to those of the other display units . furthermore , wall display units 130 , of a type similar to that illustrated and described in connection with the embodiment of fig1 through 7 , are disposed along perimeter wall 111 . thus , these units include storage units 131 , 131 and display units 132 , 132 which again include a vertical wall surface 132a of the &# 34 ; first &# 34 ; color and are enclosed by sliding glass doors 132b , 132b . freestanding display units 140 are employed in this form of the invention , although in this instance only along one side of the store due to the fact that effectively two sides are open in this embodiment . however , these also embody the same structural components as the units 40 and also are arranged in a similar angular configuration as is clearly evident from fig8 and 14 of the drawings . thus the units 140 each include legs 140a , bases 140b and glass enclosures 140c . the end units 120 and 121 are also virtually identical including the feature of the walls being at least , in some instances , parallel with the planes of the faces of the display units so as to complement and carry out the angular arrangement . these units also include the display areas 120a and 121a and the lighted signage 122 together with the covered wall surfaces 120b and 121b and lighting 123 . this embodiment of the invention also differs as noted above , however , by employing certain freestanding islands 190 . these are somewhat irregular and six - sided . however , they each include support legs 191 , 191 , an article supporting area 192 and a transparent enclosure 193 . each of them also includes an access door 194 . associated with at least some of the units 190 is a floor to ceiling pedestal 195 which is covered with reflective material such as a mirror . also a small freestanding unit 200 is provided . at least one of the islands 190 has associated with it a canopy 170 ( see fig8 and 12 ) depending from ceiling c ( see fig1 ). this canopy has a plurality of vertical sides 171 , 171 and at least one of those sides has signage similar to that contained on the end panels 120 and 121 . as is the case with the form of the invention described in connection with fig1 through 7 of the drawings , the canopy also has a planar configuration which is complemental to that of the islands thereby focusing attention on them and also thereby accentuating , complementing and completing the angular concept which is employed with regard to both the islands and the freestanding display units 140 . referring to fig1 , ceiling c is covered with reflective material 180 , and also supports suitable lights 181 , 181 . the coloring or relative coloring in the form of the invention illustrated in fig8 through 14 is similar to that of fig1 through 7 in that essentially , except for fairly neutral areas such as areas which might be made of stainless steel , two colors are employed with the background of the display units being a &# 34 ; first &# 34 ; color in conjunction with the floor f and remaining vertical surfaces being of the &# 34 ; second &# 34 ; color . all of this taken with the reflective features of the columns 195 , 195 and the surface 180 of ceiling c as well as the mirror surfaces on some of the upstanding walls cooperate to give the feeling of spaciousness and the impression of angularity and the consistency desired . furthermore , with both embodiments of the invention , it should be noted that the practical objects of a retail type store are achieved . first of all , the product or merchandise is readily available for view throughout the store . secondly , the desireability of the merchandise is enhanced by the profusion of reflecting surfaces . third , accessability for the persons working in the store is also readily enhanced by the design layout . furthermore , security is achieved without sacrificing the aesthetic appearance of the overall store . the store is compact , but gives the impression of spaciousness and is attractive without sacrificing the utilitarian aspects thereof . forth , the angular arrangement of the display units is eyecatching but also permits maximum utilization of the available floor space . while a full and complete description of the invention has been set forth in accordance with the dictates of the patent statutes , it should be understood that modifications can be resorted to without departing from the spirit hereof of the scope of the appended claims . thus , while suede has been mentioned as a covering for some of the vertical surfaces , it should be understood that the invention is not intended to be limited to a specific material .	4
referring now to the figures of the drawing in detail and first , particularly , to fig1 and 2 thereof , the device according to the present invention , which is used to support or route lines in sewers includes the cable conduit shown in fig1 and fig2 . this cable conduit comprises a base 1 and side walls , or cheek pieces 2 that extend from the base 1 . as can be seen in fig2 , the base 1 comprises individual sheet - metal segments 3 that are connected flexibly to one another by way of hollow rivets 4 , the heads of which are countersunk into the segments 3 so that they do not protrude and thereby impede the flow through the sewer . the cheek pieces 2 are formed from flexible plastic . they incorporate side slots 5 that accommodate arc - shaped edges 6 of the segments 3 forming the base 1 . the edges 6 can be introduced into the slots 5 by pivoting the cheek pieces 2 about the radius of curvature of the edges 6 of the segments 3 , after which they are securely anchored in the cheek pieces 2 . as can be seen from fig1 , the cheek pieces 2 have continuous chambers 7 formed with side openings 9 that can be partially closed by the flexible lips 8 , and by which additional lines can be supported in the cable conduit . the additional lines are introduced through the openings 9 . two pipes 10 that enclose channels 11 are disposed in the space between the cheek pieces 2 . lines , preferably fiber optic cables , are routed through these pipes . the pipes 10 are separated from one another by a spacer 12 that is of hard plastic and thus provides flexible support for the pipes 10 and can adapt to the curvature of the cable conduit . the spacer 12 is disposed above the hollow rivets 4 . self - tapping screws 14 , shown in detail in fig3 , are used to secure the cable conduit to the sewer wall 13 . the screws 14 pass through the hollow rivets 4 and the spacer 12 , and they are anchored in the sewer wall . each self - tapping screw 14 is surrounded along a section of its thread by a silicone sealant 15 which , as can be seen from fig1 , seals off the screw hole in the passage wall once the screw has been inserted . with reference to fig4 to 6 , the sewer opens out into a clean - out or inspection shaft 16 that is connected to the surface . a conduit box 18 is mounted on the wall of the shaft in the area of the opening . the conduit box 18 is secured to the wall 17 of the shaft by screws that pass through tabs 19 . the conduit box 18 can be coupled to the cable conduit , which is formed from a base 1 and the cheek pieces 2 , through an extension piece 20 that is so configured that the individual fiber optic cables 21 are curved in a manner that prevents them from becoming damaged . within the conduit box 18 , the individual fiber optic cables 21 are connected through sleeve connectors 22 ; the fiber optic cables are then either routed to an adjacent section of the passage , or connected to a branch cable 21 ′ that emerges into the shaft 16 through a twist connector 23 to be routed onward along the wall of the shaft . the conduit box 18 is closed off by a cover 24 so as to be watertight . in the area of the extension piece 20 , the conduit box 18 has on its outside a rounded guide surface 25 that is bordered on its side by projecting cheek pieces 26 . this guide surface 25 serves to support a high - pressure cleaning hose that can be introduced into the sewer through the shaft 16 , and because of the manner in which it curves , prevents damage to the high - pressure hose at the guide points ; the high - pressure hose is prevented from sliding off the side of the guide surface by the cheek pieces 26 . in addition , studs 27 extend from the opposite side surfaces of the conduit box 18 ; if they are required , guide rollers for a high - pressure cleaning hose or supports for such guide rollers can be mounted on or secured to these studs . fig1 a is a schematic cross section through a cheek piece at a scale that is greater than that used for fig1 . the cheek piece 2 has a bottom 30 from which there extend dividers 31 that are , in particular , parallel and end at the lips 8 . these flexible lips 8 define the chambers 7 that are formed between the dividers 31 . the recess 34 into which the curved end area 6 of the base 1 can be inserted can also be seen in fig1 a . in order to ensure firm installation on a wall , or in particular a ceiling , on which the device is to be installed , in the end area of the cheek piece 2 that is remote from the base there is a distance piece 32 that is preferably perpendicular to the base 1 ; in principle , this distance piece 32 could also extend the bottom 30 . if the base 1 is to be secured to a wall by means of the screw 14 , this distance piece is pressed against the wall and thereby forms a seal and simultaneously prevents the uppermost divider 31 of the cheek piece 2 , i . e ., the one remote from the base , from being bent excessively by small irregularities in the surface of the wall , so that the opening 9 is closed , with the result that subsequent installation of lines is made much more difficult . this distance piece 32 is shown diagrammatically in fig1 . in addition to the foregoing , a flange 33 , especially one that is pliable , flexible or elastic , can branch of f from the base bottom 30 toward the interior of the device . this flange subtends an angle of 0 ° to 60 ° with the base or with a perpendicular to the bottom 30 . this resilient flange 33 is intended to provide elastic or flexible support for or secure the pipe ( s ) 10 in the interior of a channel 11 , as can be seen in fig1 . the distance piece 32 and the resilient flange 33 can be formed in one piece on the cheek pieces 2 , and are substantially of the same material . both the distance piece 32 and the resilient flange 33 can extend , either continuously or intermittently , along the entire length of the cheek piece 2 . in principle , these parts can also be configured in sections or extend across sequential subareas of the cheek pieces 2 .	5
referring now to fig1 what is shown is a typical gsm system in which in - phase and quadrature components of the transmitted signals are recovered to provide a bit stream which conveys the information transmitted . here a network 10 is utilized to transmit the information to and from multiple users 12 , 14 and 16 and a base station 18 through a wireless communication network to and from a cell tower 20 . the ability to overuse frequencies is depicted by a situation in which there are multiple simultaneous users all assigned to a single channel or tdma time slot at a given frequency . thus user 1 transmits on channel 1 , as does user 2 and all other users assigned to that channel , up to user k . it is the purpose of the subject system to sort out the interfering signals with signal processing at the receiver , in this case at the base station . it will be appreciated that identical processing is carried out in each of the handsets so that full duplex , two - way communication can be achieved by multiple users on both the forward and reverse channels . by so doing , the channel capacity of a tower , a satellite or other transmit / receive point can be augmented by the amount or the number of users that can simultaneously utilize a given channel . referring to fig2 , if two users , here illustrated at 22 and 24 , were to simultaneously transmit information over the same frequency , a base station 26 coupled to a matched filter 28 , in turn coupled to a decision unit 30 would provide as an output hopelessly corrupted signals . the reason is that the individual signals would be interfering with each other . in present systems , signals are intentionally coordinated to avoid interference because if one signal were to interfere with another signal and if no attempt was made to remove interference or to disambiguate the signals , the demodulated signal is corrupted beyond recognition . it has been found , however , that there is a significant amount of information carried by each of the signals which can be utilized to identify the signals and to separate them to provide intelligible information . referring now to fig3 , the case is illustrated where there is one signal per channel . here a transmitting source 32 transmits to a receiver 34 utilizing an in - phase , quadrature modulation scheme with a root raised cosine transmitter filter . a matched filter 36 is provided with a root raised cosine filter . this is followed by 37 in which they are separated , then in - phase and quadrature components sampled at 38 and in - phase and quadrature sample streams in which the information is carried in the sign of the samples . in the illustrated example the bits are either − 1 or 1 , with the in - phase and quadrature signals from the matched filter being sampled by clock 40 at the bit rate . these in - phase and quadrature signals are then supplied to an interleave re - assembler 42 which results in a demodulated output 44 corresponding to recovered in - phase and quadrature components of the modulated signal . referring now fig4 a , in one embodiment , in the subject system two or more simultaneous signals are transmitted from handheld units 22 and 24 to a base station 26 . here , the output from the base station is supplied to a joint parameter processing unit 50 which seeks to recover all relevant parameters of both signals in terms of power , offset and oscillator phase . as will be described , processor 50 may provide these joint parameter estimates through an estimation process . as illustrated at 52 , a power , offset and phase detector is utilized to provide an initial estimate of parameters from signals on the acquisition channel . note , that detector 52 operates by calculating the parameters during the acquisition phase in which the new transmitter sends its signal over the control channel 54 without any interference from other users in that channel . it will be appreciated as illustrated at 56 that base station 56 assigns two users to the same channel , with the number of signals on the same frequency 58 being derived therefrom . this information is passed to the joint parameter estimation processor 50 and signal separator 60 so that the appropriate estimations are provided to signal separation unit 60 . the output of the base station , namely the scrambled signals , are coupled to signal separation unit 60 , the operation of which will be described hereinafter . utilizing the power , offset and phase estimations , signal separation unit 60 disambiguates or recovers the data streams corresponding to the two signals based on multi - user detection techniques . it employs an exhaustive search algorithm which , in essence , runs through all the possibilities of data points in a received constellation and determines which data points belong to which signals . the ability for this algorithm to sort out the various data streams from the corrupted received signal is due in part , to the different powers , offsets , and phases . as can be seen in fig4 b , the description of multi - user detection is in accordance with the verdu text , chapter 4 . the minimum bit error rate multi - user detector can be implemented by a dynamic programming algorithm that carries out an exhaustive search of all possible bits streams for all interfering users jointly to ascertain the most likely bit stream for each user . having assigned bit streams to users means that the transmitted information corresponding to each interfering user is separated . the exhaustive search carries out two independent iterations each of which requires a computational effort proportional to the number of stages and to the number of states per stage m kn . therefore the complexity per bit is on the order of m kn . it will be thus appreciated that the exhaustive search algorithm utilized to determine which of the data points pertain to which of the interfering signals requires an extensive amount of computation power . in general , multi - user detection has been accomplished with relatively massive computers . such intense computations cannot presently be carried out by the cpus within handsets or within the base station . it is therefore important to be able to cut down on the exhaustive search in order to be able to implement the signal separation bits in a handheld unit and in real time at the base station . referring now to fig5 , how the computational reduction is accomplished is now described using a simplified example . it will be seen that two waveforms 62 and 64 , having identical phases , exist in respective envelopes , are summed as illustrated at 66 and are extracted by filter 68 and then sampled at 70 . the result has four possible values + a 1 + a 2 , + a 1 − a 2 , − a 1 + a 2 , or − a 1 − a 2 . these components can be plotted as data points in a received constellation and as illustrated in fig5 , 6 and 7 where each shows a different phase and power relationship between the two signals . there is a certain amount of uncertainty as to these data points due to background and receiver noise as illustrated at 74 . it is the purpose of the exhaustive search , in effect , to be able to provide an estimate of the actual data point in the received constellation and it is this search that must be heavily curtailed or refined so as to reduce the computational load . one of the contributors to the total number of the data points to be searched is the length of the inter - symbol interference tail , here illustrated at 80 , which will be seen to exist from a latter portion of the signal 84 and is interfering with the main portion of pulse 82 . as one of the aspects of the subject invention , this tail is ignored to provide a more amenable number of data points in the received constellation . specifically , this corresponds to less states per stage in the search trellis or viterbi decoder . it will be appreciated that the effect of the tail of one user on the succeeding main portion of the pulse corresponding to the other user is power dependant . for instance , if the power of the signal which is interfering is relatively low compared to the highest power signal , then the effect of ignoring the lower power signal tail is minimal on the exhaustive search process results pertaining to the highest power signal . on the other hand , the effect of ignoring the high power signal tail is catastrophic on the results of the exhaustive search that pertain to the lower power signal . if both signals are received at relatively similar powers , then ignoring the tails causes only negligible increase in the size of the uncertainty cloud around each point in the constellation , while dramatically reducing the total number of points that must be searched . what this means is that the exhaustive search need not go through a tremendous number of possibilities in order to assign a data point to a given signal if isi tails can be ignored . the two techniques of ignoring inter - symbol interference tails beyond r - symbols , r & lt ; n , and the use of a stripping technique to strip off the highest power user or group of users are illustrated in fig8 . here the simplest rendition is shown for which the highest power user is stripped off at 86 prior to the exhaustive search multi - user detection being performed , as illustrated at 88 . it will be appreciated that in the exhaustive search multi - user detection inter - symbol interference tails beyond r bit durations are ignored . the combination of the stripped - off highest power user and the ignoring of the tails reduces the computation load by , in general , at least five orders of magnitude in the recovery of the various bit streams , here illustrated by b 1 and b 2 . . . b k . as illustrated in fig9 , if the signals are of the same power , there is no stripping and the exhaustive search multi - user detection 88 is performed , again ignoring interference tails . referring now to fig1 , more particularly , base station controller 90 provides the received signal in the acquisition channel over line 92 to a standard single user parameter estimation unit 94 which is in turn coupled to a joint multi - user parameter refinement and user grouping unit 96 . also , an input to unit 96 is the number of signals currently assigned to traffic channel x as illustrated by line 98 . the received signal in traffic channel x is delivered over line 100 to unit 96 and to a joint multiple - user signal demodulation unit 102 which requires the output 104 of the parameter refinement and user grouping unit . note that the standard single user parameter estimation unit is coupled to the joint parameter refinement and user grouping unit 96 via a line 106 which provides to this unit initial estimates of power , carrier phase , carrier offset , and timing offset . the output of the joint multiple - user parameter refinement and user grouping unit is a set of improved estimates of power , carrier offset , and timing offset for all the signals in traffic channel x . these five parameters and user groupings are utilized by the joint multiple user signal demodulation unit so as to be able to output a raw bit stream for user 1 , user 2 . . . user k , representing the separated signals . it will be noted that unit 96 , also functions to determine a grouping of the incoming signals in terms of their relative power . it will be appreciated that the raw bits streams may be run through the remaining processing already present in the system such as the deinterleaving , error correction decoding and other filtering techniques . referring now to fig1 , the joint multiple user signal demodulation system is described . here joint multiple user signal demodulation unit 102 has an input which is the received signal in channel x , here illustrated at 100 . as will be seen , the received signal is applied to a joint demodulation , remodulation , stripping and user grouping unit 10 which in essence processes a first group of q 1 incoming signals which have been grouped according to power . the output of user group 1 unit 110 is an estimate of the received signal if the only users present were those having received powers below those in the first grouping . this output is then applied to a joint demodulation , remodulation stripping unit for user group 2 as illustrated at 112 , the output of which , again , is an estimate of received signal if the only users present were those having received powers below those in the second grouping . the process is iterative such that for all user groupings up to user grouping l the process continues until the signals are processed for user grouping l as indicated at 114 . it will be noted that the output of each of units 110 , 112 and 114 are raw bit streams for all users in the particular groupings . for instance , the output on line 116 is the raw bit stream for all q 1 users in the first grouping , on 118 the raw bit stream for all q 2 users in the second grouping and on line 120 the raw bit stream for all ql users in the last grouping . referring now to fig1 , the operation of a joint demodulation , remodulation and stripping unit is described . here input signal 100 is applied to an optimum asynchronous multi - user detector 130 for a user in a current grouping , in this case the first grouping . this unit also takes into account isi tail modifications . the optimum asynchronous multi - user detector or mud 130 is the unit which performs the multi - user detection utilizing the techniques described in verdu , chapter 4 and in this case ignores the existence of intersymbol interference tails that exists beyond the appropriate number of symbols , say , r . this is done to significantly reduce the computational complexity of the exhaustive search provided in this unit . as indicated in chapter 4 of verdu , the multi - user detection algorithm requires the knowledge of received powers , phases , frequency offsets , and timing offsets for all users sharing the channel which is the output from the joint parameter estimation procedure . in addition , user - grouping information is also passed over line 104 to unit 130 . from this information unit 130 determines the q 1 signals to be processed and the k − q 1 signals to be ignored at this stage . by grouping together a small subset , q 1 , of the total number of users , k , one reduces the complexity of the optimum asynchronous multi - user detection and results in complexities m q1 × r where q 1 is the number of users in this first sub - group . recall that r is used to denote the reduced isi number which is less than n , the actual isi number . it will be appreciated that the output of unit 130 is a raw bit stream for all users in the current grouping as illustrated on line 132 , whereas another output of unit 130 is applied to a unit 134 which remodulates and recreates received signals with full isi tails for users in the current grouping . the purpose of unit 134 is to recreate the received signal that would be present when the only users transmitting are those associated with the first grouping . note that each user &# 39 ; s signal is recreated with the full extent of isi tails . this operation is accomplished at 136 such that the output at 138 is an estimate of the received signal if the only users present were those having received powers below those in the first grouping . it will be appreciated that the signals at output 138 are those which correspond only to a smaller number of transmitting signals . for example , if fig1 were to represent the joint demod - remod - strip block associated with the first user grouping , output 138 would correspond to only k − q 1 users . it will be appreciated that block 110 is repeated in order to stepdown a number of users so that the computational complexity of the optimum synchronous mud is significantly reduced . the overall result is to reduce the computational complexity by at least five orders of magnitude when power grouping is possible . it will be appreciated that in order for the optimum synchronous multi - user detection unit to operate properly , it is important that the inputs thereto be accurate in terms of the receive powers , phases , frequency offsets and timing offsets of all of the users sharing the channel . in essence there are two ways in which to estimate the above parameters . the first is an apriori way of estimating the parameters as illustrated by unit 94 which assumes a single user exists in the acquisition channel . unit 94 performs a simple parameter estimation based on the signals in the acquisition channel . it will be noted that when a phone is turned on , the phone must communicate to the base station over the separate acquisition channel prior to being assigned to a traffic channel . if a user is all alone , the parameter estimation unit 94 can ascertain power , timing offset and frequency offset with state of the art technology . it is these signals which can be utilized to establish apriori an initial estimate of the powers , frequency offsets and timing offsets of all users sharing the channel . this system of parameter estimation works because only a single user is allowed to transmit over the acquisition channel at any time . it will be appreciated that only one user seeks to join the system at one given time . the result is that if one user is utilizing a given traffic channel and another user seeks to communicate with the base station , assuming that the base station has run out of available traffic channels , the second user can have its parameters ascertained in the above manner and then be connected over the same traffic channel . this is a continual process upon the access of an additional user on the traffic channel . once a user hops off the acquisition phase over to the traffic channel , his or her parameters are refined . this is accomplished by unit 96 of fig1 . the joint multiple user parameter refinement and user grouping unit 96 calculates an estimate of phase and refines initial estimates of power , carrier offset and timing offset as illustrated in fig1 . while it is indeed possible to use unrefined parameters for signal separation , it is more useful to further refine these parameters so that a more robust signal separation can be accomplished by optimum asynchronous multi - user detector 130 of fig1 . referring now to fig1 , how the refinement is accomplished is now described : as can be seen , incoming signal 100 here illustrated by r ( t ) goes to a unit 140 which functions to isolate the training sequence portion of the corrupted signal . in one embodiment of the subject invention a training sequence is established during acquisition by base station 26 of fig4 a , which assigns a unique training sequence to each user that is assigned the same traffic channel . the system uses the training sequence to allow for tracking of bit timing offset , a frequency offset and phase . thus during acquisition the base station communicates with the handset to synchronize its timing with that of the base station , and , in effect , with the timing of the other users already in the traffic channel that will also be assigned to this new user . this is accomplished traditionally in any tdma based commercial cellular or satellite system . this training sequence is utilized additionally in the subject system to provide means of separating the individual signals so that one can ascertain refined parameter estimates . thus , as illustrated at 140 , the received signals are isolated based on zeroing out of the portions of the signals corresponding to the data bits , leaving the portions of the signal relating to training bits only as an output . the training sequence portion of the received signal corresponding to the transmitted signals occupying traffic channel x is illustrated at 142 and 144 , with the zeroing out of the signal due to the data portion of the received signal . the output of unit 140 is applied to a summing junction 146 . at 148 , signals corresponding to the training sequence portion of all user signals that were previously assigned to same traffic channel are recreated . thus the output of 148 is an estimate of the training sequence portion of the received signal due to all of the users minus the newest . at 146 , the estimate of the training sequence portion of all but the newest user is subtracted from the training sequence portion of the received signal that contains all users including the newest . the result , on 150 is an estimate of the training sequence portion of the received signal that would be present if only the newest user were to exist alone on channel x . this is applied over line 150 to a maximum apostiori estimator for a user k &# 39 ; s parameters , given the known training sequences and initial estimates for user k &# 39 ; s parameters found during the acquisition stage , namely received power , oscillator phase , timing offset and frequency offset . this is accomplished by unit 152 . it will be appreciated that the information over line 150 reflects what the received signal would have been during the training sequence portion if only the newest user were present . thus the above processing appears to unit 152 as if the other signals were not there . note , unit 152 takes up where unit 94 left off . it will be remembered that the standard single user parameter estimation unit 94 assumes that there was only one user per channel , which was true because in the acquisition phase , there is only one user per channel . now unit 152 utilizes the initial information based on the traffic channel and permits the refinement of parameters which are useful in separating the signals in the traffic channel . in estimation theory , it is well known that the quality of the parameter estimates measured in error variance of the estimate is inversely proportional to the duration over which the parameter estimation process is allowed to continue . in short , the longer you look , the better the parameter estimates . what therefore takes place in the estimator 152 is that given the number of users assigned to the traffic channel as illustrated over line 98 and the initial estimates for each user , namely timer offset , frequency offset , power and phase , as illustrated on 106 , estimator 152 continues to run , finding the improved estimates of the parameters of all signals on the communications channel assigned until adequate quality is obtained . this is done by refining the parameters of each user one at a time , always giving preference to the newest user to join channel x , but taking turns to further refine each of the parameter sets corresponding to each user on channel x . more particularly , the estimator operates as follows : the system initially takes in the prior estimates and puts them aside temporarily . then it takes the interference adjusted signal 150 that corresponds to the training sequence portion of the signal transmitted by the new user only . it observes this signal over multiple burst periods , meaning a predetermined short time interval to be used to calculate another set of parameter estimates . in this predetermined interval or window , phase , power , timing offset and frequency offset is determined in exactly the same manner as illustrated at unit 94 , fig1 . this assumes the training sequence noted above . at this point , one has set aside the original estimates and , in addition , has a second set of estimates independent of the first set . the system averages the two to get a better estimate . this process is repeated , adding the new estimates based on the new intervals or windows with the appropriate weighting to reflect an evenly weighted average or giving a heavier weighting to more recent estimates . a maximum number of consecutive estimates is averaged iteratively until the desired accuracy is achieved . it will be appreciated that the multi - user detector needs estimates as soon as possible , preferably in real time and cannot wait until such time as an extremely large number of averages have taken place . in the subject system , the parameter refining unit outputs refined estimates at one time , but then keeps refining the estimates over a longer period of time so that as the system continues to operate , the estimates will become more and more refined , while at the same time providing real time estimates to the multi - user detector . once a good quality estimate has been made for the newest user to join channel x , block 148 switches over to subtract out all but one of the older user &# 39 ; s signals on channel x so as to allow a parameter refinement associated with this user . this process is repeated so that all users parameters are refined in turn . it will be appreciated that as one continues to average over successive time intervals , there will become a collection duration when an optimal averaging takes place for the given system . at this time , estimates based on prior collection intervals arc tossed off or removed so that the estimation becomes as current as possible given the changes in the signals over time . this is referred to here as tracking . thus the estimator 152 refines the parameter estimates with a sliding window of collected data so as to allow the estimates to vary with time . in addition , at any given point in time , up to date estimates of any of the k users assigned to channel x are being sent over 106 to the signal separation block as well as being fed back into 148 . the final result is that , on as close to a real time basis as possible , high quality parameter estimates are fed over 106 to the signal separation block . it will be appreciated that not only is the above parameter estimator useful in the separation of the signals which are simultaneously assigned to a given traffic channel , the estimator is also useful for every kind of multi - user detector which attempts to separate interfering signals , intentionally made to interfere or not . thus the maximum apostiori estimator is used for not only the multi - user signal demodulation system described as the preferred embodiment hereof , it may be utilized in any case where any type of multi - user detection or stripping of signals is required . as a further aspect of the subject invention , the subject system can be made to operate even better through a power control scheme in which the power of an individual handheld units is more carefully controlled to enhance the performance of the signal separation block . the parameter estimator can therefore function to provide estimates of the powers of the individual signals so that their power can be carefully controlled in a closed loop overpacked system . source code for the subject hybrid multiuser detector is now presented : % inputs : traffic out of the downlink and an estimated parameter file . paramflag : when set to 1 , use output from the parameter estimation routin defaulted to 0 ( since the parameter estimate is not quite perfect yet ) demoflag : when set to 1 , the viterbi save the state in the surviving path ; when set to 0 , the viterbi save the bit sequence in the surviving path to save memory for running case with more than 2 users when set to k ( integer ) process only k stage for quick look on the k_est is a scalar integer representing the estimate of k ( number of transmitters in tau_est is a k_est by 1 vector of floating point estimates of the burst delay ( tau ) t_est is a k_est by 1 vector of integer estimates of t ( stagger offset ). dchoutdata is the signal out of the downlink channel module . it is a 1 by l vector of demodoutdata ia a k_est by l matrix of floating point time samples . if nargin & lt ; 1 % when not specified by user set demoflag to be 0 elseif nargin & lt ; 2 % when not specified by user set demoflag to be 0 elseif nargin & lt ; 3 % when not specified by user set femoflag to be 0 elseif nargin & lt ; 4 % when not specified by user set demoflag to be 0 % record the index for later use ( bitinfo can be altered ) % replace training bitinfo with regular data effeectively turn off the training debug bitinfo ( find (( bitinfo ˜= 3 )& amp ; bitinfo ))= 2 ; % jo add bit type of 3 as transition bit for corrlation if iusr = = 1 % the least delay is the longest use it to allocate space a_est = a * 2 ; %% this accounts for multiply by sqrt ( 8 ) -- samples between unit - energy %% and divide by sqrt ( 2 ) -- making the complex waveform % now that everything is base on unit energy no normalization % this block move out of if loop to shared with non parafile case % offset = offset − offset ( 1 ); % make everyone reference to earliest one dim = size ( a_est ); % record matrix dim now ; a_est got altered soon % right now assume all the 32 slot has the same parameters adb = 20 * log10 ( abs ( a_est (:,:, 1 ))); %% uses first time slot to estimate all a &# 39 ; s and tau &# 39 ; s % find any above x db , but not more than 3 , because mud . m takes too long for k & gt ; 3 a_est = a_est * 2 ; % this is necessary for normalization due to gains in oqpskmod . m % map column oriented indx return by find back to ndim idexing idxn = mapidx3 ( idx , dim ); % map idx back to 3 d to derive t and tsc % the current version of parameter estimate every slot is filled offset = offset − offset ( 1 ); % make everyone reference to earliest one % i think here is the problem for the 1 bin off for the delay case else % extra guard bit burst every 4 start from the first % tau : estimate relative multi - user time delay fraction of tfwd in sample % according to time delay . the q component is tfwd from the i channel . % assuming max tau is less than tfwd or bit epoch % note we record the state in the surviving path for traceability % when demoflag is set to 1 . when demo flag is set to 0 iqtau = [ tau ; tau + 1 ]; % tau is unit of 1 tfw 1 tfw later for q component % replace by direct bit calculation to speed up when large number of % mf independent term when all signal are co - exist ( most of time ) % condition for using fix table all interference term are non zeros % rebuild = 1 ; % hard code to examine all tables will remove % if not reuseable or fixcost has not been build for that user % need to find out what exactly is the fs for the simulation % t dependent modulo index should only perform once for every loop . n num_burst_bits = 148 ; % number of bits in a burst ( 120 + 22 + 6 tail ) l_half = 3 ; % square root raised cosine half filter length ( in symbols ) the number of samples per symbol t has to be an even % check to see if the pulse length is zero , or set to zero mi = i ( 1 : 2 : li ); % even data ( since matlab arrays start at one ) % the factor of two corrects for the i and q separation . % we need zeros every 8 samples , not every 4th . . . − dak having now described a few embodiments of the invention , and some modifications and variations thereto , it should be apparent to those skilled in the art that the foregoing is merely illustrative and not limiting , having been presented by the way of example only . numerous modifications and other embodiments are within the scope of one of ordinary skill in the art and are contemplated as falling within the scope of the invention as limited only by the appended claims and equivalents thereto .	7
arc tube 1 has a generally tubular shape with a substantially uniform inside diameter throughout most of its length except at its ends 2 , which have a smaller inside diameter . arc tube 1 is made from high purity alumina powder which contains small amounts of grain growth inhibiting materials and is of monolithic construction . that is to say , before firing , arc tube 1 is pressed into a reduced end diameter shape , instead of being pressed into a uniform cylinder , as in the prior art . sealed in ends 2 of arc tube 1 are metal members 3 . metal members 3 are supports and lead - in conductors for electrodes 4 which are disposed within arc tube 1 . members 3 have a diameter close to the inside diameter of ends 2 in order to be a slip fit therein and to permit provision of a reliable seal therebetween . seals between members 3 and ends 2 are formed by known sealant materials . prior to sealing of member 3 in end 2 , the usual lamp fill , such as mercury , sodium and inert gas , is placed in arc tube 1 . the lamp is completed in the usual manner by disposing arc tube 1 within an outer glass envelope ( not shown ) and by electrically connecting members 3 to the usual screw - type base at one end of said envelope . in a 400 watt high pressure sodium lamp in accordance with this invention , arc tube 1 was 4 . 4 inches long and had inner and outer diameters along its length between ends 2 of 0 . 288 and 0 . 350 inches , respectively . ends 2 of arc tube 1 extended longitudinally about 0 . 2 inches and had inner and outer diameters of 0 . 162 and 0 . 300 inches , respectively . each metal member 3 was a thin wall niobium tube having an outer diameter of 0 . 160 inches . the inner end of member 3 was sealed and had a 41 mil tungsten rod 5 welded thereto , protruding axially into arc tube 1 . supported on the inner end of rod 5 was the usual electrode 4 . in the manufacture of arc tube 1 , a thick - wall cylindrical tube made of a hard rubbery material , such as polyurethane , is used as a mold for the alumina powder to be isostatically pressed . axially positioned within the mold is a pattern the shape of which corresponds to the inside shape of arc tube 1 but somewhat enlarged to compensate for shrinkage of the pressed arc tube during processing . the pattern for the arc tube described above was a low melting alloy ( such as cerrobend ) with a diameter of 0 . 387 inches except at the ends where it tapers to 0 . 225 inches ; it is 7 inches long . the cerrobend alloy consists of 50 % bismuth , 26 . 7 % lead , 13 . 3 % tin , and 10 % cadmium and has a melting point of 150 ° f . the pattern was axially positioned within the rubbery mold , which had an i . d . of 0 . 585 inches , and the space between the pattern and mold was filled with alumina powder . the mold was isostatically pressed at 12 , 500 psi and the pressed alumina tube was then removed from the mold . in order to remove the pattern from within the pressed alumina tube , heat is applied thereto until the cerrobend material melts and flows out of the alumina tube . next , the pressed tube is fired , first at a temperature of about 1000 °- 1200 ° c and , subsequently , at a higher temperature , 1600 °- 1800 ° c , to achieve maximum densification and strength . the firing also eliminates any shell material impurity in the alumina . there are other ways of accomplishing the internal shaping of the arc tube in addition to the use of a low melting alloy : hard waxes may be used or plastics which can be melted . in addition , the pattern can be made of a perforated metal tube whose diameter is equal to the diameter of the arc tube ends . the perforated tube is filled internally with the low melting material and externally shaped to the internal configuration of the arc tube . after isostatically pressing the alumina powder onto this pattern within the rubber mold , this pattern can be removed by heating in which the low melting material runs out through the perforated tube on melting and the tube will then readily slide out . to date , the cerrobend alloy has been found easiest to use , but the wax pattern is potentially slightly less expensive . in this example , seal 6 between niobium tube 3 and end 2 of arc tube 1 was generally peripheral around niobium tube 3 , which had a diameter of 0 . 160 inches . without the reduced diameter end of this invention , a seal in accordance with the prior art would have included a larger periphery , at least 0 . 288 inches diameter for a 400 watt lamp . this is a reduction of about 45 % in the length of the seal line . for minimum seal area , the hole through end 2 should be as small as possible . however , said hole must be large enough to permit electrode 4 to be inserted therethrough . in this example the diameter of electrode 4 was 0 . 160 inches .	7
hereinafter , the present inventive concept will be described in detail with reference to the accompanying drawings so that those skilled in the technical field to which the present inventive concept pertains may easily carry out the present inventive concept . as those skilled in the art would realize , the described embodiments may be modified in various different ways , all without departing from the spirit or scope of the present inventive concept . a part irrelevant to the description will be omitted to clearly describe the present inventive concept , and the same or similar constituent elements will be designated by the same reference numerals throughout the specification . terms or words used in the specification and the claims should not be interpreted as a general and dictionary meaning and should be interpreted as a meaning and a concept which conform to the technical spirit of the present inventive concept based on a principle that an inventor can appropriately define a concept of a term in order to describe his / her own inventive concept by the best method . fig1 is a schematic view illustrating a part of a vehicle in which a side lid according to an exemplary embodiment of the present inventive concept is installed , fig2 is a perspective view illustrating an appearance in which a handle assembly 300 according to an exemplary embodiment of the present inventive concept is assembled , and fig3 is an exploded perspective view illustrating the disassembled handle assembly 300 according to an exemplary embodiment of the present inventive concept . as illustrated in fig1 , an accommodating space ( not illustrated ) is formed in a lateral side portion of a vehicle body 110 so as to accommodate an article , and the accommodating space is opened or closed by a side lid 100 . two upper hinge assemblies 200 are coupled to both sides ( a left side and a right side ) of an upper portion of the side lid 100 , and the upper hinge assemblies 200 are connected with an upper handle 300 , which is coupled to a center of the upper portion of the side lid 100 , by means of cables 600 that are indicated by alternate long and short dash lines in the drawing . two lower hinge assemblies 400 are coupled to both sides of a lower portion of the side lid 100 , and the lower hinge assemblies 400 are connected with a lower handle 500 , which is coupled to a center of the lower portion of the side lid 100 , by means of the cables 600 . when a user operates the upper hinge assemblies 200 by manipulating the upper handle 300 , the upper portion of the side lid 100 is opened downward while being spaced apart from the vehicle body 110 , and when the user operates the lower hinge assemblies 400 by manipulating the lower handle 500 , the lower portion of the side lid 100 is opened upward while being spaced apart from the vehicle body 110 . when the user operates both the upper hinge assemblies 200 and the lower hinge assemblies 400 by manipulating the upper handle 300 and the lower handle 500 simultaneously or sequentially , the side lid 100 may be completely removed from the vehicle body 110 . in this case , the upper hinge assemblies 200 and the lower hinge assemblies 400 are symmetrically disposed on the side lid 100 so as to face each other , the upper handle 300 and the lower handle 500 may be installed outside the side lid 100 , and the upper hinge assemblies 200 and the lower hinge assemblies 400 may be installed inside the side lid 100 . in an exemplary embodiment of the present inventive concept , the upper hinge assembly 200 and the lower hinge assembly 400 are formed in the same shape , the upper handle 300 and the lower handle 500 are formed in the same shape , and configurations of the hinge assemblies and the handles , which will be described below , are applied to other hinge assemblies and other handles in an identical or similar manner . as illustrated in fig2 , the hinge assembly 200 according to an exemplary embodiment of the present inventive concept may include a female portion 210 which is coupled to the side lid 100 and in which a shaft 220 having one end connected with the cable 600 is slidably accommodated , and a male portion 230 which is coupled to the vehicle body 110 and has a through hole portion 231 that is formed so that the shaft 220 penetrates the through hole portion 231 . when the shaft 220 accommodated in the female portion 210 is penetratively coupled to the through hole portion 231 formed on the male portion 230 , the side lid 100 is fixed to the vehicle body 110 and closes the accommodating space , and when the shaft 220 is spaced apart from the through hole portion 231 , the side lid 100 is spaced apart from the vehicle body 110 and opens the accommodating space . specifically , as illustrated in fig3 , the female portion 210 has entry portions 211 that are formed so that the through hole portion 231 formed on the male portion 230 may enter and exit the entry portions 211 , and a support portion 212 that is formed to support a spring 222 that provides elastic force to the shaft 220 . the shaft 220 has a protruding portion 221 which is in contact with the entry portion 211 and restricts movement of the shaft , and the spring 222 is installed between the protruding portion 221 formed on the shaft 220 and the support portion 212 formed on the female portion 210 and provides elastic restoring force to the shaft 220 . a bracket 224 to which the cable 600 is connected is coupled , by means of a bracket pin 225 , to one end ( left end in the illustrated exemplary embodiment ) of the shaft 220 , and when the cable 600 is pulled or released , the shaft 220 is moved leftward or rightward on the female portion 210 . a through hole 232 , which has a diameter that is equal to or relatively and slightly greater than a diameter of the shaft 220 , is formed in the through hole portion 231 formed on the male portion 230 , and when the male portion 230 enters the female portion 210 , the shaft 220 is inserted into the through hole 232 . fig4 a is a cross - sectional view illustrating a configuration in which the male portion is spaced apart from the female portion , fig4 b is a cross - sectional view illustrating a configuration in which the male portion enters the female portion , and fig4 c is a cross - sectional view illustrating a configuration in which the male portion is completely engaged with the female portion . as illustrated in fig4 a , before the male portion 230 enters the female portion 210 , the shaft 220 is moved toward the right side by elastic force of the spring 222 , such that the protruding portion 221 is maintained to be in contact with the entry portion 211 of the female portion 210 . in this case , a first inclined surface 223 having a predetermined inclination angle is formed at the other end ( right end in the illustrated exemplary embodiment ) of the shaft 220 , and a second inclined surface 233 , which has a shape corresponding to the shape of the first inclined surface 223 of the shaft 220 , is formed at an end ( lower end in the illustrated exemplary embodiment ) of the through hole portion 231 formed on the male portion 230 . when the male portion 230 is spaced apart from the female portion 210 , the first inclined surface 223 formed on the shaft 220 is disposed between the entry portions 211 of the female portion 210 , and the second inclined surface 233 formed on the male portion 230 may be positioned above the first inclined surface 223 . as illustrated in fig4 b , when the male portion 230 enters the female portion 210 , the first inclined surface 223 of the shaft and the second inclined surface 233 of the through hole portion come into contact with each other , and the shaft 220 is slowly moved toward the left side while overcoming the elastic force of the spring 222 . as illustrated in fig4 c , when the male portion 230 completely enters the female portion 210 , the shaft 220 is moved toward the right side again by elastic force of the spring 222 , and the end of the shaft 220 is inserted into the through hole 232 formed in the through hole portion 231 , such that the vehicle body 110 and the side lid 100 are coupled to each other . fig5 is a perspective view illustrating an assembled handle according to an exemplary embodiment of the present inventive concept , fig6 is an exploded perspective view illustrating the disassembled handle according to an exemplary embodiment of the present inventive concept , fig7 is a cross - sectional perspective view illustrating a part of the handle illustrated in fig6 , and fig8 is a usage state view schematically illustrating the handle connected with the hinge assembly according to an exemplary embodiment of the present inventive concept . as illustrated in fig5 and 6 , the handle 300 according to an exemplary embodiment of the present inventive concept includes a handle portion 310 which is rotatably connected to one side of a fixing portion 320 coupled to the side lid 100 by means of a handle pin 314 , and a lever portion 330 which is coupled to the other side of the fixing portion 320 by means of a lever pin 331 , and rotated along with rotation of the handle portion 310 , and has one end connected with the cable 600 . specifically , as illustrated in fig6 , the handle portion 310 includes a grip portion 311 which is formed so that the user may hold the grip portion 311 with the hand and may manipulate the grip portion 311 , and an extension portion 312 which extends from the grip portion and is connected to the cable 600 . two holes are formed in the grip portion 311 , and the grip portion 311 is coupled to the fixing portion 320 by means of the handle pin 314 . a first torsion spring 315 is coupled to the handle pin 314 and provides elastic restoring force to the handle portion 310 . as seen in the illustrated exemplary embodiment , a center of the lever portion 330 is formed to be bent , and a second torsion spring 332 is coupled to the lever pin 331 coupled to the fixing portion 320 and provides elastic restoring force to the lever portion 330 . a recess 313 , which has a shape corresponding to the shape of the lever portion 330 , is formed to be depressed at one side of the extension portion 312 that extends from the handle portion 310 , and the lever portion 330 is rotated while being caught by the recess 313 . specifically , as illustrated in fig5 and 8 , the handle 300 is connected , by means of the cables 600 , with the two hinge assemblies 200 that are disposed to face each other , and the cables 600 are connected to the handle portion 310 and the lever portion 330 of the handle 300 , respectively . when the user holds the handle portion 310 and pulls the handle 300 in a direction of a lower arrow illustrated in fig8 , the entire handle portion 310 is rotated about the handle pin , and the extension portion 312 is operated to be rotated in a direction of a right arrow , such that the hinge assembly 200 , which is disposed at the left side in fig8 , is operated . at the same time , as the handle portion 310 is rotated , the lever portion 330 is caught by the handle portion and then rotated in a direction of a left arrow illustrated in fig8 , such that the hinge assembly 200 , which is disposed at the right side in fig8 , is operated . accordingly , when the user manipulates the upper handle 300 illustrated in fig1 , the upper hinge assemblies 200 , which are connected with the upper handle 300 , are operated , such that the side lid 100 is opened downward , and when the user manipulates the lower handle 500 , the lower hinge assemblies 400 , which are connected with the lower handle 500 , are operated , such that the side lid 100 is opened upward , and whereby depending on the circumstances , the user may appropriately determine a direction in which the side lid is opened . the aforementioned present inventive concept is not limited to the aforementioned exemplary embodiment and the accompanying drawings , and it will be obvious to those skilled in the technical field to which the present inventive concept pertains that various substitutions , modifications , and changes may be made without departing from the technical spirit of the present inventive concept .	1
with reference to the drawing views , generally indicated at 1 is a valve intended for installation on a gas bottle for automobile applications . the valve 1 has a body 2 of substantially t - like configuration , which comprises cylindrical coaxial sections 2a , 2b extending symmetrically across a section 2c which defines axially a threaded fitting 3 of frustum - like configuration adapted for connection to a corresponding threaded seat in the gas bottle . an annular shoulder 4 is defined between said section 2c and fitting 3 . transversely to the plane defined by the sections 2a , 2b , 2c , the body 2 defines a tubular portion 2d which forms a seat for the valve shutter members , of a substantially known type no further described herein . mounted on the tubular portion 2d is an actuating knob 5 of socket - like configuration which is sealed by means of an annular seal 6 . the body 2 of the valve has formed in its interior a gas delivery conduit 7 , also of t - like configuration through respective branches 7a , 7b , 7c extending lengthwise to the sections 2a , 2b , 2c , respectively , of said body . the branches 7a , 7b have at their ends threaded female fittings 8a , 8b for suitable gas delivery pipes 9 . at the intersection area of the branches 7a , 7b with the branch 7c of the gas delivery conduit , there is defined the front closure seat 10 of the valve shutter 11 : an annular seal 12 is arranged to make a seal against the shutter 11 which is mounted inside the tubular portion 2d , the holow whereof is in communication with said intersection area of the branches 7a , 7b , 7c of the gas delivery conduit . formed on one side of the branches 7a , 7b of the gas delivery conduit and through the body 2 of the valve is a bleed hole 13 of large cross - sectional area . a crosshole 14 opening at the end at the shoulder 4 is in communication with the bleed hole 13 . a further bleed hole 15 is formed lengthwise to the tubular portion 2d of the body 2 , which hole opens , in turn , into the bleed hole 13 . adapted for clamping onto the sections 2a , 2b of the valve body are respective bleed pipes 16a , 16b in communication with the exterior of the vehicle in a known manner . the holes 13 , 14 and 15 act as a bleed - out device for any leaking gas , in association with the bleed pipes 16a , 16b . in fact , once the valve 1 is mounted to the fitting 17a of a bottle 17 the outward seal of the joint is ensured by means of a sleeve seal 18 held tightly by suitable straps 19 , any minor leaks past the threaded connection 3 - 17a are led , at the shoulder 4 , to the bleed hole 13 - 14 which opens into the bleed pipes 16a , 16b connecting the valve to the exterior of the vehicle . a second possibility for leaks could occur inside the valve itself , owing to a faulty seal formed by the seal 12 and consequent seepage past the internal thread of the tubular portion 2d . such a leak would be led to the further bleed hole 15 which , in turn , opens into the hole 13 . it should be emphasized that to prevent propagation of that leak out of the valve , the knob 5 is provided with a gasket 6 . another possibility for an imperfect seal and hence , the occurence of leaks , may happen at the connection between the fittings of the delivery pipes 9 to the valve itself , but in this case the leaking gas would be conveyed directly to the exterior of the vehicle via the bleed pipes 16a , 16b . the valve 1 has two threaded fittings 8a , 8b to allow connection of two gas bottles , where contemplated . when not used , one of said fittings is closed by means of an appropriate threaded plug . in practicing the invention , any suitable materials , shapes and dimensions may be used to meet individual requirements .	8
in fig1 which illustrates the principle of the invention , a disk - shaped electrode 1 is rigidly connected to a rotatable shaft 2 in such a way that the center axis of symmetry of the electrode coincides with the axis of rotation r - r . an edge track running around the circumference of the electrode surface serves as a receiving area 3 for a molten metal , e . g ., tin or a tin alloy , and is constructed so as to be wetting for this material . wetting surfaces for the edge track can comprise , e . g ., copper , chromium , nickel or gold . the rest of the electrode surface , or at least a portion of the electrode surface adjoining the receiving area , should not be wetting for the emitter material because application of the molten metal is not desired here . suitable non - wetting surfaces can comprise , e . g ., ptfe , stainless steel , glass , or ceramic . a liquid dispensing nozzle 4 of a fluid generator is directed to the receiving area 3 to apply the molten metal to the receiving area 3 in a regenerative manner as a liquid jet 5 during the rotation of the electrode 1 . since the applied molten metal is propelled to the edge of the electrode by centrifugal force , it is necessary to provide splash protection 6 so that the molten metal that detaches is prevented from spreading in an uncontrolled , undefined manner . depending on the amount of molten metal to be supplied , the rotational speed of the electrode , the diameter of the electrode , and the temperature of the molten metal as well as that of the electrode , a layer between 0 . 1 μm and 100 μm is applied . the appropriate regulating devices required for this purpose need not be discussed herein , as the person skilled in the art can find suitable solutions . an energy beam , e . g ., a laser beam , serving as a pre - ionization beam 7 is directed in a discharge area 8 to an injected droplet of advantageous emitter material in order to evaporate it . in the construction shown in fig2 , a first disk - shaped electrode 1 and a second disk - shaped electrode 9 are rigidly connected to the rotatably mounted shaft 2 at a distance from one another in such a way that the center axes of symmetry of the electrodes 1 , 9 coincide with the axis of rotation ( r - r ) of the shaft 2 . each of the electrodes 1 , 9 contains on its surface facing the other electrode surface a receiving area 3 , 10 which is constructed as an edge track and acts in a wetting manner for the molten metal and to which a liquid dispensing nozzle 4 , 11 is directed . the receiving areas 3 , 10 are arranged on the electrode surfaces in such a way that they lie opposite one another . in order to prevent electrical short circuiting between the electrodes 1 , 9 via the liquid jets 5 , 12 of molten metal , a disk - shaped insulating body 13 , particularly an electrically insulating ceramic plate , is provided and is immersed in the intermediate space between the two electrodes 1 , 9 in an electrode area provided for applying the molten metal . as is illustrated in fig2 , the two liquid dispensing nozzles 4 , 11 are guided through the electrically insulating ceramic plate from opposite sides , one liquid dispensing nozzle 4 works in direction of the force of gravity and the other liquid dispensing nozzle 11 works in countercurrent with the force of gravity . as is shown in fig3 , another construction of the invention comprises a pair of electrodes , only one of which , the cathode electrode 14 , is rotatably mounted . the latter has a smaller diameter than the other , stationary electrode ( anode electrode 15 ) in which the cathode electrode 14 is recessed into a cutout 16 extra - axially so that its axis of rotation r ′- r ′ is oriented eccentrically parallel to the axis of symmetry s - s of the anode electrode 15 . the cathode electrode 14 is rigidly fastened to a shaft 17 which is received by suitable bearings and whose driving means lie outside the discharge chamber . the two electrodes 14 , 15 are insulated with respect to one another so as to resist dielectric breakdown in that they are at a distance from one another that is so dimensioned that a discharge is prevented from reaching a desired position of the plasma generation ( pinch position ) by vacuum insulation . this position lies within the discharge area in the region of an outlet opening 18 for the generated radiation that is provided in the anode electrode 15 . a liquid dispensing nozzle 20 is directed through an opening 19 in the cutout 16 to a wetting receiving area on an edge track of the electrode surface of the cathode electrode 14 . further , an annular groove 21 surrounding the circumference of the cathode electrode 14 is introduced in the cutout 16 , an outlet channel 22 leads from the annular groove 21 to a reservoir 23 for the molten metal . the annular groove 21 is advantageously coated with a non - wetting surface . the radiation source shown in fig4 contains a rotating electrode arrangement according to fig2 in a discharge chamber 26 which can be evacuated by means of vacuum pumps 24 , 25 . electric feeds 1 , 9 to the electrodes are preferably carried out via ring - shaped , electrically separated baths 27 , 28 of molten metal , e . g ., tin or other low - melting metals , e . g ., gallium , into which the electrodes 1 , 9 dip via contact elements 29 , 30 . the contact elements 29 , 30 either comprise a plurality of individual contacts ( contact elements 29 ) which are arranged along a ring on one electrode 9 and guided through openings 31 in the other electrode 1 so as to be electrically insulated or are formed as a closed cylinder ring ( contact element 30 ). suitable partial covers of the melt baths 27 , 28 in the form of inwardly turned outer walls 32 , 33 prevent the molten metal that is pushed outward from exiting the vessels for the melt baths 27 , 28 . since an arrangement of the type mentioned above requires horizontally arranged electrodes 1 , 9 and a vertically directed axis of rotation r - r , a technique for applying a molten metal , such as is provided by the invention , is particularly advantageous because , in contrast to what was previously known , the molten metal cannot be applied to the electrodes 1 , 9 against the force of gravity . the rotating electrode arrangement according to the invention allows current pulses to be supplied to the electrodes 1 , 9 without wear and , above all , with low inductance . further , for this purpose , the melt baths 27 , 28 are electrically connected from the discharge chamber 26 to capacitor elements 38 , 39 via electric vacuum feedthroughs 34 to 37 . the capacitor elements 38 , 39 are part of a discharge circuit which ensures , by generating high - voltage pulses at a repetition rate between 1 hz and 20 khz and by a sufficient pulse quantity , that a discharge is ignited in the discharge area 8 that is filled with a discharge gas and a high current density is generated which pre - ionizes emitter material so that radiation of a desired wavelength ( euv radiation ) is emitted by a plasma 40 that is formed . after passing through the debris protection device 41 , the emitted radiation reaches collector optics 42 which direct the radiation to a beam outlet opening 43 in the discharge chamber 26 . imaging the plasma 40 by means of the collector optics 42 generates an intermediate focus zf which is localized in or in the vicinity of the beam outlet opening 43 and which serves as an interface to exposure optics in a semiconductor exposure installation for which the radiation source , preferably constructed for the euv wavelength region , can be provided . the ignition of the plasma 40 can be initiated in a particularly advantageous manner through evaporation of a droplet of advantageous emitter material injected between the electrodes 1 , 9 . an advantageous emitter material of the kind mentioned above can be xenon , tin , tin alloys , tin solutions or lithium . as was already shown in fig1 , the energy beam 7 which is directed to an injected droplet in the discharge area 8 so as to be synchronized with respect to time with the frequency of the gas discharge is preferably used for the pre - ionization of the emitter material . therefore , in another construction according to fig5 , the emitter material is introduced into the discharge area 8 in the form of individual volumes 44 , particularly at a location in the discharge area 8 that is provided at a distance from the electrodes 1 , 9 and at which the plasma is generated . the individual volumes 44 are preferably provided as a continuous flow of droplets in dense , i . e ., solid or liquid , form at a repetition rate corresponding to the frequency of the gas discharge by means of an injection device 4 that is directed to the discharge area 8 . each individual volume is limited in amount in such a way that it is entirely in gaseous phase after the discharge and can easily be pumped out . the pulsed pre - ionization beam 7 which is provided by an energy beam source 46 , preferably a laser beam of a laser radiation source , is directed to the plasma generation site in the discharge area 8 so as to be synchronized with respect to time with the frequency of the gas discharge in order to evaporate the individual volumes 44 in the form of droplets . when the molten metal which is applied regeneratively to the electrodes 1 , 9 is emitter material , the energy beam 7 for pre - ionization of the emitter material can also be directed thereto synchronous in time with the frequency of the gas discharge , namely either only to one electrode 1 or 9 , or simultaneously to both electrodes 1 , 9 , or alternately to one and then the other electrode 1 or 9 . while the foregoing description and drawings represent the present invention , it will be obvious to those skilled in the art that various changes may be made therein without departing from the true spirit and scope of the present invention .	7
fig1 is a diagrammatic perspective view , illustrating a prior art socket adaptor 10 that is formed of a single piece of material ( e . g ., by casting , stamping , machining , etc . ), with generally inflexible and difficult to bend prongs 12 a , 12 b ( 12 c shown in fig2 ). the prongs 12 a , 12 b , 12 c are formed together with a main body 14 with a top edge 16 . in practice , the prior art socket adaptors are casts or machined as a single piece and the metallurgical properties , such as the tensile strength and level of rigidity of all portions , including the main body 14 and the prongs 12 a , 12 b , 12 c , are the same . it has a split clamp 18 that is at generally the same level as the main body 14 . a groove 19 passes through both halves of the split clamp 18 . the main body 14 can have a groove 28 formed partially around its outer perimeter going around to join each half of the split clamp 18 . fig2 is a top plan view of the prior art socket adaptor 10 of fig1 . as can be seen , the three prongs 12 a , 12 b , and 12 c are generally positioned apart from each other by about 90 degrees , with the split clamp 18 positioned between prongs 12 a and 12 c . thus , prongs 12 a , 12 b , and 12 c , and split clamp 18 are positioned at about 6 o &# 39 ; clock , 9 o &# 39 ; clock , 12 o &# 39 ; clock , and 3 o &# 39 ; clock , respectively , around the main body 14 . the main body 14 has a bore 22 formed therein . fig3 is a diagrammatic perspective view , illustrating the prior art socket adaptor 10 of fig1 sitting atop a stump socket 30 , prior to having its prongs 12 a , 12 b ( 12 c not shown ) bent down to more closely conform to the contours of the stump socket 30 . in practice , each stump socket 30 must be individually made to precisely fit the residual limb stump of a prosthetic user , and as a result , each stump socket will be unique in its internal and external size and shape . the bore 20 has threads 22 ion its inside and is adapted to engage with other accessories ( not shown ). a screw 24 is used to adjust the size of the gap 19 between the two portions of the split clamp 18 and the size of the threaded bore . after an accessory , e . g ., a prosthetic connector , is screwed in place ( not shown ), the split clamp 18 is used to clamp down on accessory to securely retain it in place . as can be seen , due to the unique shape of each stump socket 30 , the prongs 12 a , 12 b , 12 c will not conform to the outer shape of stump socket 30 , and must be bent to closely conform for a tight fit . given the nature of the materials of which the socket adaptor is made of , e . g ., stainless steel or titanium that is cast or machined from a block of material , the prongs have the same metallurgical properties as the main body and are very stiff and are difficult to bend and generally must be secured in a vice while a bending tool is used to bend the prongs . in order to establish a tight and conforming fit , the prosthetist must repeatedly adjust the prongs by bending in order to establish a close fit of the prior art socket adaptor 10 to the stump socket prongs . in the process of repeatedly bending the prongs , fractures can form , which compromises the structural integrity of the socket adaptor 10 and can lead to failure . moreover , the split clamp 16 is more or less on the same level as the rim portion 14 , which leads to problems as discussed below . fig4 is a diagrammatic perspective view , illustrating the prior art socket adaptor 10 of fig2 with overwrapping material 24 ( prior to being coated with resin ) shown placed around the prongs of the socket adaptor ( not shown ) and partially covering and crowding around the split clamp 18 and its clamping screw 24 . as can be seen , the top edge 16 of the main body 14 barely extends above the level of the overwrapping material 26 , which can for example comprise fiberglass , carbon fiber , kevlar ® ( para - aramid synthetic fiber ), and other fibers and materials . fig5 is a diagrammatic perspective view showing a finished laminated stump socket 40 with its encapsulated prior art socket adaptor 10 covered by the resin cured overwrapping material 30 . in order to gain access to the clamping screw 24 , a clamping screw access groove 42 must be machined in the resin cured overwrapping material 30 . since resin often infiltrates the gap 19 and can also get on the threads of the screw 24 , these parts must be cleaned of resin too . this requires additional time and labor , and the action of tightening the screw 24 can be further impeded by adhesion of the resin cured overwrapping material 30 to the socket adaptor 10 . positioning of the inflexible prongs of fig1 causes disproportionate support of total surface area of residual limb increasing failure potential at the gap site between the split clamp 18 . fig6 and 7 illustrate a first exemplary embodiment of a socket adaptor 110 for use in the creation of a laminated stump socket , for attaching a prosthetic limb or device to a patient . the socket adaptor 110 includes a main body 112 , and three prongs 114 a , 114 b , and 114 c extending outwardly from the main body 112 . the main body 112 can be formed by casting or machining from a block of solid material , and is rigid and not flexible . the prongs 114 are each shown as being broad and flat , and substantially parabolic in shape , preferably having a curved extremity . however , other shaped and sized prongs can be used . the socket adaptor 110 may be manufactured such that the prongs 114 a , 114 b , and 114 c initially extend in a co - planar configuration as the prongs 114 a , 114 b , and 114 c are flexible and thus bendable - allowing them to be set as desired by the prosthetist in fitting the socket adaptor 130 to the stump socket of a patient . due to the differences in the construction and metallurgical properties of the main body 112 compared to the prongs 114 a , 114 b , and 114 c , the prongs 114 a , 114 b , and 114 c can be freely bent without distorting the main body 112 . to facilitate such bendability , the prongs are made of sheet metal , such as titanium , steel , stainless steel , aluminum alloys , or other high strength metals that are flexible and repeatedly bendable without substantially losing strength or because fractured or weakened . as used herein , the term “ sheet metal ” referral to relatively thin metal ( less than 6 mm ( 0 . 25 inches ) which by virtue of it nature ( e . g ., having been formed by repeated rolling ), remains strong yet pliable and can be repeatedly bent , twisted , and deformed , such as to conform to a stump socket , without causing stress fractures or decreasing the structural integrity of the metal . for example , the use of sheet titanium material , and stainless steel provide extremely strong prongs which , unlike the prongs of the prior art socket adaptors , are able to be bent and re - bent repeated to the desired configuration to exactly fit to the contours of a stump socket without the need for bending tools and without causing damage to the prongs or distortion or damage to the main body . a suitable thickness for the sheet titanium has been discovered to be about 0 . 4 mm to about 1 . 2 mm , and more preferably about approximately 0 . 5 mm . other thicknesses are also suitable and thus may also be used , such as about 0 . 6 mm to about 1 . 6 mm for stainless steel , and a thickness of about 0 . 8 mm to about 1 . 8 mm for aluminum alloy . the inventor has found that stainless steel , such as stainless steel 302 and stainless steel 304 , and titanium 6 - 4 function well . in asme ( american society of mechanical engineers ) standards , a “ strip ” is 0 . 187 ″ ( 4 . 75 mm ) and under in thickness and less than 24 ″ ( 609 mm ) wide , while “ sheet ” is 0 . 187 ( 4 . 75 mm ) and under in thickness and over 24 ″ ( 609 mm ) wide . the inventor has found that stainless steel , such as stainless steel 302 and stainless steel 304 , and titanium 6 - 4 function well . in asme ( american society of mechanical engineers ) standards , a “ strip ” is 0 . 187 ″ ( 4 . 75 mm ) and under thick and less than 24 ″ ( 609 mm ) wide , while “ sheet ” is 0 . 187 ″ ( 4 . 75 mm ) and under thick and over 24 ″ ( 609 mm ) wide . “ plate ” is over 0 . 187 ″ ( 4 . 75 mm ) thick and over 10 ″ wide ( 254 mm .) this is not the case with the socket adaptors of the prior art , including those of the type shown in fig1 - 5 . the main body 112 has a lower surface 112 l , and an upper surface 112 u . a main bore 116 extends fully between the upper surface 112 u and lower surface 112 l . the main bore 116 is internally threaded 117 , and may be selectively adjusted with an split clamp 118 that straddles a gap 119 that extends from the upper surface 112 u and lower surface 112 l and allows the main bore 116 to be slightly spread and narrowed . an adjustment screw 120 that regulates the magnitude of the split clamp 118 . in particular , the adjustment screw 120 allows a device to be threaded into the main bore 116 and then prevented from unthreading by tightening the adjustment screw 120 to narrow the split clamp 118 and thus cause the main bore 116 to clamp upon the item . in construction , the three prongs 114 a , 114 b , and 114 c can be secured to the main body 112 by use of rivets 122 , by welding , adhesives , and / or clamping down the main body 112 on the prongs 114 a , 114 b , and 114 c . in this regard , the main body 12 can be formed with a slot 124 into which ends of the prongs 114 a , 114 b , and 114 c are inserted and then attached . as can be seen , the prongs 114 a , 114 b , and 114 c and split clamp 118 are equally positioned around the main body , e . g ., by 90 degrees , in a 3 + 1 orientation . fig8 shows an alternative embodiment of a socket adaptor 210 , where in lieu of slot being formed in the main body 112 to receive ends of the prongs , a plate or ring 126 can be used to sandwich the prongs 114 a , 114 b , and 114 c in place to the main body 112 . rivets 122 can be used to secure the prongs 114 a , 114 b , and 114 c in place and if desired , adhesive can be additionally placed in a gap 128 between the plate or ring 126 and the main body 112 . in other respects , this embodiment is similar to the embodiments of fig6 and 7 . fig9 illustrates the first exemplary socket adaptor 110 according to the present invention , wherein the prongs 114 a , 114 b , and 114 c initially extend radially outwardly from the main body 112 in a common plane . again , due to the differences in the construction of the main body 112 and the prongs 114 , the prongs 114 can be freely bent without causing distortion to the main body 112 . socket adaptor 110 is shown positioned immediately above a stump casting a 130 , having a distal end 130 d . the stump casting 130 is created from a residual limb stump of a patient for which the laminated stump socket is intended . the creation of the stump casting 130 allows the prosthetist to work without requiring the patient to be present and thereby facilitates making a laminated stump socket that precisely fits the stump of the patient . fig1 illustrates the socket adaptor 110 being customized for the patient . in particular , the main body 112 is positioned against the distal end 130 d of the stump casting 130 , and the prongs 114 of the socket adaptor 110 previously illustrated in fig9 are being bent downwardly to conform to the distal end 130 d of the stump casting 130 . since the prongs 114 a , 114 b , and 114 c of the present invention are made of sheet titanium , sheet stainless steel , or sheet metal of some other strong material , the bending can be repeated until a precise fit is obtained with close conformation of the prongs 114 a , 114 b , and 114 c to the stump casting 130 . as can be seen , one issue with the 3 + 1 format of the prongs 114 a , 114 b , and 114 c and split clamp 118 of the socket adaptor 110 is that there is no prong to secure the socket adaptor 110 in the vicinity of the split clamp 118 . fig1 illustrates a prosthetic connector , e . g ., a pyramid plug 140 having a round base 142 with a threaded portion 144 and a pyramid plug 146 positioned above and ready to screw into the internally threaded 117 main bore 116 of the socket adaptor 110 . the pyramid plug 146 allows connection of various prosthetic devices having hardware that is configured to attach thereto . the pyramid plug 146 may be substituted with other configurations that are adapted to connect to prosthetic devices having different connection hardware . it should be noted that according to a preferred embodiment , the main body 112 is made of solid titanium , solid stainless steel , or some other solid and generally inflexible material , as is the prosthetic connector 140 . after the prosthetic connector 140 is screwed in place to the socket adaptor 110 , the adjustment screw 120 can be tightening to narrow the adjustment opening 118 and thus cause the main bore 116 to clamp upon the threaded portion 144 of the prosthetic connector 140 . fig1 illustrates the socket adaptor 110 , fitted onto the stump casting 130 , and covered with an overlaying material , such as graphite or carbon fiber mesh , fiberglass , kevlar ® ( para - aramid synthetic fiber ), and other fibers and materials 150 . the overlaying material 50 is subsequently coated with resin to encapsulate the socket adaptor 110 and create a hardened , shell - like surface which is then removed from the stump casting 130 and is permanently formed to fit the stump of the patient . most importantly , by using the socket adaptor 110 , the laminated stump socket 166 thus created closely adapts to the residual limb stump of the patient for a comfortable fit , without sacrificing the structural integrity of the socket adaptor 110 encapsulated therein . resin will be deposited under the prongs ( not shown ) on the stump casting 130 so that there is not direct contact of the metal prongs with the patient &# 39 ; s stump . alternatively , a layer of material can placed directly on at least areas of the stump casting 130 , and the socket adaptor 110 can then be placed thereon , with overlaying material 150 subsequently applied and then soaked with resin to create the finished piece . fig1 is a diagrammatic top perspective view showing an exemplary embodiment of another socket adaptor 210 of the invention for use in the creation of a laminated stump socket , for attaching a prosthetic limb or device to a patient . the socket adaptor 210 includes a main body 112 , and four prongs 214 a , 214 b , 214 c , and 214 d that extend outwardly from the main body 212 . the main body 212 can be formed by casting or machining from a block of solid material , and is rigid and not flexible . the prongs 214 a , 214 b , 214 c , and 214 d are each flat , and substantially elongate in shape , preferably having rounded terminal ends 236 . the socket adaptor 210 may be manufactured such that the prongs 214 a , 214 b , 214 c , and 214 d initially extend in a co - planar configuration because the prongs 214 a , 214 b , 214 c , and 214 d are flexible and thus bendable - allowing them to be set as desired by the prosthetist in fitting the socket adaptor 210 to the stump socket of a patient . due to the differences in the construction and metallurgical properties ( e . g ., tensile strength , rigidity , etc .) of the main body 212 ( being rigid ) and the prongs 214 a , 214 b , 214 c , and 214 d ( being flexible ), the prongs 214 a , 214 b , 214 c , and 214 d can be freely bent without distorting the main body 212 . to facilitate such bendability , the prongs are made of sheet metal , such as titanium , steel , stainless steel , aluminum alloys , or other high strength metals that are flexible and repeatedly bendable without substantially losing strength or because fractured or weakened . as used herein , the term “ sheet metal ” referral to relatively thin metal ( less than 4 . 75 mm ( 0 . 187 inches )) which by virtue of it nature ( e . g ., having been formed by repeated been rolled ), remains strong yet pliable and can be repeatedly bent , twisted , and deformed , such as to conform to a stump socket , without causing stress fractures or decreasing the structural integrity of the metal . for example , the use of sheet titanium material , and stainless steel provide extremely strong prongs which , unlike the prongs of the prior art socket adaptors , are able to be bent and re - bent repeated to the desired configuration to exactly fit to the contours of a stump socket without the need for bending tools and without causing damage to the prongs or distortion or damage to the main body . a suitable thickness for the sheet titanium has been discovered to be about 0 . 4 mm to about 1 . 2 mm , and more preferably about approximately 0 . 5 mm . other thickness are also suitable and thus may also be used , such as about 0 . 6 mm to about 1 . 6 mm for stainless steel , and a thickness of about 0 . 8 mm to about 1 . 8 mm for aluminum alloy . the inventor has found that stainless steel , such as stainless steel 302 and stainless steel 304 , and titanium 6 - 4 function well . in asme standards , a “ strip ” is 0 . 187 ″ ( 4 . 75 mm ) and under in thickness and less than 24 ″ ( 609 mm ) wide , while “ sheet ” is 0 . 187 ( 4 . 75 mm ) and under in thickness and over 24 ″ ( 609 mm ) wide . “ plate ” is over 0 . 187 ″ ( 4 . 75 mm ) thick and over 10 ″ wide ( 254 mm .) this is not the case with the socket adaptors of the prior art , including those of the type shown in fig1 - 5 . the main body 212 further has a sleeve portion 216 which defines a main bore 218 with internal threads 220 . the main bore 218 extends fully between an upper surface 222 and lower surface 224 of the main body 212 . the main bore 218 may be selectively adjusted with a split clamp 226 that straddles a gap 240 that extends between the upper surface 222 and lower surface 230 and allows the main bore 218 to be slightly spread and narrowed with an adjustment screw ( shown in fig1 and 18 ) that regulates the magnitude of the split clamp 226 . the split clamp 226 and its gap 240 are spaced up and away from the level of the prongs 214 a , 214 b , 214 c , and 214 d . the split clamp 226 and its gap 240 are positioned between two prongs so that expansion and contraction of the bore is unimpeded . the adjustment screw allows a device , such as a pyramid plug 146 ( such as shown in fig1 ) to be threaded into the main bore 218 and then prevented from unthreading by tightening the adjustment screw to narrow the split clamp 226 and thus cause the main bore 218 to clamp upon the item . in construction , the four prongs 214 a , 214 b , 214 c , and 214 d can be secured to the main body 220 by use of rivets 226 , by welding , adhesives , and / or clamping down the main body 212 on the prongs 214 a , 214 b , 214 c , and 214 d . in this regard , a plate or washer 230 can be provided to hat sandwich ends of the four prongs 214 a , 214 b , 214 c , and 214 d to an underside 224 of the main body 212 , with rivets 228 securing the parts together . adhesive , e . g ., epoxy adhesive , can additionally be used to further secure the parts together and fill spaces between the underside 224 of the main body 212 and the washer 230 and the prongs 214 a , 214 b , 214 c , and 214 d . the prongs 214 a , 214 b , 214 c and 214 d and split clamp 226 are preferably equally positioned around the main body , e . g ., by about 90 degrees and equally supports and distributes the loading forces , and the split clamp 226 is positioned above the level of the prongs 214 a , 214 b , 214 c , and 214 d , with an exposed throat area 232 , as also shown in fig1 - 18 . the throat areas 232 defines a continuous and uninterrupted groove along the main body which allows for an evenly secured position of the overwrapping material prior to the lamination process . a lower rim 242 of the main body 212 extends outwardly from the lower end of the throat 232 , and it is through this lower rim 242 that the rivets 228 pass . apertures 234 may be formed in the prongs 214 a , 214 b , 214 c , and 214 d to aid in bonding of the prongs to the stump socket . while the prongs are shown as being generally rectangular with rounded ends 236 , they can be provided in different sizes and shapes as required . the threads 220 in the bore 218 will be located at a level above the level of the prongs and thus , are more free to expand and contract when the socket adaptor is secured to a stump socket . fig1 is a bottom plan view and fig1 is a bottom perspective view showing the exemplary socket adaptor 210 of fig1 , and best shows the plate or washer 230 that sandwiches ends of the four prongs 214 a , 214 b , 214 c , and 214 d to the underside 224 of the main body 212 , with rivets 228 securing the parts together . fig1 is a side plan view showing the exemplary socket adaptor 210 of fig1 , and shows prongs 214 a and 214 c , the plate or washer 230 that sandwiches ends of the four prongs 214 a , 214 b , 214 c , and 214 d to the underside 224 of the main body 212 , with rivets 228 securing the parts together . the throat 232 is shown in this view , which shows the split clamp 226 spaced well above the level of the prongs 214 a , 214 b , 214 c , and 214 d . thus , as will be described below , when the socket adaptor 210 is formed together with overlaying material and resin to form the stump socket , the overlaying material will not cover over the split clamp 226 . fig1 is a diagrammatic perspective view showing the exemplary socket adaptor 212 of fig1 sitting atop a stump socket , before its prongs 214 a , 214 b , 214 c , and 214 d are bent down to closely confirm to the contours of the stump socket 250 . the screw 238 is used to adjust the size of the gap 240 between the two ends of the split clamps 226 , and thus adjust the diameter of the bore 218 . as shown , the split clamps 226 sits above the level of the lower rim 242 and the prongs 214 a , 214 b , 214 c , and 214 d , with the throat 232 shown . the threaded bore 218 rises substantially above the level of the prongs . fig1 is a diagrammatic perspective view showing the exemplary socket adaptor 212 of fig1 , but with its prongs 214 a , 214 b , 214 c , and 214 d bent down to closely conform to the shape and contours of the stump socket 250 . due to the flexibility of the prongs 214 a , 214 b , 214 c , and 214 d a close fit can be established and the level of the split clamp 226 and screw 238 will be substantially raised up above the level of the lower rim 242 , split clamp 226 and screw 238 . fig1 is a diagrammatic perspective view showing the exemplary socket adaptor 210 of fig1 after its prongs are covered with overwrapping material 244 to form a stump socket , but prior to being coated with resin . as can be seen , the overwrapping material 244 terminates around the throat 232 , and its continuous and uninterrupted groove which allows for an evenly secured position of the overwrapping material prior to the lamination process , and compared to the prior art socket adaptor 10 shown used in fig4 and the socket adaptor 210 shown used in fig1 , the level of the overwrapping material 244 will not reach up to the upper surface 222 of the socket adaptor 210 or cover the split clamp 226 or its screw 238 . a result is that after being soaked with resin , the split clamp 226 and its screw 238 remain uncovered with overwrapping material and resin , and no additional labor is required to gain access to the screw 238 and split clamp 226 . having thus described the exemplary embodiments of the present invention , it should be understood by those skilled in the art that the above disclosures are exemplary only and that various other alternatives , adaptations , and modifications may be made within the scope of the present invention . the presently disclosed embodiment is to be considered in all respects as illustrative and not restrictive . the scope of the invention being indicated by the appended claims rather than the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are , therefore , intended to be embraced therein .	0
fig1 generally illustrates an automobile equipped with a driving lane tracking control system embodying the present invention . a ccd camera 2 is mounted to an upper part of the interior of a vehicle body 1 adjacent to a rearview mirror so that the road path ahead of the vehicle may be constantly monitored . by appropriately processing the video signal from the ccd camera 2 , the driving lane is detected , and the position and direction of the vehicle in relation to the driving lane are identified . typically , a driving lane may be detected by identifying a line marking on the road defining the driving lane . a plurality of side radar devices 3 a are mounted on either side of the vehicle body so that the relative positions and speeds of other vehicles , in particular the relative positions and speeds of those approaching obliquely from the rear , may be detected . a yaw rate sensor 4 is provided in a central part of the vehicle body 1 to detect the yaw angle of the vehicle body 1 around a vertical axial line passing through the gravitational center of the vehicle body 1 . a vehicle speed sensor 5 is provided in association with a drive shaft of the vehicle to measure the rotational speed of the drive shaft as data for determining the vehicle speed . a front radar device 3 b is also provided on the vehicle body 1 to detect an object in front of the vehicle . referring also to fig2 the steering device of the illustrated embodiment comprises a steering wheel 6 for applying a steering input by the vehicle operator , a steering shaft 7 directly connected to the steering wheel 6 , and a pinion 8 fixedly attached to a lower end of the steering shaft 7 , a rack shaft 10 meshing with the pinion 8 to convert the rotational motion of the pinion 8 ( or that of the steering wheel 6 ) to a linear motion , knuckle arms 11 pivotally attached to either end of the rack shaft 10 via a tie rod ( not shown in the drawing ), and front wheels 12 supported by hub carriers ( not shown in the drawing ) integrally provided with the knuckle arms 11 . a cogged belt 13 is passed around a pulley which is fixedly attached to an intermediate part of the steering shaft 7 to transmit a supplemental steering torque produced by an electric motor 14 serving as a steering actuator . a per se known rotary encoder 15 is connected to an axial end of the output shaft of the electric motor 14 to detect the rotational angle of the steering shaft 7 or the steering wheel steering angle . the signals from the ccd camera 2 , the radar devices 3 a and 3 b , the yaw rate sensor 4 , the vehicle speed sensor 5 and the rotary encoder 15 are forwarded to a control unit 16 for determining the supplemental steering torque to the steering shaft 7 as described hereinafter . the control unit 16 is incorporated with a storage unit which can retain data from various sensors at least for a certain time period so that the past data may be made available for the operation of the control unit 16 suppose that the fore - and - aft speed u of the vehicle is constant . then , the relationship between the lateral speed ν , the yaw rate γ , and the front wheel steering angle δ f can be represented by a two - degree of freedom model given by the following two equations ( eq . 1 ) and ( eq . 2 ).  v  t = a _ 1 u  v - ( u - a _ 2 u )   γ + b _ 1  δ f ( 1 )  r  t = a _ 3 u  v + a _ 4 u  γ + b _ 2  δ f ( 2 ) it is also supposed that the steering angle δ f is given as an output of an actuator which has a first - order time delay and receives a steering command δ c . this is represented by the following equation ( eq . 3 ).  δ f  t = - b _ 3  δ f + b _ 3  δ c ( 3 ) the parameters a i and b i which are unique to the particular vehicle can be given by the following equation ( eq . 4 ). a _ 1 = - 2  ( k f + k r ) m ,  a _ 2 = - 2  ( l f  k f = l r  k r ) m   a _ 3 = - 2  ( l f  k f + l r  k r ) i ,  a _ 4 = - 2  ( l f 2  k f + l f 2  k r ) i   b _ 1 = 2  k f m ,  b _ 2 = 2  l f  k f i ,  b _ 3 = 1 t f ( 4 ) where t f is the time constant of the steering actuator , i f is the distance between the front axle and the gravitational center , i r is the distance between the rear axle and the gravitational center , k f is the front wheel cornering power , and k r is the rear wheel cornering power . fig3 illustrates the geometrical relationship between the actual course the vehicle is taking and the target road path which is obtained from the image data of the ccd camera 2 ( additionally or alternatively from the map data of a navigation system and / or an electromagnetic homing signal of a transmitter installed on the road ). in fig3 ψ is the angle of the actual heading of the vehicle relative to a reference direction , ψ r is the angle of the target road path relative to this reference direction , ψ e is the angular deviation of the actual heading of the vehicle relative to the target road path , y e is the lateral deviation of the vehicle from the target road path and r is the radius of curvature of the target road path . the relationships given by the following equations ( eq . 5 ) to ( eq . 7 ) hold between these variables where y e is the time derivative of the deviation of the actual yaw rate from the target yaw rate , and ν e is the time derivative of the lateral deviation . from equations ( eq . 5 ) to ( eq . 7 ), the following equations ( eq . 8 ) and eq . ( 9 ) can be derived .  γ  t =  γ e  t ( 8 )  v  t =  v e  t - u   γ e ( 9 ) by substituting these relationships into equations ( 1 ) to ( 3 ), the following state equation ( eq . 10 ) can be obtained .   t  [ y e v e ψ e γ e δ e ] =  [ 0 1 0 0 0 0 a _ 1 / u - a _ 1 a _ 2 / u  b _ 1 0 0 0 0 0 0 a _ 3 / u - a _ 3 a _ 4 / u b 2 0 0 0 0 - b _ 3 ]  [ y e v e ψ e γ e δ e ] +  [ 0 0 0 0 b _ 3 ]   δ 3 + [ 0 a _ 2 - u 2 0  a _ 4 0 ]   ρ ( 10 ) the continuous - time state equation ( eq . 10 ) is then converted into a discrete - time model ( darma model ; deterministic auto - regressive moving average model ) represented by the following equation ( eq . 11 ) to apply the gpc theory to the above defined vehicle model and road path model . a ( q − 1 ) y e ( k )= b ( q − 1 ) δ c ( k − 1 )+ d ( q − 1 ) ρ ( k − 1 ) ( 11 ) where k denotes the k - th sampling time . a , b and c are polynomials ( eqs . 12 to 14 which are described by a time - delay operand q − 1 . a ( q − 1 )= 1 + a 1 q − 1 + . . . + a n q − n ( 12 ) b ( q − 1 )= b 0 + b 1 q − 1 + . . . + b m q − m ( 13 ) c ( q − 1 )= d 0 + d 1 q − 1 + . . . + d m q − m ( 14 ) where n and m denote the orders of the polynomials which are selected as n = 5 and m = 4 in the illustrated embodiment . in the darma model , the curvature ρ of the part of the target road path up to m steps ahead may be considered as a known disturbance . in other words , the future values of ρ , or ρ ( k + 1 ) ( k = 1 , 2 , . . . , m ), are known information at the current sampling time . to reduce the lateral deviation y e to zero by introducing an integral property to the control system , the darma model given by equation ( 11 ) is converted as defined by the following equation ( eq . 15 ). ã ( q − 1 ) y e ( k )= b ( q − 1 ) δδ c ( k − 1 )+ d ( q − 1 ) δβ ( k − 1 ) ( 15 ) the control input is designed such that an evaluation function j given by the weighted sums of the square of the lateral deviation and the square of the increment of the steering angle command value or by the following equation ( eq . 18 ) may be minimized . j = ∑ j = 1 m  { y e 2  ( k + j ) + λ   δ   δ c 2  ( k + j - 1 ) } ( 18 ) to compute the evaluation function j ( eq . 18 ), the future lateral deviations are predicted according to the prediction at the k - th sampling time . it is represented by the following predictor based on the darma model of equation ( 18 ). y e ( k + l )= g l ( q − 1 ) y e ( k )+ h l b ( q − 1 ) δδ c ( k + l − 1 )+ h l d ( q − 1 ) δρ ( k + l − 1 ), l ε { 1 , 2 , . . . , m } ( 19 ) where h l b  ( q 1 ) =  f l  ( q - 1 )  b  ( q - 1 ) =  h 0 b + h 1 b  q - 1 + ⋯ + h l + m - 1 b  q - ( l + m - 1 ) ( 20 ) h l d  ( q - 1 ) =  f l  ( q - 1 )  d  ( q 1 ) =  h 0 d + h 1 d  q - 1 + ⋯ + h l + m - 1 d  q - ( l + m - 1 ) ( 21 ) 1 = f l ( q − 1 ) ã ( q − 1 )+ q − 1 g l ( q − 1 ) l ρ { 1 , 2 , . . . , m } ( 22 ) the future lateral deviation given by equation ( 19 ) consists of a part depending on known signals and predicted information , and a part depending on future inputs which are not known . the present invention treats the predicted information consisting of the curvature of the future road path as known information . by using this information , the following equation can be derived . the vectors consist of m - dimensional vectors , and the following equations are obtained . y e =[ y e ( k + 1 ) y e ( k + 2 ) . . . y e ( k + m )] δ { overscore ( δ )} c =[ δδ c ( k ) δδ c ( k + 1 ) . . . δδ c ( k + m − 1 )] { overscore ( p )}=[ p ( k + 1 ) p ( k + 2 ) . . . p ( k + m )] ( 24 ) the m × m matrix may be fully written as given by the following equation . h _ = [ h 0 b 0 ⋯ 0 h 1 b h 0 b ⋯ 0 ⋮ ⋮ ⋰ ⋮ h m - 1 b h m - 2 b ⋯ h 0 b ] ( 25 ) from the above equations , the evaluation function j ( eq . 18 ) can be rewritten as given in the following . j =  y e t  y e + λ  δ _ c t   δ   δ _ c  =  ( h _  δ   δ _ c + p _ ) t  ( h _  δ   δ _ c + p _ ) + λ   δ   δ c t   δ   δ _ c ( 26 ) from the condition under which the evaluation function j is minimized or ∂ j /∂ δ c = 0 , the following equation can be obtained . δ { overscore ( δ )} c =−( { overscore ( h )} t { overscore ( h )}+ λi ) − 1 { overscore ( h )} t { overscore ( p )} ( 27 ) because the first component of the vector δδ c consists of δ c ( k ), the increment δδ c ( k ) at the k - th sampling time can be given by the following equation ( 28 ). δδ c ( k )= { overscore ( h )} t { overscore ( p )} ( 28 ) therefore , the steering angle command value δ c ( k ) at the k - th sampling time can be given by the following equation ( 29 ). δ c ( k )= δ c ( k − 1 )+ { overscore ( h )} t { overscore ( p )} ( 29 ) now , the lqi control which combines an integration action to the more conventional lq control is compared with the gpc control incorporating a prediction control of the present invention by using computer simulations . the responses of the gpc control and the lqi control can change significantly depending on the selection of the weighting coefficients . fig4 show a result of comparison in which the weighting coefficients are varied so as to substantially equalize the magnitudes of the maximum command signals when tracking a given target road path . as can be seen from this drawing , the gpc control starts a steering action before the actual change in the curvature of the target course takes place , and the lateral deviation ( steady - state tracking error ) is reduced to zero . it means that the vehicle can smoothly track the driving lane . on the other hand , according to the lqi control , because it does not make use of predicted information , the steering action begins only after the road path curvature has started changing , and the lateral deviation is significant . therefore , the lqi control is not as effective as the gpc control in enabling the vehicle to track the driving lane . because the lqi control gives rise to larger lateral accelerations than the gpc control , the gpc control is superior over the lqi control in terms of ride quality . fig5 compares the responses of the gpc control and the lqi control when the weighting coefficient of the lqi control is varied such that similar lateral deviations may be produced . in this case , the steering angle command value of the lqi control changes impulsively , and this significantly impairs the ride quality through stepwise changes in lateral acceleration and oscillatory changes in yaw rate . to show the properties of the gpc control in the frequency domain , fig6 compares the frequency responses of the gpc control and the lqi control using the road curvature as the input and the lateral deviation as the output . from this drawing , it can be seen that the gpc control demonstrates a lower gain than the lqi control in a low frequency range , pointing to the superior capability of the gpc control to track the driving lane . fig7 compares the frequency responses of the gpc control and the lqi control using the road curvature as the input and the steering angle command value as the output . because the lqi control demonstrates a flat frequency response , it tends to produce a steering angle command containing high frequency components in response to stepwise changes in the road curvature . on the other hand , the gpc control produces a steering angle command consisting only of relatively low frequency components , it is expected that the gpc control can track a driving lane more smoothly . fig8 compares the frequency responses of the gpc control and the lqi control using the road curvature as the input and the lateral acceleration as the output . according to the graph , it can be seen that the gpc control demonstrates a favorable damping in a high frequency range so that it can maintain a favorable ride quality even when there are sharp changes in the curvature of the road , and the measurement of the road curvature involves a substantial amount of high frequency noises . if the control command value consists of a steering supplemental torque , instead of the front wheel steering angle , the present invention can be applied not only to a simple driving lane tracking control but also to a vehicle operator assisting system for varying the force required to turn the steering wheel depending on the state of the motor vehicle or other factors . thus , according to the present invention , by using predicted information or by giving an integration property to the feedback loop , it is possible to achieve both a required driving lane tracking capability and a favorable ride quality at the same time . although the present invention has been described in terms of preferred embodiments thereof , it is obvious to a person skilled in the art that various alterations and modifications are possible without departing from the scope of the present invention which is set forth in the appended claims .	1
referring to fig1 , a system model of the present invention is created in the following process : b . set up the number of cells : in doing so , the entire dots distribution 2d is divided into a plane by the arrangement of multiple square cells . c . set up dot density (%) before deciding on the dot filling density ( d ) in each cell . the filling density ( d ) is solved by employing equation ( 1 ) as follows : where , m represents the total number of dots within a cell ; and r k represents the radius of each dot . d . determine the initial position of dot : when the density for each cell is determined , the number of dots in that cell is also determined ; and the initial position of dot in each cell is then determined by fuzzy at random . in the force operation relation adopted according to the algorithm proposed by the present invention , the perimeter of the substrate must be set up as a periodical boundary to achieve balanced conditions since there is only the repulsive force relation existing among dots . in the present invention , motion of an atom is considered as that of a dot as illustrated in equation ( 2 ) below according to the methodology of molecular dynamics while observing the newton &# 39 ; s second law of motion : where , r i is the position of i th dot ; m is the mass of the dot ; c is the damping term of the motion system ; and f ij is the force between dot i and its adjacent dot j . in the concept of molecular dynamics , a certain energy relation existing among atoms known as the potential energy φ ij ( r ij ), and the potential energy is a function of the relative distance among atoms . therefore , force among atoms may be solved by differential of the distance as illustrated in equation ( 3 ) below : by incorporating both equations ( 2 ) and ( 3 ), it is found that a motion status of a dot is a result of a force applied to it from its adjacent dots . when the total force applied to that dot is at its minimum , it is safe to say that that dot has attained its balanced position in the system and starts to execute mild regular oscillation . perform integration for equation ( 2 ) with a range of micro time lag δt = t − t 0 , to solve the position of a dot after a micro time lag as illustrated in equation ( 4 ) below : where , f i is the total force that dot i is subject to , i . e ., whereas the present invention focuses on the randomized position of the dot distribution on 2d plane , the mass relation in the real physical system can be ignored . therefore , equation ( 4 ) is simplified with the assumption of equation ( 5 ) is related to one that predicts the position . that is , the position for each dot at the next step of time is the corrected position of the current step of time solved . however , the damper coefficient , c , is also a determinant factor other than the amount of the total force externally applied to the dot that affects the correction of the dot at each unit step of time . step of time δt in the computer operation plays a role of each operation loop . once the value of c gets greater , δt / c can be seen as such that the correction in each operation loop tends to get smaller ; on the contrary , the smaller the value of c is , the greater correction gets . the force operation equation applied for the term of exponent in the present invention is equation ( 6 ) where , r ij is a vector representing relative distance among dots ; s c is a force control parameter for each dot ; and r cut is a force operation cut radius of dot . a parameter a r is defined to represent the reaction area of each dot and extendable to its adjacent cell before explaining how to determine the force operation cut radius of the dot . in the present invention , conditions are set up with the minimal reaction area for analysis as shown in equation ( 7 ): where , a c is the ratio parameter and is set at 1 ; and m represents the number of dots within a cell . as illustrated in fig2 , if a cell contains three dots and the total area of the dots is equal to that of the cell , partial overlapped area of the dots must take place . to avoid overlapping , the minimal distance among dots has to be two times over the radius of any current dot . accordingly , the distance relation is set as r cut of the dot within the cell that can be solved by equation ( 8 ) as follows : the primary reason to select the force operation equation of the exponent term is for its simple form of function to easily solve the force control parameter . the residual force , f re must be determined before solving the force control parameter . the value selected for the residual force is directly reacted in the size of the resultant force each dot is subject to in each operation step . although assignment of a greater value to f re pays the greater correction of the position in each operation step so that the balanced position can be attained for the dot in shorter time , the entire operation time increases instead since the greater value of position correction means frequent access to and from the cell boundary to warrant continuous performance of verlet algorithm . 0 . 001 is proposed for f re in the present invention that provides more efficiency in the course of operation . the pattern plotted in fig3 is related to one of dot - to - dot force operation function ; wherein , the amount of force reaction at the position of the length r cut is the very residual force . when both the residual force and the cut radius are finalized , the force control parameter is determined for each cell by employing equation ( 9 ). the primary purpose of the force control parameter is to is serve as a modulation technique in the process of the force operation of the dot in the adjacent cell . where \| r ij \|= r cut . all parameters required in the entire process have been determined and the algorithm is described as follows . whereas the present invention focuses on how to generate dot - pattern that is random , consistently distributed with its density controllable on an optical device ; the distribution position of dot is the ultimate results desired . fig4 illustrates the operation process that commencing from solving parameters needed for the operation process by taking advantage of the mathematic structure as described above before proceeding to force operation process until the dot - pattern is availed as desired to end up the operation of the loop at the position of the output dot . when the dot density in the adjacent cell varies , the cut radius and force control parameters applicable to that cell also differ . judging from equations ( 8 ) and ( 9 ), it is found that when r cut varies , the resultant force control parameter also differs . proper command of the force control parameter will create a transition region featuring a smooth density distribution on the boundary of the adjacent cell of different dot density . fig5 illustrates the process of the force operation for the dot crossing the cell boundary . as illustrated in fig5 , the dot r cut of cell a with lower dot density is greater than that of cell b ; therefore , the dot in the r cut ( broken line ) of dot a 1 will exert repulsive force against a 1 . a 1 appears to be subject to two different types of repulsive force and the force control parameter introduced determines the primary variation between the two types of repulsive force . the force applied from the dot in the same cell on a 1 ( dark line with arrow ) is solved by substituting with force control parameter s c of cell a in equation ( 6 ). dot b 1 in cell b will apply a certain force , but the force is not determined by substitution with cell b force control parameter ; instead , equation ( 10 ) is employed to determine the force operation parameter when the dot crosses the boundary : equation ( 10 ) forthwith takes the arithmetic mean of force control parameters of two abutted cells becomes the parameter to be introduced into equation ( 6 ) for solving the force taking place on the cell boundary ( dotted line with arrow ). since the dot density of cell b is higher , the r cut of dot b 1 becomes smaller . therefore , dot b 1 is subject only to the force applied by the other two dots within the same cell without being affected by a 1 . that is , the action between a 1 and b 1 is one - way nature , not such as described for the force among atoms in the orthodontic molecular is dynamics that force between two atoms takes place by opposite corners . fig6 shows the results of uniform distribution of random distribution of dots in different numbers within a 3 * 3 pre - designated cell region under different number of dots according to the statistics compiled by employing equation ( 2 ). within a pre - designated region , the value of uniform distribution of random distribution varies depending on the number of dots contained in that region though it must satisfy equation ( 1 ). after the dot pattern is completed , the dot pattern is transferred to an optical device by a transfer printing equipment to form a microstructure arrangement of the optical device . the method is specially applicable for arranging the dot pattern on a light guide plate ( a ) as shown in fig7 , such that the feature of the random distribution can prevent the unpredictable occurrence of moires , such that a uniform brightness at a light emitting surface can be achieved by controlling the density distribution of the dots .	6
herein after , detailed descriptions of certain embodiments consistent with the present invention will be provided with reference to the accompanying drawings . fig3 a to 3e are cross - sectional views illustrating a method for fabricating a bulb shaped recess gate pattern consistent with embodiments of the present invention . as shown in fig3 a , a plurality of device isolation layers 32 are formed in a substrate 31 through a shallow trench isolation ( sti ) process . herein , the device isolation layers 32 are formed to define an active region and thus , the device isolation layers 32 have a greater depth than a recess gate pattern subsequently formed . to form the device isolation layers 32 , predetermined portions of the substrate 31 are etched , thereby forming trenches . insulation layers are buried into the trenches and polished through a chemical mechanical polishing ( cmp ) process to form the device isolation layers 32 . subsequently , a plurality of mask patterns 33 are formed over the substrate 31 including the device isolation layers 32 . herein , each of the mask patterns 33 is formed by sequentially stacking a patterned sacrificial oxide layer 33 a , a patterned hard mask 33 b , a patterned anti - reflective coating layer 33 c , and a patterned photoresist layer 33 d . although not shown , processes of forming the patterned sacrificial oxide layer 33 a , the patterned hard mask 33 b , the patterned anti - reflective coating layer 33 c , and the patterned photoresist layer 33 d are explained . first , a sacrificial oxide layer is formed over the substrate 31 including the device isolation layers 32 . the sacrificial oxide layer can be a pad oxide layer used during the device isolation layer formation process . then , a hard mask is formed over the sacrificial oxide layer . the hard mask comprises silicon and serves to secure a margin of a photoresist layer during a subsequent etching process . next , an anti - reflective coating layer and a photoresist layer are sequentially formed over the hard mask . afterwards , the photoresist layer is patterned through a photo - exposure process and a developing process . next , the anti - reflective layer , the hard mask , and the sacrificial oxide layer are patterned using the patterned photoresist layers 33 d as an etch mask . as a result , the mask patterns 33 including the patterned sacrificial oxide layer 33 a , the patterned hard mask 33 b , the patterned anti - reflective coating layers 33 c , and the patterned photoresist layers 33 d are formed . as shown in fig3 b , predetermined portions of the substrate 31 are etched using the mask patterns 33 as an etch mask , thereby forming a plurality of first recesses 34 with a vertical profile . when the first recesses 34 are formed , most portions of the mask patterns 33 except the patterned sacrificial oxide layers 33 a are removed . as shown in fig3 c , a plurality of spacers 35 are formed on sidewalls of the first recesses 34 to a thickness ranging from approximately 50 å to approximately 100 å . the spacers 35 , along with the patterned sacrificial oxide layers 33 a , prevent damages to the substrate 31 during a subsequent etching process for forming a second recess . the spacers 35 comprise an oxide formed at a medium temperature ranging from approximately 500 ° c . to approximately 700 ° c . as shown in fig3 d , the substrate 31 beneath the first recesses 34 is etched to form a plurality of second recesses 36 . the second recesses 36 are formed through an isotropic etching process in the same chamber where the first recesses 34 are formed . that is , the first recesses 34 and the second recesses 36 are formed in - situ . also as fig3 d shows , the second recesses 36 are wider and more rounded than the first recesses 34 . the second recesses 36 may be formed by etching the substrate 31 in one apparatus selected from the group consisting of an inductively coupled plasma ( icp ) reactor , a transformer coupled plasma ( tcp ) reactor , a microwave down stream ( mds ) plasma reactor , an electron cyclotron resonance ( ecr ) plasma reactor , and a helical type plasma reactor , with a pressure ranging from approximately 20 mtorr to approximately 100 mtorr , a top power ranging from approximately 500 w to approximately 1 , 500 w , and without a bottom power . the etching of the substrate 31 for forming the second recesses 36 may use a plasma including tetrafluoromethane ( cf 4 ) gas , helium ( he ) gas and oxygen ( o 2 ) gas as a main gas and , in addition , chlorine ( cl 2 ) gas or hydrogen bromide ( hbr ) gas . the addition of chlorine ( cl 2 ) gas or hydrogen bromide ( hbr ) results in a high etch selectivity between the substrate 31 which comprises silicon and the spacers 35 which comprise oxide . a flow rate of the cf 4 gas is approximately 30 sccm to approximately 80 sccm , a flow rate of the he gas is approximately 50 sccm to approximately 300 sccm , and a flow rate of the o 2 gas is approximately 10 sccm to approximately 50 sccm . a flow rate of the additional gas such as cl 2 or hbr is approximately one fifth to approximately one third of the flow rate of the cf 4 gas . for example , the flow rate of the additional gas is approximately 6 sccm to approximately 27 sccm . with the additional gas such as cl 2 or hbr , a high etch selectivity between oxide layer and silicon is achieved during the etching of the substrate 31 for forming the second recesses 36 . thus , it becomes possible to secure uniformity in a bulb formation without damage to either internal or external sides of a recess pattern . it is also possible to extend a channel length by forming the second recesses 36 which are wider and more rounded than the first recesses 34 . subsequently , although not shown , a plasma oxidation process is performed using a chemical dry etching ( cde ) method . to perform the plasma oxidation process , an icp type apparatus with a faraday field is used with supply of a power ranging from approximately 300 w to approximately 3 , 000 w . also , the plasma oxidation process is performed using a plasma including cf 4 gas , he gas and o 2 gas . the cf 4 gas , the he gas and the o 2 gas are mixed in a ratio of approximately 12 to 100 to 30 . particularly , the plasma oxidation process is performed to oxidize the substrate 31 to a thickness of approximately 50 å . hereinafter , recesses including the first recesses 34 and the second recesses 36 are referred to as recesses r . as shown in fig3 e , a wet cleaning process is performed . herein , the wet cleaning process is performed by using a solution of hydrogen fluoride ( hf ) or buffered oxide etchant ( boe ) to remove the patterned sacrificial oxide layer 33 a , the spacers 35 which comprises an oxide , and an etch residue . next , a gate insulation layer 37 is formed over the substrate 31 including the recesses r . next , a plurality of gate patterns 38 are formed with first portions thereof buried in the recesses r and second portions thereof projecting over the substrate 31 . herein , each of the gate patterns 38 is formed by sequentially stacking a polysilicon layer 38 a , a gate electrode 38 b , and a gate hard mask 38 c . fig4 is a micrographic image of transmission electron microscopy ( tem ) illustrating semiconductor devices with bulb shaped recess gate patterns consistent with embodiments of the present invention . fig4 illustrates bulb shaped recess gate patterns formed by etching a silicon substrate with a plasma including cl 2 gas or hbr gas , which results in a high etch selectivity between an oxide layer and silicon . first bulb shaped recess gate patterns 400 are formed by etching the silicon substrate with a plasma including cl 2 gas with a flow rate of approximately 10 sccm , and second bulb shaped recess gate patterns 500 are formed by etching the silicon substrate with a plasma including hbr gas with a flow rate of approximately 10 sccm . first bulb shaped recess gate patterns 400 and second bulb shaped recess gate patterns 500 have a uniform profile . consistent with the present invention , it is possible to increase etch selectivity between silicon and an oxide layer by using a plasma including cl 2 gas or hbr gas . consequently , problems of damage to the top and side of a recess gate pattern and possible abnormality of the recess gate pattern are alleviated or avoided . as described above , the method for fabricating a semiconductor device with the bulb shaped recess gate pattern consistent with the present invention achieves a high etch selectivity between silicon and an oxide layer during an etching for forming the recess gate pattern and makes it possible to secure uniformity in a bulb formation without causing any damages to internal and external sides of the recess gate pattern . thus , a channel length of the recess gate pattern can be increased and an ion - implantation concentration can be decreased . accordingly , a refresh property of the device can be greatly improved , thereby improving a design rule and maximizing a process margin . the method for fabricating the semiconductor device with the bulb shaped recess gate pattern consistent with embodiments of the present invention also allows for an increased scale of integration of semiconductor devices , improved yields of production , and decreased production costs . it will be apparent to those skilled in the art that various modifications and variations can be made in the disclosed process without departing from the scope or spirit of the invention . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims .	7
in the figures , equivalent parts appearing in various embodiments have been referenced using the same numerals . fig1 shows a general scheme of the protection circuit ( p , p ′, p ″, p ′″) of the invention , having three terminals : input terminal e is connected to the input signal vx which may be affected by overvoltages . output terminal s connects the protection circuit p to the overvoltage protected instrument a . common terminal gnd is connected to ground . the protection circuit ( p , p ′, p ″, p ′″) of the invention does not require any power source neither control signals . it operates in an automatic way depending on the voltage levels detected at the input terminal e . when the input signal vx is inside a certain low voltage range with respect to the common terminal gnd , the output vy equals the input voltage vx multiplied by a constant . when vx is affected by an overvoltage that exceeds said the upper limit of said range , the protection circuit p switches automatically to a state in which the output voltage vy is low . a first example , corresponding to the first aspect of the invention , is displayed in fig2 . the protection circuit p comprises a mosfet depletion transistor q 1 , which is an n - channel depletion transistor in the present example . the goal of this protection circuit p is to protect again negative overvoltages . when a negative overvoltage appears at the input , vx & lt ;& lt ; 0 , transistor q 1 does not conduct , since the voltage between gate g and source s , v gs1 , is lower than the conduction threshold voltage , v th : since transistor q 1 is in cutoff state , the output voltage is vy = 0 , and no current passes through third resistor r 3 . the level vx = v n & lt ; 0 for which protection is effective may be programmed adjusting the values of r 1 and r 2 , according to the following expression : switching of transistor q 1 can be very fast , however when transients with abrupt edges occur , there are current peaks passing through the parasitic capacities of the transistor q 1 . limiting diodes da and db absorb these current peaks , limiting the output voltage vy to the voltage drop vd in a directly biased diode ( typically between 0 . 7 and 1 . 5 v depending on the current peak amplitude ). when an input signal v x & gt ; v n is applied , transistor q 1 conducts with a low resistance which depends on the voltage between gate g and source s . particularly , for input signal vx levels close to 0 , transistor q 1 conducts with a resistance r ds close to the nominal for v gs = 0 , producing vy = g · vx , where g is a factor lower than unity representing the attenuation due to the voltage divider formed by resistors r 1 and r 2 and to the voltage drop in the transistor with the load resistor r 3 . for typical output voltage values v y & lt ; 0 . 6 , diodes da and db do not conduct . when a positive overvoltage occurs , the depletion mosfet q 1 parasitic diode conducts . however , diode db will keep output signal vy limited to a voltage drop vd , while resistors r 1 and r ds together with the impedance of the overvoltage source limit the current . therefore , the circuit of fig2 must be rather considered as a monopolar protection circuit for negative overvoltages . a protection circuit for positive overvoltages would be an analogous circuit , only substituting n - channel depletion transistor for a p - channel depletion transistor . thus , a positive protection circuit cascaded with a negative protection circuit would constitute a bipolar protection circuit , that is , it would protect against both positive and negative overvoltages . fig3 ( p ′) and 4 ( p ″) disclose two examples corresponding to the second aspect of the invention having two transistors . in a first particular embodiment shown in fig3 , both transistors have a short circuit between gate and source , thus always operating with v gs = 0 . for low values of the voltage between drain and source ( v ds & lt ;− v th , being v th the threshold voltage of the transistor ), the transistors operate in the linear region , in which they show a low resistance r ds that is determined by the constructive characteristics of the device . for high values of the voltage between drain and source ( v ds & gt ;− v th ), the transistors operate in the saturation region , acting as a current source of a value i dss corresponding to the saturation current of the device . thus , for a negative overvoltage at the input , vx & lt ;& lt ; 0 , the parasitic diode associated to transistor q 1 is conducting , and v ds2 = vx − vd , where vd = 0 . 7 is the voltage drop in said parasitic diode . in this situation , v ds2 & lt ; v th , and transistor q 2 is operating in the saturation region , having a drain current of i dss . this current goes through diode da , which is directly biased , thus limiting the output voltage level to vy =− 0 . 7 v . most of the voltage applied at the input drops between drain and source of q 2 , that is , v ds2 =− vx + 2vd . analogously , for a positive overvoltage at the input , vx & gt ;& gt ; 0 , transistor q 1 operates in the saturation region , and the parasitic diode of q 2 and db conduct . the current is limited to the saturation current i dss of transistor q 1 , which is diverted to ground through diode db . voltage vy is thus fixed at approximately 0 . 7 v , the voltage drop of db . for low input voltage values , particularly − 0 . 5 & lt ; vx & lt ; 0 . 5 v , both transistors operate in the linear region , having a low drain - source resistance . in this circuit , the voltage drop in each transistor v ds is related to drain current through the following expression : even though its performance is not as linear as a pure resistor , in practice i d & lt ;& lt ; i dss , ( being i dss the nominal saturation current of the transistor ) and then : that is , the performance is approximately lineal with a resistive value in the order of vth / 2i dss . this way , the harmonic distortion provided by this circuit is very low , lower than , for example , that produced by other alternatives inserting diodes in the signal path . particularly , in contrast with other approaches , transistors q 1 and q 2 always conduct , switching automatically from the linear region to the saturation region for input signals of low and high level , respectively . this protection circuit is thus bipolar , that is , it provides protection both against positive and negative overvoltages . when a positive overvoltage occurs , transistor q 1 is saturated , supporting between its drain and source the voltage exceeding two diode drops . when a negative overvoltage occurs , transistor q 2 is , in turn , saturated , supporting between drain and source the voltage exceeding two diode drops . the example shown in fig4 shows a second preferred embodiment of the invention having a resistor ( r ) connected between the sources of the transistors in order to reduce the current through diodes da and db when an overvoltage is applied at the input . in this situation , the current flowing through the resistor causes a voltage drop that reduces the gate - source voltage of the saturated transistor . this inverse biasing regulates the current passing through the transistor , reducing it with respect to the nominal current i dss . the protection circuit of fig4 is preferred when an overvoltage situation could last for a long time , since the power dissipation in transistors and diodes becomes more important . on the contrary , since resistance r in the signal path causes greater insertion and bandwidth losses , protection circuit of fig3 is preferred for transient overvoltages of short duration . finally , fig5 shows a preferred embodiment mixing the first two aspects of the invention . two n - channel mosfet depletion transistors are used , in such a way that negative overvoltages are blocked by transistor q 1 , which does not conduct when its gate - source voltage gets more negative than the threshold voltage . in this situation , the voltage at the drain of transistor q 2 is 0 , since no current flows through resistor r 3 , which can be of high value , and q 2 operates in the linear region , such that vy = 0 . positive overvoltages pass through the parasitic diode of mosfet q 1 and are blocked by transistor q 2 , which operates in the saturation region . in these conditions , the maximum current in the circuit is the saturation current i dss for v gs = 0 of q 2 , which is diverted to ground through diode db . db , together with da , limits the voltage peaks in vy due to fast transients at the input through the parasitic capacities of the transistors . when the input signal vx is close to cero , both transistors operate in the linear region , producing an output vy = g · vx , where g is a factor below unity representing the attenuation due to the resistive dividers formed by r 1 and r 2 , and to the series resistance of the transistors in the conduction state with the input resistance of the device to be protected . next , experimental results regarding a specific protection circuit ( p ′) shown in fig3 are shown . although commercially available components have been used , this protection circuit ( p ′) would ideally be made in a single device . the external instrument ( a ) to be protected has been simulated using the following passive components : this protection circuit ( p ′) has been mounted and verified using pulses of − 160 v of amplitude and duration in the range of microseconds . the results show that the protection circuit ( p ′) blocks high voltage pulses , producing output levels below ± 1 . 2 v . also , the operation of the protection circuit ( p ′) has been verified using a sine signal generator with frequencies in the range of 0 to 100 mhz , and measuring insertion losses , bandwidth and harmonic distortion , with a 200 mv peak to peak amplitude . the results were : by design , the maximum overvoltage supported by this circuit is ± 250 v , which corresponds to the maximum v ds for the selected mosfet transistors .	7
microscopes include a type of emitting light and a type of emitting electron beams . the types are different in resolution . however , in some cases , both types can adopt the same image processing . this is because , although an optical microscope with a high resolution causes a ccd sensor or the like to detect light reflected by a sample and an electron microscope having a higher resolution detects electrons generated on the sample , both types perform digital signal processing for imaging . image acquisition conditions ( presence and absence of focus , the number of integrations , magnification , etc .) of an electron microscope and the like automatically measuring and inspecting a sample are to be preliminarily registered . however , a semiconductor manufacturing process includes process variation . accordingly , conditions at the time of registration are sometimes incapable of appropriately extracting a pattern to cause a matching error . in order to solve the problem , the number of integrations ( the number of frames ), which is one of the image acquisition conditions , may be set larger to sharpen the pattern . unnecessary increase in the number of integrations unfortunately reduces the throughput . furthermore , there is a possibility of increasing adverse effects of contamination , shrinkage , and charging . accordingly , measures to appropriately set the number of integrations according to process variation and the like are preferable to realize achievement of a matching success rate and reduction in processing time and the like . however , there are no clear indicator for appropriate setting , and is a possibility of erroneous setting . accordingly , it is difficult to reset the number of integrations . furthermore , erroneous setting may affect measurement results and the like , which is a cause of giving up resetting . in many cases , an unnecessary number of integrations , which is one of image acquisition conditions requiring preliminary setting in the template matching method , are set . this setting is largely affected by contamination , shrinkage , charging and the like , while throughput is reduced . in order to solve the problem , it is preferred to correct the number of integrations to an appropriate number . the correction requires verification using a device and a sample . this verification prevents the device from being used for inspection , which is the original object , and results in reducing the operating ratio of the device . that is , once operation on a mass production line has started , it is significantly difficult to change the image acquisition conditions . hereinafter , a device for setting image acquisition conditions and a computer program that can find setting conditions of the device without using a device or a sample will be described in further detail . in order to set device conditions without using a device or a sample , a method is proposed that sets conditions using images acquired by automatic measurement or automatic inspection . a critical dimension sem ( cd - sem ) is a device for continuously measuring many samples formed through the same manufacturing process . that is , as the measurement process progresses , image information is accumulated . the accumulation of the image information and use thereof for determination for setting image acquisition conditions negate the need to operate the device only for setting the device conditions . the previously acquired images include variation in pattern size , brightness at pattern edges , and pattern noise due to process variation . use of data of the image group can verify variation in the case of changing the image acquisition conditions without using a device or a sample . in the device of this embodiment , which will be described below , the image acquisition conditions are changed using the data of the image group including process variation . use of the image group including process variation acquired by automatic measurement negates the need to use the device or a sample again for verifying change of image acquisition conditions , thereby allowing changing off - line . furthermore , mass production can be developed in a short time period . accordingly , even a user who cannot have tried correction concerning matching error can easily perform change . fig1 is a schematic configuration diagram of a cd - sem . a primary electron beam 104 drawn from a negative pole 101 by a voltage v 1 applied to a first positive pole 102 is accelerated by a voltage vacc applied to a second positive pole 103 and travels toward a lens system on a succeeding stage . the primary electron beam 104 is converged as a minute spot on a sample 107 by a converging lens 105 and an objective lens 106 controlled by a lens control power source 114 , and two - dimensionally scans the sample 107 by means of two stages of deflection coils 108 . scanning signals for the deflection coils 108 are controlled by a deflection controller 109 in conformity with an observation magnification . a secondary electron 110 emitted from the sample by the primary electron beam 104 scanning the sample 107 is detected by a secondary electron detector 111 . information on the secondary electron detected by the secondary electron detector 111 is amplified by an amplifier 112 and displayed on a display of a computer 113 . the process of manufacturing a semiconductor device processes a silicon wafer to manufacture a semiconductor device . the wafer is adopted as the sample 107 . a circuit pattern in the middle of manufacturing is displayed on a screen of the display of the computer 113 , which allows an operator to observe a manufacturing failure of the circuit pattern and an adhering foreign body . some cd - sems have a function of automatically measuring the width of a circuit pattern using secondary electron information . the process using the image information and the template matching identifying a desired pattern from the image are performed in an operation unit in the computer 113 . images used for template matching and an automatic measurement file for automatic measurement are registered in a storage in the computer 113 . the automatic measurement is performed on the basis of the registered information . the acquired image is registered in a data accumulation unit in the computer 113 . fig2 schematically shows images acquired by automatic measurement by a cd - sem . in the case of adopting fig2 ( a ) as a standard , ( b ) has a large pattern size and ( c ) has a small pattern size . there is what has a large noise as with ( d ). these images include an image having a strong pattern edge as with ( e ) and an image having a weak pattern edge as with ( f ). the differences between images ( a ) to ( f ) occur owing to effects of process variation or differences in layer , even in the case of automatic measurement with the identical image acquisition conditions . the differences of images ( d ) to ( f ) also appear owing to differences in the number of integrations , which is one of the image acquisition conditions . the larger the number of integrations , the stronger the pattern edge is and the lower the noise is . the smaller the number of integrations , the weaker the pattern edge is and the higher the noise is . the differences of images ( a ) to ( f ) affect scores acquired by matching with the template . in particular , in the case of an image with high noise and a weak pattern edge , the pattern is not successfully detected , which tends to cause a matching error . the score will now be described . for instance , the score represents a degree of matching with the template from 0 to 1000 . complete matching is represented as 1000 . the lower the degree of matching , the lower the score becomes . in the cd - sem , in order to prevent erroneous detection , an acceptance is set as a reference value for determining presence or absence of a target pattern . the acceptance is a threshold set automatically or by a user . if the score is at least the acceptance , it is determined that the pattern is successfully detected . instead , if the score is equal to or less than the acceptance , it is determined that matching error occurs . fig3 is a schematic configuration diagram of the cd - sem and image acquisition conditions optimization function / device . an image acquired by a cd - sem 301 is accumulated in a data accumulation unit 302 residing in the computer 113 in fig1 . as necessary , the image is transmitted to an image acquisition conditions optimization function / device 303 . the image acquisition conditions optimization function / device 303 optimizes the image acquisition conditions . a result calculated here is transmitted to a storage 304 residing in the computer 113 in fig1 , and registered again as new setting content of automatic measurement . a cd - sem 305 performs automatic measurement with the new setting content . the image acquisition conditions optimization function / device 303 in fig3 will now be described in detail with reference to fig4 . first , image data accumulated in a data accumulation unit 401 is transmitted to an image acquisition conditions optimization function / device 409 . a conversion unit 402 of the number of integrations converts the data into a plurality of images with the number of integrations . the converted images are transmitted to a pattern matching unit 403 at any time , which matches each image with the number of integration with the template to thereby acquire the score . the acquired score is temporarily accumulated in a matching result ( score ) accumulation unit 404 . meanwhile , in the case where the optimization target is a length measurement image , there is a possibility where the measured length varies owing to contamination or variation in shrinkage according to the number of integrations . accordingly , it is required to verify that the measured length is within a control value , in addition to the acceptance . thus , while the image converted by the conversion unit 402 of the number of integrations is transmitted to the pattern matching unit 403 , the image is transmitted to a length measurement unit 405 in parallel . length measurement with each image with the number of integrations acquires the measured length . the measurement result is accumulated in a length measurement result accumulation unit 406 . accordingly , verification of the results accumulated in the matching result accumulation unit 404 and the length measurement result accumulation unit 406 allows a simulation of the case of changing the number of integrations , which is one of the image acquisition conditions . a score average , variation in the scores ( 3σ ), a length measurement average , and a length measurement reproducibility ( 3σ ) are calculated from the accumulated information . a filter unit 407 automatically determines the optimal number of integrations from the calculated result , thereby determining optimum conditions . the conversion unit 402 of the number of integrations in fig4 will now be described in detail with reference to fig5 . image data in the data accumulation unit 401 includes gradation values of respective pixels per scan . for instance , in the case of the image with the number of integrations n ( n frames ), n times of scans are repeatedly performed as shown in fig5 , and one image is generated from the data . thus , n pieces of data exist . use of the n pieces of data can generate images with 2 frames , 4 frames , 6 frames to n frames at the maximum as shown in fig6 . the number of generated frames can be automatically or arbitrarily set . the pattern matching unit 403 in fig4 will now be described in detail with reference to fig7 . after the images with the respective numbers of integrations are transmitted from the conversion unit 402 of the number of integrations to the pattern matching unit 403 , matching with the template registered in the automatic length measurement file in the storage of the computer 113 in fig1 is performed on each image . as exemplified in fig5 and 6 , a plurality of images with the numbers of integrations can be generated from one image . accordingly , a plurality of scores per image can be acquired as shown in fig7 . likewise , acquisition of scores of images 2 to x allows the score average and the variation in the scores ( 3σ ) of each number of integrations to be calculated . here , it is provided that the calculated result is shown in fig8 . meanwhile , the filter unit 407 in fig4 determines the optimal number of integrations on the basis of the acceptance registered in the automatic measurement file and an arbitrarily set allowable value of the variation in the scores . that is , the filter unit 407 functions as a selection unit that selects a candidate of the number of integrations or the final number of integrations . here , fig9 exemplifies a matching result determination flowchart . in a matching result accumulation unit 701 , the score average and the variation in the scores ( 3σ ) with each number of integrations are calculated as described above . the information is transmitted to a filter unit 702 , and , first , it is determined whether the variation in the scores ( 3σ ) is within the allowable range or not . here , it is provided that , if a value where 3σ is within r is the allowable value , a plurality of applicable conditions exist . next , it is determined whether the score average is higher than the acceptance set in the automatic length measurement file by at least a certain amount u or not . this is because errors may frequently occur if the difference from the acceptance is not at least the certain amount . if a plurality of applicable conditions exist at this stage , a condition with the smallest number of integrations is determined as the optimum condition . here , fig1 shows a determination example in the case of fig8 . for instance , provided that the acceptance q set in the automatic length measurement file is 300 , the allowable value r of the variation in the scores ( 3σ ) is 100 , and the certain amount u is 100 , it is determined that 8 frames or more is optimal . next , the length measurement unit 405 in fig4 will be described in detail with reference to fig1 and 12 . after the images with the respective numbers of integrations are transmitted from the conversion unit 402 of the number of integrations to the length measurement unit 405 , length measurement with the same condition as the length measurement method registered in the automatic length measurement file is performed on each image . as described above , plural images with the numbers of integrations can be generated from one image . accordingly , a plurality of measured lengths can be acquired on the basis of one image as in fig1 . likewise , acquisition of measured lengths with the respective numbers of integrations on images 2 to x allows the length measurement average and the length measurement reproducibility ( 3σ ) to be calculated . here , it is provided that the calculated result is shown in fig1 . meanwhile , the filter unit 407 determines the optimal number of integrations on the basis of the length measurement managing value set in the automatic measurement file and the automatically or arbitrarily set length measurement variation ( 3σ ). here , fig1 shows a measurement length result determination flowchart . in a length measurement result accumulation unit 901 , the length measurement average and the length measurement reproducibility ( 3σ ) with each number of integrations are calculated , as described above . the information is transmitted to a filter unit 902 , and , first , it is determined whether the length measurement reproducibility ( 3σ ) is within the allowable range or not . here , it is provided that , if a value where the allowable value is 3σ is within m , a plurality of applicable conditions exist . next , it is verified whether the length measurement average falls within the length measurement managing value set in the automatic length measurement file . this is because , change in the number of integrations prevents the measured length from being significantly changed . if a plurality of applicable conditions exist at this stage , a condition with the smallest number of integrations is determined as the optimum condition . here , a determination example in the case of fig1 is shown in fig1 . for instance , provided that the set length measurement managing value ( n ± p ) is within 51 . 5 nm ± 1 nm and the length measurement reproducibility m is within 3 nm , 16 frames or more is determined optimal . even if the pattern matching result is determined such that 8 frames is optimal , determination of the measurement result has precedence in the case of the length measurement image . fig1 is a flowchart illustrating a process of determining image acquisition conditions . after processing is started , image data is read from a storing medium accumulating the images ( step 1201 ). image data for forming one image includes plural pieces of data of images to be integrated . accordingly , a plurality of images including the different numbers of integrations are formed using these pieces of image data ( step 1202 ). for instance , a plurality of images including the different numbers of integrations , for instance , one , two , three , . . . , n are formed . in the case where a operation device preliminarily forming the images with the different numbers of integrations , and a storing medium accumulating the differently integrated images are provided , step 1202 is not required . next , template matching is performed on the integrated image , thereby acquiring the score ( step 1203 ). the template matching process is performed on each image with the different number of integrations , thereby acquiring a plurality of scores ( degree of matching between the template and the position specified by the template ) on one evaluation target image ( step 1204 ). next , the process of acquiring a plurality of scores is performed even on a different evaluation target image , thereby acquiring a plurality of scores on the evaluation target images ( step 1205 ). the scores acquired as described above are compared with the preset acceptance ( step 1206 ). the number of integrations having a score of at least the acceptance on every evaluation target image is selected ( step 1207 ). the acceptance is a threshold for determining whether matching succeeds or not . accordingly , it can be considered that the number of integrations where all the scores exceed the acceptance is the image acquisition condition where success of matching is compensated on a plurality of images acquired from the different samples ( different samples acquired under the same manufacturing conditions ). thus , selection of the number of integrations from there among at least allows the matching success rate to be maintained high . next , the minimum one is selected from among the selected numbers of integrations ( step 1208 ). the selection of the minimum one from among the numbers of integrations where the high matching success rate is compensated can minimize beam irradiation on the sample while maintaining the matching success rate in a high state . finally , the selected number of integrations is stored in a recipe as the image acquisition conditions ( step 1209 ). the above steps allow appropriate image acquisition conditions to be set without reducing the operating ratio of the device . on the automatic length measurement file in the cd - sem , it is determined whether template matching succeeds or not according to the acceptance , as described above . in the case where the matching success rate is set to have priority , the acceptance may sometimes become higher than necessary . automatic determination of the acceptance will be described in detail with reference to fig1 . first , an image 1001 to be registered as a template is acquired . next , a target pattern 1002 to be a target of image recognition in the acquired image is registered . at the same time of registering the target pattern , image recognition 1003 is performed with the target pattern in the acquired image . a first candidate score s 1 with the highest score and a second candidate score s 2 with the second highest score are extracted . the acceptance is calculated from s 1 and s 2 . the acceptance is the average between s 1 and s 2 . in the case where s 1 is 800 and s 2 is 300 , the acceptance is 550 . here , the acceptance is a value that can be set to an arbitrary value . the value can be rewritten in the case where it is determined that the value automatically determined on registration of the template is high . thus , a method is proposed that automatically determines whether the automatically determined acceptance is optimal or not and , if the value is determined inappropriate , automatically or arbitrarily rewrites the value to an appropriate value . it should be noted that , setting the acceptance too low causes a possibility of erroneously recognizing a pattern different from the target pattern as the target pattern . in order to prevent erroneous recognition , a minimum value qmin with an acceptance that can be preset is determined . even without difference between the acceptance and the score average , errors frequently occur . accordingly , the acceptance is required to be set such that at least a certain difference is secured . fig1 exemplifies an acceptance optimization flowchart in consideration therewith . if the acceptance is high , the variation in the scores ( 3σ ) is small . accordingly , even with a high score average , the verification of score average 1103 unfortunately processes the condition as an inapplicable condition . here , it is verificated whether the score average of the inapplicable conditions is at least a minimum acceptance qmin and the certain amount u of difference is secured or not . if the condition is met , reduction in acceptance allows adoption of the condition where the number of integrations is further reduced . it is provided that the optimal acceptance value is a value acquired by subtracting the certain amount u from the score average of the inapplicable condition . however , it can be automatically or arbitrarily selected whether to adopt a condition with a reduced acceptance or not . that is , the optimum condition is selected from between two cases , or the case where the acceptance is not optimized and the case where the acceptance is optimized ( a plurality of conditions if , on optimization , a plurality of applicable conditions exist ). in the case of setting optimization to be automatic , it can be preset whether to select acceptance - optimized one or not . here , fig1 shows an example of simulation based on the result in fig8 . in the case where the acceptance q registered in the automatic length measurement file is 550 , the allowable value r of the variation in the scores ( 3σ ) is 100 , the certain amount u is 100 , and the minimum acceptance qmin is 300 , it is determined that the number of integrations is required to be at least 16 unless the acceptance is optimized . in the case where the optimization of the acceptance is valid , the number of integrations can be reduced to 8 frames . 407 , 702 , 704 , 902 , 904 , 1102 , 1105 filter unit	7
fig1 is a preferred embodiment of a diversion device . like a conventional diversion device , the present invention connects two source water pipes : one ( 14 ) for the hot water and the other ( 12 ) for the cold . the two pipes join to a central housing ( 16 ). on the front of the housing ( 16 ) is a knob ( 18 ) which is use to control the flow of or to divert the water to either the shower head or to the spout . with reference to fig2 the inner structure of the housing ( 16 ) is shown . a diversion tube ( 20 ) is held within the housing ( 16 ) with a watertight fit . the inner chamber of the housing ( 16 ) is divided into four sections by the diversion tube ( 20 ) and corresponding walls : an upper outlet chamber ( 162 ), two inlet chambers ( 160 ) and a lower outlet chamber ( 164 ). the four chambers are separated by two o - rings ( 260 ) respectively installed in two grooves ( 26 ) so that the water can not flow within the space defined by the housing &# 39 ; s ( 16 ) inner surface and the diversion tube &# 39 ; s ( 20 ) outer surface . the upper outlet chamber ( 162 ) is connected to the shower head ( not shown ) and the lower outlet chamber ( 164 ) is connected to the spout ( now shown ). in the diversion tube ( 20 ), corresponding to each above - mentioned three sections , there are an upper outlet hole ( 202 ), a plurality of inlet holes ( 200 ) and a lower outlet hole ( 204 ). fig4 shows the diversion tube ( 20 ), the control shaft ( 30 ) and their relationship . defined in the diversion tube 20 are a shoot opening ( 22 ) and a first threaded locking hole ( 24 ). the control shaft ( 30 ) is rotatably inserted into the diversion tube ( 20 ) with the watertight fit maintained by two o - rings ( 380 ) each mounted in a groove ( 38 ) respectively . provided between the bases of said two grooves ( 38 ) and aligned with the inlet holes ( 200 ) and either the upper outlet ( 202 ) or lower outlet ( 204 ) holes defined in the diversion tube ( 20 ) is an aqueduct ( 32 ). this aqueduct ( 32 ) is defined by a thin rectangular plate connected to a diameter of said groove bases respectively . a semicircular cross section shielder ( 324 ) is attached on the plate &# 39 ; s back surface , and here in this embodiment it is attached by a plurality of receiving openings ( 320 ). longitudinally corresponding to the shoot opening ( 22 ), an opening ( 34 ) is defined in the control shaft ( 30 ) for receiving a stop bolt ( 340 ) which limits the control shaft &# 39 ; s rotation with respect to the diversion tube ( 20 ). corresponding to the first locking hole ( 24 ), a second opening ( 36 ) is defined in the control shaft ( 30 ). when the diversion tube ( 20 ) and the control shaft ( 30 ) are assembled together , a spring ( 360 ) and a positioning ball ( 362 ) are put into the two aligned openings ( 24 , 36 ) and are sealed therein by a plug ( 240 ). fig5 and 7 show relative positions of the control shaft ( 30 ) and the division tube ( 20 ) when the control shaft ( 30 ) is aligned to perform the three functions : &# 34 ; shut &# 34 ;, divert to &# 34 ; spout &# 34 ; and divert to &# 34 ; shower head &# 34 ;, respectively . in fig5 the side view of the assembled diversion tube ( 20 ) and control shaft ( 30 ), together with accompanying cross sections from five different positions , shows the situation when the control shaft ( 30 ) is turned to &# 34 ; shut &# 34 ;. fig . a -- a shows that the upper outlet hole ( 202 ) in the diversion tube ( 20 ) is closed by the shield ( 324 ); fig . b -- b shows that the inlet holes ( 200 ) in the diversion tube ( 20 ) are open to the aquaduct ( 32 ); fig . c -- c shows that the lower outlet hole ( 204 ) in the diversion tube ( 20 ) is also closed by the shield ( 324 ); fig . d -- d shows that the stop bolt ( 340 ) is at the center of the shoot opening ( 22 ), and it can be turned to left or right ; and , fig . e -- e shows that under the force of the spring ( 360 ), the positioning ball ( 362 ) is pushed into a space of a certain depth left by the plug ( 240 ) thus providing a positioning force on the control shaft ( 30 ) with respect to the diversion tube ( 20 ). under these conditions , all the outlet holes are closed so the shower - divert is &# 34 ; shut off &# 34 ;. in fig6 the control shaft is turned to the position of &# 34 ; spout &# 34 ;. fig . a -- a shows that the upper outlet hole ( 202 ) in the diversion tube ( 20 ) is closed by the shield ( 324 ); fig . b -- b shows that the inlet holes ( 200 ) in the diversion tube ( 20 ) are open ; fig . c -- c shows that the lower outlet hole ( 204 ) is also open ; fig . d -- d shows that the stop bolt ( 340 ) is at the right most end of the stop groove ( 22 ), a position easy to identify by a user ; fig . e -- e shows that the spring ( 360 ) is compressed and the positioning ball ( 362 ) is pushed by the spring against the inner surface of the diversion tube . under these conditions , the inlet hole ( 200 ) and the lower outlet hole ( 204 ) which connects to the lower outlet chamber ( 164 ) which connects to the pipe leading to the spout is open yet the upper outlet hole ( 202 ) is closed , so the source water will be diverted to the spout . in fig7 the control shaft 30 is turned to the position for &# 34 ; shower head &# 34 ;. fig . a -- a shows that the upper outlet hole ( 202 ) in the diversion tube 20 is open ; fig . b -- b shows that the inlet hole ( 200 ) in the diversion tube ( 20 ) is open ; fig . c -- c shows that the lower outlet hole ( 204 ) is closed by the shield ( 324 ); fig . d -- d shows that the stop bolt ( 340 ) is at the left most end of the shoot opening ( 22 ); fig . e -- e shows that the spring ( 360 ) is compressed and the positioning ball ( 362 ) is pushed by the spring against the inner surface of the diversion tube ( 20 ). fig8 and 10 show a cut - off valve device ( 40 ) and its principle of operation . the cut - off valve device is used between the shower - divert device ( 10 ) ( shown in fig1 ) and the water pipe ( 12 , 14 ) ( here the cold - water tube ) to prevent flow of the water from the shower - divert device ( 10 ) back into the water pipe ( 12 , 14 ) when the shower divert device ( 10 ) is shut off . fig8 shows that the cut - off device comprises a cut - off valve ( 40 ) and a valve cover ( 122 ) covered thereon . with reference to fig9 the cut - off valve is a small barrel - like device comprising therewithin : a hollowed - out frame ( 400 ) fixed on the inner face of the barrel with a central opening , a shaft ( 420 ) slidably inserted in said central opening , a cylinder ( 42 ) connected onto the free end of said shaft at the cylinder &# 39 ; s center , a spring ( 44 ) covering around the shaft and fixed onto said hollowed - out frame ( 400 ) at one end and onto the cylinder ( 42 ) at the other end . when the water is shut off , the cylinder ( 42 ) will close the inlet hole defined in the bottom face , facing the side of the shower divert , of the cut - off valve device under the force of the spring thus preventing the water from flowing back into the water tube . and also with reference to fig1 , when the source water is turned on , the cut - off valve will open because the cylinder ( 42 ) is pushed back by the pressure of the water .	8
best modes for carrying out the present invention will be described in further detail using various embodiments with reference to the accompanying drawings . fig1 is a block diagram showing a portable radio terminal with an infrared communication function according a first embodiment . as shown in fig1 , the portable radio terminal is provided with an information processing section 101 , an infrared communication function section 102 , a driving current control section 103 , a radio communication function section 104 , a battery 105 , a power source section 106 , an input device 107 and an output device 108 . the information processing section 101 operates by program control and is connected to the infrared communication function section 102 bidirectionally . the infrared communication function section 102 is capable of infrared - communicating with another apparatus ( not shown ) with the infrared communication function . the information processing section 101 is connected to the driving current control section 103 . the radio communication function section 104 capable of radio - communicating is connected to the infrared communication function section 102 bidirectionally . the power source section 106 stabilizes a voltage of the battery 105 and distributes stabilized voltage to each section . the input device 107 such as a keyboard is connected to the information processing section 101 . the information processing section 101 is connected to the output device 108 such as an lcd ( liquid crystal display ). the infrared communication function section 102 , as shown in fig2 , is a light emitting element 201 such as an infrared led ( light emitting diode ) for emitting infrared signals , a light receiving element 202 such as a phototransistor for receiving infrared signals and a first signal conversion section 203 for coordinating a signal level between the light emitting element 201 and the information processing section 101 and a signal level between the light receiving element 202 and the information processing section 101 . the driving current control section 103 , as shown in fig2 , is provided with a current control section 204 changing a driving current of the light emitting element 201 in the infrared communication function section 102 . the current control section 204 can set a driving current value to a first current value , a second current value and a third current value . the radio communication function section 104 is provided with a transmission power amplification section 205 and a transmission power control section 206 . the transmission power control section 206 controls and optimizes a transmission power in accordance with a distance from a base station and an usage situation . the information processing section 101 is provided with a first control section ( not shown ) for outputting a control signal 211 controlling a driving current of the light emitting element 201 to the driving current control section 103 when the radio communication function section 104 is in radio communication , and a second control section ( not shown ) for outputting a switching signal 212 switching control levels of the driving current of the light emitting element 201 . fig4 shows a concrete circuit diagram of the block diagrams shown in fig1 and 2 . the light emitting element 201 is an infrared led ( light emitting diode ) 412 , and the light receiving element 202 is a photodiode 413 . the first signal conversion section 203 is provided with a driver 414 for driving the infrared led 412 and an amplifier 415 for amplifying electric signals from the photodiode 413 . analog electric signals amplified by the amplifier 415 are converted into digital signals by a comparator 416 . a driver 417 coincides the digital signals with signals of the information processing section 101 as to a signal level . the current control section 204 in the driving current control section 103 is provided with a current restriction resistor a 405 , a current restriction resistor b 406 and a current restriction resistor c 407 for restricting the driving current of the infrared led 412 , a first fet ( field effect transistor ) 401 to short - circuit the current restriction resistor a 405 , a second fet 402 for driving the first fet 401 , a third fet 403 to short - circuit the current restriction resistor a 405 and the current restriction resistor b 406 , a fourth fet 404 for driving the third fet 403 , a pull - up resistor a 408 and a pull - up resistor b 409 . fig3 shows an operation according to the first embodiment of the present invention . when starting the infrared communication function is requested to the information processing section 101 by the input device 107 ( step s 301 ), the information processing section 101 judges whether the radio communication function section 104 is in radio communication or not before executing an infrared communication operation ( step s 302 ). when the radio communication function section 104 is not in radio communication , the information processing section 101 sets a driving current value of the light emitting element 201 in the infrared communication function section 102 to a first current value i - 1 for the current control section 204 in the driving current control section 103 ( step s 307 ). the first current value i - 1 gives no restriction to the driving current of the light emitting element 201 . when the radio communication function section 104 is in radio communication , the information processing section 101 also judges a transmission power value of the radio communication function section 104 in accordance with information from the transmission power control section 206 . when the transmission power value is lower than a predetermined first threshold ( step s 304 : no ), the information processing section 101 sets a driving current value of the light emitting element 201 in the infrared communication function section 102 to a second current value i - 2 for the current control section 204 in the driving current control section 103 ( step s 306 ). the second current value i - 2 restricts the driving current of the light emitting element 201 . when the transmission power value is higher than the predetermined first threshold ( step s 304 : yes ), the information processing section 101 sets a driving current value of the light emitting element 201 in the infrared communication function section 102 to a third current value i - 3 for the current control section 204 in the driving current control section 103 ( step s 305 ). the third current value i - 3 further restricts the driving current of the light emitting element 201 more than the second current value i - 2 . with these current restrictions , a consumption power of the light emitting element 201 is deduced and an arrival distance of infrared emitted from the light emitting element 201 is restricted . the output device 108 indicates that a communicable distance of the infrared communication is restricted in this way ( step s 308 ). as above described , after the driving current of the light emitting element 201 is determined based on battery voltage , the infrared communication operation is executed ( step s 309 ), and the infrared communication operation is finished ( step s 310 ). next , concrete descriptions will be given of the operation with the circuit diagrams ( fig1 , 2 and 4 ) and the operational flowchart ( fig3 ). when not in radio communication ( step s 302 : no ), the information processing section 101 outputs a signal of a hi ( high ) level to a control line 411 and outputs a signal of a low level to a control line 410 for the current control section 204 in the driving current control 103 . with these outputs , the fourth fet 404 is turned on and the third fet 403 is also turned on . both sides of the current restriction resistor a 405 and the current restriction resistor b 406 are short - circuited , the driving current of the infrared led 412 is restricted by the resistance value of the current restriction resistor c 407 , and the first current value i - 1 can be set . in radio communication ( step s 302 : yes ), when a transmission power value is lower than a predetermined first threshold ( step s 304 : no ), the information processing section 101 outputs a signal of a hi ( high ) level to the control line 410 and outputs a signal of a low level to the control line 411 for the current control section 204 in the driving current control 103 . the second fet 402 is turned on and the first fet 401 is also turned on . therefore , both sides of only the current restriction resistor a 405 are short - circuited , the driving current of the infrared led 412 is restricted by the total resistance value of the current restriction resistor b 406 and the current restriction resistor c 407 , and the second current value i - 2 can be set . in radio communication ( step s 302 : yes ), when a transmission power value is higher than a first predetermined threshold ( step s 304 : yes ), the information processing section 101 outputs signals of low levels to a control line 410 and to a control line 411 for the current control section 204 in the driving current control section 103 . all of fets are turned off , the driving current of the infrared led 412 is restricted by the total resistance value of the current restriction resistor a 405 , the current restriction resistor b 406 and the current restriction resistor c 407 , and the second - current value i - 3 can be set . in the first embodiment , the explanations are given in a case that one threshold is used for judgment of the transmission power value of the radio communication section and two restricted driving current values of the light emitting element are used . however , two and more thresholds may be used to judge detected results of transmission power values and three and more driving current values of light emitting elements may be used in accordance with the number of thresholds . in the first embodiment , a case is described in that the radio communication function section has a function to control a transmission power , however , though there is no function controlling the transmission power , the driving current of the light emitting element is restricted only whether in radio communication or not , and thereby similar effects can be obtained . a second embodiment according to the present invention will be described . fig5 shows a portable radio terminal with an infrared communication function according to the second embodiment of the present invention . the portable radio terminal with the infrared communication function according to the second embodiment is different from that of the first embodiment in being provided with a second infrared communication function section 501 and a third infrared communication function section 502 instead of a driving current control section 103 . a driving current of a light emitting element ( not shown ) in the second infrared communication function section 501 is set to a value lower than a driving current of a light emitting element in the first infrared communication function section 102 . further , a driving current of a light emitting element ( not shown ) in the third infrared communication function section 502 is set to a value lower than the driving current of the light emitting element in the second infrared communication function section 501 . when starting the infrared communication function is requested to an information processing section 101 by an input device 107 ( step s 601 ), the information processing section 101 judges whether a radio communication function section 104 is in radio communication or not before executing an infrared communication operation ( step s 602 ). when the radio communication function section 104 is not in radio communication ( step s 602 : no ), the information processing section 101 executes the infrared communication function by the first infrared communication function section 102 ( step s 606 ). no restriction is given to the driving current of the light emitting element in the first infrared communication function section 102 . when the radio communication function section 104 is in radio communication ( step s 602 : yes ), the information processing section 101 judges the transmission power value of the radio communication function section 104 based on information from a transmission power control section 206 . when the transmission power value is lower than a predetermined first threshold ( step s 603 : no ), the information processing section 101 executes infrared communications using the second infrared communication function section 501 ( step s 605 ) and , at a same time , an output device 108 notifies to a person having the portable radio terminal that a communicable distance of the infrared communications is restricted ( step s 607 ). a restriction is given to the driving current of the light emitting element in the second infrared communication function section 501 . when the transmission power value is higher than the predetermined first threshold ( step s 603 : yes ), the information processing section 101 executes infrared communications using the third infrared communication function section 502 ( step s 604 ) and , at a same time , the output device 108 notifies to the person having the portable radio terminal that a communicable distance of the infrared communications is restricted ( step s 607 ). a further restriction is given to the driving current of the light emitting element in the third infrared communication function section 502 rather than the second infrared communication function section 501 . in this way , the infrared communication function is selected , the selected infrared communication operation is executed and the infrared communication operation is finished ( step s 608 ). it is thus apparent that the present invention is not limited to the above embodiments but may be changed and modified without departing from the scope and spirit of the invention . finally , the present application claims the priority based on japanese patent application no . heill - 235009 filed on aug . 23 , 1999 , which is herein incorporated by reference .	8
the present invention is based upon the concept that that the recovery of tissue after injury is promoted by maintaining high local concentrations of growth factors such as igf - 1 or pdgf . experiments described in the art have supported this approach using biologically compatible membranes to retain therapeutic agents at the site of administration ( see us20060088510 and us20060148703 ). it has now been discovered that growth factors can be fused to heparin binding peptides and bound to cardiomyocytes prior to their implantation into the heart tissue . the fused protein maintains its ability to promote cell growth and survival and is maintained at the site of implantation without the need to make and use a biologically compatible membrane . one way of joining the heparin binding peptide to the therapeutic agent is through the use of a nonpeptide linker . for example , the use of biotin and avidin for linking molecules is well known in the art and standard methodology can be used for attaching heparin binding peptides to growth factors such as igf - 1 . in order to prevent steric interference between the biotin / avidin groups and peptides , a spacer may be included between the two . the spacer can take the form of 1 - 15 ( preferably 1 - 10 ) fatty acids or 1 - 15 ( preferably 1 - 10 ) amino acids . methodology for incorporating spacers of this type is well known in the art . preferably , heparin binding peptides and growth factors such as igf - 1 and pdgf are joined together in the form of a fusion protein . fusion proteins may either be chemically synthesized or made using recombinant dna techniques . chemical methods include solid - phase peptide synthesis using standard n - tert - butyoxycarbonyl ( t - boc ) chemistry and cycles using n - methylpyrolidone chemistry . once peptides have been synthesized , they can be purified using procedures such as high pressure liquid chromatography on reverse - phase columns . purity may also be assessed by hplc and the presence of a correct composition can be determined by amino acid analysis . cardiomyocytes or other cells may be obtained using standard procedures and may then be incubated with fusion compositions or proteins for a period sufficient to allow the fusion proteins to bind to cell surfaces . the incubation may last anywhere from about an hour to several days and should be carried out under conditions that allow for cell survival , e . g . at about 37 ° c ., neutral ph , and in a culture medium that insures cell survival . the amount of protein present should generally be enough to coat the cells but the exact amount is not critical . the cells may be administered by syringe or catheter to cardiac tissue . the exact amount of cells used is not critical but , in general , between 1 × 10 5 and 1 × 10 7 will be used . fusion proteins may be incorporated into a pharmaceutical composition containing a carrier such as saline , water , ringer &# 39 ; s solution and other agents or excipients and cells may be maintained in standard media to maintain viability . preparations will generally be designed for implantation , infusion or injection , particularly into cardiac tissue but topical treatments will also be useful , e . g ., in the treatment of wounds . all pharmaceutical compositions may be prepared using methods that are standard in the art ( see e . g ., remington &# 39 ; s pharmaceutical sciences , 16th ed . a . oslo . ed ., easton , pa . ( 1980 )). it is expected that the skilled practitioner will adjust dosages on a case by case basis using methods well established in clinical medicine . the optimal dosage will be determined by methods known in the art and will be influenced by factors such as the age of the patient , disease state and other clinically relevant factors . the present example demonstrates that igf - 1 improves survival of es - derived cardiomyocytes and describes the development of a novel heparin binding ( hb )- igf - 1 fusion protein engineered to improve survival of injected cells . to minimize teratoma formation , we studied es cells committed to the cardiomyocyte lineage . mouse es cells , stably transfected with α - cardiac myosin heavy chain promoter - driven enhanced green fluorescent protein ( egfp ), were differentiated into cardiomyocytes by the hanging drop method and egfp positive cells were purified by fluorescent cell sorting . in these es - derived cardiomyocytes , igf - 1 reduced cell death induced by serum deprivation , ( 13 . 6 +/− 1 . 9 % vs 25 . 9 +/− 2 . 5 % in control , p & lt ; 0 . 05 ) and decreased apoptosis induced by serum deprivation ( tunel - positive cells 8 . 0 +/− 1 . 5 % to 4 . 3 +/− 0 . 5 % respectively , p & lt ; 0 . 05 ). furthermore , igf - 1 decreased doxorubicin ( 1 μm , 24 hr ) or chelerythrin ( 3 μm , 1 hr )- induced apoptosis ( p & lt ; 0 . 01 ). the phosphoinositide - 3 kinase inhibitor , ly294002 ( 10 μm ), inhibited the protective effect of igf - 1 on doxorubicin - induced apoptosis ( p & lt ; 0 . 05 ). since igf - 1 diffuses rapidly away from injected sites , we then designed and expressed a novel recombinant igf - 1 fusion protein with an n - terminal hb domain . the protein was purified by nickel - affinity chromatography and then subjected to oxidative refolding to restore biological activity . hb - igf - 1 bound to cell surfaces dramatically better than igf - 1 and hb - igf - 1 activated akt in neonatal cardiac myocytes and 3t3 fibroblasts as potently as native igf - 1 . because igf - 1 improves survival of es - derived cardiomyocytes in vitro , this new heparin - binding igf - 1 should improve cell therapy by binding to the surfaces of injected cells . this demonstrates the potential for changing the cellular microenvironment through locally - delivered therapeutic proteins . in this example , we designed and purified a novel protein , heparin - binding igf - 1 ( hb - igf - 1 ), which is a fusion protein of native igf - 1 with the heparin - binding domain of heparin - binding epidermal growth factor - like growth factor . hb - igf - 1 bound selectively to heparin as well as the cell surfaces of 3t3 fibroblasts , neonatal cardiac myocytes and differentiating embryonic stem cells . hb - igf - 1 activated the igf - 1 receptor and akt with the identical kinetics and dose - dependence of igf - 1 , indicating no compromise of biological activity due to the heparin - binding domain . because cartilage is a proteoglycan - rich environment and igf - 1 is a known stimulus for chondrocyte biosynthesis , we then studied the effectiveness of hb - igf - 1 in cartilage . hb - igf - 1 was selectively retained by cartilage explants and led to sustained chondrocyte proteoglycan biosynthesis compared to igf - 1 . these data show that the strategy of engineering a “ long - distance ” growth factor like igf - 1 for local delivery may be useful for tissue repair and minimizing systemic effects . rat igf - 1 cdna was amplified by polymerase chain reaction ( pcr ) using primers ( 5 ′ to 3 ′) ggaccagaggaccctttgcg ( forward , seq id no : 22 ) and agctgacttt gtaggcttcagc ( reverse , seq id no : 23 ). we used mature peptide igf - 1 ( 70 amino acids ), which encodes exons 3 and 4 ( hameed , et al ., j . physiol . 547 : 247 - 254 ( 2003 ); shavlakadze , et al ., growth horm igf res 15 : 4 - 18 ( 2005 ); musaro , et al ., exp gerontol 42 : 76 - 80 ( 2007 )). the product was subcloned into the ptrchis - topo vector ( invitrogen , carlsbad , calif ., usa ) with the addition of a stop codon ( tag ) at the c - terminus of igf - 1 , thus encoding an xpress - tagged igf - 1 ( xpress - igf - 1 ). to encode hb - igf - 1 , the heparin binding sequence ( aa 93 - 113 ) of rat hb - egf ( aaaaagaagaggaaaggcaagggg ttaggaaagaagagagatccatgcct taagaaatacaag ( seq id no : 24 )) was inserted between the x - press tag and the igf - 1 sequence through mutagenesis . amplification was performed with pfuultra hf dna polymerase ( stratagene , cedar creek , tex ., usa ) and the template plasmid was digested with dpni ( new england biolabs , beverly , mass ., usa ) before transformation in e . coli . all sequences were confirmed by dna sequencing . xpress - igf - 1 and hb - igf - 1 were expressed in e . coli bl21 cells and grown in lb medium in 4 1 batches . protein synthesis was induced with 1 mm isopropyl β - d - thiogalactoside for 4 hours and cells were then harvested by centrifugation , lysed in lysis buffer ( 6 m guanidine hydrochloride , 20 mm sodium phosphate , 500 mm nacl , ph 7 . 8 ) and homogenized . the first purification step consisted of affinity purification by the polyhistidine tag in fusion proteins with ni - nta ( invitrogen ). ni - nta resin was washed with wash buffer ( 8 m urea , 500 mm nacl , 20 mm phosphate , ph 6 . 2 ), and bound protein was eluted at ph 4 . eluted proteins were then subjected to oxidative refolding to restore biological activity . the proteins were incubated overnight at 4 ° c . with refolding buffer ( 50 mm tris , 75 mm nacl , 100 μm oxidized - glutathione and 100 μm reduced - glutathione , ph 7 . 8 ). after refolding , the samples were adjusted to 0 . 1 % trifluoroacetic acid and loaded on a c18 reverse - phase high - performance liquid chromatography ( rp - hplc ) column ( delta - pak c18 , waters , milford , mass ., usa ) as a final purification step . the column was subjected to a linear gradient from 25 % to 40 % acetonitrile in 0 . 1 % trifluoroacetic acid . primary cultures of cardiac myocytes were prepared from the ventricles of neonatal sprague dawley rats and cultured in dulbecco &# 39 ; s modified eagle &# 39 ; s medium ( dmem , invitrogen ) with 7 % fetal bovine serum ( invitrogen ); medium was replaced after 24 hours with serum - free medium . 3t3 fibroblast cells were cultured in dmem with 10 % newborn calf serum ( invitrogen ) and the medium was replaced with serum - free medium 24 hours before experiments . mouse embryonic stem ( es ) cells were grown on gelatin - coated dishes without feeder cells in glasgow minimum essential medium ( invitrogen ) supplemented with 15 % knockout sr ( invitrogen ) and leukemia inhibitory factor ( chemicon , billerica , mass ., usa ). cells were passaged every three days . to induce differentiation , cells were first enzymatically dissociated and cultured as hanging drops for embryoid body formation as described previously ( takahashi , et al ., circulation 107 : 1912 - 1916 ( 2003 )). differentiation medium with 10 % es cell - qualified fetal bovine serum ( invitrogen ) without leukemia inhibitory factor was added . these es cells become green fluorescent protein ( gfp ) positive after differentiation into cardiac myocytes , because they were stably transfected with an alpha - myosin heavy chain promoter - driven enhanced gfp vector . after embryoid body formation ( days 7 ), cells were plated on gelatin - coated dishes . bovine articular cartilage explants ( 3 - mm - diameter , 1 - mm - thick disks ) were harvested from the femoropatellar grooves of 1 - 2 - week - old calves and cultured in low - glucose dmem with 10 mm hepes , 0 . 1 mm nonessential amino acids , 0 . 4 mm l - proline , 20 μg / ml ascorbate , 100 u / ml penicillin and 100 μg / ml streptomycin at 37 ° c . in a 5 % co 2 atmosphere . neonatal cardiac myocytes and 3t3 fibroblasts were lysed using phosphate - buffered saline ( pbs ) with 1 % triton - x , 0 . 25 % na - deoxycholate , 1 mm ethylenediamine - tetraacetic acid ( edta ), 1 mm phenylmethylsulfonyl fluoride ( pmsf ), 1 mm naf , 1 mm na 3 vo 4 and 1 : 1000 protease inhibitor cocktail ( sigma , st . louis , md ., usa ). cartilage disks were pulverized and lysed with 100 mm nacl , 50 mm tris , 0 . 5 % triton - x , 5 mm edta , 1 mm pmsf and 1 : 1000 proteinase inhibitor cocktail ( sigma ). protein concentration was measured by bradford assay and 10 μg protein was loaded in each well for western blot analysis . similar gag content was observed in all samples as measured by dmmb dye binding . anti - xpress antibody ( invitrogen ), anti - polyclonal igf - 1 antibody ( abeam , cambridge , mass ., usa ), anti - phospho - igf - 1 receptor antibody ( cell signaling , danvers , mass ., usa ), anti - phospho - akt antibody ( cell signaling ) and anti - actin antibody ( sigma ) were used . igf - 1 was purchased from sigma as a control protein . to detect the fusion proteins by enzyme - linked immunosorbent assays ( elisa ), 96 - well plates were coated with an anti - xpress antibody ( 10 μ / ml ) overnight . identical amounts of protein from cartilage extracts were added to each well . polyclonal igf - 1 antibody was used as the primary antibody , and anti - rabbit - horseradish peroxidase ( bio - rad , hercules , calif ., usa ) was used as the secondary antibody . after addition of abts peroxidase substrate ( kpl , gaithersburg , md ., usa ), plates were read at 405 nm . heparin agarose beads ( sigma ) were incubated with 300 pmol hb - igf - 1 or xpress - igf - 1 or 2 hours and washed 3 times with pbs . bound fusion proteins with heparin agarose beads were extracted by boiling with sds - page sample buffer ( invitrogen ). 3t3 fibroblast cells or neonatal rat cardiomyocytes were incubated with 100 nm hb - igf - 1 or control igf - 1 ( sigma ) for 2 hours and then washed with pbs 3 times . the cells were lysed with lysis buffer and then subjected to western blot analysis with an anti - igf - 1 antibody . embryoid bodies ( 10 days after induction of differentiation ) were incubated with fusion proteins for 2 hours , washed with pbs 3 times , and fixed with paraformaldehyde before immunohistochemistry with an anti - xpress antibody . cartilage disks were cultured in serum - free dmem supplemented with either 500 nm hb - igf - 1 or 500 nm xpress - igf - 1 . after 48 hours ( on day 0 ), disks were washed 3 times with pbs then incubated in dmem with no igf - 1 . disks were collected on days 0 , 1 , 2 and 4 . protein remaining in cartilage extracts was detected by western blot analysis and elisa . chondrocyte proteoglycan synthesis was measured by incorporation of [ 35 s ] sulfate ( perkinelmer , waltham , mass ., usa ) as previously described ( sah , et al ., j . orthop . res . 7 : 619 - 636 ( 1989 )). cartilage disks were equilibrated in serum - free medium for 1 day and incubated in medium containing 100 nm hb - igf - 1 , xpress - igf - 1 or control igf - 1 ( sigma ) for 2 days . the disks were then washed 3 times with pbs and changed to igf - 1 free medium . cultured disks were radiolabeled with 5 μci / ml [ 35 s ] sulfate for the final 24 hours of culture . after labeling , each disk was washed 3 times in 1 . 0 ml of pbs with 0 . 8 mm proline and 1 mm na 2 so 4 at 4 ° c . to remove free radiolabel . disks were digested in 1 . 0 ml of proteinase k ( 125 μg / ml in 0 . 1 m na 2 so 4 , 5 mm edta and 5 mm cysteine at ph 6 . 0 ). samples were analyzed for dna content by fluorometric analysis by reaction of 20 μl of digest with 180 μl of hoechst dye 33258 ( 24 ). the [ 35 s ] sulfate content of the digests was then measured in a scintillation counter ( wallac microbeta trilux , perkinelmer , waltham , mass ., usa ), with corrections for spillover and quenching . statistical analyses were performed by student &# 39 ; s t - test with acceptance level α = 0 . 05 . t - tests were corrected for multiple comparisons using α = 1 -( 1 - α 0 ) 1 / n , where α 0 = 0 . 05 and n = total number of comparisons . all data were expressed as mean ± se . igf - 1 has 3 disulfide bonds and includes 70 amino acids . the igf - 1 fusion proteins both contain poly - histidine tags for protein purification and xpress tags for protein detection . molecular weights of hb - igf - 1 and xpress - igf - 1 are 14 , 018 da and 11 , 548 da , respectively . hb - igf - 1 has the hb domain on the n - terminus of igf - 1 . the hb domain has 21 amino acids and includes 12 positively charged amino acids . final purification of the new fusion proteins after refolding was performed with rp - hplc . identification of the correctly - folded protein was performed as previously described ( milner , et al ., biochem . j . 308 ( pt 3 ): 865 - 871 ( 1995 )) and confirmed with bioactivity assays . coomassie blue staining and western analysis with an anti - xpress antibody of the refolded igf - 1 proteins after rp - hplc , revealed a single band . we first tested whether hb - igf - 1 binds selectively to heparin . after 2 hours incubation of heparin agarose beads with 300 pmol hb - igf - 1 or xpress - igf - 1 , bound proteins were extracted from beads by boiling . coomassie blue staining of bound protein with heparin agarose beads showed that hb - igf - 1 binds selectively to heparin compared with xpress - igf - 1 . next we tested the ability of hb - igf - 1 to bind to cell surfaces , which have heparin sulfate proteoglycans , using 3t3 fibroblast cells and neonatal rat cardiac myocytes . after pretreatment with 0 - 100 nm of hb - igf - 1 for 2 hours , cells were washed with pbs 3 times . for these experiments , commercial igf - 1 was used as control . hb - igf - 1 bound to 3t3 fibroblast cells when treated with 10 nm and 100 nm concentrations . hb - igf - 1 binding to neonatal cardiac myocytes showed clear selective binding of hb - igf - 1 at 10 nm and 100 nm and a very weak band of igf - 1 at 100 nm . these results are consistent with binding of this hb domain to heparin in the submicromolar range . we also studied the ability of hb - igf - 1 to bind to embryonic stem cells in embryoid bodies , which contain multiple cell types . hb - igf - 1 was readily detected on the surfaces of cells in the embryoid bodies by immunofluorescence for the xpress epitope tag , indicating that hb - igf - 1 can bind to multiple cell types . to determine whether the hb domain interferes with bioactivity , bioassays for igf - 1 receptor phosphorylation and akt activation were performed . control igf - 1 , hb - igf - 1 and xpress - igf - 1 all activated the igf - 1 receptor of neonatal cardiac myocytes dose dependently and induced akt phosphorylation identically . control igf - 1 , hb - igf - 1 and xpress - igf - 1 all activated akt within a similar time course . these data demonstrate that addition of the heparin - binding domain does not interfere with the bioactivity of igf - 1 . cartilage is a proteoglycan - rich tissue , and chondrocytes respond to igf - 1 with increased extracellular matrix synthesis . because prolonged local stimulation of igf - 1 signaling could thus be beneficial for cartilage repair , we studied the ability of hb - igf - 1 to bind to cartilage . identically sized bovine articular cartilage disks were incubated with 500 nm hb - igf - 1 or xpress - igf - 1 for 1 day , 3 days or 6 days , and there were no differences in the amount of igf - 1 protein that diffused into cartilage over this time period . after pre - incubation with hb - igf - 1 or xpress - igf - 1 for 48 hours , cartilage disks were washed with pbs at day 0 and similar amounts of igf - 1 were detected . however , on days 1 , 2 , and 4 after removal of the igf - 1 proteins , only hb - igf - 1 remained in the cartilage , suggesting that hb - igf - 1 bound to the proteoglycan - rich extracellular matrix . in contrast xpress - igf - 1 was undetectable even 1 day after washing . we also performed this selective binding experiment with cartilage extracts and elisa measurements . these results confirmed that hb - igf - 1 is selectively retained by cartilage , while xpress - igf - 1 is rapidly lost . the selective retention of hb - igf - 1 to cartilage suggests that this fusion protein could deliver a sustained stimulus for chondrocyte biosynthesis . therefore , we measured chondrocyte biosynthesis of extracellular matrix proteoglycans by incorporation of [ 35 s ] sulfate . cartilage disks were incubated with 100 nm hb - igf - 1 , control igf - 1 or xpress - igf - 1 for 2 days and washed 3 times with pbs , followed by culture in medium with no igf - 1 . [ 35 s ] sulfate incorporation was measured for 24 hours beginning on day 0 ( before wash - out ), day 2 ( just after wash - out ), day 4 , day 6 and day 8 . during incubation with the igf - 1 constructs on day 0 , control igf - 1 , xpress - igf - 1 and hb - igf - 1 groups all stimulated proteoglycan synthesis as expected . however , after washing , neither control igf - 1 nor xpress igf - 1 stimulated proteoglycan synthesis at day 4 or beyond . in contrast , hb - igf - 1 led to sustained stimulation of proteoglycan synthesis for 6 days . proteoglycan synthesis was significantly higher in cartilage incubated with hb - igf - 1 vs . xpress - igf - 1 on days 2 , 4 , and 6 . these data demonstrate that hb - igf - 1 , which is selectively retained in the cartilage , stimulates chondrocyte biosynthesis over a more sustained period . local delivery of igf - 1 has the potential for improving tissue repair and regeneration while minimizing systemic adverse effects . in this example , we describe a novel igf - 1 protein , hb - igf - 1 , that binds to proteoglycan - rich tissue and cell surfaces but has the same bioactivity as igf - 1 . our data indicate that hb - igf - 1 can activate the igf - 1 receptor and akt and thus that the heparin - binding domain does not interfere with interactions of igf - 1 and its receptor . igf - 1 has four domains : domain ( aa1 - 29 ), c domain ( aa30 - 41 ), a domain ( aa42 - 62 ) and d domain ( aa63 - 70 ), with the c domain playing the most important role in binding to the igf - 1 receptor . replacement of the entire c domain causes a 30 - fold decrease in affinity for the igf - 1 receptor . thus , the addition of the heparin - binding domain to the n terminus of igf - 1 was not anticipated to interfere with interactions with the igf - 1 c domain . both extracellular matrix and cell surfaces are rich in proteoglycans and can serve as reservoirs for proteoglycan - binding growth factors . a classic example is the fibroblast growth factor - 2 ( fgf - 2 ) system , where a low affinity , high capacity pool of proteoglycan receptors serves as a reservoir of fgf - 2 for its high affinity receptor . our experiments suggest that hb - igf - 1 could function in some circumstances in a similar manner , since hb - igf - 1 is selectively retained on cell surfaces . igf - 1 can also bind with extracellular matrix via igf binding proteins ( igfbp ); in the circulation , at least 99 % of igf - 1 is bound to igfbps ( igfbp - 1 to - 6 ). igf - 1 can promote the synthesis of cartilage extracellular matrix and inhibit cartilage degradation ( bonassar , et al ., arch . biochem . biophys . 379 : 57 - 63 ( 2000 )); however , a practical mode of igf - 1 delivery to cartilage has yet to be developed ( schmidt , et al ., osteoarthritis cartilage 14 : 403 - 412 ( 2006 )). heparan sulfate proteoglycans are prevalent in the pericellular matrix of cartilage , particularly as chains on perlecan and syndecan - 2 , and are known to bind other ligands such as fgf - 2 . our experiments suggest that hb - igf - 1 protein can bind with matrix and increase local , long - term bioavailability to chondrocytes and thus improve cartilage repair . in addition to cartilage , hb - igf - 1 has potential for use in other tissues . for example , igf - 1 induces the axon outgrowth of pc12 cells and corticospinal motor neurons , and thus igf - 1 may benefit motor neuron degeneration diseases . in dermal wound healing , igf - 1 is also effective because igf - 1 stimulates collagen synthesis and mitogenicity of fibroblasts and keratinocytes . the ability of hb - igf - 1 to bind to the surfaces of cells may enhance cell therapies and other regenerative strategies . all references cited herein are fully incorporated by reference . having now fully described the invention , it will be understood by those of skill in the art that the invention may be practiced within a wide and equivalent range of conditions , parameters and the like , without affecting the spirit or scope of the invention or any embodiment thereof .	2
fig1 shows a system 10 , which embodies features of the invention , for visualizing interior regions of a living body . the invention is well adapted for use inside body lumens , chambers or cavities for either diagnostic or therapeutic purposes . it particularly lends itself to catheter - based procedures , where access to the interior body region is obtained , for example , through the vascular system or alimentary canal , without complex , invasive surgical procedures . the invention may be used in diverse body regions for diagnosing or treating diseases . for example , various aspects of the invention have application for the diagnosis and treatment of arrhythmia conditions within the heart , such as ventricular tachycardia or atrial fibrillation . the invention also has application in the diagnosis or treatment of intravascular ailments , in association , for example , with angioplasty or atherectomy techniques . various aspects of the invention also have application for diagnosis or treatment of ailments in the gastrointestinal tract , the prostrate , brain , gall bladder , uterus , and other regions of the body . the invention can also be used in association with systems and methods that are not necessarily catheter - based . the diverse applicability of the invention in these and other fields of use will become apparent . the invention makes it possible for a physician to access and visualize or image inter - body regions , to thereby locate and identify abnormalities that may be present . the invention provides a stable platform through which accurate displays of these images can be created for viewing and analysis by the physician . accurate images enable the physician to prescribe appropriate treatment or therapy . as implemented in the embodiment shown in fig1 the invention provides a system 10 comprising a support structure 20 that carries within it an imaging or visualizing probe 34 . as fig1 shows , the system 10 includes a flexible catheter tube 12 with a proximal end 14 and a distal end 16 . the proximal end 14 carries an attached handle 18 . the distal end 16 carries the support structure 20 . the support structure 20 can be constructed in various ways . in one preferred embodiment ( illustrated in fig1 ), the structure 20 comprises two or more flexible spline elements 22 . in fig1 the support structure 20 includes eight spline elements 22 . of course , fewer or more spline elements 22 can be present . for example , fig5 a shows the support structure 20 comprising just two , generally oppositely spaced spline elements 22 . as another example , fig5 b shows the support structure 20 comprising a single spline element 22 . in fig5 b , the distal end 23 of the spline element 22 is attached to a stylet 25 , carried by the catheter tube 12 , which moves the distal end 23 ( as shown by arrows 27 ) along the axis of the catheter tube 12 to adjust the curvature of the spline element 22 . as fig3 shows , each spline element 22 preferably comprises a flexible core body 84 enclosed within a flexible , electrically nonconductive sleeve 32 . the sleeve 32 is made of , for example , a polymeric , electrically nonconductive material , like polyethylene or polyurethane . the sleeve 32 is preferable heat shrunk about the core body 84 . the core body 84 is made from resilient , inert wire or plastic . elastic memory material such as nickel titanium ( commercially available as nitinol ™ material ) can be used . resilient injection molded plastic or stainless steel can also be used . preferably , the core body 84 is a thin , rectilinear strip . the rectilinear cross - section imparts resistance to twisting about the longitudinal axis of the core body 84 , thereby providing structural stability and good bio - mechanical properties . other cross - sectional configurations , such as cylindrical , can be used , if desired . the core bodies 84 of the spline elements 22 extend longitudinally between a distal hub 24 and a base 26 . the base 26 is carried by the distal end 16 of the catheter tube 12 . as fig1 shows , each core body 84 is preformed with a convex bias , creating a normally open three - dimensional basket structure expanded about a main center axis 89 . as fig2 shows , in the illustrated and preferred embodiment , the system 10 includes an outer sheath 44 carried about the catheter tube 12 . the sheath 44 has an inner diameter that is greater than the outer diameter of the catheter tube 12 . as a result , the sheath 44 slides along the outside of the catheter tube 12 . forward movement ( arrow 43 ) advances the slidable sheath 44 over the support structure 20 . in this position , the slidable sheath 44 compresses and collapses the support structure 20 into a low profile ( shown in fig2 ) for introduction through a vascular or other body passage to the intended interior site . rearward movement ( arrow 45 ) retracts the slidable sheath 44 away from the support structure 20 . this removes the compression force . the freed support structure 20 opens ( as fig1 shows ) and assumes its three - dimensional shape . the methodology for deploying the support structure 20 of course varies according to the particular inter - body region targeted for access . fig4 a and 4b show a representative deployment technique usable when vascular access to a heart chamber is required . the physician uses an introducer 85 , made from inert plastic materials ( e . g ., polyester ), having a skin - piercing cannula 86 . the cannula 86 establishes percutaneous access into , for example , the femoral artery 88 . the exterior end of the introducer 85 includes a conventional hemostatic valve 90 to block the outflow of blood and other fluids from the access . the valve may take the form of a conventional slotted membrane or conventional shutter valve arrangement ( not shown ). a valve 90 suitable for use may be commercial procured from b . braun medical company ( bethlehem , pa .). the introducer 85 includes a flushing port 87 to introduce sterile saline to periodically clean the region of the valve 90 . as fig4 a shows , the physician advances a guide sheath 92 through the introducer 85 into the accessed artery 88 . a guide catheter or guide wire ( not shown ) may be used in association with the guide sheath 92 to aid in directing the guide sheath 92 through the artery 88 toward the heart 94 . it should be noted that the views of the heart 94 and other interior regions of the body in this specification are not intended to be anatomically accurate in every detail . the figures show anatomic details in diagrammatic form as necessary to show the features of the invention . the physician observes the advancement of the guide sheath 92 through the artery 88 using fluoroscopic or ultrasound imaging , or the like . the guide sheath 92 can include a radio - opaque compound , such as barium , for this purpose . alternatively , a radio - opaque marker can be placed at the distal end of the guide sheath 92 . in this way , the physician maneuvers the guide sheath 92 through the artery 88 retrograde past the aortic valve and into the left ventricle 98 . the guide sheath 92 establishes a passageway through the artery 88 into the ventricle 98 , without an invasive open heart surgical procedure . if an alternative access to the left atrium or ventricle is desired ( as fig1 shows ), a conventional transeptal sheath assembly ( not shown ) can be used to gain passage through the septum between the left and right atria . access to the right atrium or ventricle is accomplished in the same manner , but without advancing the transeptal sheath across the atrial septum . as fig4 a shows , once the guide sheath 92 is placed in the targeted region , the physician advances the catheter tube 12 , with the support structure 20 confined within the slidable sheath 44 , through the guide sheath 92 and into the targeted region . as fig4 b shows , pulling back upon the slidable sheath 44 ( see arrow 45 in fig4 b ) allows the structure 20 to spring open within the targeted region for use . when deployed for use ( as fig4 b shows ), the shape of the support structure 20 ( which , in fig4 b , is three - dimensional ) holds the spline elements 22 in intimate contact against the surrounding tissue mass . as will be explained in greater detail later ( and as fig4 b shows ), the support structure 20 has an open interior 21 , which surrounds the imaging probe 34 , keeping the tissue mass from contacting it . as fig1 and 4b show , the geometry of flexible spline elements 22 is radially symmetric about the main axis 89 . that is , the spline elements 22 uniformly radiate from the main axis 89 at generally equal arcuate , or circumferential , intervals . the elements 22 also present a geometry that is axially symmetric along the main axis 89 . that is , when viewed from the side ( as fig1 and 4b show ) the proximal and distal regions of the assembled splines 22 have essentially the same curvilinear geometry along the main axis 89 . of course , if desired , the spline elements 22 can form various other geometries that are either radially asymmetric , or axially asymmetric , or both . in this respect , the axial geometry for the structure 20 , whether symmetric or asymmetric , is selected to best conform to the expected interior contour of the body chamber that the structure 20 will , in use , occupy . for example , the interior contour of a heart ventricle differs from the interior contour of a heart atrium . the ability to provide support structures 20 with differing asymmetric shapes makes it possible to provide one discrete configuration tailored for atrial use and another discrete configuration tailored for ventricular use . examples of asymmetric arrays of spline structures 20 for use in the heart are shown in copending u . s . application ser . no . 08 / 728 , 698 filed oct . 29 , 1996 , entitled &# 34 ; asymmetric multiple electrode support structures ,&# 34 ; which is incorporated herein by reference . as fig5 a shows , the imaging probe 34 located within the support structure 20 includes a flexible body 36 , which extends through a central bore 38 in the catheter tube 12 . the body 36 has a distal region 40 that projects beyond the distal end 16 of the catheter tube 12 into the interior of the support structure 20 . the body 36 also includes a proximal region 42 that carries an auxiliary handle 46 . another conventional hemostatic valve 48 is located at the distal end 16 of the catheter tube 12 to block the backflow of fluid through the catheter tube 12 while allowing the passage of the body 36 . the distal body region 40 carries an image acquisition element 50 , which will be called in abbreviated form the iae . the iae 50 generates visualizing signals representing an image of the area , and objects and tissues that occupy the area , surrounding the structure 20 . the iae 50 can be of various constructions . in one embodiment ( see fig6 ), the iae 50 comprises an ultrasonic transducer 52 . the transducer 52 forms a part of a conventional ultrasound imaging system 54 generally of the type shown in u . s . pat . no . 5 , 313 , 949 . this patent is incorporated herein by reference . the transducer 52 comprises one or more piezoelectric crystals formed of , for example , barium titinate or cinnabar , which is capable of operating at a frequency range of 5 to 20 megahertz . other types of ultrasonic crystal oscillators can be used . for example , organic electrets such as polyvinylidene difluoride and vinylidene fluoride - trifluoro - ethylene copolymers can also be used . the imaging system 54 includes a transmitter 56 coupled to the transducer crystal 52 ( see fig6 ). the transmitter 56 generates voltage pulses ( typically in the range of 10 to 150 volts ) for excitation of the transducer crystal 52 . the voltage pulses cause the transducer crystal 52 to produce sonic waves . as the transmitter 56 supplies voltage pulses to the transducer crystal 52 , a motor 58 rotates the transducer crystal 52 ( being linked by the flexible drive shaft 53 , which passes through a bore in the tube 36 ). the transmission of voltage pulses ( and , thus , the sonic waves ) and the rotation of the transducer crystal 52 are synchronized by a timing and control element 60 . typically , the motor 58 rotates the transducer crystal 52 in the range of 500 to 2000 rpm , depending upon the frame rate of the image desired . the rotating transducer crystal 52 thereby projects the sonic waves in a 360 ° pattern into the interior of the chamber or cavity that surrounds it . tissue , including tissue forming anatomic structures , such as heart valves ( which is generally designated t in the figures ), and internal tissue structures and deposits or lesions on the tissue , scanned by the rotating transducer crystal 52 will scatter the sonic waves . the support structure 20 also scatters the sonic waves . the scattered waves return to the rotating transducer crystal 52 . the transducer crystal 52 converts the scattered waves into electrical signals . the imaging system 54 includes a receiver 57 , which amplifies these electrical signals . the imaging system 54 digitally processes the signals , synchronized by the timing and control element 60 to the rotation of the transducer crystal 52 , using known display algorithms ; for example , conventional radar ( ppi ) algorithms . these algorithms are based upon the direct relationship that elapsed time ( δt ) between pulse emission and return echo has to the distance ( d ) of the tissue from the transducer , expressed as follows : ## equ1 ## where ν is the speed of sound in the surrounding media . the digitally processed signals are supplied to a display unit 59 . the display unit 59 comprises a screen , which can be , for example , a crt monitor . the display screen 59 shows an ultrasound image or profile in the desired format , which depicts the tissue and anatomic structures scanned by the transducer crystal 52 . the display screen 59 can provide a single or multi - dimensional echocardiograph or a non - imaging a - mode display . a control console ( not shown ) may be provided to allow selection by the physician of the desired display format . alternatively , the ultrasonic transducer crystal 52 can be operated in conventional fashion without rotation , as shown in u . s . pat . nos . 4 , 697 , 595 , or 4 , 706 , 681 , or 5 , 358 , 148 . each of these patents is incorporated herein by reference . in another embodiment ( see fig7 ), the iae 50 comprises a fiber optic assembly 62 , which permits direct visualization of tissue . various types of fiber optic assemblies 62 can be used . the illustrated embodiment employs a fiber optic assembly 62 of the type shown in u . s . pat . no . 4 , 976 , 710 , which is incorporated herein by reference . the assembly 62 includes a transparent balloon 64 carried at the end of the body 36 . in use , the balloon 64 is inflated with a transparent gas or liquid , thereby providing a viewing window that shields the fiber optic channels 66 and 68 from blood contact . the channels includes an incoming optical fiber channel 66 , which passes through the body 36 . the channel 66 is coupled to an exterior source 70 of light . the channel 66 conveys lights from the source 70 to illuminate the tissue region around the balloon 64 . the channels also include an outgoing optical fiber channel 68 , which also passes through the body 36 . the channel 68 is coupled to an eye piece 72 , which can be carried , for example , on the handle 46 . using the eye piece 72 , the physician can directly view the illuminated region . the iae 50 can incorporate other image acquisition techniques . for example , the iae 50 can comprise an apparatus for obtaining an image through optical coherence tomography ( oct ). image acquisition using oct is described in huang et al ., &# 34 ; optical coherence tomography ,&# 34 ; science , 254 , nov . 22 , 1991 , pp 1178 - 1181 . a type of oct imaging device , called an optical coherence domain reflectometer ( ocdr ) is disclosed in swanson u . s . pat . no . 5 , 321 , 501 , which is incorporated herein by reference . the ocdr is capable of electronically performing two - and three - dimensional image scans over an extended longitudinal or depth range with sharp focus and high resolution and sensitivity over the range . as shown in fig2 , the iae 50 comprises the distal end 220 of an optic fiber path 222 . the distal end 220 is embedded within an inner sheath 224 , which is carried within an outer sheath 226 . the outer sheath 226 extends in the distal body region 40 , within the support structure 20 . the inner sheath 224 includes a lens 228 , to which the distal fiber path end 220 is optically coupled . the inner sheath 224 terminates in an angled mirror surface 230 , which extends beyond the end of the outer sheath 226 . the surface 230 reflects optical energy along a path that is generally perpendicular to the axis of the distal end 220 . a motor 232 rotates the inner sheath 224 within the outer sheath 226 ( arrow 237 ). the lens 228 and the mirror surface 230 rotate with the inner sheath 224 , scanning about the axis of rotation . a second motor 234 laterally moves the outer sheath 226 ( arrows 236 ) to scan along the axis of rotation ). a source 238 of optical energy is coupled to the optic fiber path 222 through an optical coupler 240 . the source 238 generates optical energy of short coherence length , preferably less than 10 micrometers . the source 238 may , for example , be a light emitting diode , super luminescent diode , or other white light source of suitable wavelength , or a short - pulse laser . a reference optical reflector 242 is also coupled by an optic fiber path 244 to the optical coupler 240 . the optical coupler 240 splits optical energy from the source 238 through the optic fiber path 222 to the distal optic path end 220 and through the optic fiber path 244 to the optical reflector 242 . the optical energy supplied to the distal optic path end 220 is transmitted by the lens 228 for reflection by the surface 230 toward tissue t . the scanned tissue t ( including anatomic structures , other internal tissue topographic features , and deposits or lesions on the tissue ) reflects the optic energy , as will the surrounding support structure 20 . the reflected optic energy returns via the optic path 222 to the optical coupler 240 . the optical energy supplied to the reference optical reflector 242 is reflected back to the optical coupler 240 by a corner - cube retro - reflector 246 and an end mirror 250 ( as phantom lines 239 depict ). the corner - cube retro - reflector 246 is mounted on a mechanism 248 , which reciprocates the corner - cube retro - reflector 246 toward and away from the optical path 244 and an end mirror 250 ( as arrows 241 depict ). the mechanism 248 preferable moves the corner - cube retro - reflector 246 at a uniform , relatively high velocity ( for example , greater than 1 cm / sec ), causing doppler shift modulation used to perform heterodyne detection . the length or extent of movement of the corner - cube retro - reflector 246 caused by the mechanism 248 is at least slightly greater than half the scanning depth desired . the total length of the optical path 222 between the optical coupler 240 up to the desired scanning depth point is also substantially equal to the total length of the optical path 244 between the optical coupler 240 and the end mirror 250 . movement of the corner - cube retro - reflector 246 will cause periodic differences in the reflected path lengths 222 and 244 . reflections received from the optical path 222 ( from the lens 228 ) and the optical path 244 ( from the end mirror 250 ) are received by the optical coupler 240 . the optical coupler 240 combines the reflected optical signals . due to movement of the corner - cube retro - reflector 246 , the combined signals have interference fringes for reflections in which the difference in the reflected path lengths is less than the source coherence length . due to movement of the corner - cube retro - reflector 246 , the combined signals also have an instantaneous modulating frequency . the combined output is coupled via fiber optic path 252 to a signal processor 254 . the signal processor 254 converts the optical output of the coupler 240 to voltage - varying electrical signals , which are demodulated and analyzed by a microprocessor to provide an image output to a display device 256 . further details of image acquisition and processing using ocdr are not essential to an understanding of the invention , but can be found in the above - cited swanson u . s . pat . no . 5 , 321 , 501 . regardless of the particular construction of the iae 50 , the support structure 20 positioned about the distal region of the probe 34 remains substantially in contact against surrounding tissue mass t as the iae 50 operates to acquire the desired image or profile ( see fig5 to 8 ). the support structure 20 serves to stabilize the iae 50 and keep tissue t from contacting and possible occluding the iae 50 . stabilizing the iae 50 is particularly helpful when the geometry of surrounding body chamber or passage 100 is dynamically changing , such as the interior of a heart chamber during systole and diastole . the iae 50 is thereby allowed to visualize tissue and anatomic structures t , without the attendant need for constant positioning and repositioning . the structure 20 thus makes possible the generation of accurate images of the targeted body region by the iae 50 . in a preferred embodiment ( see fig5 a ), the physician can move the iae 50 within the structure 20 forward and rearward ( respectively , arrows 101 and 103 in fig5 a ) by pushing or pulling upon the auxiliary handle 46 . by torquing the handle 46 ( arrows 105 in fig5 a ), the physician may also manually rotate the iae 50 within the structure 20 . the illustrated and preferred embodiment further includes a mechanism 74 for deflecting , or steering , the distal region 40 of the body 36 , and with it the iae 50 , transverse of the axis 89 ( as depicted in phantom lines 40 in fig5 a ). the construction of the steering mechanism 74 can vary . in the illustrated embodiment , the steering mechanism 74 is of the type shown in u . s . pat . 5 , 336 , 182 , which is incorporated by reference . the steering mechanism 74 of this construction includes an actuator 76 in the auxiliary handle 46 . in the illustrated embodiment , the actuator 76 takes the form of a cam wheel rotated by means of an external steering lever 78 . the cam wheel 76 holds the proximal ends of right and left steering wires 80 . the steering wires 80 extend from the cam wheel 76 and through the body 36 . the steering wires 80 connect to the left and right sides of a resilient bendable wire 82 or spring present within the distal region 40 . rotation of the cam wheel 76 places tension on steering wires 80 to deflect the distal region 40 of the body 36 , and , with it , the iae 50 ( as shown by arrows 107 in fig5 a ). thus , the physician can manually move the iae 50 with respect to the structure 20 in three principal directions . first , the iae 50 can be moved along the axis 86 of the structure 20 by pushing and pulling on the auxiliary handle 46 ( arrows 101 and 103 ). second , the iae 50 can be moved rotationally about the axis 86 of the structure 20 by torquing the auxiliary handle 46 ( arrows 105 ). third , the iae 50 can be moved in a direction normal to the axis 86 of the structure 20 by operating the steering mechanism 74 ( arrows 107 ). by coordinating push - pull and torquing movement of the handle 46 with operation of the steering lever 78 , the physician can manually move the iae 50 in virtually any direction and along any path within the structure 20 . the iae 50 can thereby image tissue locations either in contact with the exterior surface of the structure 20 or laying outside the reach of the structure 20 itself . fig9 shows an electro - mechanical system 102 for manipulating the iae 50 within the structure 20 . the system 102 synchronizes the imaging rate of the iae 50 with movement of the iae 50 within the structure 20 . the system allows the physician to use the structure 20 to accurately acquire a set of image slices , which can be processed in an automated fashion for display . the details of the system 102 can vary . as shown in fig9 the system 102 includes a longitudinal position translator 104 mechanically coupled to the probe handle 46 . the translator 104 includes a stepper motor 106 that incrementally moves an axial screw 111 attached to the handle 46 . the motor 106 rotates the screw 111 to move the iae 50 at a specified axial translation rate within the structure 20 , either forward ( arrows 101 ) or rearward ( arrows 103 ). as fig9 shows , during axial translation , the distal body region 40 carrying the iae 50 is preferably maintained in a generally straight configuration , without transverse deflection . by synchronizing the axial translation of the iae 50 within the structure 20 with the imaging rate of the iae 50 , the system 102 provides as output axially spaced , data sample slices of the region surrounding the iae 50 . for example , the use of an axial translator 104 of the general type shown in fig4 in combination with a rotating transducer crystal 52 of the type shown in fig6 is described in u . s . pat . no . 5 , 485 , 846 , which is incorporated herein by reference . by rotating the transducer crystal 52 in synchrony with the axial translation rate of the translator 104 , the system 102 provides axially spaced , 360 ° data sample slices of the region perpendicular to the transducer crystal 52 . conventional signal processing techniques are used to reconstruct the data slices taken at specified intervals along the axis into three - dimensional images for display . this technique is well suited for acquiring images inside blood vessels or other body regions having a known , relatively stable geometry . when used to acquire images inside a beating heart chamber , the stepper motor 106 is preferable gated by a gating circuit 190 ( see fig9 ) to the qrs of an electrocardiogram taken simultaneously with image gathering , for example , by using a surface electrode 188 shown in fig9 . the gating circuit 190 is also synchronized with the imaging system 54 ( as described in greater detail in conjunction with fig6 ), so that the data image slices are recorded in axial increments at either end - diastolic or end - systolic points of the heart beat . when imaging an atrium , the data slice recordings are preferably gated to the p - wave . when imaging a ventricle , the imaging is preferably gated to the r - wave . alternatively , the circuit 190 is gated to the timing of local intracardiac electrogram activation . in this arrangement ( see fig2 ), the flexible body 36 , which carries the transducer 54 within the structure 20 , also carries an electrode 184 to sense electrograms in the region of the structure 20 . the sensed electrograms are conveyed to the circuit 190 to gate the stepper motor 106 , as before described . when imaging an atrium , the data slice recordings are gated to the atrial intracardiac electrogram activation . likewise , when imaging a ventricle , the data slice recordings are gated to the ventricular intracardiac electrogram activation . as fig2 shows , the body 36 carrying the transducer 54 and the electrode 184 is preferably confined for movement within a straight , generally rigid sheath 186 . the sheath 186 guides the body 36 along a known , stable reference axis 183 . the sheath 186 is also preferably constructed of an ultrasonically transparent material , like polyethylene . the transducer 54 and electrode 184 move in tandem within the confines of the sheath 186 ( as shown by arrows 187 and 189 in fig2 ) in response to the gated action of the stepper motor 106 . because the sheath 186 is ultrasonically transparent , the transducer 54 can remain within the confines of the sheath 186 while acquiring images . nonlinearities in image reconstruction caused by deflection of the transducer outside of the axis 183 , as would occur should the transducer 54 move beyond the sheath 186 , are avoided . the acquired data image slices , position - gated by the electrograms while maintained along a known , stable reference axis 183 , are generated for accurate reconstruction into the desired three - dimensional image . alternatively , a catheter tracking system as described in smith et al . u . s . pat . no . 5 , 515 , 853 may be used to track the location and orientation of the iae 50 during movement . another system that can be used for this purpose is disclosed in copending u . s . patent application ser . no . 08 / 717 , 153 , filed sep . 20 , 1996 and entitled &# 34 ; enhanced accuracy of 3 - dimensional intraluminal ultrasound ( ilus ) image reconstruction ,&# 34 ; naming harm tenhoff as an inventor . the structure 20 itself can establish a localized position - coordinate matrix about the iae 50 . the matrix makes it possible to ascertain and thereby guide the relative position of the iae 50 within the structure 20 ( and thus within the targeted body cavity ), to image specific regions within the targeted body cavity . in this embodiment ( see fig1 ), the iae 50 carries an electrode 31 for transmitting electrical energy . likewise , each spline 22 carries an array of multiple electrodes 30 for transmitting electrical energy . in the illustrated embodiment ( see fig1 ), the electrodes 30 are supported about the core body 84 on the flexible , electrically nonconductive sleeve 32 , already described . the electrodes 30 are electrically coupled by wires ( not shown ), which extend beneath the sleeve 32 through the catheter tube 12 to external connectors 32 , which the handle 18 carries ( see fig1 ). in the illustrated embodiment , each electrode 30 comprises a solid ring of conductive material , like platinum , which is pressure fitted about the sleeve 32 . alternatively , the electrodes 30 comprise a conductive material , like platinum - iridium or gold , coated upon the sleeve 32 using conventional coating techniques or an ion beam assisted deposition ( ibad ) process . still alternatively , the electrodes 30 comprise spaced apart lengths of closely wound , spiral coils wrapped about the sleeve 32 . the coils are made of electrically conducting material , like copper alloy , platinum , or stainless steel . the electrically conducting material of the coils can be further coated with platinum - iridium or gold to improve its conduction properties and biocompatibility . further details of the use of coiled electrodes are found in u . s . pat . no . 5 , 545 , 193 entitled &# 34 ; helically wound radio - frequency emitting electrodes for creating lesions in body tissue ,&# 34 ; which is incorporated herein by reference . in yet another alternative embodiment , the electrodes 30 can be formed as part of a ribbon cable circuit assembly , as shown in pending u . s . application ser . no . 08 / 206 , 414 , filed mar . 4 , 1994 , which is incorporated herein by reference . in this arrangement ( see fig1 ), a microprocessor controlled guidance element 108 is electrically coupled to the electrodes 30 on the structure 20 and the electrode 31 carried by the iae 50 . the element 108 conditions the electrodes 30 on the structure 20 and the iae electrode 31 to generate an electric field ( shown in phantom lines 113 in fig1 ) within the structure 20 , while also sensing electrode electric potentials in the electric field . more particularly , the element 108 commands a transmitting electrode , which can be either the iae electrode 31 or at least one of the electrodes 30 in the structure 20 , to transmit electrical energy . the element 108 commands a sensing electrode , which also can be either the iae electrode 31 or at least one of the electrodes 30 on the structure 20 , to sense electrical energy emitted by the emitting electrode . the element 108 generates an output by analyzing spatial variations in the electrical potentials within the field 113 , which change based upon the relative position of the iae electrode 31 relative to electrode 30 on the structure 20 . the variations can comprise variations in phase , variations in amplitude , or both . alternatively , the element 108 generates an output by analyzing spatial variations in impedances between the transmitting and sensing electrodes . the output locates the iae 50 within the space defined by the structure 20 , in terms of its position relative to the position of the multiple electrodes 30 on the structure 20 . the element 108 includes an output display device 110 ( e . g ., a crt , led display , or a printer ), which presents the position - identifying output in a real - time format most useful to the physician for remotely guiding the iae 50 within the structure 20 . further details of establishing a localized coordinate matrix within a multiple electrode structure for the purpose of locating and guiding the movable electrode within the structure are found in copending u . s . patent application ser . no . 08 / 320 , 301 , filed oct . 11 , 1994 and entitled &# 34 ; systems and methods for guiding movable electrode elements within multiple electrode structures .&# 34 ; this application is incorporated herein by reference . in a preferred embodiment ( see fig2 ), structure 20 carries an identification component 270 . the identification component 270 carries an assigned identification code xyz . the code xyz identifies the shape and size of the structure 20 and the distribution of electrodes 30 carried by the structure 20 , in terms of the number of electrodes and their spatial arrangement on the structure 20 . the structure - specific information contained in the code xyz aids the element 108 in creating a positioning matrix using the electrodes 30 , to help guide the iae 50 within the structure 20 . in the illustrated embodiment ( see fig2 ), the coded component 270 is located within the handle 46 attached to the proximal end 14 of the catheter tube 12 that carries the structure 20 . however , the component 270 could be located elsewhere in relation the structure 20 . the coded component 270 is electrically coupled to an external interpreter 278 when the structure 20 is coupled to the element 108 for use . the interpreter 278 inputs the code xyz that the coded component 270 contains . the interpreter 278 electronically compares the input code xyz to , for example , a preestablished master table 280 of codes contained in memory . the master table 280 lists , for each code xyz , the structure - specific information required to create the positioning matrix to guide the iae 50 within the structure 20 . the element 108 preferably includes functional algorithms 288 which set guidance parameters based upon the code xyz . these guidance parameters are used by the signal processing component 274 of the element in analyzing the spatial variations of the electric field created within the structure 20 to guide the iae 150 . the guidance parameters are also used to create the position - identifying output displayed on the device 110 . because knowledge of the physical characteristic of the structure 20 and the spatial relationship of the electrodes 30 is important in setting accurate guidance parameters , the algorithms 288 preferably disable the guidance signal processing component 274 in the absence of a recognizable code xyx . thus , only structures 20 possessing a coded component 270 carrying the appropriate identification code xyz can be used in association with the element 108 to guide the iae 50 . the coded component 270 can be variously constructed . it can , for example , take the form of an integrated circuit 284 ( see fig2 ), which expresses in digital form the code xyz for input in rom chips , eprom chips , ram chips , resistors , capacitors , programmed logic devices ( pld &# 39 ; s ), or diodes . examples of catheter identification techniques of this type are shown in jackson et al . u . s . pat . no . 5 , 383 , 874 , which is incorporated herein by reference . alternatively , the coded component 270 can comprise separate electrical elements 286 ( see fig2 ), each one of which expressing a individual characteristic . for example , the electrical elements 286 can comprise resistors ( r1 to r4 ), comprising different resistance values , coupled in parallel . the interpreter 278 measures the resistance value of each resistor r1 to r4 . the resistance value of the first resistor r1 expresses in preestablished code , for example , the number of electrodes on the structure . the resistance value of the second resistor r2 expresses in preestablished code , for example , the distribution of electrodes on the structure . the resistance value of the third resistor r3 expresses in preestablished code , for example , the size of the structure . the resistance value of the fourth resistor r4 expresses in preestablished code , for example , the shape of the structure . alternatively , the electrodes 30 / 31 can define passive markers that , in use , do not transmit or sense electrical energy . the markers are detected by the physician using , for example , external fluoroscopy , magnetic imaging , or x - ray to establish the location of the structure 20 and the iae 50 . the stability and support that the structure 20 provides the iae 50 is well suited for use in association with an iae 50 having one or more phased array transducer assemblies . the stability and support provided by the structure 20 make it possible to accommodate diverse numbers and locations of phased array transducers in close proximity to tissue , to further enhance the resolution and accuracy of images created by the iae 50 . in one embodiment , as fig2 shows , the structure 20 carries an iae 50 comprising a phased array 192 of ultrasonic transducers of the type shown , for example , in shaulov u . s . pat . no . 4 , 671 , 293 , which is incorporated herein by reference . as fig2 shows , the array 192 includes two groups 194 and 196 of electrodes . the electrode groups 194 and 196 are differently partitioned by channels 206 on opposite faces or planar sectors 194 &# 39 ; and 196 &# 39 ; of a piezoelectric material 198 . the channels 206 cut through the electrode surfaces partially into and through the piezoelectric material 198 to prevent mechanical and electrical coupling of the elements . the channels 206 on the planar section 194 &# 39 ; create spaced transducer elements 202a , 202b , 202c , etc . likewise , the channels 206 on the planar section 196 &# 39 ; create spaced transducer elements 204a , 204b , 204c , etc . the electrode groups 194 and 196 are alternatively pulsed by a conventional phase array circuit 200 . during one pulse cycle , the electrode element group 194 is grounded , while the transducer elements 204a , 204b , 204c , etc . on the other planar section 196 &# 39 ; are simultaneously pulsed , with the phase relationship of the stimulation among the transducer elements 204a , 204b , 204c , etc . set to create a desired beam angle , acquiring an image along the one planar sector 196 &# 39 ;. during the next pulse cycle , the other electrode element group 196 is grounded , while the transducer elements 202a , 202b , 202c , etc . on the other planar section 194 &# 39 ; are likewise simultaneously pulsed , acquiring another image along the planar sector 194 &# 39 ;. further details , not essential to the invention , are provided in haykin , adaptive filter theory , prentice - hall , inc . ( 1991 ), pp . 60 to 65 . the signals received by the transducer groups 202a , 202b , 202c , etc . and 204a , 204b , 204c , etc ., when pulsed , are processed into amplitude , phase , frequency , and time response components . the processed signals are compared to known configurations with varying transducers activated to produce and measure the desired waveform . when signals from combinations of transducers are processed , a composite image is produced . the phased array 192 shown in fig2 permits the real time imaging of two different planar sectors , which can be at any angle with respect to each other . fig2 and 24 show other embodiments of an iae 50 comprising a phased array of transducers carried within the structure 20 . in the embodiment shown in fig2 , the iae 50 comprises an array of flexible spline elements 208 having a known geometry . the spline elements 208 are carried within the support structure 20 , which itself comprises a larger diameter array of flexible spline elements 22 , as previously discussed in conjunction with fig1 . each flexible spline element 208 carries a grouping of multiple ultrasonic transducers 210 . collapsing the outer structure 20 of spline elements 22 by advancing the sheath 44 ( previously described and shown in fig1 and 2 ) also collapses the inner iae structure of spline elements 208 . the mutually collapsed geometry presents a low profile allowing joint introduction of the structures 22 and 208 into the desired body region . in the embodiment shown in fig2 , the iae 50 comprises an expandable - collapsible body 212 carried within the support structure 20 . again , the structure 20 is shown as comprising the array of flexible spline elements 22 . like the flexible spline elements 208 shown in fig2 , the exterior surface of the body 212 carries an array of multiple ultrasonic transducers 210 . an interior lumen 214 within the body 216 carrying the iae 50 conducts a fluid under pressure into the interior of the body 212 ( as shown by arrows 213 in fig2 ) to inflate it into a known expanded geometry for use . in the absence of the fluid , the body 212 assumes a collapsed geometry ( not shown ). the advanced sheath 44 envelopes the collapsed body 212 , along with the outer structure 20 , for introduction into the desired body region . in the illustrated embodiment , the ultrasonic transducers 210 are placed upon the spline elements 208 or expandable body 212 ( which will be collectively called the &# 34 ; substrate &# 34 ;) by depositing desired transducer materials or composites thereof onto the substrate . ion beam assisted deposition , vapor deposition , sputtering , or other methods can be used for this purpose . to create a spaced apart array of transducers 210 , a masking material is placed on the substrate to keep regions free of the deposited material . removal of the masking material after deposition of the transducer materials provides the spaced apart array on the substrate . alternatively , an etching process may be used to selectively remove sectors of the transducer material from the substrate to form the desired spaced apart array . the size of each deposited transducer 210 and the density of the overall array of transducers 210 should be balanced against the flexibility desired for the substrate , as conventional transducer material tends to be inherently stiffer than the underlying substrate . alternatively , transducers 210 can be attached in a preformed state by adhesives or the like to the spline elements 208 or flexible body 212 . again , the size of each attached transducer 210 and the density of the overall array of transducers 210 should be balanced against the flexibility desired for the substrate . signal wires may be coupled to the transducers 210 in various ways after or during deposition or attachment ; for example by soldering , or by adhesive , or by being deposited over . various other ways to couple signal wires to solid or deposited surfaces on an expandable - collapsible body are discussed in copending patent application ser . no . 08 / 629 , 363 , entitled &# 34 ; enhanced electrical connections for electrode structures ,&# 34 ; filed apr . 8 , 1996 , which is incorporated herein by reference . the signal wires may be bundled together for passage through the associated catheter tube 12 , or housed in ribbon cables for the same purpose in the manner disclosed in kordis u . s . pat . no . 5 , 499 , 981 , which is incorporated herein by reference . it should be appreciated that the multiple ultrasonic transducers 210 could be supported on other types of bodies within the structure 20 . for example , non - collapsible hemispherical or cylindrical bodies , having fixed predetermined geometries , could occupy the interior of the structure 20 for the purpose of supporting phased arrays of ultrasonic transducers 210 . alternatively , the signal wires and transducers may be braided into a desired three - dimensional structure . the braided structure may further be laminated to produce an inflatable balloon - like structure . the dimensions of these alternative transducer support bodies can vary , subject to the requirement of accommodating introduction and deployment in an interior body region . other examples of phased arrays of multiple transducers are found , for example , in griffith et al . u . s . pat . no . 4 , 841 , 977 and proudian et al . u . s . pat . no . 4 , 917 , 097 . phased arrays of multiple transducers may be used in association with gating techniques , described above in conjunction with fig9 to lessen the image acquisition time . in the dynamic environment of the heart , gating may be used to synchronize the phased acquisition of multiple plane images with the qrs or intracardiac electrogram activation , particularly if it is desired to analyze the images over more than one heart beat . as just shown ( see fig1 ) and described , the structure 20 can carry an array of electrodes 30 for the purpose of guiding the iae 50 . these same electrodes 30 can also serve to sense electrical impulses in tissue , like myocardial tissue . this sensing function in heart tissue is commonly called &# 34 ; mapping .&# 34 ; as fig1 shows , when deployed for use inside a heart chamber , the support structure 20 holds the electrodes 30 in contact against the endocardium . the electrodes sense the electrical impulses within the myocardium that control heart function . in this arrangement the element 108 includes or constitutes an external signal processor made , for example , by prucka engineering , inc . ( houston , tex .). the processed signals are analyzed to locate aberrant conductive pathways and identify foci . the foci point to potential ablation sites . alternatively , or in combination with mapping , the electrodes 30 on the support structure 20 can be used to derive an electrical characteristic , such as impedance , in heart tissue for the purpose of characterizing tissue and locating aberrant conductive pathways . systems and methods for deriving an electrical characteristic of tissue for this purpose are disclosed , for example , in panescu et al u . s . pat . no . 5 , 494 , 042 , which is incorporated herein by reference . an electrical characteristic is derived by transmitting electrical energy from one or more electrodes into tissue and sensing the resulting flow of electrical energy through the tissue . the iae 50 carried within the multiple electrode structure 20 greatly assists the physician in mapping or characterizing tissue , whether in the heart or elsewhere in the body , by locating the electrodes 30 in the desired orientation with respect to selected anatomic sites . for example , when used within the heart , the physician can manipulate the iae 50 in the manners previously described to visual identify the coronary sinus , heart valves , superior and inferior vena cava , the fossa ovalis , the pulmonary veins , and other key anatomic sites in the heart . relying upon the visual information obtained by the iae 50 , the physician can then orient the multiple electrode structure 20 with respect to one or more of these anatomic sites . once properly oriented , the physician can further visualize with the iae 50 , to assure that all or a desired number of the electrodes 30 carried by the structure 20 are in intimate contact with tissue required for good signal transmission or good signal acquisition . as fig1 shows , the iae 50 can also be used to help visually steer a separate mapping electrode 112 , carried on its own catheter tube 121 , outside or within the support structure 20 into the desired location in contact with heart tissue . if the roving electrode 112 is present within the confines of the support structure 20 , the structure 20 also serves to stabilize the electrode 112 . the guidance processing element 108 as previously described ( see fig1 ) can be used in association with the structure 20 to electronically home the external mapping electrode 112 to a desired location within the structure 20 . fig8 shows a system 170 that includes the structure 20 carrying an iae 50 to identify perfusion patterns in myocardial tissue and , thereby , diagnose potential ablation sites within the heart . in this embodiment , the iae 50 carried within the structure 20 comprises a rotating ultrasonic transducer 52 of the type previously described in conjunction with fig6 . the system 170 shown in fig8 also preferably includes an electro - mechanical system 102 for incrementally moving the transducer 52 within the structure 20 to obtain axially spaced , data sample slices of the region surrounding the transducer 52 . the details of this the system 102 have been previously described in conjunction with fig9 . the electro - mechanical system 102 may also be gated to the qrs of an electrocardiogram or to intracardiac electrogram activation to acquire images at either end - diastolic or end - systolic points of the heart cycle , in the manner also previously described in conjunction with fig9 or 21 . the system 170 shown in fig8 includes a separate catheter 172 . the catheter 172 includes an interior lumen 174 , which is coupled to a source of an echoluscient contrast media 176 . the catheter 172 injects the media 176 into the blood stream . the echoluscient contrast media 176 used may vary . in a preferred embodiment , the media 176 comprises sonicated albumin microbubbles , or their equivalent , having a diameter smaller than red blood cells ( which are typically about 8 μm ). when carried within the blood stream , the microbubbles in the media 176 are perfused into tissue , just as the blood components that accompany them . the microbubbles in the media 176 , perfused into tissue , strongly scatter ultrasonic waves . they appear ultrasonically &# 34 ; bright &# 34 ; in contrast to the less ultrasonically &# 34 ; bright &# 34 ; cellular components of blood also perfused into tissue . the physician is thereby able to accurately observe the patterns of perfusion of the media 176 into tissue . the more volume of media 176 perfused into tissue , the brighter the ultrasonic image , and vice versa . myocardial tissue that has been infarcted has significantly lower perfusion characteristics than healthy myocardial tissue . see , for example , nath et al ., &# 34 ; effects of radiofrequency catheter ablation on regional myocardial blood flow ,&# 34 ; circulation , 1994 ; 89 : 2667 - 2672 ; and villaneuva et al ., &# 34 ; assessment of risk area during coronary occlusion and infarct size after reperfusion with myocardial contrast echocardiography using left and right atrial injections of contrast ,&# 34 ; circulation , 1993 ; 88 : 596 - 604 ). as fig8 shows , the catheter 172 is preferably maneuvered percutaneously into a selected coronary vessel . the contrast media 176 is injected through the catheter lumen 174 into the vessel , and thus into the vascular system near the heart . if the selected vessel is the coronary artery , the media 176 is distributed throughout the regions of the heart perfused by the coronary artery , increasing the resolution and contrast in a selected localized region . more global distribution of contrast media 176 can be obtained by selecting an injection site in one of the heart chambers or in the pulmonary artery . for example , if myocardial tissue in the basil or posterio - lateral aspect of the left ventricle is slated for diagnosis , the catheter 172 is preferably maneuvered to inject the media 176 into the circumflex . coronary artery branch of the left main artery . if myocardial tissue in the anterior aspect of the right or left ventricles is slated for diagnosis , the catheter 172 is preferably maneuvered to inject the media 176 into the left anterior descending ( lad ) coronary artery branch of the left main artery . if myocardial tissue in the free wall of the right ventricle or the posterior ventricular septum is slated for diagnosis , the catheter 172 is preferably maneuvered to inject the media 176 into the right coronary artery . alternatively , the media 176 can be injected directly into the left atrium or left ventricle . in this arrangement , the body 36 carrying the transducer 52 can also include an interior lumen 178 to convey the media 176 . this approach may be easier and potentially less traumatic than injection directly into the coronary artery . however , a portion of the media 176 will still be dispersed past the coronary arteries and through the systemic arterial system , thereby resulting in a poorer resolution per given volume of media 176 injected . therefore , a larger volume of media 176 should be injected directly into the left atrium or ventricle to obtain contrast in myocardial tissue comparable to a smaller volume of media 176 injected directly into a coronary artery , as described above . furthermore , contrast media 176 may be injected systemically into the femoral vein . again , with this approach , significant portions of the media 176 will be disbursed within the circulatory system , and , in particular , into the lungs . as just discussed , a larger volume of media 176 should be injected systemically into the femoral vein to obtain contrast in myocardial tissue comparable to a smaller volume of media 176 injected directly into a coronary artery . the system 170 includes a receiver and processor 180 and display device 182 , as earlier described in conjunction with fig6 . in synchrony with the axial translation system 102 , the receiver and processor 180 preferably creates a three - dimensional image for display on the device 182 . alternatively , an echocardiographic image may be created for display without using the axial translation system 102 . the contrast media 176 highlights the differences in perfusion in myocardial tissue surrounding the structure 20 . regions of infarcted tissue are visually characterized , as they are not well perfused with blood and appear in negative contrast to the healthy tissue regions that are well perfused . the same visually characterized , negative contrast regions of infarcted tissue may also form part of the pathways of slow conduction of electrical impulses . these slow conduction pathways may be a substrate for ventricular tachycardia and therefore candidates for cardiac ablation . these candidate regions of slow conduction pathways will , in the presence of the contrast media 186 , appear on the ultrasonic device 182 as zones of negative contrast , being significantly less ultrasonically &# 34 ; bright &# 34 ; than well perfused tissue regions . the candidate regions of slow conduction will typically have infarcted tissue interspersed with well perfused tissue . the candidate regions will therefore appear ultrasonically &# 34 ; mottled &# 34 ;, with patchy regions of darker contrast interspersed with lighter contrast . the mottled zones will appear contiguous to negative contrast areas . the image resolution of the device 182 should preferably be fine enough to discern among mottled zones , light contrast zones , and dark contrast zones . the support structure 20 maintains the transducer 54 in a stable , substantially unobstructed viewing position near the targeted tissue region . the transducer 54 thereby generates ultrasonic images of the differences in perfusion of the media 176 throughout the imaged heart tissue . the system 170 therefore make possible the accurate characterization of tissue for identifying potential ablation sites using contrast echocardiography . in addition to identifying candidate ablation sites , the stable , unobstructed perfusion images that the system 170 provides , also make it possible to discern the lesion characteristic required to treat the arrhythmia . the perfusion pattern may indicate a localized , contained mottled contrast area , suited for treatment by creating an equally localized , small surface area lesion . alternatively , the perfusion pattern may indicate a larger or deeper mottled contrast area , or a mottled contrast area that is elongated or a random complex of different , intersecting geometries . these instances give rise to the need for corresponding larger or deeper lesion patterns , or long or intersecting legion patterns , or lesion patterns otherwise having geometries tailored to the geometry of the mottled contrast area . the stable , unobstructed perfusion images that the system 170 provides also make it possible to characterize tissue substrates associated with polymorphic ventricular tachycardia . the system 170 makes it possible to characterized these regions using echocardiography during normal sinus rhythm . conventional mapping of electrical events requires induction of sometimes hemodynamically unstable rhythms to locate and ablate substrates associated with polymorphic ventricular tachycardia . the stable , unobstructed perfusion images that the system 170 provides also make it possible to discern intermediate contrast zones between &# 34 ; bright &# 34 ; ( well perfused tissue ) images and negative contrast ( not well perfused , infarcted tissue ) images . these intermediate contrast zones also delineate the infarcted tissue border . once identified , tissue ablation can be conducted with the objective of ablating tissue within the border zone , to eliminate the potential for ventricular tachycardia substrates . the system 170 may characterize tissue morphology based upon echocardiography to locate potential ablation sites in other ways . for example , the system 170 may image based upon ultrasonic frequency domain analyses . for example , the intensity of the second harmonics can be used to identify tissue morphologies such as scar tissue , ischemic tissue , infarcted tissue , and healthy tissue as a function of tissue elasticity . frequency domain analyses like second harmonics may be used without the injection of contrast media 170 to characterize tissue for ablation purposes . the system 170 for carrying out contrast echocardiography may also incorporate an iae 50 comprising multiple transducers and using phased array techniques to enhance the perfusion images , as previously described in conjunction with fig2 to 24 . fig8 shows the system 170 being used in association with intracardiac echocardiography . it should also be appreciated that the echocardiography can be used to characterize tissue morphology , and thereby identify potential ablation sites , using external ultrasound transducers located outside the body . it should also be appreciated that the system 170 can be used as an adjunct to other echography procedures ; for example , transesophageal or transthoracic echography . the analysis of tissue perfusion patterns to characterize myocardial tissue to locate potential ablation sites can also be accomplished using external imaging techniques other than echography . for example , magnetic resonance imaging ( mri ) can be used . using mri , an isotope , such as gadolinium - chelate , is injected to serve as the contrast material . as another example , computerized tomography ( ct ) scanning can be used . using ct , iodine radiopaque compounds , such as renografin , can be injected to serve as the contrast material . as another example , nuclear imaging using thallium as the contrast material can be used . using any of these alternative imaging techniques , slow conduction pathways in myocardial tissue will , in the presence of the appropriate contrast media , appear as zones of negative or mottled contrast . as before discussed , the image resolution of the alternative technique should preferably be fine enough to discern among mottled zones , light contrast zones , and dark contrast zones . the alternative imaging techniques , like echography , can also be used to discern intermediate contrast zones , which delineate infarcted tissue borders . the foregoing description of the structure 20 and associated iae 50 exemplify use in the performance of general diagnostic functions , to accurately locate and identify abnormalities that may be present in body cavities or in electrical activities within tissue . the structure 20 and associated iae 50 can also aid in providing therapeutic functions , alone or in combination with these and other diagnostic functions . the following exemplifies this use in the context of treating cardiac arrhythmias . however , it will be appreciated that there are diverse applications where the invention can serve therapeutic functions or both diagnostic and therapeutic functions . once a potential ablation site has been identified by mapping ( typically , in the ventricle ), or by reference to an anatomic landmark within the heart ( typically , in the atrium ), or by deriving an electrical characteristic , the physician deploys an ablation element to the site . while various types of ablation energy can be used , in the preferred implementation , the ablation electrode transmits radio frequency energy conveyed from an external generator ( not shown ). the ablation element can takes various forms , depending upon the type of lesion required , which , in turn , depends upon the therapeutic effect desired . typically , lesions that are characterized as &# 34 ; small and shallow &# 34 ; have a depth of about 0 . 5 cm , a width of about 10 mm , and a lesion volume of up to 0 . 2 cm 3 . fig1 exemplifies the geometry for a typical &# 34 ; small &# 34 ; lesion 118 . these lesions are desired in the sinus node for sinus node modifications , or along the a - v groove for various accessory pathway ablations , or along the slow zone of the tricuspid isthmus for atrial flutter ( afl ) or av node slow pathways ablations . for this purpose , a physician will typically deploy an electrode having approximately an 8 f diameter and a 4 mm length to transmit radio frequency energy to create small and shallow lesions in myocardial tissue . this type of ablation electrode can be used in association with the support structure 20 , even when the catheter tube bore is occupied by the imaging probe 34 . in this arrangement ( see fig1 ), the physician separately deploys the ablation electrode as a &# 34 ; roving &# 34 ; electrode 112 outside the support structure 20 . the physician then steers the external electrode 112 into the confines of the support structure 20 for ablation ( such an electrode 112 can also perform an auxiliary mapping function , as already described ). usually , the electrode 112 is preferably operated in a uni - polar mode during ablation , in which the radio frequency ablation energy transmitted by the electrode 112 is returned through an indifferent patch electrode 114 externally attached to the skin of the patient . the support structure 20 serves to stabilize the external &# 34 ; roving &# 34 ; ablation electrode 112 within a confined region of the heart . the iae 50 can be used in this arrangement to help visually navigate the roving ablation electrode 112 into the desired location in contact with heart tissue . the guidance processing element 108 as previously described ( see fig1 ) can also be used in association with the structure 20 to electronically home the roving ablation electrode 112 to the desired ablation site contacting the support structure 20 . alternatively ( as fig5 and 10 show ), the electrode 31 that the iae 50 carries can comprise an ablation electrode , in the manner shown in u . s . pat . no . 5 , 385 , 148 , which is incorporated herein by reference . the exterior diameter of the iae 50 ( with electrode 31 ) is preferably larger than the interior diameter of the catheter tube bore 38 ( see fig5 a ). thus , while the iae 50 ( and electrode 31 ) can be freely moved within the structure 20 in the manner already described , it cannot be withdrawn into the catheter tube bore . in this arrangement , the slidable sheath 44 that encloses the structure 20 during deployment ( see fig2 ), also encloses the iae 50 and ablation element 31 within the collapsed structure 20 . further details of a structure integrating a movable element within a multiple electrode support structure can be found in u . s . pat . no . 5 , 476 , 495 , which is incorporated herein by reference . as before explained , the guidance processing element 108 ( fig1 ) can also create a position - identifying output in a real - time format most useful to the physician for guiding the ablation electrode 31 carried by the iae 50 within the structure 20 toward a potential site identified for ablation . in an alternative embodiment , the exterior diameter of the iae 50 ( with electrode 31 ) is smaller than the interior diameter of the catheter tube bore 38 . the iae 50 and the entire imaging probe 34 can thereby be withdrawn through the catheter tube bore 38 from the catheter tube 12 . in this arrangement , the catheter tube 12 carrying the multiple electrode support structure 20 and the imaging probe 34 comprise separately deployed components . the imaging probe 34 is deployed through the catheter tube 12 only when the visualization function is required . when the imaging probe 34 is withdrawn , the catheter tube bore 38 is open to provide passage for other components ; for example , the separate mapping or ablation electrode 112 shown in fig1 . in this arrangement , the imaging probe 34 can be switched in situ with the mapping or ablation electrode 112 , without altering the position of the structure 20 . the elimination of ventricular tachycardia ( vt ) substrates is thought to require significantly larger and deeper lesions , with a penetration depth greater than 1 . 5 cm , a width of more than 2 . 0 cm , with a lesion volume of at least 1 cm 3 . there also remains the need to create lesions having relatively large surface areas with shallow depths . fig1 exemplifies the geometry of a typical larger surface area lesion 120 , compared to the geometry of the smaller lesion 118 shown in fig1 . fig1 a and 13b show an alternative embodiment of the invention , which provides a composite structure 122 carrying an imaging probe 124 and an ablation element 126 , which is capable of providing larger lesions . the composite structure 122 ( like structure 20 shown in fig1 ) is carried at the distal end of a flexible catheter tube 12 . the proximal end of the catheter tube carries an attached handle 18 for manipulating the composite structure in the manners previously described . the composite structure 122 comprises an expandable - collapsible hollow body 128 made from a porous transparent thermoplastic or elastomeric material . the size of the pores 129 in the body 128 are exaggerated for the purpose of illustration in fig1 a . the entire body 128 may be porous , or the body 128 may include a discrete porous region . the body 128 carries within it an interior electrode 130 , which is formed of an electrically conductive material that has both a relatively high electrical conductivity and a relatively high thermal conductivity . materials possessing these characteristics include gold , platinum , platinum / iridium , among others . noble metals are preferred . an insulated signal wire 132 is coupled to the electrode 130 , which electrically couples the electrode 130 to an external radio frequency generator 134 . an interior lumen 136 within the catheter tube 12 conducts an electrically conductive liquid 140 under pressure from an external source 138 into the hollow interior of the expandable - collapsible body 128 . as fig1 a shows , the electrically conductive liquid 140 inflates the body 128 to an enlarged , or expanded , geometry . as will be explained later , it is this expanded geometry that makes possible the formation of the larger lesions desired . as fig1 b shows , in the absence of the fluid 140 , the expandable - collapsible body 128 assumes a collapsed , low profile . it is this low profile that permits straightforward introduction of the structure 122 into the body . when radio frequency energy is transmitted by the interior electrode 130 , the electrically conductive liquid 140 within the body 128 establishes an electrically conductive path . the pores of the porous body 128 establish ionic transport of ablation energy from the electrode 130 , through the electrically conductive liquid 140 , to tissue outside the body . the paths of ionic transport are designated by arrows 142 in fig1 a . preferably , the liquid 140 possesses a low resistivity to decrease ohmic loses , and thus ohmic heating effects , within the body 128 . the composition of the electrically conductive liquid 140 can vary . in the illustrated and preferred embodiment , the liquid 140 comprises a hypertonic saline solution , having a sodium chloride concentration at or near saturation , which is about 9 % weight by volume . hypertonic saline solution has a low resistivity of only about 5 ohm · cm , compared to blood resistivity of about 150 ohm · cm and myocardial tissue resistivity of about 500 ohm · cm . alternatively , the composition of the electrically conductive liquid 140 can comprise a hypertonic potassium chloride solution . this medium , while promoting the desired ionic transfer , requires closer monitoring of the rate at which ionic transport 142 occurs through the pores , to prevent potassium overload . when hypertonic potassium chloride solution is used , it is preferred to keep the ionic transport rate below about 10 meq / min . the imaging probe 124 is also located within the body 128 . as before described , the probe 124 includes a flexible body 36 , which extends through a central bore 38 and a hemostatic valve ( not shown ) at the distal end of the catheter tube 12 . the body 36 has a distal region 40 that projects beyond the distal end 16 of the catheter tube 12 into the interior of the support structure 20 . the distal body region 40 carries an iae 150 , which is sealed from the surrounding liquid 140 , for example , within a housing . like iae 50 before described , the iae 150 generates visualizing signals representing an image of objects surrounding the body 128 . as before explained in conjunction with fig5 a , the iae 150 is preferably carried for forward and rearward movement by pushing or pulling upon the body 36 . the iae 150 is also preferably movable transverse of the body axis by the provision of a steering mechanism 76 in the distal region 40 , as already described . the iae 150 can be variously constructed , depending upon the transparency of the body 128 to imaging energy . for example , if the body 128 is transparent to optical energy , the iae 150 can comprise a fiber optic channel , as already generally described ( see fig7 or fig2 ). regenerated cellulose membrane materials , typically used for blood oxygenation , dialysis , or ultrafiltration , can be made to be optically transparent . regenerated cellulose is electrically non - conductive ; however , the pores of this material ( typically having a diameter smaller than about 0 . 1 μm ) allow effective ionic transport 142 in response to the applied rf field . at the same time , the relatively small pores prevent transfer of macromolecules through the body 128 , so that pressure driven liquid perfusion through the pores 129 is less likely to accompany the ionic transport 142 , unless relatively high pressure conditions develop within the body 128 . regenerated cellulose is also transparent to ultrasonic energy . the iae 50 can thus alternatively comprise an ultrasonic transducer crystal , as also already described ( see fig6 ). other porous materials , which are either optically transparent or otherwise transparent to the selected imaging energy , can be used for the body 128 . candidate materials having pore sizes larger than regenerated cellulous material , such as nylon , polycarbonate , polyvinylidene fluoride ( ptfe ), polyethersulfone , modified acrylic copolymers , and cellulose acetate , are typically used for blood microfiltration and oxygenation . porous or microporous materials may also be fabricated by weaving a material ( such as nylon , polyester , polyethylene , polypropylene , fluorocarbon , fine diameter stainless steel , or other fiber ) into a mesh having the desired pore size and porosity . these materials permit effective passage of ions in response to the applied rf field . however , as many of these materials possess larger pore diameters , pressure driven liquid perfusion , and the attendant transport of macromolecules through the pores , are also more likely to occur at normal inflation pressures for the body 128 . considerations of overall porosity , perfusion rates , and lodgment of blood cells within the pores of the body 128 must be taken more into account as pore size increase . low or essentially no liquid perfusion through the porous body 128 is preferred . limited or essentially no liquid perfusion through the porous body 128 is beneficial for several reasons . first , it limits salt or water overloading , caused by transport of the hypertonic solution into the blood pool . this is especially true , should the hypertonic solution include potassium chloride , as observed above . furthermore , limited or essentially no liquid perfusion through the porous body 128 allows ionic transport 142 to occur without disruption . when undisturbed by attendant liquid perfusion , ionic transport 142 creates a continuous virtual electrode at the body 128 - tissue interface . the virtual electrode efficiently transfers rf energy without need for an electrically conductive metal surface . as shown in fig1 a , the porous body 128 serves a dual purpose . like the structure 20 , the porous body 128 keeps open the interior chamber or passages within the patient &# 39 ; s body targeted for imaging , while at the same time keeping tissue t away from potential occluding contact with the iae 150 . the body 128 also helps to stabilize the position of the iae 50 . in these ways , the body 128 , like the support structure 20 , provides a substantially stationary platform for visualizing tissue and anatomic structures for diagnostic purposes , making possible the creation of an accurate image of the targeted body cavity . furthermore , through the ionic transfer 142 of the rf field generated within the body 128 , the porous body 128 also serves the therapeutic function as a tissue ablation element . the use of a porous body 128 , expanded after introduction to an enlarged diameter ( see fig1 a ), makes possible the creation of larger lesions in a controlled fashion to ablate epicardial , endocardial , or intramural vt substrates . by also controlling the porosity , and thus the electrical resistivity of the body 128 , the physician can significantly influence the depth of the lesion . the use of a low - resistivity body 128 results in deeper lesions , and vice versa . further details of the use of porous bodies to deliver ablation energy through ionic transport are found in copending u . s . patent application ser . no . 08 / 631 , 356 , filed apr . 12 , 1996 and entitled &# 34 ; tissue heating and ablation systems and methods using electrode structures with distally oriented porous regions ,&# 34 ; which is incorporated herein by reference . in an alternative embodiment , the porous body 128 and iae 150 can themselves occupy the interior of a multiple spline support structure 146 , as shown in fig1 . in this arrangement , the exterior multiple spline structure 146 provides added stabilization and protection for the porous body and iae 150 . as shown in fig1 , the multiple spline support structure 146 may also carry an array of electrodes 148 . these electrodes 148 can be used for mapping or characterizing tissue or for guidance of the interior porous ablation body and iae 150 , in the manners previously described . atrial geometry , atrial anisotropy , and histopathologic changes in the left or right atria can , alone or together , form anatomic obstacles . the obstacles can disrupt the normally uniform propagation of electrical impulses in the atria , resulting in abnormal , irregular heart rhythm , called atrial fibrillation . u . s . patent application ser . no . 08 / 566 , 291 , filed dec . 1 , 1995 , and entitled &# 34 ; systems and methods for creating complex lesion patterns in body tissue &# 34 ; discloses catheter - based systems and methods that create complex long lesion patterns in myocardial tissue . in purpose and effect , the systems and methods emulate the open heart maze procedure , but do not require costly and expensive open heart surgery . these systems and methods can be used to perform other curative procedures in the heart as well . the multiple spline support structure 152 shown in fig1 is well suited for therapeutic use in the atrial regions of the heart . in fig1 , a transeptal deployment is shown , from the right atrium ( ra ), through the septum ( s ), into the left atrium ( la ), where the support structure 152 is located for use . the longitudinal splines 154 carry an array of electrodes 156 . the electrodes 156 serve as transmitters of ablation energy . an iae 50 , as previously described , is movably carried within the interior of the structure 152 . the electrodes 156 are preferably operated in a uni - polar mode , in which the radio frequency ablation energy transmitted by the electrodes 156 is returned through an indifferent patch electrode 158 externally attached to the skin of the patient . alternatively , the electrodes 156 can be operated in a bi - polar mode , in which ablation energy emitted by one or more electrodes 156 is returned an adjacent electrode 156 on the spline 154 . the size and spacing of the electrodes 156 shown in fig1 are purposely set for creating continuous , long lesion patterns in tissue . fig1 shows a representative long , continuous lesion pattern 160 , which is suited to treat atrial fibrillation . continuous , long lesion patterns 160 are formed due to additive heating effects when rf ablation energy is applied in a uni - polar mode simultaneously to the adjacent electrodes 156 , provided the size and spacing requirements are observed . the additive heating effects cause the lesion pattern 160 to span adjacent , spaced apart electrodes 156 , creating the desired elongated geometry , shown in fig1 . the additive heating effects will also occur when the electrodes 156 are operated simultaneously in a bipolar mode between electrodes 156 , again provided the size and spacing requirements are observed . the additive heating effects between spaced apart electrodes 156 intensify the desired therapeutic heating of tissue contacted by the electrodes 156 . the additive effects heat the tissue at and between the adjacent electrodes 156 to higher temperatures than the electrodes 156 would otherwise heat the tissue , if conditioned to individually transit energy to the tissue , or if spaced apart enough to prevent additive heating effects . when the spacing between the electrodes 156 is equal to or less than about 3 times the smallest of the diameters of the electrodes 156 , the simultaneous emission of energy by the electrodes 156 , either bipolar between the segments or unipolar to the indifferent patch electrode , creates the elongated continuous lesion pattern 160 shown in fig1 due to the additive heating effects . conversely , when the spacing between the electrodes 156 is greater than about 5 times the smallest of the diameters of the electrodes 156 , the simultaneous emission of energy by the electrodes 156 , either bipolar between segments or unipolar to the indifferent patch electrode , does not generate additive heating effects . instead , the simultaneous emission of energy by the electrodes 156 creates an elongated segmented , or interrupted , lesion pattern 162 in the contacted tissue area , as shown in fig2 . alternatively , when the spacing between the electrodes 156 along the contacted tissue area is equal to or less than about 2 times the longest of the lengths of the electrodes 156 , the simultaneous application of energy by the electrodes 156 , either bipolar between electrodes 156 or unipolar to the indifferent patch electrode , also creates an elongated continuous lesion pattern 160 ( fig1 ) due to additive heating effects . conversely , when the spacing between the electrodes 156 along the contacted tissue area is greater than about 3 times the longest of the lengths of the electrodes 156 , the simultaneous application of energy , either bipolar between electrodes 156 or unipolar to the indifferent patch electrode , creates an elongated segmented , or interrupted , lesion pattern 162 ( fig2 ). in an alternative embodiment ( see fig1 ), the assembly includes periodic bridge splines 164 . the bridge splines 164 are soldered or otherwise fastened to the adjacent longitudinal splines 154 . the bridge splines 164 carry electrodes 166 , or are otherwise made to transmit ablation energy by exposure of electrically conductive material . upon transmission of ablation energy , the bridge splines 166 create long transverse lesion patterns 168 ( see fig1 ) that span across the long longitudinal lesion patterns 160 created by the adjacent splines 154 . the transverse lesions 168 link the longitudinal lesions 160 to create complex lesion patterns that emulate the patterns formed by incisions during the surgical maze procedure . further details of the creation of complex long lesion patterns in the treatment of atrial fibrillation are found in copending u . s . application ser . no . 08 / 566 , 291 , filed dec . 1 , 1995 , and entitled &# 34 ; systems and methods for creating complex lesion patterns in body tissue ,&# 34 ; which is incorporated herein by reference . the iae 50 / 150 associated with the structures shown permits the physician to visually inspect the lesion pattern during or after ablation to confirm that the desired pattern and depth have been created . by manipulating the iae 50 / 150 in the manner described above during or after ablation , the physician can view the lesions from different directions , to assure that the lesion geometry and depth conforms to expectations . the iae 50 / 150 can also inspect a long lesion pattern ( like patterns 160 or 168 in fig1 ) during or after ablation for gaps or interruptions , which could , if present , provide unwanted pathways for aberrant electrical pulses . contrast echocardiography , employing contrast media ( as earlier described in conjunction with fig8 ), may also be used to identify gaps in long lesions during or after their formation . since perfusion through thermally destroyed tissue is significantly less than in other tissue , gaps in long lesion patterns ( i . e ., tissue that has not been thermally destroyed ) will , in the presence of contrast media , appear ultrasonically &# 34 ; brighter &# 34 ; than tissue in the lesion area . ablation of these gaps , once identified by the iae 50 / 150 , completes the long lesion pattern to assure that the intended therapeutic result is achieved . the iae 50 / 150 can also help the physician measure the width , length , and depth of the lesion pattern . using the iae 50 / 150 , the physician can directly measure these physical lesion characteristics , instead of or as an adjunct to predicting such characteristics from measurements of applied power , impedance , tissue temperature , and ablation time . the iae 50 / 150 can further help the physician characterize tissue morphology . using the iae 50 / 150 , the physician can visualize border regions between healthy and infarcted tissue , alone or in combination with electrical impulse sensing with the electrodes 156 . various features of the invention are set forth in the following claims .	0
with reference to fig1 - 3 , number 1 indicates a system for producing rheocast ingots ( not shown ) of desired weight and size , and suitable for semiliquid die casting as described in u . s . patent application ser . no . 07 / 870 , 494 filed by the present applicant and mentioned previously . system 1 comprises a conventional smelting furnace 2 , e . g . an electric reverberatory furnace , for receiving and smelting a solid metal alloy , preferably aluminium alloy , e . g . in the form of pigs ; a powered ladle 3 running along rails 4 and designed to receive , from runner 5 on furnace 2 , the liquid alloy with or without ceramic particles fed directly into the liquid alloy in furnace 2 ; and a flowing furnace 6 ( fig2 ) of the type described in u . s . pat . no . 5 , 119 , 977 already mentioned . being fluidtight , furnace 6 may be pressurized as required , and is mounted on a fixed support 7 and rocked by actuators 8 between an idle position ( shown by the dotted line in fig2 ) and an operating position ( shown by the continuous line ) assumed during casting as described in detail later on . furnace 6 presents a loading door 9 facing rails 4 and preferably fitted with a filter 10 ; and a static mixer 12 of the type described in u . s . pat . no . 4 , 310 , 352 filed by the present applicant and mentioned previously . inside , furnace 6 ( fig2 ) presents a siphon type tank 14 for storing and maintaining the liquid alloy at roughly 50 ° above the temperature at which it begins to solidify . static mixer 12 is supported directly at the bottom of furnace 6 , and , with furnace 6 in the operating position shown by the continuous line in fig2 is connected hydraulically to the inside of tank 14 . with furnace 6 pressurized and in the tilted position , therefore , it is possible to pour the molten metal alloy in the semiliquid state and under strictly laminar flow conditions through mixer 12 , while maintaining the rest of the molten alloy in tank 14 under stationary rheological ( i . e . pressure / speed / potential energy ) conditions , thus preventing any hydraulic disturbance in tank 14 capable of affecting laminar flow through mixer 12 . system 1 also presents means 15 for receiving the stream of rheocast material at the outlet of mixer 12 ( semiliquid metal alloy , with or without stably suspended ceramic particles ) , and for solidifying and subsequently forming it into ingots . according to the present invention , means 15 comprise ( fig3 ) an extruder or metal die 20 cooled , for example , by forced circulation of water along pipes 21 and by means of a motor - driven pump 22 ; a tank 23 made for example of refractory material , for collecting the semiliquid rheocast material and located downstream from the outlet end 24 of mixer 12 and immediately upstream from die 20 ; a series of powered guide rollers 25 ( fig2 ) beneath die 20 ; and a circular saw 26 mounted on a powered platform 27 traveling along and parallel to rails 28 . in particular , die 20 comprises a cylindrical forming conduit 30 made of good heat conducting material , e . g . copper , and having a jacket 31 cooled by water ( or other coolant ), connected internally to pipes 21 , and having partitions 33 for enhancing turbulent flow and , hence , the heat exchange capacity of the coolant . conduit 30 is butt connected directly to outlet 35 of collecting tank 23 , which , according to the present invention , is a siphon type , and comprises a collecting portion 36 separated from outlet 35 by a partition 37 flush with the top edge 37a of tank 23 and of such a height as to project from the free surface of a bath of semiliquid rheocast material 38 ( fig3 ) in tank 23 . collecting portion 36 is also separated from outlet 35 by a spur 39 offset in relation to partition 37 and formed at the bottom of tank 23 , flush with outlet 35 . as such , the outflow stream 40 of semiliquid rheocast material from end 24 of mixer 12 is collected inside portion 36 from which it flows into the rest of tank 23 , at outlet 35 , with no effect whatsoever on the hydraulic conditions of material 38 stored in tank 23 as a whole , and is fed from tank 23 through die 20 under stationary rheological and strictly laminar flow conditions . as it flows along conduit 30 , material 38 solidifies and forms , at the outlet of die 20 , a single , continuous , constant - section billet 41 . the distance between tank 23 and outlet end 24 is kept as short as possible , compatible with construction and operating requirements . by virtue of the storage function of tank 23 , any turbulence originating in rheocast material 38 as a result of outflow stream 40 is limited to portion 36 , and is anyway rendered negligible by virtue of the level of semiliquid material 38 being substantially constant and close to edge 37a under operating conditions . from outlet 35 , the rheocast material then flows directly into forming conduit 30 with absolutely no possibility of any turbulence originating . as a result of eliminating turbulence and providing for stationary rheological conditions inside tank 23 and direct hydraulic connection of tank 23 to die 20 , material 38 solidifies into a single billet 41 incorporating substantially no gaseous substances . once formed , billet 41 is fed out through outlet 50 of die 20 and in known manner on to powered guide rollers 25 , which are rotated so as to feed it parallel to rail 28 along which powered circular saw 26 is mounted in sliding manner . saw 26 travels along rail 28 together with billet 41 , and , at the same time , cuts it into pieces which are collected by a device 52 ( fig2 ) beneath guide rollers 25 . upon a given number of pieces being fed into device 52 , this is moved into the position shown by the dotted line in fig2 for transferring the pieces of billet 41 to the user facility , e . g . on a known conveyor belt ( not shown ). device 52 is then restored to its original position beneath rollers 25 , for collecting further pieces cut off continuous billet 41 . as the cross section of billet 41 is constant , the pieces cut off the billet may be cut further to size to obtain ingots of exactly the required weight and ready for use in the semiliquid die casting process mentioned previously . alternatively , by appropriately selecting the axial position in which billet 41 is cut by saw 26 , the billet may be cut directly into ingots of given weight and size . for eliminating substantially all the gaseous substances in the rheocast material and , hence , in the ingots , system 1 may also comprise means for eliminating any gaseous substances contained in the initial metal alloy and any possibly incorporated during smelting and pouring in / from furnace 2 . in particular , system 1 comprises a known degassing station 60 located at a given point along rails 4 between furnaces 2 and 6 , and which provides for receiving powered ladle 3 as it travels along rails 4 , for reducing the hydrogen content of the molten alloy , and for eliminating most of the gaseous substances possibly incorporated as a result of the turbulence originating during transfer of the alloy to ladle 3 . system 1 also comprises ejector means 65 ( fig3 ) between static mixer 12 and tank 23 , for reducing the oxides in the alloy while still in the semiliquid state . in particular , ejector means 65 comprise a device for creating a protective inert gas atmosphere about outflow stream 40 , and consisting of a pair of hollow toroidal bodies 66 mounted coaxially one on top of the other , coaxial with outlet end 24 of mixer 12 , and located beneath outlet end 24 and over tank 23 , so that the continuous outflow stream 40 of rheocast material between static mixer 12 and tank 23 is forced to flow through and along the axis of bodies 66 . each body 66 presents a respective series of nozzles 67 , 68 , and a connecting pipe 70 to a pressurized protective gas source ( e . g . inert gas ). nozzles 67 and 68 are oriented obliquely in relation to the axis of bodies 66 and in opposite directions to each other . in the example shown , nozzles 67 of body 66 closest to mixer 12 are oriented towards mixer 12 , i . e . upwards ; while nozzles 68 of body 66 closest to tank 23 are oriented downwards and diverge from nozzles 67 . nozzles 67 , 68 thus provide for feeding into bodies 66 and about outflow stream 40 two diverging streams of gas , which may even differ chemically , so that laminar flow of rheocast material 38 through die 20 is effected under a shield of protective gas for further reducing possible contamination and , above all , for reducing the formation of oxides in stream 40 thanks to the protective action of the gas from nozzles 67 , 68 . the advantages of the system and process according to the present invention will be clear from the foregoing description . firstly , forming the rheocast material into one continuous billet , by feeding it under laminar flow conditions through a cooled die of the type used for continuous steel casting , provides for eliminating any turbulence whatsoever and , hence , for preventing gaseous substances from being incorporated in the molten alloy . it should be pointed out that this would not be possible , for example , if the billets , as is customary in the case of light alloys , were to be cast continuously using so - called &# 34 ; rice fields &# 34 ; i . e . tanks having a number of outlets through which a number of billets are formed simultaneously . in the first place , the rheocast material , being of a very high density , would not have sufficient energy for the casting to be completed ; and , secondly , such a technique inevitably results in turbulence and incorporation of gaseous substances , which is precisely what is to be avoided . secondly , the process according to the present invention enables troublefree production from the billet , i . e . from the pieces cut off the billet by saw 26 , of ingots of the required weight and size . by virtue of the billet presenting a constant section , in fact , the weight of the ingot may be determined by simply determining the axial position in which the piece is to be cut . for producing ingots of different diameters , die 20 need simply be replaced with one featuring a conduit 30 of the required inside diameter . finally , the process according to the present invention provides for eliminating scrap due to shrinkage of the material inside conventional ingot molds , and to the necessity of compensating for the conical shape of the same .	1
referring to fig1 a - 1b , a medical instrument 200 is shown with a handle 202 and elongated introducer or shaft member 205 that carries the working end 210 and is adapted for transecting and remodeling tissue . in one embodiment , the instrument is adapted for arthroscopy wherein the shaft member 205 extending along axis 215 can have a diameter ranging from 3 mm to 8 mm . the working end 210 comprises an openable - closeable jaw assembly with first ( upper ) jaw 222 a and second ( lower ) jaw 222 b that close and engage tissue about axis 215 . the shaft member 205 can have a cylindrical or rectangular cross - section and can comprise a thin - wall tubular sleeve that extends from handle 202 . in one embodiment , the handle 202 has a lever arm 224 that is adapted to actuate a translatable , reciprocating member that functions as a jaw - closing mechanism as is known in the art . in one embodiment shown in fig1 b , jaw member 222 a has a first or inner surface portion 225 extending around an interior tissue extraction channel 228 defined by the two jaws , wherein at least one tissue cutting element 232 is carried about a first surface portion 225 . in this variation , the cutting element is a sharp blade edge 232 carried by the upper jaw 222 a . the sharp blade edge 232 is configured for shearing tissue against the edge 235 of the extraction channel 228 in lower jaw 222 b . in another variation , both jaws can carry sharp blade edges that shear against each other to transect tissue . in the embodiment of fig1 b and 2a - 2b , each jaw has a second surface portion 240 outward of the blade edge 232 and in upper jaw 222 a edge 235 in lower jaw 222 b , where the second surface portion 240 is formed over a heat emitter 244 for applying thermal energy to engaged tissue for remodeling such tissue under pressure . the second surface portion 240 can have a gripping surface for gripping tissue , for example , a surface with fine ridges or an abrasive surface ( not illustrated ). in one variation , the second surface portions 240 in the opposing jaws are configured to define a tapered region that tapers toward the cut edges of the tissue as shown in fig2 b - 2c . by applying heat through the heat emitter 244 , a tapered edge can be formed or “ remodeled ” into transected tissue margins 268 which can be beneficial in treatment of cartilage and other tissues , for example , any tissues which are formed at least partly of collagen and can be thermally denatured and effectively molded or remodeled . in one variation as depicted in fig1 b and 2a - 2b , the heat emitters 244 can comprise ptcr ( positive temperature coefficient of resistance ) elements that are disposed on or within a jaw body . suitable materials for forming the ptct elements are described , for example , in u . s . pat . nos . 7 , 309 , 849 ; 7 , 087 , 054 ; 7 , 955 , 331 ; 8 , 075 , 555 ; and 8 , 192 , 428 , the full disclosures of which are incorporated herein by reference . the ptcr elements 244 can be positioned within an insulated layer if the jaw body is a conductive material or can be embedded in a plastic or other insulating jaw body . the ptcr elements comprise constant temperature heaters in which electrical energy provided by an electrical source 250 and controller 255 resistively heats the ptcr material to a predetermined temperature level at which the material switches between electrically conductive and non - conductive . in fig1 b , it can be understood that positive and negative electrical leads extend to each ptcr element in the upper and lower jaws . the ptcr material can be configured to have a constant or switching temperature that is suited for remodeling collagenous tissue under pressure , such 55 ° c . or less , 56 ° c ., 57 ° c ., 58 ° c ., 59 ° c ., 60 ° c ., 61 ° c ., 62 ° c ., 63 ° c ., 64 ° c ., 65 ° c ., 66 ° c ., 67 ° c ., 68 ° c ., 69 ° c ., 70 ° c ., 71 ° c ., 72 ° c ., 73 ° c ., 74 ° c ., 75 ° c ., 76 ° c ., 77 c ° , 78 ° c ., 79 ° c . or 80 ° c . at such temperatures , collagen fibrils will denature , unwind and can be remodeled under pressure wherein thermal relaxation will result in a remodeled collagen shape . referring to fig1 b , the diameter or cross - section of the shaft 205 can be from about 3 mm to 8 mm . the diameter d of the extraction channel can range from about 2 . 5 mm to 7 . 5 mm . a typical device for use in arthroscopy has a diameter of about 5 mm . the width w of the second surface portion 240 can range from about 1 mm to 4 mm . the length l of the jaws can range from about 3 mm to 5 mm as in a type of ‘ punch ’ currently used in trimming cartilage , meniscus etc . or the jaws can be longer , for example 5 mm to 20 mm in length . in fig1 b , the jaws 222 a and 222 b are shown with the upper jaw pivoting around pin 248 but any type of jaw configuration is possible . in fig1 b , it can be seen that a negative pressure source 260 communicates with the tissue extraction channel 228 which is configured for aspirating transected tissue proximally through the channel 228 in the instrument to a collection reservoir . typically , the instrument working end 210 would be operated in a saline fluid environment , and in one variation the aspiration function can operate only when the jaws are closed . alternatively , the aspiration mechanism can be manually turned on when needed by the physician . in another variation , the interior of the jaws can be configured with an electrode arrangement to provide for explosive vaporization of captured saline when the jaws are in the closed position to expel the transected tissue in the proximal direction , generally as disclosed in co - pending u . s . patent application ser . no . 13 / 277 , 913 filed oct . 20 , 2011 titled tissue extraction devices and methods ( docket no . 33291 - 712 . 201 ). fig2 a - 2c show a method of using the working end of fig1 b to cut and remodel tissue . in fig2 a , a transverse sectional view of the jaws 222 a and 222 b can be seen in an open position preparing to engage tissue 265 , which for example can be cartilage or meniscus . fig2 b depicts the jaws 222 a and 222 b closing on the tissue 265 with the sharp blade edge 232 cutting the tissue and capturing transected tissue 266 in the interior channel 228 . at the same time , fig2 b illustrates heat being applied to the tissue margins 268 from the ptcr emitters 244 to remodel the engaged tissue . fig2 c shows the tissue margins 268 after heating and compression wherein the thermal remodeling can provide a tapered tissue margin which is needed in treatments of joint tissue . in another embodiment , referring to fig3 , the cutting edge can comprise an rf electrode 270 that creates a plasma for cutting tissue . in fig3 , the rf electrode 270 can cooperate with opposing polarity electrode 275 in the interior of the lower jaw . in this embodiment , the heat emitters 277 a and 277 b in the respective jaws 222 a and 222 b can comprise opposing polarity electrodes or ptcr elements as described previously . in general , the device corresponding to the invention comprises an elongated probe with a working end 210 having openable - closeable first and second jaws wherein at least one jaw has a first surface portion carrying a tissue cutting element and a second surface portion outward of the first surface portion carrying a heat emitter configured for applying thermal energy for remodeling tissue , and not for cutting tissue . the independent cutting element can comprise a blade edge or at least one rf electrode . in general , a method of treating joint tissue comprises providing an elongated probe with a working end having openable - closeable first and second jaws having a first inner tissue - cutting perimeter and a second outer tissue - remodeling perimeter , clamping tissue between the first and second jaws and cutting tissue engaged within the first perimeter and remodeling tissue engaged intermediate the second and first perimeters . the cutting step can be accomplished by a sharp edge at the first perimeter of at least one jaw or an rf electrode edge at the first perimeter of at least one jaw . the remodeling step is accomplished at least in part by heating tissue captured intermediate the second and first perimeters . the heating step can be provided by at least one of joule heating and passive conductive heating . the method further comprises capturing cut and mobilized tissue within a channel within at least one jaw , and transporting tissue in the proximal direction within a channel extending through the elongated probe . typically , the cut and mobilized tissue is transported under the influence of fluidic pressure , which can be negative pressure that pulls the tissue proximally and / or positive pressure that pushes the tissue proximally . although particular embodiments of the present invention have been described above in detail , it will be understood that this description is merely for purposes of illustration and the above description of the invention is not exhaustive . specific features of the invention are shown in some drawings and not in others , and this is for convenience only and any feature may be combined with another in accordance with the invention . a number of variations and alternatives will be apparent to one having ordinary skills in the art . such alternatives and variations are intended to be included within the scope of the claims . particular features that are presented in dependent claims can be combined and fall within the scope of the invention . the invention also encompasses embodiments as if dependent claims were alternatively written in a multiple dependent claim format with reference to other independent claims .	0
a detailed description of a preferred embodiment of the present invention will now be given referring to the accompanying drawings . in the following explanation , the invention is applied to an intelligent power module for hybrid vehicle . a power module 100 of this embodiment includes , as shown in fig1 , a semiconductor element 10 which is a heat generating element , a metal layer 20 on which the semiconductor element 10 is mounted , a cooler 30 internally formed with coolant flow passages , an insulating resin sheet 40 that insulates the metal layer 20 and the cooler 30 from each other and joins them to each other , and a bus bar housing 60 fixed on the cooler 30 and holding a bus bar 61 . the power module 100 is configured to dissipate the heat generated in the semiconductor element 10 to the cooler 30 through the metal layer 20 and the insulating resin sheet 40 . the power module 100 is assembled as shown in fig1 such that the insulating resin sheet 40 , the metal layer 20 , and the semiconductor element 10 are laminated on the cooler 30 . in this description , this lamination direction is referred to as a height direction , the semiconductor element 10 side in the height direction is referred to as an upper side , and the cooler 30 side in the height direction is referred to as a lower side . the semiconductor element 10 is a device such as igbt constituting an inverter circuit and is electrically connected to the bus bar 61 in the bus bar housing 60 with bonding wires 13 . the semiconductor element 10 is mounted on the metal layer 20 and fixed thereto with solder 15 . it is to be noted that a vehicle - mounted power module mounts thereon many semiconductor elements , but it is schematically illustrated in the present description to simplify the explanation . the metal layer 20 is a board on which the semiconductor element 10 is mounted . the metal layer 20 serves as an electrode and also as a heat dissipating plate to dissipate the heat from the semiconductor element 10 . accordingly , the metal layer 20 is made of a material having high thermal conductivity and high electric conductivity . in the present embodiment , the metal layer 20 is made of copper ( cu ) having a thickness of 2 mm to 3 mm . the insulating resin sheet 40 is a joining sheet for bonding the cooler 30 and the metal layer 20 together . further , the insulating resin sheet 40 also has a function to electrically insulate the cooler 30 and the metal layer 20 from each other . as the insulating resin sheet 40 , therefore , a sheet having a joining function and an insulating function is used . in the present embodiment , the insulating resin sheet 40 is made of epoxy - system thermosetting resin with a thickness of about 200 μm . the cooler 30 has cooling fins each of which is formed of a rolled sheet shaped in wave form , and a top plate and a bottom plate that fix the cooling fins interposed therebetween . each component constituting the cooler 30 is made of aluminum ( al ) having high thermal conductivity and light weight . a hollow area defined by the top plate , the bottom plate , and the cooling fins provides flow passages for coolant . the coolant may be selected from liquid and gas . the components constituting the cooler 30 are integrally joined together with a brazing material in order to efficiently transfer the heat from the semiconductor element 10 to the cooler 30 . available brazing materials are aluminum brazing materials such as al — si alloy and al — si — mg alloy . the cooler 30 configured as above is one example and not limited thereto . in the present embodiment , a coefficient of linear expansion of the metal layer 20 made of copper is about 17 × 10 − 6 / k and a coefficient of linear expansion of the cooler 30 made of aluminum is about 24 × 10 − 6 / k . thus , there is a difference in coefficient of linear expansion ( coefficient of thermal expansion ) between the metal layer 20 and the cooler 30 . the cooler 30 is easier to expand than the metal layer 20 . the reflow furnace for mounting the semiconductor element 10 of the power module 100 will be explained below . a reflow furnace 200 in the present embodiment includes , as shown in fig2 , a heating chamber 201 to accommodate a work 1 , a radiation - heating type heater 202 placed in an upper side in the heating chamber 201 and configured to emit radiation to heat the work 1 , a hot plate 203 located in a lower side in the heating chamber 201 to hold thereon the work 1 and heat the work 1 , shielding plates 204 and 205 to block the passage of radiation from the heater 202 , and an air blow gun 206 configured to inject cooling air in the heating chamber 201 . the work 1 in the present embodiment corresponds to the power module 100 to which the semiconductor element 10 is not yet soldered . in other words , for example , the work 1 is in a state where the semiconductor element 10 is placed on cream solder printed on the metal layer 20 . in the work 1 , the metal layer 20 and the cooler 30 are bonded together through the insulating resin sheet 40 . in the reflow furnace 200 , as shown in fig2 , the work 1 is placed on the hot plate 203 . by the heat from the hot plate 203 , the work 1 is heated from below . further , the work 1 is placed below the heater 202 and thus heated from above by the radiation from the heater 202 . in other words , the reflow furnace 200 is configured to heat the work 1 from both sides , above and below , in the height direction . the shielding plates 204 and 205 are movably provided in the heating chamber 201 . during heating of the work 1 , the shielding plate 204 covers upper surfaces ( especially , exposed portions ) of the cooler 30 and the insulating resin sheet 40 and the shielding plate 205 covers an upper surface of the semiconductor element 10 . specifically , the shielding plates 204 and 205 cover other portions than the metal layer 20 of the work 1 when seen from above in the height direction of the work 1 . the shielding plates 204 and 205 may be made of any materials capable of reflecting the radiation form the heater 202 to restrain the passage of radiation . in the present embodiment , the plates 204 and 205 are steel plates whose surfaces coated with au plating . the shielding plate 204 includes , as shown in fig2 , a shielding part 214 for covering the upper surface of the cooler 30 and a shielding part 224 for covering the upper surface of the insulating resin sheet 40 . the shielding plate 204 is formed in a shape including the shielding parts 214 and 224 integrally . the shielding part 214 and the shielding part 224 of the shielding plate 204 may be provided as separate parts . for instance , the shielding plates 204 and 205 may consist of a plurality of parts which are assembled to cover necessary portions of the work 1 or may be formed of a single plate having a cutout ( s ) corresponding to an uncovered portion ( s ) ( the metal layer 20 in this embodiment ) of a work . the air blow gun 206 is movably provided in the heating chamber 201 . this gun 206 injects cooling air toward a portion or portions difficult to be covered by the shielding plate 204 of the cooler 30 , thereby cooling the surface of the cooler 30 . in the case where it is unnecessary to cool the cooler 30 by use of the air blow gun 206 ( e . g ., in the case where temperature control mentioned later is enabled by using only the shielding plates 204 and 205 ), the air blow gun 206 is held outside the heating chamber 201 . a soldering procedure in the power module 100 by use of the aforementioned reflow furnace 200 will be explained below . the work 1 is first put on the hot plate 203 as shown in fig2 . further , the shielding plates 204 and 205 are moved to between the work 1 and the heater 202 . to be concrete , the shielding plate 204 is placed to cover the upper surfaces of the cooler 30 and the insulating resin sheet 40 , while the shielding plate 205 is placed to cover the upper surface of the semiconductor element 10 . subsequently , heating using the heater 202 and the hot plate 203 is started . specifically , the metal layer 20 is heated to at least a melting temperature of the solder 15 . at that time , the metal layer 20 uncovered with the shielding plates 204 and 205 absorbs the radiation from the heater 202 . accordingly , the metal layer 20 is heated by the heater 202 . as the metal layer 20 is heated , the heat is transferred to the solder 15 , and thus the solder 15 is melted . the cooler 30 and the insulating resin sheet 40 each being covered by the shielding plate 204 hardly absorb the radiation from the heater 202 . thus , the cooler 30 and the insulating resin sheet 40 are not influenced by the radiation from the heater 202 . similarly , the semiconductor element 10 covered by the shielding plate 205 is little influenced by the radiation from the heater 202 . in the cooler 30 side , on the other hand , the cooler 30 is heated by the hot plate 203 . in the reflow furnace 200 , concretely , heating control of the hot plate 203 is performed so that a thermal expansion amount ( i . e ., an expanding amount in a width direction ) of the cooler 30 is approximately equal to that of the metal layer 20 . when soldering is to be performed at 300 ° c ., the work 1 is heated by the radiation from the heater 202 so that the temperature of the metal layer 20 reaches 300 ° c ., while the cooler 30 side is controlled so that the temperature of the cooler 30 becomes 212 ° c . while the work 1 is heated by the heater 202 and the hot plate 203 , the temperature of the metal layer 20 and the temperature of the cooler 30 are continuously detected and the temperature of the cooler 30 is increased following the increasing temperature of the metal layer 20 so that their thermal expansion amounts are approximately equal to each other . specifically , the hot plate 203 is controlled to maintain a difference in thermal expansion amount between the metal layer 20 and the cooler 30 within a predetermined value . in this reflow process ( one example of the mounting process ), a difference in temperature is provided between the metal layer 20 and the cooler 30 so that the difference in thermal expansion amount between the metal layer 20 and the cooler 30 is a threshold value or less . since the control is performed to prevent the occurrence of a difference in thermal expansion amount between the metal layer 20 and the cooler 30 , the insulating resin sheet 40 is less likely to be deformed or warped and hence stress concentration is restrained . during adjustment of the temperature of the cooler 30 , the temperature of the cooler 30 is adjusted simply by heating control of the hot plate 203 . as an alternative , the air blow gun 206 may be used to blow cooling air to the cooler 30 for the purpose of fine adjustment of the temperature of the cooler 30 . as another alternative , instead of using the shielding plates 204 and 205 , the cooler 30 may be cooled by cooling air to provide a temperature difference between the metal layer 20 and the cooler 30 . fig3 shows a relationship between temperature and coefficient of thermal expansion of a subject to be heated . in the conventional example , both the temperature of the metal layer 20 and the temperature of the cooler 30 are increased to the melting temperature ( a sign a in fig3 ) of the solder 15 . that is , the temperature of the metal layer 20 and the temperature of the cooler 30 are equal to each other . accordingly , a difference in thermal expansion amount occurs due to the difference in coefficient of thermal expansion as indicated by a sign d in fig3 . this causes peeling of the insulating resin sheet 40 . in the present embodiment , in contrast , the temperature of the metal layer 20 and the temperature of the cooler 30 are controlled to be different from each other so that their thermal expansion amounts are equal to each other . in the present embodiment , specifically , the coefficient of thermal expansion of the cooler 30 is higher than that of the metal layer 20 . therefore , the temperature of the cooler 30 is made lower than the metal layer 20 so that the thermal expansion amount of the cooler 30 is equal to the metal layer 20 . for instance , when the metal layer 20 reaches the temperature a in fig3 , the temperature of the cooler 30 is adjusted to a temperature b at which the thermal expansion amount of the cooler 30 becomes equal to a thermal expansion amount c of the metal layer 20 . in the present embodiment , the thermal expansion amounts are equal as above , so that the insulating resin sheet 40 is less warped . this can consequently prevent peeling of the insulating resin sheet 40 . a power module 110 in a second embodiment is configured , as shown in fig4 , such that a shielding film 50 covers a portion of a surface of the cooler 30 facing to the semiconductor element 10 , the portion being in noncontact with the insulating resin sheet 40 . the bus bar housing 60 is fixed onto the shielding film 50 . the shielding film 50 reflects the radiation from the heater 202 to restrain the passage of radiation . for example , an au film is usable . specifically , the shielding film 50 has a function similar to the shielding plates 204 and 205 of the reflow furnace 200 . further , the shielding film 50 is in noncontact with the metal layer 20 and electrically insulated from the metal layer 20 by the insulating resin sheet 40 . in the power module 110 , the surface of the cooler 30 facing to the heater 202 is covered by the shielding film 50 . thus , the heater 202 does not contribute to heating of the cooler 30 . accordingly , in a similar manner to the first embodiment , a temperature difference can be provided between the metal layer 20 and the cooler 30 . since the power module 110 is provided in itself with a shielding member , any shielding plate does not need to be provided in the reflow furnace as disclosed in the first embodiment . even when the configuration of the power module is changed , therefore , there is no need to change the configuration of the reflow furnace . therefore , the reflow furnace has a simpler configuration than that in the first embodiment . on the other hand , in the case where the shielding plate is provided in the reflow furnace as in the first embodiment , the power module does not need any shielding film . thus , the number of components of the power module can be small . further , manufacturing of such cooler needs no step of covering the cooler by the shielding film and the cooler can be made simpler than that in the second embodiment . as explained in detail above , in the soldering process of the power module in the present embodiments , the work 1 is heated so that the metal layer 20 ( a low thermal expansion member ) becomes higher in temperature as compared with the cooler 30 ( a high thermal expansion member ). specifically , the metal layer 20 is heated to a melting temperature of the solder 15 and the cooler 30 is heated to have a thermal expansion amount approximately equal to the thermal expansion amount of the metal layer 20 . since the metal layer 20 and the cooler 30 are heated as above to different temperatures , their thermal expansion amounts are little different from each other as compared with the case where the metal layer 20 and the cooler 30 are heated to almost the same temperature . accordingly , shear stress generated in the insulating ; resin sheet 40 is small and thus it can be expected to prevent peeling of the insulating resin sheet 40 . the above embodiments are mere examples and do not give any limitations to the present invention . the present invention therefore may be embodied in other specific forms without departing from the essential characteristics thereof . for instance , although the above embodiments show that the present invention is applied to the intelligent power module for hybrid vehicle , the invention is also applicable to general modules including electronic components mounted on electronic circuit boards . although the radiation - heating type heater 202 and the hot plate 203 are used as heating devices for heating the work 1 in the above embodiments , the invention is not limited thereto . for instance , the work 1 may be heated by heated air , laser heating , arc heating , electromagnetic induction heating , electronic beam heating , or ion beam heating . in the above embodiments , the cooling air from the air blow gun 206 is used as a cooling device for cooling the work 1 , but the invention is not limited thereto . for instance , the work 1 may be cooled by a cooling plate , cooling water , or compression cooling . in the above embodiments , the sheet - like member 40 is used as a member for joining the metal layer 20 and the cooler 30 and insulating them from each other . instead of such a sheet - like member , a plate - like member ( a ceramic insulating plate , etc .) may be used . in the above embodiments , on ground that the coefficient of thermal expansion of the cooler 30 is higher than that of the metal layer 20 , heating of the metal layer 20 and the cooler 30 is controlled so that the temperature of the cooler 30 is lower than the temperature of the metal layer 20 . however , the invention is not limited to such heating control . in the case where the coefficient of thermal expansion of the cooler 30 is lower than that of the metal layer 20 , heating is controlled so that the temperature of the cooler 30 is higher than that of the metal layer 20 , thereby making their thermal expansion amounts equal to each other .	7
this invention is best understood by reference to the drawings . the intravascular catheter adhesive tape 40 of this invention is shown in fig5 through 8 . the adhesive tape comprises a strip of tape 41 having adhesive on a portion of one side with two removable end covers 42 and 43 affixed near the ends of the adhesive side and a third removable center cover 44 affixed to the central portion of the adhesive side . the adhesive side of the tape is shown in fig5 through 7 and the non - adhesive side of the tape is shown in fig8 . the components of the intravascular catheter adhesive tape are discussed in detail below . the strip of tape 41 has an adhesive on one of its sides and is non - adhesive on the other side . as previously mentioned , it is adhesive on a portion of one side only . as best seen in fig7 , most of the side is adhesive as represented by the dotted area . the two ends of the tape 41 a and 41 b are not adhesive . these ends either lack adhesive or have non - removable covers on top of adhesive . the length of the non - adhesive portions of the tape 41 a and 41 b is not particularly critical so long as the length of the non - adhesive portion is great enough for a healthcare professional to grip the end of the tape after it has been affixed to the skin of a patient . however , the two non - adhesive ends of the tape 41 a and 41 b typically have a length of about 2 mm to about 15 mm and more typically have a length of about 5 mm to about 12 mm . the material of the tape and the type of adhesive are not critical . conventional plastics and fabrics are suitable and conventional adhesives are also suitable . the strip generally has a length of about 15 to 300 mm , preferably has a length of about 20 mm to 200 mm , and most preferably has a length of 50 mm to 150 mm . the strip normally has a width of about 4 to 50 mm , preferably has a width of about 4 to 25 mm , and most preferably has a width of 5 to 10 mm . two removable end covers 42 and 43 are affixed near the ends of the adhesive side of the strip . the material of the covers is not critical . conventional plastics and papers are suitable . the end covers can optionally overhang the non - adhesive portions of the strip by about 5 mm and optionally overhang the sides of the strip by about 1 to 3 mm . the end covers are generally separated by about 10 to 15 mm so that a centrally located portion of the adhesive can be exposed by removal of the removable center cover 44 . the end covers are typically separated by a length that is between 2 % and 33 % of the overall length of the adhesive tape 40 . the end covers are more typically separated by a length that is between 10 % and 20 % of the overall length of the adhesive tape 40 . as best seen in fig6 , the inner ends of the covers are preferably folded back to form cover tabs 50 for ease of gripping after the center cover has been removed . the center cover 44 is affixed to the central portion of the adhesive side of the strip . it optionally overhangs the end covers by about 5 mm so that it can be removed first without dislodging the end covers . the center cover can be made of the same type of materials as the end covers . the center cover optionally overhangs the sides of the strip by about 2 to 5 mm , preferably slightly more than the end covers . in another embodiment of this invention , the removable covers are designed in a manner where they do not overhang the sides of the strip . this embodiment of the invention is depicted in fig9 , fig1 , fig1 and fig1 . in this embodiment of the invention , tabs are affixed to the removable covers for easy removal from the adhesive side of the strip eliminating the need for the removable covers to overhang the sides of the strip . fig9 shows tabs 64 which are affixed to the removable covers 63 affixed to the ends of the adhesive side of the tape . tab 65 is shown as being affixed to the central cover 61 which is shown as covering the centrally located portion of the adhesive side of the strip . fig1 shows the adhesive side of the strip after the center cover 61 has been removed exposing the adhesive 66 located in the center of the strip . tabs 64 can be grasped by the healthcare provider to remove the removable cover 62 and removable cover 63 covering the adhesive at the two opposite ends of the strip . after end cover 62 and end cover 63 have been removed , the adhesive 66 is exposed on the entire adhesive side of the strip as depicted in fig1 . the non - adhesive portion of the strip which is on the opposite side of the tape from the adhesive portion is depicted in fig1 . in this embodiment of the invention , the adhesive covers the entire length of the adhesive side of the tape . in this case , tabs 68 are affixed to each end of the non - adhesive side of the tape 67 to facilitate easy removal by the healthcare provider at the time that the catheter is removed from the injection site . fig1 is a cross - sectional view depicting this embodiment of the invention . in fig1 , the non - adhesive side of the tape 67 is shown with tabs 68 located near the ends of the tape for easy removal . in this cross - sectional view of the tape , the adhesive 66 is sandwiched between the non - adhesive side of the tape 67 and the centrally located removable cover 61 , and the removable covers 62 and 63 located at the ends of the tape . a first tab 64 and a second tab 65 are affixed to the removable covers to facilitate easy removal . it should be noted that removable cover 62 abuts the centrally located removable cover 61 at abutment point 69 so that the adhesive is completely covered . the other end of the centrally located removable cover 61 is abutted by removable cover 63 at a second abutment point 70 . the use of the intravascular catheter adhesive tape can now be considered . after an intravascular catheter is inserted into the patient , the adhesive tape is held with the adhesive side facing up ( away from the patient ). the center cover is removed and the adhesive tape is centered under the hub of the catheter so that the exposed adhesive is directly below the hub . the hub is gently pressed down against the exposed adhesive . one of the end covers is then removed and that end of the tape is folded over the catheter . the other end cover is then removed and that end of the tape is folded over the catheter . the covers are easy to grasp by a medical professional wearing gloves . this is by virtue of the fact that the covers are equipped with tabs or overhang the sides of the tape , in either case making it easy for the healthcare provider to grasp and remove the covers from the tape . more importantly , the adhesive tape of this invention eliminates the need to temporarily stick the tape to a potentially contaminated surface prior to being used to affix the catheter to an intravascular site on the skin of a patient . since there is no need to bring the adhesive tape into contact with a contaminated surface , the risk of catheter - related nosocomial infection is greatly reduced . the adhesive tape of this invention also eliminates any temptation that a healthcare provider may have to use his or her bare hands in affixing the catheter to an intravascular site because the adhesive tape of this invention can be easily used wearing gloves . this protects both the patient and the healthcare provider from potential risk . also , a catheter can be secured to the skin of a patient utilizing the adhesive tape of this invention with only one hand which offers the advantage of leaving the healthcare provider with a “ free ” hand to stabilize the catheter at the intravascular site . the adhesive tape of this invention can also be easily removed from a patient by virtue of the fact that it can be easily and firmly grasped by a healthcare provider for removal . this is advantageous in that the medical professional is not required to “ dig ” at the end or side of conventional tape to remove it from the skin . the digging action associated with removal of conventional tape is irritating to most patients and can be harmful to patients with fragile skin , such as the elderly and neonates . since the adhesive tape of this invention has tabs that can be easily gripped for removal from the skin of the patient , the removal procedure is quicker and far less irritating . this invention is illustrated by the following examples that are merely for the purpose of illustration and are not to be regarded as limiting the scope of the invention or the manner in which it can be practiced . unless specifically indicated otherwise , parts and percentages are given by weight . intravascular catheters are commonly inserted into a blood vessel on the back of a human patient &# 39 ; s hand utilizing aseptic techniques . in such procedures , the healthcare provider typically wears gloves which are preferably sterile for both his or her protection and the protection of the patient . the first step of the process normally involves placing a sterile towel under the patient &# 39 ; s arm or hand . then , the healthcare provider sequentially tears several pieces of tape from a roll of tape in appropriate lengths for subsequent use in affixing the catheter to the intravascular site . as these strips of tape are torn from the roll of tape , the healthcare provider typically sticks the end of each of the strips to a convenient surface to allow the tape strips to hang so that they are accessible . this surface could be an i . v . pole , bed rail , bedside table or other convenient object nearby . in the next step of the conventional procedure , a tourniquet is applied to the patient &# 39 ; s arm . the healthcare provider then cleans and sterilizes the site where the catheter will be inserted into the patient with an antiseptic skin prep , such as an antiseptic swab . the antiseptic is allowed to dry . in such a procedure , an integral stylet is then inserted into a blood vessel on the back of the patient &# 39 ; s hand by utilizing the sharp needle of the stylet to puncture through the patient &# 39 ; s skin and other tissue to allow the stylet to enter the blood vessel . the needle is then removed from the patient &# 39 ; s body while allowing the end of the intravascular catheter to remain in the blood vessel . at this point , it is typically necessary to apply pressure to the catheter to keep blood from flowing through the catheter . after the needle has been removed the hub of the catheter is affixed to the skin of the patient at the intravascular site . during this procedure , the healthcare provider typically holds the hub of the intravascular catheter to the site of insertion with one hand and with his or her free hand retrieves one piece of previously torn tape and slips it adhesive side up underneath the hub of the catheter . the healthcare provider then pulls one free end of the tape over the catheter hub and wraps it over the catheter hub to stick the adhesive to the patient &# 39 ; s skin . then , the healthcare provider wraps the other end of the tape over the opposite side of the catheter hub and sticks it to the patient &# 39 ; s skin . the intravenous tubing line is then connected to the catheter hub and the tourniquet is released . at this point , additional strips of tape can be used to more firmly adhere the catheter to the intravascular site . then , a clear occlusive dressing is placed over the top of the intravascular site . the biggest problem with this conventional procedure is that the tape utilized in adhering the catheter to the intravascular site can be contaminated , exposing the patient to the risk of nosocomial infection . another inherent problem with this procedure is that the tape can get stuck to the glove of the healthcare provider . in one unfortunate scenario that occurs from time to time , the catheter can be accidentally removed from the intravascular site by virtue of being unknowingly stuck to the healthcare provider &# 39 ; s glove . after the catheter has served its purpose , it is , of course , necessary to remove it from the patient . the removal procedure can be unpleasant and can cause skin irritation in certain patients . for instance , in cases where the tape adhering the intravascular catheter is firmly stuck to the skin of the patient , it is frequently necessary for the healthcare provider to dig at the ends of the tape to establish a point where the tape can be grasped for removal . this digging action can scratch or irritate the skin of patients having sensitive skin such as those with skin conditions and elderly and newborn patients . the procedure utilized in comparative example 1 for inserting a catheter into a blood vessel on the back of a patient &# 39 ; s hand can be done utilizing the adhesive tape and procedure of this invention . in this procedure , the healthcare provider first puts on sterile gloves for both his or her protection and the protection of the patient . then a sterile towel is placed under the patient &# 39 ; s arm or hand . next , a tourniquet is applied to the patient &# 39 ; s arm . the healthcare provider then cleans and sterilizes the site where the catheter will be inserted into the patient with an antiseptic skin prep such as antiseptic swab . the antiseptic is allowed to dry . in such a procedure an integral stylet is then inserted into a blood vessel on the back of the patient &# 39 ; s hand by utilizing the sharp needle of the stylet to puncture through the patient &# 39 ; s skin and other tissue to allow the stylet to enter the blood vessel . the needle is then removed from the patient &# 39 ; s body while allowing the end of the intravascular catheter to remain in the blood vessel . at this point , it is typically necessary to apply pressure to the catheter to keep blood from flowing through the catheter . after the needle has been removed the hub of the catheter is affixed to the skin of the patient at the intravascular site . during this procedure , the healthcare provider typically holds the hub of the intravascular catheter to the site of insertion with one hand and with his or her free hand removes the third removable cover affixed to the central portion of the adhesive side of the strip of tape . after the adhesive is exposed , the central portion of the adhesive tape is slipped with the adhesive side up underneath the hub of the catheter . the healthcare provider then removes the removal cover affixed to one end of the adhesive tape of this invention , pulls that end of the tape over the catheter hub and wraps it over the catheter hub to stick the adhesive to the patient &# 39 ; s skin . then , the healthcare provider removes the removable cover from the other end and wraps that end of the tape over the opposite side of the catheter hub and sticks it to the patient &# 39 ; s skin . the intravenous tubing line is then connected to the catheter hub and the tourniquet is released . then , a clear occlusive dressing is placed over the top of the intravascular site . optionally , the healthcare provider can further secure the intravascular catheter to the patient &# 39 ; s skin by applying a second adhesive tape of this invention to the catheter at the point where it comes out from under the clear occlusive dressing . this is done by first removing the cover from the central portion of the adhesive side of the adhesive tape of this invention . the exposed adhesive is then gently pushed onto the top of the catheter at the point where it exits the clear occlusive dressing . then , the cover is removed from one of the ends of the adhesive tape and the exposed adhesive is gently pushed into contact with the clear occlusive dressing and the patient &# 39 ; s skin . subsequently , the cover is removed from the other end of the adhesive tape and it is then gently pushed into contact to adhere to the clear occlusive dressing and the patient &# 39 ; s skin . the benefits associated with utilizing the adhesive tape of this invention include easy application with one hand with minimized risk of the tape accidentally sticking to the gloves of a healthcare provider . this accordingly reduces the risk of the catheter being accidentally pulled out of the patient due to it being accidentally stuck to the glove of the healthcare provider . since it can be easily used while wearing gloves it also reduces the temptation of healthcare providers performing all or part of the procedure with bare hands which reduces the risk of infection for both the healthcare provider and the patient . thus , catheters can be firmly secured to an intravascular site without the risk of contamination . the risk of the hub or tape becoming contaminated by contact with foreign objects is virtually eliminated . aseptic techniques are utilized during the entire procedure of affixing the catheter to the intravascular site with sterility preferably being maintained . after the catheter has served its purpose , it is , of course , necessary to remove it from the patient . the adhesive tape of this invention can be easily removed from patients in a more pleasant manner that causes less skin irritation . this is because the adhesive tape of this invention includes non - adhesive end portions or tabs that allow the healthcare provider to firmly grasp the adhesive tape for removal from the patient &# 39 ; s skin without the need to dig at the ends of the tape to establish a point where the tape can be grasped for removal . this makes the removal procedure easier and faster for the healthcare provider . more importantly , it eliminates the need for the healthcare provider to dig at the ends or sides of the tape which greatly reduces the incidences of scratching or irritating fragile or delicate skin . the procedure utilized in comparative example 1 for inserting a catheter into a blood vessel on the back of a patient &# 39 ; s hand can be done utilizing a sterile intravascular start kit that includes the adhesive tape of this invention . in such a procedure , the healthcare provider opens the sterile intravascular start kit and dons the sterile gloves that are packaged in the kit . then a sterile towel is removed from the kit and placed under the patient &# 39 ; s arm or hand . next , a sterile tourniquet is taken from the kit and applied to the patient &# 39 ; s arm . the healthcare provider then removes an antiseptic skin prep , such as an antiseptic swab , from the kit and used it to clean and sterilize the site where the catheter will be inserted into the back of the patient &# 39 ; s hand . the antiseptic is then allowed to dry . in such a procedure an integral stylet is then inserted into a blood vessel on the back of the patient &# 39 ; s hand by utilizing the sharp needle of the stylet to puncture through the patient &# 39 ; s skin and other tissue to allow the stylet to enter the blood vessel . the needle is then removed from the patient &# 39 ; s body while allowing the end of the intravascular catheter to remain in the blood vessel . at this point , it is typically necessary to apply pressure to the catheter to keep blood from flowing through the catheter . after the needle has been removed the hub of the catheter is affixed to the skin of the patient at the intravascular site . during this procedure , the healthcare provider typically holds the hub of the intravascular catheter to the site of insertion with one hand and with his or her free hand removes the sterile adhesive tape of this invention from the kit . the healthcare provider then removes the third removable cover affixed to the central portion of the adhesive side of the strip of tape with his or her free hand . after the adhesive is exposed , the central portion of the adhesive tape is slipped with the adhesive side up underneath the hub of the catheter . the healthcare provider then removes the removal cover affixed to one end of the adhesive tape of this invention then pulls that end of the tape over the catheter hub and wraps it over the catheter hub to stick the adhesive to the patient &# 39 ; s skin . then , the healthcare provider removes the removable cover from the other end and then wraps that end of the tape over the opposite side of the catheter hub and sticks it to the patient &# 39 ; s skin . the intravenous tubing line is then connected to the catheter hub and the tourniquet is released . then , a clear occlusive dressing is placed over the top of the intravascular site . optionally , the healthcare provider can remove a second sterile adhesive tape from the kit and further secure the intravascular catheter to the patient &# 39 ; s skin by applying it to the catheter at the point where it comes out from under the clear occlusive dressing . this is done by first removing the cover from the central portion of the adhesive side of the adhesive tape of this invention . the exposed adhesive is then gently pushed onto the top of the catheter at the point where it exits the clear occlusive dressing . then , the cover is removed from one of the ends of the adhesive tape and the exposed adhesive is gently pushed into contact with the clear occlusive dressing and the patient &# 39 ; s skin . subsequently , the cover is removed from the other end of the adhesive tape and it is then gently pushed into contact to adhere to the clear occlusive dressing and the patient &# 39 ; s skin . the most significant benefits associated with utilizing the sterile intravascular start kit of this invention include convenience , ease of use , and reduced risk of contamination . because the sterile intravascular start kit includes at least one sterile adhesive tape of this invention a catheter can be easily affixed to an intravascular cite with one hand with minimized risk of the tape accidentally sticking to the gloves of a healthcare provider . this accordingly reduces the risk of the catheter being accidentally pulled out of the patient due to it being accidentally stuck to the glove of the healthcare provider . since it can be easily used while wearing gloves it also reduces the temptation of healthcare providers performing all or part of the procedure with bare hands which reduces the risk of infection for both the healthcare provider and the patient . thus , catheters can be firmly secured to an intravascular site without the risk of contamination . the risk of the hub or tape becoming contaminated by contact with foreign objects is virtually eliminated . during the entire procedure of affixing the catheter to the intravascular site sterility is maintained . after the catheter has served its purpose , it is , of course , necessary to remove it from the patient . the adhesive tape of this invention can be easily removed from patients in a more pleasant manner that causes less skin irritation . this is because the adhesive tape of this invention includes non - adhesive end portions or tabs that allow the healthcare provider to firmly grasp the adhesive tape for removal from the patient &# 39 ; s skin without the need to dig at the ends of the tape to establish a point where the tape can be grasped for removal . this makes the removal procedure easier and faster for the healthcare provider . more importantly , it eliminates the need for the healthcare provider to dig at the ends or sides of the tape which greatly reduces the incidences of scratching or irritating fragile or delicate skin . while certain representative embodiments and details have been shown for the purpose of illustrating the subject invention , it will be apparent to those skilled in this art that various changes and modifications can be made therein without departing from the scope of the subject invention .	8
embodiments presented in the present disclosure and the various features and advantageous details thereof are explained more fully with reference to the nonlimiting embodiments that are illus rated in the accompanying drawings and detailed in the following description . descriptions of well - known techniques , components and equipment are omitted so as not to unnecessarily obscure the embodiments of the present disclosure in detail . it should be understood , however , that the detailed description and the specific examples are given by way of illustration only and not by way of limitation . various substitutions , modifications , additions and / or rearrangements within the scope of the underlying inventive concept will become apparent to those skilled in the art from this disclosure . embodiments of this disclosure include methods , system architectures and apparatus to prevent obi in rfog networks or in hybrid fiber coax ( hfc ) networks , or in any other networks , where multiple laser transmitters can simultaneously operate over a common optical fiber connected to a shared optical receiver . the system includes a controller that resides in the headend or the hub , and a cpe that resides at the customer premises , as shown in fig3 . referring to fig3 , the controller 310 and the cpes 320 form a bi - directional communication system . downstream data messages from the controller are modulated on a rf carrier f 1 , optically modulated by the optical transmitter 330 , combined onto a single fiber and delivered to the cpe through the optical splitter 340 . upstream data messages from the cpes on f 2 are delivered to the controller 310 through an optical receiver 350 . referring to fig5 , at the cpe 500 the optical signal is received by a photo diode 510 , amplified by an rf amplifier 520 , and delivered to a rf demodulator 530 through an rf splitter 540 . the rf demodulator extracts the data stream and delivers it to the microcontroller 550 . in the upstream direction , control messages from the microcontroller are modulated by an rf modulator 560 on an rf frequency f 2 . this rf carrier is modulated by the laser 570 and transmitted to the optical receiver 350 ( shown in fig3 ) through the optical diplexer 580 , the optical fiber and the wavelength division multiplexer ( not shown in fig5 ). in an alternate embodiment shown in fig4 , two downstream optical transmitters 401 , 402 are used . one transmitter 402 is used to modulate the downstream rf signal from the controller . another optical transmitter 401 is used to modulate the downstream video , cmts and set top box channels . these two transmitters operate at different optical wavelengths which are combined using an optical multiplexer 410 or an optical coupler . the combined signals are amplified , and delivered to the cpe 420 . it should be noted that it is not necessary for the controller 430 , the optical transmitter 402 that modulates the downstream rf signal from the controller , and the optical receiver 440 to he located at the same location as the transmitter 401 that modulates the other downstream channels . they can he located at a remote location such as a node or a pedestal . a characteristic of a laser is that its wavelength can be adjusted by changing its dc bias point or its temperature . thus any given laser with intrinsic wavelength λ i o at ambient temperature can access a range of wavelenaths from to λ i _ min to λ i _ max over temperature and bias current : i o ( t ) is laser bias current at given temperature for a particular output power is the change in laser wavelength as a function of temperature is the change in laser wavelength as a function of laser bias current the laser in the cpe is connected to a thermo - electric cooler ( tec ) that is used to change the temperature of the laser and thus its wavelength . it should be noted that besides a tec , there are other ways to change the wavelength of the laser , such as a heater , or any other device or method that changes the wavelength of the laser . a tunable laser could also be used . it should be noted that the tec can be mounted inside the laser . the system works by defining a wavelength grid . the grid could include wavelength ranges , for example , known as the c - band , o - band or any cwdm wavelength band or combination of bands . it can also be defined to span the entire optical communication window from 1250 nm to 1650 nm . the range is specified by λ start , λ stop , and spacing between the wavelengths , δλ bin , is defined to be large enough to eliminate the possibility of obi . typically this is greater than 3 to 5 times the adiabatic chirp of the laser plus an additional amount to account for dynamic wavelength shift due to burst mode transmission and a margin for lifetime wavelength aging of a laser device . the available wavelengths are discreet positions given by λ i = λ start + i = δλ bin with i = 0 , 1 , 2 , 3 . . . , m and λ m ≦ λ stop . during the time of manufacture , the tec is used to change the temperature of the laser and determine which wavelengths on the grid this particular laser can be tuned to . it should be noted that any one cpe may only map onto a very small subset of the m wavelengths on the grid . a table is created that contains the list of these wavelengths , and the corresponding temperature and tec voltage that needs to be set to tune the laser to those wavelengths . the cpe then selects its default wavelength , which is the ideal wavelength it should be operated at . this wavelength would typically he in the middle of the range of wavelengths that a cpe laser can be tuned to . having the cpe laser operate at the middle of the rage is preferable because it is easier for the tec to maintain this wavelength over the entire operating temperature range of the cpe . this information about the cpe default wavelength ( and the wavelengths above and below the default wavelength that the cpe can be tuned to ) is then stored into the memory of the cpe . this memory can he an eeprom , flash , internal microcontroller memory , fpga or any other method or device that can store information . when the cpe is first deployed in a network , it reports its default wavelength along with the number of wavelengths above and below the default wavelength that the cpe laser can be tuned to . along with this information , the cpe also reports its unique identifier to the controller . this identifier can be a serial number , a mac address , an ip address , or any other set of characters unique to the cpe . the controller compares this information to its database of information containing all the cpes connected to that optical receiver . if the default wavelength of the new cpe has not been assigned to any other cpe on the same receiver , then the controller sends a downstream control message assigning the default wavelength to the cpe . the cpe continues to operate on this default wavelength unless told by the controller to move to a different wavelength . if the default wavelength of the cpe has been assigned to another cpe connected to the same receiver , then the controller assigns to the cpe the closest available wavelength to its default wavelength . this ensures that as far as possible , the cpes will operate at or close to their default wavelengths . fig6 shows how this process would work . since cpe 1 is the first cpe to come online , it is assigned its default wavelength ( λ 5 ). cpes 2 , 3 , and 4 also come online and are assigned their default wavelengths because those wavelengths have not been assigned to any other cpes . cpe 5 comes online and its default wavelength is taken by cpe 3 , so cpe 5 is assigned . the next closest wavelength ( λ 17 ) to right of the default wavelength . cpe 7 also has the same default wavelength and it is assigned the wavelength to the left of its default wavelength although this method of using a default wavelength that is in the middle of the range of laser wavelengths has certain advantages as stated above , a system where the default wavelength is not in the middle of the range can also be implemented . in another embodiment of the method , the wavelength of the cpe laser is measured at two temperatures , t 1 and t2 . the temperatures and the corresponding laser wavelengths λ 1 and λ 2 are used to create a linear equation in the form the equation defines the wavelength of the laser as a function of temperature . the two data points , the slope in and the constant are stored in the cpes memory . when the cpe is deployed for the first time , the cpe reports this information , along with its present operating wavelength and its unique identifier to the controller . the initial wavelength used by the cpe to report this information can be any wavelength that it can tune to . the controller compares this information with its database of information on the wavelengths of all other cpes connected to this optical receiver . it then sends control messages to the cpe to either stay at the cpes present wavelength , if it is not close enough to the wavelengths of other cpes to cause obi , or to move to a different wavelength that is far enough apart from the wavelengths of the other cpes so as not to cause obi . in this method , a wavelength grid does not have to be defined . it is also not necessary to limit the characterization of temperature and wavelength to two data points . an implementation with more data points will enable the wavelengths to be set more precisely . one factor that limits the operating temperature range of the cpe is the heating and cooling capacity of the tec . given this constraint , the following approach can be used to extend the operating temperature range of the cpe . one parameter the cpe could report to the controller is its temperature . the controller can collect the temperature readings from every cpe belonging to a single n sized cluster of cpes connected to the optical receiver and can determine the distribution of temperatures for that specific cluster . there are daily and / or seasonal variations in ambient temperature and the controller can respond to the moving envelope of temperature variations . a cluster of cpes connected to an optical receiver is likely confined to a geographic region where the cpes would not experience both extremes of an industrial temperature range simultaneously . when the ambient temperature moves lower than the specified low operating temperature , the controller can move every cpe , in concert to a lower wavelength . the amount of wavelength shift would depend on the amount of change in the ambient temperature . the same approach can be utilized to extend the operating temperature range on the high temperature side . this approach can also minimize the power consumption of the unit because at a lower ambient temperature , the tec consumes less power to maintain wavelengths that are on the shorter side of the optical spectrum . similarly , at higher ambient temperatures , the tec consumes less power to maintain wavelengths that are on the longer side of the optical spectrum . the wavelength movement happens in a way that the cpes will not overlap when moved . for example when cold ambient temperatures are experienced the wavelengths will be moved to the shorter values starting from the shortest wavelength one - by - one to the longest wavelength , lithe ambient temperatures move toward the hot extreme the wavelengths will be moved toward the higher value starting from the longest wavelength to the shortest . in a 1 × n network configuration , where n cpes are connected to a single optical receiver , it is desirable to have n as large as possible . one factor that defines how large n can be is the variation in the intrinsic wavelengths of the lasers . if a group of cpes use lasers manufactured from a single semiconductor wafer then the total available operating wavelength range for the group of lasers will be larger than the operating wavelength range of one laser from the wafer . this is because the laser chips on a wafer have a non - zero wavelength distribution . typically the laser wavelengths across a single water follow a gaussian distribution with a mean central wavelength of λ 0 and standard deviation of ˜ 1 nm . if the laser transmitters are sourced from multiple wafers than the operating wavelength range could be even larger since the wafer - to - wafer mean wavelengths vary from run - to - run when comparing wafers manufactured from a single laser vendor . with multi - sourced laser vendors one could ensure a wide variation in intrinsic laser wavelengths . one could also exploit the natural wafer - to - wafer wavelength variation by building an array of 2 ( or more ) lasers in a single package and choosing laser chips from different wafers that have different mean central wavelengths . in another implementation one could fabricate wafers with custom wavelengths and build a laser array to include standard laser chips and custom laser chips . this allows an even larger operating wavelength range to be available to the cpe allowing the controller to decide which laser transmitter should be turned on based on the accessible wavelengths available in the network at the time the cpe comes online . the decision of which laser in the array is turned on can be done at initial startup and could be changed later as more cpes come online and more usage statistics are gathered about the network of cpes . in one implementation , as the controller gains more information about the usage statistics of each subscriber the cpe wavelengths can be moved into groups or clusters of high data bandwidth users and low data bandwidth users . in the case of low data bandwidth users the adjacent wavelength spacing criteria described above can be relaxed to allow more spectral bandwidth to be opened up for new cpes as they brought online . the relaxed criteria may only be needed when a new cpe that comes online cannot be assigned any of its accessible wavelengths because those wavelengths have been assigned to other cpes . the two way communication channel between the controller and the cpe can also be used to monitor wavelengths and periodic spectral position adjustments can be added to improve system performance . the improvements could he in the form of relaxing the channel spacing for low bandwidth users or making corrections for aging of the laser . this could be done with an optical spectrum analyzer , an optical channel monitor or other wavelength monitoring device . the monitoring device could be shared within one group of n transmitters in a cluster or it could be shared among multiple groups of n sized clusters . embodiments of the present disclosure can include method and system architecture , and apparatus to prevent optical beat interference in optical networks that allow multiple laser transmitters to simultaneously transmit to a shared optical receiver . embodiments of the present disclosure can include a system that allows bi - directional communication path between the cpe and the controller over a downstream and an upstream rf frequency . embodiments of the present disclosure can include a system where the downstream rf frequency of the controller is modulated by a separate transmitter . embodiments of the present disclosure can include a cpe that stores laser wavelength information and determines its default wavelength from this information . embodiments of the present disclosure can include a cpe that transmits this information to the controller . embodiments of the present disclosure can include a controller that compares this information to the wavelength information from other cpes and assigns to the cpe a wavelength such that obi will not occur . embodiments of the present disclosure can include a cpe that receives downstream control messages from the controller carrying the wavelength assignment information , demodulates them , and based on this information uses a tec to appropriately position its optical wavelength on the wavelength grid . embodiments of the present disclosure can include a method that uses information stored on the cpe about its laser transmitter wavelength characteristics and communicates it to the controller . embodiments of the present disclosure can include a method that uses the full spectral bandwidth of a laser transmitter to move it away from its default wavelength if needed . embodiments of the present disclosure can include a method that places cpe wavelengths into spectrally separated wavelength grid to prevent signal degradation from wavelength collisions of simultaneously transmitting cpes . embodiments of the present disclosure can include a system that monitors cpe ease temperatures and responds to daily and seasonal variations in temperature to extend the operational temperature range of the unit . embodiments of the present disclosure can include a method to widen the spectral bandwidth available to cpe by employing an array of laser transmitters . embodiments of the present disclosure can include a method to employ custom semiconductor wafer fabrication to widen the wavelength distribution of laser transmitters available to a cpe . embodiments of the present disclosure can include a method that collects network data bandwidth usage statistics and moves cpe wavelengths into like - user clusters . embodiments of the present disclosure can include a system that employs wavelength monitoring to improve system performance . the terms . program and software and / or the phrases program elements , computer program and computer software are intended to mean a sequence of instructions designed for execution on a computer system ( e . g ., a program and / or computer program , may include a subroutine , a function , a procedure , an object method , an object implementation , an executable application , an applet , a servlet , a source code , an object code , a shared library / dynamic load library and / or other sequence of instructions designed . for execution on a computer or computer system ). the phrase radio frequency ( rf ) is intended to mean frequencies less than or equal to approximately 300 ghz . the term light is intended to mean frequencies greater than or equal to approximately 300 ghz . the term uniformly is intended to mean unvarying or deviate very little from a given and / or expected value ( e . g ., within 10 % of ). the term substantially is intended to mean largely but not necessarily wholly that which is specified . the term approximately is intended to mean at least close to a given value ( e . g ., within 10 % of ). the term generally is intended to mean at least approaching a given state . the term coupled is intended to mean connected , although not necessarily directly , and not necessarily mechanically . the term proximate , as used herein , is intended to mean close , near adjacent and / or coincident ; and includes spatial situations where specified functions and / or results ( if any ) can be carried out and / or achieved . the term distal , as used herein , is intended to mean far , away , spaced apart from and / or non - coincident , and includes spatial situation where specified functions and / or results ( if any ) can be carried out and / or achieved . the term deploying is intended to mean designing , building , shipping , installing and / or operating . the terms first or one , and the phrases at least a first or at least one , are intended to mean the singular or the plural unless it is clear from the intrinsic text of this document that it is meant otherwise . the terms second or another , and the phrases at least a second or at least another , are intended to mean the singular or the plural unless it is clear from the intrinsic text of this document that it is meant otherwise . unless expressly stated to the contrary in the intrinsic text of this document , the term or is intended to mean an inclusive or and not an exclusive or . specifically , a condition a or b is satisfied by any one of the following : a is true ( or present ) and b is false ( or not present ), a is false ( or not present ) and b is true ( or present ), and both a and b are true ( or present ). the terms a and / or an are employed for grammatical style and merely for convenience . the term plurality is intended to mean two or more than two . the term any is intended to mean all applicable members of a set or at least a subset of all applicable members of the set . the phrase any integer derivable therein is intended to mean an integer between the corresponding numbers recited in the specification . the phrase any range derivable therein is intended to mean any range within such corresponding numbers . the term means , when followed by the term “ for ” is intended to mean hardware , firmware and / or software for achieving a result . the term step , when followed by the term “ for ” is intended to mean a ( sub ) method , ( sub ) process and / or ( sub ) routine for achieving the recited result . unless otherwise defined , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this present disclosure belongs , in case of conflict , the present specification , including definitions , will control . the described embodiments and examples are : illustrative only and not intended to be limiting . although embodiments of the present disclosure can be implemented separately , embodiments of the present disclosure may be integrated into the system ( s ) with which they are associated . all the embodiments of the present disclosure disclosed herein can be made and used without undue experimentation in light of the disclosure . embodiments of the present disclosure are not limited by theoretical statements ( if any ) recited herein . the individual steps of embodiments of the present disclosure need not be performed in the disclosed manner , or combined in the disclosed sequences , but may be performed in any and all manner and / or combined in any and all sequences . the individual components of embodiments of the present disclosure need not be combined in the disclosed configurations , but could be combined in any and all configurations . various substitutions , modifications , additions and / or rearrangements of the features of embodiments of the present disclosure may be made without deviating from the scope of the underlying inventive concept . all the disclosed elements and features of each disclosed embodiment can he combined with , or substituted for , the disclosed elements and features of every other disclosed embodiment except where such elements or features are mutually exclusive . the scope of the underlying inventive concept as defined by the appended claims and their equivalents cover all such substitutions , modifications , additions and / or rearrangements the appended claims are not to he interpreted as including means - plus - function limitations , unless such a limitation is explicitly recited in a given claim using the phrase ( s ) “ means for ” or “ mechanism for ” or “ step for ”. sub - generic embodiments of this disclosure are delineated by the appended independent claims and their equivalents . specific embodiments of this disclosure are differentiated by the appended dependent claims and their equivalents .	7
one well known issue associated with the lyophilization of materials ( e . g ., sugars ) is the formation of one of more layers of the solute ( the dissolved materials ) on the top of the frozen solution . these layers form during the freezing of the solution because , typically , the solutions are positioned within the lyophilization chamber on a heat sink which rapidly decreases in temperature and causes the solution to freeze from the bottom up . this bottom up freezing pushes the solute in the liquid phase closer to the top of the solution and increases the solute concentration in the still liquid solution . the high concentration of solute can then form a solid mass that can inhibit the flow of gasses therethrough . in a worse case , the solute forms an amorphous solid that is nearly impermeable and prevents sublimation of the frozen solvent . these layers of concentrated solute can inhibit the sublimation of the frozen solvent and may require use of higher drying temperatures and / or longer drying times . disclosed herein is an apparatus for and method of freezing a material , e . g ., for subsequent lyophilization , that can prevent the formation of these layers and thereby provide efficient sublimation of the frozen solvent . the lyophilization or freeze drying of solutes is the sublimation of frozen liquids , leaving a non - subliming material as a resultant product . herein , the non - subliming material is generally referred to as a solute . a common lyophilization procedure involves loading a lyophilization chamber with a container that contains a liquid solution of at least one solute . the liquid solution is then frozen . after freezing , the pressure in the chamber is reduced sufficiently to sublime the frozen solvent , such as water , from the frozen solution . the lyophilization device or chamber is adapted for the freeze drying of samples in containers by including at least one tray for supporting the container and means for reducing the pressure in the chamber ( e . g ., a vacuum pump ). many lyophilization devices and chambers are commercially available . with reference to fig1 - 3 , the lyophilization chamber includes a heat sink 101 that facilitates the lowering of the temperature within the chamber . the heat sink 101 includes a heat sink surface 102 that is exposed to the internal volume of the lyophilization chamber and is in thermal communication with a refrigerant 103 . the refrigerant 103 can be carried in the heat sink 101 within a refrigerant conduit 104 . the refrigerant conduit 104 can carry the heat sink surface 102 or can be in fluid communication with the heat sink surface 102 for example through a heat sink medium 105 . the heat sink medium 105 is a thermal conductor , not insulator , and preferably has a thermal conductivity of greater than about 0 . 25 , 0 . 5 , and / or 1 w / mk at 25 ° c . according to the novel method described herein , the sample containers 106 do not sit on or in direct thermal conductivity with the heat sink 101 . in one embodiment , the sample containers 106 sit on or are carried by a tray surface 107 that is thermally insulated from the heat sink 101 . in another embodiment , the sample containers 106 are suspended above the heat sink 101 . the tray surface 107 is thermally insulated from the heat sink 101 by a thermal insulator 108 . the thermal insulator 108 has a thermal conductivity of less than about 0 . 2 , less than 0 . 1 , and / or less than 0 . 05 w / mk at 25 ° c . the thermal insulator 108 can be a gas , a partial vacuum , a paper , a foam ( e . g ., a foam having flexibility at cryogenic temperatures ), a polymeric material , or a mixture of thereof . the polymeric material can be free of or substantially free of open cells or can be a polymeric foam ( e . g ., a cured foam ). as used herein , the thermal insulator 108 refers to the material , object and / or space that provides thermal insulation from the heat sink 101 . air is still considered a thermal insulator in a method or apparatus wherein the pressure of the air is decreased due to evacuation of the lyophilization chamber . the level of thermal insulation provided by the thermal insulator 108 can be dependent on the thickness of the thermal insulator 108 . this thickness can be measured by the distance 109 from the heat sink surface 102 to the tray surface 107 , for example . this distance 109 , limited by the internal size of the lyophilization chamber , can be in a range of about 0 . 5 to about 50 mm , for example . this distance 109 can be optimized for specific lyophilization chamber volumes and preferably is greater than about 0 . 5 , 0 . 75 , 1 , 1 . 5 , 2 , 2 . 5 , 3 , 3 . 5 , 4 , 4 . 5 , 5 , 5 . 5 , 6 , 6 . 5 , 7 , 7 . 5 , 8 , 8 . 5 , 9 , 9 . 5 , 10 , 15 , 20 , 25 , 30 , 35 , 40 , 45 , or 50 mm . while the distance 109 can be larger than about 10 mm , the volume within the lyophilization device is typically better used by optimizing the distances below about 20 mm . notably , the distance between the heat sink surface 102 and the tray surface 107 is only limited by the distance between the heat sink surface 102 and the upper heat sink 101 minus the height of a vial 106 . the preferred distance 109 can be dependent on the specific model and condition of lyophilization chamber , heat sink , refrigerant , and the like , and is readily optimized by the person of ordinary skill in view of the present disclosure . in an embodiment where the tray surface 107 is thermally insulated from the heat sink 101 by a gas , a partial vacuum , or a full vacuum , the tray surface 107 is carried by a tray 110 , preferably a rigid tray . notably , the tray surface 107 can be a thermal insulator ( e . g ., foamed polyurethane ) or a thermal conductor ( e . g ., stainless steel ). the tray 110 maintains preferably a fixed distance between heat sink surface 102 and the tray surface 107 during freezing . the tray 110 can be spaced from the heat sink surface 102 by a spacer 111 positioned between the tray 110 and the heat sink surface 102 or can be spaced from the heat sink surface 102 by resting on a bracket 112 affixed to an internal surface 113 ( e . g ., wall ) of the lyophilization chamber . in an embodiment where a spacer 111 supports the tray 110 , the distance from the heat sink surface 102 to the tray surface 107 is the thickness of the spacer 111 plus the thickness of the tray 110 . in agreement with the distances disclosed above , the spacer 111 can have a thickness in a range of about 0 . 5 mm to about 10 mm , about 1 mm to about 9 mm , about 2 mm to about 8 mm , and / or about 3 mm to about 7 mm , for example . the tray 110 can be carried by one or more spacers 111 placed between the heat sink surface 102 and the tray 110 . in another embodiment , the tray 110 can be carried by a rigid thermal insulator . for example the tray 110 can be a thermal conductor ( e . g ., stainless steel ) and supported by ( e . g ., resting on ) a thermal insulator ( e . g ., foamed polyurethane ). the rigid thermal insulator can be combined with spacers to carry the tray . in agreement with the distances disclosed above , the rigid thermal insulator ( with or without the spacer ) can have a thickness in a range of about 0 . 5 mm to about 10 mm , about 1 mm to about 9 mm , about 2 mm to about 8 mm , and / or about 3 mm to about 7 mm , for example . the lyophilization device can include a plurality of heat sinks 101 that individually have a heat sink surface 102 in thermal communication with a refrigerant 103 . in such a lyophilization device , the heat sinks 101 can be disposed vertically in the lyophilization chamber with respect to each other , forming upper and lower heat sinks 101 ( see e . g ., fig1 ). by convention , the lower heat sink surface 102 is disposed between the upper and lower heat sinks and the tray surface 107 is disposed between the upper heat sink 101 and the lower heat sink surface 102 . in this arrangement , the thermal insulator 108 is disposed between the tray surface 107 and the lower heat sink 101 . in another embodiment , each individual sample container 106 can sit on or be carried by a thermal insulator 108 ( see e . g ., fig4 b ). for example , when the sample container is a vial having a top and a bottom there can be a thermally insulating support 114 affixed to the bottom of the vial 115 ( see e . g ., fig4 c ). the thermally insulating support 114 can have a thermal conductivity less than about 0 . 2 w / mk , less than about 0 . 1 w / mk , and / or less than about 0 . 05 w / mk at 25 ° c ., for example . in one embodiment , the vial 106 and the insulating support 114 are different materials ( e . g ., the vial can comprise a glass and the insulating support can comprise a foam or a polymer ). the vial can comprise a sealable vial . another embodiment of the invention includes a method of freezing a liquid solution for subsequent lyophilization . in one embodiment of the method , the lyophilization chamber as described above is loaded with a liquid solution held in a container that includes a solute ( e . g ., an active pharmaceutical agent ) and a solvent . the liquid solution will have a top surface 116 and a bottom surface , wherein the bottom surface 117 is proximal to the heat sink 101 ( see fig5 ). the container is separated from the heat sink 101 by providing a thermal insulator between the container and the heat sink 101 , the thermal insulator having the characteristics described herein . having been loaded into the lyophilization chamber , the liquid solution can be frozen by lowering the temperature of the heat sink 101 and thereby the ambient temperature in the lyophilization chamber . the liquid solution advantageously can be frozen from the top and the bottom surfaces at approximately the same rate to form a frozen solution . a further advantage is that the concurrent water to ice conversion at the top and bottom of the solution avoids problematic freeze - concentration and skin formation observed when the bottom of the solution freezes more rapidly than the top . once frozen , the liquid solution ( now the frozen solution ) can be lyophilized to yield a lyophilized cake . in this embodiment , the thermal insulator provides for the facile freezing of the liquid solution from the top and the bottom within the lyophilization chamber at approximately the same rate . the freezing of the liquid solution from the top and the bottom can be determined by measuring the temperature of the solution during the freezing process . the temperature can be measured by inserting at least two thermocouples into a vial containing the solution . a first thermocouple 118 can be positioned at the bottom of the solution , at about the center of the vial , for example , and a second thermocouple 119 can be positioned at the top of the solution , just below the surface of the solution , in about the center of the vial , for example . the thermal insulator can further provide a water - ice conversion index between a value of about − 2 ° c . and about 2 ° c ., about − 1 ° c . and about 1 ° c ., and / or about − 0 . 5 ° c . and about 0 . 5 ° c . preferably , the water - ice conversion index is zero or a positive value . the water - ice conversion index is determined by a method including first plotting the temperatures reported by the thermocouples at the top ( t t ) and at the bottom ( t b ) of the solution as a function of time . the water - ice conversion index is the area between the curves , in ° c .· minute , between a first nucleation event and the end of water - ice conversion divided by the water - ice conversion time , in minutes . the water - ice conversion time is the time necessary for the temperature at the top ( t t ) of the solution to reduce in value below the freezing point plateau for the solution . the temperature data are collected by loading solution - filled vials into a lyophilization chamber . the lyophilization tray , at t = 0 min , is then cooled to about − 60 ° c . the temperature can then be recorded until a time after which the top and the bottom of the solution cool to a temperature below the freezing point plateau . the areas , positive and negative , are measured from the first nucleation event ( observable in the plot of temperatures , e . g ., such as in fig6 ) 122 until both temperature values cool below the freezing point plateau 123 . the sum of these areas provides the area between the curves . when calculating the area between the curves , the value is positive when the temperature at the bottom of the vial ( t b ) is warmer than the temperature at the top of the vial ( t t ) 120 and the value is negative when the temperature at the top of the vial ( t 1 ) is warmer than the temperature at the bottom of the vial ( t b ) 121 . preferably , the water - ice conversion index is zero or a positive value . this condition will prevent the consequence that the freezing rate at the bottom of the solution is significantly higher than that at the top of the solution . for a particular solution and container configuration , the cooling rate , temperature of the tray , and the thermal insulator can be optimized to provide an area between the curves at or near 0 ° c .· minute . for example , fig7 shows the water - ice conversion indices for 5 wt . % aqueous solutions of sucrose in vials on a stainless steel tray as a function of the distance from the heat sink surface to the stainless steel tray , with air as a thermal insulator provided by a gap between the heat sink surface and the bottom of the stainless steel tray . the tray had a thickness of about 1 . 2 mm . still another embodiment of the invention is a lyophilized cake made by a method disclosed herein . the lyophilized cake can include a substantially dry lyophilized material and a plurality of pores in the lyophilized material having substantially the same pore size . in one embodiment , the lyophilized cake has a pore size that is substantially larger than the pore size of a reference lyophilized cake comprising the same material as the lyophilized cake but made by a standard lyophilization process ( e . g ., placing a vial 106 comprising a liquid solution onto a heat sink 101 within a lyophilization chamber , excluding a thermal insulator between the vial and the heat sink 101 , lowering the temperature of the heat sink 101 and thereby freezing the liquid solution , and then lyophilizing the frozen solution ). the cross - sectional area of the cylindrical pores of the lyophilized cake is preferably at least 1 . 1 , 2 , and / or 3 times greater than the cross - sectional area of the reference lyophilized cake . in another embodiment the lyophilized cake has a substantially consistent pore size throughout the cake . the size of pores in the lyophilized cake can be measured by a bet surface area analyzer . the effective pore radius ( r e ), a measure of the pore size , can be calculated from the measured surface area of the pores ( ssa ) by assuming cylindrical pores . the effective pore radius r e can be determined by the equation r e = 2ε / ssa · p s ·( 1 − ε ) where ssa is the surface area of the pores , ε is the void volume fraction or porosity ( ε = v void / v total = n · r e 2 / v total ), ( 1 − ε ) is the solute concentration in the volume fraction units , and p s is the density of the solid . the following examples are provided to illustrate the invention , but are not intended to limit the scope thereof . effect of gap freezing on lowering product temperature and on pore enlargement the effect of gap freezing on the pore enlargement for a lyophilized 10 % aqueous sucrose solution was studied . multiple 20 ml schott tubing vials were filled with 7 ml of a 10 % aqueous solution of sucrose . these filled vials were placed in a lyostar ii ™ ( fts systems , inc . stone ridge , n . y .) freeze dryer either directly in contact with a top shelf ( heat sink surface ) or on a 6 mm gapped tray . see e . g ., fig1 . multiple probed vials were produced by inserting two thermocouples into the solutions , one at the bottom - center of the vial and the other one about 2 mm below the liquid surface . see . fig5 . the filled vials were then lyophilized by the following procedure : 1 ) the shelf was cooled to 5 ° c . and held at this temperature for 60 minutes ; next 2 ) the shelf was cooled to − 70 ° c . and held at this temperature for 200 minutes ( the internal temperatures of the thermocouple - containing vials were recorded during freezing ); 3 ) after freezing , the 6 mm gapped tray was removed and these vials were placed directly on the bottom shelf ( this provided the vials on the top and bottom shelves with the same shelf heat transfer rate during lyophilization , and thereby a direct comparison of the effect of different freezing methods could be performed ); next 4 ) the lyophilization chamber was evacuated to a set - point of 70 mtorr , and 5 ) a primary drying cycle , during which time the internal temperatures of the frozen samples were recorded , was started . the primary drying cycle involved ( a ) holding the samples for 10 minutes at − 70 ° c . and 70 mtorr , then ( b ) raising the temperature at a rate of 1 ° c ./ min to − 40 ° c . while maintaining 70 mtorr , then ( c ) holding the samples for 60 minutes at − 40 ° c . and 70 mtorr , then ( d ) raising the temperature at a rate of 0 . 5 ° c ./ min to − 25 ° c . while maintaining 70 mtorr , and then ( e ) holding the samples for 64 hours at − 25 ° c . and 50 mtorr ; 6 ) a secondary drying followed , and involved raising the temperature at a rate of 0 . 5 ° c ./ min to 30 ° c . and 100 mtorr , and then holding the samples for 5 hours at 30 ° c . and 100 mtorr . the average product temperatures for the frozen samples in vials on the top and bottom ( gapped - tray ) shelves , during primary drying , are presented in fig8 . it can be seen that the temperature profile of the samples on the bottom shelf is much lower than that of those on the top shelf , which implies that the pore size in the dry layer of the bottom shelf samples is much larger than those on the top shelf , due to the effect of “ gap - freezing .” theoretically , the temperatures are different from the set point temperatures due to evaporative cooling and / or the insulative effect of larger pore sizes . the effective pore radius , r e , for the individual lyophilized cakes was determined by a pore diffusion model . see kuu et al . “ product mass transfer resistance directly determined during freeze - drying using tunable diode laser absorption spectroscopy ( tdlas ) and pore diffusion model .” pharm . dev . technol . ( 2010 ) ( available online at : http :// www . ncbi . nlm . nih . gov / pubmed / 20387998 ). the results are presented in fig9 , where it can be seen that the pore radius of the cakes on the bottom shelf is much larger than that on the top shelf . the results demonstrate that the 6 mm gapped tray is very effective for pore enlargement . acceleration of drying rate for gapped tray by raising the shelf temperature an alternative lyophilization procedure was developed to increase the rate of freeze - drying and through - put for the currently disclosed method . samples of the solutions prepared in example 1 were placed on a 6 mm gap tray and lyophilized on the tray according to the following procedure : 1 ) the shelf was cooled to 5 ° c . and held at this temperature for 60 minutes ; next 2 ) the shelf was cooled to − 70 ° c . and held at this temperature for 70 minutes ( the internal temperatures of the thermocouple - containing vials were recorded during freezing ); 3 ) the shelf was then warmed to − 50 ° c . and held at this temperature for 100 minutes ; next 4 ) the lyophilization chamber was evacuated to a set - point of 50 mtorr , and 5 ) a primary drying cycle , during which time the internal temperatures of the frozen samples were recorded , was started . the primary drying cycle involved ( a ) holding the samples for 10 minutes at − 50 ° c . and 50 mtorr , then ( b ) raising the temperature at a rate of 1 ° c ./ min to − 40 ° c . while maintaining 50 mtorr , then ( c ) holding the samples for 60 minutes at − 40 ° c . and 50 mtorr , then ( d ) raising the temperature at a rate of 0 . 5 ° c ./ min to − 5 ° c . while maintaining 50 mtorr , and then ( e ) holding the samples for 40 hours at − 5 ° c . and 50 mtorr ; 6 ) a secondary drying followed , and involved raising the temperature at a rate of 0 . 5 ° c ./ min to 35 ° c . and 100 mtorr , and then holding the samples for 7 hours at 35 ° c . and 100 mtorr . fig1 shows the average product temperature profile for the gap - frozen samples in example 1 and example 2 . the two profiles indicate that when the shelf temperature is raised to − 5 ° c . from − 25 ° c ., the drying rate is higher . this indicates that the heat transfer rate from the bottom shelf to the vials on the gapped tray can be easily accelerated by raising the shelf temperature . the new heat transfer coefficient of the gapped tray , k s , can be determined and an optimized cycle can be quickly obtained , balancing both the optimal shelf temperature and chamber pressure . the foregoing description is given for clearness of understanding only , and no unnecessary limitations should be understood therefrom , as modifications within the scope of the invention may be apparent to those having ordinary skill in the art .	5
the following description of various embodiments of the application is only illustrative rather than a limitation to the present application and application or use thereof . like reference numerals are used to indicate like parts throughout the drawings . thus , the construction of the like parts will not be descried repeatedly . the dimension relation of various configurations in the drawings a only illustrative , but not representing actual dimension relations . the general configuration and operation principle of a scroll compressor will be described first with reference to fig1 . as shown in fig1 , a scroll compressor 100 ( also referred to as compressor sometimes hereinafter ) generally includes a shell 110 , a top cover 112 provided at one end of the shell 110 , a bottom cover 114 provided at the other end of the shell 110 , and a partition plate 116 provided between the top cover 112 and the shell 110 for separating the internal space of the compressor into high - pressure side and low - pressure side . the space between the partition plate 116 and the top cover 112 constitutes the high - pressure side , while the space among the partition plate 116 , the shell 110 and the bottom cover 114 constitutes the low - pressure side . an intake joint 118 for sucking fluid is provided on the low - pressure side , and a discharge joint 119 for discharging compressed fluid is provided on the high - pressure side . a motor 120 consisting of a stator 122 and a rotor 124 is provided in the shell 110 . a drive shaft 130 is provided in the rotor 124 to drive a compression mechanism consisting of a fixed scroll 150 and a movable scroll 160 . the movable scroll 160 includes an end plate 164 , a hub 162 formed on one side of the end plate and a spiral vane 166 formed on the other side of the end plate . the fixed scroll 150 includes an end plate 154 , a spiral vane 156 formed on one side of the end plate and a discharge port 152 formed substantially at the center of the end plate . a series of compression pockets c 1 , c 2 and c 3 with volumes gradually decreasing from the radial outer side to the radial inner side are formed between the spiral vane 156 of the fixed scroll 150 and the spiral vane 166 of the movable scroll 160 . the compression pocket c 1 at the radial outermost side is at a suction pressure , and the compression pocket c 3 at the radial innermost side is at a discharge pressure . the middle compression pocket c 2 is at a pressure between the suction pressure and the discharge pressure , thus referred to as medium - pressure pocket . the movable scroll 160 is supported at one side thereof by the upper portion of the main bearing housing 140 ( i . e ., the supporting portion ), and the drive shaft 130 is supported at one end thereof by a main bearing 144 provided in the main bearing housing 140 . an eccentric crankpin 132 is provided on one end of the drive shaft 130 , and an unloading bush 142 is provided between the eccentric crankpin 132 and the hub 162 of the movable scroll 160 . under drive of the motor 120 , the movable scroll 160 will orbit relative to the fixed scroll 150 ( i . e ., the central axis of the movable scroll 160 rotates about the central axis of the fixed scroll 150 , but the movable scroll 160 itself cannot rotate about its central axis ) so as to achieve the compression of fluid . the above orbit motion is achieved by a oldham coupling 190 provided between the fixed scroll 150 and the movable scroll 160 . fluid compressed by the fixed scroll 150 and the movable scroll 160 is discharged through the discharge port 152 to the high - pressure side . in order to prevent the fluid on the high - pressure side from flowing back to the low - pressure side via the discharge port 152 in certain situations , a check valve or discharge valve 170 may be provided at the discharge port 152 . in order to compress fluid , effective sealing is required between the fixed scroll 150 and the movable scroll 160 . on the one hand , axial sealing is required between the top end of the spiral vane 156 of the fixed scroll 150 and the end plate 164 of the movable scroll 160 and between the top end of the spiral vane 166 of the movable scroll 160 and the end plate 154 of the fixed scroll 150 . generally , a back pressured cavity 158 is provided on the side of the end plate 154 of the fixed scroll 150 opposite to the spiral vane 156 . a seal assembly 180 is provided in the back pressured cavity 158 , and is limited in the axial displacement by the partition plate 116 . the back pressured cavity 158 is in fluid communication with the medium - pressure pocket c 2 via a through hole ( not shown ) formed in the end plate 154 and extending axially so as to create a force for pushing the fixed scroll 150 towards the movable scroll 160 . since the movable scroll 160 is supported on one side thereof by the supporting portion of the main bearing housing 140 , the fixed scroll 150 and the movable scroll 160 may be effectively pushed together under the pressure in the back pressured cavity 158 . when the pressure in individual compression pockets exceeds a set value , the resultant force from the pressure in these compression pockets will exceed the downward pressure provided in the back pressured cavity 158 , so that the fixed scroll 150 will move upwards . then , the fluid in the compression pockets may leak into the low - pressure side through a gap between the top end of the spiral vane 156 of the fixed scroll 150 and the end plate 164 of the movable scroll 160 and a gap between the top end of the spiral vane 166 of the movable scroll 160 and the end plate 154 of the fixed scroll 150 so as to achieve unloading , thereby providing axial compliance for the scroll compressor . on the other hand , radial sealing is required between side surfaces of the spiral vane 156 of the fixed scroll 150 and of the spiral vane 166 of the movable scroll 160 . such radial sealing therebetween is generally implemented by means of a centrifugal force generated from the motion of the movable scroll 160 and a drive force provided from the drive shaft 130 . specifically , in operation , under drive of the motor 120 , the movable scroll 160 will orbit relative to the fixed scroll 150 , so that the movable scroll 160 will generate a centrifugal force . in addition , the eccentric crankpin 132 of the drive shaft 130 may also generate a drive component force during rotation for facilitating the radial sealing between the fixed scroll and the movable scroll . the spiral vane 166 of the movable scroll 160 will abut against the spiral vane 156 of the fixed scroll 150 by means of the centrifugal force and the drive component force mentioned above , thereby achieving the radial sealing therebetween . when incompressible matters ( e . g ., solid impurities , lubricating oil and liquid lubricate ) enter the compression pockets and are jammed between the spiral vane 156 and the spiral vane 166 , the spiral vane 156 and the spiral vane 166 can temporarily move away from each other in the radial direction so as to allow the foreign matters to pass therethrough , thereby preventing damage to the spiral vane 156 or 166 . such capability of radial separation from each other provides radial compliance for the scroll compressor , improving the reliability of the compressor . the process for lubricating various parts of the compressor will be described below . in an example of the vertical scroll compressor shown in fig1 , lubricant is stored at the bottom of the shell of the compressor . accordingly , a passage is formed in the drive shaft 130 and extends substantially in the axial direction of the drive shaft 130 , including a central hole 136 formed in the lower end of the drive shaft 130 and an eccentric hole 134 extending from the central hole 136 upwards to the end face of the eccentric crankpin 132 . an end of the central hole 136 is immersed in lubricant at the bottom of the shell of the compressor or otherwise is provided with lubricant . in an example , a lubricant supplying means may be provided in or near the central hole 136 , for example , the oil pump or fork 138 as shown in fig1 or the like . in operation of the compressor , lubricant is provided into one end of the central hole 136 by the lubricant supplying means , is then pumped or threw into the eccentric hole 134 under the centrifugal force as the drive shaft 130 rotates , and flows upwards along the eccentric hole 134 to the end face of the eccentric crankpin 132 . the lubricant discharged out of the end face of the eccentric crankpin 132 flows downwards through a gap between the unloading bush 142 and the eccentric crankpin 132 and a gap between the unloading bush 142 and the hub 162 into the recess 146 of the main bearing housing 140 . a part of the lubricant collected in the recess 146 flows downwards through the main bearing 144 , and another part of the lubricant is stirred by the hub 162 , then flows upwards to the underside of the end plate 164 of the movable scroll 160 and spreads over the thrust surfaces of the movable scroll 160 and of the main bearing housing 140 as the movable scroll 160 orbits . in order to improve the lubricating and cooling effect on the rotor 124 of the motor , a radial hole 139 may be arranged in the drive shaft 130 to directly provide lubricant from the eccentric hole 134 to the rotor 124 . furthermore , a radial hole 137 may also be arranged in the drive shaft 130 to directly provide lubricant to the lower bearing for supporting the lower end of the drive shaft 130 . in operation of the compressor , the lubricant supplied to various movable parts of the compressor is threw and splashed so as to form droplets or mist . such droplets or mist of the lubricant will be introduced into working fluid ( or refrigerant ) sucked from the intake joint 118 . then , the working fluid mixed with the droplets of the lubricant is sucked into the compression pockets between the fixed scroll 150 and the movable scroll 160 so as to achieve the lubrication , sealing and cooling inside these scrolls . such lubrication between the movable scroll and the fixed scroll is generally known as oil mist lubrication . as described above , the axial sealing between the movable scroll 160 and the fixed scroll 150 is mainly achieved by the main bearing housing 140 for axially supporting the movable scroll 160 as well as the seal assembly 180 and the back pressured cavity 158 for providing the fixed scroll 150 with the back pressure . as shown in fig2 and 3 , the thrust surface t 1 of the main bearing housing 140 and the thrust surface t 2 of the movable scroll 160 are commonly formed to be flat . the lubrication process between the main bearing housing 140 and the movable scroll 160 in such configuration will be described below with reference to fig4 a and 4b . in fig4 a , t 1 schematically denotes the thrust surface of the main bearing housing 140 ; ob schematically denotes the orbiting path of any point on the movable scroll 160 , i . e ., the point does not rotate about its axis but moves only along the path ob ; r denotes a radius of the orbiting path and is referred to as an orbiting gyration radius of the movable scroll ; f 1 denotes a drive force of the drive shaft 130 applied to the movable scroll 140 ; ar 1 and ar 2 denote the paths at different stages of the orbiting motion of any point on the movable scroll 160 . only the orbiting path ob of one point on the movable scroll is shown in fig4 a , however , the person skilled in the art will appreciate that each point on the movable scroll makes similar orbiting motion in practice . in fig4 b , t 2 denotes the thrust surface of the movable scroll 160 . in operation of the scroll compressor , the movable scroll 160 may be subject to a drive force from the drive shaft 130 , a gas force applied by gas in the compression pockets ( including a horizontal component force and a vertical component force ), a pressure in the back pressured cavity and a supporting force from the main bearing housing . the movable scroll will tilt with respect to the main bearing under the action of these forces . thus , as shown in fig4 b , an angle is formed between the thrust surface t 2 of the movable scroll and the thrust surface t 1 of the main bearing housing . in orbiting motion of the movable scroll , one point p on the thrust surface t 2 may move relative to the thrust surface t 1 along the path ob in the directions indicated by arrows ar 1 and ar 2 . as shown in fig4 b , a distance spaced between the thrust surfaces t 1 and t 2 in the axial direction of the compressor is gradually decreased in the extent of arrow ar 1 but increased in the extent of arrow ar 2 . as such , in orbiting motion of the movable scroll , the lubricant between the thrust surfaces t 1 and t 2 has increasing pressure in the extent of arrow ar 1 so as to generate a fluid dynamic pressure forcing the two thrust surfaces t 1 and t 2 to go away from each other , thereby forming a lubricant film capable of providing good lubrication ( i . e ., forming a so - called wedge effect ). besides , the lubricant between the thrust surfaces t 1 and t 2 has a decreasing pressure in the extent of arrow ar 2 so as to destroy the lubricant film . with the above process , the movable scroll floats on the main bearing housing by the hydrodynamic lubrication oil film of lubricant during the orbiting motion , thereby effectively reducing the friction therebetween . however , in certain situations , the above tilt orbiting motion of the movable scroll may not be effectively performed , resulting in that the above - mentioned hydrodynamic lubrication oil film of lubricant cannot be formed . for example , with the increasing environmental requirements , there is a trend to use co 2 as the refrigerant of the compressor . in case of using co 2 as refrigerant , on the one hand , since the pressure in the compression pockets is to be increased , the height of the scroll vane will be designed to be lowered in order to enhance the strength of the scroll ; on the other hand , since the pressure in the compression pockets is increased , the overall force applied to the movable scroll may be changed such as to reduce the tilt degree of the movable scroll during the orbiting motion . according to embodiments of the application , even if the movable scroll cannot carry out effective tilt orbiting motion , the hydrodynamic lubrication oil film of lubricant can be formed effectively . the configuration of the main bearing housing 40 according to a first embodiment of the application will be described below with reference to fig5 - 7 . as shown in fig5 , the main bearing housing 40 for a scroll compressor may include the thrust surface s 1 for supporting the movable scroll 160 . an uneven construction w is formed on at least part of the thrust surface s 1 such that a hydrodynamic lubrication oil film can be formed from lubricant between the main bearing housing 40 and the movable scroll 160 . preferably , the uneven construction w may be formed over the entire thrust surface s 1 . the uneven construction w may include a plurality of protrusions or recesses . in particular , the uneven construction w on the thrust surface s 1 of the main bearing housing 40 includes at least a surface inclined relative to the thrust surface of the movable scroll 160 . in this case , the thrust surface of the movable scroll 160 may be flat or , like the main bearing housing of the invention , may be also formed with an uneven construction . as shown in the section views of fig6 and 7 , in the first embodiment , the uneven construction w may be formed in a corrugated shape . more specifically , the corrugated surface may include one or more waves . in an example shown in fig7 , the corrugated surface is exemplarily shown as including waves w 1 , w 2 and w 3 . the locus lines a 1 , a 2 , a 3 of the crest ( or trough ) of individual waves w 1 , w 2 and w 3 ( that is , projection of extension of the crest or trough of a wave on a plane ) are configured such that the locus lines a 1 , a 2 , a 3 are formed as a circle with the center being the central axis o - o of the main bearing housing . each wave w 1 , w 2 and w 3 of the corrugated surface may be formed in a wavy - shape , e . g ., a sinusoidal shape . alternatively , as shown in fig8 , each wave w 1 , w 2 and w 3 of the corrugated surface may be formed in a trapezoidal shape . as shown in fig9 , each wave w 1 , w 2 , w 3 and w 4 of the corrugated surface may be formed in a triangular shape . person skilled in the art will appreciate that the individual waves of the corrugated surface may also be formed in any other shape . in the individual wave shapes as shown in fig7 - 9 , the wavelength l of each wave of the corrugated surface ( i . e ., the length between two adjacent crests or troughs ) may be set to be between 0 . 25 and 2 times as long as the orbiting gyration radius r of the movable scroll . preferably , the wavelength l of each wave of the corrugated surface may be set to be between 0 . 75 and 1 . 5 times as long as the orbiting gyration radius r of the movable scroll . more preferably , the wavelength l of each wave of the corrugated surface ( i . e ., the length between two adjacent crests or troughs ) may be set to be equal to the orbiting gyration radius r of the movable scroll . the amplitude h of the corrugated surface ( i . e ., vertical height between the crest and the trough ) may be set to be larger than 10 micrometers , preferably between 30 and 100 micrometers . in the example as shown in fig8 , when each wave of the corrugated surface is a trapezoidal wave , the length a of the top side z of the trapezoidal wave may be set to be between ⅙ and ½ times as long as the wavelength l of the trapezoidal wave . in the example as shown in fig9 , there may be a platform z at the crest of the triangular wave , and the length a of the platform z may be also set to be between ⅙ and ½ times as long as the wavelength l of the triangular wave . the above - mentioned corrugated surface may be produced by any one of the following processes , for example , a ) machining , such as turning or grinding ; b ) pressing ; c ) stamping . further , the corrugated surface may be integrally formed on the main bearing housing 40 , or the corrugated surface may be formed on a separate member ( for example , a stamping part ) which is then assembled onto the main bearing housing 40 . the process of forming the hydrodynamic lubrication oil film of lubricant according to the first embodiment of the application will be described below with reference to fig1 . in fig1 , s 1 schematically denotes the thrust surface of the main bearing housing 40 ; w denotes the section of the uneven construction ( i . e ., the corrugated surface ) on the main bearing housing 40 ; ob schematically denotes the orbiting path of any point on the movable scroll 160 ; r denotes a radius of the orbiting path and is referred to as an orbiting gyration radius of the movable scroll . it is assumed that the movable scroll still orbits in the clockwise direction . as shown in fig1 , when any point on the movable scroll orbits along the path ob , the point may pass over the crest and trough of the corrugated surface . provided that the movable scroll cannot make valid tilt orbiting motion due to a variety of reasons ( that is , the thrust surface of the movable scroll moves horizontally ), due to the nature of the corrugated surface , the points on the corrugated surface is differently distant from the thrust surface of the movable scroll . when a point on the movable scroll moves from a trough towards a crest of the corrugated surface ( e . g ., in the range shown by arrow ar 3 in the figure ), the spaced distance between the movable scroll and the corrugated surface is gradually decreased , so that the hydrodynamic lubrication oil film of lubricant is formed of the lubricant therebetween due to the wedge effect ; and when a point on the movable scroll moves from a crest towards a trough of the corrugated surface ( e . g ., in the range shown by arrow ar 4 in the figure ), the spaced distance between the movable scroll and the corrugated surface is gradually increased , so that the hydrodynamic lubrication oil film of lubricant is damaged . thus , generally , with the presence of the corrugated surface , even if the movable scroll does not make tilt orbiting motion , the effective hydrodynamic lubrication oil film may be formed on 50 % area of the thrust surfaces of the movable scroll and the main bearing housing . certainly , when the movable scroll can perform a tilt orbiting motion , with the configuration of the application , the effective oil film of lubricant may also be formed between the main bearing housing and the movable scroll . as described above , the wavelength l of each wave of the corrugated surface may be set to be between 0 . 25 and 2 times as long as the orbiting gyration radius r of the movable scroll . when the wavelength l is 0 . 25 times as long as r , a point on the movable scroll may pass over several crests and troughs while orbiting , thereby effectively forming the oil film of lubricant . when the wavelength l is 2 times as long as r , a point on the movable scroll may orbit over a part of a wave . even so , the gap between any point and the main bearing may be gradually decreased within 50 % time duration of orbiting motion , and thus the hydrodynamic oil film may be formed . in a second embodiment shown in fig1 , the locus line of the crest ( or trough ) of each wave of the corrugated surface may be configured such as to be a line extending radially from the central axis of the main bearing housing . in a third embodiment shown in fig1 , the locus line of the crest ( or trough ) of each wave of the corrugated surface may be configured such as to be a line perpendicular to the central axis of the main bearing housing . in the third embodiment , the locus lines may be parallel . in any other embodiment not shown , the locus line of the crest ( or trough ) of each wave of the corrugated surface may be configured such as to be a spiral line gradually unwound from the radial inside towards the radial outside of the main bearing housing . in the second , third and any other embodiment , each wave of the corrugated surface may be formed in the form of one of the sinusoidal wave , the triangular wave and the trapezoidal wave , and the parameters , such as wavelength l , amplitude h , length of platform z and the like , of each wave of the corrugated surface may be set as that in the first embodiment . certainly , the second , third and any other embodiment may bring about the similar advantageous effects as the first embodiment . a fourth embodiment of the application will be described below with reference to fig1 . a movable scroll 160 for a scroll compressor according to the fourth embodiment may include a thrust surface s 2 for being supported by the main bearing housing 140 . an uneven construction w is formed on at least part of the thrust surface such that a hydrodynamic lubrication oil film can be formed of lubricant between the movable scroll 160 and the main bearing housing 140 . similar to the first embodiment , in the fourth embodiment , the uneven construction w may be formed on the entire thrust surface s 2 of the movable scroll . the configuration and parameters of the uneven construction w may be chosen with reference to the first to third embodiments . particularly , the uneven construction w on the thrust surface s 2 of the movable scroll 160 may include at least a surface inclined with respect to the thrust surface of the main bearing housing 140 . preferably , the uneven construction w may be shaped as a corrugated surface . the corrugated surface may include one or more waves , and the locus line of the crest or trough of each wave may be configured in one of the following forms : a ) the locus line forms a circle with its center being the central axis of the movable scroll ; b ) the locus line is formed as a spiral line gradually unwound from the radial inside towards the radial outside of the movable scroll ; c ) the locus line is formed as a line extending radially from the central axis of the movable scroll ; d ) the locus line is formed as a line perpendicular to the central axis of the movable scroll . each wave of the corrugated surface may be formed as one of a sinusoidal wave , a triangular wave and a trapezoidal wave . the wavelength of each wave of the corrugated surface is ranged between 0 . 25 and 2 times , preferably between 0 . 75 and 1 . 5 times as long as the orbiting gyration radius of the movable scroll , more preferably , equal to the orbiting gyration radius of the movable scroll . the amplitude of each wave of the corrugated surface may be set to be larger than 10 micrometers , preferably between 30 and 100 micrometers . when each wave of the corrugated surface is a trapezoidal wave , the length of top side of the trapezoidal wave may be between ⅙ and ½ of the wavelength of the trapezoidal wave . similarly , the corrugated surface on the movable scroll may be produced by one of the following processes : a ) machining , such as turning or grinding ; b ) pressing ; c ) stamping . the corrugated surface may be integrally formed on the movable scroll , and the corrugated surface may be formed on a separate member which is then assembled onto the movable scroll . by using the fourth embodiment alone or in combination with the first embodiment , the same advantageous effects as produced from the first embodiment can be achieved . according to the application , there may be further provided a scroll compressor including the main bearing housing according to the first , second or fourth embodiment and / or the movable scroll according to the fourth embodiment . the scroll compressor may be a scroll compressor using co 2 as refrigerant . furthermore , the scroll compressor may be a scroll compressor with a variable frequency operating function . while various embodiments and variations of the present application have been described in detail above , person skilled in the art will appreciate that the present application is not limited to the specific embodiments and variations described above but may include other possible group or combination . for example , according to an aspect of the application , a main bearing housing for a scroll compressor is provided , including a thrust surface for supporting a movable scroll , wherein an uneven construction may be formed on at least part of the thrust surface such that a hydrodynamic lubrication oil film may be formed from lubricant between the main bearing housing and the movable scroll . according to a second aspect of the application , the uneven construction may be formed on the entire thrust surface . according to a third aspect of the application , the uneven construction may be formed in the form of a corrugated surface . according to a fourth aspect of the application , the corrugated surface may include one or more waves , each wave has a crest or trough with a locus line in one of the following forms : a ) a circle with its center being the central axis of the main bearing housing ; b ) a spiral line gradually unwound from the radial inside towards the radial outside of the main bearing housing ; c ) a line extending radially from the central axis of the main bearing housing ; and d ) a line perpendicular to the central axis of the main bearing housing . according to a fifth aspect of the application , each wave of the corrugated surface may be one of a sinusoidal wave , a triangular wave and a trapezoidal wave . according to a sixth aspect of the application , each wave of the corrugated surface may have a wavelength being between 0 . 25 and 2 times as long as an orbiting gyration radius of the movable scroll . according to a seventh aspect of the application , each wave of the corrugated surface may have a wavelength being between 0 . 75 and 1 . 5 times as long as an orbiting gyration radius of the movable scroll . according to an eighth aspect of the application , each wave of the corrugated surface may have a wavelength equal to an orbiting gyration radius of the movable scroll . according to a ninth aspect of the application , each wave of the corrugated surface may have an amplitude larger than 10 micrometers , preferably between 30 and 100 micrometers . according to a tenth aspect of the application , in case of each wave of the corrugated surface being the trapezoidal wave , a top side of the trapezoidal wave may have a length being ⅙ ( a sixth ) to ½ ( a half ) of a wavelength of the trapezoidal wave ; and in case of each wave of the corrugated surface being the triangular wave , the triangular wave includes a platform at its vertex angle , and the platform has a length being ⅙ to ½ of a wavelength of the triangular wave . according to an eleventh aspect of the application , the corrugated surface may be produced in one of the following processes : a ) machining , b ) pressing , c ) stamping . according to a twelfth aspect of the application , the corrugated surface may be integrally formed on the main bearing housing , or the corrugated surface may be formed on a separate member and then assembled onto the main bearing housing . according to a thirteenth aspect of the application , the uneven construction on the thrust surface of the main bearing housing may include at least a surface inclined relative to the thrust surface of the movable scroll . according to a fourteenth aspect of the application , there is provided a movable scroll for a scroll compressor , including a thrust surface for being supported by a main bearing housing , wherein an uneven construction may be formed on at least part of the thrust surface such that a hydrodynamic lubrication oil film may be formed from lubricant between the movable scroll and the main bearing housing . according to a fifteenth aspect of the application , the uneven construction may be formed on the entire thrust surface . according to a sixteenth aspect of the application , the uneven construction may be formed in the form of a corrugated surface . according to a seventeenth aspect of the application , the corrugated surface may include one or more waves , each wave has a crest or trough with a locus line in one of the following forms : a ) a circle with its center being the central axis of the movable scroll ; b ) a spiral line gradually unwound from the radial inside towards the radial outside of the movable scroll ; c ) a line extending radially from the central axis of the movable scroll ; and d ) a line perpendicular to the central axis of the movable scroll . according to an eighteenth aspect of the application , each wave of the corrugated surface may be one of a sinusoidal wave , a triangular wave and a trapezoidal wave . according to a nineteenth aspect of the application , each wave of the corrugated surface may have a wavelength being between 0 . 25 and 2 times as long as an orbiting gyration radius of the movable scroll . according to a twentieth aspect of the application , each wave of the corrugated surface may have a wavelength being between 0 . 75 and 1 . 5 times as long as an orbiting gyration radius of the movable scroll . according to a twenty - first aspect of the application , each wave of the corrugated surface may have a wavelength equal to an orbiting gyration radius of the movable scroll . according to a twenty - second aspect of the application , each wave of the corrugated surface may have an amplitude larger than 10 micrometers , preferably between 30 and 100 micrometers . according to a twenty - third aspect of the application , in case of each wave of the corrugated surface being the trapezoidal wave , a top side of the trapezoidal wave may have a length being ⅙ ( a sixth ) to ½ ( a half ) of a wavelength of the trapezoidal wave ; and in case of each wave of the corrugated surface being the triangular wave , the triangular wave includes a platform at its vertex , and the platform has a length being ⅙ to ½ of a wavelength of the triangular wave . according to a twenty - fourth aspect of the application , the corrugated surface may be produced in one of the following processes : a ) machining , b ) pressing , c ) stamping . according to a twenty - fifth aspect of the application , the corrugated surface may be integrally formed on the movable scroll , or the corrugated surface may be formed on a separate member and then assembled onto the movable scroll . according to a twenty - sixth aspect of the application , the uneven construction on the thrust surface of the main bearing housing may include at least a surface inclined relative to the thrust surface of the main bearing housing . according to a twenty - seventh aspect of the application , a scroll compressor is provided , including at least one of the above - mentioned main bearing housing and the above - mentioned movable scroll . according to a twenty - eighth aspect of the application , the scroll compressor may be a scroll compressor using co 2 as working medium . according to a twenty - ninth aspect of the application , the scroll compressor is a scroll compressor with variable frequency operating function . while various embodiments of the present application have been described in detail herein , it should be understood that the present application is not limited to the specific embodiments described and illustrated herein in detail , and that those skilled in the art can also make other variations and modifications without departing from the spirit and scope of the application . these variations and modifications should also be deemed to fall into the protective scope of the application . furthermore , all the elements described herein can be replaced by other technically equivalent elements .	5
temperature - controlled actuators described herein use an inhomogeneous core - wire that , when subjected to a pulling force , stretches by different amounts at different locations . these different amounts depend , in part , on temperatures at various sections of the core - wire . at least one portion of the core - wire includes a shaped memory alloy that has been pre - heated to take a pre - defined shape when in its austenite state . this portion of the wire is attached to and controls the shape of a flexible portion of the actuator . a weight or other force applicator coupled to the proximal section of the core - wire maintains tension along the core - wire . referring to fig1 , a first embodiment of an actuator 10 incorporating the principles of the invention includes a housing 12 having a proximal portion and a distal portion . in the illustrated embodiment , the housing 12 is a flexible tube made of articulating segments . however , the housing 12 can also be a tube having a flexible distal portion and a rigid proximal portion . a housing 12 has an equilibrium compressed state in which it defines a pre - selected path . additionally , the housing 12 can be a tube having a rigid distal portion coupled to a rigid proximal portion by one or more hinges to allow movement of the distal portion relative to the proximal portion . in other embodiments , the housing 12 need not be tubular at all , but can instead be open to its surroundings . a sleeve 14 enclosing the proximal portion of the housing 12 provides rigid support to the proximal portion . the distal portion of the housing 12 , however , is free to change its shape . in particular , the distal portion is free to change between a relaxed shape , shown in fig1 , and a tensioned shape , shown in fig2 . in fig1 and 2 , the relaxed shape is a coil and the tensioned shape is straight . however , the invention is not constrained to these two particular configurations . as indicated by fig1 , the housing 12 can be a segmented structure capable of articulation between its constituent segments . however , the housing 12 can also be any flexible section capable of freely making the required transition between the curved state of fig2 and the extended state of fig1 . the housing 12 may be a close wound coil , with or without preload , or it may be an open wound coil . the housing 12 can include baffles , bellows , or any such flexible and compressible member . a cross - sectional view of the actuator 10 , shown in fig3 and 4 , reveals a portion of the structure that enables a change in temperature to toggle the housing 12 between its relaxed state and its tensioned state . referring to fig3 , a core - wire 16 anchored at an end cap 19 at the distal end of the housing 12 extends through a lumen between the distal and proximal ends thereof . the end cap 19 provides mechanical coupling between the core - wire 16 and the housing 12 so that a change in the path traced out by the core - wire 16 results in a corresponding change in the path traced out by the housing 12 . coupling between the housing 12 and the core - wire 16 can also be provided by a direct connection between the housing 12 and the core - wire 16 . in addition , the point of coupling need not be at the tip of the housing 12 as shown in fig3 . by proximally displacing the coupling point , for example , the tip can be made floppy . a proximal end of the wire 16 is operably connected to a tensioning element 20 that applies a constant force , denoted by the force vector { right arrow over ( f )}, to the proximal end of the core - wire 16 . because the core - wire 16 is anchored to the end cap 19 , this constant force does not move the core - wire 16 . instead , it places the wire 16 under tension . this tension is manifested as a stress field throughout the core - wire 16 . in response to the stress field , the core - wire 16 stretches . the design of the core - wire 16 is such that at a particular temperature , different portions of the core - wire 16 stretch by different amounts . the tensioning element 20 is represented in fig3 as a weight . however , any mechanism for applying a force can be used as a tensioning element 20 . for example , a pulley may be used to direct the force at an angle relative to the force vector . the magnitude of the force need not be constant . in other embodiments , the weight can be replaced by a spring mechanism . a distal section 22 of the core - wire 16 is made from a shaped - memory alloy . a suitable alloy from which the core - wire 16 can be manufactured is a nickel - titanium alloy sold under the trade name nitinol ™. such an alloy has the property that when deformed and heated past a critical temperature , which is on the order of 700 degrees fahrenheit for nitinol , it “ remembers ” its deformed shape . a distal section 22 is formed by deforming a distal section of the core - wire 16 , heating it past a critical temperature , and then cooling it . the shape into which the distal section 22 is deformed then becomes the remembered shape . when treated in this manner , the distal section 22 acquires temperature - dependent mechanical properties . in particular , the distal section 22 has the property that it can be in one of two states : an austenite state , in which it reverts to its remembered shape , and a martensite state , in which it is super - elastic . the state in which the distal section 22 of the core - wire 16 finds itself depends on its temperature . when heated past an austenite transformation temperature , the distal section 22 reverts to its austenite state . in this state , the distal section 22 has a tendency to recover its remembered shape . in addition , when the distal section 22 is stressed , it yields reluctantly . an applied stress on the distal section 22 in its austenite state results in comparatively little elongation of that section . in contrast , when cooled below a martensite transformation temperature , the distal section 22 becomes super - elastic . in its martensite state , the distal section 22 yields readily . thus , an applied stress results in considerable strain , and hence considerable elongation of the distal section 22 . a proximal section 24 of the core - wire 16 is made of a rigid material , for example stainless steel , whose strain response is only weakly dependent on temperature . alternatively , the proximal section 24 can be made of a super - elastic alloy having an austenite transformation temperature that is less than the austenite transformation temperature of the distal section 22 . in operation , the force applied by the tensioning element 20 urges the core - wire 16 to stretch . when the distal section 22 of the core - wire 16 is below its martensite transformation temperature , the distal section 22 loses its tendency to assume its remembered shape . in addition , the distal section 22 becomes super - elastic . as a result , most of this stretching occurs at the distal section 22 . the proximal section 24 , being more rigid than the super - elastic distal section 22 , stretches very little . because the distal end of the core - wire 16 is anchored to the end cap 19 , there is a tendency for the core - wire 16 to straighten the distal section of the housing 12 , as shown in fig4 . in contrast , when the distal section 22 of the core - wire 16 is above its austenite transformation temperature , it loses its super - elastic properties and assumes its remembered shape . as a result , it stretches very little . in this case , what stretching occurs is borne by the proximal section 24 . in addition , the distal section 22 reverts to its remembered shape . because the core - wire 16 is mechanically coupled to the housing 12 by the end cap 19 , the distal section of the housing 12 likewise assumes this remembered shape . as noted above , a material such as nitinol becomes super - elastic when it transitions from its austenite form to its martensite form . this can occur when the nitinol , in its austenite form , is cooled to below its martensite transition temperature . another way to cause a transition from austenite to martensite , however , is to pull so hard on an austenite wire that it turns into martensite . martensite formed in this way is referred to as “ stress - induced martensite ”. additional embodiments of the invention , described below , make use of stress - induced martensite . in a second embodiment , shown in fig5 and 6 , the core - wire 16 has a distal section 22 , a proximal section 24 , and an intermediate section 26 between the distal and proximal sections 22 , 24 . the distal section 22 and the intermediate section 26 are similar to the distal section 22 and proximal section 24 described above in connection with the first embodiment . as was the case with the first embodiment , a tensioning element 20 coupled to the proximal end applies a constant force that places the core - wire 16 in tension . the resulting tension causes a stress field throughout the core - wire 16 , including within its proximal section 24 . the strain experienced by the proximal section 24 in response to that stress depends in part on whether the distal section 22 is in its austenite state or in its martensite state . referring to fig5 , when the distal section 22 is below its martensite transition temperature , it becomes super - elastic . as a result , most of the stress imposed by the tensioning element 20 is relieved by the stretching of the distal section 22 . because the stress is relieved primarily by stretching of the distal section 22 , the proximal section 24 undergoes comparatively little strain . as a result , the proximal section 24 remains in its austenite form . referring now to fig6 , when the distal section 22 is above its austenite transition temperature , it loses its super - elastic properties and reverts to its remembered shape . as a result , the distal section 22 no longer contributes so generously toward relieving the stress present throughout the core - wire 16 . in this case , the stress strains the proximal section 24 and thereby causes it to transition into its martensite form . once in its martensite form , the proximal section 24 becomes super - elastic . in its super - elastic form , the proximal section 24 stretches sufficiently to relieve the stress in the core - wire 16 . the proximal section 24 and the intermediate section 26 can be different materials . however , to avoid having to join the proximal and middle sections , it is convenient to make them integral with each other . in the illustrated second embodiment , the proximal section 24 is formed by grinding down a section of the core - wire 16 . in this case , the proximal section 24 is that portion of the wire 16 whose diameter has been reduced by grinding and the intermediate section 26 is that portion of the wire 16 that retains its original diameter . because the proximal section 24 has a smaller diameter than the intermediate section 26 , it yields more to stress than does the intermediate section 26 . this , in turn , ensures that the intermediate section 26 can remain in its austenite form even when the proximal section 24 has transitioned into its martensite form . in a third embodiment , shown in fig7 and 8 , the roles of the proximal and distal sections of the core - wire 16 are opposite those in the second embodiment . in this case , a nitinol core - wire 16 has a reduced - diameter distal section 22 . as a result , the distal end responds to sufficient stress by transitioning into stress induced martensite . in so doing , it acquires super - elastic properties and stretches as shown in fig7 . because the core - wire 16 is coupled to the housing 12 by the end cap 19 , this causes the housing 12 to straighten . in the absence of such stress , the distal end reverts to austenite and recovers a remembered shape . again , because the core - wire 16 is coupled to the housing 12 by the end cap 19 , this causes the housing 12 to assume that remembered shape . the proximal section 24 of the core - wire 16 has an austenite transition temperature that is higher than the austenite transition temperature of the intermediate section 26 of the core - wire 16 . as was the case with the second embodiment , a tensioning element 20 applies a pulling force to the proximal end . referring to fig8 , when the proximal end of the core - wire 16 is below its martensite transition temperature , it becomes martensite . as a result , it stretches considerably , so much so that it manages to relieve most of the stress applied throughout the core - wire 16 . the proximal section 24 thus isolates the distal section 22 from stress sufficient to turn it into stress induced martensite . because the distal section 22 remains austenite , it assumes its remembered shape . because of the coupling between the core - wire 16 and the housing 12 , the housing 12 likewise assumes the remembered shape . referring to fig7 , when the proximal section 24 is above its austenite transition temperature , it becomes austenite , and therefore does not stretch significantly in response to the applied stress . as a result , the stress must be borne by the remainder of the core - wire 16 . because of its reduced diameter , the distal section 22 of the core - wire 16 experiences considerable stress , enough to cause it to transition into stress - induced martensite . in doing so , it loses its remembered shape and straightens . because of the coupling between the core - wire 16 and the housing 12 , the housing 12 also straightens . the tensioning element 20 shown in fig6 - 8 is a collar having a slot for accepting the sleeve 14 and a central opening for attachment to the core - wire 16 . the slot enables the tensioning element 20 to move axially along the sleeve 14 , thereby changing the tension applied to the core - wire 16 . the axial position of the slot can be adjusted by , for example , by a rack and pinion arrangement . however , no particular form of tensioning element 20 is required . what is important is that the core - wire 16 be constantly sufficient tension to stretch a portion of the core - wire when the temperature provides an opportunity to do so . another embodiment of a tensioning element 20 is a screw that mounted across the diameter of the housing . the screw has a hole in its shaft that engages the core - wire 16 . as the screw turns , the core - sire 16 can be tightened or loosened in the same manner that a string is tuned on a guitar or other stringed instrument . the austenite transformation temperature and the martensite transformation temperature can be adjusted by known methods such as heat treating the alloy or doping the alloy . it is to be understood that while the invention has been described in conjunction with the detailed description thereof , the foregoing description is intended to illustrate and not limit the scope of the invention , which is defined by the scope of the appended claims . other aspects , advantages , and modifications are within the scope of the following claims .	0
as previously indicated , the essential feature of the present invention lies in the use of a small target and in the use of a target which is diamond shaped . this is best illustrated by fig1 which is a comparison of the small and large target approaches . a wafer 11 is shown broken down into a plurality of squares , each square representing a micro - circuit . as indicated previously , there is a need for a target on at least two sites on the wafer . thus , there are shown conventional target arrays 13 on each side of the wafer 11 . the target array 13 on the left hand side of the wafer is shown in an enlarged presentation . note that the target array 13 consists of a rectangular block containing three separate targets 15 and that each array displaces one integrated circuit on the wafer . in accordance with the present invention , however , small targets are used . such a small target is shown within the enlarged view of the circuit 17 . note that a much smaller area of the wafer 11 is circled and includes parts of four micro - circuits . visible on the micro - circuit are typical bonding pads 19 which are typically 5 mils square . shown is an unused alignment target 21 and an alignment target 23 which has been previously used . note that the alignment targets are printed on each of the sections or micro - circuits 25 on the wafer . thus they are between other components on the wafer and do not require the displacement of a pair of integrated circuits therefore resulting in a greater yield . fig2 illustrates a first embodiment of the alignment pattern of the present invention . each time a pattern for processing is printed on the wafer for each microcircuit , an alignment pattern 27 is also printed . on the next succeeding mask , an alignment pattern 28 is provided of the same diamond shape and in the corresponding position as the pattern 27 , but of smaller size . when the two are aligned , they take the relative position shown by the overall diagram 30 . the mask may , of course , in addition to containing a smaller pattern 28 , contain somewhere else one or more copies of pattern 31 which will be available for the next steps in the process . although the closed diamonds of fig2 may be used , it is preferred that the patterns shown on fig3 be used . in these patterns , the diamond 27 is replaced by a pattern which has a diamond outline but in which the corners are cut away . thus , on each of the sides of the diamond there only remains a segment 31 . similarly , with the small diamond only the segments 33 remain so that the resulting pattern 34 is as shown on the figure when alignment takes place . the dimensions of the targets 31 and 33 can be varied to suit the resolution of the imaging system and the field of the viewing system and might typically be as given on fig3 . furthermore , although the pattern shown on fig2 ane 3 are hollow patterns which have certain advantages , it is possible to use solid patterns . as noted , it is through the use of such patterns that automatic alignment is possible and thus , in its broadest aspects the present invention comprises the use of such patterns for alignment . however , another aspect of the invention is the manner in which these patterns are used to carry out automatic alignment . this will now be explained . fig5 shows the basic block diagram of the system of the present invention . in conventional fashion the wafer is disposed on a stage 41 . though the optical system of the aforementioned patent , the wafer 41 and mask 43 can both be observed . a television camera is installed to view two portions of the mask and wafer through a split field optical system using dark field illumination . viewing the targets under dark field illumination results in edges providing consistent bright images on a dark background due to the topography inherent in ic fabrication . this type of illumination also allows for efficient use of a technique known as video integration to increase the video signal to noise ratio . video integration is implemented by blanking the electron readout beam in the vidicon image tube for a desired number of frames allowing the tv image in the form of a photocathode charge or conductivity difference to build up with time resulting in an increased video signal when the vidicon target is first allowed to be sampled . initial mechanical positioning is carried out by the wafer loading mechanism to bring the mask and wafer into general alignment . the television camera scans over the portions of the mask and wafer in the viewing field and provides its video output to a line position detector 47 during one frame . the detector , in a manner to be more fully described below , detects the presence of the lines on the alignment patterns . upon detection , these positions are digitized and temporarily stored in a memory buffer 49 and then in a microcomputer memory . the digitized information is then available to a microcomputer 51 in which computations are carried out in order to determine whether or not the mask pattern is aligned with the wafer pattern . depending on the degree of misalignment , outputs are provided to an alignment motor drive 53 which drives the wafer stage , in the manner described in the aforementioned u . s . pat . no . 4 , 006 , 645 . the line position 47 detector , as the television camera scans horizontally will detect not only diagonal edges of the pattern but will tend to also detect any vertical lines . the principle on which it operates is illustrated by fig6 . the video signal 55 from a typical hollow target line 56 illuminated by dark field illumination has a characteristic voltage versus time wave shape 59 as shown in fig6 as vi . detection is carried out as follows : 1 . a second signal v2 is derived from v1 by delaying it for a time δt . 2 . the crossover point 61 when v2 becomes greater than v1 , is used to generate a signal ( v out ) which causes the contents of a counter to be stored in memory . 3 . the output signal ( vout ) is qualified by requiring that the signal v2 be above a threshold voltage v t ( i . e ., noise level ). the resulting positive going edge of the v out pulse 63 will be generated at a time delayed by a constant amount after the center of the waveform is encountered . this constant delay is equal to one half of the total delay line time δt . the optimum time delay δt varies for different target line - widths but small variations in line sizes or edge profiles can be readily accommodated by a fixed time delay . fig7 shows a schematic diagram of the line position detector . fig1 shows a way in which the edge position signal vout is converted to a number corresponding to its horizontal position which may be stored in the microcomputer memory . digitization of the horizontal position of a line or edge is accomplished by starting a counter at the beginning of each horizontal scan line and incrementing it at a 10 mhz rate . when an edge is detected , its position is stored in the microcomputer memory as an eight bit word corresponding to the count when the edge was detected . the 10 mhz counting rate permits each horizontal tv line to be divided into 2 acquisition zones each having 256 possible line positions . each line has 16 words of computer memory reserved allowing as many as 15 edge positions , and a zero word designating end of valid data . if one uses 170 lines in each acquisition zone , a total of 16 by 170 or 2720 words of memory are required for each acquisition zone . at the end of the digitizing , there will be stored in a memory associated with the micro - computer the locations of each of the edge crossings . the magnitude of the word in memory represents the horizontal position coordinate ; and the memory location indicates the vertical position coordinate . attached hereto is a computer program for the microprocessor needed to carry out the identification of targets and a positioning of the wafer stage to bring the targets into alignment . 1 . searches through the raw data stored in the memory looking for diagonal lines . all diagonal lines having three or more consecutive points are listed . 2 . the endpoints and y - intercepts of each diagonal line are computed . 3 . close - by , like slope diagonal lines are combined ; thus reducing the number of endpoints and y intercepts . 4 . the known mask target size is used to predict y - intercept spacing for mask targets . y - intercept spacings from like - slope line pairs corresponding to the mask spacing are listed and a mid - point calculated for each pair . if more than one line pair is found for each slope , the lines with the largest number of data points are used . 5 . from the midpoints of oppositely sloping diagonal pairs , the center of the mask target is computed . 6 . the same procedure is used to find the wafer target center and the mask and wafer target separation is calculated . 7 . the information from the other side of the split field viewing system is used to find its mask and wafer target separation in the same fashion . 8 . the separations from both viewing sites are used to compute the worst alignment error . 9 . if the error is greater than the predetermined limit , e . g ., 1 . 0 μm , an output is provided to drive the wafer stage to correct the misalignment and the procedures to put another alignment picture into memory and compute the alignment error are repeated . if the error is under the limit , the exposure is allowed to take place . in order to further reduce computer memory storage requirements , further processing of edge position data before storage in memory is possible . fig9 illustrates one possibility . in this scheme , a plurality of 256 bit shift registers 101 are provided and connected such that the output of the first shift register 101 is the input to the first stage of the second shift register and so forth . each shift register stores one line of data . outputs are taken from the first stage of the first shift register 101 , the second stage of the second shift 101 and the third stage of the third shift register 101 to an and gate 103 . a 10 mhz output from a clock provides the shift command into the shift registers . the data input is the output of the line position detector 47 . thus , this data is sampled and loaded into the register and continually shifted therethrough . each shift register 101 will contain one line of data in digital form , &# 34 ; 1s &# 34 ; indicating narrow lines or edges and the absence of a &# 34 ; 1 &# 34 ; indicating the absence of narrow lines or edges . if a diagonal line is present , a diagonal of &# 34 ; 1s &# 34 ; should appear as shown on the figure . when this occurs , a diagonal line , which normally only appears in the alignment target geometries has been detected and an output from the and gate 103 occurs , which output can then be stored in memory . in other words , there will be stored in memory a value corresponding to the horizontal location of the &# 34 ; 1 &# 34 ; which has been identified as belonging to a diagonal . a slightly different arrangement of the and gate inputs is required to detect lines or edges of opposite slope . if the horizontal digitization rate and the vertical spacing between the readout lines in the tv camera do not correspond to the same distance on the tv picture , then some modification of the above scheme is necessary . one possibility is simply to choose a diagonal line having a slope so that the intersection by two adjacent horizontal readout lines corresponds to an integral number of digitization spaces ( equal vertical to horizontal digitization ratio ). this results in a digitization error of half of the digitization increment . ( if the increment is one micron and the line is assumed to lie in the middle of the increment but lies instead at the edge then the error is half the increment .) the digitization error can be reduced by choosing a target line slope and a readout and digitization scheme that does not possess an integral number of digitization spaces between adjacent horizontal tv readout lines . for example , if 45 ° target lines are used with a digitization scheme having a 1 . 5 micron space between horizontal lines and a 1 . 0 micron digitization increment along each line ( 1 . 5 : 1 vertical to horizontal digitization ratio ), then the worst error due to digitization will be 0 . 25 micron averaged over two adjacent lines . with this scheme , the correlator would have to include two possible edge locations on every other line . this is illustrated in fig9 . a schematic of the digitizer and memory buffer is shown in fig1 . the vertical and horizontal synchronization pulses generated by the tv camera are used by the memory address logic to determine when the tv signal being read out is contained in either of the two acquisition zones . typically , each acquisition zone is a rectangular area spanning most of one or the other halves of the split viewing field . once the tv camera readout beam crosses the edge of an acquisition zone , an edge position counter 105 is incremented at a 10 megahertz rate by a clock 106 and an edge counter 107 is enabled . a signal indicating the presence of a target edge causes the count in the position counter 105 to be held in a latch 108 and the edge counter 107 to be incremented . if the number in the edge counter 107 is less than 16 , then the memory address logic 109 causes the number in the latch 108 to be stored in the computer memory 110 at an address which is offset by 16 times the horizontal lines number plus the edge counter number . if the computer memory is sufficiently fast , the line edge position can be stored directly without using a fast buffer memory .	6
as shown in fig1 an air - cushion vehicle toy , generally designated by the reference numeral 1 , according to preferred embodiment of the present invention generally comprises a chassis 1b serving as a toy base , a body 1a covering the upper surface of the chassis 1b , and a skirt 1c attached to the lower surface of the chassis 1b . the body 1a has two downward flexible fingers 2a , 2b on respective front and rear ends thereof . the chassis 1b has holes 2c , 2d defined in respective front and rear ends thereof for receiving the respective fingers 2a , 2b therein . an air inlet hole 2h in the form of slits is defined in upper and opposite side surfaces of a rear portion of the body 1a , and an air outlet hole 2i having grids is defined in a rear surface of the rear portion of the body 1a . a laterally swingable steering rudder 2j is attached to the rear end of the body 1a behind the air outlet hole 2i . a motor 3b with a propeller fan 3a fixed to its rotatable shaft is mounted on a rear portion of the chassis 1b by an attachment structure 3 which comprises a holder frame 3c that accommodates the motor 3b therein and an attachment 3d , the holder frame 3c being installed on the chassis 1b . as shown in fig2 and 3 , the attachment 3d , which is made of a flexible material , has an inverted channel - shaped cross section . the attachment 3d has a central tongue which includes a tooth 3e on its lower surface , which is resiliently held against an upper surface of the motor 3b , holding the motor 3b against the holder frame 3c . the attachment 3d also has a pair of laterally spaced resilient fingers 3f on the lower ends of its laterally spaced legs , the fingers 3f resiliently engaging respectively in recesses 3g that are defined in lateral side walls of the holder frame 3c . a hovering fan 4a for producing a downward air thrust is mounted on the rotational shaft of a motor 4b which is installed on a front portion of the chassis 1b . the motor 4b is installed on the chassis 1b by an attachment structure 4 which comprises a holder frame 4c that accommodates the motor 4b therein and an attachment 4d , the holder frame 3c being installed on the chassis 1b . the attachment 4d is made of a flexible material and has a central tongue which includes a tooth 4e on its lower surface , which is resiliently held against an upper surface of the motor 4b , holding the motor 4b against the holder frame 4c . the attachment 4d also has a pair of laterally spaced fingers 4f on the lower ends of its laterally spaced legs , the fingers 4f engaging respectively in recesses 4g that are defined in lateral side walls of the holder frame 4c . in order not to adversely affect the stability of the toy 1 when it hovers , the hovering fan 4a comprises a multiblade fan whose axis is oriented horizontally . the fan 4a is covered with a casing 4h which is integral with the attachment 4d and fittingly joined to an air duct 4i which is defined in the chassis 1b behind the holder frame 4c and communicates with the space below the chassis 1c . the chassis 1b has a battery holder 5b for holding batteries 5a . a control switch 5c is mounted on one side of the chassis 1b laterally of the battery holder 5b , the control switch 5c having a knob projecting laterally outwardly from the chassis 1b . the control switch 5c can be angularly shifted to one , at a time , of three positions , i . e ., &# 34 ; stop &# 34 ;, &# 34 ; hover &# 34 ;, and &# 34 ; hover / run &# 34 ;. as shown in detail in fig4 , 6a , and 6b , the toy 1 has a power cutoff mechanism 5 , which comprises a fixed contact 5e of the battery holder 5b , a movable contact 5d positioned near a side of the battery holder 5b and normally spaced from the fixed contact 5e , and an engaging member end 5f projecting inside the body 1a for engaging the movable contact 5d . the movable contact 5d has an end fastened to the chassis 1b and electrically connected to a power wire 5g . the power wire 5g is connected through the control switch 5c to the motors 3b , 4b , thereby constituting a power supply circuit . as shown in fig6 a , when the body 1a is attached to the chassis 1b , bringing the engaging member end 5f into engagement with the movable contact 5d , the movable contact 5d contacts the fixed contact 5e , making the power supply circuit . when the body 1a is removed from the chassis 1b , lifting the engaging member end 5f out of engagement with the movable contact 5d , the movable contact 5d is shifted out of contact with the fixed contact 5e , braking the power supply circuit , as shown in fig6 b . as illustrated in fig7 and 8 , a float 6a made of polystyrene foam is fixedly attached to the peripheral edge of the lower surface of the chassis 1b . the float 6a serves to float the toy 1 on water and keep the toy 1 horizontal in the floating position . a skirt 1c is attached to the lower surface of the chassis 1b through a substantially rectangular attachment plate 7a . the skirt 1c is positioned beneath the float 6a , and is in the form of a bag of thin film made of soft resin . the attachment plate 7a has a lower frame 7b on its lower side . the skirt 1c has upper and lower central opening edges which are vertically spaced from each other and hermetically joined respectively to a lower peripheral edge of the attachment plate 7a and a lower peripheral edge of the lower frame 7b , thereby defining a rectangular annular inner opening 7c ( fig8 ). the lower frame 7b has an open lower side , defining an open space 7d below the attachment plate 7a . when viewed in plan , the space 7d contains the battery holder 5b , and hence the center of gravity of the toy 1 . the air duct 4i which projects downwardly through the chassis 1b and serves as an air flow guide , extends through the attachment plate 7a into the inner opening 7c within the skirt 1c . the skirt 1c has a number of small holes 7e defined in a lower layer thereof and spaced radially outwardly from the space 7d in surrounding relation thereto when viewed in plan . air which is delivered into the skirt 1c by the hovering fan 4a is ejected downwardly from the small holes 7e . the skirt 1c , the attachment plate 7c , and the lower frame 7b are constructed as a unitary structure . therefore , the skirt 1c is affixed to the chassis 1b when fingers 7f of the attachment plate 7a engage in holes 7g in the chassis 1b and the attachment plate 7a is fastened to the chassis 1b by a screw ( not shown ) threaded into an attachment hole 7h which is defined in the front portion of the chassis 1b . operation of the air - cushion vehicle toy 1 thus constructed will be described below . when the front and rear fingers 2a , 2b of the body 1a ( fig1 ) are fitted respectively in the front and rear holes 2c , 2d in the chassis 1b , the body 1a is fixed to the chassis 1b , thus covering the upper surface of the chassis 1b . the body 1a can be detached from the chassis 1b when the fingers 2a , 2b are removed from the holes 2c , 2d . when the fingers 3f of the attachment 3d of the attachment structure 3 engage respectively in the recesses 3g in the holder frame 3c , the tooth 3e ( fig3 ) resiliently presses down the motor 3b , which is thus fixed in place . at the time of installing the motor 3b in the holder frame 3c , the motor 3b is oriented with respect to terminals ( not shown ) on the bottom of the holder frame 3c , and then the attachment 3d is placed over the motor 3b and pressed against the motor 3b . in this manner , the motor 3b is electrically connected to the power supply circuit at the same time that the motor 3b is installed in the holder frame 3c . the motor 3b can subsequently be detached from the holder frame 3c by spreading apart the fingers 3f outwardly and pulling the attachment 3d away from the holder frame 3c . as with the attachment structure 3 , the attachment structure 4 allows the motor 4b to be easily attached to and detached from the chassis 1b . the casing 4h , which is integral with the attachment 4d of the attachment structure 4 , is securely joined to the air duct 4i , thus guiding an air flow produced by the hovering fan 4a downwardly of the chassis 1b . as shown in fig6 a , when the body 1a is mounted on the chassis 1b , the engaging member end 5f of the body 1a engages the movable contact 5d , laterally shifting the movable contact 5d into contact with the fixed contact 5d . as a result , the electric energy of the batteries 5a can be supplied through the power wire 5g to the motors 3b , 4b . as shown in fig6 b , when the body 1a is dismounted from the chassis 1b , the engaging member end 5f is spaced from the movable contact 5d , which springs back out of contact with the fixed contact 5e . as a consequence , the motors 3b , 4b are disconnected from the batteries 5a and hence de - energized . when the toy 1 is placed on a surface such as a surface of water and the control switch 5c is shifted to the &# 34 ; hover &# 34 ; position , the motor 4b for the hovering fan 4a is energized , and the hovering fan 4a is rotated . air under pressure is now delivered by the hovering fan 4a through the air duct 48 into the open space 7d below the chassis 1b . since the space 7d is closed at its lower side by the surface on which the toy 1 is placed , most of the air supplied from the air duct 48 fills up the open space 7d . a portion of the air is also sent through the opening 7c into the skirt 1c itself , inflating the skirt 1c downwardly into a substantially doughnut shape . the space 7d now functions as a pressure chamber or a floating force generating chamber . when the pressure of the air filled in the open space 7d increases in excess of a predetermined pressure , there is developed a floating force which is large enough to float or hover the toy 1 . at the same time , the air filled in the skirt 1c itself is ejected through the small holes 7e downwardly toward the surface on which the toy 1 is placed . the air which is ejected downwardly from the small holes 7e is effective either to lift aloft the toy 1 when the skirt 1c is in contact with the surface on which the toy 1 is placed , or to generate an air curtain layer which shields the air flowing downwardly from the space 7d when the toy 1 has already been lifted aloft and the skirt 1c is spaced from the surface over which the toy 1 is hovering . more specifically , when the toy 1 is lifted aloft , the air ejected from the small holes 7e produces an air layer of relatively high pressure between the lower surface of the skirt 1c and the surface over which the toy 1 is hovering . the high - pressure air layer surrounds the open space 7d when viewed in plan . therefore , the air under pressure in the space 7d , which serves as a floating force generating chamber , is prevented from locally leaking out of the space 7d . as a result , the generated floating force is well balanced , and free of localized intensity variations . the air curtain layer has a certain width in the radially outward direction , which is also effective in preventing the air under pressure in the space 7d from locally leaking out of the space 7d . since the small holes 7e are disposed closely to the center of the bottom of the skirt 1c , i . e ., near the open space 7d , the air ejected from the small holes 7e also serves to effectively increase the air pressure in the space 7d . the rotatable shaft of the motor 4b on which the hovering fan 4a lies horizontally . therefore , while the toy 1 is floating , no yawing acceleration is produced by the hovering fan 4a , and hence the toy 1 remains directionally stable . when the control switch 5c is shifted to the &# 34 ; hover / run &# 34 ; position , the motor 3b for the propeller fan 3a is also energized in addition to the motor 4b , so that the propeller fan 3a is also rotated . when the propeller fan 3a is rotated , air is introduced into the cover 1a through the air inlet hole 2h and ejected rearwardly through the air outlet hole 2i , thus propelling the toy 1 . the direction in which the toy 1 is propelled is determined by the steering rudder 2j . when the control switch 5c is shifted to the &# 34 ; stop &# 34 ; position , the motors 3b , 4b are de - energized , and the fans 3a , 4a are stopped . therefore , the toy 1 is neither hovered nor propelled . if the toy 1 is placed on water , the toy 1 stably floats on the water surface due to the buoyancy of the float 6a . with the air - cushion vehicle toy 1 according to the present invention , when the body 1a is removed from the chassis 1b for battery replacement , motor replacement , or other servicing , the motors 3b , 4b are forcibly de - energized by the power cutoff mechanism 5 . therefore , the motors 3b , 4b are effectively prevented from being energized by mistake during such servicing operation . since the motor attachment structure 3 is constructed of only the holder frame 3c and the attachment 3d , the number of required parts is small . because the attachment 3d can easily manually be attached to the holder frame 3c , the motor 3b can easily be installed on the chassis 1b . it is not necessary to use tools such as a screwdriver when the motors are to be replaced for the modification of the toy 1 . as a result , the motor attachment structure 3 is low in cost . the attachment 3d is larger than screws and other small - size fastening elements and has a noncircular shape , the attachment 3d is less liable to be lost or roll away when detached from the holder frame 3c . the above advantages hold true for the motor attachment structure 4 . in addition , since the casing 4h for the fan 4a is integral with the attachment 4d , the casing 4h can be attached in place at the same time that the motor 4b is installed on the chassis 1b . the motor 4b is therefore also easy to install on the chassis 1b . when the air - cushion vehicle toy 1 is floating , the air pressure in the space 7d is presented from locally leaking out of the space 7d by an air curtain which is established by air ejected from the small holes 7e . accordingly , the air under pressure which is confined in the space 7d is effective to produce a well - balanced downward air thrust or floating forces . the air - cushion vehicle toy 1 as it floats is thus prevented from being tilted , by a relatively simple construction . the principles of the present invention are also applicable to a remotely controlled air - cushion vehicle toy . although there has been described what is at present considered to be the preferred embodiment of the present invention , it will be understood that the invention may be embodied in other specific forms without departing from the essential characteristics thereof . the present embodiment is therefore to be considered in all aspects as illustrative , and not restrictive . the scope of the invention is indicated by the appended claims rather than by the foregoing description .	0
distal refers to away from the body in relation to a crutch or assistive mobility device . proximal refers to toward the body in relation to a crutch or assistive mobility device . outboard in the context of a bicycle refers to the direction that is toward the end of the handlebar . inboard in the context of a bicycle refers to the direction that is toward the stem of the handlebar . a hand grip , generally referred to as 10 is shown in fig1 . the hand grip has a body 12 and an integral fin 14 . the body has a central region 16 , a distal region 18 , a proximal region 20 , a distal end 22 and a proximal end 24 . the fin 14 extends distally from the proximal 20 and central region 16 . the central region 16 has a protuberance 26 . a split ring or c - type clamp 28 is located at the proximal end 24 and encircles the innermost layer or core 60 of the hand grip 10 . the clamp 28 has a fastener 30 that when tightened , compresses the clamp 28 and the core 60 . the fastener 30 extends through a clamp aperture 61 and a vertically disposed retainer aperture 62 to assist in aligning the hand grip 10 and clamp 28 . the distal end 22 terminates in a flange 32 . as shown in fig2 , the distal and proximal regions , generally shown as 18 and 20 , are thinner in cross sectional area than is the central region , generally referred to as 16 , with a gradual increase in cross sectional area in the distal region 18 and the proximal region 20 , leading to the protuberance 26 . the cross sectional area also increases around the distal end 22 in the flange 32 . a central bore 36 extends along a longitudinal axis 38 of the hand grip 10 between a distal aperture 40 and a proximal aperture 42 . the dimensions of the body are as follows : the length is about 110 to about 150 mm long , preferably about 120 mm to about 140 mm , more preferably about 130 mm long ; the width is about 25 to about 35 mm wide , preferably about 30 mm wide at the narrowest point , increasing to about 35 mm to about 45 mm wide , preferably about 38 mm wide , including at the flange 32 and the protuberance 26 ; and the diameter of the central bore 36 is about 20 to about 25 mm in diameter , preferably about 22 mm . also shown in fig2 , the innermost layer of the hand grip 10 is a hard plastic core 60 , having a durometer rating of at least about 80 , preferably about 85 and more preferably about 85 to about 90 on the a durometer scale . alternatively , the core 60 is integral with the structural layer 70 and therefore has the same durometer rating as the structural layer 70 . to be clear , either the structural layer 70 or the core 60 form the inner layer 60 and the inner layer 60 defines the central bore 36 . the central bore 36 of the core 60 is sized to fit snugly over the tube 50 . as shown in fig1 , the proximal zone 64 of the core 60 has at least one slot 66 extending into the core 60 . the slot allows the circumference of the core 60 to be reduced under the pressure of the clamp 28 , thereby retaining the hand grip 10 in place . as shown in fig2 , the middle layer of the hand grip 10 is a structural layer 70 . the structural layer 70 is composed of a single elastomeric thermoplastic , such as , but not limited to ethylene vinyl acetate . the material can be foam or a soft plastic polymer or alternatively , a high - density polyethylene ( hdpe ), such as thermolyn ™ rch 500 . it is formed into the body 12 , the protuberance 26 , the fin 14 and the flange 32 . the material used in the structural layer has a durometer rating of about 30 to about 55 , preferably about 35 to about 50 and more preferably about 40 to about 45 on the a durometer scale . rather than using a number of materials of differing durometer ratings to provide differences in the degree of support and damping , the present technology uses differences in thickness to provide differences in the degree of support and damping . this simplifies construction of the hand grip and provides superior support , vibration damping and impact absorption , thereby reducing fatigue for the user . with regard to the body 12 , the middle layer 70 is about 0 . 5 mm to about 2 mm thick , preferably about 1 to about 1 . 5 mm thick on the distal 18 and proximal regions 20 of body 12 , increasing gradually to about 1 mm to about 2 . 5 mm , preferably about 2 mm thick at the protuberance 26 . the distal end 22 terminates in a flange 32 of about 5 mm thick . with regard to the fin 14 , the middle layer 70 is about 7 mm to about 12 mm , preferably about 8 mm to about 10 mm , more preferably 9 mm thick on the proximal base 110 ( see fig4 ), and is about 0 mm to about 0 . 5 mm preferably 0 mm thick on each of the distal base 118 and the fin tip 102 ( see fig5 ). an outer layer 82 covers the structural layer 70 . it is a washable material and can be provided in a number of colours . the material is preferably a single elastomeric thermoplastic , such as , but not limited to ethylene vinyl acetate ( eva ). the preferred eva product is lunalastik ™, a product used in making orthotics . it has a density of approximately . 0 . 23 g / mm 3 and a durometer rating of about 25 on the a scale . other durometer ratings that are acceptable are about 20 to about 35 and preferably about 22 to about 30 . the outer layer 82 is a uniform thickness in the range of about 0 . 5 to about 2 mm , preferably about 0 . 5 to about 1 . 5 mm and most preferably about 1 mm . if additional padding is required , different thicknesses can be used rather than using materials of different durometer ratings . this simplifies construction the hand grip and provides superior support , vibration damping and impact absorption , thereby reducing fatigue for the user . when used with mobility devices , the smooth outer layer 82 is preferred , while sculpting may be preferred for bicycles . this can be in the form of ridges , dimples , waffles or any other surface contour , as would be known to one skilled in the art . in this case , the outer layer 82 is made of a rubberized or rubbery layer . the durometer ratings are about 20 to about 35 and preferably about 22 to about 30 on the a durometer scale . the fin 14 flexes in response to force . an average person will cause the fin to deflect between about 3 mm to about 6 mm , more specifically about 4 mm to about 5 mm , with the deflection increasing distally . this damps the impact of the hand on the hand grip 10 , whether as a result of striking a cane , crutch or walking stick on the ground , or as a result of a bicycle traveling over rough terrain . details of the fin 14 are shown in fig3 , 4 , and 5 . as shown in fig3 , which is a plan view , the fin , generally referred to as 14 has a ridge 100 , a tip 102 , a fin return 104 , and a concave region 106 . the dimensions are as follows : the ridge 100 is about 70 mm to about 90 mm long ( along the longitudinal axis 38 ), preferably about 75 mm to about 85 mm , most preferably 80 mm long ; about 15 mm to about 35 mm high ( normal to the longitudinal axis 38 ), preferably about 20 mm to about 30 mm , most preferably 25 mm high at the lowest point , increasing in a curvilinear manner to the tip 102 ; the tip 102 is about 35 mm to about 55 mm high ( normal to the longitudinal axis 38 ), preferably about 40 mm to about 50 mm , most preferably about 45 mm high at the highest point ; and the fin return 104 defines the concave region 106 between the fin 14 and the body , generally referred to as 12 , the concave region being about 15 mm to about 25 mm , preferably 20 mm wide between the underside of the fin 14 and the body 12 and about 10 mm to about 15 mm deep ( along the longitudinal axis ). the thumb of the user sits in the concave region 106 . the dimensions of the fin 14 and body 12 are such that the user is able to align the first joint of their thumb with the inner margin 108 of the concave region 106 and wrap their thumb at least partially around the body 12 . as shown in fig4 , which is a proximal end view , the fin , generally referred to as 14 , has a ridge 100 , a proximal base 110 and a lateral offset 112 . notably , the fin 14 decreases in width laterally i . e . from the proximal base 110 to the ridge 100 . the dimensions are as follows : the ridge 100 is about 4 mm to about 6 mm , more preferably about 5 mm ; the proximal base 110 is about 7 mm to about 14 mm wide , preferably about 8 mm to about 12 mm , more preferably 10 mm wide ; and the lateral offset 112 is about 15 to about 30 degrees , more preferably about 20 to about 25 degrees and most preferably at 23 degrees from a vertical axis 114 . the offset mimics the angle at which the user &# 39 ; s thumb naturally extends from the remainder of the user &# 39 ; s hand . as shown in fig5 a , which is a distal end view , the fin 14 has a distal base 118 , a fin tip 102 , and a longitudinal depression 116 with each of the fin tip 102 and the inner margin 108 of the concave region 106 preferably lacking the structural layer 70 . as shown in fig5 b , the fin 14 decreases in width from the distal base 118 to the fin return 104 and the fin tip 102 . as can be seen by comparing the dimensions of the distal base 118 and the proximal base 110 , the fin decreases in width from the proximal base 110 to the distal base 118 . the dimensions are as follows : the distal base 118 is about 0 . 5 mm to about 4 mm wide , preferably 1 mm to about 3 mm , more preferably 2 mm wide ; the fin tip 102 is about 1 mm to about 2 . 5 mm wide , preferably 1 . 5 mm to about 2 mm wide , more preferably 2 mm wide ; the fin return 104 is about 1 mm to about 2 . 5 mm wide , preferably 1 . 5 mm to about 2 mm wide , more preferably 2 mm wide ; and the longitudinal depression 116 is formed to rest the user &# 39 ; s thenar eminence and is about 10 mm deep decreasing proximally to nothing over about 30 mm . fig6 shows a hand grip 10 on a tube or bar 50 . this may be , for example , but not limited to a handle or a crutch hand support . the clamp 28 holds the hand grip 10 in place on the handle 50 . the flange 32 extends radially outward in the vicinity of the distal end 22 to assist in hand placement . an end cap 54 is located in the distal aperture 40 . the hand grip 10 is ergonomically designed . the heel of a user &# 39 ; s hand rests on the fin 14 , while the thumb fits around the hand grip 10 at the distal region 18 . the protuberance 26 fits into the palm of the hand , providing cushioned support . the fourth and fifth finger close around the hand grip 10 at the proximal region 20 . as there is a gradual increase in cross sectional area in the distal 18 and proximal 20 regions , differences in hand sizes can be accommodated by shifting the hand on the hand grip 10 until a comfortable fit is found . additionally , placement of the hand grip 10 on the tube 50 can be optimized by rotating the grip 10 and by moving it longitudinally along the tube 50 . once the hand grip 10 placement is optimized , the clamp 28 is tightened over the hand grip 10 and tube 50 , immobilizing the hand grip 10 . as shown in fig7 , when used on a bicycle handlebar 150 , the clamp 28 may be located on the inboard end , generally referred to as 122 or may be on the outboard end , generally referred to as 124 . the fin tip 102 extends towards the inboard end 122 . the core 60 has an inboard zone 164 that extends beyond the structural layer 70 and the outer layer 82 to allow for the clamp 28 to tighten around the core 60 , just as the clamp is tightened around the proximal zone 64 of the core 60 when used on the handle 50 of an assistive mobility device . the inboard zone 164 of the core 60 has at least one slot 66 extending into the core 60 . the slot allows the circumference of the core 60 to be reduced under the pressure of the clamp 28 , thereby retaining the hand grip 10 in place . the clamp 28 has a fastener 30 that when tightened , compresses the clamp 28 and the core 60 . the fastener 30 extends through a clamp aperture 61 and a vertically disposed retainer aperture 62 to assist in aligning the hand grip 10 and clamp 28 . a flange 132 is located in the vicinity of the inboard end 122 . the flange 132 extends radially outward to assist in hand placement . an end cap 54 is located in the outboard aperture 140 . the outboard end 124 may be retained with a clamp 56 and fastener 58 . as would be appreciated , there is a left and a right hand grip 10 , each being mirror images of the other . as shown in fig8 , the end cap 54 can be replaced with a light 220 and power source 222 . the power source may be integral with the light , or may be separate , for example , a separate battery . a switch 224 is provided for turning the light 220 on and off . the switch can be pressure activated or motion activated . it may be separate from the light , as shown , or integral to the light . the light provides a safety feature as it shines in the direction of travel if mounted on an assistive mobility device and at right angles to the direction of travel if mounted on a bicycle , allowing motorists to see a user crossing a road in front of them . in an alternate embodiment , the body 12 of the hand grip 10 is split longitudinally into two sections , a body upper section 212 and a body lower section 213 , as shown in fig9 . each of the core 60 , structural layer 70 , and outer layer 82 are configured to allow the hand grip 10 to be fitted on the handlebars of road bikes , similarly to affixing aerobars . the core upper section 230 and the core lower section 232 have mating members 234 . the mating members are preferably releasable and are a tongue in groove type of mating members . the structural layer upper section 240 abuts the structural layer lower section 242 . similarly , the outer layer 82 , or cover has an outer layer upper section 250 that abuts an outer layer lower section 252 . the fin 14 is preferably located on one of the sections and is not split . two piece clamps 260 with fasteners 262 for tightening the clamps 260 fit over the inboard end 270 and the outboard end 272 of the core 60 , which extend beyond the structural layer 70 and outer layer 82 , to allow the hand grip 10 to be retained on the handlebar 50 close to the stem . as would be appreciated , there is a left and a right hand grip 10 , each being mirror images of the other . the foregoing is a description of an embodiment of the present technology . as would be known to one skilled in the art , variations that do not alter the scope of the technology are contemplated . for example , the core may be formed from the structural layer , resulting in the hand grip being two layers — the structural layer and the outer layer . this would be a preferable design if injection molding is used . the split ring clamps may be replaced with two piece clamps or other clamps that function to retain the grips . the grips may be permanently affixed to the handles or bars , using for example , but not limited to , an adhesive . the slots in the core may be replaced with a series of slits or a more malleable material may be used to construct the core . the hand grip can be used on any device or apparatus where load bearing on the hands occurs , for example , but not limited to , exercise equipment , walking sticks , and walkers .	1
reference is now made to the drawings and in particular to fig1 wherein there is illustrated a preferred embodiment of the present invention which includes a series of similar horns 2 said horns having a peripheral rear surface t with mounting lugs 3 formed as a integral part thereof . the assembly also includes a series of speakers 1 each said speaker having a central axis ( not shown ) and a peripheral front surface f of size and shape , in this case circular , to correspond with respective horn members 2 . each speaker is disposed with its mounting surface or peripheral front surface f abutting the planar rear surface t of a respective horn 2 said speaker being attached at said mounting lugs 3 provided by screws or other fasteners . this particular embodiment includes speaker grille covers 5 formed as integral parts with the horn members 2 , said grille covers provided for the protection of the delicate parts of the speakers thereto attached . said speakers are oriented and positioned with their central axes divergently aligned and equidistant from a point described as the centre of a polyhedron such that said central axis of each said speaker is coaxial with a line normal to and projected from the centre of each face of said polyhedron such that each said central axis diverges from each adjacent central axis at a common angle of divergence a . therefore the number of speakers and said angle of divergence a will depend on the particular polyhedron selected as a baic form for each arrangement thus the tetrahedral form employs four speakers having an angle a of 109 . 47122 degrees with one another , the hexahedral form employs six speakers having an angle a of 90 degrees , the octahedral form employs eight speakers having a angle a of 70 . 52878 degrees , the dodecahedral form employs twelve speakers having an angle a of 63 . 43494 degrees and the icosahedral form employs twenty speakers having an angle a of 41 . 81031 degrees . therefore the embodiment of fig1 employing six speakers contains mounting or attaching means to orient these six speakers at a common angle of divergence of 90 degrees according to the requirements of said hexahedral form which is the basis for the arrangement of fig1 . said mounting or attaching means consists of four attachment members such as rectangular tabs 4 equispaced about the perimeter towards the rear surface t of each said horn member 2 and projecting outwardly therefrom and formed integrally with said horn members , said tabs being provided with holes at their outer ends , the axis of said holes being perpendicular to said central axis of said speaker 1 as mounted to said horn member 2 . each said tab 4 is attached to those of adjacent horn members 2 using bolts thus forming the assembly as illustrated . the tabs 4 are positioned displaced slightly along a line parallel to the axis of their respective holes in a common direction to ensure proper alignment of the horns one to another . two hangers 5a consisting of flat metal members each being equipped with two holes at their opposite respective extremities are provided bolted to two respective adjacent tabs 4 of any horn member 2 during the assembly thereof using one respective hole of each for this purpose . the opposite extremity of each respective hanger is bent slightly to orient these pieces outwardly from the centre of the assembly . two linear suspension members 7 each having loops at their respective ends are bolted to the respective hangers using their available respective holes . the respective loops at the opposite respective ends of said suspension members 7 are installed into the ceiling 9 of the listening room from hooks said hooks being positioned at a distance apart which corresponds to the distance between adjacent tabs 4 on the horn member 2 to which said hangers 5 are bolted . referring now to fig2 thereis shown an assembly according to the invention based on the form of said dodecahedron and containing twelve speakers said speakers having a common angle of divergence of 63 . 43494 degrees said assembly incorporating frame members , horn members and an airtight membrane into and formed as a single universal part referred to in this dissertation as a horn / frame member 10 . in this instance , horn / frame member 10 is provided with an outline that corresponds with the shape of each face of said dodecahedron i . e . the pentagon . the edges of said horn frame member 10 are provided with a bevelled surface s to ensure proper alignment with adjacent horn / frame members . said bevelled surface s is inclined at angle b which is defined as the angle in degrees included between the face of said polyhedron and the bevelled surface r and is equal to where a is the included angle between the axes of adjacent speakers . in this assembly the angle b is 58 . 28253 degrees . each said horn / frame member 10 is provided with a blind assembly hole 14 centered on and normal to one end of each said bevelled surface s to receive assembly screw 16 . centered on the opposite end of each said surface s is provided an assembly hole 15 normal to said surface s and passing through said horn / frame member 10 to the front face thereof where is provided a coaxial socket to allow the head of assembly screw 16 to be hidden therein in the final assembled form of theunit . each said hole is provided with a cylindrical spacer member 17 coaxial with each said hole 15 and formed integrally as part of said horn / frame member 10 and located in relation to each said surface such that when adjacent horn / frame members 10 are assembled and screwed together according to the invention , said spacer member 17 ensures that the proper gap is maintained therebetween to prevent overcompression of gasket member 18 which is provided to form an airtight seal between all adjacent bevelled surface 8 . each said gasket member 18 is sized and shaped to correspond with said bevelled surface s and is provided with bevelled ends 19 to ensure a complete airtight seal where it abutts two adjacent gasket members 18 at each end thereof 19 in its position in the assembled unit 20 . this gasket member 18 is further provided two holes 21 which correspond with the position of assembly holes 14 and 15 and are sized to accommodate said spacer member 17 . each said bevelled surface s is further provided an integrally formed rectangular slot 22 located at the midpoint of said bevelled surface s and oriented parallel to said surface and projected normally to a depth into said surface to receive the shorter arm of metal hanger 23 said hanger being of l shaped section with its long arm being oriented outward and said longer arm being provided with a hole for hanging the assembled unit 20 therefrom . when two adjacent horn / frame members 10 are assembled and screwed together according to the invention with said hanger 23 located in slot 22 of one said member 10 and with said gasket 18 included therebetween , said hanger 23 is trapped and fixed in position and embedded in gasket 18 so as not to interfere in the alignment or the airtight seal provided . adjacent to slot 22 in each bevelled surface s and formed integrally with horn / frame member 10 is provided a channel 24 sized and shaped to direct signal wires into the airtight space of the assembly for the operation of speakers contained therein . said channel 24 is further provided with an integrally formed bridge 25 closing off said channel at the exterior surface of said horn / frame member in order to preserve the airtight seal and to ensure an attractive appearance of the assembled unit . said bridge 25 is removed at that point where said signal wires must pass through the assembly for the proper function thereof . in the embodiment shown in fig2 each speaker 1 is provided a grille cover 26 which is dome - shaped and constructed of metal mesh covered with an acoustically transparent fabric or expanded foam material for the protection of the delicate speaker parts located therebehind said cover having a flexible gasket attached thereto to size and shape to conform to the said opening of the planar rear surface of horn / frame member 10 and having holes in this gasket provided to correspond with the mounting holes located in said horn / frame member for the attachment thereto of said speakers 1 at its peripheral front surface f said grille cover being trapped therebetween in its correct position . said speakers 1 are provided and attached with said grille covers to said horn / frame members 10 positioned with their bevelled surfaces in mutual adjacent relation with said gasket members 18 trapped therebetween and two said hangers 23 provided fixed in position in two adjacent slots 22 of an upper facing horn / frame member selected for this purpose , said horn / frame members are screwed and fixed in place one to another using mounting screws 16 in all placed provided . employing two suspension members 7 bolted to two respective hangers 23 protruding through the surface of said assembled unit 20 and attached to two respective hooks 8 provided in the ceiling of said listening room 9 at a distance apart equal to that of said hanger located as part of said assembled unit 20 enables the operation of the assembly according to the invention . the sectional view of fig3 through the assembly of fig2 illustrates the profile of said horn / frame member 10 directing the sound energy from the speaker outward into the mouth of said exponential horn defined by the infinite acoustic barrier 27 projected outwardly between adjacent speakers 1 said speakers being excited in phase . the profile of the exponential horn is fixed by the geometry of the arrangement of speakers . in the case illustrated in fig2 the profile is pentagonal and the expansion rate is determined by its occupation of one twelfth of a sphere . each configuration of speakers according to the invention will impart its own particular characteristics to said exponential horn . the profile of the horn 28 contained within said horn / frame member 10 directs the sound energy into the throat of the exponential horn . because the speaker unit as shown in fig2 is intended for domestic use and could be hung overhead in a listening room of conventional height , long horns would interfere with the use thereof and would be impractical , thus , the profile of horn 28 creates a rather abrupt transition . if the unit is designed intended for commercial use such as a stadium or a church , much more flexibility in the design of the horn is possible due to the increased space allowable for horn structures . in the case of the unit of fig2 if round speakers of 4 inch diameter are selected for incorporation therewithin , and said speakers are placed as compactly as possible according to the invention and noninterferingly located , the centers of the peripheral front surfaces of opposing speakers are separated by a distance of approximately 8 inches depending on the specific dimensions of the features of these speakers such as the magnets , mounting lugs , etc . adding a horn of two inches in length to each speaker an effective diameter of the assembly of approximately 12 inches which is of appropriate size for domestic use . incidental to the discussion of horns but of overall interest , such a unit divided into stero would provide an area of diaphragm roughly equal to that of a 10 inch speaker provided on each channel of a conventional speaker system . the profile of the horn 28 as illustrated in fig3 directs the sound energy outwardly from the speaker and smoothly directs said sound energy into the exponential horn with a minimum of reflective discontinuity which may be caused by abrupt changes in the rate of expansion of the vibrating air column . the profile of this horn is a straight line imparting a steady expansion rate to said air column up to the mouth of said horn 28 whereupon the throat of said exponential horn beings . a profile in the form of a broad s curve may smooth this transition somewhat and offer advantages of sound quality . the depiction of fig3 also illustrates other details such as the structural profile of said horn / frame member 10 showing the spacer member 17 and the gasket member 18 . fig4 illustrates an additional design which is similar to that of fig2 in form and construction except that the horn frame members 29 have been modified to include a series of ports 30 located at the vertices of said polyhedron passing through the said airtight membrane . given the characteristics of the speakers incorporated into the unit , internal pressure may limit the response of the diaphragms of said speakers as they vibrate in their relative positions . by introducing ports the overall quality of sound may be improved although the integrity of the said exponential horn is somewhat reduced . the optimum location of said ports is at the vertices of said polyhedron because the space between adjacent speakers is greatest at these locations . the gasket members 31 have been modified in this design to allow for the addition of the ports 30 . should the assembly require higher internal presure or should the action of the diaphragms require damping or if extraneous internal acoustic interference need be reduced , the internal airtight cavity may be packed with acoustic fiberglass or expanded foam or some other elastic or inelastic material . under certain conditions a large public address system may require a speaker assembly of large size and high output . fig5 illustrates the polyhedron known as the icosahedron , this polyhedron has 20 faces and therefore could be provided with 20 speakers according to the invention . a further 12 speakers of a slightly smaller size could be provided at the vertices of this form if said vertices were truncated as illustrated in fig6 . the output from the smaller speakers being equal one to another should be carefully balanced with the output from said larger speakers in order to maximize the output of the entire assembly . all of the polyhedra may be so modified to accommodate additional speakers or ports therein depending on the requirements of the application . in the interests of reducing costs or of modifying the sound produced by the assembly according to the invention , a number of the speakers may be removed and replaced with passive drivers said passive drivers having elastic diaphragms designed to resonate in unison with driven speakers . it must be understood that this form of modification may render the assembly unfit for stereophonic application . multichannel sound reproduction is achieved by dividing the assembly into equal divergent portions . in dual channel application an equatorial plane m in fig7 is established which bisects the polyhedron , that is it passes through the centre . if this plane also passes through the midpoints of two nearest adjacent edges , it happens to bisect the polyhedron such that one half of the centres of the faces of this polyhedron will fall on either side of this plane m and all said lines projected from said centre points normal to said faces will diverge from the equatorial plane and if speakers installed in the configuration of said polyhedron are excited in accordance with the twoinput channels being designated left and right respectively , dual channel sound output divided by plane m is the result . if two nearest adjacent edges are used as points of suspension according to the invention and given that the unit contains similar parts , its mass is equally balanced on my plane passing through its centre including equatorial plane m and will hang suspended such that said equatorial plane will be found vertical . further if the suspension hooks 8 are located on a line that bisects the ceiling of a listening room , said equatorial plane will bisect said listening room providing a broadcasting of dual channel sound to each half of said room respectively . edges x , y and y , z of fig7 are nearest adjacent edges and their midpoints are points p and q respectively . it can be seen that the dodecahedron illustrated is divided by plane m seen on edge such that left and right sides designated l and r respectively are defined by plane m passing through points p and q . fig8 illustrates a listening room 32 according to prior art with two cabinets 33 and 34 said cabinets 33 and 34 being located on baseline c each containing speakers and being excited by left and right channels of a dual channel sound signal respectively . two fields of influence from these cabinets designated l and r respectively show the area ( hatched ) in which the listener must be located to hear properly balanced sound emanating therefrom . the improved listening room 35 contains the improved speaker 20 as illustrated in fig2 and located in the room such that equatorial plane m roughly bisects the room as shown . an aforementioned infinite acoustic baffle in the shape of an exponential horn emanates coaxially with each speaker and prevents the listener from hearing more than one speaker at a time . the majority of the sound that reaches the listener does so after being reflected off the walls , ceiling and floor of the listening room . this creates two fields of influence l and r in the illustration projected from the surfaces of the listening room and creating a much enlarged area shown hatched from which balanced sound can be heard as projected from the improved assembly 20 . fig1 shows an assembly based on the hexahedron suspended from a stand specially adapted to be placed on the floor or an item of furnature such as a shelf or table in the listening room . in this example each speaker has been replaced with a pattern of smaller speakers . an assembly according to the invention and based on the octahedron is shown in fig1 suspended from a wall mounted bracket adapted for that purpose . under certain conditions it may be practical to remove one or more of the speakers from the assembly . this may be necessary to increase the port area or to provide special controls , etc . in the space provided . removing a speaker should not completely nullify the advantages of the assembly if the orientation and position of the remaining speakers one to another is not disturbed . fig1 illustrates such an example where an assembly 36 according to the invention has been adapted through the use of special mounting plates 37 for mounting on a pole 38 which passes through the body of the assembly as may be required for exterior public address application on a light pole or a sign pole . another such example is shown in fig1 where one face of a tetrahedral based unit 39 has been removed for flush mounting on a wall surface 40 . the invention is not limited to the exact form shown in the drawings as obvious changes may be made within the scope of the following claims .	8
the essential operating principles of a feedforward linearization technique are illustrated in fig4 . as seen in the diagram , the fig4 system includes an unlinearized system 440 ( such as a laser or amplifier ), and a replica of the unlinearized system , 450 . also shown are microwave splitter 410 and variable gain amplifier 415 . an input signal , which is this example includes frequency components f 1 , f 2 , is split by splitter 410 , coupled to system 440 , and also coupled to replica system 450 via the variable gain amplifier 415 . the output of system 440 is received by the positive input of 180 degree hybrid coupler 460 , and the output of replica system 450 , after passing through variable gain amplifier 455 , is received by the negative input of 180 degree hybrid coupler 460 . the resultant difference signal , output from coupler 460 , is the linearized signal , with cancellation of the harmonics 2f 1 − f 2 and 2f 2 − f 1 , as shown . in can be observed that due to the two - port nature of the system to be linearized , there is the need for the replica of the unlinearized system as well as additional components such as two variable gains and one 180 ° coupler for harmonic cancellation . typically , and as seen above , optical and / or electrical delays may also be needed for fine - tuning purposes . embodiments of the present invention utilize heterojunction bipolar transistors which operate as light - emitting transistors and laser transistors . reference can be made for example , to u . s . pat . nos . 7 , 091 , 082 , 7 , 286 , 583 , 7 , 297 , 589 , and 7 , 354 , 780 , and to the following : u . s . patent application ser . no . 10 / 646 , 457 , filed aug . 22 , 2003 ; u . s . patent application ser . no . 10 / 861 , 320 , filed jun . 4 , 2004 ; u . s . patent application ser . no . 11 / 496 , 161 , filed jul . 31 , 2006 ; u . s . patent application ser . no . 11 / 805 , 859 , filed may 24 , 2007 ; u . s . patent application ser . no . 11 / 974 , 323 , filed oct . 12 , 2007 ; and u . s . patent application ser . no . 12 / 008 , 796 , filed jan . 14 , 2008 ; pct international patent publication number wo / 2005 / 020287 , published mar . 3 , 2005 , and pct international patent publication number wo / 2006 / 006879 published aug . 9 , 2006 ; all the foregoing being assigned to the same assignee as the present application . reference can also be made , for example , to the following publications : light - emitting transistor : light emission from ingap / gaas heterojunction bipolar transistors , m . feng , n . holonyak , jr ., and w . hafez , appl . phys . lett . 84 , 151 ( 2004 ); quantum - well - base heterojunction bipolar light - emitting transistor , m . feng , n . holonyak , jr ., and r . chan , appl . phys . lett . 84 , 1952 ( 2004 ); type - ii gaassb / inp heterojunction bipolar light - emitting transistor , m . feng , n . holonyak , jr ., b . chu - kung , g . walter , and r . chan , appl . phys . lett . 84 , 4792 ( 2004 ); laser operation of a heterojunction bipolar light - emitting transistor , g . walter , n . holonyak , jr ., m . feng , and r . chan , appl . phys . lett . 85 , 4768 ( 2004 ); microwave operation and modulation of a transistor laser , r . chan , m . feng , n . holonyak , jr ., and g . walter , appl . phys . lett . 86 , 131114 ( 2005 ); room temperature continuous wave operation of a heterojunction bipolar transistor laser , m . feng , n . holonyak , jr ., g . walter , and r . chan , appl . phys . lett . 87 , 131103 ( 2005 ); visible spectrum light - emitting transistors , f . dixon , r . chan , g . walter , n . holonyak , jr ., m . feng , x . b . zhang , j . h . ryou , and r . d . dupuis , appl . phys . lett . 88 , 012108 ( 2006 ); the transistor laser , n . holonyak , m feng , spectrum , ieee volume 43 , issue 2 , february 2006 ; signal mixing in a multiple input transistor laser near threshold , m . feng , n . holonyak , jr ., r . chan , a . james , and g . walter , appl . phys . left . 88 , 063509 ( 2006 ); collector current map of gain and stimulated recombination on the base quantum well transitions of a transistor laser , r . chan , n . holonyak , jr ., a . james , g . walter , appl . phys . lett . 88 , 143508 ( 2006 ); high - speed ( 1 ghz ) electrical and optical adding , mixing , and processing of square - wave signals with a transistor laser , milton feng ; n . holonyak , jr . ; r . chan ; a . james ; g . walter , photonics technology letters , ieee volume : 18 issue : 11 ( 2006 ); graded - base ingan / gan heterojunction bipolar light - emitting transistors , b . f . chu - kung et al ., appl . phys . left . 89 , 082108 ( 2006 ); carrier lifetime and modulation bandwidth of a quantum well algaas / ingap / gaas / ingaas transistor laser , m . feng , n . holonyak , jr ., a . james , k . cimino , g . walter , and r . chan , appl . phys . left . 89 , 113504 ( 2006 ); chirp in a transistor laser , franz - keldysh reduction of the linewidth enhancement , g . walter , a . james , n . holonyak , jr ., and m . feng appl . phys . left . 90 , 091109 ( 2007 ); photon - assisted breakdown , negative resistance , and switching in a quantum - well transistor laser , a . james , g . walter , m . feng , and n . holonyak , jr ., appl . phys . left . 90 , 152109 ( 2007 ); franz - keldysh photon - assisted voltage - operated switching of a transistor laser , james , a . ; holonyak , n . ; feng , m . ; walter , g ., photonics technology letters , ieee volume : 19 issue : 9 2007 ; experimental determination of the effective minority carrier lifetime in the operation of a quantum - well n - p - n heterojunction bipolar light - emitting transistor of varying base quantum - well design and doping , h . w . then , m . feng , n . holonyak , jr ., and c . h . wu , appl . phys . lett . 91 , 033505 ( 2007 ); charge control analysis of transistor laser operation , m . feng , n . holonyak , jr ., h . w . then , and g . walter , appl . phys . lett . 91 , 053501 ( 2007 ); optical bandwidth enhancement by operation and modulation of the first excited state of a transistor laser , h . w . then , m . feng , and n . holonyak , jr ., appl . phys . lett . 91 , 183505 ( 2007 ); modulation of high current gain ( β & gt ; 49 ) light - emitting ingan / gan heterojunction bipolar transistors , b . f . chu - kung , c . h . wu , g . walter , m . feng , n . holonyak , jr ., t . chung , j .- h . ryou , and r . d . dupuis , appl . phys . lett . 91 , 232114 ( 2007 ); collector characteristics and the differential optical gain of a quantum - well transistor laser , h . w . then , g . walter , m . feng , and n . holonyak , jr ., appl . phys . lett . 91 , 243508 ( 2007 ); and transistor laser with emission wavelength at 1544 nm , f . dixon , m . feng , n . holonyak , jr ., yong huang , x . b . zhang , j . h . ryou , and r . d . dupuis , appl . phys . lett . 93 , 021111 ( 2008 ). fig5 illustrates a light emitting transistor device of a type described in pct international patent application publication wo / 2005 / 020287 and in pct international patent application publication wo / 2006 / 093883 , both of these pct published international patent applications being incorporated herein by reference . a substrate 505 has the following layers disposed thereon : subcollector 510 , n - type gaas collector 530 , 600 angstrom p + compositionally graded ingaas base 540 , n - type ingap emitter 550 , and cap layer 560 . also shown are collector metallization ( or electrode ) 515 , base metallization 545 , and emitter metallization 565 . collector lead 517 , base lead 547 , and emitter lead 567 are also shown . as described in the referenced pct published international patent applications , for conventional pn junction diode operation , the recombination process is based on both an electron injected from the n - side and a hole injected from the p - side , which in a bimolecular recombination process can be limited in speed . in the case of hbt light emission ( as represented in fig5 as light emission from base region 540 ) the base “ hole ” concentration is so high that when an electron is injected into the base , it recombines ( bimolecular ) rapidly . the base current merely re - supplies holes via relaxation to neutralize charge imbalance . as is also described in the referenced pct international patent application publications wo / 2005 / 020287 and wo / 2006 / 093883 , in typical transistor operation , one of the three terminals of a transistor is common to both the input and output circuits . this leads to familiar configurations known as common emitter ( ce ), common base ( cb ), and common collector ( cc ). the common terminal ( often ground reference ) can be paired with one or the other of the two remaining terminals . each pair is called a port , and two pairs for any of the configurations are called a two - port network . the two ports are usually identified as an input port and as an output port . as also described in the referenced pct published international patent applications , and as illustrated in fig6 , a third port , namely an optical output port , is provided , and is based on ( recombination - radiation ) emission from the base layer of the hbt light emitter . for the hbt of fig5 operated , for example , with a common emitter configuration , when an electrical signal is applied to the input port ( port 1 ), there results simultaneously an electrical output with signal amplification at port 2 and optical output with signal modulation of light emission at port 3 . as further described in the referenced pct international patent application publications wo / 2005 / 020287 and wo / 2006 / 093883 , fig7 illustrates the three terminal light emitting hbt , 910 , in a lateral optically resonant cavity , represented at 920 , for operation , for example , as a lateral gain guided laser . the lateral cavity may be defined , for example , by cleaved edges on or near the light emitting region . as further described in the referenced pct published patent applications , and as will be understood throughout the present application , vertical cavity laser configurations can also be employed , using , for example , distributed bragg reflectors ( dbrs ) as upper and lower optical cavity reflectors . as also described in the referenced pct international patent application publications wo / 2005 / 020287 and wo / 2006 / 093883 , stimulated emission can be employed to advantage in the base layer of a bipolar transistor ( e . g . a bipolar junction transistor ( bjt ) or a heterojunction bipolar transistor ( hbt ), in order to enhance the speed of the transistor . spontaneous emission recombination lifetime is a fundamental limitation of bipolar transistor speed . the base layer of a bipolar transistor is adapted to enhance stimulated emission ( or stimulated recombination ) to the detriment of spontaneous emission , thereby reducing recombination lifetime and increasing transistor speed . at least one layer exhibiting quantum size effects , preferably a quantum well or a layer of quantum dots , preferably undoped or lightly doped , is provided in the base layer of the bipolar transistor . preferably , at least a portion of the base layer containing the at least one layer exhibiting quantum size effects , is highly doped , and of a wider bandgap material than said at least one layer . the at least one quantum well , or , for example , layer of quantum dots , within the higher gap highly doped material , enhances stimulated recombination and reduces radiative recombination lifetime . a two - dimensional electron gas (“ 2 - deg ”) enhances carrier concentration in the quantum well or quantum dot layer , thereby improving mobility in the base region . improvement in base resistance permits reduction in base thickness , with attendant reduction of base transport time . these advantages in speed are applicable in high speed bipolar transistors in which light emission is utilized , and / or in high speed bipolar transistors in which light emission is not utilized . in light emitting bipolar transistor devices , for example heterojunction bipolar transistors of direct bandgap materials , the use of one or more layers exhibiting quantum size effects can also be advantageous in enhancing light emission and customizing the emission wavelength characteristics of the devices . doped or highly doped quantum size regions can also be utilized . fig8 shows the general epitaxial layers of a type of device that can be utilized in practicing embodiments and techniques hereof , and which can be modified to implement other embodiments and techniques hereof . reference can also be made , for example , to copending u . s . patent application ser . no . 11 / 805 , 859 , filed may 24 , 2007 , and assigned to the same assignee as the present application . in the simplified device diagram of fig8 , a substrate , which may be doped or undoped , is represented at 805 , and has the following layers disposed thereon . a lower cladding layer , which is n - type in this example ( it being understood , throughout , that , where suitable , devices of opposite conductivity type can be employed ), is represented at 810 . then , an n - type sub - collector contact layer is represented at 815 , and an intrinsic or lightly doped n - type collector layer is represented at 820 . next , a p - type base region , which preferably exhibits quantum size effects ( e . g . by virtue of its own dimensions and / or by inclusion of one or more quantum well ( s ) and / or layer ( s ) of quantum dots and / or quantum wires ), is represented at 830 . disposed thereon are n - type emitter 850 , n - type upper cladding 870 , and an n - type emitter contact layer , represented at 880 . contacts and leads for application of signals are applied to the sub - collector contact layer 815 , the base layer 830 , and the emitter contact layer 880 . for operation as a laser , an optical resonant cavity is provided , as previously set forth . as has been described , the heterojunction bipolar light - emitting transistor ( hblet ) is a three - port device ( 2 electrical ports and 1 optical port ), which , when incorporated with a suitable photon resonator cavity , can operate in laser mode . as shown in fig9 , its optical output may be modulated , for example , by a microwave signal input to electrical port 1 or to electrical port 2 , or concurrently to both ports 1 and 2 . the hblet of fig9 is represented as being in common - emitter configuration where port 1 is the base - emitter and port 2 is the collector - emitter . as also described herein , configurations , such as common - base and common - collector , are also realizable . the input to port 1 is designated x 2 ( t ) and the input to port 2 is designated x 2 ( t ). due to its three - port nature , and concurrent port 1 - and port 2 - modulation capability , and as will be demonstrated further herein , the hblet laser can be employed in a special way to implement the feedforward linearization scheme at the level of a single - device , hence achieving an unprecedented compact and integrated form . in fig1 , the functional blocks of a feedforward linearization scheme , that may be implemented at the single - device level with an hblet laser , are identified . ( the reference numerals , with primes added , denote conceptually elements corresponding to those of fig4 with like reference numerals .) for example , in the common - emitter configuration , the optical output response to port 1 ( v be ) modulation is fundamentally not the same as that of port 2 ( v ce ) modulation due to involvement of different underlying physical processes . port 1 ( v be ) modulation is a direct current injection process whereby the injected emitter current , hence the base electron - hole recombination current which forms coherent photons giving the laser signal , is modulated directly . port 2 ( v ce ) modulation involves both v be - and v cb - modulation ( since v ce = v cb + v be ). v cb - modulation is an electroabsorption ( or franz - keldysh ) process at the reverse - biased base - collector junction . in a transistor laser , both processes occur in a single photon resonator cavity ( i . e ., the cavity of the transistor laser ). the optical output response to port 1 and port 2 modulation may then be characterized by two non - linear 3 rd order polynomials with different linear gains ( modulation efficiencies ), a b and a c , and 3 rd order non - linear coefficients , γ b and γ c , respectively . in accordance with a feature of an embodiment of the invention , a feedforward linearization system and technique is implemented by feeding port 1 with rf input , x ( t ) while feeding the port 2 concurrently with the same rf input with an appropriate gain , g , of selected amplitude and phase to cause the non - linearity ( e . g ., intermodulation products ) in the responses to cancel . as is shown below , the desired optical output that is linear in relationship with the applied electrical ac signal does not cancel . however , the resultant total ( effective ) linear gain due to the concurrent two - port modulation will be reduced . fig1 shows this in schematic form . the input to electrical port 1 is x ( t ) and the input to electrical port 2 is gx ( t ). the output of optical port 3 is the optical rf output , which is linearized , as can be seen as follows : port 1 - modulation : y b ( t )= a b x ( t ){ 1 + γ b x 2 ( t )} port - 2 - modulation : y c ( t )= a c gx ( t ){ 1 + γ c g 2 x 2 ( t )} y ( t )=[ a b + ga c ] x ( t )+[ a b γ b + a c γ c g 3 ] x 3 ( t ) for perfect cancellation of 3 rd order non - linearity , gain g is chosen such that there will be a trade - off in the form of reduced total linear gain , a b + ga c = a b −{ a b γ b / a c γ c } 1 / 3 a c while fig1 shows a common emitter configuration , it will be understood that common collector and common base configurations can alternatively be employed . the generalized circuit is for all three configurations is shown in fig1 , in which the port 1 terminals are denoted 1 + and 1 −, and the port 2 terminals are denoted 2 + and 2 −. the terminals 1 + and 2 + are the common terminals . the table of fig1 shows the respective laser transistor regions ( emitter , collector , or base ) to which the terminals are coupled for each configuration . the generalized equations for port 1 and port 2 modulation are as follows : port 1 - modulation : y 1 ( t )= a 1 x ( t ){ 1 + γ 1 x 2 ( t )} port 2 - modulation : y 2 ( t )= a 2 gx ( t ){ 1 + γ 2 g 2 x 2 ( t )} y ( t )=[ a 1 + ga 2 ] x ( t )+[ a 1 γ 1 a 2 γ 2 g 3 ] x 3 ( t ) for perfect cancellation of 3 rd order non - linearity , gain g is chosen such that there will be a trade - off in the form of reduced total linear gain , a 1 + ga 2 = a 1 −{ a 1 γ 1 / a 2 γ 2 } 1 / 3 a 2 based on the two - port optical modulation of a three - port heterojunction bipolar light emitting transistor ( hb let ) laser , the unique feedforward linearization system and technique hereof achieves , in the exemplary embodiment , a fourfold reduction in component count ( that is , from more than eight active and passive components to only two transistors — namely , the transistor laser and a transistor to implement the gain function ). hence , the system may be implemented as a single - chip , integrated solution , thereby achieving great reduction in volume , power consumption , and costs .	7
in the present invention , to solve the problem of check valves sticking when operated with acetonitrile mixtures , valves in new , used and failed conditions were disassembled and examined . to enable the balls and seats to be inspected by scanning electron microscopy ( sem ) their surfaces were plated with a conductive and extremely thin ( approximately 100 angstrom ) layer of gold . sem images of crystal balls from new , used and failed valves showed no detectable differences . an sem image of a new sapphire seat surface 66 as shown in fig4 a reveals grinding marks 68 , but an sem image of a used seat surface 70 as shown in fig4 b reveals smooth patches 72 . an sem image of a failed ( stuck ) seat 74 as shown in fig4 c reveals an even smoother surface 76 . it has been suggested that geometry differences originally existing between new ball and seat sets in different valves determine the likelihood of the valves sticking . to ascertain whether failed valve seats originally had smoother surfaces or later developed smoother surfaces during use , new ( sapphire ) seats known to have surface grinding marks 68 as in fig4 a were operated with acetonitrile mixtures until failing . afterwards , sem inspections confirmed that the failed valve seats had developed smoother surfaces 76 as in fig4 c . in an experiment to learn whether failed seats develop smoother surfaces through being worn or through being coated with deposits , additional valves were operated with various mixtures of acetonitrile and water , so that the seats would develop smoother surfaces 72 , 76 which could be used as samples for further analysis . valve seats 26 made of alumina oxide in the form of sapphire or ruby crystal routinely failed as expected . surprisingly , however , valve seats 80 made of alumina oxide in the form of sintered ceramic ( in identical geometries ) as shown in fig5 a , which had been believed to have sealing qualities identical to seats 26 made of alumina oxide in the form of sapphire crystal , did not fail after being run with acetonitrile / water gradients 25 times . this indicates that sintered alumina oxide ceramic seat 80 valves could be operated in acetonitrile environments without sticking . sintered alumina oxide ceramic check valve balls and seats are available from imetra inc . of elmsford n . y . to explain the difference between sticking and nonsticking alumina oxide seats , sem images of crystal valve seats 26 were compared against images of sintered ceramic valve seats 80 . new crystal seats 26 as shown in fig4 a as well as new ceramic seats 80 as shown in fig5 a featured broach grinding marks 68 and 84 respectively . new crystal seat surface 66 grinding marks 68 faded into smooth patches 72 on used crystal seat surfaces 70 as shown in fig4 b . the patches spread into a progressively smoother surface 76 on failed crystal seat surfaces 74 as shown in fig4 c . in contrast , new ceramic seat surface 82 grinding marks 84 were still apparent on used ceramic seat surfaces 86 as shown in fig5 b . to characterize the smooth surfaces 72 , 76 , the used crystal seat 26 shown in fig4 b was fired in a 1400 degree f . flame for ten minutes . sem inspection of the fired surface 78 of the used seat 26 as shown in fig4 d revealed grinding marks 68 which had been uncovered from beneath the coating of residue 72 . a fourier transform infra - red ( f . t . i . r .) spectra identified components of residue 72 as aliphatic amines , esters and possibly ether . apparently , originally rough - scored crystal seat surfaces 66 expose alumina oxide bonding sites which are activated by the presence of water in the solvent mixture and thereby present a reduced steric hindrance to the seeding of aliphatic amines . the other ends of aliphatic amine r groups polymerize and grow into residue patches 72 and 76 coating the surfaces of seats 26 . despite being made of alumina oxide , sintered ceramic is amorphous , having no crystal structure to present crystal bonding sites . neither polished nor roughened amorphic alumina oxide ceramic surfaces react with acetonitrile residues . sintered alumina oxide ceramic is uniformly hard , relatively easy to grind and polish , and resists wear and retains its shape as well as alumina oxide crystal . according to this invention it is hypothesized that at least some other elements from groups iiib and ivb of the periodic table in pure or oxidized forms having non - polycrystalline ( i . e . either amorphic or single - crystal ) structures would exhibit non - sticking characteristics comparable to those demonstrated by alumina and zirconia oxides . crystal ball surfaces 60 may be too smooth to support the seeding or growth of residue molecules . although originally smoother , crystal ball surface smoothness is surpassed by the even smoother coating of residue 76 developed on failed crystal seat surface 74 . once coated with acetonitrile residue , stuck valves may be manually freed and reused , but invariably stick again upon reaching the pressure at which they failed . a stuck and freed valve will operate normally with solvents other than acetonitrile ( such as methanol ) up to a pressure of about 6000 psi . this implies that the smooth coating of residue 76 causes ball and seat interface sticking by surface tension rather than by a chemical reaction . thus , although smoother interface surfaces are advantageous for tighter sealing , ball and seat surfaces can become so smooth and seal so tightly that they become stuck together . although the present invention has been described in a preferred embodiment , it will be appreciated by those skilled in the art that this embodiment may be modified without departing from the essence of the invention . it is therefore intended that the following claims be interpreted as covering any modifications falling within the true scope and spirit of the invention .	8
in the following description , numerous details are set forth to provide an understanding of the present invention . however , it will be understood by those of ordinary skill in the art that the present invention may be practiced without these details and that numerous variations or modifications from the described embodiments may be possible . the disclosure herein generally relates to a steering system for directional drilling . a bottom hole assembly incorporates a rotary steerable system having a piston actuated mechanism . however , the piston actuated mechanism is controlled by pressurized oil supplied from a pressurized oil system rather than being controlled by flowing drilling mud . the flow of oil to pistons of the piston actuated mechanism is controlled by a valve system . the valve system allows the pressurized oil to be ported to the pistons of the rotary steerable system to , for example , point the bit in the desired steering direction . the force required to manage the reactive forces from weight on bit ( wob ), bottom hole assembly ( bha ) mass and other drilling loads is provided by the pressure differential between the annulus and the pressurized oil acting across the piston area of the pistons . the separate pressurized oil system may be used with , for example , point - the - bit type systems , push - the - bit systems , or other types of steerable drilling systems . referring generally to fig1 , an embodiment of a drilling system 20 is illustrated . in this embodiment , drilling system 20 comprises a bottom hole assembly 22 coupled with a pressurized oil system 24 . the bottom hole assembly 22 comprises a drill bit 26 connected to a rotary steerable system 28 having a steering section 30 which is selectively manipulated via a piston actuated mechanism 32 having a plurality of pistons 34 . pressurized oil system 24 is employed to route pressurized oil to piston actuated mechanism 32 and to selected pistons 34 via oil supply lines 36 . the pressurized oil is used to move specific pistons 34 which changes the orientation of the drill bit 26 , e . g . changes the drilling axis orientation , with respect to the longitudinal axis 38 of the bottom hole assembly 22 . for example , the pistons 34 may be employed to control at least one of the directional bias and the axial orientation of the drill bit 26 . the pistons 34 may be arranged , for example , to point the drill bit 26 or to push the drill bit 26 . by way of specific example , the drilling system 20 utilizes rotary steerable system 28 which rotates with the plurality of pistons / actuators 34 . additionally , the rotary steerable system 28 may be used in conjunction with stabilizers , such as non - rotating stabilizers . pressurized oil system 24 may comprise an oil pump 40 which pressurizes the oil supplied through oil supply lines 36 for controlling the drilling orientation of the rotary steerable system 28 . the pressurized oil from pump 40 may be routed through a valve system 42 used to control the flow and pressure of the oil supplied to pistons 34 of rotary steerable system 28 and piston actuated mechanism 32 . in the embodiment illustrated , oil pump 40 is driven by a shaft 44 which , in turn , may be driven directly by flowing drilling mud flowing through a turbine 46 or other device designed to power oil pump 40 . alternatively , the oil pump 40 may be powered by an electric motor 48 . in the case of an electric motor , electrical power may be provided to motor 48 by an alternator 50 . by way of example , the alternator 50 may be driven by drilling mud , e . g . driven by drilling mud via a mud turbine or mud pump ( pdm ) 52 . in the embodiment employing electric motor 44 , a speed control system 54 may be implemented to maintain a constant pump pressure . in the embodiment in which pump 40 is a direct mud driven pump , the pressure may be maintained by an internal pressure relief valve 56 . it should be noted that electrical power may be supplied to motor 48 from other sources , e . g . from a surface supply coupled to electric motor 48 via cable or other conductors routed downhole . the motive fluid for steering rotary steerable system 28 , e . g . oil supplied through oil supply lines 36 , works between a high - pressure source and a low - pressure reservoir . the low - pressure reservoir may be pressure balanced with the pressure internal to the drill string . the power required to provide the cyclic steering forces as the drill string rotates often requires a mechanical source of energy of several kwatts . for example , 5000 pounds acting over 0 . 25 square inches requires 141 joules at four times a second ( 240 rpm )− mechanical power of 1700 watts assuming there is no energy recycling / storage . the valve system 42 employs valves to control the flow of pressurized oil into / out of the pistons 34 , and those valves may comprise bistable actuators ( low energy fluid flow switches ) or piezo restrictive actuator valves . as an alternative , the valve system 42 may employ a rotary valve format , such as the rotary valve format used in the powerdrive rotary steerable system available from schlumberger corporation . in either case , the system is designed to track the local gravity vector to enable the system to determine which valves are to be activated to achieve the required steering response taking into account the various tool face offset effects that exist due to friction , bit response , bottom hole assembly load , formation tendencies , and other potential factors . the gravity and valve data may be provided by suitable sensors . however , other types of valves and sensor systems may be employed in pressurized oil system 24 to control the flow of pressurized oil . by using the separate pressurized oil system 24 to control the orientation of rotary steerable system 28 , less internal wear results which enables extended runtimes and a reduction in tools for each drilling job . the pressurized oil system also is amenable to higher pressure which , in turn , enables actuation by smaller pistons 34 , thereby providing more flexibility with respect to both packaging and actuation . the pressurized oil system 24 further enables use of higher forces while eliminating the coupling of actuation force and flow rate of the drilling mud . additionally , the system 20 no longer requires relatively high bit drop pressures . the pressurized oil also can be combined with oil needed for other drilling systems . depending on the specific application , the pressurized oil system 24 may be located in whole or in part downhole along the drill string . for example , the oil pump 40 and the valve system 42 may be located anywhere in the bottom hole assembly . the rotary steerable system 28 and the pressurized oil system are designed so that the pistons 34 can be actuated independently to achieve a straight ahead steering . additionally , the design of the system enables modulation of the piston displacement and forces in synchronism with the phase of drill string rotation to achieve intermediate steering curvatures . the pressurized oil system 24 may be used in combination with a variety of bottom hole assemblies 22 and rotary steerable systems 28 . however , one example of a suitable bottom hole assembly is illustrated in fig2 . a similar bottom hole assembly is described in u . s . pat . no . 7 , 188 , 685 . in this example , bottom hole assembly 22 combines both point - the - bit and push - the - bit technologies . it should be noted , however , the pressurized oil system 24 may be combined with a variety of other types of steerable bottom hole assemblies for use in directional drilling . for example , the rotary steerable system 28 may be a purely point - the - bit system or a purely push - the - bit system . in the example illustrated , bottom hole assembly 22 comprises an upper stabilizer 58 mounted on a collar 60 which may be positioned adjacent rotary steerable system 28 . a lower stabilizer 62 is attached to an upper section 64 of rotary steerable system 28 . a steering section 65 is connected to drill bit 26 . a surface control system 66 may be utilized to communicate steering commands to electronics in upper section 64 . in some embodiments , the rotary steerable system 28 rotates with the pistons / actuators 34 and the stabilizers 58 and / or 62 may comprise non - rotating stabilizers . the drill bit 26 is tilted about a swivel 67 which may be in the form of a universal joint 68 . in this embodiment , the steering section 65 is selectively actuated ( e . g . pivoted / rotated ) about swivel 67 with respect to upper section 64 to actively maintain a bit axis 69 pointing in a particular direction while the bottom hole assembly is rotated at a desired rotational speed of the drill string . pistons 34 act on a periphery of the steering section 65 to apply a force for tilting the drill bit 26 with respect to the bottom hole assembly or tool axis 38 . the direction or orientation of the drill bit 26 broadly defines the direction of borehole formation . in a push - the - bit type system , the pistons 34 can be configured to act against the surrounding wellbore wall . in one example , pistons 34 are sequentially actuated by virtue of the pressurized oil from oil system 24 as steering section 65 pivots / rotates . this enables the desired tilt of the drill bit 26 to be actively maintained to ensure drilling in a desired direction through the formation . in other embodiments and situations , the pistons 34 may be intermittently actuated in a random manner by the pressurized oil supplied through oil supply lines 36 to , for example , drill straight ahead as discussed above . in still other embodiments and situations , the pressurized oil from oil system 24 is used to actuate pistons 34 in a directionally - weighted semi - random manner to provide for less aggressive steering as the steering section 65 pivots / rotates . in some situations , the pressurized oil system 24 may be used to activate either all or none of the pistons 34 simultaneously to lock the steering sleeve , e . g . steering section 65 , in a drill ahead configuration and / or to reduce wear on the steering actuators . a variety of methods may be employed to measure the sleeve angle so as to improve control over the toolface and to improve control over the direction in which the sleeve is oriented . as described above , the steering may be achieved by synchronously modulating the pistons 34 in both force and displacement in phase relationship with the desired toolface pointing direction . accordingly , the pressurized oil system 24 provides great flexibility for controlling directional drilling in a variety of applications and with many types of bottom hole assemblies 22 and rotary steerable systems 28 . although only a few embodiments of the present invention have been described in detail above , those of ordinary skill in the art will readily appreciate that many modifications are possible without materially departing from the teachings of this invention . accordingly , such modifications are intended to be included within the scope of this invention as defined in the claims .	4
referring initially to fig1 , removable screen 10 includes a top edge 11 , a right edge 13 , a bottom edge 15 and a left edge 17 . removable screen 10 also includes corners 29 , 31 , 33 and 35 . as illustrated in fig1 , removable screen 10 has a rectangular shape , but can have any other geometric shape , for example , a circle , a polygon , or other non - geometric shape . removable screen 10 can include magnets 37 a , 37 b , 37 c , 37 d , 37 e , 37 f , 37 g , 37 h , 37 i , 37 j , 37 k and 37 l . alternatively , removable screen 10 can include continuous magnetic strips along edges 11 , 13 , 15 and 17 . as illustrated in fig1 , removable screen 10 includes 12 magnets 37 a - l , but can include any number of magnets . as further illustrated in fig1 , magnets 37 a - l are distributed evenly along edges 11 , 13 , 15 and 17 , but they can be distributed in any way , for example , evenly , in a particular pattern , or randomly . magnets 37 a - l can be coupled to removable screen 10 by means of receptacle 27 , having a top outer edge 11 , a top inner edge 19 , a right outer edge 13 , a right inner edge 21 , a bottom outer edge 15 , a bottom inner edge 23 , a left outer edge 17 and a left inner edge 25 . as illustrated in fig1 , receptacle 27 can be a pocket or a fold that runs along edges 11 , 13 , 15 and 17 of removable screen 10 . receptacle 27 can be made of the same material as removable screen 10 or can be made of another material . receptacle 27 can be affixed to removable screen 10 or can be removable . receptacle 27 can be a continuous pocket along the perimeter of removable screen 10 , as illustrated in fig1 . removable screen 10 can also include a plurality of receptacles . each of the magnets 37 a - l can be coupled to removable screen 10 by means of an individual receptacle or groups of magnets can be coupled by means of the same receptacle . receptacles can include pockets , fasteners , or any other mechanisms or means that can receive a magnet . magnets 37 a - l are secured in place and are not movable in the field of the formable material . magnets 37 a - l can be coupled to removable screen 10 such that they are not visible when viewed from a given perspective of the formable material . receptacle 27 and any other receptacles can also be kept out of view . referring to fig2 , removable screen 110 is shown having a top edge 111 , a right edge 113 , a bottom edge 115 and a left edge 117 . as illustrated in fig2 , removable screen 110 has a rectangular shape , but can have any other shape , for example , a circle , a polygon , or other non - geometric shape . removable screen 110 includes magnets 137 a , 137 b , 137 c , 137 d , 137 e , 137 f , 137 g , 137 h , 137 i , 137 j , 137 k and 137 l along edges 111 , 113 , 115 and 117 or individual points 137 a , 137 b , 137 c , 137 d , 137 e , 137 f , 137 g , 137 h , 137 i , 137 j , 137 k and 137 l on a continuous magnetic strip along edges 111 , 113 , 115 and 117 . in addition to magnets 137 a , 137 b , 137 c , 137 d , 137 e , 137 f , 137 g , 137 h , 137 i , 137 j , 137 k and 137 l , removable screen 110 can also include magnets throughout its surface , such as magnets 139 a , 139 b and 139 c . as illustrated in fig2 , removable screen 110 includes 15 magnets 137 a - l and 139 a - c , but can include any number of magnets . as further illustrated in fig2 , magnets 137 a - l and 139 a - c are distributed evenly along edges 111 , 113 , 115 and 117 and throughout the surface of removable screen 110 , but they can be distributed in any way , for example , evenly , in a particular pattern , or randomly . magnets 137 a - l and 139 a - c can be coupled to removable screen 110 by means of a receptacle or a plurality of receptacles . for example , as illustrated in fig2 , magnets 137 a - l can be coupled to removable screen 110 by means of receptacle 127 having a top outer edge 111 , a top inner edge 119 , a right outer edge 113 , a right inner edge 121 , a bottom outer edge 115 , a bottom inner edge 123 , a left outer edge 117 and a left inner edge 125 . as illustrated in fig2 , receptacle 127 can be a pocket or a fold that runs along edges 111 , 113 , 115 and 117 of removable screen 110 . receptacle 127 can be made of the same material as removable screen 110 or can be made of another material . receptacle 127 can be affixed to removable screen 110 or can be removable . receptacle 127 can be a continuous pocket along the perimeter of removable screen 110 , as illustrated in fig2 . magnets 139 a - c can be coupled to removable screen 110 by means of another receptacle ( not shown in fig2 ), for example , a pocket or strip of material or other fastener means . removable screen 110 can also include a plurality of receptacles . each of the magnets 137 a - l and 139 a - c can be coupled to removable screen 110 by means of an individual receptacle or groups of magnets can be coupled by means of the same receptacle . receptacles can include pockets , fasteners , or any other mechanisms or means that can receive a magnet . magnets 137 a - l and 139 a - c can be coupled to removable screen 110 such that they are not visible from a given perspective of the formable material . receptacle 127 and any other receptacles can also be kept out of view . fig2 shows a fold line between each pair of magnets 137 a - l and 139 a - c , for example , fold line 141 a between magnets 137 g and 137 d , and fold line 141 b between magnets 137 g and 139 c . these fold lines will be discussed in more detail below . a removable screen , such as removable screen 10 or removable screen 110 , can be magnetically coupled to a window or other frame by the magnetic attraction of the magnets within the removable screen to magnetically compatible elements such as corner bead . in the absence of corner bead or other property within a window or frame that would result in magnetic attraction of the magnets within the removable screen to the wall or screen , the removable screen can be magnetically coupled to a window or other frame by means of an attachment surface . referring now to fig3 a , attachment surface 60 is coupled to a window 50 . attachment surface 60 is a continuous strip of material along window edges 51 , 52 , 53 and 54 . attachment surface 60 is made of magnetic , ferromagnetic or other material that would result in magnetic attraction to the magnets within a removable screen . attachment surface 60 can be permanently affixed to window 50 , for example by means of screws or permanent adhesive or can be attached by removable means , such as velcro , pins , tacks or a removable adhesive . as illustrated in fig3 a , attachment surface is a continuous strip of material but can also include multiple strips of material or individual small pieces of material distributed where needed , for example , at corners 50 a , 50 b , 50 c and 50 d of window 50 . referring now to fig3 b , a side view of a removable screen system 800 is shown . attachment surface 860 is coupled to frame 870 of window 850 . removable screen 810 includes magnets 837 a - g , which are magnetically coupled to attachment surface 860 . referring now to fig3 c , a side view of a removable screen system 900 is shown . attachment surface 960 is coupled to frame 970 of window 950 . removable screen 910 includes a continuous magnetic strip 980 , which is magnetically coupled to attachment surface 960 . referring now to fig3 d , a side view of a removable screen system 1000 is shown . frame 1070 of window 1050 includes corner bead ( not shown in fig3 d ), or other material embedded within window 1050 capable of magnetic attraction , therefore an attachment surface is not needed . removable screen 1010 includes magnets 1037 a - 1037 g , which are magnetically coupled to frame 1070 . referring now to fig3 e , a side view of a removable screen system 1100 is shown . frame 1170 of window 1150 includes corner bead ( not shown in fig3 e ), or other material embedded within window 1150 or frame 1170 capable of magnetic attraction , therefore an attachment surface is not needed . removable screen 1110 includes a continuous magnetic strip 1180 , which is magnetically coupled to frame 1170 . referring now to fig4 a , the removable screen arrangement 200 is an example of a horizontal roman shade arrangement of the removable screen 10 of fig1 or removable screen 110 of fig2 . removable screen 210 , as illustrated in fig4 , has a rectangular shape and has a top edge 211 , a right edge 213 , a bottom edge 215 ( not shown in fig4 ) and a left edge 217 , is coupled to window 250 . removable screen 210 includes a plurality of magnets ( not shown in fig4 ), as discussed in fig1 . for aesthetic purposes , some or all of the magnets can be kept out of view . in particular , there is at least a magnet 237 a at corner 229 , a magnet 237 e at corner 231 , a magnet 237 g at corner 233 , a magnet 237 k at corner 235 , magnets 237 b and 237 c along right edge 213 , and magnets 237 i and 237 j along left edge 217 . removable screen 210 is magnetically coupled to window 250 . removable screen 210 can be magnetically coupled to window 250 by virtue of corner bead that is embedded within the frame of window 250 , which is commonly found in many households . alternatively , removable screen 210 can be magnetically coupled to window 250 by means of an attachment surface 260 ( not shown in fig4 ), as discussed above . arrangement 200 is achieved by first magnetically coupling removable screen 210 to window 250 such that right edge 213 of removable screen 210 is parallel to the right edge of window 250 , that left edge 217 of removable screen 210 is parallel to the left edge of window 250 , and that removable screen 210 lays flat on top of window 250 , as shown in fig1 or fig2 . magnets 237 b and 237 j slide up along the left and right edges of window 250 to create fold 251 in removable screen 210 as shown in fig4 . similarly , magnets 237 c and 237 i slide up along the left and right edges of window 250 to create fold 253 , and magnets 237 e and 237 g slide up along the edges of window 250 to create fold 255 . referring now to fig4 b , the removable screen arrangement 300 is an example of a vertical roman shade arrangement of the removable screen 10 of fig1 or removable screen 110 of fig2 , and is achieved similarly to arrangement 200 of fig4 a , that is , by sliding pairs of magnets 337 b with 337 j , 337 c with 337 i , 337 d with 337 h , and 337 e with 337 g , along the edges of window 350 , to create folds 351 , 353 , 355 and 357 . referring now to fig5 , removable screen arrangement 400 is an example of another arrangement of removable screen 10 of fig1 or removable screen 110 of fig2 . arrangement 400 is achieved by first magnetically coupling removable screen 410 to window 450 , but unlike arrangements 200 and 300 of fig4 a and 4b , arrangement 400 is achieved by lifting pairs of magnets 437 c with 437 i , and 437 d with 437 h and placing them along the edges of window 450 to create fold 451 . referring now to fig6 , removable screen arrangement 500 is an example of a side roll arrangement of removable screen 10 of fig1 or removable screen 110 of fig2 . arrangement 500 is achieved by starting with removable screen 510 flat on top of and magnetically coupled to window 550 . instead of sliding magnets , magnets are lifted and joined with other magnets to create rolls or folds . for example , referring to fig6 , magnet 537 a , which is coupled to the upper right corner 529 ( not shown in fig6 ) of removable screen 510 and to the upper right corner 550 a of window 550 , is lifted . simultaneously , magnet 537 e ( not shown in fig6 ), coupled to the lower right corner 531 ( not shown in fig6 ) of removable screen 510 , is lifted . removable screen 510 is then rolled in the left direction toward left edge 517 of removable screen 510 . magnet 537 a is joined with magnet 537 k at the upper left corner 535 of removable screen 510 and at the upper left corner 550 b of window 550 . magnet 537 e is joined with magnet 537 g at the bottom left corner 533 of removable screen 510 and at the bottom left corner 550 d of window 550 . referring now to fig7 , removable screen arrangement 600 is an example of a draped arrangement of removable screen 10 of fig1 or removable screen 110 of fig2 . similarly to arrangement 500 of fig6 , arrangement 600 is achieved by lifting particular magnets and displacing them to make contact with other magnets , thus creating folds and rolls , and forming a desired shape , such as the shape shown in fig7 . referring now to fig8 , removable screen arrangement 700 is an example of a shaped arrangement of removable screen 110 of fig2 . similarly to arrangement 600 of fig7 , arrangement 700 is achieved by lifting particular magnets and displacing them to make contact with other magnets , thus creating folds and rolls , and forming a desired shape , such as the shape shown in fig8 . referring now to fig9 , removable screen arrangement 1200 is an example of a classic curtain arrangement of removable screen 10 of fig1 . arrangement 1200 includes two removable screens 1210 a and 1210 b . removable screen 1210 a includes a top edge 1211 a , a right edge 1213 a , a bottom edge 1215 a and a left edge 1217 a . removable screen 1210 b includes a top edge 1211 b , a right edge 1213 b , a bottom edge 1215 b and a left edge 1217 b . removable screen 1210 a includes a plurality of magnets , including but not limited to magnets 1237 aa , 1237 ae , 1237 ag and 1237 ak . removable screen 1210 b includes a plurality of magnets , including but not limited to magnets 1237 ba , 1237 be , 1237 bg and 1237 bk . removable screens 1210 a and 1210 b are magnetically coupled to window 1250 along left edge 1217 a and top edge 1211 a of removable screen 1210 a and right edge 1213 b and top edge 1211 b of removable screen 1210 b . removable screens 1210 a and 1210 b can also be magnetically coupled to window 1250 along bottom edges 1215 a and 1215 b . removable screens 1210 a and 1210 b can be opened and closed by sliding magnets 1237 aa and 1237 bk left and right along window 1250 , or by sliding the pair of magnets 1237 aa and 1237 ae and the pair of magnets 1237 bk and 1237 ba left and right along window 1250 . various additional implementations of this invention are described and shown in the appendix . other embodiments are included within the scope of the claims .	7
it is to be understood that the figures and descriptions of the present invention have been simplified to illustrate elements that are relevant for a clear understanding of the present invention , while eliminating , for purposes of clarity , many other elements found in typical exercise and fitness applications . those of ordinary skill in the art will recognize that other elements are desirable and / or required in order to implement the present invention . but because such elements are well known in the art , and because they do not facilitate a better understanding of the present invention , a discussion of such elements is not provided herein . the disclosure herein is directed to all such variations and modifications to the applications , networks , and systems disclosed herein and as will be known , or apparent , to those skilled in the art . fig1 is a prompt key that correlates prompts to parts of the body , which prompt references are illustratively used hereinbelow . of course , it will be apparent to those skilled in the art that the present invention is not limited to the type or number of prompts illustratively used hereinthroughout . fig2 is a schematic diagram of a body of an exerciser 20 having associated , such as physically associated , therewith one or more prompts 1 , 3 , 5 , corresponded to at least one exercise to be performed by the user , and to at least one body part 1 , 3 , 5 of the user . the user may be any exerciser performing at least one exercise intended to target at least one of the body areas 1 , 3 , 5 , or targets , corresponded to the at least one prompt 1 , 3 , 5 . the user may perform the at least one exercise in association with one or more items of exercise equipment , or in accordance with one or more exercise routines , or in accordance with an exercise routine system or equipment system . the user 20 may use the exercises , equipment and systems to target body areas for rehabilitation , relaxation , muscle - building , fitness , toning , or for any other reason known to those skilled in the art . in the present invention , users 20 may include youths , adults , and older adults . users 20 may engage in youth fitness , general fitness , body - building , special or adaptive fitness , older adult fitness and wellness , physical therapy and rehabilitation , and the like . the one or more prompts 1 - 20 increase a user &# 39 ; s comprehension of the parts of the body as the intended targets for an exercise . the prompts may be associated with exercise instructions 40 . the instructions 40 may be spoken by an instructor , written and presented to the user , audibly presented by an automated or manual system , or visibly presented by an automated or manual system . for example , instructions may be visibly presented to the user by scrolling or otherwise presenting text or pictures via a display on the equipment used in the exercise , or on a unit mounted within the fitness facility . instructions may be included on or in live demonstration , videos , dvds , cds , computer - readable media , and the like . further , instructions may be visually presented by , for example , associating matching prompts on one or more fitness props to the prompts associated with the user . a fitness prop 60 , as used herein , includes any item that may be associated with an exercise . fitness props 60 , as illustrated in fig2 a - 2g may include exercise equipment , a mat ( fig2 a ) with or without a mat carrying case ( such as a sticky mat or yoga style mat of a suitable size , with or without background color ), a ball 60 with or without a stabilizing ball stand ( such as an inflatable exercise ball of a given size , such as 55 cm , 65 cm , or 75 cm ), a towel of a suitable size , a poster , as in fig2 b ( such as a wall mounted poster ), or clothing , such as a shirt , as in fig2 c ( such as a t - shirt , long sleeve shirt , crew shirt , or the like , of a preferably breathable fabric , such as cotton / lycra , in varying sizes , such as s - xxxl ), sweatshirt or sweatpants in varying sizes , as in fig2 d , jacket ( such as long sleeve , with a breathable fabric , such as cotton , and such as with drawstring waist , in varying sizes ), shorts , as in fig2 e , pant , or tights in varying sizes , such as s - xxxl , or by waist , inseam , or dress size , or velcroed cloth , for example . the matching prompt 1 a , 3 a , 5 a on a prop 60 may be matched to the one or more prompts 1 , 3 , 5 associated with the user . the use of props 60 may , for example , aid an exerciser 20 in effecting areas of the body the user is unable to see , such as the upper back , gluteus , or hamstrings , for example . the prompts may include colors , symbols , textures , music , or electrical impulses , such as lights or sounds , for example . prompts have a greater recognizability to a user than the mere name of a muscle group , pointing by a trainer , or like prior art methodologies . prompts may be fastened by fasteners known in the art for association with the user or with a prop , such as by dying for cloth or fabric , placing sleeves , such as nylon sleeves as in fig2 f , having prompts thereon over limbs , velcroing to fabric ( such as velcroing color - coded patches directly to or over a user &# 39 ; s clothing , or velcroing a strap around clothing as in fig2 g ), snapping using snap tabs , temporary skin colorations , paint , or the like , as will be apparent to those skilled in the art . the prompts correlate with one or more muscle groups or regions of the body effected by an exercise or series of exercises , and do not typically correlate solely with motions . the effects on the body part correspondent to the prompt may include flexing , tensing , or relaxing the body part . effects may also include covering a body part correspondent to a first prompt from within view of a user in favor of a body part correspondent to another prompt , such as to insure proper form . in an embodiment , the instructions 40 may focus on one or more prompts as exercise targets , with or without any reference to the medical terminology for related regions or muscle groups . for example , an instructor may give the instruction “ tense blue , and relax red ”, which will be much more readily understandable to an average user than “ tense bicep , and relax tricep ”. further , the instructor may give the instruction “ cross red over blue to hide blue from view ”, rather than instructing to “ cross right leg over left leg ”. in an embodiment , the exerciser is prompted to focus on one or more targets correlated to the prompts for a given exercise . a given exercise may include pilates , yoga , weight training , calisthenics , kick boxing , core training , plyometrics , cardiovascular exercise , cross training , stability ball training , aquatic training , or the like , as will be apparent to those skilled in the art . prompts , with or without the use of props , and with the use of instructions , increase the impact of exercise by focusing on proper form , and decrease the probability of injury . matching prompts on props 60 may be used in conjunction with the prompts associated with the user . for example , an instruction may tell the user , “ pull the red handle until you feel the resistance start to burn in the red area of your arms .” matching prompts on props may be used to insure proper alignment , or the like . for example , when the feet of the user are properly aligned on a leg press , one or both of the prompt on the user &# 39 ; s feet and the matching prompt on the leg press may light up , or buzz . multiple prompts , and multiple matching prompts on props , may be used . in a series of embodiments , discussed hereinbelow , and with respect to fig1 and 2 , are several exemplary exercise routines . the embodiments described are exemplary only , and it will be apparent that other exercises , prompt types , and prop types may be used in accordance with the present invention . fig3 is a schematic diagram illustrating a reclined squats exercise in accordance with an aspect of the present invention . recline squats may be performed by lowering the hips toward the floor while pressing the low back to the front of a prop 60 in the form of a ball . the feet may be planted on the floor , and the knees may be bent to less than a 90 - degree angle . the user may initiate a rocking motion by extending the body supine over the top of the ball while straightening the legs , then bending the knees once again , and returning to the starting position . during recline squats , the user is to focus , such as in accordance with instructions , on prompts 6 , 7 , 8 , and 14 for muscle contraction . the user is to focus on prompts 4 , 5 and 12 controlled for stability . by focusing on prompts 6 , 7 , 8 and 14 , the intensity of the recline squat is increased . by directing attention to prompts 4 , 5 and 12 , stability is easier to achieve and maintain throughout the exercise . the ball prop may include matching prompts to allow for user focus on the desired prompts . fig3 also illustrates table top hip drops in accordance with an aspect of the present invention . table top hip drops may be performed by rolling the body forward into a supine position , and stopping with the shoulders resting on a prop 60 , such as a ball , to support the weight of the upper body . the knees may be bent to a 90 - degree angle with feet resting on the floor , hip distance apart . the hips may be lifted to horizontal level , then bent toward the floor and lifted again , while keeping the ball motionless . during table top hip drops , the user may focus on prompts 6 , 8 , 14 and 15 , in accordance with instructions , for range of motion . by focusing on these prompts , the user can increase the intensity of contractions throughout the exercise . by focusing on prompts 4 , 7 , the user will be able to increase the intensity of the exercise by increasing the awareness of the abdominals and quadriceps , therefore eliciting greater muscle response , range of motion and flexibility . the ball prop may include matching prompts to allow for user focus on the desired prompts . fig4 is a schematic diagram illustrating dips in accordance with an aspect of the present invention . dips may be performed by sitting upright on a ball prop , hands placed on the ball next to hips . while pressing hands down into the ball , the hips lift from the surface of the ball . during dips , the user may focus on prompts 10 , 11 , 12 and 13 for contraction . prompt 9 should not be contracted . by raising awareness of prompt 9 , improper form and potential injury can be avoided , as prompt 9 is often incorrectly utilized during this exercise . by drawing attention to prompt 10 , prompt 9 can be minimized in activity . also , attention may placed on prompts 7 , 15 to increase support and stability throughout the exercise . fig4 also illustrates roll aways in accordance with an aspect of the present invention . roll aways may be performed by , while kneeling on the floor , placing a stability ball prop directly in front of the thighs . the fists may rest on the ball , close to the thighs . the ball may then be pushed away from the thighs through direct force of the arms , extending the body straight from the elbows to the knees . the ball may then be pulled back toward the body while the arms are extended , until the user is resting on clenched fists . prompt 9 should remain extended , not contracted , but is often incorrectly contracted during roll aways . effort and attention should be placed on prompts 1 , 10 and 13 to reduce stress on prompt 9 . attention should also be placed on prompts 4 , 12 , 14 and 15 to stabilize the exercise . fig5 is a schematic diagram illustrating caboose kickers in accordance with an aspect of the present invention . caboose kickers may be performed by lying prone over a stability ball prop , with belly on the ball , hands and feet on the floor . the emphasis of the exercise is on prompts 14 , 15 and 16 for contraction and range of motion . extra emphasis may be placed on prompts 14 , 15 and 16 , increasing the intensity of the contraction through range of motion . attention may be focused on prompts 4 and 12 to increase stability while decreasing the opportunity for pain or injury . for example , if there is any flexion or motion in prompt 12 , there is an increased likelihood of injury to the low back . therefore , attention may be called to prompt 4 to increase contraction , thus increasing awareness and limiting mobility in prompt 12 . fig5 also illustrates push ups in accordance with an aspect of the present invention . push ups may be performed while lying prone over a ball prop , hands on floor , legs on the ball , with body suspended . the arms may be bent and extended through range of motion . by drawing attention to prompts 1 , 2 and 11 , the user may learn where to exert the force to move through one rep . prompt 4 should be contracted , but typically is ignored during this exercise . instruction to contract prompt 4 with prompt 7 increases stability , increases effectiveness , and decreases the opportunity for injury . fig6 is a schematic diagram illustrating swans in accordance with an aspect of the present invention . swans may be performed by lying prone on a ball prop and separating the feet hip distance apart . the arms may be extended straight over the head , move out to 90 - degrees from the body , rotate hands , then continue moving arms back until parallel with the hips . the swan is a relatively simple exercise to perform , but without proper emphasis on the upper back , one could potentially injure the low back . prompts 1 , 9 , 10 and 13 correspond to the primary movers in the upper back , and prompts 12 and 14 correspond to the lower body stabilizers . fig4 also illustrates hip thrusts in accordance with an aspect of the present invention . hip thrusts may be performed by lying supine on the floor , feet flat on the top of a ball prop , knees bent . the user may press feet into the ball and lift hips from the floor while squeezing the gluteus . the user may focus on the contraction in prompts 6 , 8 , 14 and 15 , while keeping prompt 16 relaxed to prevent cramping . the user may also pay close attention to prompt 12 to avoid undue strain to the low back . fig7 is a schematic diagram illustrating suspension bridges in accordance with an aspect of the present invention . suspension bridges may be performed by sitting on the floor , legs extended straight , heels over the top of a ball prop , hands on the floor next to the hips . while pressing the hands down into the floor , the hips may be lifted until straight , body parallel to the floor , then slowly returned to the starting position . may be drawn to prompts 9 , 101 , 11 , 12 and 13 to initiate this exercise . the user may use prompts 4 , 14 and 15 to lift and stabilize the hips before returning to the starting position . fig8 is a schematic diagram illustrating pikes in accordance with an aspect of the present invention . may be performed by lying prone over a ball prop . once stable , the user may roll the body forward , until parallel with the floor , with hands on the floor , knees fully extended and while resting on the ball . while contracting prompts 4 and 7 , the legs may be pressed down into the ball and the hips lifted . the feet will slide forward until meeting the ball , shoelaces down . attention should be focused on prompts 4 and 7 . focus may also be placed on prompts 9 , 10 and 11 to stabilize the exercise as the user moves to an inverted position . while the user is in an inverted position , there is a decreased ability to view the surrounding area or look to an instruction provider . the prompts can be quickly referenced by the user to ensure proper form and balance are maintained , even without seeing the instruction provider . fig8 also illustrates dorothys in accordance with an aspect of the present invention . dorothys may be performed by lying prone , belly on a ball prop . the arms may be straight , aligned perpendicularly to the floor , with hands supporting the body weight . the legs may be extended straight , parallel to the floor and completely unsupported . the legs may then move in and out from center , creating a tapping motion at the heels . the motion may be executed while contracting prompts 6 and 8 to control the motion , prompt 7 to keep the legs straight , and prompts 14 and 15 to maintain proper alignment . prompt 4 remains contracted and in contact with the ball , thus decreasing stress on prompt 12 . fig9 is a schematic diagram illustrating protractors in accordance with an aspect of the present invention . protractors may be performed by sitting upright on the ball , feet flat on the floor . one leg may be lifted from the floor and extended straight , parallel to the floor . while maintaining balance , that leg is lifted and lowered while continuing to remain straight . by bringing attention to prompt 7 , the user is able to maintain the contraction in the quadriceps , keeping the leg straight . the user may also focus attention on prompts 4 and 12 to keep the body upright and stabilized throughout the range of motion . less apparent to the user would be the involvement of prompts 9 , 10 , 12 and 13 . these prompts must be fully engaged to improve posture on the ball , thus increasing stability . fig9 also illustrates retractors in accordance with an aspect of the present invention . retractors may be performed in combination with protractors . the user may be sitting upright on the ball prop , leg extended straight and parallel to the floor . the leg moves side to side in a small sweeping motion , from the midline out and back again . attention is drawn to prompts 5 , 6 , and 8 , in addition to prompts 4 and 7 in the protractors . the present invention clearly differentiates the contractions of the various regions of the thigh without confusing the user with the similarly named muscle groups , namely “ abductors ”, “ adductors ” and “ abdominals ”, in such confusingly similar exercises . fig9 also illustrates reverse planks in accordance with an aspect of the present invention . reverse planks may be performed by sitting upright on a ball prop , legs extended straight to the floor , feet flat . the user may place the hands on the ball , just outside of the hips . while pressing the hands down , the user may lift the hips until the hips and the arms are fully extended , and thus not bent . attention may be focused on the back to prompts 9 , 10 , 13 and 14 , as well as prompts 1 and 11 in the shoulder and upper arm . prompt 9 should be pulled away from the ears , and prompt 2 should be pronounced in the chest , not collapsed or hidden . fig1 is a schematic diagram illustrating iron crosses in accordance with an aspect of the present invention . iron crosses may be initiated by kneeling on the floor , ball prop to one side . one knee remains on the floor , and the body may extend sideways across the ball , while straightening the top leg fully . the user may engage in a series of exercises , initiated by raising and lowering of the top leg . throughout range of motion , the top leg should remain parallel to the floor , with the instep of the foot also remaining parallel to the floor . prompt 6 should remain on the top of the leg throughout the exercise , as if prompt 6 rolls backward or forward , proper form is being compromised and the exercise decreases in effectiveness . to remain stable on the ball , attention is also on prompts 4 and 5 . fig1 is a schematic diagram illustrating cross overs in accordance with an aspect of the present invention . cross overs may be performed in combination with iron crosses . the user remains lying on the side , the lower leg is extended straight , and the top leg is bent and placed on the floor behind the lower leg . the straightened lower leg is lifted parallel to the floor , parallel to the other leg . throughout the range of motion , prompt 8 should be on top , but often prompt 7 will roll to the top , negating the effectiveness of the exercise . fig1 also illustrates a hip lift in accordance with an aspect of the present invention . the hip lift may be performed by lying supine on the floor , legs extended to a 90 - degree angle in the air , and a ball prop between the lower portion of the legs at prompt 16 . while contracting prompt 4 , the hips are lifted off the mat and slowly lowered . attention should be placed on prompt 8 to increase the intensity of the exercise , but prompt 12 should always maintain contact with the floor to decrease the likelihood of injury . fig1 is a schematic diagram illustrating an aspect of the present invention . props used may include a ball prop and a towel prop . the exercise may be performed while lying prone over a towel prop , hand prompts 110 on matching towel prompts 110 a , leg prompts as discussed hereinabove on matching ball prompts , with body suspended . the arms may be bent and extended through range of motion . if not otherwise stated herein , it may be assumed that all components and / or processes described heretofore may , if appropriate , be considered to be interchangeable with similar components and / or processes disclosed elsewhere in the specification . it should be appreciated that the systems and methods of the present invention may be configured and conducted as appropriate for any context at hand . the embodiments described hereinabove are to be considered in all respects only as illustrative and not restrictive . all changes which come within the meaning and range of equivalency of the claims hereinbelow are to be embraced within the scope thereof .	0
the following detailed description is exemplary in nature and is not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the following description provides practical illustrations for implementing exemplary embodiments of the present invention . as is known to those in the art of cardiac surgery , electrophysiology , and / or interventional cardiology , an exemplary delivery tool is used to position a medical electrode assembly and / or a physiologic sensor which couples to a portion of a medical electrical lead for deployment of the assembly and / or sensor to an epicardial surface of a heart . according to some embodiments of the present invention , the assembly and / or sensor include one or more pacing or defibrillation electrodes and a physiologic sensor ( e . g ., a metabolic sensor , a mechanical sensor such as an accelerometer or the like , a pressure sensor , etc .). in addition , more than one electrode and / or sensor assembly can be deployed on a single medical electrical lead or dedicated electrode units and dedicated sensor units can be deployed individually or coupled to a common lead or several dedicated medical electrical leads . known electrical multiplexing techniques can be used to provide and receive signals from the units . a proximal end of a medical electrical lead operatively couples the unit or units to pacing , sensing , and / or cardioversion / defibrillation circuitry , in the case of electrodes , and to appropriate signal processing circuitry , in the event that sensors are deployed . a variety of deployment techniques and delivery tools can be used in conjunction with the apparatus of the present invention that would typically include an elongated shaft having a distal portion coupled to a shaft portion . during deployment the distal portion is inserted between an epicardial surface of the heart and a pericardial sac surrounding the heart through a pericardial incision . according to certain embodiments of the present invention , the shape of the distal portion can be adjusted to facilitate insertion of the assembly and / or sensor between the pericardium and epicardium . fig1 is an elevational schematic view of an active pericardial fixation apparatus 100 according to the present invention depicted spaced on a first side 106 from an adjacent portion of pericardial tissue 124 . the apparatus comprises a body structure 101 and at least one physiologic parameter - sensing and / or cardiac rhythm management component 122 . thus , although only a single component 122 disposed on a second side 108 of body 101 is depicted in fig1 more than one component 122 can be operably deployed with an active fixation apparatus 100 according to the invention . the body structure 101 of the apparatus 100 mechanically and electrically couple to a portion of a medical electrical lead 104 . the lead 104 thus includes at least one elongated conductor for transferring electrical power and signals to and from component 122 to remotely located medical device circuitry ( e . g ., pulse generator , sensor signal processing , defibrillation and cardioversion circuitry and the like ). in some forms of the invention the lead 104 includes a hollow lumen and is optionally adapted to receive a stylet as will be described further hereinbelow . a component 122 can couple within and / or upon the body 101 and the lead 104 . for instance a pair of closely spaced - apart electrodes can be electrically coupled in a bi - polar pacing configuration and at least one sensor , such as an accelerometer can be coupled within the body 101 . those of skill in the art will recognize that myriad configurations can be implemented . in addition , more than one apparatus 100 can be deployed within the pericardial space of a heart . each apparatus 100 can be coupled to a dedicated medical electrical lead 104 or can be coupled to a common lead 104 . according to some embodiments of the invention body structure 101 and / or lead 104 can be comprised of a biocompatible polymer as well as other known biocompatible materials . regarding fabrication techniques , body structure 101 and lead 104 can be individually fabricated or can form an integrated unit . the body structure and / or lead 104 can be injection molded from a polymer having a relatively high modulus of elasticity , yet being sufficiently elastic and not prone to brittle fracture , for example 75d durometer polyurethane or high density polyethylene or polyamide . alternately , one or both can be insert molded or formed by molding or an extrusion process . according to some embodiments , portions can be wholly or partially formed from a metal having suitable elastic and elastomeric properties , examples of which include , but are not limited to , titanium alloys , ni — ti super - elastic alloys and stainless steel and the like . other suitable materials can also be used as known in the art . fig2 is an elevational schematic view of an active pericardial fixation apparatus 100 according to the present invention depicted within the pericardial space 121 of a heart and in contact on the first side ( 106 ) with an adjacent portion of pericardial tissue 124 . the body structure 101 contacts epicardial tissue 126 on the second side ( 108 ). once situated as depicted in fig2 , the component 122 of body structure 101 is disposed in electrical communication with excitable myocardial tissue of the epicardium 126 and can sense and / or deliver pacing therapy as well as provide high voltage therapies ( e . g ., cardioversion , defibrillation ). as mentioned with respect to fig1 , in addition to or in lieu of such a configuration , one or more sensors can be coupled to the body 101 and / or the lead 104 . as depicted in fig2 the lead 104 includes a lumen 180 adapted to receive a stylet of other elongated and relatively flexible member 150 . the member 150 can be manually advanced and retracted within the lumen 180 by manipulating a proximal portion thereof as is known in the art . the member 150 can be one or more radio - opaque markers or the like ( e . g ., 152 in fig5 ) so that the location of the member 150 can be visualized with , for example , fluoroscopy equipment . the member 150 can optionally include a lumen or passageway from a proximal end portion to a distal end portion thereof adapted to dispense diverse fluids . thus either the lead 104 and / or the member 150 can be employed to dispense fluid materials ( e . g ., contrast media , saline solution , biological , genetic , pharmaceutical , as well as other therapeutic and / or palliative substances ). fig3 is an enlarged perspective view depicting interior components in an exemplary configuration of one embodiment of an active pericardial fixation apparatus 100 according to the invention disposed in spaced relationship relative to adjacent pericardial tissue 124 ( schematically represented by a disk - shaped object ). the body 101 of the apparatus 100 includes a recessed chamber 160 fluidly coupled to a lumen ( 180 in fig2 ) of the lead 104 . the lumen is also adapted to receive a stylet member 150 and to fluidly couple to a remote source of vacuum ( 160 ′ in fig5 ). thus , when the recessed chamber 160 is evacuated by the remote source of vacuum a suction force is generated that tends to draw adjacent pericardial tissue 124 into the chamber 160 . the stylet 150 preferably includes a sharpened distal end or tip so that once the pericardial tissue 124 is drawn into the chamber 160 , the stylet is advanced thus piercing the tissue 124 and actively fixing the apparatus 100 into place within the pericardial space . as depicted in fig3 a plurality of channels 182 are optionally formed within the lumen ( although a single optional channel could be employed ). the optional channels 182 provide at least two functional features to the operation of apparatus 100 ; first of all , they allow the vacuum source 160 ′ to continue to evacuate the chamber 160 when the stylet is being advanced , and second , they promote ease of movement to the stylet along its oftentimes serpentine path . fig4 is an enlarged perspective view depicting interior components in an exemplary configuration of one embodiment of an active pericardial fixation apparatus 100 according to the invention fixated in contact with pericardial tissue 124 on a first side ( 106 in fig1 ) and in contact with epicardial tissue 126 on a second side ( 108 in fig1 ). as just described with reference to fig3 , the apparatus 100 is initially fixed due to a remote source of vacuum and subsequently is mechanically fixed with the stylet member 150 . fig4 is intended to also show that the stylet member 150 can itself comprise a hollow member having a lumen 180 . in this form of the invention the channel features ( 182 in fig3 ) are not required to allow the source of vacuum to evacuate the chamber 160 . as long as an adequately - sized aperture is disposed on or near the distal tip of the stylet member 150 evacuation of the chamber 160 can take place . fig5 schematically depicts an embodiment wherein a body structure 101 of an apparatus according to the invention is disposed within the pericardial space 121 of a heart and fluidly coupled to a source of vacuum 160 ′ during an implantation procedure . lead 104 is shown passing through the pericardium 124 at 125 . one or more valves 165 can be disposed intermediate the vacuum source 160 ′ and the lead 104 to allow evacuation of the chamber 160 during implantation . as mentioned , in the event that a hollow stylet 150 is implemented , the vacuum source 160 ′ could simply be coupled directly to a proximal portion of the hollow stylet 150 . also , as previously mentioned in addition to or in lieu of the vacuum source 160 ′ other or different fluid dispensing apparatus could be coupled to the lead 104 and / or the hollow stylet 150 . when activated such apparatus would provide one or more fluids to the chamber 160 and thus to one of the pericardial space 121 and the adjacent , pierced pericardial tissue 124 . as noted above , the stylet member 150 can optionally include one or more visualization markers 152 to assist deployment and confirm the location of the member 150 during implantation procedures . the configuration depicted in fig5 can be acutely implement to relieve excess fluid build - up in the pericardial space ( i . e ., tamponade ). for example , the source of vacuum can be employed to help aspirate fluid from the pericardial space 121 . alternately , the configuration can be implemented to provide palliative substances to the pericardial space 121 , for example , in an effort to relieve symptoms of an acute episode of pericarditis . fig6 schematically depicts an embodiment of an active pericardial fixation apparatus 100 according to the present invention that includes multiple implantable physiologic sensors and / or electrodes 122 , 122 ′, 122 ″ disposed within and / or upon a portion of body 101 and lead 104 . in the foregoing detailed description , the invention has been described with reference to specific embodiments . however , it may be appreciated that various modifications and changes can be made without departing from the scope of the invention as set forth in the appended claims . for example , the lumen described as part of a medical electrical lead can be independently coupled to the recessed portion that provides a suction - retaining force to the body structure . in this form of the invention , the independent lumen structure can be closed via a valve structure or simply compressed or pinched to a closed state and the remaining portions removed so that the vacuum or suction - retaining force continues to fixate the body structure . one aspect of this derivative form of the invention is that a stylet or other mechanical means for piercing the pericardium becomes an optional feature , as the suction - retaining forces alone are adequate for retaining the body structure .	0
among the compounds of formula ( i ) according to the present invention , preferred are those represented by formula ( i - a ) ## str3 ## wherein r 2 and r 3 are the same as defined above , preferably trifluoromethyl group . when r 2 and r 3 are each a trifluoromethyl group , the compound of formula ( i ) may be prepared by reacting 1 , 1 , 1 , 5 , 5 , 5 - hexafluoro - 2 , 4 - pentanedione ( hhfac ), a vinylcycloalkane and cuprous oxide ( cu 2 o ) in the presence of an organic solvent , e . g ., an ether or dichloromethane . this reaction may be conducted at a temperature ranging from 0 to 20 ° c . under an ambient pressure for 30 to 60 minutes . the reactants may be preferably employed in a hhfac : vinylcycloalkane : cu 2 o molar ratio of about 2 : 2 : 1 . the compound of formula ( i ) according to the present invention has good thermostability and high volatility , and in a cvd process for the formation of a copper film on a specified surface of a substrate , it may be conveniently volatilized in a bubbler at a temperature ranging from about 15 to 60 ° c . alternatively , the liquid compound of formula ( i ) may be employed in a direct liquid injection ( dli ) system . the cvd process for the formation of a copper thin film using the inventive organocuprous precursor may be carried out in a conventional manner , e . g ., by vaporizing the inventive precursor and conveying the resulting vapor with a carrier gas such as argon to a substrate , e . g ., platinum , silica or tin , heated to a temperature ranging from 70 to 250 ° c ., preferably 70 to 110 ° c . under a reduced pressure , e . g ., 0 . 1 to 10 torr . the thickness of the copper film may be conveniently controlled by adjusting the deposition time . the following examples are intended to further illustrate the present invention without limiting its scope . 0 . 5 g ( 3 . 5 mmol ) of cu 2 o and 0 . 84 g ( 3 . 5 mmol ) of mgso 4 were charged to a schlenk flask and thereto was added 30 ml of diethyl ether which had been previously distilled from sodium benzophenone under an argon atmosphere . the resulting mixture was cooled to 0 ° c . and added thereto was 0 . 78 g ( 7 . 0 mmol ) of vinylcyclohexane . the resulting reddish suspension was stirred for 30 minutes , and slowly added thereto was a solution of 1 . 46 g ( 7 . 0 mmol ) of 1 , 1 , 1 , 5 , 5 , 5 - hexafluoro - 2 , 4 - pentanedione ( hhfac ) in diethyl ether with a canula . the resulting mixture was stirred until the color of the mixture changed from yellow to green . the resulting solution was filtered through a bed of cellite ™ and the solvent was removed therefrom under a reduced pressure to obtain 1 . 13 g of the titled compound as a green liquid ( yield 85 %). 1 h - nmr ( cdcl 3 , ppm ) δ 6 . 13 ( s , 1h , hfac proton ), 5 . 29 ( m , 1h , ch 2 ═ ch --), 4 . 33 ( dd , 2h , ch 2 ═ ch --), 1 . 66 - 1 . 97 ( m , 6h , cyclohexyl ), 1 . 08 - 1 . 35 ( m , 5h , cyclohexyl ). 13 c - nmr ( cdcl 3 , ppm ) δ 178 . 33 ( q , 33 . 7 hz , cf 3 cooh ), 117 . 92 ( q , 277 . 5 hz , -- cf 3 ), 114 . 79 ( ch 2 ═ ch --), 90 . 34 ( cochco ), 79 . 09 ( ch 2 ═ ch --), [ 42 . 22 , 33 . 65 , 26 . 31 , 26 . 17 ( cyclohexyl )]. the titled compound in its liquid form was found to be stable indefinitely at 60 ° c . this should be contrasted with the thermal instability of the liquid form of the prior art precursor , ( hfac ) cu ( i )( allyltrimethylsilane ), at 60 ° c . the procedure of example 1 was repeated using vinylcyclopentane in place of vinylcyclohexane to obtain the titled compound as a bluish green liquid in a yield of 75 %. 1 h - nmr ( cdcl 3 , ppm ) δ 6 . 10 ( s , 1h , hfac proton ), 5 . 35 ( m , 1h , ch 2 ═ ch --), 4 . 38 ( m , 2h , ch 2 ═ ch --), 2 . 39 ( m , 1h , cyclopentyl ), 1 . 86 ( m , 2h , cyclopentyl ), 1 . 68 ( m , 2h , cyclopentyl ), 1 . 44 ( m , 4h , cyclopentyl ). 13 c - nmr ( cdcl 3 , ppm ) δ 178 . 52 ( q , ch 3 coch ), 120 . 11 ( q , -- cf 3 ), 117 . 06 ( ch 2 ═ ch --), 90 . 12 ( cochco ), 83 . 59 ( ch 2 ═ ch --) [ 45 . 16 , 34 . 01 , 26 . 01 ( cyclopentyl )] a copper film was formed on a tin or sio 2 - coated substrate by a cvd process . specifically , the compound synthesized in example 1 was fed to a bubbler maintained at 45 ° c . the resulting vapor stream was conveyed together with an argon carrier gas at a flow rate of 50 sccm to the surface of the substrate positioned in a cvd chamber under a pressure of 0 . 3 mmhg . the deposition rate of the copper film and the specific resistance of the deposited film depending on the substrate temperature were measured , and the results are shown in fig1 and 2 , respectively . fig1 shows that the copper film starts to form even at a low substrate temperature of 75 ° c . the deposition rate increases rapidly until the substrate temperature reaches 120 ° c ., but it increases only very slowly at above 125 ° c . further , it can be seen from fig2 that the specific resistance of the film deposited at a substrate temperature of 100 ° c . to 175 ° c . approximately reaches that of bulk copper ( about 1 . 67 μω . cm ). the copper film deposited at 125 ° c . was analyzed by auger electron spectroscopy to determine its depth profile in terms of elemental composition , and the result in fig3 demonstrates that the copper film deposited in accordance with the present invention is exceptionally pure , containing no significant amounts of impurities such as o , f and c . further , in order to determine the crystallinity of the copper film deposited in accordance with the present invention , each of the films deposited at 125 , 175 , 225 and 250 ° c . was analyzed with a x - ray diffractometer and the result in fig4 shows that the copper film deposited onto the substrate in accordance with the present invention has preferential ( 111 ) orientation , with a minor degree of ( 200 ) orientation . the higher the ( 111 ) to ( 200 ) intensity ratio is , an interconnect made of the film becomes more resistant to the occurrence of short . accordingly , it is clear that the copper film deposited in accordance with the present invention has excellent physical properties . fig5 illustrates xsem ( cross - sectional sem ) photographs of four copper films ( 3 , 000 å thick ) deposited at 100 , 150 , 225 and 250 ° c ., respectively (( a ): substrate temperature ( ts )= 100 ° c ., ( b ): ts = 150 ° c ., ( c ): ts = 225 ° c ., and ( d ): ts = 250 ° c .). from the shape and size of crystals , it can be seen that the deposited films exhibit good step coverage . for a comparative purpose , the above - mentioned film deposition procedure was repeated employing cu ( hexafluoroacetylacetonate ) allyltrimethylsilane in place of the inventive precursor at substrate temperatures of 75 , 125 , 175 , 225 and 275 ° c . the sem and xsem photographs of the deposited films are shown in fig6 (( a ),( f ): ts = 75 ° c ., ( b ),( g ): ts = 125 ° c ., ( c ),( h ): ts = 175 ° c ., ( d ),( i ): ts = 225 ° c ., and ( d ),( j ): ts = 275 ° c .). by comparing fig5 with fig6 it should become clear that the copper film derived from the inventive organocuprous compound gives a better step coverage than that derived from the prior art compound . the cvd procedure of example 3 was repeated except that a tin - coated substrate having contact holes of a depth of 1 . 3 μm and a width of 0 . 3 μm was employed to fill the holes with metallic copper . fig7 shows xsem photographs of the hole - filled substrates produced by cvd at 100 and 125 ° c . (( a ): ts = 100 ° c . and ( b ): ts = 125 ° c . ), and it is clear that the inventive compound provides excellent hole - filling . the procedure of example 4 was repeated using cu ( hexafluoroacetylacetonate ) allyltrimethylsilane in place of the inventive precursor compound at substrate temperatures of 75 , 125 and 175 ° c ., and xsem photographs of the deposited substrates are shown in fig8 (( a ): ts = 75 ° c ., ( b ): ts = 125 ° c . and ( c ): ts = 175 ° c .). by comparing fig7 with fig8 it can be concluded that the inventive organocuprous precursor provides a better hole - filling capability than the prior art compound . while the invention has been described with respect to the above specific embodiments , it should be recognized that various modifications and changes may be made to the invention by those skilled in the art which also fall within the scope of the invention as defined by the appended claims .	2
referring to fig1 an electrical system 10 includes a control panel 20 that utilizes a digital computer to provide effective control of many associated electrical devices . the centralized control panel 20 determines the effects on the entire system 10 , or a portion of the system 10 , of enabling or disabling an electrical device . for example , such associated electrical devices may include motors , pumps , fans , valves , generators , switches , lights , etc . one type of control panel 20 is generally known as a programmable logic controller , such as those sold by allen bradley . a starter 22 , designed to start ( energize ) and stop ( de - energize ) remotely located electrical devices , is electrically connected to an associated electrical device 24 by three power cables 23 a , 23 b , and 23 c . each starter 22 is usually located within an individual starter housing 26 which is a part of a substation . most substations are not large , so it is desirable to reduce the size of the housing 26 , so as to maximize the number of housings 26 that may be located within the substation . accordingly , the housing 26 is normally designed to be only slightly larger than the enclosed starter 22 , and so there is only limited space within the housing 26 in which to place additional devices , such as protection devices . referring to fig2 a protection device 35 includes both a current sensor , including a transformer 34 and an input circuit 50 , and a switch circuit 60 within the single package 30 . the package 30 is preferably slidably mounted on a support 31 mounted within the housing 26 . by placing the transformer 34 , input circuit 50 , and switch circuit 60 proximate to one another , within the single package 30 , it is considerably easier to locate the device 35 within the limited space of the starter housing 26 . additionally , installing only the single package 30 requires less installation time than installation of separate devices to perform each of the desired functions , and the expense of manufacturing , packaging and shipping a single device is less than for two separate devices . a reduction in the number of backup parts and troubleshooting time is also realized . the package 30 defines a central opening 32 through which the power cable 23 c is routed . surrounding the central opening 32 is a toroidal sensing transformer 34 to sense the changing current within the power cable 23 c . the toroidal sensing transformer 34 is preferably a wire - wrapped magnetically permeable toroidal core , normally made of iron , encircling the respective power cable . thus , the wire wound on the toroidal sensing transformer 34 is the secondary winding , while the power cable 23 c , or a parallel shunt current divider ( not shown ) , is the primary winding of the toroidal sensing transformer 34 . changing current in the power cable 23 c induces a changing electromagnetic field around the power cable 23 c , which in turn induces a magnetic flux in the magnetically permeable core . the magnetic flux in the core induces in the wire windings on the toroidal core a voltage representative of the current in the power cable . an exemplary sensing transformer has the following construction : core material made by arnoid engineering , of norfolk , nebr ., of 0 . 012 silectron , 3 % silicon steel , grain oriented , with an outside diameter of 1 . 375 inches , an inside diameter of 1 . 125 inches , strip width of 0 . 500 inches , strip thickness of 0 . 012 inches , an epoxy powder coating of 0 . 010 to 0 . 030 inches thick , a nylon overcoat wound on the metal core , and a # 35 awg size wire coated with a heavy polyurethane wound 1 , 800 turns as a secondary winding . such a sensing transformer with a core of magnetically permeable material , such as iron , generates a voltage signal reasonably accurately representative of the current in the power cable over a certain normal load range . however , iron and other magnetically permeable materials have hysteresis and other nonlinear responses to changing magnetic fields that result in a nonlinear relationship between current in the power cable and the voltage signal produced in a transformer coil having such a core . the nonlinearity of such responses is especially significant with large variations in load current and frequency . to provide a more linear measurement of power , “ air core ” transformers have been designed using wire wrapped on a core made of material having a low magnetic permeability , such as one of plastic or nylon . without a magnetically permeable core , however , the transformer winding generates relatively small voltage levels in response to power cable currents . an exemplary air core transformer has the following construction : core of nylon , outside diameter of 1 . 375 inches , inside diameter of 1 . 125 inches , strip width of 0 . 500 inches , and a # 35 awg size wire coated with a heavy polyurethane , wound 4 , 000 turns as a secondary winding . examples of circuitry suitable for use with an “ air core ” transformer are disclosed in u . s . patent application ser . no . 08 / 300 , 732 , assigned to the same assignee , and incorporated herein by reference . the ends of the secondary winding 40 a and 40 b of the transformer 34 are electrically connected to an input circuit 50 . the input circuit 50 is designed to convert the voltage signal received from the transformer 34 to either a signal representative of the changing current in the power cable or a circuit condition at the output terminal 41 a and 41 b representative of the changing current in the power cable . the signal or circuit condition is provided to transmission lines 54 and 56 which are connected to the control panel 20 . for example , the signal could be a current signal , voltage signal , or some sort of frequency modulation , amplitude modulation , or digital encoding . the circuit condition , for example , could be a short circuit , open circuit , or other suitable type of condition . the input circuit 50 can be designed and constructed in any manner , so long as it converts the voltage signal output from the transformer 34 to an appropriate corresponding signal or circuit condition . several exemplary input circuit designs are described below . a light emitting diode 58 is electrically connected to the input circuit 50 and is illuminated when current is sensed within the power cable . a potentiometer 59 allows adjustment of a threshold level within the input circuit 50 of the sensed voltage from the transformer 34 . the use of the control panel 20 or system controller provides automated control over the electrical system 10 . the control panel 20 receives the signal from the input circuit 50 or determines the circuit condition of the input circuit 50 via a pair of transmission lines 54 and 56 . the control panel 20 in response to receiving the signal or determining the circuit condition of the input circuit 50 analyzes the signal or circuit condition to determine information such as power consumption , overcurrent , overvoltage , undercurrent , undervoltage , frequency , spikes , harmonics , etc . from this information the control panel 20 , among other things , may determine that the electrical device 24 should be disabled or enabled . for example , if the current sensor indicates that a motor ( not shown ) for a pump is malfunctioning , then the control panel 20 may have that motor deactivated . if deactivation of that motor would also impact another device , such as an auger within a storage tank supplying fluids to the pump , then the control panel 20 may also deactivate the motor for the auger . the control panel 20 is electrically connected to a switch circuit 60 by a pair of transmission lines 61 and 63 . the switch circuit 60 is located proximate to the transformer 34 and input circuit 50 . the switch circuit 60 , transformer 34 , and input circuit 50 are all enclosed within the single package 30 . the package is preferably mounted within the starter housing 26 . the switch circuit 60 includes any suitable switching device , for example , a triac or a relay , as will be described below . the triac or relay is powered by a 24 volt ac or dc signal through the transmission lines 61 and 63 . the power on the transmission lines 61 and 63 closes the circuit through the switch circuit 60 and maintains a short circuit between the output terminals 67 a and 67 b of the switch circuit 60 . when power ceases to be supplied to the switch circuit 60 , the output terminals 67 a and 67 b of the switch circuit 60 are electrically isolated from each other ( open circuit ). with the output terminals of the switch circuit 60 in an open circuit condition when the transmission lines 61 and 63 are not powered , a safety feature for the starter 22 is provided in the event of power failure to the control panel as will be described below . alternatively , the switch circuit 60 could be designed to be controlled by any type of suitable signal or circuit condition . a pair of wires 70 and 72 are connected between the output terminals 67 a and 67 b , respectively , of the switch circuit 60 and starter terminals 74 and 76 . the starter terminals 74 and 76 permit exterior control over the operation of the starter 22 . for most starters 22 , when the terminals 74 and 76 are short circuited ( electrically connected together ) the starter 22 energizes and operates the associated electrical device 24 . alternatively , when the terminals 74 and 76 are open circuited ( isolated from each other ), the starter 22 de - energizes , or otherwise ceases the operation of the associated electrical device 24 . accordingly , the open or short circuited circuit conditions applied between the output terminals 67 a and 67 b of the switch circuit 60 connected to the wires 70 and 72 are suitable to control the starter 22 . the switch circuit 60 may alternatively be constructed to provide whatever signal or circuit condition is necessary to control the particular starter 22 , which may include a voltage signal , a current signal , digital signal , etc . a light emitting diode 64 is electrically connected to the switch circuit 60 and is illuminated when the transmission lines 61 and 63 are powered . referring to fig3 an electrical schematic diagram of a current sensor 300 suitable to provide a full scale 0 volt to 5 volt output signal is shown . the transformer 34 encircles a power cable 23 c , producing a voltage between the ends 40 a and 40 b of its secondary winding . the ends 40 a and 40 b of the transformer secondary winding are connected to the input circuit 50 which includes a full wave rectifier 312 , connected to a variable resistance 314 and associated capacitors 316 and 318 , to scale the output of the full wave rectifier 312 to the desired range . the preferred range to interface with conventional control panels 20 is 0 volts when no current within the power cable 23 c is sensed to 5 volts when the maximum desired level within the power cable is sensed . referring to fig4 current sensor 320 provides either an open circuit or short circuit at its output terminals 41 a and 41 b depending on whether the voltage signal produced in response to the current sensed by the transformer 34 surpasses a predetermined threshold level . a variable resistor 326 sets the threshold level . referring to fig5 current sensor 340 provides a 4 - 20 ma variable output signal at its output terminals 41 a and 41 b . when the current sensed in the power cable 23 c is 0 then the sensor circuit 340 puts out a 4 ma signal . when the current sensed in the power cable 23 c is equal to a desired maximum , when the variable resistor 341 is correctly set , then the sensor circuit 340 puts out a 20 ma signal . referring to fig6 an electrical schematic of a switch circuit 60 is shown . a voltage or current signal from the control panel 20 is provided to the input terminals 66 and 68 of the switch circuit 60 . when a non - zero signal is received by the switch circuit 60 a light - emitting - diode 64 is illuminated to indicate that the switch circuit 60 is energized . a diode 368 , a resistor 370 and a capacitor 372 rectify the signal received at input terminals 66 and 68 if it is an alternating signal . the voltage imposed across the capacitor 372 is the input to the direct current relay 374 . if the signal received at input terminals 66 and 68 is a direct voltage or current signal , then the signal will also pass through to the relay 374 . accordingly , the switch circuit 360 is suitable to receive both an alternating signal or direct signal . the relay 374 is energized by a high voltage signal at the input terminals 66 and 68 and thereby its output contacts 67 a and 67 b are shorted . when the high voltage signal provided to the relay 374 is below a threshold level , the output contacts 67 a and 67 b to the relay 374 open , open - circuiting the output contacts 67 a and 67 b . the output contacts 67 a and 67 b are connected to the terminals 74 and 76 of a remotely located starter 22 ( not shown ) via wires 70 and 72 ( fig1 ). in other words , the starter 22 is spaced apart from the switch circuit 60 . referring to fig7 an alternative switch circuit 60 a includes a pair to input terminals 66 and 68 , a resistor 406 , a diode 407 , and a capacitor 408 to permit the use of either an alternating signal or a direct signal as the input to the input terminals 66 and 68 . an opto - isolator 410 isolates the high voltage to the input terminals 66 and 68 from the output terminals 67 a and 67 b for safety . a triac 412 , which is a switching device , is energized with a low voltage on the gate 413 of the triac 412 to close the triac 412 creating a short circuit between the output terminals 67 a and 67 b a “ snubber circuit ” includes a resistor 418 and capacitor 420 connected in parallel across the output terminals 67 a and 67 b . in general , the ‘ snubber circuit ’ prevents false triggering of the triac 412 that may occur when driving an inductive load . output terminals 67 a and 67 b are thus short circuited or open circuited ( by the operation of the triac 412 ) with the result that the terminals 67 a and 67 b exhibit a circuit condition to the starter 22 indicative of whether the electrical device 24 controlled by the starter 22 should be operating . the terms and expressions which have been employed in the foregoing specification are used therein as terms of description and not of limitation , and there is no intention , in the use of such terms and expressions , of excluding equivalents of the features shown and described or portions thereof , it being recognized that the scope of the invention is defined and limited only by the claims which follow .	7
it is to be understood that the awning assembly with integral lighting is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings . the invention is capable of other embodiments and of being practiced or of being carried out in various ways . also , it is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . the use of “ including ,” “ comprising ,” or “ having ” and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . unless limited otherwise , the terms “ connected ,” “ coupled ,” and “ mounted ,” and variations thereof herein are used broadly and encompass direct and indirect connections , couplings , and mountings . in addition , the terms “ connected ” and “ coupled ” and variations thereof are not restricted to physical or mechanical connections or couplings . referring now in detail to the drawings , wherein like numeral indicate like elements throughout several views , there are shown in fig1 through 12 various embodiments of awning assemblies which include an integrated lighting on the awning assembly . the assembly is retractable or extendable despite the luminaire . referring now to fig1 , a perspective view of a recreational vehicle 10 is depicted . the rv includes a drive and transmission , not shown , as well as a sidewall 12 and a roof 14 . an awning assembly 20 is connected to one of the sidewall 12 or the roof 14 of the vehicle 10 . in further embodiments , the awning assembly 20 may be retractable within the sidewall so as to reduce the airflow interference of the assembly while the vehicle 10 is being operated . the awning assembly 20 includes an awning or canopy 22 , at least one first arm 24 and at least one second arm 26 . the awning or canopy 22 includes a first side edge 32 , a second side edge 34 , a first inner edge 36 and a second outer edge 38 . the awning 22 is exemplary and other variations may be utilized . the assembly 20 further includes a roller assembly 30 which moves inwardly and outwardly with corresponding retraction or extension of the awning 22 to provide the sheltered or shaded area beneath the awning assembly 20 . the roller assembly 30 may be a manual assembly requiring manual rotation to extend or retract the canopy 22 . alternatively the roller assembly 30 may be an automated system such as by electrical , air , hydraulic or other fluid power systems to cause extension or retraction of the canopy 22 . the awning assembly 20 further comprises an awning rail assembly 40 which is utilized according to the instant embodiment to connect the awning assembly 20 to the sidewall 12 of the vehicle . it should be understood that although an rv is referred to in the exemplary embodiments , one skilled in the art should understand that the use of the awning with lighting is not limited to these vehicles . the awnings may be used with homes other stationary structures as well as boats or other marine application for example which use canopy structures which may or may not be retractable , commercial vehicles , agricultural vehicles , horse trailers , and temporary structures such as those used at sports events , ( tailgating ) and flea markets . referring now to fig2 , an exploded perspective view of a portion of an exemplary awning rail assembly 40 is depicted . an awning rail 42 is positioned against a structural or rv sidewall 12 ( fig1 ). the awning rail 42 includes an upstanding wall or wall mount 44 and a retaining channel 46 connected thereto . alternatively , the mount 44 may be directed downwardly or alternatively the channel 46 may be located at various positions thereon . as a further alternative , the mount wall 44 may be curved or other shapes other than linear . a variety of awning rail shapes are known in the art and well within the scope of the present disclosure . the wall mount 44 may be fastened to the sidewall 12 of the rv or building by fasteners , suction devices , or adhesive or any combination thereof . the retaining channel 46 is generally circular in shape with a relief opening 47 which allows the awning 22 to extend therefrom upon assembly . the retaining channel 46 while circular in the exemplary embodiment may be various alternate shapes such as a u - shaped channel , square with the relief opening 47 or other polygonal shape . according to some embodiments , a connector 50 may be positioned within the retaining channel 46 or according to other embodiments the awning 22 may be captured within the retaining channel by the connector 50 . the instant embodiment utilizes a connector 50 which is positioned within the retaining channel 46 . the connector 50 includes a head 52 and a neck 56 extending from the head 52 . the connector 50 may be formed in an extrusion process , for example , for ease of manufacture . the extrusion or connector 50 may be rigid or soft . for example , if a rigid extrusion is desired , the material may be , for example , pvc polypropylene or other polymeric with ultraviolet and embrittlement resistant characteristics . alternatively , for example , a flexible extrusion 50 may be desired made of santoprene or other soft extruding materials . these are non - limiting examples as other materials may be used by one skilled in the art . the head 52 is generally circular in shape corresponding in size to the retaining channel 46 so that the head 52 may be positioned therein . the head 52 may be solid or hollow . according to the exemplary embodiment , the head 52 is hollow defining an opening 54 . the head 52 has a first terminating end and extends circularly to adjacent the first end . the neck 56 is curvilinear continues extending from the head 52 such that the curvilinear shape of the neck 56 passes by the first terminating end of the head 52 , forming a gap or relief opening 57 therebetween . the neck 56 extends to a luminaire mount 60 which has a first sidewall 62 and a second opposed sidewall 64 . a joining wall 66 connects ends of the walls 62 , 64 defining the luminaire mount 60 . the wall 64 is connected to the neck 56 to form the connector 50 . the first and second walls 62 , 64 have at least one retaining bead 68 . in the exemplary embodiment , two opposite beads 68 are utilized to retain a luminaire strip 70 . the luminaire strip may be formed of a plurality of light emitting diodes ( leds ) and is electrically connected to a circuit 90 ( fig1 ) by at least one wire 72 . the led strip 70 may vary in length depending on the desired length of illumination . the led strip 70 may be a water proof , water resistant or a standard led which may be used with or without a lens to inhibit weather contaminants from negatively affecting operation of the led strip 70 . the strip 70 is retained within the mount 60 toward the wall 66 by retaining beads 68 . although this design is depicted , alternate methods of retaining the luminaire 70 may be utilized and the exemplary embodiment should not be considered limiting . alternatively , the luminaire strip 70 may be adhered to the luminaire mount 60 with adhesives or fixatives rather than requiring use of the beads 68 . additionally , or example , one or more pairs of retaining beads 68 may be utilized to retain caps or lens structures 78 on the luminaire mounts 60 . one pair may be used to retain a luminaire strip 70 in place while a second pair of beads 68 may be utilized to retain a cap 78 . alternatively , a single pair of opposed beads 68 may retain both the led strip 70 and the cap or lens 78 in position . as alluded to above , the caps 78 may be a variety of lengths and may be translucent , semi - translucent or opaque . the caps 78 include at least one leg which engages beads 68 to retain the cap on the extrusion or connector 50 . these caps 78 may or may not be used with all of the embodiments shown and described herein . the luminaire mount 60 is oriented at an angle to the vertical . when installed , the mount is at an angle to the vertical and may be adjusted by rotation of the connector 50 within the retaining channel 46 as described further herein . such rotation may be limited by the awning and by the neck 56 engagement with the lower portion of the retaining channel 46 . alternatively , the luminaire mount 60 may be fixed relative to the awning rail and as a further addition may be directed horizontally or vertically downward to provide lighting under the awning assembly 20 ( fig1 ). the awning 22 is captured within the opening 54 of the head 52 . the awning 22 is sewn or otherwise formed to have a pocket at a first inner end , in the instant embodiment . the pocket 28 may be formed by folding an end of the awning over and forming a loop or pocket 28 . the loop or pocket structure 28 is retained by sewing or otherwise connecting the awning to itself . within the pocket 28 is a polyrope structure 80 which fills the pocket 28 and has a diameter size to fit within the opening 54 of the connector 50 . the pocket 28 , including the polyrope 80 is slidably positioned through the connector 50 so that awning 22 extends from the relief opening 57 . the diameter of the polyrope 80 is formed to be greater than the size of the relief opening 57 , inhibiting removal of the polyrope 80 and awning pocket 28 except by axial sliding motion . for example , the polyrope 80 is about ( ¼ ″) one - quarter inch in diameter but may be within an exemplary and non - limiting range of ⅛ to about 5 / 16 inch and more preferably , for non - limiting example , 3 / 16 to about ¼ inch . the polyrope may be formed of butyl - rubber , rope or other flexible materials . referring now to fig3 , an alternate embodiment of the awning rail assembly 140 is depicted wherein an awning rail 42 is provided . similar to the prior embodiment , the awning rail 42 includes retaining channel 46 and a wall mount 44 . the relief opening 47 is defined between ends of the retaining channel 46 which is generally circular in cross - section except for the relief 47 . adjacent to the awning rail 42 is the awning 22 . the awning has a pocket 28 as defined by looping the inner end of the awning 22 back to attach upon itself . the pocket 28 , as depicted in the fig3 may or may not be sewn or affixed together so as to receive a connector 150 . according to this second embodiment , the connector 150 includes a head 152 and a neck 156 which extends linearly from the head 152 . the head 152 is formed with a solid material so that the entire connector may be extruded during manufacture . other manufacturing methods may be utilized however . the head 152 is received within the pocket 28 of the awning 22 . these may or may not be sewn or affixed together through the neck 156 . these pieces are slidably received within the retaining channel 46 and extend from the awning rail 42 through the relief opening 47 . the head 152 is circular in shape and of a size to fit within the retaining channel 46 while further having the awning pocket 28 formed around the head 152 . a luminaire mount 60 extends from the neck 156 and has a three wall design as with the previous embodiment . the luminaire mount 60 may take a variety of forms however and therefore the exemplary embodiment is not limiting . the luminaire 70 is exploded from the mount 60 but as with previous embodiments may be mounted between the walls 62 , 64 . according to the current embodiment , the luminaire 70 is directed downwardly so as to provide direct lighting . according to an alternate embodiment of fig3 , the connector 150 may be spaced from the rail 42 . for example , the connector 150 may be sewn into the awning 22 some distance from the rail 42 rather than received by the rail channel 46 . such manner is discussed below and shown in fig4 . any of the embodiments of the connectors described within this disclosure may be sewn directly into the awning 22 or may be connected to the awning by way of a polyrope or other rope like materials which is sewn into the awning 22 . referring now to fig4 an assembled perspective view of a further alternative embodiment is depicted . according to this embodiment , the connector 250 is spaced from the awning rail 42 and merely connected by way of awning material stretched between the awning rail 42 and connector 250 . as described in previous embodiments , the awning rail 42 includes a wall mount 44 and retaining channel 46 . again , the retaining channel 46 of the exemplary embodiment is generally circular in cross - section however alternate shapes may be utilized , for example pentagonal , hexagonal or octagonal . a polyrope structure 80 captures a portion of the awning 22 within the retaining channel 46 . according to one embodiment , the awning 22 may be wrapped around the polyrope 80 and the combined rope 80 and awning material 22 slidably positioned through the relief opening 47 of the retaining channel 46 . since the rope 80 and awning 22 combination have a larger diameter than the relief opening 47 , the awning 22 and rope 80 are captured within the retaining channel 46 . further portions of the awning 22 extend from the first retaining channel 46 to the connector 250 . the connector 250 includes a retaining channel 252 which receives the awning 22 and a polyrope 80 . as with the first retaining channel 46 , the combination of polyrope 80 and awning 22 have a diameter greater than the distance of a relief opening 247 in the connector 250 . thus the rope 80 and awning 22 are retained in the second channel 252 . depending from the second retaining channel 252 is a luminaire mount 260 . alternatively , this hollow second retaining channel may be considered a head with a neck joining the luminaire mount 260 . this embodiment is similar to those of the previous figures and receives luminaire 70 . according to the instant embodiment , the mount may direct luminaire strip 70 toward the rv as shown , or away from the rv as in previous embodiments . optionally , a positioning leg 76 may be formed on the connector 250 by extrusion in order to direct the light in various directions . such positioning leg 76 may be formed in a variety of manners and may or may not be used with any of the connectors depicted in the disclosure in order to provide an additional means of directing light . as with previous embodiments , this may be a luminaire strip formed of leds for example . at least one stitch or hem 25 is located between the awning rail 42 and the connector 250 . this stitch 25 inhibits the connector from hanging loosely below the upper portion of the awning 22 . alternatively , the awning may be affixed with adhesive or welding rather than the at least one stitch depicted . referring now to fig5 , a still further embodiment of the awning rail assembly 340 . an awning rail 42 is configured at one end of the depicted assembly . the awning rail 42 is similar to those recently described . a connector 350 includes a head 352 , a neck 354 and a second retaining channel 356 . the connector 350 may be an extruded structure and further includes a luminaire mount 360 . the head 352 is a solid material and is circular in cross - section to be received within the correspondingly shaped retaining channel 46 . the extrusion or connector 350 may be formed of a single piece of material as previously described or may be formed of two or more materials in a co - extrusion process . for example , the head 352 and neck 354 may be formed of polyrope or butyl material . additionally , the second retaining channel 356 may be formed of a more rigid material such as pvc , polypropylene or other polymeric with ultraviolet and embrittlement characteristics . however , these are non - limiting examples . as with previous embodiments the diameter of the head 352 is greater than the dimension of the relief opening 47 so that the connector 350 is retained within the channel . the neck 354 extends linearly from the head 352 to the second retaining channel 356 which is also circular in shape . the polyrope material 80 is again utilized within a pocket 28 of the awning 22 such that the combination of the polyrope and awning pocket 28 may be slidably received within the retaining channel 356 . referring now to fig6 , a further alternative embodiment of the awning rail assembly 440 is depicted . the awning rail assembly 440 includes an awning rail 42 similar to the previously described embodiments . adjacent to the awning rail 42 is an awning 22 which may receive a polyrope 80 so that the polyrope is fitted within the awning 22 in order to capture or retain the awning within the retaining channel 46 of the awning rail 42 . as with the previous embodiments , a relief opening 47 is utilized in the retaining channel 46 to allow the awning 22 to extend from the awning rail 42 . although the instant embodiment depicts the use of the polyrope 80 to capture the awning 22 within the awning rail 42 , alternative embodiments may be utilized such as the connector structures described previously which may also capture or retain the awning 22 within the retaining channel 46 . the awning 22 of the instant embodiment further comprises a pocket 422 . the pocket 422 extends between a first - side edge and a second - side edge of the awning 22 and may or may not extend the full width of the awning 22 depending on the length of light strip 70 utilized . the pocket 422 may be formed of a transparent material which is sewn or otherwise affixed to the awning 22 and does not hinder roll - up of the awning 22 from the extended to the retracted position . the pocket 422 allows for insertion of the light strip 70 there thru . the wiring for the light strip may extend from the pocket end and through a side wall to which the awning rail 42 is connected . in one embodiment , the pocket 422 is located closely to the rail awning 42 so that the wiring need only run a short distance to a side wall of an rv or building to which the awning is connected . thus the problems associated with running wiring thru a hem of an awning is alleviated and also problems associated with roll - up of the wiring are also alleviated . however , such embodiment is not limiting as the pocket 422 and light strip 70 may be moved to various locations between the inner and outer ends of the awning 22 . it should also be understood that alternate embodiments may orient the pocket 422 in manners other than that which is shown . for example , the pocket 422 may be oriented in a plurality of manners . as shown , the pocket 422 extends between first and second sides of the awning . however , alternate lengths may be utilized . further , alternate orientations may be used such that the pocket 422 may extend between inner and outer ends and further at angles therebetween as shown in broken lines . additionally , according to this embodiment , a method of moving wire for powering the light strip 70 is shown . for example , the wire may be located within a hem along side edges of the awning 22 . referring now to fig7 , an alternative embodiment is depicted in perspective view . a roller assembly 30 is utilized with the awning assembly 20 to extend or retract the awning material 22 . as previously indicated , this may be done manually or automatically through use of a motor . the roller assembly 30 includes a roller housing 120 and an end cap 122 . a slot 124 extends in an axial direction of the roller housing 120 and through the end cap 122 . the accessory slot allows positioning of a luminaire strip 70 and wiring to power and control the luminaire strip 70 without interfering with the awning or canopy material 22 when the structure is rolled during retraction or extension . the wiring may extend fully through the slot and through the end cap externally or may be routed along the slot to a suitable position for further routing into the roller and elsewhere through the awning assembly components . as a further embodiment , depicted in the figure , a connector ( for example fig5 ) may be positioned within the slot 124 . the connector and such embodiment would likely be extruded of a soft material to allow positioning through the slot 124 . the luminaire 70 would then be positioned in the luminaire mount 60 . in such construction , caps or lenses 78 could be utilized with the luminaire mount 60 . it should be understood by one skilled in the art that any of the connectors depicted in the embodiment described herein might be utilized with the roller housing 120 . referring now to fig8 , an alternative embodiment of a connector 550 is depicted . the connector 550 includes a head 552 and a neck 556 which extend to a luminaire mount 560 . the head 552 includes a plurality of ribs or teeth 553 . the ribs or teeth 553 may be utilized to engage corresponding ribs or teeth 148 located in a retaining channel of an alternative awning rail 142 ( fig9 ). this would allow for rotation of the connector 550 into different positions relative to opposing teeth 148 ( fig9 ) so that the luminaire mount 560 may be aimed to various positions . alternatively , rather than teeth or ribs , an interference fit may be made between the connector and the retaining channel and may be adjustably rotated until a desirable light path is found wherein friction retains the luminaire mount at the desired position . with reference now to fig9 , a further alternative connector 650 is shown having a head 652 including a plurality of teeth 653 . as with the previous embodiment , these teeth or ribs may engage teeth 148 at various positions so as to retain the connector at a desired location to aim the luminaire mount 660 . thus , the various connectors previously discussed may be utilized with teeth or ribs for adjustment to various angular positions . referring now to fig1 , an alternate embodiment is depicted having a luminaire mount 760 including structures to allow parallel mounting of light strips 70 . the parallel mounts 760 may form two or more rows of luminaire strips 70 . the strips 70 may be aligned in the vertical direction or they may be offset from one another in the vertical direction along the width direction of the awning 22 . additionally , and with reference now to fig1 , an alternative luminaire mount 860 is depicted where the two or more rows are offset angularly so as to provide lighting in different directions as opposed to that shown in fig1 . the lighting 70 may be directed downwardly or upwardly or both so as to provide direct lighting in a downward direction and upward to provide indirect reflective lighting from the awning under - surface . as a further alternative , any of the previously described luminaire mounts may also be directed upwardly to illuminate the under - surface of the awning or in a reverse direction from that which is depicted so as to illuminate the side wall of the rv or building and provide indirect lighting for the area in such a manner . referring now to fig1 , a schematic view of an exemplary circuit 90 for powering the device is shown . a power supply 92 is shown which may be a battery which is connected for charging to an rv engine . alternatively , the power supply 92 may be typical 120v supply which is used in many homes and buildings or may be a low voltage , such as 12v , dc source typical in homes and rvs . the power supply 92 is electrically connected to a switch 94 which is manually operated to power on and power off the luminaire 70 . additionally or as an alternative to the switch 94 , the circuit 90 may include a remote operation for powering the light 70 . according to such embodiment , a remote 96 is shown for wireless communication with a receiver 98 . the remote may communicate by rf , infrared , bluetooth or other known wireless communication standards . disposed between the switch 94 and the receiver 98 is a driver 95 which may provide various functionality of the led luminaire 70 . the driver 95 may vary providing fixed illumination , dimming functionality of the led 70 or vary the color of the light bar 70 or some combination of these functions . referring still to fig1 , a solar collector 93 may additionally be utilized with the circuit 90 . the solar collector 93 is shown in connection with the power supply 92 , for example to charge one or more batteries in the rv , building , or marine vehicle . the solar collector 93 is an optional embodiment and therefore is not required for use as previously described but could be used to provide a self - sufficient system for powering the luminaire 70 . referring still to fig1 , a solar collector 93 may additionally be utilized with the circuit 90 . the solar collector is shown in connection with the power supply 92 , for example to charge one or more batteries in the rv , building , or marine vehicle . the solar collector is an optional embodiment and therefore is not required for use as previously described but could be used to provide a self - sufficient system for powering the luminaire 70 . while several inventive embodiments have been described and illustrated herein , those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein , and each of such variations and / or modifications is deemed to be within the scope of the invent of embodiments described herein . more generally , those skilled in the art will readily appreciate that all parameters , dimensions , materials , and configurations described herein are meant to be exemplary and that the actual parameters , dimensions , materials , and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used . those skilled in the art will recognize , or be able to ascertain using no more than routine experimentation , many equivalents to the specific inventive embodiments described herein . it is , therefore , to be understood that the foregoing embodiments are presented by way of example only and that , within the scope of the appended claims and equivalents thereto , inventive embodiments may be practiced otherwise than as specifically described and claimed . inventive embodiments of the present disclosure are directed to each individual feature , system , article , material , kit , and / or method described herein . in addition , any combination of two or more such features , systems , articles , materials , kits , and / or methods , if such features , systems , articles , materials , kits , and / or methods are not mutually inconsistent , is included within the inventive scope of the present disclosure . all definitions , as defined and used herein , should be understood to control over dictionary definitions , definitions in documents incorporated by reference , and / or ordinary meanings of the defined terms . the indefinite articles “ a ” and “ an ,” as used herein in the specification and in the claims , unless clearly indicated to the contrary , should be understood to mean “ at least one .” the phrase “ and / or ,” as used herein in the specification and in the claims , should be understood to mean “ either or both ” of the elements so conjoined , i . e ., elements that are conjunctively present in some cases and disjunctively present in other cases . multiple elements listed with “ and / or ” should be construed in the same fashion , i . e ., “ one or more ” of the elements so conjoined . other elements may optionally be present other than the elements specifically identified by the “ and / or ” clause , whether related or unrelated to those elements specifically identified . thus , as a non - limiting example , a reference to “ a and / or b ”, when used in conjunction with open - ended language such as “ comprising ” can refer , in one embodiment , to a only ( optionally including elements other than b ); in another embodiment , to b only ( optionally including elements other than a ); in yet another embodiment , to both a and b ( optionally including other elements ); etc . as used herein in the specification and in the claims , “ or ” should be understood to have the same meaning as “ and / or ” as defined above . for example , when separating items in a list , “ or ” or “ and / or ” shall be interpreted as being inclusive , i . e ., the inclusion of at least one , but also including more than one , of a number or list of elements , and , optionally , additional unlisted items . only terms clearly indicated to the contrary , such as “ only one of ” or “ exactly one of ,” or , when used in the claims , “ consisting of ,” will refer to the inclusion of exactly one element of a number or list of elements . in general , the term “ or ” as used herein shall only be interpreted as indicating exclusive alternatives ( i . e . “ one or the other but not both ”) when preceded by terms of exclusivity , such as “ either ,” “ one of ,” “ only one of ,” or “ exactly one of .” “ consisting essentially of ,” when used in the claims , shall have its ordinary meaning as used in the field of patent law . as used herein in the specification and in the claims , the phrase “ at least one ,” in reference to a list of one or more elements , should be understood to mean at least one element selected from any one or more of the elements in the list of elements , but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements . this definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “ at least one ” refers , whether related or unrelated to those elements specifically identified . thus , as a non - limiting example , “ at least one of a and b ” ( or , equivalently , “ at least one of a or b ,” or , equivalently “ at least one of a and / or b ”) can refer , in one embodiment , to at least one , optionally including more than one , a , with no b present ( and optionally including elements other than b ); in another embodiment , to at least one , optionally including more than one , b , with no a present ( and optionally including elements other than a ); in yet another embodiment , to at least one , optionally including more than one , a , and at least one , optionally including more than one , b ( and optionally including other elements ); etc . it should also be understood that , unless clearly indicated to the contrary , in any methods claimed herein that include more than one step or act , the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited . in the claims , as well as in the specification above , all transitional phrases such as “ comprising ,” “ including ,” “ carrying ,” “ having ,” “ containing ,” “ involving ,” “ holding ,” “ composed of ,” and the like are to be understood to be open - ended , i . e ., to mean including but not limited to . only the transitional phrases “ consisting of ” and “ consisting essentially of ” shall be closed or semi - closed transitional phrases , respectively , as set forth in the united states patent office manual of patent examining procedures , section 2111 . 03 . the foregoing description of several methods and an embodiment of the invention has been presented for purposes of illustration . it is not intended to be exhaustive or to limit the invention to the precise steps and / or forms disclosed , and obviously many modifications and variations are possible in light of the above teaching . it is intended that the scope of the invention and all equivalents be defined by the claims appended hereto .	5
referring now to the drawings and first to fig1 there is shown a well head structure generally at 10 that is utilized during well drilling operations and which incorporates one or more blow - out preventers such as shown at 12 that are capable of functioning responsive to certain conditions , such as conditions of drastic change in pressure , to cause gripping and sealing of drill pipe that extends through the blow - out preventer structure and into the well . immediately below the lowermost blow - out preventer may be provided a spool structure 14 having a conduit connection 16 formed integral therewith or connected thereto . a flow line , illustrated generally at 18 , may be interconnected between the conduit connection 16 and a flow line connector element 20 of a choke - and - kill manifold 22 . the flow line structure 18 may include a plurality of rigid flow line sections , such as shown at 24 and 26 , that are interconnected by a plurality of swivel joints , such as shown at 28 and 30 . each of the swivel joints may be of substantially identical construction and may be constructed in accordance with the present invention . the swivel joints allow relative movement of the various flow line sections 24 and 26 , such as might occur when portions of the drilling rig support structure yield or move relative to other portions that are bridged by the flow line structure . valves 32 and 34 may be interconnected into the flow line structure and may control communication between the flow line and the interior of the spool 14 . the plural valves 32 and 34 allow the flow line to be pressurized up to or above the pressure within the spool 14 with one of the valves being maintained in the closed position thereof . the valves then may be opened selectively to communicate fluid from the choke - and - kill manifold 22 to the spool structure 14 for the purpose of killing the well in conventional manner . with reference now to fig2 each of the swivel joint mechanisms 28 and 29 may taken the form illustrated generally at 36 , where a rotatable hub element 38 and a stationary hub element 40 are shown to be disposed in slightly spaced relationship , being separated by an annular friction resisting washer 42 . the washer 42 may be composed of polytetrafluoroethylene or any other suitable material having low friction characteristics . each of the hub elements 38 and 40 may be provided with an annular thrust transmitting flange , such as shown at 44 and 46 , with the flanges being disposed in juxtaposed relation and being separated only by the friction resisting washer 42 . flange 44 is of smaller diameter and width as compared to flange 46 to permit field repair as will be discussed hereinbelow . a swivel housing structure , such as that shown generally at 48 , may be composed of generally identical housing sections , one being shown at 50 . the housing sections may be retained in assembly by bolts 52 that extend through apertures formed in one housing section and are threadedly received by threaded apertures formed in the opposite housing section . the housing structure 46 is formed to define a swivel chamber 56 within which the thrust transmitting flanges 44 and 46 are retained . the swivel chamber is defined in part by thrust support surfaces 58 and 60 defined by the housing structure . lubricant passages 62 may be formed in each of the housing sections and lubricant fittings 64 in order to provide the swivel bearing with suitable lubrication . since the lubricant fittings 64 are externally exposed , the swivel mechanism may be readily lubricated as is desirable to promote efficiency of servicing operations and to extend the useful life of the swivel joint construction . it is highly desirable that the swivel assembly be capable of repair while in the field and the repair operations such as replacement of worn bearings and seals be capable of accomplishment in a relatively short period of time . according to the present invention , a flow line swivel assembly having such field repair capability may conveniently take the form illustrated in fig2 . as mentioned above , the thrust flange 44 is significantly smaller in diameter as compared to the opposing thrust flange 46 of hub 40 . the diameter of the thrust flange 44 is also slightly smaller than the internal diameter 66 of the thrust bearing 68 , thereby allowing the thrust bearing to pass over the flange 44 during installation and removal thereof . it is also necessary that the thrust bearing 68 be capable of transmitting thrust forces relative to the thrust support surface 58 of the split body 48 and also relative to the flange 44 . to accomplish this feature , a plurality of bearing retainer and thrust flange segments are employed as shown at 70 and 72 which cooperate to define a segmented thrust support flange 74 defining segmented thrust support surfaces 76 . although it is not intended to restrict the present invention to any particular number of bearing retainer segments , it has been determined that three mating bearing retainer segments , each including 120 °, are capable of functioning quite readily for the purposes intended . there may be provided any suitable number of bearing support segments , however , without departing from the spirit and scope of this invention . to accomplish installation of the bearing and bearing retainer segments , the flanges 44 and 46 of the hubs 38 and 40 are separated . the housing segments 50 of the swivel housing are also separated from the hubs 38 and 40 to allow installation of the bearing . the thrust bearing 68 is then moved over a smaller diameter flange 44 of the rotatable hub 38 and moved sufficiently to the left as shown in fig2 as to provide adequate clearance for assembly of the bearing retainer segments with the rotatable hub . the bearing retainer segments are then installed in the position illustrated in fig2 locating thrust shoulders 78 of each of the bearing retainer segments in abutting engagement with respect to an annular force transmitting surface 80 defined by the small hub flange 44 . with the bearing retainer segments thus located , it is necessary to retain the segments in assembly with the rotatable hub 38 until such time as the bearing 68 may be moved into encircling assembly about the bearing retainer segments . to so retain the bearing retainer segments , each of the segments is formed to define an annular groove segment which cooperates in assembly to define an annular retainer groove 82 . an annular retainer element 84 is then positioned within the retainer groove 82 and functions to retain the bearing retainer segments in assembly with the rotatable hub 38 . the annular retainer element 84 may be defined by any suitable split retainer ring having a spring - like capability causing the retainer ring to be urged into the annular groove 82 and to retain the bearing retainer segments in properly assembled relation with respect to the rotatable hub . the retainer ring 84 may be composed of metal such as stainless spring steel or , in the alternative , may be composed of any other suitable material having the spring - like characteristic that is desirable for retaining the bearing retainer segments in proper assembly with the rotatable hub . with the bearing retainer segments retained in the position illustrated in fig2 the bearing element 68 is then moved laterally into assembled relation about the cylindrical surface 86 that is defined by the cylindrical segmented surfaces of the respective bearing retainer segments . with the bearing 68 so positioned , the hubs 38 and 40 may be brought into assembly with the friction - resistant washer 42 interposed therebetween and the housing segments 50 of the housing 48 may be brought into assembly with the hub bearing and bearing retainer structure in the manner shown in fig2 . it will be desirable to provide the swivel construction with means for preventing fluid disposed therein from flowing through the joint between the hubs 38 and 40 , which joint is occupied by the friction resisting washer 42 , and thereby preventing the fluid from contaminating the bearing 68 . in accordance with the present invention , each of the hub structures may be formed to define internal annular recesses , such as shown at 88 and 90 , that cooperate when the hubs are in assembled position such as shown in fig2 to define an elongated annular seal recess that is exposed to the flow passage 92 extending through the swivel construction . a seal carrier or retainer element 94 is positioned within the elongated seal recess and provides both primary and secondary sealing capability in order to prevent fluid within the flow passage 92 from reaching the bearing 68 . as illustrated in fig2 the annular seal carrying element 94 provides a transition , bridging the space or joint defined between the opposed inner extremities of the hub elements 38 and 40 and cooperates with the hub structures to define a pair of primary seal pockets 96 and 98 within which may be contained a pair of primary seal assemblies 100 and 102 , respectively . a plurality of annular grooves 104 may also be formed in the outer periphery of the annular seal carrier element 94 , which annular grooves may receive a plurality of annular sealing elements 106 that establish secondary seals between the seal carrier element and respective ones of the hubs 38 and 40 . referring now to fig4 and 5 , the primary seal assemblies 100 and 102 may be defined by a relatively hard or stiff annular sealing body 108 that may be considered of generally u - shaped cross - sectional configuration defining a pair of annular yieldable sealing flanges or lips 110 and 112 . it is desirable that the annular sealing body 108 be of friction resistant characteristic , in addition to being capable of providing sealing ability and , in accordance with the present invention , the sealing body may be composed of glass filled polytetrafluoroethylene or any other suitable relatively hard plastic sealing material . referring to fig5 the annular sealing body 108 , in the uncompressed condition thereof , may be shown to have externally tapered surfaces 114 and 116 extending from an annular generally cylindrical base surface 118 . the surfaces 114 and 116 may be tapered in the order of 3 ° so as to cause the outer edges of the sealing flanges or lips 110 and 112 to make initial contact with side walls 120 and 122 of the sealing pocket 96 . as the swivel structure is assembled , the annular sealing body will be deformed from its uncompressed state shown in fig5 toward the fully compressed condition thereof illustrated in fig4 . it is not necessary , however , that the annular sealing body be completely compressed as shown in fig4 it only being necessary that the sealing body be sufficiently compressed to establish initial sealing contact with the side walls 120 and 122 in order to provide initial sealing capability exclusive of the pressure - energized sealing capability to be discussed hereinbelow . the annular sealing body 108 may also be formed to provide an annular groove 124 between the sealing lips 110 and 112 , within which groove may be disposed a relatively soft annular sealing element 126 that substantially fits the major portion of the configuration of the groove 124 . the annular sealing element 126 may be composed of viton or any one of a number of other suitable elastomeric or rubber - like sealing materials within the spirit and scope of the present invention . the sealing element 126 conveniently takes the form of an o - ring that is subjected to a slight degree of initial compression in the unpressurized state of the swivel construction , thereby establishing an initial seal between the seal carrier element 94 and the annular sealing body 108 . as pressure within the flow passage 78 is increased , pressurized fluid will enter the annular seal pocket 96 and will bear upon both the annular sealing body 108 and the elastomeric sealing element 126 . because an initial seal has been established between the annular sealing body and the side surfaces 120 and 122 defining the primary seal pocket , initial leakage past the annular sealing body will be prevented . pressure from the flow passage 92 will bear directly upon the annular sealing element 126 , causing it to deform slightly because of its elastomeric composition . when this occurs , the force of the pressurized fluid is transmitted from the elastomeric sealing element 126 to the annular sealing lips 110 and 112 of the annular body , causing the lips to be urged more tightly against the respective side surfaces 120 and 122 of the primary seal pocket . pressure therefore enhances the sealing ability of the seal assembly within the primary seal pockets , but the additional mechanical pressure that is developed between the annular sealing body , the hub and the annular seal carrier element 94 does not materially retard the capability of these parts to be free for relative rotational movement because of the friction resistant composition of the annular sealing body . the annular recesses 88 and 89 of the respective hubs define a cylindrical surface against which the secondary sealing elements 106 establish initial sealing contact upon assembly of the swivel mechanism . the secondary sealing elements 106 may be composed of any suitable elastomeric sealing material , such as viton , for example . the secondary sealing elements , in addition to providing o - ring type sealing capability to prevent leakage of pressurized medium between the seal carrier element 94 and the cylindrical surface defining the respective recesses 88 or 89 , serve an additional function of preventing lubricant material from flowing from the swivel chamber to the primary seal assembly . as discussed above , lubricant material is injected into the chamber 56 through lubricant fittings 64 . the secondary sealing elements 106 prevent the lubricant material from flowing from the swivel bearing chamber 56 through the joint between the friction resisting washer 42 and the respective hubs where it might otherwise flow along the seal carrier element to the primary seal assembly . additionally , annular sealing elements 128 and 130 , such as viton o - rings , may be retained within appropriate grooves formed in the housing structure and may prevent lubricant from leaking from the swivel bearing chamber . each of the various swivel devices of a swivel joint construction embodying this invention are capable of being disassembled for the purpose of repair or replacement . after the housing structure has been separated from the hubs simply by removing the bolts 52 , a flow line segment , together with its hub structure , may be moved linearly relative to the opposite hub structure , which not only separates the hubs 38 and 40 but extracts the seal carrier element 94 from at least one of the recesses 88 or 90 defining the elongated seal carrier receptacle . after this has been accomplished , the bearing 68 and bearing retainer segments will be in assembly with the hub 38 as shown in fig2 . in the event it is desired to replace the bearing , the bearing will be moved to the left , thus clearing it from its encircling relation about the segmented cylindrical surface 86 . after so removing the bearing , the spring retainer ring 84 is removed from the segmented groove 82 , thus freeing the segments from the assembled relation thereof about the hub 38 and allowing the segments to be withdrawn by radial movement relative to the hub . after this has been accomplished , the bearing may be passed over the small diameter flange 44 thus separating it from the hub 38 , after which a replacement bearing may be installed by passing it over the flange 44 in the manner described above . the bearing retainer segments 70 and 72 are then positioned as shown in fig2 and the retainer ring 84 is positioned within its groove 82 to retain the segments in assembled reltaion with the hub 38 . with the bearing so placed , the seal carrier element 94 , with new primary and secondary seals installed , is inserted into one of the recesses 88 or 90 and the friction resistant washer is positioned about the seal carrier element . the hubs 38 and 40 are then moved into assembled relation as shown in fig2 after which the body sections 50 are assembled about the hubs and bearing . bolting of the body section by means of bolts 50 completes the repair operation . when the swivel structure is assembled , the thrust support surfaces 62 and 64 of the housing structure will cause the bearing and thrust transmitting flanges of the hub structure to be so positioned that the primary seal assemblies are caused to yield from the uncompressed condition thereof , shown in fig5 toward a linearly compressed condition , where the sealing lips 110 and 112 are caused to move more closely together by the opposed side surfaces 120 and 122 of the respective primary seal pocket . an initial mechanical seal is formed thereby in addition to the initial mechanical seal formed by the secondary sealing elements between the seal carrier element and the respective hubs . low pressure leakage will be prevented by this initial sealing capability . as pressure within the flow passage 92 increases , this pressure will enter the primary seal pockets and will act upon the annular relatively hard sealing body 108 and upon the elastomeric annular sealing element 126 . the effect of pressure will have a tendency to cause spreading of annular sealing lips , thereby further enhancing the sealing engagement between the lips and the respective side walls of the seal pocket . the sealing ability of the primary seal assemblies is therefore enhanced in direct proportion to increase in pressure within the flow passage 92 . in view of the foregoing , it is quite clear that a novel swivel structure has been provided for movable flow lines which is capable of maintaining a positive seal against leakage of fluid at all pressure ranges through incorporation of primary and secondary sealing elements that function to prevent such leakage . in addition , a swivel joint construction has been provided that effectively allows relative rotation of various sections of a segmented flow line construction and does not allow high stresses to be induced to the flow line structure that would otherwise cause rupture or malfunction thereof . a swivel construction has been provided that may be easily and simply disassembled for replacement of the bearing and seals or repair of the various parts thereof . even though the swivel structure is readily rotatable , responsive to forces applied thereto , the swivel structure provides effective sealing capability at all pressure ranges thereof and functions also to prevent contamination of the bearing of the swivel structure by any leakage . the design and manufacturing costs of the swivel structure is maintained at a simple and low cost nature because the hub elements , together with the transition type seal assembly , are the only pressure containing structures of the swivel mechanism . the housing is not required to withstand the pressure of the fluid medium within the swivel structure and therefore does not need to be of sufficient strength to withstand the radial stresses that will be caused by severely high pressure conditions . the housing structure is required only to withstand the thrust forces applied thereto by the thrust transmitting flanges through the thrust bearing . the swivel structure is also provided with an efficient lubrication system causing the bearings to be effectively lubricated during use . moreover , the lubrication system is so designed as to promote simple and efficient lubrication servicing while the apparatus is in service and under pressure to enhance the service life of the swivel construction . it is therefore seen that this invention is one well adapted to attain all of the features and advantages hereinabove set forth , together with other features and advantages which will become obvious and inherent from a description of the apparatus itself . it will be understood that certain combinations and subcombinations are of utility and may be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the present invention .	5
referring to the drawings , the golf ball marking tool of the invention comprises a molded housing 10 having a hemispheric shape 11 in this preferred embodiment and has a lower peripheral edge 12 having a circular ring 12 for retaining an elastic member or o - ring so that the elastic member stretches across slots s 1 , s 2 , s 3 and s 4 thereby intruding in the space of the open end of the shell housing . the intruding portions or - 1 , or 2 , or - 3 , or - 4 are displaceable by a golf ball gb to be inserted therein so that when the ball is going past the centerline thereof , the ball is retained in the inner shell in a position whereby the stencils can be traced with a tracing pen to thereby place the monogram or indicia of the user or owner on the golf ball as shown in fig7 . a plurality of stencil windows w 1 , w 2 , w 3 are formed for receiving the individual stencils s 1 , s 2 , s 3 . although only one set of windows w 1 , w 2 , w 3 is shown , it will be obvious that more or less windows may be molded into the housing for other characters and / or indica . for example , a set of stroke alignment stencils 21 a , 21 b and 21 c may be provided . numerical stencils may be provided . moreover , although the windows are shown on the top surface of the hemisphere 11 for the alphabetic indicia , they can be located almost anyplace on the upper surface and they need not necessarily be in alignment . each window w 1 , w 2 , w 3 includes at least one latching rib or shoulder 15 , 16 ( see the enlarged sectional view of character stencil latched in place in fig6 b ). preferably , each latching shoulder or rib 15 , 16 is preceded by a chamfered or beveled edge 17 and 18 , respectively . referring to fig3 a , 3 b , 3 c and 3 d , the letters of the alphabet are formed in stencil carriers sc , and for the purpose of monogram , the letters or alphabetic characters a - z are formed in stencil openings in stencil carriers 20 a , 20 b . . . 20 z , constituting the 26 letters of the alphabet and additional indicia such as stars 21 d , squares , straight lines . in stencil indicia blocks 21 a , 21 b and 21 c are shown lines which may be lined up to draw or stencil alignment indica for ball stroking purposes , such as putting and driving alignment purposes . referring to fig3 b , 3 c and 3 d , the detailed construction of the individual stencil carriers is shown . each stencil carrier has a pair of latchment edges 25 , 26 . the upper 25 and lower 26 latchment edges have a stop flange or shoulder 27 , 28 which abut the upper surface 29 of the window 29 , 30 . each character is installed , e . g . plugged in , either before or after the ball is in the housing , and are individually and accurately spaced in position by the windows w 1 , w 2 , w 3 . the grooves g 1 , g 2 in each window block 20 is preceded by a bevel or chamfered edge 31 , 32 to facilitate entry into the window in coaction with the window bevel or chamfered edges 17 and 18 . as shown in fig1 and 2 and the lower peripheral edge of the housing 11 is provided with a plurality of slits or slots s 1 , s 2 , s 3 and s 4 into which is fitted an o - ring 40 or other endless elastic member which stretches through and across each of the slots to intrude in the space of the open end of the housing and is displaceable by a ball inserted therein so that when the ball is going past the centerline thereof the ball is retained in the hemispherical shell in a position whereby the stencils can be traced with a tracing pen to thereby place the monogram or other indicia of the user on the golf ball . the golf ball can be removed from the housing in a few different ways . the user can simply shake the ball out . he can use the tip of the marking pen to push the ball equator past the o - ring or and it will fall out , or the housing can have one or more openings on either side of the three windows to push the ball out by using your fingers . thus , there has been described a golf ball monogramming or marking tool comprising a molded , rigid plastic shell housing having a ball receiving open - end with a peripheral edge and a plurality of side - by - side windows , a plurality of character or indicia stencil carriers , each window adapted to receive a selected stencil carrier , means in each window for interacting with each stencil carrier to retain the stencil carrier in the given window , the peripheral edge of said hemispherical shell having at least one slot therein , and an elastic member stretched across the slot and intruding in the space of the open end of the shell . the stretched member is displaceable by a ball inserted therein so that when the ball goes past a centerline thereof the ball is retained in the hemispherical shell in a position whereby the stencils can be traced with a tracing pen to thereby place the monogram of the user on the golf ball . further , the tool defined above wherein each window includes at least one rib and a chamfered surface contiguous to the rib , each stencil carrier having a complementary groove and a chamfered edge leading to the groove whereby when the stencil carrier is located in said window and pressed down the chamfered edges cooperate to allow the rib to enter the complementary groove to form an interference fit and latch said stencil carrier in said window . ( the “ rib ” and “ groove ” can be reversed .) the golf ball marking tool described above wherein the peripheral edge has a plurality of slits in said lower edge and an o - ring member seated in said slits such as to intrude in said opening thereby retaining the golf ball in said hemispherical shell when placed therein . the invention also features a golf ball marking tool comprising a hemispheric plastic shell having a ball receiving open - end and a plurality of side - by - side windows , each window adapted to receive from the exterior of said hemispheric shell one or more plug - in indicia stencil carrier , means in each window for interacting with each said stencil carrier and retain said stencil carrier in the given window . the golf ball marking tool includes a ball retention system comprised of a plurality of slits in the peripheral edge therein and an endless extensible member seated in said slits such as to intrude in the opening thereby retaining the golf ball in the hemispherical shell . while the invention has been described in relation to preferred embodiments of the invention , it will be appreciated that other embodiments , adaptations and modifications of the invention will be apparent to those skilled in the art .	1
a gas is present in chamber 10 ; it may be dissolved in solution . the gas may be any gas although the typical and perhaps most important applicationof this invention is when the gas to be detected is hydrogen , h 2 . for example , in a sodium leak detector application , a palladium diaphram 20is used in a system to measure h 2 which is liberated when liquid soidum used to carry heat from a nuclear reactor leaks out of its containment pipe into an atmosphere containing a hydrogen - liberating substance . in another highly important application , the invention is used to measure hydrogen dissolved in the liquid sodium . in this use of the invention , chamber 10 is the pipe containing the liquid sodium used to draw off heat from the reactor . the sodium pipe goes through a succession of heat exchangers to further reduce the heat . in one of the exchangers the heat is transferred from a sodium coolant system to a water coolant system . if there were a leak of water into the sodium line in this portion of the system , a reaction would take place causing rapid corrosion and erosion ofthe metal tubes adjacent to the leak . a sufficiently large or long lasting leak could result in the deformation and rupture of the reactor itself . hence , it is imperative that even the smallest water leaks into the sodiumline be detected immediately if propagation of damage is to be avoided . oneof the byproducts of such a leak would be the production of hydrogen dissolved in the molten or liquid sodium . hence , in this use the instant invention may be termed a water leak detector . in such an application membrane 20 is a thin nickel diaphragm which is transparent to hydrogen and can withstand the corrosive effects of the molten sodium . the water leak detector is operated in what is referred to as the dynamic equilibrium mode in order to provide early warning of a leak condition . ion pump current is used as the indicator of hydrogen flux through the nickel diaphragm . this current is continuously monitored and any appreciable increase signals a leak warning . in prior art systems the variations in pumping speed inherent in all ion pumps caused by complicated processes of chemisorption and physisorption of hydrogen result in large variations of current in the closed system from which one might erroneously conclude that the concentration of hydrogen in the molten sodium has changed . in the present invention , however , the sensing means , sensing chamber 40 , is isolated from the pumping means , pumping chamber 60 , and the variation in pumping speed in chamber 60 does not affect the sensing of the hydrogen which transpires in chamber 40 . in prior art installation it was customary to connect a vacuum gauge to themeasuring system between the interface 20 and the sputter ion pump , and provide a valve between the gauge connection and the sputter ion pump . onetype of vacuum gauge used for this purpose is the gauge sold by varian associates under the trademark &# 34 ; millitorr &# 34 ;. periodically the valve was closed and the equilibrium pressure read from the gauge was used as a gas concentration monitor , particularly for hydrogen gas . the gauge reading was used periodically to provide continuing calibration of the sputter ionpump current to correct for changes in pumping speed . however , since the current reading from the present invention is substantially independent ofpumping speed , the present instrument does not require continuing calibration checks . on the other hand , design of the instant instrument still facilitates incorporation of the valve and vacuum gauge of a known hydrogen concentration monitor should the option of this added feature prove desirable . the invention may also be used as a chemical reaction rate monitor in the case where the instrument interface is in or forms part of a chamber in which the chemical reaction is taking place . the stability and consistancy of the instant invention in pumping hydrogen will now be described . let s be the pumping speed of the sputter ion pump formed in chamber 60 . the speed , normally measured in liters / second , is ( within the range of normal operating conditions ) independent of the pressure of the gas in thesystem and the quantity of gas moving in ( flux ). the pumping speed is dependent upon the geometry of the pump , electrical potential on anode 62 and cathod 64 , magnetic field , and the chemical acitivity of the pump . letc be the conductance of restrictive conductance 50 . c is normally measured in liters / second and is given by the following equation : k is the boltzmann constant , 1 . 38 × 10 - 16 erg / deg , t is the absolute temperature of the gas being measured ( in this regard it is important to note that this temperature in actual operation is normallythe temperature of the chamber , not the temperature of the gas in the molten solvent , since the gas moving into the chamber quickly assumes the temperature of the chamber ), and m is the molecular weight of the gas being measured . page 19 of a . guthrie and r . k . wakerling , vacuum equipment and techniques , mcgraw hill ( 1949 ). it is known in the art that the effective pumping speed of a pump in serieswith a known vacuum conductance is given by the formula : s eff is the effective pumping speed of the conductance / pump combination , and s p is the pumping speed of the pump . guthrie and wakerling , supra , page 15 . with respect to the accompanying drawing this is : s 40 is the pumping speed with which sensing chamber 40 is evacuated , if c 50 is very much smaller than s 60 , then we see that : in other words , s 40 is substantially independent of s 60 . thus s 60 may be allowed to change as a result of chemical activity on cathode 64 but s 40 will remain essentially a constant , permitting precise measurements within sensing chamber 40 . as a specific example , letus assume that c 50 = 0 . 1 liter / second , that s 60 at time t 1 is 5 liters / second and that s 60 at time t 2 is 2 . 5 liters / second . in other words , the pumping speed in pumping chamber 60 varies by a factor of 2 between times t 1 and t 2 . the variation in pumping speed with which sensing chamber 10 is evacuated is given as a ratio of its pumping speed at the two times as follows ; ## equ1 ## thus we see that the pumping speed with which sensing chamber 40 is evacuated has hardly changed at all . now q , the flux of the gas permeating through membrane 20 , is normally measured in torr liters / second and is given by the following formula : s is the pumping speed in liters per second at which chamber 40 is being evacuated and if the pumping speed with which sensing chamber 40 is evacuated is constant , it follows from the above equation that the pressure change in the chamber depends solely upon the change in q or flux . now the current ipassing through cathode 44 is directly proportional to the pressure p for agiven geometry of the chamber and electrical and magnetic field parameters . this linearity can be maintained over a wide range of values by selecting appropriate values for the geometry and construction parameters of the chamber , for example , the size of aperture 50 , the size , thickness and material of membrane 20 , and the geometric values of sensing chamber 40 . in other words , a simple electrical measurement of the current i through cathode 44 will give us a measurement of p and in turn a measurement of q ( since s is known from the reltionship s 40 ≅ c 50 ). this in turn gives us a measurement of the concentration of hydrogen or other gas of interest in chamber 10 , because the value of the concentration of gas depends only upon q and the temperature of membrane 20 . an important advantage of the instant invention is that the device can be used as a gas concentration monitor . this is because , as indicated above , the pumping speed with which the sensing chamber is evacuated is approximately equal to c 50 and is constant . since we can calculate c 50 from a group of physical constants , we can determine s eff ( the effective pumping speed with which chamber 40 is being evacuated ), and from the equation determine the absolute concentration of hydrogen or other gas in the system . in prior art systems in which the pump and measuring unit were combined in the form of a single sputter ion pump , the pumping speed was neither measurable nor invariant . an important feature of the instant invention is that it functions as a current amplifier . in other words for a given q the present invention willdevelop a higher current than the prior art . this will be demonstrated after first showing that changing the ion pump size in known instruments does not affect sensitivity . assume that a unit pumping element ( single anode / cathode cell ) has a speed of s u . two such elements used in concert will have a speed 2s u , and n unit elements ns u speed . by the same token for the same geometry and electrical and magnetic field parameters , the current drawn by each element will be , to a close approximation , directly proportional to pressure . that is to say for the unit element , i = k u p ( where p is the pressure in a unit element and k u is the proportionally constant for the unit element ) whereas for two unit elements , i = 2k u p 2 and for n unit elements i n = nk u p n where p n isthe pressure in each unit element when there are n unit elements . it will now be demonstrated that for the same q , the current drawn by a pump with a unit pumping elements will be the same as the current drawn bya pump with m unit pumping elements . note that p m ≠ p n , because as you increase the number of pumping elements you decrease the pressure . ## equ2 ## on the other hand , compare the current drawn by a known instrument with n pumping elements to that of the instant invention with a sensing chamber and a pumping chamber . for a given q and n pumping elements , the total current drawn will be for the instant invention there will be two current components . assume the pumping chamber has the same parameters as given for the known instrument . then for the same q one current component will also be ( k u q / s u ), but there is also a current component drawn by the sensing chamber albeit no pumping . assume that this sensing chamber has m unit elements . then , aswe know from the prior art ( guthrie and wakerling , supra , page 35 ) and where subscripts m and n relate to chambers 40 and 60 respectively ## equ3 ## in other words for a given q , the current in the sensing chamber increases in direct proportion to the number of unit cells added to that chamber . this is because the sensing cells perform substantially no pumping and therefore adding cells in chamber 40 does not reduce pressure in that chamber . such a multiple sensing cell arrangement is shown in fig2 in which 42 &# 39 ; indicates the multiple cells in chamber 40 . the current amplification ( ratio of the total current drawn by the instant invention compared with that of the known instrument ) is : ## equ4 ## or current amplification = ( ms u / c +( m / n )+ 1 . assume the least advantageous configuration of m = 1 & gt ;& gt ; n . inasmuch that typically 10 ≦ ( s u / c )≦ 100 . assume s u / c = 20 . then the amplication will be ≈ 21 . because of the current amplication feature of the instant invention it is possible to use the same high voltage power supply to operate each of the separate chambers 40and 60 , thus resulting in a savings of instrumentation costs . even though large variations in pump speed may occur this is possible . for example , assume that the speed of the pumping chamber is decreased by a factor of two . the ratio of the total current drawn in the two cases , for the least advantageous configuration , would be 22 / 21 or a change of 4 . 8 %. note that most of the current is drawn through the sensing chamber because the pressure in it is higher than in the pumping chamber . the ratio of currentdrawn through the sensing chamber to that drawn through the pumping chamberis given by ## equ5 ## since one of our assumptions is that s u & gt ;& gt ; c , it follows that i m & gt ;& gt ; i n . therefore most of the current amplification is obtainable fromreading just i m . however , a simplified power supply configuration may be used in which i m + i n is measured , and very little error deviation from the true i m value is introduced . the isolation of the sensing functions and pumping functions , and the consequent current amplification feature , permits a much greater sensitivity in the device . because of this sensitivity , it is possible to decrease the size of membrane 20 by at least an order of magnitude and still retain the same accuracy of measurement . since q is directly proportional to the area of membrane 20 , q also decreases by an order of magnitude . a high measurement accuracy coupled with a low q means that thelife of the pump increases dramatically because a fewer number of moleculesentering through membrane 20 means that cathode 64 is not subject to as much ion bombardment and thus lasts longer . this is an important advantageof the instant invention . the material used for cathode 64 is typically titanium or an alloy of same although any active gettering material for sorption of the ionized particles will do . the material utilized for cathode 44 is typically stainless steel , although any non - active cathode material that is a passive element precluding a pumping effect will do . the increased sensitivity of the device results also in an increased accuracy at lower signal levels ; this is another important advantage of the instant invention . the concepts of the invention may be extended by placing a number of sensors similar to sensing chamber 40 in parallel , all connected to and pumped by a single large ion pump corresponding to pumping chamber 60 . thepumping speed of the pumping chamber must be very much larger than the conductance through which each sensing chamber is connected to the pumpingchamber . in this case , each sensing chamber can be used to monitor a separate and distinct type or source of gas . such a plural sensing chamberarrangement is shown in fig3 in which prime and double prime numbers indicate parts corresponding to similar elements with unprimed numbers in fig1 . while the principles of the invention have now been made clear in the illustrated embodiment shown above , there will be obvious to those skilledin the art many modifications in structural arrangement of components used in the practice of the invention without departing from the above enuniciated principles . for example , any type of vacuum gauge ( e . g ., millitorr gauge ) can be used for sensing chamber 40 . the appended claims are therefore intended to cover and embrace any such modification within the limits only of the true spirit and scope of the invention .	6
with reference to fig1 the principle of the horn speaker according to the present invention will be described . within the sound passage of a horn , two partition walls 4 and 4 extending from a throat 5 to a mouth are arranged symmetrically with respect to the straight principal axis of the horn to divide the horn into three sound passages 1 , 2 and 2 . the two sound passages 2 and 2 have the same length . one diaphragm is positioned close to the throat 5 and the surface of the mouth is generally planar . the plane of the mouth is substantially in parallel to the inlet face of the horn . the divided sound passages 1 , 2 and 2 are substantially equal to each other in the rate of area expansion , such that the areas of the divided sound passages 1 , 2 and 2 in section taken along a plane perpendicular to the principal axis of the horn continuously increase at nearly equal rates to each other from the throat 5 to the mouth plane in the direction of the principal axis . the partition walls 4 and 4 are formed with bulging portions 3 and 3 on their outer sides . the outer surfaces of the partition walls 4 and 4 are therefore curved along the principal axis of the horn . positioned outwardly of the partition wall 4 and 4 are side walls 6 and 6 whose inner surfaces are likewise curved along the principal horn axis , with the result that the divided sound passages 2 and 2 are curved and are greater in length than the principal axis of horn included in the sound passage 1 of the divided horn . sound waves projected into the horn from the throat 5 are dividedly propagated through the divided sound passages 1 , 2 and 2 and then radiated from the mouth plane . since the divided sound passages 2 and 2 have a greater length than the divided sound passage 1 , the propagation time taken for the sound wave to travel from the throat 5 to the mouth plane through the sound passages 2 and 2 is longer than the propagation time required for the sound wave to pass through the sound passage 1 , so that the apparent propagation velocity is lower in the former case . accordingly , the apparent propagation velocity of sound wave at the mouth plane differs in accordance with the position from which the sound wave is radiated . thus the sound wave will be refracted toward the direction where the sound wave velocity is lower . the index of refraction n at this time is given by equation ( a ): where co is the velocity of sound wave propagated through the sound passage 1 , c is the apparent velocity of sound wave propagated through the sound passage 2 , lo is the effective length of the sound passage 1 and l is the effective length of the sound passage 2 . thus the sound wave is refracted at the index of refraction n given by equation ( a ) toward the direction of straight directional line . consequently , the sound waves are radiated from the mouth plane in spreading fashion , whereby wide directional characteristics are available . the refraction due to the difference in the length of passages is represented by equation ( b ): where n is the index of refraction , x is the length of centerline of the sound passage 1 , f is a virtual focal distance of curved waves radiated from the mouth plane , y is the distance between the central axis of the sound passage 1 and the central axis of the sound passage 2 in the mouth plane . accordingly , if the virtual focal distance f is given as desired , l will be determined by the value of y . the effect of the present invention derived from the planar mouth surface of the horn will be described . generally , if a horn of a short length is used to compact the horn speaker , the impedance characteristics exhibit peaks and valleys at low frequencies as indicated at 21 in fig2 to impair the sound quality . however , with the horn speaker of this invention , the sound passage 2 has a greater length than the sound passage 1 , with the result that the impedance characteristics ( indicated at 22 in fig2 ) of the sound passage 2 and the impedance characteristics ( indicated at 21 in fig2 ) are displaced from each other with respect to the frequency axis . thus the characteristics of the sound passage 1 and the characteristics of the sound passage 2 are combined to give smooth overall characteristics ( indicated at 23 in fig2 ), with the peaks and valleys of the former offsetting those of the other . a horn speaker is therefore available which is adapted for sound reproduction at low frequencies without objections and which is low in the threahold frequency for low - frequency reproduction in spite of its compactness . next the number of divided sound passages will be described in relation to the directional characteristics and impedance characteristics . the relation between the angle of refraction θ and the index of refraction n is given by : n = 1 / cos θ . it therefore follows from equation ( a ) that cos θ = lo / l . thus the cosine of the angle of refraction θ is determined by the ratio of lo to l . the smaller the lo / l , namely the greater the l , the larger will be the angle of refraction in the divided passage 2 , giving wider directivity . however , if the number of divided passages is small , there occurs a valley in the directional characteristics curve and , even within the directional angle , a low sound pressure will result . further to utilize the peaks and valleys in the impedance characteristics at low frequencies effectively , the peak in the characteristics of the divided sound passage 2 must be superposed on the valley in the characteristics of the divided sound passage , and vice versa , so that the ratio between l and lo need be selected suitably , hence the angle of refraction θ is limited . accordingly , it may be considered to divide the sound passage into a greater number . fig3 shows a sound passage divided into seven divisions . suppose the divided sound passages 31 , 32 , 32 , 33 , 33 , 34 and 34 have effective lengths of l 31 , l 32 , l 33 and l 34 . the divided sound passage 31 and divided sound passage 32 give an angle of refraction θ 31 , with which cos θ 31 = l 31 / l 32 . in respect of the angle of refraction θ 32 given by the divided sound passages 31 and 33 , cos θ 32 = l 31 / l 33 . in the case of the angle of refraction θ 33 given by the divided sound passages 31 and 34 , cos θ 33 = l 31 / l 34 . the size and direction of the sound waves emerging from the divided sound passages are indicated by the arrows in the figure . the shape of the sound waves is represented by an envelope obtained by connecting the tips of the arrows together and centered about a virtual focal point f . it therefore follows that the greater the number of divided sound passages , the more closely the waveshape resembles a smooth curve . the impedance characteristics of this horn speaker will be described . the impedance characteristics of the divided sound passage 31 are deviated from the characteristics of the divided sound passage 32 . similarly , the characteristics of the divided sound passage 32 are deviated from those of the divided sound passage 33 , the characteristics of the divided sound passage 33 from those of the divided sound passage 34 , respectively . consequently , the four characteristics offset each other to result in overall characteristics which are smoother than those of fig2 to assure more satisfactory reproduction at low frequencies . when the horn is divided into an increased number of sound passages as above , a correspondingly increased number of partition walls are necessary . this increases the cost but the product obtained is satisfactory in directional properties and frequency characteristics . next , embodiments of this invention will be described . the horn speaker shown in fig4 has three sound passages 41 , 42 and 43 divided by two partition walls 44 and 44 extending through the horn in the direction of principal axis thereof . the horn has a rectangular mouth and a first straight directional line coinciding with the longitudinal central axis of the rectangular . the partition walls 44 and 44 are formed with bulging portions 43 and 43 . the inner surfaces of the side walls 46 and 46 include first portions 46a and 46a which are positioned toward the direction of the first directional line and curved along the principal horn axis , such that the relation of equation ( c ) will be established on the first directional straight line . the number of the partition walls need not necessarily be two but may be any even number to form an odd number of divided sound passages symmetrically with respect to the principal horn axis in the direction of the first direction straight line . fig6 shows the values of directional characteristics of horn speakers as actually measured , wherein indicated at 62 are the directional characteristics of a conventional horn speaker having no partition walls , whilst indicated at 61 are the directional characteristics of a horn speaker having the construction of fig4 . comparison between these two characteristics 61 and 62 indicates that the horn speaker of the present invention has greatly improved directional characteristics . fig7 shows the actually measured values of frequency characteristics , wherein those of a conventional horn speaker with an undivided horn are indicated at 72 and those of a horn speaker having the construction of fig4 are designated at 71 . comparison between the two reveals that the first peak of the curve 71 is positioned at a lower frequency than the curve 72 , this showing a lower threshold frequency for low - frequency reproduction . while the horn speaker shown in fig4 has a rectangular mouth , with the straight directional line oriented only in one direction , fig5 shows another embodiment wherein the directional line is oriented in every direction . more specifically , the horn speaker of fig5 includes one cylindrical partition wall 54 having a central axis substantially in coincidence with the principal axis of the horn and dividing its sound passage into two divisions 51 and 52 . the mouth of the horn is circular and every diametrical direction of the mouth plane substantially coincides with the straight directional line described above . further when seen in cross section in parallel to the mouth plane , the first divided sound passage 51 including the principal horn axis has a generally circular shape , whilst the second divided sound passage 52 surrounding the first divided sound passage 51 has an annular shape . although the embodiment of fig5 has one partition wall 54 , which includes a thickened portion 53 intermediate its ends , a plurality of partition walls may of course be provided whether in an even or odd number . the thickened portion 53 of the partition wall 54 extends only radially outward , the inwardly facing surface of the partion wall 54 does not exhibit any bulge . thus , the sound passage 52 is longer than the sound passage 51 . sound waves travelling dividedly through the sound passages 51 and 52 are refracted and diffused at the mouth plane and radiated therefrom as spherical waves due to the difference in apparent velocity between sound waves passing through the sound passages 51 and 52 . as already described , the horn speaker according to this invention has remarkably improved directional characteristics and is lowered in threshold frequency for low - frequency reproduction and can therefore be made compact . with the planar mouth surface , the speaker is easy to mount in a speaker box and saves the space for installation . the horn speakers as shown in fig4 and 5 are thus adapted for improved directional characteristics by dividing the sound passage with partition walls . consequently , where a small number of partition walls are used , the frequency characteristics obtained have the drawback that the sound pressure will be markedly attenuated at a specific frequency . more specifically , if a small number of partition walls are used , there arises a need to increase the difference between the lengths of divided passages to widen the directivity , such that the difference in length between the passages changes greatly stepwise . as a result , depending on the wavelength , a sound wave from one divided sound passage will offset , by means of the difference in passage length at the mouth plane , a sound wave from another passage with a reverse phase , causing abrupt attenuation of sound pressure . the attenuation of sound pressure at a specified frequency may be remedied by increasing the number of partition walls to reduce the difference in the length per passage and to thereby eliminate a sound wave of reverse phase , but this makes the speaker complex in construction and cumbersome to assemble and require a greater number of parts , resulting in a cost increase . fig8 and 13 show embodiments intended to overcome these drawbacks . the horn speaker shown in fig8 an improvement of the embodiment shown in fig4 does not employ a partition wall such as already described but is so designed that the effective length of passage is varied continuously with the interior shape of the horn defined by its side walls . fig9 shows the horn speaker of fig8 in longitudinal sections taken along the lines extending in the axial direction and dividing the distance between the principal axis of the horn and its side wall in definite proportions . the section along the arrow a is close to the principal axis , the section along the arrow b shows an intermediate portion and the section along the arrow c is proximate to the side wall . put in greater detail , the section ( a ) in fig9 taken along the arrow a shows a sound passage defined by upper and lower walls 91 and 92 . an effective centerline 93a extending midway between the upper and lower walls 91 and 92 is a gently curved line resembling a straight line . the section ( b ) of fig9 taken along the arrow b shows the sound passage curved by the upper and lower walls 91 and 92 , so that the effective centerline 93b is much more curved than the effective centerline 93a shown in fig9 ( a ). the length of effective centerline ( 93b ), namely the effective length of the passage , is therefore greater than that of fig9 ( a ). fig9 ( c ), the section along the arrow c , shows the upper and lower walls 91 and 92 as curved to a still greater extent to provide a passage having further greater effective length . thus , respective portions of the sound passage , as illustrated respectively in fig9 ( a )- 9 ( c ), define respective virtual sound passages of different lengths . stated differently , portions of a single sound passage cause some sound to travel a greater distance than sound travels in other portions . the views in fig1 are in cross section taken along the lines a &# 39 ;, b &# 39 ; and c &# 39 ; in fig8 . fig1 ( a ), a section a &# 39 ; relatively close to the mouth plane , shows the sound passage defined by the right and left side walls 94 and 95 and upper and lower walls 91 and 92 , the passage being symmetrical on the right and left . fig1 ( b ) shows a section b &# 39 ; at the approximate midportion of the principal horn axis where the upper and lower walls 91 and 92 are maximum in curvature . fig1 ( c ) shows a section c &# 39 ; proximate to the throat where the upper and lower walls 91 and 92 are reduced in curvature . to sum up , the curvature ( orthogonal to the principal horn axis ) of the upper and lower walls 91 and 92 which are straight at the mouth progressively increases to a maximum at the approximate midportion of the principal horn axis ( as shown in fig1 ( c ) and then reduces toward the throat , where the walls 91 , 92 again become straight in section . in other words , the side walls include the first portions 94 and 95 which are oriented in the direction of the aforesaid first straight directional line and curved along the principal horn axis , the side walls also including the second portions 91 and 92 which are oriented in the direction of a second straight directional line contained in the mouth plane and intersecting the first straight directional line at right angles . the second portions further are curved along the principal horn axis and along the first straight directional line as well . briefly , the second side wall portions 91 and 92 are curved so that as the distance between a point within the mouth plane and the aforementioned intersection increases , the length of a passage for propagating a sound wave from the diaphragm to the mouth plane will also increase . it will be apparent from the above that with the horn speaker shown in fig8 the shape of the sound passage is ingeniously altered to thereby vary the effective length of sound passage . in fact , the horn speaker achieves the same effect as is produced by dividing the sound passage into an infinite number of divisions and exhibits satisfactory directional characteristics and frequency characteristics . fig1 shows the actually measured values of directional characteristics of this speaker as indicated at 111 , whilst designated at 112 therein is a curve representing the directional characteristics of a conventional horn speaker . further fig1 shows frequency characteristics of this speaker as indicated at 121 , wherein those of a conventional speaker are designated at 122 . fig1 shows an improvement of the horn speaker of fig5 . according to this improved embodiment , the sound passage is divided into divisions 134 , 135 and 136 by two cylindrical partition walls 131 and 132 having a central axis substantially in coincidence with the principal horn axis . as seen in fig1 , the partition walls 131 and 132 are formed with bulging portions continuously varying in thickness in the direction of the principal horn axis and also in the circumferential direction . with reference to fig1 showing the horn speaker of fig1 in longitudinal section containing the principal horn axis , fig1 ( a ) a section a - o - o &# 39 ;- a &# 39 ; of fig1 , fig1 ( b ) is a section b - o - o &# 39 ;- b &# 39 ; of the same and fig1 ( c ) is a section c - o - o &# 39 ;- c &# 39 ; of the same . although the first sound passage 134 is uniform in any of the sections 134a , 134b and 134c , the annular second divided sound passage 135 positioned around the first sound passage 134 has varying lengths as at 135a , 135b and 135c , namely a minimum at 135a which progressively increases toward 135b and reaches a maximum at 135c . further the other second vidided sound passage 136 has a maximum length at 136a , which progressively reduces toward 136b and decreases to a minimum at 136c . although these divided sound passages are distorted , their sectional areas of course change at a constant rate from the throat to the plane of mouth along the principal horn axis . fig1 shows quartered cross sections in parallel to the mouth plane . fig1 ( a ) is a section relatively close to the mouth plane , fig1 ( b ) is that of midportion and fig1 ( c ) is that relatively close to the throat . it will be apparent from fig1 that when seen in cross section in parallel to the mouth plane , the first divided sound passage 134 is generally circular , whereas the annular second sound passages 135 and 136 are wavy and undulating . the waveshapes of both the second divided sound passages 135 and 136 need not necessarily be uniform in period and in the levels of ridges and furrows , but the point where the sound passage 135 has a maximum length and the point where the sound passage 136 has a minimum length are positioned on the same radial line . with reference to fig1 ( a ), for example , the ridge of the sound passage 135a &# 39 ; and the furrow of the sound passage 136a &# 39 ; are positioned on the line o &# 34 ;-- o &# 34 ; passing through the center . the difference in length between the sound passage 134 and sound passage 135 is minimum on the line o &# 34 ;-- o &# 34 ; o and increases circumferentially toward the line o &# 34 ;-- d &# 34 ; or o &# 34 ;- f &# 34 ;, where it is maximum . further in the circumferential direction , the difference reduces progressively . likewise , the difference in length between the sound passage 135 and the sound passage 136 is minimum on the line o &# 34 ;-- o &# 34 ; or o &# 34 ;- f and maximum on the line o &# 34 ;- a &# 34 ; or o &# 34 ;- d &# 34 ;. between these lines , the difference varies continuously . if the sound passages 134 and 135 are made as equal as possible in length on the line o &# 34 ;- a2 , the difference in passage length can be varied continuously from zero . similarly , if the sound passages 135 and 136 are made as equal as possible on the line o &# 34 ;- c &# 34 ; or o &# 34 ;- f &# 34 ;, the difference in passage length can be varied continuously from zero . as already described , the wavy undulation of the sound passage in the circumferential direction need not be periodically regular but may alter from place to place circumferentially . furthermore the ridge and furrow levels need not be constant . however , the position where one sound passage has a maximum length must radially coincides with the position where the adjacent sound passage has a minimum length . the period of wavelike undulation way preferably be short to obtain effective results . moreover , the greater the number of partition walls , the better will be the resulting directional characteristics and frequency characteristics . as already described , the two second divided sound passages 135 and 136 are wavy and undulating , with the difference in passage lengths varying continuously with the circumferential deviation of the first divided sound passage 134 , with the result that the phase deviation resulting from the difference in passage length will be distributed continuously , starting with zero . the factor leading to reversion of phase is little , if any , ( i . e . at f in fig1 ). since the overall sound level is given in terms of integrated value of the curve , attenuation of sound pressure hardly takes place . with reference to fig1 showing frequency characteristics , those of the horn speaker of fig1 are indicated in solid lines , while indicated in dot lines are the characteristics of a speaker having the same number of divided passages but the partition walls are not provided with undulations . the frequency characteristics in fig1 ( a ) are determined at a directional angle of zero , fig1 ( b ) showing those at a point deviated by 30 ° from the center and fig1 ( c ) those at a point with deviation of 45 °. comparison between the two indicates that the attenuation of sound pressure is eliminated at around 7 , 000 hz , 13 , 000 hz and 17 , 000 to give flat frequency characteristics . with the horn speaker illustrated in fig1 , the attenuation of sound pressure can be eliminated , and a greater effect will be achieved with the increase in the number of annular second divided sound passages . however , the making of the wavy partition walls required is no easy job and may entail a cost increase . this has been overcome with the embodiment shown in fig1 in which a cylindrical partition wall that can be produced more easily is used to achieve the same effectiveness as will be attained by the horn speaker illustrated in fig1 . with reference to fig1 , the sound passage is divided into three divisions 191 , 192 and 193 by two cylindrical partition walls 194 and 195 having a central axis coinciding with the principal horn axis . when seen in cross section in parallel to the plane of mouth , the first divided sound passage 191 including the principal horn axis is generally circular and the second divided sound passages 192 and 193 are annular . the partition wall 195 is formed with a plurality of penetrating bores 197 at desired positions along a circumference centered about the principal horn axis . accordingly , the sound wave travelling through the outer second divided sound passage 193 partly enters the second divided sound passage 192 through the bores 197 , whereupon the wave joins with the sound wave travelling through the inner second divided sound passage 193 . at this time , the sound wave travelling inward from the outer second divided sound passage 193 through the bore 197 has passed a greater distance than the sound wave which has reached the bore 197 through the inner second divided sound passage 192 and is therefore delayed in phase . as a result , the phase of the sound wave combined from those travelling through the second divided sound passages 192 and 193 lags behind the phase of sound wave in the inner second divided sound passage 192 but is ahead of the phase of sound wave travelling through the outer second divided sound passage 193 . thus within the inner sound passage 192 , the phase of sound wave travelling through the position of the bore 197 lags behind the phase of sound wave travelling through a position where the bore 197 is not formed . in the plane of the mouth , the sound waves exhibit a phase distribution as illustrated in fig2 . the phase 191 &# 39 ; of the sound wave from the first divided sound passage 191 is uniform along the circumference of the horn and is indicated as 0 °. the delay of phase involved in the inner second divided sound passage 192 due to the difference in passage length is designated at φ °, and the delay of phase of the combined sound wave at the bore 197 , at φ ° + φ °. designated at 192 &# 39 ; in fig2 is the phase distribution given by the sound waves from the inner second sound passage 192 and first sound passage 191 in the mouth plane at the sound passage 192 . put in detail , the sound wave has a phase value of φ ° + φ &# 39 ;° at a point on the mouth plane which point is positioned on the same radial line as the bore 197 when seen in fig2 , whereas the sound wave has a phase value of φ ° at another point on the mouth plane which point is not positioned on the radial line on which the bore 197 is located . in effect , the sound wave emerging from the bore 197 is diffused as it travels forward through the sound passage , with the result that a wavy undulating phase is obtained which continuously alters between φ ° + φ &# 39 ;° and φ °. the slope of the undulation alters with the position and size of the bore 197 and the degree of diffusion of the sound wave . indicated at 193 &# 39 ; in fig2 is a phase distribution in the mouth plane at the outer second divided sound passage 193 which is likewise produced by the sound wave travelling from the inner second sound passage 192 , through the penetrating bores 197 into the outer sound passage 193 and then passing therethrough . thus with the provision of the penetrating bores 197 in the partition wall 195 , it becomes possible to generate souund waves continuously varying in phase along a circumference within the same divided sound passage to give continuous distribution of phase difference , as seen in fig2 , in which reversion of phase , if any ( as at f in fig2 ), will hardly cause attenuation of sound pressure as a whole . despite the easiness of production owing to the use of a cylindrical partition wall , the same effectiveness is expected as will be attained by the horn speaker illustrated in fig1 . with reference to fig2 showing the frequency characteristics as actually measured , the characteristics of this speaker is indicated at 211 , while designated at 212 is those of a horn speaker having the same dimensions but no penetrating bores . apparently , the drawing reveals that the abrupt attenuation of sound pressure at about 7 , 000 hz has been eliminated , hence flat overall characteristics . although the penetrating bores 197 are formed only in the partition wall 194 to achieve similar effects . further the number of the partition walls may suitably be increased , in which case improved directional characteristics and low - frequency characteristics can of course be available . furthermore , although the position of the planar mouth surface has been illustrated and described in the foregoing description in its preferred embodiment as substantially in parallel to the inlet face of the horn , it will be understood that a slight deviation in the position of said surface is allowed .	6
fig1 shows a refrigerant circuit 1 having a compressor 2 which is connected to a condenser 3 . the condenser 3 is connected to an evaporator 5 by way of an expansion valve 4 . the evaporator is connected to the compressor by way of a pressure regulating valve 6 , which is in this case in the form of a suction pressure regulating valve . such a construction of a refrigerant circuit is known . the compressor 2 sucks up refrigerant from the evaporator 5 and compresses it , in the process of which the temperature of the refrigerant rises . the compressed refrigerant is cooled in the condenser 3 and thereby liquefied . the liquefied refrigerant is fed by way of the expansion valve 4 into the evaporator 5 , where some of it is already in gaseous form . in the evaporator 5 the liquid refrigerant evaporates as it absorbs heat , it being possible for the vapour also to absorb additional heat . that vapour is then called superheated vapour . the pressure regulating valve 6 is regulated by a control unit ( not shown in greater detail ), using the temperature in a region to be cooled by the evaporator 5 , optionally also in dependence on the evaporation pressure . where possible , the pressure regulation in the evaporator 5 is effected in such a manner that the evaporation temperature is close to the desired value of the temperature in the region to be cooled so that the cooling required to retain that desired value is already being maintained . the pressure regulating valve has the task , inter alia , of rendering the pressure in the evaporator 5 independent of the suction pressure of the compressor 2 . the pressure regulating valve 6 is shown in greater detail in fig2 and 3 . the pressure regulating valve 6 has a tubular housing 7 that has an inlet 8 and an outlet 9 , branching off at right angles thereto , for the refrigerant ( not shown in greater detail ). arranged in the housing 7 is a slider member 10 , which is held there by a guide 11 , which is connected to the housing 7 by way of a soldered joint 12 . the guide 11 is located on the upper side of the outlet 9 , that is to say on the side of the outlet 9 remote from the inlet 8 . arranged below the outlet 9 , that is to say on the side of the outlet 9 facing the inlet 8 , is an auxiliary guide 13 , which also guides the slider member 10 . the auxiliary guide 13 can be held in the housing 7 by means of a bead ( not shown in greater detail ). it can also be held in the housing 7 in a different manner by form fit or interlocking fit . the connection between the housing 7 and the auxiliary guide 13 should be impermeable to gas . arranged between the auxiliary guide 13 and the slider member 10 is a seal 14 , so that there is a gas - impermeable closure in the region of the auxiliary guide 13 . the slider member 10 is in the form of a beaker - shaped hollow cylinder that ( based on fig2 and 3 ) has at the bottom an open end face 15 and at the top a closed head 16 . arranged in the head 16 is a nut 17 , which co - operates with a threaded spindle 18 , which is in turn driven by a stepper motor 19 . the stepper motor 19 is held in the guide 11 , or more precisely in a continuation 20 of the guide 11 . the stepper motor 19 is the element that is able to effect a change in the opening of the pressure regulating valve 6 . it is therefore connected to the control device ( not shown in greater detail ). the stepper motor 19 is an incrementally operating drive device , that is to say it can only ever bring the slider member 10 into predetermined positions , although those positions are extremely closely adjacent to one another , for example of the order or magnitude of 1 / 200 mm . intermediate positions between those individual steps or increments are not , however , possible . the threaded spindle 18 projects through the head 16 and the nut 17 into the inner space 21 of the slider member 10 , which is surrounded by a wall 22 . the slider member 10 has in a middle region of its axial length a circumferential projection 23 , on which there rests a sealing ring 24 on the side facing the guide 11 . the sealing ring 24 is made of a resilient material , that is to say it is yielding to a certain extent , as will be explained below . the outer circumference of the slider member 10 decreases from the projection 23 towards the guide 11 , that is to say the slider member has a conical portion 25 that co - operates with a control edge on the guide 11 , which control edge is in the form of a sealing edge . the sealing edge 26 is located on the radial inside of a circumferential groove 27 on the end face 28 of the guide 11 ( see , for example , fig5 ). as can be seen especially in fig3 the slider member 10 has in the region of the head 16 two radial projections 29 , each of which is guided in an axially running groove 30 in the guide 11 . the guide 11 accordingly also secures the slider member 10 against rotation . the slider member 10 has an opening 31 in the wall 22 above the conical portion 25 . in the present case , the opening 31 is circular , but this is not imperative . other shapes of opening are also possible . refrigerant can flow past between the guide 11 and the slider member 10 in order to enter a chamber 32 above the slider member 10 . in that case , substantially the same refrigerant pressure acts upon the slider member from both directions of movement . if the corresponding faces on which the refrigerant pressure acts are also of the same size , then the slider member 10 is substantially balanced in every position , that is to say the forces that the stepper motor 19 must deliver are required solely to displace the slider member 10 and not to overcome external forces . the way in which the pressure regulating valve 6 functions will now be explained in greater detail in conjunction with fig4 to 7 . it should be said in advance that the conical portion 25 together with the sealing edge 26 form a valve that operates according to the needle valve principle , that is to say the edge 26 together with the wall of the conical portion 25 delimit a gap 33 which increases the greater the distance of the projection 23 from the end face 28 of the guide 11 . the size of the gap 33 can be controlled with very high precision . a different valve principle , the so - called cage valve principle , is achieved by the co - operation of the opening 31 with the inside of the guide 11 . the opening 31 is covered over to a greater or lesser extent by the inner wall of the guide 11 . the further the slider member 10 is moved down , the greater is the free cross - section of flow through the opening 11 . fig4 shows the pressure regulating valve , or more precisely a portion a from fig2 in the closed position . the sealing edge 26 is pressed into the sealing ring 24 . the sealing ring 24 is sufficiently yielding for the sealing edge 26 to be able to penetrate by a distance that corresponds at least to one increment of the stepper motor 19 or of the displacement produced by the transmission by the nut 17 and threaded spindle 18 . whilst gaseous refrigerant can then pass through the inner space 21 and the opening 31 into the chamber between the guide 11 and the slider member 10 , it cannot flow away to the outlet 9 because the path to the outlet is blocked by the sealing edge 26 that is resting on the sealing ring 24 . as has already been said , the sealing ring 24 must be made of a flexible material because the sealing edge 26 must be able to be pressed into the sealing ring 24 . in the case of a stepper motor drive , the slider member can be moved only to specific positions because the displacement of the slider member occurs in discrete steps . the result of this is that the sealing edge must be able to move into the sealing ring 24 . if that were not possible , the pressure regulating valve 6 might not be leakproof because the sealing edge 26 would not reach the sealing ring 24 . as already explained , fig5 shows a position of the slider member 10 relative to the guide 11 , in which a gap 33 has opened between the wall of the conical portion 25 and the sealing edge 26 . in that position it is possible to regulate the flow of refrigerant through the pressure regulating valve 6 with very high precision . in fig6 the pressure regulating valve has been opened further , that is to say the slider member 10 has been displaced further towards the inlet 8 . the displacement is sufficient for the opening 31 to be no longer completely covered by the guide 11 . there is also no longer any direct connection between the sealing edge 26 and the wall of the conical portion 25 . the refrigerant flow is dependent substantially only upon the extent to which the opening 31 has been exposed by the inside of the guide 11 . in fig7 the pressure regulating valve 6 has been opened completely , that is to say the opening 31 has been exposed fully so that refrigerant can flow unhindered from the inner space 21 through the opening 31 into the outlet 9 .	8
referring now to the drawings and initially to fig1 , there is shown an exemplary system 10 for conducting an e - commerce commercial transaction . the system 10 includes a user workstation 20 coupled with a merchant website 40 via a communications network 30 , such as the internet or other publicly accessible network . it will be appreciated that a particular user may connect to this network via a private network , such as an intranet . herein , the phrase “ coupled with ” is defined to mean directly connected to or indirectly connected through one or more intermediate components . such intermediate components may include both hardware and software based components . the user workstation may be a personal computer , personal digital assistant , cellular telephone , or any other suitable device capable of connecting to the communications network 30 . the merchant site 40 is an e - commerce website that offers a variety of products or services for sale . in one embodiment , the merchant site is coupled with a customer information database 50 and a product and service information database 60 . the customer information database 50 preferably stores information relating to users of the merchant site 40 . this information may include username and password information , address information , user status information , user credit information and the like . the product and service information database 60 preferably stores information relating to products and services offered for sale on the merchant site . such information may include stock keeping unit numbers ( sku &# 39 ; s ), pricing information , product and service descriptions , product usage information , quantity information , product and service classification information , product and service availability and the like . fig2 shows an exemplary logical architecture for a merchant site 40 in accordance with one embodiment . the merchant site 40 includes a plurality of tools designed to allow users to purchase one or more products or services being offered for sale through merchant site 40 . the exemplary site includes a user interface 110 , a status level tool 120 , a credit amount tool 130 , a purchase tool 140 , an approval tool 150 , a contract generation tool 150 , and a save contract tool 170 . the user interface 110 may be adapted to accept user input , such as a customer identifier or username , as well as order information and other user inputs via known user interface controls . the user interface 110 may be adapted to display products and services and other pieces of information , both in graphical and textual formats . moreover , the user interface 110 may be adapted to provide a communication link among the various other tools 120 - 170 . in one embodiment , the user interface 110 is implemented as one or more world wide web pages using dynamic or static hypertext markup language (“ html ”), extensible markup language (“ xml ”), application server pages , or combinations thereof as are known . the tools 120 - 170 may be implemented as graphic user interface elements of the user interface 110 , such as menus , dialog boxes , buttons , etc . or may themselves be implemented as one or more world wide web pages . further , the user interface 110 and tools 120 - 170 may be part of the merchant site 40 or offered as a service to the merchant site 40 via the network 30 by a third party . it will be further be appreciated that the functionality of one or more of the tools 120 - 170 may be combined into a single tool and that the provision of the described functionality is implementation dependent . the status level tool 120 is coupled with the user interface 110 and , in one embodiment , is adapted to determine a customer status level associated with a customer identifier , as described below . the credit amount tool 130 is also coupled with the user interface 110 and , in one embodiment , is adapted to determine a credit amount available to a customer . the credit amount may be based on the customer status level or other factors , as described below . the purchase tool 140 is coupled with the user interface 110 and , in one embodiment , is adapted to allow a user to purchase products or services through the site 40 . for example , the purchase tool 140 may collect order information , payment information , shipping information , and the like , secure the payment for any desired orders , complete an order and initiate the shipping process , as known . in one embodiment , the purchase tool 140 is adapted to allow users to purchase products or services with a credit amount provided by the merchant site 40 , as discussed below . the approval tool 150 is coupled with the user interface 110 and , in one embodiment , is adapted to verify credit information associated with a user , such as payment histories , history of credit fraud , credit ratings and the like , and determine whether to approve the purchase by credit of one or more products or services by a particular customer , as discussed below . the contract generation tool 160 is coupled with the user interface 110 and may be adapted to generate a contract binding a customer to repay a loan , as discussed below . in one embodiment , the contract may be generated in response to an approval from the approval tool 150 . the save contract tool 170 is coupled with the user interface 110 and may be adapted to save accepted contracts for future reference or display , as described below . in one embodiment , the save contract tool 170 may be adapted to provide electronic versions of previously saved contracts on request . referring to the figures , according to one embodiment a user , using the user workstation 20 , connects to the merchant website 40 via a communications network 30 , such as the internet . upon connecting to merchant site 40 , the user is presented with the user interface 110 , described above , and may log into the merchant site 40 by providing an identifier , such as a username and password uniquely identifying the user ( block 210 ). after logging into the merchant site 40 , the user may browse an electronic catalogue for products or services being offered for sale , as known in the art . the user may at any time select a product or service for purchase ( block 220 ). preferably , the merchant site 40 allows users to add items to a virtual “ shopping cart ”, as known in the art . the user may select a plurality of products or services for purchase , adding each item to the shopping cart , until the user has selected every product and / or service they wish to purchase . the user may then initiate a “ check out ” process whereby the order is finalized and payment information and shipping preferences are verified . optionally , the user may be provided with multiple shopping carts . according to an alternative embodiment , a user does not log into merchant site 40 until after the user initiates the “ check out ” process . the user then selects one or more products or services in the users “ shopping cart ” for which a financing payment option is available , and verifies their desire to purchase the selected products or services with financing ( block 230 ). if the user does not wish to purchase the selected products with financing , the user may alternatively proceed to a regular checkout ( block 235 ). in one embodiment , only products or services of a particular class are available for purchasing with financing . in alternate embodiments , financing payment options are available for all products and services . according to one embodiment , the user is provided with a “ financing ” shopping cart that only contains user selected items for which financing is available and desired . after the user has finished selecting products to be purchased with financing , the system analyzes customer credit information ( block 240 ), such as by using the status level , credit amount and approval tools 120 , 130 , 150 described above . if the current transaction is approved ( block 245 ), a contract is generated ( block 250 ), such as by using the contract generation tool 160 described above . if the current transaction is not approved ( block 245 ), the transaction may be canceled ( block 270 ). the system - generated financing contract may include the provisions necessary to create a binding financing contract . in one embodiment , the terms of the contract may be automatically varied to accommodate jurisdictional changes to comport with local law . for example , the terms may vary if the buyer is located in a particular geographical location . in one embodiment , the necessary information may include installment information , financing interest information , truth in lending disclosures , payment schedule information , an installment payment agreement , and the like . the installment information may include the total amount financed , finance charge information , an annual percentage rate , a total sale price for the products to be purchased and the like . the payment schedule may include monthly payment information , monthly principal and interest payments , payoff amount , and the like . the installment payment agreement may include provisions necessary to give legal affect to the contract . instructions regarding execution of the contract and additional information may also be included in the contract . regardless of the information included , each contract includes an accept button and a decline button . the user may electronically sign the contract and accept the terms therein by depressing the accept button . alternatively , the user may decline the financing offer by depressing the decline button . in alternative embodiments , other methods of accepting and declining may be implemented , such as by providing a digital or encrypted signature or other method recognized by the controlling jurisdiction as a legally binding signature . if the user accepts the contract ( block 255 ), the order is processed ( block 260 ). order processing may include verifying the contents of an order , product shipment information , and the like . invoice numbers for the processed order may also be provided . if the user declines to be bound by the contract ( block 255 ), the order may be canceled ( block 270 ). finally , the electronic contract is saved to the customer information database 50 ( block 280 ). in one embodiment , the stored contract is accessible by the user , such as via user profile maintenance features of the merchant web site 130 , described below in reference to fig1 . fig4 shows a flow chart of an exemplary customer approval process according to one embodiment . initially , customer status information is retrieved from customer information database 50 . in one embodiment , each customer may belong to predefined status levels . status levels may be determined based on any number of criteria , such as user &# 39 ; s purchase history , credit rating , length of time registered with merchant and the like . in one embodiment , each user belongs to a multi - level marketing program which categorizes users by fulfillment type and class . for example , each user may belong to either a standard fullfillment ( sf ) or a direct fulfillment ( df ) type . according to one embodiment , a sf multi - level marketing customer orders products from a product supplier for that multi - level marketing organization . those products are shipped from the product supplier to a third party , who then delivers the product to the customer . according to one embodiment , a df multi - level marketing customer orders products from a product supplier for that multi - level marketing organization . those products are shipped directly from the product supplier to the customer . exemplary classes include an associate independent business owner ( ibo ), 25 % sponsor , silver producer , or platinum level , indicating the customers position within the hierarchy of the multi - level marketing organization . as used herein , a 25 % sponsor is an ibo with a silver producer group downline . the credit amount tool 130 then determines a default pre - approved credit limit for the user based on the status level . for example , any user who has been registered for 90 days may have a credit limit of $ 700 . 00 , whereas a user that has been registered for 30 days may have a credit limit of $ 100 . 00 . according to an alternative embodiment , credit tool 130 determines a default pre - approved credit limit for the user based on the users fullfilment type or class within a multi - level marketing organization . after determining the default pre - approved credit limit , the credit amount tool 130 accesses a credit management file ( block 320 ). the credit management file includes information such as user id number , credit limit type ( such as a default or individual limit ), credit block flag , credit block reason code , net accounts receivable balance , the user &# 39 ; s credit score , the user &# 39 ; s individual credit limit ( if present ), or a flag for whether a past due invoice exists for the user . in one embodiment , a batch process is used to obtain the net accounts receivable balance from an account management system designed to track account receivable information for a user and insert that information into the credit management file . the credit management file may be accessible to a credit manager or other employees of the merchant site 40 , such as a credit department employee , for manually editing the information in the credit management file , such as entering a credit block or setting an individual credit level . in one embodiment , each user has an associated credit management file . in alternate embodiments , a single credit management file containing credit information for every user is maintained . once the credit management file has been accessed , the system determines whether the credit management file indicates a credit block ( block 322 ) for a particular user . if a credit block is indicated , the system denies the credit request ( block 324 ). after a denial , the user may be permitted to arrange for alternate payment means for completing the order . in one embodiment , the user is provided with a telephone number for contacting a customer service department to discuss alternate payment / credit options . optionally , the credit management file may indicate a manual override ( block 326 ) indicating an individual credit limit for the particular user . if such an override exists , the system will use the custom credit limit ( block 328 ) in place of the previously determined default limit . once a credit limit for the user has been determined , the system accesses a payments file ( block 330 ). the payments file may include information pertaining to the users outstanding orders , delivered orders , or back orders , which the user financed . in one embodiment , an associated payments file is maintained for each user . in alternate embodiments , a single payments file includes order information for a plurality of users . if outstanding credit orders exist ( block 332 ), the total amount of the outstanding credit is subtracted from the determined credit limit to determine an available line of credit ( block 334 ). finally , the current order total is compared with the user &# 39 ; s available line of credit . if the user &# 39 ; s available line of credit is greater than or equal to the current order total , the transaction will be approved . if the user &# 39 ; s available line of credit is less than the current order total , the transaction may be denied , or the user may be directed to call a customer service department to discuss alternate payment options . alternatively , the system may apply the user &# 39 ; s available line of credit to the current order total and allow the user to arrange for alternate payment means to cover any deficiency . an exemplary transaction is shown in fig5 - 13 . fig5 shows an exemplary product display screen 400 . the product display screen 400 displays a variety of products 410 for which financing is available . controls 412 may also be provided to allow the user to enter the desired quantity for any of the available products 410 . in one embodiment , the product display screen is implemented as one or more web pages . it will be appreciated that the design of the product display screen 400 is implementation dependent and that multiple product display screens 400 may be provided to implement the disclosed functionality or display information about one or more products or services . once products and product quantities are selected , the user may select to purchase the products with financing by selecting the ‘ purchase with 6 payments ’ button 420 . alternatively , the user may select the ‘ purchase with 1 payment ’ button 430 to purchase the products . in alternative embodiments , other payment plans may be provided . for example , the merchant may allow the user to specify the number of payments to be made . the user may select to not purchase any products by selecting the ‘ no thanks ’ button 440 . as discussed above , a financing shopping cart may be provided for products that are eligible for purchasing with financing . the user may view the contents of the financing shopping cart by selecting the ‘ view financing cart ’ button 450 . the user may elect to view the pre - approved credit limits by selecting the ‘ view pre - approved limits ’ button 460 . fig6 shows a screen shot of an exemplary pre - approved financing chart 500 . in one embodiment , the pre - approved financing chart 500 is implemented as one or more web pages . the chart 500 includes a list of user status levels 510 and the credit limits 520 corresponding to the various status levels 510 . in one embodiment , the user status levels correspond to status levels of a multilevel marking organization . optionally , additional information 530 relating to the credit limits may be provided . the user may return to the product display screen 400 by selecting the ‘ back ’ link 540 or the ‘ back ’ button provided by the web browser . returning to fig5 , the user may elect to view a sample financing contract by selecting the appropriate link 450 . a screen shot of an exemplary sample financing contract 600 is shown in fig7 . in one embodiment , the sample financing contract 600 is implemented as one or more web pages . as discussed above , the system - generated financing contract may include the provisions necessary to create a binding financing contract . an exemplary financing contract is a truth in lending statement . as used herein , a “ truth in lending statement ” is any statement comporting , at least in part , with the truth in lending act of 1968 ( 15 u . s . c . § 1601 et seq .). as shown in fig7 , the financing contract may include installment information 610 . the installment information 610 can include an amount financed for the current transaction , finance charge information , annual percentage rate information , and a total sale price comprising the total amount the user will pay after making all scheduled payments . in a sample financing contract , this information may be blank or omitted . payment schedule information 620 may also be included in a sample financing contract 600 . the payment schedule information 620 may set forth amounts for each payment under the terms of the contract . it will be appreciated that any suitable payment schedule may be displayed . in one embodiment , the sale price of the selected products may be paid in six equal installments , with any tax and service charges , such as a delivery charge , added to the initial payment . alternatively , the tax and service charges may be apportioned over the life of the contract . according to alternative embodiments , the sales price may be paid according to any number of installments defined by the merchant , or according to any number of installments defined by the user . installment payment agreement information 630 may also be included in the sample financing contract 600 . the installment payment agreement may include the provisions necessary to create a binding financing agreement . exemplary provisions may include provisions for authorizing credit card charges , provisions for maintaining a given credit card account , provisions for certifying credit card account ownership , provisions for granting permission to obtain an independent credit report or similar credit check provisions , and acceleration provisions . additional notices to the user 640 may also be provided in the sample financing contract . exemplary additional notices 640 include notices that explain how to electronically sign the contract , or user rights and obligations . the user may return to the product display screen 400 by selecting the link 640 or the ‘ back ’ button provided by the web browser . returning to fig5 , the user may initiate a financing purchase by selecting the ‘ purchase with 6 payments ’ button 420 . in one embodiment , selection of the ‘ purchase with 6 payments ’ button 420 will add the selected products 410 to the financing shopping cart and display the updated contents of the cart to the user . fig8 shows a screen shot of an exemplary financing shopping cart display screen 700 . in one embodiment , the financing shopping cart display screen 700 is implemented as one or more web pages . the financing shopping cart display screen 700 may include shipping information 710 and product information 720 . the shipping information 710 may establish a destination address for the order . controls may also be provided to allow the user to edit the currently designated shipping destination . the product information 720 may include quantities , product types , case quantities , retail value , item cost , delivery estimates , product descriptions and product numbers or skus . reward program incentives may also be provided for each product 710 . controls may also be provided to allow a user to edit the contents of a shopping cart . for example , the user may be allowed to add products to the cart , edit product quantities for items in the cart , and remove items from the cart . totals 730 may also be provided for the total cost of the order and the like . the user may go to the order preview screen by selecting the ‘ to step 2 ’ button 740 as described below . upon selection of the ‘ to step 2 ’ button 740 , the user may be presented with an order preview screen . an exemplary order preview screen 800 is shown in fig9 . in one embodiment , the order preview screen 800 is implemented as one or more web pages . shipping information 810 may be provided , and , as discussed above , controls may be provided to allow the user to edit the shipping information 810 . pricing information 820 may also be provided . typical pricing information includes total cost , tax , delivery and handling charges and the like . the user may also select from available delivery options 830 . the delivery options 830 may include standard shipping , ground express , premium shipping , such as 2nd business day shipping , and the like . the user may update the pricing information 820 to reflect a change in the shipping information 830 by selecting the ‘ update delivery options ’ button 835 . as all shipping options 830 may not necessarily be available for each product , the availability of shipping options 830 may be dynamically adjusted based on the products of a given order . in a similar manner the prices associated with each shipping option 830 may be altered dynamically to reflect shipping costs for the items of a given order . additionally , controls may be added to allow the user to return to the shopping cart 815 to edit an order or to create a receipt for the current order 825 . optionally , order details 860 may be provided to allow the user to review the contents of an order . controls to collect payment information 840 may also be provided on the order preview screen 800 . payment information 840 may include the information necessary to pay for an order . typically , a credit card is used to purchase e - commerce goods . the exemplary order preview screen 800 provides controls to acquire a credit card number , a cardholder name , a credit card type , and an expiration date . other information may be collected to secure payment of the order , as known in the art , such as a checking account number and the like . once payment information 840 is provided , the user may select the ‘ purchase ’ button 850 to complete the order . after selecting the ‘ purchase ’ button 850 , the user is presented with a finance contract . an exemplary finance contract 900 is shown in fig1 . in one embodiment , the finance contract 900 is implemented as one or more web pages . the contract contains the same provisions as the sample financing contract of fig7 , however , payment amounts are provided to reflect the current order . the financing contract 900 may include the amount financed 910 , an applicable finance charge and the corresponding annual percentage rate , and a total sale price 920 . as discussed above , the financing contract 900 may also include a payment schedule . in one embodiment , the sale price of the selected products may be paid in six equal installments , with any tax and service charges , such as a delivery charge , added to the initial payment . accordingly , the first payment amount 930 and subsequent payment amounts 940 may be provided in the financing contract 900 . the user may electronically sign the financing contract by selecting the ‘ accept ’ button 950 . upon acceptance , the order can be finalized and the contract can be saved for future reference . in one embodiment , accepted contracts are saved in a profile associated with the user . alternatively , the user may decline the offer by selecting the ‘ decline ’ button 960 . the order may be deleted if the user declines the offer , or the user may be provided with the alternative payment options for the products or services in the financing shopping cart . for example , the user may be provided to pay for the products and services in the financing shopping cart using a credit card , money order , bank draft , or other payment options . after the user accepts the financing contract and the order is finalized , an order confirmation screen 1000 may be provided , as shown in fig1 . in one embodiment , the order confirmation screen 1000 is implemented as one or more web pages . the order confirmation screen 1000 may include an invoice number 1010 for the finalized order . additionally , the order confirmation screen 1000 may include shipping information 1020 , pricing information 1030 and order detail information 1040 , as described above . optionally , the user may access previously accepted contracts via user profile maintenance tools . an exemplary user profile maintenance tool screen 1100 is shown in fig1 . in one embodiment , the user profile maintenance tool screen 1100 is implemented as one or more web pages . the user may be provided with various options 1110 to edit his / her profile . exemplary profile maintenance options include changing a password , editing a list of credit cards associated with the user , editing general account information , customizing login functions , and viewing accepted financing contracts . the user may select the ‘ view free financing contracts ’ option 1112 from the list of options 1110 . in response , a list of previously accepted financing contracts may be provided . each item in the list may include an identifier that identifies the type of financing contract the user accepted and a date for when the contract was accepted . the previously accepted contract 1120 may be displayed upon selection of the corresponding item in the list . if no contracts have been previously accepted by the user , a message indicating that no accepted contracts exist may be provided . while the invention has been described in conjunction with specific embodiments it is to be understood that many alternatives , modifications , and variations will be apparent to those skilled in the art in light of the foregoing detailed description . it is therefore intended that the foregoing description be regarded as illustrative rather than limiting , and that it be understood that it is the following claims , including all equivalents , that are intended to define the spirit and scope of this invention .	6
the ethylene feed is preferably as high a purity as possible and generally contains 5 to 99 . 9 % ethylene with the balance being alkanes such as ethane , propane , butane and the like which are inerts in this process . the presence of other olefins in materials may be substantially detrimental to the production of high purity ethyl benzene if that is required . preferably the ethylene feed to the alkylation reactor will contain less than 1 . 5 % other olefinic material . however , operating the reaction with far less than a stoichiometric amount of olefin in the reaction zone , as described , will normally keep the olefin level in the bottoms low or entirely eliminated . there may be some olefin going overhead even with the large molar excess of the organic aromatic compound present in the reaction zone . in those instances the overhead may be condensed to remove a major portion of the organic aromatic compound and the olefin and inerts removed for further separation or use . similarly inerts such as the alkane of the particular olefin ( s ) which are often found in olefin streams will be a possible contaminant . the mole ratio of organic aromatic compound to olefin in the reactor may be in the range of 2 to 100 : 1 , preferably 2 to 50 : 1 and more desirably about 2 to 10 : 1 . the greater the excess of organic aromatic compound the more the selectivity to the monosubstituted product is improved . alkylation is forced to completion , since the simultaneous and concurrent fractionation and removal of the alkylation product from the distillation column reactor does not allow the products to contribute to the reverse reaction ( le chatelier &# 39 ; s principle ). however , very large molar excesses of organic aromatic compounds require a very high reflux ratio , and a low unit productivity . the length of the catalyst bed , particularly that portion wherein the reactants are in contact and the major portion of the reaction occurs , depends on the reactants , location of the olefin feed and the acceptable unreacted olefin in the streams leaving the tower . the present alkylation reaction can be carried out at sub - through super atmospheric pressure , e . g ., 0 . 20 to 50 atmospheres . the temperature will vary depending on the reactants and product . furthermore , the temperature along the column will be as in any distillation column , the highest temperature will be in the bottom and the temperature along the column will be the boiling point of the composition at that point in the column under the particular conditions of pressure . moreover , the exothermic heat of reaction does not change the temperature in the column , but merely causes more boil up . however , the temperatures within the column with the above considerations in mind will generally be in the range of 50 ° c ., e . g . 50 ° c . to 300 ° c . and more preferably in the range of about 80 ° c . to 250 ° c . at pressures of 0 . 5 to 30 atmospheres . molecular sieves are porous crystalline , three - dimensional alumina - silicates of the zeolite mineral group . the crystal skeleton is composed of silicon and aluminum atoms each surrounded by four oxygen atoms to form a small pyramid or tetrahedron ( tetrahedral coordination ). the term molecular sieve can be applied to both naturally occurring zeolites and synthetic zeolites . naturally occurring zeolites have irregular pore size and are not generally considered as equivalent to synthetic zeolites . in the present invention , however , naturally occurring zeolites are acceptable so long as they are substantially pure . the balance of the present discussion shall be directed to the synthetic zeolites with the understanding that natural zeolites are considered equivalent thereto as indicated above , i . e ., in so far as the natural zeolites are the functional equivalents to the synthetic zeolites . usually synthetic zeolites are prepared in the sodium form , that is , with a sodium cation in close proximity to each aluminum tetrahedron and balancing its charge . to date seven principal types of molecular sieves have been reported , a , x , y , l , erionite , omega and mordenite . the a type have relative small pore size . by the term pore size is meant the effective pore size ( diameter ) rather than the free pore size ( diameter ). types x and y have larger pore size ( approximately 10 a .) and differ as to the range of ratio of al 2 o 3 to sio 2 as : type l and other types listed above have still higher ratios of sio 2 to al 2 o 3 the mole sieve catalysts employed in the present invention are the acid form mole sieves or exhibit acidic characteristics . the acid form of the mole sieves is commercially available , but also may be prepared by treating the mole sieves with acid to exchange na for hydrogen . another method to produce the acid form is to treat the mole sieve with decomposable cations ( generally ammonium ions ) to replace na with the decomposable ions and thereafter to heat the mole sieve to decompose the cation , leaving the acid form . generally the na form mole sieve is treated with soluble ammonium salts to remove the na and thereafter the mole sieve is heated to a temperature of about 350 ° c . to remove of the ammonia . the removal of na + ions with nh + 4 is more easily carried out than with multivalent ions as described below and these catalysts are generally more active , but less stable to heat than the multivalent cation exchange forms . mole sieves , which have had their alkali metal reduced to low levels by partial treatment with nh + 4 and partial multivalent metal cation exchange , possess increased activity and increased stability . in addition to mole sieves which are acidic according to the bronsted theory those mole sieves which exhibit acidic characteristics under the lewis theory , for example , calcium exchanged mole sieves are suitable for the present reaction . by exchanging the univalent cations ( e . g . na + ) with multivalent cation , strong ionic activity is imparted . the ratio of sio 2 : al 2 o 3 , valence and radius of the cation and the extent of exchange all affect the catalyst activity . in general activity increases with ( 1 ) increased sio 2 al 2 o 3 ratio , ( 2 ) decreased cation radius and an increase in cation valence . the effect of replacing univalent ions ( e . g . na + ) with bivalent ( e . g . ca ++ ) is much greater than replacing the bivalent ions with cations of greater valence . the various types of mole sieves having reduced alkali metal content are characterized as the acid form molecular sieve and are all contemplated as useful in the present invention . it would appear that the pore size within the crystal lattice may affect the selectivity . according to one theory of molecular sieve catalytic activity , zeolite catalysis occurs primarily inside the uniform crystal cavities , consequently zeolitic catalyst activity depends on the number of aluminum atoms in the crystal and thus on the chemical composition of the crystal . moreover , these catalytic sites are fixed within the rigid structure of the crystal , so that access to the site can be altered by altering the structure of the crystal . the acid form mole sieves are generally produced and available as particles in the range of & lt ; 10 micron ( powders ) to 0 . 2 inch in diameter ( beads ). in this form the mole sieves form too compact a bed and will not function adequately in a distillation , since there is a very large pressure drop through the bed and the free flow of internal reflux and rising vapor is impeded . mole sieves in the shape of conventional distillation structures , such as rings , saddles , and the like may be used in the present invention . the particulate mole sieves may be employed by enclosing them in a porous container such as cloth , screen wire or polymeric mesh . the material used to make the container must be inert to the reactants and conditions in the reaction system . the cloth may be any material which meets this requirement such as cotton , fiber glass , polyester , nylon and the like . the screen wire may be aluminum , steel , stainless steel and the like . the polymer mesh may be nylon , teflon or the like . the mesh or threads per inch of the material used to make the container is such that the catalyst is retained therein and will not pass through the openings in the material . particles of about 0 . 15 mm size or powders may be used and particles up to about 1 / 4 inch diameter may be employed in the containers . the container employed to hold the catalyst particles may have any configuration , such as the pockets disclosed in the commonly assigned patents above or the container may be a single cylinder , sphere , doughnut , cube , tube or the like . each container containing a solid catalytic material comprises a catalyst component . each catalyst component is intimately associated with a spacing component which is comprised of at least 70 volume % open space up to about 95 volume % open space . this component may be rigid or resilient or a combination thereof . the combination of catalyst component and spacing component form the catalytic distillation structure . the total volume of open space for the catalytic distillation structure should be at least 10 volume % and preferably at least 20 volume % up to about 65 volume %. thus desirably the spacing component or material should comprise about 30 volume % of the catalytic distillation structure , preferably about 30 volume % to 70 volume %. resilient materials are preferred . one suitable such material is open mesh knitted stainless wire , known generally as demister wire or an expanded aluminum . other resilient components may be similar open mesh knitted polymeric filaments of nylon , teflon and the like . other materials such as highly open structures foamed material , e . g ., reticulated polyurethane foam ( rigid or resilient ) may be formed in place or applied around the catalyst component . in the case of larger catalyst components such as from about 1 / 4 inch to 1 / 2 pellets , spheres , pills and the like each such larger component may be individually intimately associated with or surrounded by the spacing component as described above . it is not essential that the spacing component , entirely cover the catalyst component . it is only necessary that the spacing component intimately associated with the catalyst component will act to space the various catalyst components away from one another as described above . thus , the spacing component provides in effect a matrix of substantially open space in which the catalyst components are randomly but substantially evenly distributed . a preferred catalytic distillation structure for use herein comprises placing the mole sieve particles into a plurality of pockets in a cloth belt , which is supported in the distillation column reactor by open mesh knitted stainless steel wire by twisting the two together in a helical form . this allows the requisite flows and prevents loss of catalysts . the cloth may be any material which is inert in the reaction . cotton or linen are useful , but fiber glass cloth or &# 34 ; teflon &# 34 ; cloth are preferred . in the following examples the catalyst packing consisted of bags in the form of a fiber glass cloth belt approximately six inches wide with narrow pockets approximately 3 / 4 inch wide sewn across the belt . the pockets are spaced about 1 / 4 inch apart . these pockets are filled with the catalyst particles to form approximately cylindrical containers , and the open ends are then sewn closed to confine the particles . this belt is then twisted into a helical form to fit inside the column . twisted in with the belt is also a strip of an open mesh knitted stainless steel wire , which serves to separate the mole sieve filled cloth pockets and provide a passage for vapor flow . the wire mesh provides the support for the catalyst ( belt ) and provides some degree of vapor passage through the catalyst particles , which otherwise form a very compact bed which has a high pressure drop . thus , the down flowing liquid is in intimate contact with the rising vapors in the column . in commercial - scale operations , it is contemplated , catalyst packing would be made up of alternating layers of mole sieve filled cloth belts similar to the ones described above , and a spacing material which could be of any convenient , suitable substance , such as a corrugated wire screen or wire cloth or a knitted wire mesh . the layers would be arranged vertically or horizontally . for simplicity of fabrication and for better distribution of vapor flow passages , a vertical orientation is preferred . the height of a section of this packing should be of any convenient dimension , from a few inches to several feet . for ease of assembly and installation , the packing would be made into sections of the desired shape and size , each section fastened together with circumferential bands of tie wires depending on its size and shape . a complete assembly in a column would consist of several sections , arranged in layers , with possibly the orientation of the catalyst - filled belts turned at right angles in successive layers to improve liquid and vapor flow distribution . fig1 illustrates one embodiment of the present invention , for the production of ethyl benzene by alkylating benzene with ethylene . referring to the drawing , distillation column / reactor 10 is divided into three sections . in the middle section the catalyst packing ( catalytic distillation structures ) 12 is positioned as described . linde molecular sieve lz - y82 1 / 16 &# 34 ; ( union carbide corp .) is deposited in the pockets of fiber glass belts and formed in to a helix with stainless steel mesh as described . the reactor 10 is a four inch diameter pilot column 70 feet tall with 35 feet of the catalyst packing in the middle portion . the lower portion of the column is a conventional distillation column configuration ( equivalent 25 trays ). benzene is conveniently added as makeup via 14 into reflux accumulator . the benzene can also be added through a separate line ( 36 ). the ethylene is fed to the column via 8 at the lower point of the catalyst packing 12 . the reaction is exothermic and initiated by contacting the two reactants in the catalyst packing . ethyl benzene and diethyl benzene are the principal reaction products . both of these products as well as other polyalkyates are higher boiling than benzene and ethylene and are recovered via 18 as a bottoms product . the feed of ethylene may be such that there is a molar excess of benzene in the reactor , such that the overhead 20 is primarily benzene , the ethylene having been almost totally reacted . alternatively the benzene reflux may be increased to increase the ratio of benzene to ethylene in the reactor , while the feed ratios may be about 1 to 1 . in addition to benzene , some ethylene and other lights go off overhead . the overhead is passed to condenser 22 which is operated to condense substantially all of the benzene which passes via 24 to accumulator 16 and hence , by reflux via 26 to column 10 . the benzene used in the reaction and lost with the lights ( which exit condenser 22 via 28 ) may be made up by fresh benzene feed 14 . in a different embodiment line 14 is used as a draw to supply benzene from the accumulator to the transalkylator and in this embodiment the benzene enters reactor 10 via line 36 . the feed of benzene is also increased to a molar ratio in excess of 1 : 1 to ethylene . the bottoms in reactor 10 contain a mixture of ethyl benzene and diethyl benzene which pass via 18 to splitter 30 , which is a conventional distillation column operated to fractionate ethyl benzene and diethyl benzene . the ethyl benzene is recovered as overhead 32 and the diethyl benzene and other polyalkylates recovered as a bottoms product . in this preferred embodiment the diethyl benzene is sent via 34 to the transalkylator 40 containing the same mole sieve catalyst as column 10 . this is a single or multiple fixed bed 38 through which the polyalkylated benzenes and benzene 48 pass at 140 ° to 210 ° c . under sufficient pressure to maintain the liquid phases at lhsv of 1 to 5 . however , in this preferred embodiment it is desired to maximize ethyl benzene production . there is an equilibrium between benzene and diethyl benzene in the catalyst in the transalkylator as : there is substantially no ethylene in the transalkylator and a large volume of benzene along with the polyalkylated reaction products such as diethyl benzene , hence , the reversible reaction favors the production of ethyl benzene , which is being continuously removed from the catalytic zone as the stream passes through . in the embodiment of fig1 this product stream 42 passes to splitter where the ethyl benzene is recovered overhead and heavies , including unconverted benzene polyalkylates are removed through 46 . in the embodiment of fig2 this last step is different since the alkylation product is recovered via line 42 and returned as additional feed to splitter 30 . the only caution in such a closed system as this is that a draw must be provided to remove built up heavies or other potentially detrimental materials as required . such conventional items as valves , reboilers , slip streams , etc . are not shown , but would be obvious expedients to those setting up such equipment . the reactor was a 1 inch , six foot stainless tube , composed of 2 foot sections bolted together . the bottom and top two feet contained conventional distillation packing , the middle two feet contained mole sieve in pockets ( four pockets twisted with demister wire as described above . benzene was fed under nitrogen pressure through a rotameter to the tower about 6 &# 34 ; above the top of the catalyst bed . the olefin , either ethylene or propylene was fed from a tank to a point below the catalyst bed using a micrometering valve . the rate of feed of liquid olefin was adjusted to maintain the tower pressure with slow constant bleed of gas overhead . the rate of olefin addition was slightly larger than the rate of reaction . the benzene feed rate and bottoms withdraw rate are related . the benzene rotameter was set at a given value and the bottom withdrawal rate was adjusted to maintain a constant bottoms level . the catalyst was dried initially by taking off some benzene and water overhead and an occasional small amount of liquid material was taken off overhead during runs to maintain the dry catalyst and to remove any low boiling by - products . bottoms samples were analyzed by , gas liquid phase chromatography using a 50 meter se - 30 capillary column and fid . the conditions and results of several runs are set forth in table i . using an apparatus substantially as described in regard to fig2 the production of ethyl benzene is carried over a 4 month period of time . the catalyst in the distillation structure is union carbide lzy - 82 mole sieve . thirty feet of the helical catalytic structures were packed in the lower portion of a 35 ft . 4 &# 34 ; column . the benzene feed is 99 . 9 % benzene ( nitration grade ) with the balance being toluene and c 6 and c 7 aliphatics , and the ethylene is 90 - 95 % ( polymer grade ) with 5 - 10 % of ethane . the ethylene is fed below the catalyst bed and the benzene was feed into line 48 . benzene make up is not added to the reflux ( or benzene is removed from the overhead accumulator and used as feed to the transalkylator ). the feed rates and other conditions of the alkylation are set out in table ii . the alkylation product from the bottom of the tower is fractionated in a three inch by twenty foot packed tower and the ethyl benzene as reported in table ii is collected . the bottoms from the fractionation are passed with make up benzene through a 4 inch , ten foot long reactor packed with the particular catalyst used in the catalytic structures . results of the transalkylation are also reported in table ii . the net result of the combined alkylation and transalkylation is an average selectivity to ethyl benzene of 99 . 7 mole % ( considering 100 % conversion based of ethylene ). table i__________________________________________________________________________run no . 1 2 3 4 5 6 7 8 9 10__________________________________________________________________________catalyst y - 82 * y - 82 * y - 82 * sk - 500 * sk - 500 * y - 82 * y - 82 * y - 82 * sk - 500 * sk - 500 * olefin feed c3 c3 c3 c3 ( c ) c3 ( c ) c2 c2 c2 c2 c2pressure , psig 70 75 123 120 120 130 170 220 220 250temp , f . : bottoms 355 470 540 410 455 475 550 560 440 480lower cat . bed 300 300 341 308 320 343 358 380 340 390upper cat . bed 286 280 330 296 282 325 320 350 294 328recovery rateoverhead ( a ) ( a ) ( a ) ( a ) ( a ) ( a ) ( a ) ( a ) ( a ) ( a ) bottoms , g ./ hr . 131 165 300 283 sample 200 38 . 4 225 56 93bottoms analysis : no take offwt . % benzene 73 . 3 30 . 2 72 . 5 62 . 6 45 . 2 92 . 9 65 . 9 86 . 1 93 . 9 80 . 7ethylbenzene -- -- -- -- -- 6 . 7 31 . 8 12 . 5 5 . 4 16 . 4cumene 23 . 01 50 . 4 25 . 1 34 . 8 50 . 4 -- -- -- -- -- diethylbenzene -- -- -- -- -- 0 . 1 1 . 7 0 . 7 0 . 3 1 . 2dipropyl benzene 1 . 7 13 . 2 1 . 0 1 . 1 3 . 4 -- -- -- -- -- polyethylbenzene -- -- -- -- -- 0 . 2 0 . 5 0 . 6 0 . 3 0 . 6polypropyl benzene 2 . 4 3 . 7 1 . 1 trace trace -- -- -- -- -- other ( d ) trace 2 . 5 0 . 1 1 . 4 0 . 9 0 . 0 0 . 1 0 . 1 0 . 1 0 . 9production rate g . ethylbenzene / g . cat . hr -- -- -- -- -- 0 . 13 0 . 12 0 . 28 0 . 04 0 . 22cumene / g . cat . hr . 0 . 30 ( b ) 0 . 83 0 . 75 1 . 4 -- -- -- -- -- -- length of run , min . 39 65 52 18 -- 12 50 20 75 55__________________________________________________________________________ * sold by union carbide corp . ( acidic molecular sieve ) ( a ) olefin fed at a rate to maintain presure with a slow bleed overhead . ( b ) catalyst not dried sufficiently . ( c ) contained propylene : propan , = 58 / 42 wt . % ( d ) oligomers and other unidentified products table ii______________________________________run 487 on stream 2480 hours . catalytic distiltation tower : 3 inch × 35 feet catalyst section . catalyst : union carbide lzy - 82 , packed in lower 30 feetof tower . overhead pressure : 154 psig . bottom section of tower : 4 inch × 35 feet ( 30 ft . 5 / 8 in . pallrings ) total feed to tower : 26 . 6 lbs / hourethylbenzene tower : 3 inch × 30 feet , pressure 6 . 0 psig . transalkytator : 2 . 5 inch × 9 feet packed with lzy - 82ethylbenzene tower overhead production 23 . 1 lbs / houranalyses : wt % c2 = feed______________________________________ c2 7 . 394 c2 . sup .= 92 . 606 c3 0 . 000 c3 . sup .= 0 . 000 c4 0 . 000 c5 0 . 000 reac - eb eb tion twr . trans - tower tower btm . alkylator over - wt . % btms . purge out head______________________________________aliphatics 0 . 059 0 . 016 0 . 124 0 . 040benzene 0 . 002 0 . 000 45 . 521 0 . 003toluene 0 . 017 0 . 000 0 . 018 0 . 000ethylbenzene 70 . 527 0 . 133 19 . 521 99 . 928cumene 0 . 142 0 . 019 0 . 123 0 . 025butylbenzene 1 . 600 0 . 615 0 . 180 0 . 000cymene / unkn . 0 . 043 4 . 765 0 . 936 0 . 003deb 18 . 822 10 . 053 22 . 464 0 . 000unks / eip 0 . 529 0 . 246 0 . 517 0 . 000heavies 8 . 257 90 . 248 10 . 541 0 . 000pounds / hour 0 . 160 7 . 600 23 . 100______________________________________ des = diethylbenzene eip = ethyl isopropylbenzene	8
a frame - carrying prober according to an embodiment of the invention will be hereinafter explained with reference to the accompanying drawings . an ordinary prober and a frame - carrying prober are different only in that the prober inspects electrical characteristics of semiconductor devices formed on a wafer whereas the frame - carrying prober inspects the electrical characteristics of semiconductor chips diced discretely from the wafer as described above , and they have a similar mechanism . fig1 schematically shows an overall construction of the frame - carrying prober according to the invention . fig2 explains mis - position detection means having first and second detection means as the feature of the invention . the frame - carrying prober 1 include a stage 2 , a stage driving motor 3 , a probe card 4 equipped with probes 41 , a tester 5 , an alignment optical device 6 , a ccd camera 7 on the stage side and a control portion 8 in the same way as the ordinary prober . the frame - carrying prober 1 further includes mis - position detection means having first and second detection means 9 a and 9 b . discrete semiconductor chips 10 diced from a wafer are held by a ring - like frame 12 while they are bonded onto a dicing tape 11 and are carried under this state . to form the semiconductor chips 10 under this state , the dicing tape 11 is bonded to the back of the wafer on which electrical chip circuits are not formed , and the wafer is then diced . when dicing is done in this way , the discrete semiconductor chips 10 are bonded to the dicing tape 11 as diced . next , the dicing tape 11 is uniformly stretched in a radial direction and is held as stretched by the ring - like frame 12 . the semiconductor chips 10 are carried under this state by the frame 12 . the semiconductor chips 10 are put on and held by a chuck portion 21 on the state together with the frame 12 . the stage 2 is so constituted as to be capable of moving in x , y and z directions and in a θ rotating direction with the z axis as the center by a stage driving motor 3 controlled by the control portion 8 . the stage 2 can three - dimensionally move the semiconductor chips 10 held by the chuck portion 21 of the stage 2 . a large number of electrode pads ( not shown in the drawings ) are formed on the surface of the semiconductor chips 10 and the probe card 4 is provided with probes 41 corresponding to the electrode pads of the semiconductor chips 10 . therefore , the electrical characteristics of the semiconductor chips 10 can be inspected by bringing the probes 41 of the probe card 4 connected to the tester 5 into contact with the electrode pads of the semiconductor chips 10 . incidentally , when a plurality of semiconductor chips 10 is inspected at once , the probe card 4 has the same number of probes 41 as the number of the electrode pads . the frame - carrying prober 1 according to the invention includes the alignment optical device 6 using an alignment camera for positioning the probes 41 of the probe card 4 with the electrode pads of the semiconductor chip 10 in the same way as the ordinary prober . in other words , the ccd camera 7 for imaging from below the probes 41 and detecting the distal end positions of the probes 41 is fitted to the stage 2 . the ccd camera 7 is moved when the stage 2 is operated , measures the distal end position of each probe 41 while establishing its focus and inputs the measurement result to the control portion 8 . the alignment optical device 6 recognizes the pattern of the semiconductor chips 10 and inputs the recognition result to the control portion 8 . in this way , the control portion 8 can automatically conduct positioning between the distal end of each probe 41 and each electrode pad of the semiconductor chip 10 by using a known image processing technology on the basis of the information acquired by the alignment optical device 6 and the positional information of the distal end of each probe 41 acquired by the ccd camera 7 of the stage 2 . the frame - carrying prober 1 according to the invention further includes the mis - position detection means 9 having the first and second detection means 9 a and 9 b for detecting the semiconductor chips 10 peeling or floating from the dicing tape 11 as the feature of the invention . the first detection means 9 a of the mis - position detection means 9 includes a light emission portion 91 for emitting a laser beam l , a light reception portion 92 for receiving the laser beam l from the light emission portion 91 , a judgment portion 93 for judging peel or float of the semiconductor chips 10 from the laser beam l received by the light reception portion 92 depending on the increase / decrease of the light reception amount and an amplification portion 94 . the laser beam l emitted from the light emission portion 91 is turned to parallel rays by a lens 95 and travels on the semiconductor chips 10 towards the light reception portion 92 . when some of the semiconductor chips peel from the dicing tape 11 and partially float up , a part of the leaser beam l is cut off by these semiconductor chips 10 a and does not reach the light reception portion 92 . as the laser beam l is emitted above the semiconductor chips 10 and is gradually brought close to the upper surfaces of the semiconductor chips 10 by , for example , moving the stage 2 in the z axis direction , the semiconductor chip or chips 10 a peeling or floating from the dicing tape 11 in the horizontal row or the longitudinal low parallel to the x or y axis can be detected from the increase / decrease of the light reception amount in the light reception portion 92 . in this case , when the light emission portion 91 and the light reception portion 92 as the first detection means 9 a are arranged in the x axis direction as shown in fig3 , peel or float of the semiconductor chips 10 inside the entire horizontal row parallel to the x axis can be detected by moving the stage 2 in the y axis direction . incidentally , when the light emission portion 91 and the light reception portion 92 as the first detection means 9 a are arranged in the y axis direction , peel or float of the semiconductor chips 10 inside the entire longitudinal row parallel to the y axis can be detected by moving the stage 2 in the x axis direction . even though peel or float of the semiconductor chips 10 a inside the horizontal row or the longitudinal row can be detected by the first detection means 9 a alone , however , it is not possible to specify the semiconductor chip or chips 10 a of which of the horizontal and longitudinal rows peel or float . in other words , it is not possible to correctly detect the existence of peel or float of the discrete semiconductor chips 10 on the x - y coordinate axes . therefore , the invention includes the second detection means 9 b as the mis - position detection means 9 . this second detection means 9 b is arranged above the stage 2 and includes a light emission portion ( not shown ) for emitting the laser beam m and a light reception portion ( not shown ) for receiving the reflected laser beam m and is connected to a judgment portion 93 for judging peel or float from the concavo - convex condition of the semiconductor chips 10 and to an amplification portion 94 . the first detection means 9 a judges peel or float of the semiconductor chips 10 by the increase / decrease of the light reception amount of the laser beam l but the second detection means 9 b judges peel or float of the semiconductor chips 10 from their concavo - convex condition due to the change with time from light emission to light reception . in other words , when the first detection means 9 a judges that peel or float of the semiconductor chip ( s ) 10 a exists in a specific horizontal row parallel to the x axis , for example , the stage 2 is moved in the y axis direction in such a fashion that this specific horizontal row is situated just below the second detection means 9 b . the stage 2 is moved in the x axis direction under this condition and the position of the semiconductor chip 10 a in the specific horizontal row that peels or float is specified . when the first detection means 9 a is arranged in the y axis direction and peel or float of the semiconductor chip 10 a is detected in a specific longitudinal direction parallel to the y axis , too , the position of the semiconductor chip 10 a in the specific longitudinal row that peels or floats can be specified by the same method as described above . the invention can thus specify the position of the semiconductor chip 10 a , that peels or floats , on the x - y coordinates by using the first detection means 9 a and the second detection means 9 b as the peel detection means 9 . the semiconductor chip 10 a which is judged as defective by the judgment portion 93 and the position of which is specified is removed either manually or automatically . alternatively , the electrical characteristic test is carried out in such a fashion as to avoid the defective semiconductor chips 10 a . in this way , contact of the peeling or floating semiconductor chip with the probe card probe or with the alignment camera can be avoided and their breakage can be prevented . the invention is suitable particularly when a space for installing the detection means is available in only one of the x and y axes directions or on only one of the sides but a space for installing the detection means above the stage is available . the embodiment described above uses the laser beams l and m and detects peel or jump - out of the semiconductor chips 10 from the dicing tape 11 but may use ultrasonic wave in place of the laser beams l and m . quite naturally , a transmission portion of the ultrasonic wave and a reception portion of the ultrasonic wave are used in this case in place of the light emission portion 91 of the laser beam and the light reception portion of the laser beam , respectively . the embodiment described above detects the semiconductor chips 10 peeling or floating from the dicing tape 11 but can also detect defective electrode pads among those formed on each semiconductor device of the wafer set onto the probe by utilizing the same principle . in other words , the electrode pads such as bump pads are formed on the semiconductor device but some electrode pads are formed , in some cases , to a height greater than that of the normal electrode pads . when the probes of the probe card come into contact with such defective electrode pads , abnormal force acts on the probes , so that the probes are bent or broken and this results in breakage of the probe card . it is therefore necessary to determine in advance the coordinate positions of the defective electrode pads , to avoid probing and to prevent breakage of the probe card . the positions of the defective electrode pads on the wafer can be detected by using the first and second detection means according to the invention . although the invention has thus been described about the specific embodiments thereof , it will be obvious to those skilled in the art that numerous changes or modifications can be made thereto without departing from the scope of claim and concept of the invention .	7
the novel waveguide fiber comprises a family of segmented core designs that yield a very particular set of desired functional parameters . the family of core designs include , but are not limited to , embodiments having two , three , and four segments . the desired characteristics include a dispersion zero wavelength lower than the operating window which lies in the range of about 1530 nm to 1570 nm , referred to as the c - band and may include wavelengths at about 1625 nm which is at the upper end of the l - band , which refers to a wavelength range of about 1570 nm to 1625 nm . the total dispersion is preferably not less than about 2 ps / nm - km in the operating window and the dispersion slope is low , less than about 0 . 10 ps / nm 2 - km , to insure limited power penalty due to linear dispersion . the low slope provides for a total dispersion at 1625 nm not greater than about 13 ps / nm - km . total dispersion at 1625 nm of less than 10 ps / nm - km has been achieved . the non - zero total dispersion effectively eliminates fwm and the positive sign of the total dispersion offsets signal degradation due to spm . tables 1 , 2 and 3 , set forth below define the novel family of waveguide fibers that have these properties . it will be noted in the examples that follow , that attenuation is quite low and bending induced loses are acceptable . referring to fig2 a chart of δ % vs . core radius in microns , the segmented core is seen to have two segments . this is a special case of the waveguide fiber described in table 1 below in which the second and third segments are of equal δ %. segment 18 is an alpha profile having an alpha of about 1 . the second segment 20 is a step index profile , having an outer radius determined from the width and outer radius given in table 2 . this outer radius is the mid point radius defined above . it is drawn to the midpoint of the width of the third segment . compensation has been made for centerline dopant diffusion by increasing the dopant flow rate during lay down of the center portion of the preform . the amount of the dopant increase is preferably determined empirically by adding different dopant amounts to the centerlines of several preforms then processing the preforms through to waveguide fiber . the curved portions 22 and 24 of the profile result from dopant diffusion . in general , the radii included in the model calculations do not take this diffusion into account , because the effect of diffusion such as that shown in fig2 at profile portions 22 and 24 is small . in any case , the diffusion can be compensated by making adjustments to other portions of the refractive index profile . a fiber was modeled in accord with fig3 and had the following configuration . counting the segments consecutively , beginning with 1 at the centerline , and using the definitions provided above , the core design was δ 1 % about 0 . 70 %, r 1 about 0 . 39 μm , δ 2 % about 0 . 74 , r 2 about 2 . 84 μm , δ 3 % about 0 . 05 % and r 3 , drawn from the centerline to the midpoint of the step 20 , about 5 . 09 μm . the width of segment 3 was about 4 . 5 μm . the relative index percent on centerline was about 0 . 7 and extended to a radius of about 0 . 39 μm , at which point the α - profile began . the α is about 1 . cut off wavelength , λ c , 970 nm measured on the fiber ; attenuation at 1550 nm of 0 . 196 db / km . the pin array bend loss was 87 db . a section of the waveguide was weighted laterally and the bend loss found to be 0 . 72 db / m at 1550 nm . a second three segment core waveguide was modeled in accord with the refractive index profile shown in fig3 . in this case , the α - profile 26 began at the centerline and had δ 1 % of 0 . 63 , r 1 of 3 . 69 μm . the second segment 28 had a step profile and δ 2 % of 0 . 018 . the third segment 30 had a step profile and δ 3 % of 0 . 12 %, r 3 , the mid point radius defined above , of 8 . 2 μm and a width of 4 . 23 μm . cut off wavelength , λ c , 1648 nm measured on the fiber ; and , effective area , a eff , 72 . 8 μm 2 . the pin array bend loss was 15 . 3 db . a section of the waveguide was weighted laterally and the bend loss found to be 0 . 75 db / m at 1550 nm . in this case the properties are excellent and the bend loss is much improved over the design of example 1 . dashed lines 32 and 34 in fig3 are included to illustrate alternative three segment core designs . it will be understood that the design of fig3 includes index profiles where segments 28 and 30 deviate slightly from a step index configuration . for example the segments could have a small positive or negative slope . although dopant diffusion is shown at the segment boundaries in fig3 the model calculations did not include this diffusion . the same is true of all the model calculations contained herein . a waveguide fiber having a profile in accord with fig4 was modeled . the first segment 36 had a relative index on the centerline of 0 . 23 , δ 1 of 0 . 28 at outer segment radius r 1 , as defined above , which was 1 . 36 μm . the α - profile 38 had an α of 0 . 388 , δ 2 % of 1 . 73 , and outer segment radius r 2 of 3 . 17 μm . the step index portion 40 had δ 3 % of 0 . 17 and the step index portion 42 had δ 4 % of 0 . 17 , r 4 of 7 . 3 μm and a width of 3 . 50 μm . cut off wavelength , λ c , 1750 nm , measured on the fiber ; attenuation at 1550 nm , a1550 , of 0 . 212 db / km . the pin array bend loss was 6 . 16 db . a section of the waveguide was weighted laterally and the bend loss found to be 0 . 74 db / m at 1550 nm . in this example the properties are again excellent and the bend resistance especially good . the examples indicate a major tradeoff between the simplicity of the index profile vs . the bend resistance , with bend resistance improving as complexity of the profile increases . to find the extent of parameter variation that could occur in the profile while still providing the desired properties , the model calculations were performed at a series of points in a space having an axis corresponding to each profile variable . tables 1 through 3 illustrate preferred waveguide functional parameters in accordance with the invention that result in achievement of the desired properties . parameters are illustrated table 1 for a first three segment design , table 2 for a second three segment design , and table 3 for the four segment design . these tables set forth the waveguide fiber refractive index profile limits , i . e ., limits on radii and relative index δ %, as well as the properties which derive therefrom . a further example of the three segment design which yielded excellent results was modeled . referring to fig5 segment 46 , an α - profile with α of 1 . 33 , has δ 1 % of 0 . 64 , r 1 of 3 . 72 μm , segment 48 , a step index , has δ 2 % of 0 . 008 , r 2 of 4 . 5 μm , segment 50 , a step index , has δ 3 % of 0 . 14 , midpoint radius r 3 is 7 . 43 μm and the width of segment 50 is 4 . 49 μm . the centerline diffusion compensation provided in segment 44 has a relative index on centerline of 0 . 7 which extended to a radius of 0 . 39 μm . cut off wavelength , λ c , 1280 nm , measured in cabled form ; a large number of fibers were manufactured in accord with the model profile of fig5 . the refractive index profile as measured is shown in fig6 . the target values of the fiber parameters were as follows . the indentation on centerline had a lowest δ % of 0 . 55 % and a radius of 0 . 39 μm . the α - profile had an α of 1 . 335 , a δ % of 0 . 64 %, and a radius of 3 . 72 μm . the δ % of the second segment was 0 . 008 . the δ % of the third segment was 0 . 137 , the midpoint radius was 7 . 43 , and the segment width was 4 . 49 μm . the average properties of the fibers was tabulated as follows . these are excellent results which meet or exceed the desired waveguide fiber properties . attenuation at 1625 nm for this waveguide fiber were also less than 0 . 25 db / km . the following tables effectively define the family of refractive index profiles that yield the desired waveguide fiber function . set forth are maximum and minimum δ % of each particular segment , as well as corresponding radii r i for each segment . the cases in which the radius measurements are taken to the midpoint of a segment are labeled in the table heading . all other radii are the maximum outer radii of a given segment as well as the minimum inner radii of the next adjacent segment , where the segments are counted beginning at 1 on the center and proceeding outward . these other radii are measured to the extrapolated intersection between segment profiles . width refers to the width of the segment whose radius is measured to its midpoint . although particular examples of the novel waveguide have been disclosed and described herein , the invention is nonetheless limited only by the following claims .	6
the detailed description provided below in connection with the appended drawings is intended as a description of the present examples and is not intended to represent the only forms in which the present example may be constructed or utilized . the description sets forth the functions of the examples and the sequence of steps for constructing and operating the examples . however , the same or equivalent functions and sequences may be accomplished by different examples . as used herein , the singular forms “ a ” “ an ” and “ the ” include plural referents unless the context clearly dictates otherwise . therefore , reference to , for example , a micelle includes aspects having two or more such micelles , unless the context clearly indicates otherwise . the use of the alternative ( e . g ., “ or ”) herein should be understood to mean either one , both , or any combination thereof of the alternatives . the term “ and / or ” as used herein should be understood to mean either one , both , or any combination thereof . by way of example , “ a and / or b ” includes “ a ” or “ b ” or “ a and b .” as described herein , any concentration range , percentage range , ratio range or integer range is to be understood to include the value of any integer within the recited range and , when appropriate , fractions thereof ( such as one tenth and one hundredth of an integer ), unless otherwise indicated . as used herein , “ about ” means +/− 15 % of the indicated value or range , unless otherwise indicated . as used herein , the term “ nanocarrier ” refers to a carrier with a nanosized structure in which at least one of its phases has one or more dimensions ( length , width or thickness ) in the nanometer size range . as used herein , the term “ patient ” or “ subject ” refers to an animal , generally a mammal , especially including a domesticated animal and preferably a human , to whom treatment , including prophylactic treatment ( prophylaxis ), with the compounds or compositions according to the present invention is provided . as used herein , the term “ effective ” refers to an amount of a compound or component which , when used within the context of its use , produces or effects an intended result , whether that result relates to the prophylaxis and / or therapy of an infection and / or disease state or as otherwise described herein . the term “ effective ” subsumes all other effective amount or effective concentration terms ( including the term “ therapeutically effective ”) which are otherwise described or used in the present application . as used herein , the terms “ treat ,” “ treating ,” and “ treatment ” are used synonymously to refer to any action providing a benefit to a patient at risk for or afflicted with a disease , including improvement in the condition through lessening , inhibition , suppression or elimination of at least one symptom , delay in progression of the disease , prevention , delay in or inhibition of the likelihood of the onset of the disease , etc . the term “ pharmaceutically acceptable ” as used herein denotes that the compound or composition is suitable for administration to a subject , including a human patient , to achieve the treatments described herein , without unduly deleterious side effects in light of the severity of the disease and necessity of the treatment . the term “ active agent ” refers to any biologically active compound or drug which may be formulated for use in an embodiment of the present invention . exemplary bioactive agents include the compounds according to the present invention which are used to treat cancer or a disease state or condition which occurs secondary to cancer and may include antiviral agents as well as other compounds or agents which are otherwise described herein . the term “ diagnostic ” or “ diagnostic agent ” used herein is any chemical moiety that may be used for diagnosis or imaging a patient . in one aspect , the present invention provides a nanocarrier comprising a lipid shell enclosing a micellar core encapsulating an active agent or a diagnostic agent , wherein the lipid shell comprises one or more amphiphilic lipids , and the micellar core comprises one or more amphiphilic polymers wherein the core optionally comprises an emulsifier . the nanocarrier is a core - shell nano - structure particle . the lipid shell encloses the micellar core and preferably the micellar core is uniformly dispersed within the lipid shell . in one embodiment , the diameter of the nanocarrier is in the range of about 50 nm to about 500 nm , preferably about 100 nm to about 500 nm , more preferably about 110 nm to about 200 nm or about 120 nm to about 150 nm . in another embodiment , the nanocarrier of the invention has an encapsulating efficiency in the range of about 50 to about 100 %, preferably about 80 to about 95 %, more preferably about 90 nm to about 95 %. the lipid shell of the nanocarrier of the invention comprises one or more amphiphilic lipids . examples of the amphiphilic lipid include , but are not limited to , lipid - polyethyleneglycol conjugate , phospholipid , or cholesterol or a combination thereof . examples of the phospholipid include , but are not limited to , lecithin , soybean lecithin , egg yolk lecithin , a synthetic phospholipid or a pegylated phospholipid . preferably , the phospholipid is soybean lecithin . examples of the synthetic phospholipid include , but are not limited to phosphatidylcholine , phosphatidic acid , phosphatidylethanolamine , phosphatidylglycerol , phosphatidylserine , phosphatidylinositol , or a combination thereof . in a further embodiment , the amphiphilic lipid is a lipid - polyethyleneglycol conjugate , pegylated phospholipid , or a combination thereof . in one embodiment of the present disclosure , the lipid shell comprises a phospholipid and another amphiphilic lipid selected from pegylated phospholipid and cholesterol . in a further embodiment , the lipid shell comprises a lipid - polyethyleneglycol conjugates , pegylated phospholipid , or a combination thereof . in another embodiment , the lipid shell comprises a phospholipid and a pegylated phospholipid or cholesterol . the micellar core of the nanocarrier of the invention comprises one or more amphiphilic polymers wherein the core optionally comprises an emulsifier . examples of the amphiphilic polymer include , but are not limited to , phospholipid , poloxamer , poloxamine , l121 , tpgs , tween , or ethoxylated hydrogenated castor oil , pegylated phospholipid , plga , pla , pga , and a combination thereof . preferably , the amphiphilic polymer is phospholipid , pluronic p123 , dspe - peg2000 , l121 , tpgs or plga or a combination thereof . examples of the phospholipid are as described herein . preferably , the phospholipid is lecithin or soybean lecithin . examples of the emulsifier include , but are not limited to , sodium glycocholate , sodium taurocholate and sodium taurodeoxycholate . preferably , the emulsifier is sodium glycocholate . in a further embodiment , the micellar core comprises a phospholipid and another amphiphilic polymer selected from dspe - peg2000 , plga , pluronic p123 and a combination thereof . in another further embodiment , the micellar core comprises a combination of lecithin and pluronic p123 or a combination of lecithin and sodium glycolate . according to one embodiment of the present disclosure , the above - mentioned active agent is pharmaceutically or nutraceutically acceptable . according to a further embodiment of the present disclosure , the active agent is a hydrophobic agent . according to another further embodiment of the present disclosure , the active agent is an anti - cancer drug , an antimicrobial drug or a nutraceutical agent . examples of the active agent include , but are not limited to , docetaxel , paclitaxel , irinotecan , sn - 38 , amphotericin b , curcumin , resveratrol , quercetin , honokiol or magnolol . according to another embodiment of the present disclosure , the above - mentioned diagnostic agent is a pharmaceutically acceptable . for example , diagnostic agents include , but are not limited to , imaging agents containing radioisotopes such as indium or technetium ; contrasting agents containing iodine , technetium , or gadolinium ; enzymes such as horse radish peroxidase , gfp , alkaline phosphatase , or beta - galactosidase ; fluorescent substances such as fluorescein , rhodamine and europium derivatives ; luminescent substances such as n - methylacrydium derivatives or the like and paramagnetic molecules . according to yet another embodiment of the present disclosure , the loading of the active agent in the nanocarrier is in the range of about 5 % to about 15 %. in another aspect , the present invention provides a method of preparing a nanocarrier with higher bioactive or diagnostic agent loading , comprising ( i ) preparing a nanosuspension comprising one or more amphiphilic lipids by subjecting the one or more amphiphilic lipids to ultrasonication ; ( iia ) preparing a thin film comprising a mixture of one or more amphiphilic polymers wherein the mixture optionally comprises an emulsifier and an active agent or a diagnostic agent by dissolving the mixture in an organic solvent and then removing the organic solvent or ( iib ) dissolving the mixture in an organic solvent to form an organic solution ; ( iii ) hydrating the thin film of ( iia ) with the nanosuspension or injecting the organic solution of ( iib ) into the nanosuspension to form a solution containing self - assembling micelles encapsulating the active agent or diagnostic agent ; and ( iv ) subjecting the micellar solution to ultrasonication at a temperature of lower than 50 ° c . until the amphiphilic lipid forms a lipid shell and then encloses micelles as a core . in one embodiment , the first step is to prepare a phospholipid nanosuspension by subjecting phospholipid dispersion to ultrasonication and a thin film or an ethanol solution . self - assembling micelles encapsulating a pharmaceutically or nutraceutically active ingredient are produced by hydrating the thin film composed of an amphiphilic polymer and a pharmaceutically or nutraceutically active ingredient with phospholipid nanosuspension or by injection of ethanol solution containing an amphiphilic polymer and a pharmaceutically or nutraceutically active ingredient into this phospholipid nanosuspension . the next step is to subject this micellar solution to ultrasonication at a temperature of lower than 50 ° c . until a lipid shell encloses a micellar core composed of an amphiphilic polymer , wherein a pharmaceutically or nutraceutically active ingredient is disposed . according to an embodiment of the present disclosure , the phospholipid nanosuspension contains lecithin having a weight ratio ( w / w ) to active ingredient about 1 . 0 to 5 . 0 , preferably about 2 . 0 to 3 . 0 , prepared at a concentration of 1 . 0 - 5 . 0 % ( w / v ). according to another embodiment of the present disclosure , the phospholipid nanosuspension further contains cholesterol having a weight ratio ( w / w ) to lecithin about 0 . 0 to 0 . 5 , preferably about 0 . 1 to 0 . 2 . according to another embodiment of the present disclosure , the used amount of the amphiphilic polymer in the thin film or in ethanol solution is at a weight ratio ( w / w ) to active ingredient about 1 . 0 - 10 , preferably about 2 . 5 - 5 . 0 . according to yet another embodiment of the present disclosure , the amphiphilic polymer is tpgs , l121 , or dspe - peg2000 , and a combination of them with a used amount being at a weight ratio ( w / w ) to active ingredient about 1 . 0 - 10 , preferably about 2 . 5 - 5 . 0 . according to yet another embodiment of the present disclosure , the method for ultrasonication is using an ultrasonic processor ( vcx 750 - 750 watts ; frequency : 20 khz , sonics and materials , inc .) and the temperature is preferably 25 ° c . according to yet another embodiment of the present disclosure , the method further comprises a step of removing water from nanocarrier aqueous solution containing nanocarrier to obtain nanocarrier in powder form . it is to be understood that both the foregoing general description and the following detailed description are examples , and are intended to provide further explanation of the disclosure as claimed . an aspect of the present disclosure is to provide a nanocarrier composed of a lipid shell enclosing micelles , which are dispersed uniformly within the lipid shell . the lipid shell comprises a phospholipid with or without lipid ; the micelles comprise an amphiphilic polymer with or without phospholipid or emulsifier and the micelles enclose a pharmaceutically or nutraceutically active ingredient . according to another embodiment of the present disclosure , the phospholipid is lecithin , soybean lecithin , egg yolk lecithin or a synthetic phospholipid . the synthetic phospholipid is selected from phosphatidylcholines , phosphatidic acid , phosphatidylethanolamines , phosphatidylglycerols , phosphatidylserines , phosphatidylinositols , and a combination thereof . lipid is amphiphilic lipid or cholesterol . according to another embodiment of the present disclosure , the above - mentioned amphiphilic lipid is selected from lipid - polyethyleneglycol conjugates , pegylated phospholipid , and a combination thereof . according to yet another embodiment of the present disclosure , the above - mentioned amphiphilic polymer is selected from poloxamers , poloxamines , tpgs , tween , or ethoxylated hydrogenated castor oil , pegylated phospholipid , plga , pla , pga , and a combination thereof . emulsifier is sodium glycocholate , sodium taurocholate , or sodium taurodeoxycholate . according to another embodiment of the present disclosure , pharmaceutically or nutraceutically active ingredients include but are not limited to docetaxel , paclitaxel , irinotecan , sn - 38 , amphotericin b , curcumin , resveratrol , quercetin , honokiol and magnolol . according to yet another embodiment of the present disclosure , the diameter of the drug nanocarrier is in the range of about 50 nm to about 500 nm . according to yet another embodiment of the present disclosure , the drug loading in the nanocarrier is in the range of about 5 % to about 15 %. in another aspect , the invention provides a of preparing a nanocarrier of the invention with higher bioactive or diagnostic agent loading , comprising ( i ) preparing a nanosuspension comprising one or more amphiphilic lipids by subjecting the one or more amphiphilic lipids to ultrasonication ; ( iia ) preparing a thin film comprising a mixture of one or more amphiphilic polymers wherein the mixture optionally comprises an emulsifier and an active agent or a diagnostic agent by dissolving the mixture in an organic solvent and then removing the organic solvent or ( iib ) dissolving the mixture in an organic solvent to form an organic solution ; ( iii ) hydrating the thin film of ( iia ) with the nanosuspension or injecting the organic solution of ( iib ) into the nanosuspension to form a solution containing self - assembling micelles encapsulating the active agent or diagnostic agent ; and ( iv ) subjecting the micellar solution to ultrasonication at a temperature of lower than 50 ° c . until the amphiphilic lipid forms a lipid shell and then encloses micelles as a core . in one embodiment , the method further comprises a step of removing water from the nanocarrier aqueous solution to obtain nanocarrier in powder form . preferably , the water is removed by freeze - drying . in one embodiment , cup ultrasonication is utilized in the method at full power for 5 min while maintaining the temperature of solution at 25 ° c . in one embodiment , the nanosuspension contains an amphiphilic lipid having a weight ratio ( w / w ) to an active agent or a diagnostic agent of about 1 . 0 to 5 . 0 , preferably about 2 . 0 to 3 . 0 , prepared at a concentration of 1 . 0 - 5 . 0 % ( w / v ). in another embodiment , the amount of the amphiphilic polymer in the thin film or in the organic solution is at a weight ratio ( w / w ) to active ingredient of about 1 . 0 - 10 , preferably about 2 . 5 - 5 . 0 . in another embodiment , the organic solvent is ethanol . in a further embodiment , the amphiphilic polymer is tpgs , l121 , dspe - peg2000 , or a combination thereof . in another further embodiment , the weight ratio of the amphiphilic polymer to the active agent or diagnostic agent is about 1 . 0 - 10 , preferably about 2 . 5 - 5 . 0 . in one embodiment , the first step of preparing the nanocarrier of the invention is to prepare a phospholipid nanosuspension by subjecting phospholipid dispersion to ultrasonication and a thin film or an ethanol solution comprising a mixture of one or more amphiphilic polymers wherein the mixture optionally comprises an emulsifier and an active agent or a diagnostic agent . self - assembling micelles encapsulating a pharmaceutically or nutraceutically active ingredient are produced by hydrating the thin film composed of an amphiphilic polymer and a pharmaceutically or nutraceutically active ingredient with phospholipid nanosuspension or by injection of ethanol solution containing an amphiphilic polymer and a pharmaceutically or nutraceutically active ingredient into this phospholipid nanosuspension . the next step is to subject this micellar solution to ultrasonication at a temperature of lower than 50 ° c . until a lipid shell enclosing a micellar core composed of an amphiphilic polymer is formed , wherein a pharmaceutically or nutraceutically active ingredient is disposed . fig1 a and 1b illustrates a schematic diagram of a nanocarrier 100 according to the present disclosure . the nanocarrier 100 is composed of a micellar core 104 dispersed uniformly in a lipid shell 102 . as shown in fig1 a , the lipid shell 102 comprises a phospholipid 110 and an amphiphilic lipid 120 , and the phospholipid 110 is mixed with the amphiphilic lipid 120 . the micellar core 104 is composed of an amphiphilic polymer 130 and a pharmaceutically or nutraceutically active ingredient 106 . as shown in fig1 b , the lipid shell 102 comprises a phospholipid 110 mixed with pegylated phospholipid or cholesterol 125 , or both . the micellar core 104 is composed of an amphiphilic polymer 130 , phospholipid 140 , and a pharmaceutically or nutraceutically active ingredient 150 . the phospholipid 110 of the lipid shell 102 is contributive to enclosing the micellar core 104 , wherein hydrophobic molecules are evenly dispersed . according to an embodiment , the phospholipid 110 is lecithin , soybean lecithin , egg yolk lecithin or a synthetic phospholipid . the synthetic phospholipid is selected from phosphatidylcholines , phosphatidic acid , phosphatidylethanolamines , phosphatidylglycerols , phosphatidylserines , phosphatidylinositols , and a combination thereof . the amphiphilic lipid 120 in the lipid shell 102 is selected from lipid - polyethyleneglycol conjugates , pegylated phospholipid , and a combination thereof . the amphiphilic polymer 130 in the micellar core 104 is selected from poloxamers , poloxamines , tpgs , tween , or ethoxylated hydrogenated castor oil , pegylated phospholipid , and a combination thereof . the micellar core 104 is composed of an amphiphilic polymer 130 and a phospholipid 140 . the amphiphilic polymer 130 is dspe - peg2000 and the phospholipid is soybean lecithin . according to an embodiment , a pharmaceutically or nutraceutically active ingredient 106 is docetaxel . the above nanocarrier 100 is a core - shell nano - structure particle , and the diameter of the nanocarrier is in the range of about 100 nm to about 500 nm , preferably about 110 nm to about 200 nm , more preferably about 120 nm to about 150 nm . the above nanocarrier 100 is prepared to have an encapsulating efficiency in the range of about 50 to about 100 %, preferably about 80 to about 95 %, more preferably about 90 nm to about 95 %. the above nanocarrier 100 is prepared to have a drug loading in the range of about 5 to about 15 %, preferably about 6 to about 12 %, more preferably about 8 to about 10 %. fig2 illustrates a flow diagram of a method for preparing a nanocarrier . in the preparation method 200 as shown in fig2 , the first step is to prepare a phospholipid nanosuspension by subjecting phospholipid dispersion to ultrasonication 210 a and a thin film or an ethanol solution 210 b . self - assembling micelles encapsulating a pharmaceutically or nutraceutically active ingredient are produced by hydrating the thin film composed of an amphiphilic polymer and a pharmaceutically or nutraceutically active ingredient with phospholipid nanosuspension or by injection of ethanol solution containing an amphiphilic polymer and a pharmaceutically or nutraceutically active ingredient into this phospholipid nanosuspension 220 . the next step is to subject this micellar solution to ultrasonication at a temperature of lower than 50 ° c . until a lipid shell enclosing a micellar core composed of an amphiphilic polymer is formed , wherein a pharmaceutically or nutraceutically active ingredient is disposed 230 . optionally , the water is removed from nanocarrier aqueous solution to obtain nanocarrier in powder form 240 . in step 210 a , a thin film containing phospholipid and cholesterol is formed before subjection to ultrasonication to prepare phospholipid nanosuspension . in step 210 a , a phospholipid nanosuspension is prepared by dispersing a phospholipid in the aqueous solution and then subjecting it to probe ultrasonication . in an embodiment , the phospholipid is soybean lecithin and the amount used is at a weight ratio ( w / w ) to active ingredient of about 1 . 0 to 5 . 0 , preferably about 2 . 0 to 3 . 0 , prepared at a concentration of 1 . 0 - 5 . 0 % ( w / v ). the aqueous solution is water . in step 210 b , an amphiphilic polymer and a pharmaceutically or nutraceutic ally active ingredient are dissolved in an organic solvent for forming the thin film . in an embodiment , the amphiphilic polymer is tpgs and the amount used is at a weight ratio ( w / w ) to active ingredient of about 1 . 0 - 10 , preferably about 2 . 5 - 5 . 0 . the pharmaceutically or nutraceutically active ingredient is docetaxel . in step 210 a and step 210 b , the organic solvent is removed to obtain the thin film . in an embodiment , the method of removing the organic solvent is using a rotary vacuum evaporator . in step 220 , the thin film composed of an amphiphilic polymer and a pharmaceutically or nutraceutically active ingredient is hydrated with phospholipid nanosuspension to self - assembly form micelles encapsulating a pharmaceutically or nutraceutically active ingredient . in an embodiment , the amphiphilic polymer is dspe - peg2000 and the amount used is at a weight ratio ( w / w ) to active ingredient of about 1 . 0 - 10 , preferably about 2 . 5 - 5 . 0 . the pharmaceutically or nutraceutically active ingredient is docetaxel . in step 230 , the micellar solution is subjected to ultrasonication at a temperature of lower than 50 ° c . until a lipid shell enclosing a micellar core composed of an amphiphilic polymer and a pharmaceutically or nutraceutically active ingredient is formed . in one embodiment , cup ultrasonication is utilized at full power for 5 min while maintaining the temperature of solution at 25 ° c . the ultrasonication method in the above step 210 a and step 230 is using an ultrasonic processor implemented with cup and probe function . in step 240 , the method further comprises a step of removing water from the nanocarrier solution to obtain a nanocarrier in powder formulations by freeze - drying method . an appropriate amount of the anti - freezing agent is added to a solution having a nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . three nanocarriers manufactured by three embodiments in the present disclosure are shown in fig3 a , 3b , and 3c , respectively . all show the drug is dispersed uniformly in the micellar core encapsulated with a lipid shell . the nanocarrier containing load active agent or diagnostic agent can be administered to patients along with pharmaceutical excipients or diluents . therefore , the invention also provides a composition comprising the nanocarriers of the invention and pharmaceutically or nutraceutic ally acceptable excipients or diluents . non - limiting examples of suitable pharmaceutical excipients or diluents include starch , glucose , lactose , sucrose , gelatin , malt , rice , fluor , chalk , silica gel , magnesium carbonate , magnesium stearate , sodium stearate , glycerol monostearate , talc , sodium chloride , dried skim milk , glycerol , propylene , glycol , water , ethanol , buffered water , phosphate buffered saline and the like . these compositions can take the form of solutions , suspensions , tablets , pills , capsules , powders , sustained - release formulations and the like . it will be understood that the therapeutic dosage administered will be determined by the physician in the light of the relevant circumstances including the clinical condition to be treated and the chosen route of administration . administration may be topical , parenteral , intravenous , intra - arterial , subcutaneous , intramuscular , intracranial , intraorbital , ophthalmic , intraventricular , intracapsular , intraspinal , intracisternal , intraperitoneal , intranasal , aerosol , by suppositories , or oral administration . the nanocarrier of the invention can be provided in lyophilized form for reconstitution , for instance , in isotonic , aqueous , or saline buffers for parental , subcutaneous , intradermal , intramuscular or intravenous administration . the subject composition of the invention may also be administered to the patient in need of a therapeutic agent by liquid preparations for orifice , e . g . oral , nasal , sublingual , administration such as suspensions , syrups or elixirs . the subject composition of the invention may also be prepared for oral administration such as capsules , tablets , pills , and the like , as well as chewable solid formulations . the subject composition of the invention may also be prepared as a cream for dermal administration such as liquid , viscous liquid , paste , or powder . the presently disclosed compositions are designed to deliver an active or diagnostic agent , particularly in oral , intranasal , sublingual , intraduodenal , subcutaneous , buccal , intracolonic , rectal , vaginal , mucosal , pulmonary , transdermal , intradermal , parenteral , intravenous , intramuscular and ocular systems as well as to be able to traverse the blood - brain barrier . administration of an active or diagnostic agent bound to hydrophobic - core carrier composition of the present invention results in an increased bioavailability of the active agent compared to administration of the active agent alone . preparation of docetaxel nanocarrier with dspe - peg2000 as core and soybean lecithin as lipid shell anticancer drug docetaxel was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 150 mg docetaxel and 375 mg dspe - peg2000 were first dissolved in organic solvent and the thin film was formed after evaporation of organic solvent . 1000 mg soybean lecithin was suspended in 25 ml deionized water and then subjected to ultrasonication for forming a lecithin nanosuspension . then the lecithin nanosuspension was used to hydrate the thin film containing docetaxel and dspe - peg2000 and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 164 . 6 ± 2 . 51 nm ; pi , 0 . 423 ± 0 . 159 ; encapsulation efficiency , 93 . 06 %; drug loading , 9 . 15 %; stability at room temperature and 4 ° c . was & gt ; 8 hr and & gt ; 48 hr , respectively . as shown in fig3 a , a docetaxel nanocarrier having a micellar core encapsulated with a lecithin shell was observed by transmission electron microscopy ( tem ). fig4 shows the drug release plot ( example 1 ) of doccetaxel from this nanocarrier at ph 7 . 4 environments according to one embodiment of this disclosure ; fig5 shows the volume change of ct - 26 tumor xerograph illustrated by a mouse model treated with this docetaxel nanocarrier ( example 1 ) at a dosage regimen of 5 mg / kg q3dx4 . preparation of docetaxel nanocarrier with dspe - peg2000 as core and soybean lecithin as lipid shell anticancer drug docetaxel was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 150 mg docetaxel and 750 mg dspe - peg2000 were first dissolved in organic solvent and the thin film was formed after evaporation of organic solvent . 1000 mg soybean lecithin and 415 mg dspe - peg2000 were suspended in 25 ml deionized water and then subjected to ultrasonication for forming a lecithin / dspe - peg2000 nanosuspension . then the lecithin nanosuspension was used to hydrate the thin film containing docetaxel and dspe - peg2000 and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 154 . 0 ± 1 . 45 nm ; pi , 0 . 548 ± 0 . 128 ; encapsulation efficiency , 97 . 3 %; drug loading , 6 . 3 %; stability at room temperature and 4 ° c . was & gt ; 8 hr and & gt ; 48 hr , respectively . as shown in fig3 b , a docetaxel nanocarrier having a micellar core encapsulated with a lecithin / dspe - peg2000 shell was observed by transmission electron microscopy ( tem ). fig4 shows the drug release plot ( example 2 ) of doccetaxel from this nanocarrier at ph 7 . 4 environments according to one embodiment of this disclosure ; fig5 shows the volume change of ct - 26 tumor xerograph illustrated by a mouse model treated with this docetaxel nanocarrier ( example 2 ) at a dosage regimen of 5 mg / kg q3dx4 . preparation of docetaxel nanocarrier with dspe - peg2000 as core and soybean lecithin as lipid shell anticancer drug docetaxel was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 75 mg docetaxel and 375 mg dspe - peg2000 were first dissolved in organic solvent and the thin film was formed after evaporation of organic solvent . a uniform mixture containing 500 mg soybean lecithin and 62 . 5 mg cholesterol was suspended in 12 . 5 ml deionized water and then subjected to ultrasonication for forming a lecithin / cholesterol nanosuspension . then the lecithin nanosuspension was used to hydrate the thin film containing docetaxel and dspe - peg2000 and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 112 . 7 ± 2 . 43 nm ; pi , 0 . 43 ± 0 . 121 ; encapsulation efficiency , 93 . 3 %; drug loading , 6 . 9 %; stability at room temperature and 4 ° c . was & gt ; 8 hr and & gt ; 48 hr , respectively . as shown in fig3 b , a docetaxel nanocarrier having a micellar core encapsulated with a lecithin / cholesterol shell was observed by transmission electron microscopy ( tem ). as shown in fig3 a , a docetaxel nanocarrier having a micellar core encapsulated with a lecithin shell was observed by transmission electron microscopy ( tem ). fig4 shows the drug release plot ( example 3 ) of doccetaxel from this nanocarrier at ph 7 . 4 environments according to one embodiment of this disclosure ; fig5 shows the volume change of ct - 26 tumor xerograph illustrated by a mouse model treated with this docetaxel nanocarrier ( example 3 ) at a dosage regimen of 5 mg / kg q3dx4 . preparation of amphotericin b nanocarrier with dspe - peg2000 as core and soybean lecithin as lipid shell antifungal drug amphotericin b was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 5 mg amphotericin b and 15 mg dspe - peg2000 were first dissolved in dmso and the thin film was formed after freeze - drying . 20 mg soybean lecithin was suspended in 1 . 0 ml deionized water and then subjected to ultrasonication for forming a lecithin nanosuspension . then the lecithin nanosuspension was used to hydrate the thin film containing amphotericin and dspe - peg2000 and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 89 . 4 ± 4 . 5 nm ; pi , 0 . 679 ± 0 . 244 ; encapsulation efficiency , 96 . 8 %; drug loading , 12 . 5 %. preparation of iirinotecan nanocarrier with tpgs as core and soybean lecithin as lipid shell anticancer drug irinotecan was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 5 mg irinotecan and 10 mg tpgs were first dissolved in organic solvent and the thin film was formed after evaporation of the organic solvent . 30 mg soybean lecithin was suspended in 1 . 0 ml deionized water and then subjected to ultrasonication for forming a lecithin nanosuspension . then the lecithin nanosuspension was used to hydrate the thin film containing irinotecan and tpgs and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 107 . 6 ± 2 . 0 nm ; pi , 0 . 340 ± 0 . 053 ; encapsulation efficiency , & gt ; 90 . 0 %; drug loading , 10 . 0 %. preparation of curcumin nanocarrier with lecithin and glycolate as core and soybean lecithin as lipid shell nutraceutical drug curcumin was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 5 mg curcumin , 3 mg lecithin , and 15 mg sodium glycolate were first dissolved in organic solvent and the thin film was formed after evaporation of the organic solvent . 20 mg soybean lecithin was suspended in 1 . 0 ml deionized water and then subjected to ultrasonication for forming a lecithin nanosuspension . then the lecithin nanosuspension was used to hydrate the thin film containing curcumin / lecithin / sodium glycolate and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 117 . 4 ± 2 . 15 nm ; pi , 0 . 900 ± 0 . 037 ; encapsulation efficiency , & gt ; 93 . 0 %; drug loading , & gt ; 8 . 0 %. preparation of curcumin nanocarrier with lecithin and pluronic p123 as core and soybean lecithin as lipid shell nutraceutical drug curcumin was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 5 mg curcumin , 2 mg lecithin , and 20 mg pluronic p123 were first dissolved in organic solvent and the thin film was formed after evaporation of the organic solvent . 30 mg soybean lecithin was suspended in 1 . 0 ml deionized water and then subjected to ultrasonication for forming a lecithin nanosuspension . then the lecithin nanosuspension was used to hydrate the thin film containing curcumin / lecithin / pluronic p123 and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 128 . 8 ± 2 . 01 nm ; pi , 0 . 553 ± 0 . 060 ; encapsulation efficiency , & gt ; 90 . 0 %; drug loading , & gt ; 8 . 0 %. preparation of resveratrol nanocarrier with lecithin and pluronic p123 as core and soybean lecithin as lipid shell nutraceutical drug resveratrol was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 5 mg resveratrol , 2 mg lecithin , and 20 mg pluronic p123 were first dissolved in organic solvent and the thin film was formed after evaporation of the organic solvent . 20 mg soybean lecithin was suspended in 1 . 0 ml deionized water and then subjected to ultrasonication for forming a lecithin nanosuspension . then the lecithin nanosuspension was used to hydrate the thin film containing resveratrol and tpgs and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 101 . 8 ± 1 . 02 nm ; pi , 0 . 591 ± 0 . 021 ; encapsulation efficiency , & gt ; 95 . 0 %; drug loading , & gt ; 8 . 0 %. preparation of honokiol / magnolol nanocarrier with lecithin and pluronic p123 as core and soybean lecithin as lipid shell nutraceutical drug honokiol / magnolol was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 6 mg honokiol / magnolol , 6 mg lecithin , and 60 mg pluronics p123 were first dissolved in organic solvent and the thin film was formed after evaporation of the organic solvent . 30 mg soybean lecithin was suspended in 1 . 0 ml deionized water and then subjected to ultrasonication for forming a lecithin nanosuspension . then the lecithin nanosuspension was used to hydrate the thin film containing honokiol / magnolol / lecithin / sodium glycolate and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 147 . 1 ± 3 . 11 nm ; pi , 0 . 052 ± 0 . 137 ; encapsulation efficiency , & gt ; 95 . 0 %; drug loading , & gt ; 14 . 0 %. preparation of honokiol / magnolol nanocarrier with lecithin and pluronic p123 as core and soybean lecithin as lipid shell nutraceutical drug honokiol / magnolol was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 1 mg honokiol / magnolol , 1 mg lecithin , and 10 mg pluronic p123 were first dissolved in organic solvent and the thin film was formed after evaporation of the organic solvent . 30 mg soybean lecithin was suspended in 1 . 0 ml deionized water and then subjected to ultrasonication for forming a lecithin nanosuspension . then the lecithin nanosuspension was used to hydrate the thin film containing honokiol / magnolol / lecithin / sodium glycolate and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 151 . 9 ± 3 . 54 nm ; pi , 0 . 815 ± 0 . 075 ; encapsulation efficiency , & gt ; 85 . 0 %; drug loading , & gt ; 5 . 0 %. preparation of quercetin nanocarrier with tpgs as core and soybean lecithin as lipid shell nutraceutical drug quercetin was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 5 mg quercetin and 30 mg tpgs were first dissolved in organic solvent and the thin film was formed after evaporation of the organic solvent . 40 mg soybean lecithin was suspended in 1 . 0 ml deionized water and then subjected to ultrasonication for forming a lecithin nanosuspension . then the lecithin nanosuspension was used to hydrate the thin film containing quercetin and tpgs and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 107 . 6 ± 2 . 0 nm ; pi , 0 . 340 ± 0 . 053 ; encapsulation efficiency , & gt ; 90 . 0 %; drug loading , & gt ; 5 . 0 %. preparation of docetaxel nanocarrier with plga as core and lecithin and dspe - peg2000 as lipid shell anticancer drug docetaxel was used as the enclosed drug . referring to the flow diagram of fig2 for preparing a drug nanocarrier and the description of the above embodiments , 3 . 75 mg docetaxel and 25 mg plga were first dissolved in water miscible organic solvent to form injection solution . 5 mg soybean lecithin and 5 mg dspe - peg2000 were suspended in 10 . 0 ml deionized water and then subjected to ultrasonication for forming a lecithin nanosuspension . then the docetaxel / plga solution was injected into the lecithin nanosuspension and the mixture was subjected to ultrasonication at full power for at least 5 min while maintaining a constant temperature to obtain a solution having a nanocarrier . uncapsulated drug was discarded by filtering this nanocarrier solution via 0 . 22 um membrane . an appropriate amount of the anti - freezing agent was added to the filtrate containing nanocarrier . after being frozen at − 80 ° c ., it was transferred to a freeze dryer in an environment lower than − 40 ° c . and 0 . 133 mbar for one day , thus obtaining the dry powdered nanocarrier . after the dry powdered nanocarrier was reconstituted with deionized water , physical characteristics of nanocarrier were examined and the results were listed as follows : mean size , 122 . 5 ± 0 . 93 nm ; pi , 0 . 178 ± 0 . 072 ; encapsulation efficiency , & gt ; 50 . 0 %; drug loading , & gt ; 5 . 0 %. the above embodiments / examples in the present disclosure use the properties of micelles to prepare a nanocarrier core , and the lipid shell structure can be applied to encapsulate such a micellar core forming a nanocarrier . by the hydration of lecithin nanosuspension , the amphiphilic polymers with or without lecithin self - assemble to form the micellar core encapsulated with a lipid shell to form a nanocarrier . all materials employed in this nanocarrier have the advantages of being less expensive and having high biocompatibility and degradability . these features mean the micelles enclose each kind of drug effectively , help to increase the payload efficiency , and decrease drug leakage . the micellar core in the nanocarrier encapsulated with a lipid shell can reduce the problems of high drug leakage and instability resulting when the drug is only entrapped in the matrix of amphiphilic polymer . furthermore , the particle size of the nanocarrier is in a nano range with a lipid surface , which makes it highly permeable through various biological membrane barriers , such that it is administrable not only intravenously , but also via various routes including subcutaneously , dermally , orally , mucously , sublingually , and ocularly , to enable new application platforms for drug delivery in the future . all the features disclosed in this specification ( including any accompanying claims , abstract , and drawings ) may be replaced by alternative features serving the same , equivalent or similar purpose , unless expressly stated otherwise . thus , each feature disclosed is one example only of a generic series of equivalent or similar features .	0
the invention is a colored polyethylene composition . the composition comprises a high density polyethylene ( hdpe ), phthalocyanine blue , and talc . phthalocyanine blue introduces color to the composition , while the talc is present to reduce or eliminate warpage induced by phthalocyanine blue . suitable hdpe for the composition of the invention includes those available in the industry . the hdpe has a density preferably greater than or equal to 0 . 938 g / cm 3 , more preferably greater than or equal to 0 . 941 g / cm 3 , and most preferably greater than or equal to 0 . 945 g / cm 3 . preferably , the hdpe has a melt index mi 2 within the range of 0 . 05 to 50 dg / min . more preferably , the hdpe has an mi 2 within the range of 0 . 1 to 20 dg / min . most preferably , the hdpe has an mi 2 within the range of 0 . 5 to 10 dg / min . suitable is hdpe preferably has a melt flow ratio mfr less than or equal to 65 . more preferably , the hdpe has an mfr less than or equal to 40 . most preferably , the hdpe has an mfr less than or equal to 26 . mfr is the ratio of hlmi / mi 2 . hlmi is a high load melt index . the mi 2 and hlmi can be measured according to astm d - 1238 . the mi 2 is measured at 190 ° c . under 2 . 16 kg weight . the hlmi is measured at 190 ° c . under 21 . 6 kg weight . preferably , the hdpe has a crystallization half - time greater than or equal to 4 minutes . more preferably , the hdpe has a crystallization half - time greater than or equal to 5 minutes . the crystallization half - time can be measured by a ta instruments differential scanning calorimeter ( model q1000 ). samples are heated at 160 ° c . for 5 minutes , then cooled at a rate of 60 ° c ./ min to 123 ° c ., and allowed to crystallize at 123 ° c . for 30 min . the heat flow ( i . e ., heat of crystallization ) is measured . the crystallization half - time is taken as the time required for accumulated heat flow to reach 50 % of the total heat released by the sample . suitable talcs include those known to the industry . the talc is preferably ultrafine ground talc with a high aspect ratio and small median particle size . preferably the talc has a median particle size less than 10 microns and more preferably less than 2 microns . preferably the talc particles are exfoliated or delaminated allowing for maximum available surface area and high aspect ratio . optionally the exfoliated particles may then be compacted to allow for higher bulk densities and easier handling . talc particles with high aspect ratios and small median particle sizes are preferably chosen because the smaller particles will allow for more surface area and higher aspect ratio particles are needed for alignment of the particles with the flow of the polymer . phthalocyanine blue is used to introduce a blue color to the polyethylene composition . it can be used together with other pigments to achieve various colors . it is used preferably within the range of 0 . 02 wt % to 5 wt %, more preferably within the range of 0 . 05 wt % to 2 wt %, and most preferably within the range of 0 . 1 wt % to 1 wt %, of the composition . one problem associated with the use of phthalocyanine blue is that it causes warpage in the molded articles . we found that adding talc to the phthalocyanine blue - containing hdpe can reduce or eliminate the warpage induced by phthalocyanine blue . preferably , talc is used in an amount within the range of 0 . 05 wt % to 10 wt %, more preferably within the range of 0 . 05 wt % to 2 wt %, and most preferably within the range of 0 . 1 wt % to 1 wt %, of the composition . warpage is caused by uneven shrinkage in the machine and transverse directions . a method developed by basf colors & amp ; additives ( see axel grimm , “ low warping pigments for the coloration of molded articles ,” proceedings of the 4th european additives & amp ; colors conference , 16 - 17 march 2005 ) can be used to correlate warpage with shrinkage . in this method , an internal factor in the transverse direction if td is calculated based on the difference in shrinkage in the transverse direction between an unpigmented polymer sample and a pigmented polymer sample . s td is the shrinkage in the transverse direction . in general , an if td value of 0 %- 10 % means that the pigment causes little or no warpage , a value of 11 %- 20 % a moderate warpage , and a value greater than 20 % means a high warpage . the composition of the invention results in molded articles having an if td value preferably less than 10 %. the composition of the invention can be made by blending the components . any known blending methods including masterbatch methods can be used . preferably the blending is performed in an extruder . optionally , the composition of the invention contains antioxidants , uv - absorbents , light stabilizers , flow agents , and other additives . additives are added in an amount preferably less than 15 wt %, more preferably less than 10 wt %, and most preferably less than 5 wt %, of the composition . the composition of the invention is preferably used for injection molding applications . it is particularly useful for making refuse carts or other articles where a low warpage is essential . the following examples merely illustrate the invention . those skilled in the art will recognize many variations that are within the spirit of the invention and scope of the claims . low warpage of molded sample of hdpe in the absence of phthalocyanine blue a high density polyethylene hdpe having a density of 0 . 948 g / cm 3 and a melt index of 5 . 0 g / 10 min . at 190 ° c ./ 2 . 16 kg is strand - pelletized using a co - rotating , twin - screw extruder . the resulting pellets have a crystallization half - time of 4 . 2 min ., measured at 123 ° c . test plaques are molded using a fan - gated plaque mold with the dimensions 4 in × 6 in × 0 . 125 in . molded plaques are allowed to cool . after cooling , the dimensions of the plaques differ from the dimensions of the mold ; this difference reflects the amount of sample shrinkage that occurs . the averages of the machine direction ( md ) shrinkage and transverse direction ( td ) shrinkage are 2 . 9 % and 2 . 7 %, respectively . this indicates that the molded hdpe sample has relatively even shrinkage in md and td , i . e ., low warpage . the general procedure of comparative example 1 is followed with one exception . the strand - pelletized hdpe is dry - blended with 1 % by weight of a phthalocyanine blue color concentrate ( available from carolina color ). this blend is injection - molded into plaques by the same procedure of comparative example 1 . the averages of the machine direction ( md ) shrinkage and transverse direction ( td ) shrinkage are 2 . 9 % and 2 . 2 %, respectively . the calculated if td is 18 %. this indicates that phthalocyanine blue causes the molded hdpe sample to have significantly higher shrinkage in md than td , i . e ., a high warpage . the general procedure of comparative example 2 is followed with one exception . an exfoliated talc ( 0 . 15 % by weight , jetfine ® 3ca talc , product of luzenac ( rio tinto minerals )) is compounded with the hdpe in a twin - screw extruder . the pellets produced prior to dry - blending with the phthalocyanine blue color concentrate have a crystallization half - time of 1 . 7 min , measured at 123 ° c . by comparison with comparative example 1 , this crystallization half - time reduction indicates that the talc acts as a nucleating agent for the hdpe . the molded sample has md and td shrinkages of 2 . 9 % and 2 . 5 %, respectively . the calculated if td is 8 %. the results indicate that the presence of talc increases td shrinkage and reduces warpage caused by phthalocyanine blue . an hdpe resin having a density of 0 . 948 g / cm 3 and a melt index of 5 . 0 g / 10 min . at 190 ° c ./ 2 . 16 kg is dry - blended with 1 % by weight of a phthalocyanine blue color concentrate ( available from carolina color ). this blend is injection - molded to form several refuse carts . after cooling , the carts are visually inspected for warpage . an unacceptably high level of warpage is observed . the general procedure of comparative example 4 is followed except a master batch which contains 95 % by weight of a linear low density polyethylene having a density of 0 . 929 g / cm 3 and a melt index of 104 g / 10 min . at 190 ° c ./ 2 . 16 kg and 5 % by weight of an exfoliated talc ( ultratalc ® 609 , product of barretts minerals inc .) is dry - blended at 2 % by weight into the dry blend composition described in comparative example 4 . the resultant blend is injection - molded to form several refuse carts . after cooling , the carts are visually inspected for warpage . significantly less warpage is observed compared to comparative example 4 .	2
the following description is provided to enable any person skilled in the art to make and use the invention and sets forth the best modes contemplated by the inventor of carrying out his invention . various modifications , however , will remain readily apparent to those skilled in the art of spectroscopic ellipsometers . hereinafter , the details of the present invention will be described in reference to the drawings . fig1 shows schematically a construction of a spectroscopic ellipsometer according to a first embodiment of the present invention . in this drawing , a reference number 1 denotes a target sample ( e . g ., a semiconductor wafer ) which is held horizontally on a sample stage 2 . this sample stage 2 is constructed so as to hold the sample 1 on it with means such as a vacuum source and to move it linearly in three directions , e . g ., x - direction ( horizontal direction of the drawing ), y - direction ( perpendicular direction to the drawing ) and z - direction ( vertical direction parallel to the drawing ), respectively , which are orthogonal to each other , with a stage - holding mechanism ( not shown ). an irradiating optical system 3 is provided on one side above the sample stage 2 , and includes a light source section 4 , a pair of reflectors 5 , 6 , and a polarizer 7 . the light source section 4 is provided with a white light source comprising , for example , a xenon lamp emitting light having a wide wavelength band of , for example , from 190 nm to 830 nm and a slit for reducing light ( irradiating light ) 8 emitted from the white light source to an appropriate diameter . the reflector 5 , close to the light source section 4 comprises , for example , a concave mirror , and is installed so as to position the light source section 4 at the position of a focal point thereof , and therefore the irradiating light 8 directed from the reflector 5 to another reflector 6 is made to compose parallel rays of light having an appropriate diameter . the reflector 6 comprises , for example , a concave mirror , and receives the parallel rays of light 8 p from the reflector 5 and condenses it through a polarizer unit 7 onto a specified target position of the surface 1 a of the sample so as to form a specified beam spot diameter . the polarizer unit 7 linearly polarizes the irradiating light 8 from the reflector 6 in a specified direction . the reflectors 5 and 6 can include various types of mirrors to provide a focus point for imaging the light source such as spherical , parabolic , and elliptical mirrors . when a diameter of the above - mentioned collimated light beam 8 p from the light source section 4 is expressed by ds and a focal length of the reflector 6 is expressed by fs , the f - number ( hereinafter , referred to as fno . s ) of the above mentioned irradiating optical system 3 is expressed by the following equation : and the magnitude of the fno . s is set at a sufficiently small value for attaining a beam spot diameter to be aimed at the surface 1 a of the sample . a reference number 9 denotes a detecting optical system provided on the other side of the sample above the sample stage 1 , and when the linearly polarized light 8 is irradiated on the surface 1 a of the sample , the detecting optical system 9 outputs the amount of polarization state change of an elliptically polarized light 10 reflected from the surface 1 a of the sample , for example , to a spectrometer 11 . the spectrometer 11 can comprise an analyzer 12 , a pair of reflectors 13 , 14 , and a mask member 15 . the reflector 13 , closest to the analyzer 12 , comprises , for example , a concave mirror , and is installed so as to position the surface 1 a of the sample at the position of a focal point thereof , and makes the elliptically polarized light 10 , passing through an aperture 15 c ( opening ) of the mask member 15 parallel rays of light 10 p to reflect it to another reflector 14 . the reflector 14 comprises , for example , a concave mirror , and outputs the parallel rays of light 10 p from the reflector 13 to the spectrometer 11 . the mask member 15 has a function of an optical mask to pass only a light 10 a at the center of the optical axis of the above - mentioned elliptically polarized light 10 and comprises , for example , a plate member 15 a provided with a restricting member 15 b being opening - adjustable freely , and is constructed in such a way that a degree of opening of the opening 15 c has a shape such as a polygon in a plan view and is adjustable appropriately as shown in an enlarged view in the drawing . for example , a shutter mechanism can be utilized with an adjustable movement of the blades . when a diameter of the above - mentioned parallel rays of light 10 p is expressed by dk and a focal length of the reflector 13 is expressed by fk , the f - number ( hereinafter referred to as fno . k ) of the above - mentioned detecting optical system 9 is expressed by the following equation : and the respective f - numbers are set in such a way that the following relationship holds between this fno . k and the above mentioned fno . s of the irradiating optical system 3 . furthermore , the above - mentioned detecting optical system 9 is formed so as to introduce only the light 10 a having part of a solid angle about the objective angle of reflection to the spectrometer 11 by providing the above - mentioned mask member 15 . when an extent of the opening 15 c in the mask member 15 passes only light 10 a representing a narrowing limit to the angle ( solid angle ), only the reflected light in the range of the narrow angle is obtained , and therefore , as apparent from the drawing , the light 10 b in a portion designated by a reference character 10 b , e . g ., a space enclosed by a solid line while the space in a phantom line is significantly blocked . the solid angle of the reflected light 10 introduced to the detecting side of the spectrometer 11 is made to be an optimal value by adjusting the opening of the aperture 15 c in the above - mentioned mask member 15 in consideration of the desired amount of light from the reflection and the distribution of the spectral sensitivity of the spectrometer 11 . in the spectroscopic ellipsometer constructed as described above , since the reflected light 10 from the surface 1 a of the sample can be extracted with a small solid angle while a measurement area at the surface 1 a of the sample is lessened by lessening the area irradiated by the irradiating optical system 3 , it is possible to measure only a precise small area with a high degree of precision without lowering the quality of the measurement results . in the above - mentioned first embodiment , the mask member 15 provided in the detecting optical system 9 is not limited to the position illustrated in the drawing , and it may be installed at any appropriate location in an optical path leading to the spectrometer . when aberration ( e . g ., spherical aberration ) which can affect the gradient of the light relating to a direction parallel to the drawing ( x - direction ) is sufficiently small , the aperture 15 c in the mask member 15 formed in the form of a slit which extends linearly in the above - mentioned y - direction may be provided in the irradiating optical system 3 depending on the position in the direction perpendicular to the drawing ( y - direction ) in fig1 . thus , the reflected light to be blocked is reduced , and the amount of light may be effectively limited . [ 0029 ] fig2 shows a second embodiment of the present invention , and this embodiment omits the installation of the mask member 15 to the detecting optical system 9 , and allows the optical elements such as reflector 13 to be orientated in such a manner to perform a similar function of the optical mask . [ 0030 ] fig3 shows a third embodiment of the present invention , and , in this embodiment , reflector 16 comprises , for example , a concave mirror 16 of a size and angular orientation between the reflector 6 and the polarizer 7 , so that the irradiating light 8 to the surface 1 a of the sample is made to be as close as possible to parallel rays of light . the f number of the irradiating optical system is set to be lower than the f number of the detecting optical system . a mask member 17 having a similar constitution to the above - mentioned mask member 15 is provided , for example , at the entrance of the spectrometer 11 of the detecting optical system 9 . the respective relationships of the f - numbers of the irradiating optical system 3 and the detecting optical system 9 in the second and the third embodiments described above are similar to that of the irradiating optical system 3 and the detecting optical system 9 in the first embodiment , and the actions and effects in these embodiments are also similar to that in the first embodiment . as described above , in the present invention , it is possible to measure only an infinitesimal or very small area with a high degree of precision without lowering the precision of measurement . the spectroscopic ellipsometer is provided with an irradiating optical system for irradiating polarized light to the surface of the sample and a detecting optical system for outputting data with respect to the surface of the sample based on the amount of polarization state change of the elliptically polarized light reflected on the surface of the sample . the f - number in the above - mentioned irradiating optical system is set at a magnitude of level to be capable of obtaining a beam spot diameter at the surface of the sample , and the f - number of the above - mentioned detecting optical system is set to be higher than the f - number in the above - mentioned irradiating optical system . therefore , it is possible to measure the infinitesimal area in various kinds of samples such as on a semiconductor wafer and a reticle / mask used in microelecronics technology and microminiaturization with a higher degree of precision .	6
a nuclear camera head 10 includes a relatively thick , e . g ., 20 mm , scintillation crystal 12 whose back surface is viewed by a close - packed array of photomultiplier tubes 14 . a collimator 16 is mounted adjacent a front face of the scintillation crystal such that radiation from a subject 18 is collimated to pass along restricted rays through vanes of the collimator in order to reach the scintillation crystal and interact in a scintillation event . a moment processor 20 calculates the zero - th , first , and second moments of the signals output by the photomultiplier tubes . the zero - th moment represents energy , the first moment represents coordinate position of the scintillation event generating interaction relative to a detector plane , and the second moment represents the spread of the peak , hence the depth in the scintillation crystal at which the interaction occurred . an energy circuit 22 converts the zero - th moment into a measurement of energy which is compared with the energy of the isotopes being imaged . a coordinate circuit 24 converts the first moment into x , y - coordinate positions . a depth circuit 26 converts the second moment into an indication of depth - of - interaction relative to the front face of the crystal . the depth - of - interaction information is used to filter the coordinate information , deciding whether to reject the event or to accept and continue with processing . an effective depth selection circuit 28 is controlled by the operator to select a thickness and location of a slab of the scintillation crystal which is to be utilized . for example , the operator can select the 8 mm of the crystal closest to the front face to be the active region such that the output is substantially the same as the output from the detector head with a thin , 8 mm scintillation crystal . this would improve the resolution of the detector ; since the sizes of the light pulses are more consistent , the calibration of the energy and position - determining circuits is more consistent , thus reducing the variance in the energy and position . such a selection is appropriate for low energy isotopes , which interact primarily near the front surface of the crystal . for a slightly higher energy isotope , the operator may choose to select an intermediate slab of the scintillation crystal . for example , if the selected isotope has a penetrating power such that the median radiation photon is stopped at 8 mm into the crystal , a slab from 0 - 11 mm from the front face might be selected as the active region . as yet another option , if the isotope is a high energy isotope in which the maximum stopping power of the crystal is wanted , the operator might select the 0 - 20 mm , i . e ., the entire crystal from the front face region to be the active region . in a preferred embodiment , the depth - of - interaction filter includes a depth comparing circuit 30 which compares the calculated depth from the depth circuit 26 with the selected effective active slab of the scintillation crystal from the effective thickness circuit 28 . since the desired active thickness could depend on the event energy , the energy can be used to specify the thickness on an event - by - event basis . if the scintillation event comes from the selected slab , then the comparing circuit 30 causes an accept / reject circuit 32 to accept the event and pass the coordinate and energy values identifying the location of the event from the coordinate circuit 24 . if the scintillation event is from a layer of the scintillation crystal outside of the selected slab , the accept / reject circuit discards the coordinate information . other filter functions can , of course , be selected . for a dual isotope imaging , isotopes with two different energy peaks are injected into the subject or isotope of one energy is injected into the subject and radiation of a second energy is transmitted through the subject . a sorting circuit 34 is controlled by the energy circuit 22 to sort the accepted coordinate values between a first isotope reconstruction system 36 and a second isotope reconstruction system 38 in accordance with the energy or zero - th moment of the event . the first and second isotope reconstruction systems can share a common reconstruction processor . the first and second image reconstruction circuits reconstruct the coordinate information into first and second isotope electronic image representations for corresponding first and second image memories 40 , 42 . the image reconstruction can be a projection image reconstruction , a volume image reconstruction , or other known image formats . for volume images , the detector head 10 is typically rotated around the subject . one or more displays 44 display the reconstructed images individually or in combination with each other . this procedure could be extended to more than two isotopes , or to two or more energies for the same isotope . with reference to fig2 a pair of like detector heads 10 and 10 &# 39 ; of the construction discussed in conjunction with fig1 are mounted on opposite sides of the subject 18 with their front faces parallel to each other . the collimators 16 , 16 &# 39 ; are selected of a material with a relatively low stopping power such that they collimate the low energy isotope and are substantially invisible to higher energy positron emission radiation . a moment processor 20 again calculates the zero - th , first , and second moments of each scintillation event . a coincidence circuit 50 determines when scintillation events occur simultaneously in both scintillation crystals . this is typically done by establishing a time window logic circuit of 22 ms or less . the coincidence circuit controls a sorting circuit 52 which sorts the coordinate pairs which occur simultaneously to a positron emission tomography reconstruction processor 54 and the coordinates of events which occur non - simultaneously to a conventional low energy reconstruction processor 56 . a depth calculating circuit 26 calculates the depth of each scintillation event within the scintillation crystals . the operator uses an effective thickness selection circuit 28 to select the slabs or layers of the scintillation crystal which are to contribute to the positron emission tomographic image and the portion of the crystal whose scintillations are to contribute the low energy image reconstruction . typical segmentations of a 20 mm scintillation crystal might include limiting the positron emission image to scintillations between 0 - 20 mm from the front face of the crystal and the low energy image to scintillations in the 0 - 10 mm portion depth of the crystal . another use of higher - order moments filtering is to reject multiple interaction events . higher energy events , such as positron annihilation events , often interact by partially depositing energy at one location ( compton scattering ) and depositing the remaining energy at a second location ( photoelectric absorption ). the calculated position is therefore an average of the two and less accurate . these events can be determined with a second or higher moment and rejected in order to improve the spatial resolution . a comparing circuit 60 compares the selected depth for the positron emission tomographic image with the depth calculated by circuit 26 and causes a filter circuit 62 to accept or reject the coordinate pairs for the positron emission in accordance with the depth in the crystal at which the scintillation interaction occurred . analogously , a comparing circuit 64 compares the selected depth for the low energy scintillation events with the actual depth from the depth circuit 26 and causes a filter circuit 66 to accept or reject low energy events in accordance with the depth within the scintillation crystal at which the scintillation interaction occurred . optionally , an energy based filter circuit 68 can be utilized to accept or reject the coordinate information in accordance with the energy of the scintillation events . typically , such an accept / reject would window the energy at around the 511 kev and over the lower energy range of compton scattered positrons . a similar filter circuit can be used for the scintillations attributable to the low energy radiation . moreover , two or more low energy isotopes can be utilized . with two or more low energy isotopes , the zero - th moment controls a sorting circuit 70 which sorts the low energy radiation coordinates between reconstruction processor systems 56 , 56 &# 39 ; or discards the information in accordance with the energy levels . this functionality is particularly important for multi - isotope imaging because the lower energy window is contaminated by scatter and partial interaction of the higher energy isotope . the high energy contamination is deeper into the crystal . this could cause inaccuracies in the positioning which could cause artifacts in the reconstructed image . this problem would be alleviated by rejecting the deeper events by higher - order moment filtering . with reference to fig3 a pair of detector heads 10 , 10 &# 39 ; are again mounted on opposite sides of the subject 18 with their energy receiving faces parallel to each other . the collimators 16 , 16 &# 39 ; are constructed of a material with high absorbing power such that even high energy radiation such as positron emissions are collimated . a moment processor 20 again calculates the zero - th , first , and second moments . a depth circuit converts the second moment into an indication of depth of each scintillation event . the operator uses an effective thickness selection circuit 28 to select the depth for scintillations corresponding to the positron emission energy range , e . g ., 20 mm , and the depth corresponding to a low energy isotope , e . g ., 0 - 8 mm . a comparing circuit 80 causes a filter or sorting circuit 82 to sort the first moment coordinates of each radiation interaction in accordance with the depth at which each occurred . interactions occurring in the deep part of the crystal , e . g ., the 0 - 20 mm range , are sent to the positron emission tomography reconstruction processor 84 . interactions occurring in the front portion of the crystal , e . g ., the 0 - 8 mm range , are conveyed to the low energy image reconstruction processor 86 . optionally , the zero - th moment can be used to control filters 88 , 90 for discarding radiation which is clearly outside the energy range of either the positron emission radiation , compton scattered positrons , or the low energy radiation . the invention has been described with reference to the preferred embodiment . obviously , modifications and alterations will occur to others upon reading and understanding the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof .	6
turning first to fig1 there is shown a unitized food casing article 10 comprised of a sizing ring 25 packaged in one end of a shirred strand 44 . the terminal pleats of strand 44 are deshirred forming a pocket 50 for the sizing ring . after insertion of sizing ring 25 into the deshirred end of the casing , which casing has a diameter sufficient to accommodate the ring when fingers 14 of outer rim 12 are relaxed in an unflexed position , the terminal portion of the food casing is gathered and an end closure clip 52 applied . casing articles 10 comprised typically of fibrous casing formed of regenerated cellulose or other nonedible materials , are packaged in caddies for shipment to food processors for stuffing . the articles prior to packaging can be prepared with premoistened , ready - to - stuff casing which eliminates the need for a further moistening step prior to stuffing . alternatively , the casing article can be prepared at lower moisture content , e . g . 10 - 13 % based on total casing weight in which instance the casing article can be soaked in water by food processors prior to loading onto the stuffing horn for filling . the sizing ring is comprised of a central retaining ring 18 for connecting the device coaxially to stuffing horn 42 ( fig2 ). outer rim 12 of sizing ring 25 engages the inner wall of the casing diametrically stretching it . outer rim 12 is comprised of multiple resilient fingers 14 running parallel with the longitudinal axis of the stuffing horn . the rim of the ring is split into multiple fingers for greater flexibility . the flexible fingers 14 are retained in a retracted or relaxed position ( fig2 ) by an encircling resilient o - ring 16 at the outer peripheral edge of the sizing ring seated in a groove 17 which imparts inward pressure on fingers 14 . the encircling rubber o - ring 16 also exerts drag or holdback forces on the rate of release of casing 54 drawn from the horn during filling , particularly when the fingers are in a flexed position ( fig3 ). a wall 20 radially extending from the retaining ring 18 provides support and the means for expanding and relaxing fingers 14 , as required . the wall 20 is split into dual sections : a moveable exterior or rear portion 22 and a stationary interior or front portion 24 . the outermost section of the bifurcated wall 20 where the exterior and interior wall portions 22 and 24 respectively join forms a pivot 28 for the radial flexing of fingers 14 . the stationary interior wall portion 24 forms the fulcrum of the lever . thus , withdrawing the exterior wall portion 22 by pulling rearwardly results in slot 26 ( fig2 ) formed by walls 22 ans 24 to widen into slot 56 ( fig3 ) causing a radial flexing of fingers 14 at 360 °, and increased diametrical stretching of the sidewall of the casing 54 as it is drawn over the rim of the sizing ring . preferably , the exterior wall portion 22 is thick relative to the interior wall portion 24 , as best illustrated by fig2 and 3 . in mounting the sizing ring to the stuffing horn such that the interior wall portion is held stationary while the exterior wall portion is moveable for flexing rearwardly for adjusting the outward tension of fingers 14 , the retaining ring 18 has a dual snap ring connection . that is to say , the sizing ring has forward locking grooves 30 at the inner edge of the interior wall portion 24 and rearward locking grooves 32 at the inner edge of the exterior wall portion 22 . the forward locking grooves 30 snap connect with interconnecting land 40 of stationary tube 38 . tube 38 is shown as an inner sleeve member concentrically fitting over stuffing horn 42 . although tube 38 is shown as a lengthy sleeve , it is to be understood that a narrow ring with snap lock fittings can be used in place thereof . the rearward locking grooves 32 of the flexing exterior wall 22 connect with locking groove 36 of the outer concentric sleeve 34 . sleeve 34 operates as an axially moveable drive member over stationary sleeve 38 for transmitting energy to widen or narrow the gap between the bifurcated walls for increasing the decreasing the tension on the casing during filling . fluid motor means 58 ( fig4 ) with fluid lines 60 and 62 mounted upstream of the sizing ring at the inlet end of the stuffing horn supported by motor mount 64 provides the mechanical energy for adjusting sizing ring expansion through drive connector 66 and sleeve 34 . the sizing ring device of the present invention may be fabricated from approved plastics , such as polyolefins like higher density polyethylene , polypropylene , and the like . such materials are especially preferred for making low cost disposable rings . the present invention also contemplates the optional use of brake 46 of conventional design for regulating filled casing dimension and the rate of release of casing from the stuffing horn 42 as emulsion 48 is charged thereto . in operation of the casing presizer device described herein , a shirred strand of food casing is first inserted onto the stuffing horn . the leading end of the shirred strand nearest the horn outlet has the sizing ring inserted into a pocket formed from deshirred film which is locked into place on the stuffing horn . as emulsion is pumped into the casing , motor 58 is actuated to draw sleeve 34 slightly upstream causing an increase in radial tension in fingers 14 and further diametrical stretching of the casing . radial tension during stuffing operations may be increased or decreased for fine tuning product diameter by operation of motor 58 . although the invention has been described in considerable detail with respect to the preferred embodiments thereof , it will be apparent that the invention is capable of numerous modifications and variations to those skilled in the art without departing from the spirit and scope of the invention , as defined in the appended claims .	0
various embodiments of the present invention may be implemented with computer devices and systems that exchange and process data . elements of an exemplary computer system are illustrated in fig1 , in which the computer 100 is connected to a local area network ( lan ) 102 and a wide area network ( wan ) 104 . computer 100 includes a central processor 110 that controls the overall operation of the computer and a system bus 112 that connects central processor 110 to the components described below . system bus 112 may be implemented with any one of a variety of conventional bus architectures . computer 100 can include a variety of interface units and drives for reading and writing data or files . in particular , computer 100 includes a local memory interface 114 and a removable memory interface 116 respectively coupling a hard disk drive 118 and a removable memory drive 120 to system bus 112 . examples of removable memory drives include magnetic disk drives and optical disk drives . hard disks generally include one or more read / write heads that convert bits to magnetic pulses when writing to a computer - readable medium and magnetic pulses to bits when reading data from the computer readable medium . a single hard disk drive 118 and a single removable memory drive 120 are shown for illustration purposes only and with the understanding that computer 100 may include several of such drives . furthermore , computer 100 may include drives for interfacing with other types of computer readable media such as magneto - optical drives . unlike hard disks , system memories , such as system memory 126 , generally read and write data electronically and do not include read / write heads . system memory 126 may be implemented with a conventional system memory having a read only memory section that stores a basic input / output system ( bios ) and a random access memory ( ram ) that stores other data and files . a user can interact with computer 100 with a variety of input devices . fig1 shows a serial port interface 128 coupling a keyboard 130 and a pointing device 132 to system bus 112 . pointing device 132 may be implemented with a hard - wired or wireless mouse , track ball , pen device , or similar device . computer 100 may include additional interfaces for connecting peripheral devices to system bus 112 . fig1 shows a universal serial bus ( usb ) interface 134 coupling a video or digital camera 136 to system bus 112 . an ieee 1394 interface 138 may be used to couple additional devices to computer 100 . furthermore , interface 138 may be configured to operate with particular manufacture interfaces such as firewire developed by apple computer and i . link developed by sony . peripheral devices may include touch sensitive screens , game pads scanners , printers , and other input and output devices and may be coupled to system bus 112 through parallel ports , game ports , pci boards or any other interface used to couple peripheral devices to a computer . computer 100 also includes a video adapter 140 coupling a display device 142 to system bus 112 . display device 142 may include a cathode ray tube ( crt ), liquid crystal display ( lcd ), field emission display ( fed ), plasma display or any other device that produces an image that is viewable by the user . sound can be recorded and reproduced with a microphone 144 and a speaker 146 . a sound card 148 may be used to couple microphone 144 and speaker 146 to system bus 112 . one skilled in the art will appreciate that the device connections shown in fig1 are for illustration purposes only and that several of the peripheral devices could be coupled to system bus 112 via alternative interfaces . for example , video camera 136 could be connected to ieee 1394 interface 138 and pointing device 132 could be connected to usb interface 134 . computer 100 includes a network interface 150 that couples system bus 112 to lan 102 . lan 102 may have one or more of the well - known lan topologies and may use a variety of different protocols , such as ethernet . computer 100 may communicate with other computers and devices connected to lan 102 , such as computer 152 and printer 154 . computers and other devices may be connected to lan 102 via twisted pair wires , coaxial cable , fiber optics or other media . alternatively , radio waves may be used to connect one or more computers or devices to lan 102 . a wide area network 104 , such as the internet , can also be accessed by computer 100 . fig1 shows a modem unit 156 connected to serial port interface 128 and to wan 104 . modem unit 156 may be located within or external to computer 100 and may be any type of conventional modem , such as a cable modem or a satellite modem . lan 102 may also be used to connect to wan 104 . fig1 shows a router 158 that may connect lan 102 to wan 104 in a conventional manner . a server 160 is shown connected to wan 104 . of course , numerous additional servers , computers , handheld devices , personal digital assistants , telephones and other devices may also be connected to wan 104 . the operation of computer 100 and server 160 can be controlled by computer - executable instructions stored on a computer - readable medium 122 . for example , computer 100 may include computer - executable instructions for transmitting information to server 160 , receiving information from server 160 and displaying the received information on display device 142 . furthermore , server 160 may include computer - executable instructions for transmitting hypertext markup language ( html ) and extensible markup language ( xml ) computer code to computer 100 . as noted above , the term “ network ” as used herein and depicted in the drawings should be broadly interpreted to include not only systems in which remote storage devices are coupled together via one or more communication paths , but also stand - alone devices that may be coupled , from time to time , to such systems that have storage capability . consequently , the term “ network ” includes not only a “ physical network ” 102 , 104 , but also a “ content network ,” which is comprised of the data — attributable to a single entity — which resides across all physical networks . fig2 illustrates a system for assigning work to account collectors and monitoring and tracking work performed by account collectors , in accordance with an embodiment of the invention . collections data module 202 may be configured to communicate collections data in the form of a spreadsheet , xml document , text document or any other file or files that contain account information to an input module 204 , which in turn may be configured to retrieve collection data from the file and place the data into a database 206 . collection data may be stored as collection records 208 within database 206 . in one embodiment input module 204 is configured to parse a spreadsheet or xml file to retrieve collections data . a management module 210 may be included to allow a team leader or other person to assign accounts to account collectors . in one embodiment , management module 210 generates one or more graphical user interfaces that allow a team leader to set account assignment rules . an exemplary graphical user interface is shown in fig4 and is described below . the rules determine how accounts will be assigned to account collectors . the rules may also be used to set priorities . for example , a set of rules may be configured to analyze accounts that fall within a 90 days overdue bucket and prioritize accounts that have balances that total 60 % of the total balance for the bucket . similarly , the set of rules may be configured to analyze accounts that fall within 60 , 30 and 0 days overdue buckets and prioritize accounts that have balances that total 80 % of the total balance for the bucket . a rules module 212 may be implemented with a rules engine that processes collection data in accordance with rules set by a team leader to assign accounts to account collectors and prioritize accounts . database 206 may include account assignments 228 . a central processor 214 may be included to control the system shown in fig2 . central processor may be implemented with a conventional microprocessor or control logic . at least some of the modules shown in fig2 may be implemented with computer - executable instructions that are executed by central processor 214 . a reports module 216 may be included to track results and generate reports . database 206 may store results 218 . reports module 216 may generate employee reports 220 , team leader reports 222 , manager reports 224 , administrator reports 226 or any other type of report that shows information such as results , status or performance of the collection process . exemplary reports are described below . although not explicitly shown in fig2 , the report ( s ) thus generated by the reports module may be communicated to one or more category of user i . e . employee , team leader , manager , administrator etc ., via user terminal ( s ). the user terminal may include any device suitable for presenting data and in accepting input from the user . by way of example , the user terminal can be selected from the group comprising of personal computer , laptop computer , mainframe computer , dumb terminal , data display , internet browser , personal digital assistant ( pda ), two - way pager , wireless terminal , portable telephone , or any other form of networked personal computing device . one skilled in the art will appreciate that the system shown in fig2 may be implemented with a variety of software and hardware components . by way of example , one or more modules of the system illustrated in fig2 may be implemented using , but not limiting to , programmable logic arrays , application specific integrated circuits ( asics ) or other techniques known to those of skill in the art . moreover , the functions performed by the modules shown may be combined into fewer modules or distributed across additional modules . database 206 may be implemented with a conventional database that includes an index or any other collection of data that is arranged for retrieval by a computer device . also , one or more modules of the system may be located at one or more different locations , such as different machines which may communicate with each other using any of the conventional technique . by way of example , the collections data module may reside on a different machine . fig3 illustrates a graphical user interface 300 that may be used to import collections data , in accordance with an embodiment of the invention . the collections data may be in the form of a spreadsheet that lists accounts and account details . a user may identify the upload type by making an appropriate selection in drop down menu 302 . the type may identify the format of the document being uploaded . a browse icon 304 may be selected to search files stored on a computer , network or external device . in various embodiments collection data may be geographic specific . the format of a document from one geographic region may be different from the format of similar documents from other geographic regions . a row of geographic identifiers 306 may be included to identify the geographic region of the collections data that will be imported . alternative , geographic identifiers may be included in drop down menu 302 . after all of the selections are made , an import icon 308 may be selected to import the collections data . when the collections data is in spreadsheet , for example , the software application may use the information provided in graphical user interface 300 to parse the entries in the spreadsheet and add collections records to a database , such as database 206 . fig4 illustrates a graphical user interface 400 that may be used by a team leader or other entity to redistribute accounts among account collectors , in accordance with an embodiment of the invention . graphical user interface 400 may be generated by management module 210 ( shown in fig2 ). a total number of accounts meeting criteria identified in column 402 is displayed in region 404 . column 402 may include drop down menus , buttons , text regions or any other conventional input tools to identify a subset of accounts . a drop down menu 406 allows a user to select accounts based on current assignments or lack of an assignment . marketing flag , diary number and account code information may be provided in input fields 408 and 410 . status information may be provided with drop down menu 412 . status may include closed , work in progress , internal issues or any other identifier that is used to identify the status of an account . disposition code information may be provided with drop down menu 414 . disposition codes may include broken promise , call back , do not chase , disputed debt , legal , left voice message , no contact available , paid , pre - legal or any other code used to identify the disposition of an account . drop down menu 416 may be used to identify buckets of accounts , such as accounts that are current , 30 days overdue , 60 days overdue , 90 days overdue , 180 days overdue and 270 days overdue . a drop down menu 418 may be used to identify account collectors to whom the accounts will be assigned . a go icon 420 is used to complete redistribute the accounts among account collectors . fig5 illustrates an alternative graphical user interface 500 that may be used by a team leader or other entity to redistribute accounts among account collectors based on aged debt , in accordance with an embodiment of the invention . a drop down menu 502 may be used to identify a percentage of accounts and a drop down menu 504 may be used to identify an aged account bucket , such as current , 30 days overdue , 60 days overdue , 90 days overdue , 180 days overdue and 270 days overdue . in another embodiment a user interface element may be included to allow a user to select a quantity of accounts instead of a percentage of accounts . fig6 illustrates an account collector &# 39 ; s action user interface 600 , in accordance with an embodiment of the invention . a status region 602 displays a number of accounts that have been processed and a total number of accounts . in the example shown the account collector has processed 3 accounts out of a total of 546 accounts . this data may be updated in real time . account information is shown in region 604 and action information is shown in region 606 . action information may include the review date , comments , disposition code and review time . of course additional or alternative information may be included to indicate what action was taken by the account collector . a view next actions hyperlink 608 may be linked to a page that shows a list of actions , such as page 700 shown in fig7 . an invoice details tab 610 may be selected to display a graphical user interface that shows invoice details . fig8 illustrates an exemplary graphical user interface 800 that shows invoice details , in accordance with an embodiment of the invention . one skilled in the art will appreciate that a variety of invoice details may be displayed , such as invoice number 802 , invoice date 804 , amount of the invoice 806 , invoice type 808 , due date 810 and amount paid 812 and realization date 814 . realization date 814 is a date on which a customer promises to make a payment . returning to fig6 , an actions on hold tab 612 may be selected to access a list of actions on hold . an action may be placed on hold , for example , if a customer requests that the account collector call the customer gain in 10 minutes . in one embodiment of the invention , an account collector must act on all of the actions listed in the actions on hold list before logging off of the system for the day . in another embodiment of the invention , any actions listed in the actions on hold list at the end of a shift are identified as the highest priority actions at the beginning of the account collector &# 39 ; s next shift . fig9 illustrates a graphical user interface 900 that may be used to generate reports , in accordance with an embodiment of the invention . section 902 allows for the selection of managers , assistant mangers , team leaders and employees . in some embodiments section 902 is a function of the rights belonging to a logged in user . for example , if an assistant manger is logged into the system , the assistant manger will see drop down menus for team leaders and employee . section 904 allows for the selection of report criteria . of course , additional or fewer selection criteria may be included to generate reports based on any of the information included in database 206 ( shown in fig2 ). fig1 illustrates an exemplary graphical user interface that includes a mechanism for a team leader or other entity to add comments that will be viewable by collectors . an add comments icon 1002 may be selected to allow for the insertion of comments . team leaders and others may add comments when reviewing the processed accounts . this option enables the team leaders to guide and coach collectors by inputting their comments in the provided field where by the account collectors will be able to read the comments from their home page or another page . fig6 , for example , includes a field 614 that may be used to show team leader comments . the addition of comments helps account collectors adopt the proper or preferred strategies . fig1 illustrates an exemplary report 1100 that may be generated by report module 216 ( shown in fig2 ). report 1100 includes values for cash targets and cash collected for a group of account collectors . reports help team leaders and others set the collector parameters that may include predefined diary / market flag , cash target for the month and month to date cash collected information . the present invention has been described herein with reference to specific exemplary embodiments thereof . it will be apparent to those skilled in the art that a person understanding this invention may conceive of changes or other embodiments or variations , which utilize the principles of this invention without departing from the broader spirit and scope of the invention as set forth in the appended claims . all are considered within the sphere , spirit , and scope of the invention .	6
referring to fig2 a and 2b , an exemplary polysilicon metal silicide wiring structure according to the present invention is shown . fig2 a is a top - down view and fig2 b is a vertical cross - sectional view of along the plane b - b ′ in fig2 a . two p - type mosfets and two n - type mosfets are shown on a semiconductor substrate 210 . each of the two p - type mosfets comprises p + doped source and drain regions 261 , a gate dielectric 230 , a block of p + doped polysilicon 231 , and a block of p + doped polysilicon metal silicide 241 . each of the two n - type mosfets comprises n + doped source and drain regions 262 , a gate dielectric 230 , a block of n + doped polysilicon 232 , and a block of n + doped polysilicon metal silicide 242 . connections between adjacent mosfets are formed by extensions of the gate conductor that are substantially a stack of a block of undoped polysilicon 233 and a block of undoped polysilicon metal silicide 243 . the blocks of p + doped polysilicon 231 , the blocks of p + doped polysilicon metal silicide 241 , the blocks of n + doped polysilicon 232 , the block of n + doped polysilicon metal silicide 242 , the blocks of undoped polysilicon 233 , and the blocks of undoped polysilicon metal silicide 243 collectively form a gate line . to form the block of p + doped polysilicon 231 and the block of n + doped polysilicon 232 , an undoped polysilicon layer is deposited over the gate dielectric layer 230 and over a shallow trench isolation 220 , lithographically patterned , and etched . implantation of p - type dopants with a first mask and implantation of n - type dopants with a second mask follow . the first mask allows the p - type dopants into multiple “ p - type implant areas ” 251 that include a portion of the sti area that surrounds the pfets , while blocking the p - type dopants outside the p - type implant area 251 . unlike the prior art , however , each active area that contains a pfet has a p - type implant area 251 that does not adjoin a neighboring p - type implant area . in other words , each of the active areas for a pfet surrounded by the sti 220 has a unique p - type implant area 251 . adjacent p - type implant areas do not overlap one another . the second mask allows the n - type dopants into multiple “ n - type implant areas ” 252 that include the sti area that surrounds the nfets while blocking the n - type dopants outside the n - type implant area 252 . unlike the prior art , however , each active area that contains an nfet has an n - type implant area 252 that does not adjoin a neighboring n - type implant area . in other words , each of the active area for an nfet surrounded by the sti 220 has a unique n - type implant area 252 . adjacent n - type implant areas do not overlap one another . furthermore , edges of the p - type implant areas 251 do not overlap edges of the n - type implant areas 252 . therefore , if an active area for a pfet is located adjacent to the active area for an nfet , the associated p - type implant area 251 does not overlap the associated n - type implant area 252 . in summary , each of the active areas has an associated implant area ( 251 , 252 ) that does not overlap any other implant area ( 251 , 252 ) according to the present invention . the lack of overlap between the multiple implant areas creates an area over the sti 220 that does not receive any ion implantation . the portions of the polysilicon that is located within the area without any ion implantation remains undoped . thus , by not implanting any dopant ions into at least one portion of the polysilicon , a block of undoped polysilicon 233 is formed according to the present invention . the patterning of the polysilicon may precede or follow the implantation of the dopants . the implantation into and patterning of the deposited polysilicon forms gate lines , which at this point comprises doped polysilicon and undoped polysilicon . unlike the prior art , deposition of a heavily doped polysilicon of one dopant type followed by an implantation of dopants of the opposite dopant type to reverse the type of doping in a portion of the deposited heavily doped polysilicon may not be used according to the present invention since such a processing sequence does not form an undoped polysilicon , i . e ., polysilicon material substantially without dopants . typically , spacers ( not shown ) are formed around the gate lines . a metal layer comprising a silicide forming metal , for example cobalt , tantalum , titanium , nickel , other refractory metal or an alloy thereof , is subsequently deposited and reacted to form silicides . the reacted metal layer forms a metal silicide ( not shown ) on the p + doped or n + doped source and drain regions ( 261 , 262 ). the reacted metal layer also forms a block of p + doped polysilicon metal silicide 241 on top of the block of p + doped polysilicon 231 and a block of n + doped polysilicon metal silicide 242 on top of the block of n + doped polysilicon 232 much the same way as in the prior art . according to the present invention , however , a block of undoped polysilicon 233 is present in the gate lines as shown in fig2 a and 2b . the portion of the portion layer on the block of undoped polysilicon 233 reacts with the underlying undoped polysilicon 233 to form a block of undoped polysilicon metal silicide 243 . as noted before , the properties of an undoped polysilicon metal silicide 243 is superior in terms of its reduced susceptibility to defect generation to the properties of the p + doped polysilicon metal silicide or to the properties of the n + doped polysilicon metal silicide . the overlap between the block of p + doped polysilicon 231 with the sti 220 is preferably less than 40 nm , and more preferably less than 20 nm , and most preferably less than 10 nm . similarly , the overlap between the block of n + doped polysilicon 232 with the sti 220 is preferably less than 40 nm , and more preferably less than 20 nm , and most preferably less than 10 nm . since the edges of the block of p + doped polysilicon 231 coincides with the edges of the block of p + doped polysilicon metal silicide 241 , the overlap between the block of p + doped polysilicon metal silicide 241 with the sti 220 is preferably less than 40 nm , and more preferably less than 20 nm , and most preferably less than 10 nm . also , the edges of the block of n + doped polysilicon 232 coincides with the edges of the block of n + doped polysilicon metal silicide 242 , and consequently , the overlap between the block of n + doped polysilicon metal silicide 242 with the sti 220 is preferably less than 40 nm , and more preferably less than 20 nm , and most preferably less than 10 nm . in the exemplary polysilicon metal silicide wiring structure according to the present invention in fig2 a and 2b , each of the active area for a pfet comprises a stack of a block of p + doped polysilicon 231 and a block of p + doped polysilicon metal silicide 241 over a gate dielectric 230 . similarly , each of the active area for an nfet comprises a stack of a block of n + doped polysilicon 232 and a block of n + doped polysilicon metal silicide over a gate dielectric 230 . in addition , between each active area , a stack of a block of undoped polysilicon 233 and a block of undoped polysilicon metal silicide 243 is located on the underlying sti . therefore , on one side of each of the stacks of the block of undoped polysilicon 233 and the block of undoped polysilicon metal silicide 243 is a stack of a first block of doped polysilicon ( 231 or 232 ) and a first block of doped polysilicon metal silicide ( 241 or 242 ). the first doped polysilicon adjoins the block of undoped polysilicon at a boundary 290 and the first doped polysilicon metal silicide ( 241 or 242 ) adjoins the block of undoped polysilicon metal silicide 243 . preferably , the boundary 290 is located on the sti to avoid adverse effects on the mosfet formed on the active area . this is because a decrease or a lack of dopants in the gate polysilicon over the active area degrades the performance of the mosfet by a high resistance of the gate material and by high depletion of free carriers in the gate material nearby the channel . in a typical mosfet structure , a gate dielectric directly contacts the block of doped polysilicon ( 232 or 232 ). on the opposite side of the stack of the block of undoped polysilicon 233 and the block of undoped polysilicon metal silicide 243 , a similar stack of a second block of doped polysilicon ( 231 or 232 ) and a second block of doped polysilicon metal silicide ( 241 or 242 ) contacts the stack of the block of undoped polysilicon 233 and the block of undoped polysilicon metal silicide 243 . the second block of doped polysilicon ( 231 or 232 ) adjoins the block of undoped polysilicon 233 at another boundary 290 and the second doped polysilicon metal silicide ( 241 or 242 ) adjoins the block of undoped polysilicon metal silicide 243 . preferably , the boundary 290 is located on the sti to avoid adverse effects on the mosfet formed on that active area . all combinations of dopant types are possible for the first doped polysilicon ( 231 or 232 ) and for the second doped polysilicon ( 231 or 232 ). in a first case , the first doped polysilicon may be p + doped and the second doped polysilicon may be p + doped . in a second case , the first doped polysilicon may be p + doped and the second doped polysilicon may be n + doped . in a third case , the first doped polysilicon may be n + doped and the second doped polysilicon may be p + doped . in a fourth case , the first doped polysilicon may be n + doped and the second doped polysilicon may be n + doped . in contrast to the prior art in which a block of doped polysilicon adjoins another block of doped polysilicon of the opposite doping , a block of doped polysilicon adjoins a block of undoped polysilicon according to the present invention . similarly , in contrast to the prior art in which a block of doped polysilicon metal silicide formed out of a reaction of a metal with a doped polysilicon of one doping type adjoins another block of doped polysilicon metal silicide formed out of a reaction of the metal with another doped polysilicon of the opposite doping type , a block of doped polysilicon metal silicide adjoins a block of undoped polysilicon metal silicide according to the present invention . while the invention has been described in terms of specific embodiments , it is evident in view of the foregoing description that numerous alternatives , modifications and variations will be apparent to those skilled in the art . accordingly , the invention is intended to encompass all such alternatives , modifications and variations which fall within the scope and spirit of the invention and the following claims .	7
referring to fig1 there is shown an x - ray tube 10 . in accordance with conventional practice , tube 10 generally includes a metal housing 12 which supports other x - ray tube components including a cathode 14 , and also provides a protective vacuum enclosure therefor . cathode 14 directs a high energy beam of electrons 16 onto a target track 18 of an anode 20 , which consists of a refractory metal disk and is continually rotated by means of a conventional mounting and drive mechanism 22 . target track 18 has an annular or ring - shaped configuration and typically comprises a tungsten based alloy integrally bonded to the anode disk 20 . as anode 20 rotates , the electron beam from cathode 14 impinges upon a continually changing portion of target track 18 to generate x - rays , at a focal spot position 24 . a beam of x - rays 26 generated thereby is projected from the anode focal spot through an x - ray transmissive window 27 provided in the side of housing 12 . in order to produce x - rays as described above , there must be a potential difference on the order of 100 kilovolts between cathode 14 and anode 20 . in a monopolar tube arrangement this is achieved by connecting the anode to a ground ( not shown ), and applying power at the required 100 kilovolt range to cathode 14 through an electric cable 28 . because of the high voltage carried by cable 28 , it is necessary to use an hv connector 30 in coupling the cable to cathode 14 . the connector 30 and its interconnection with cable 28 is shown in greater detail in fig2 . referring to fig2 there is shown hv connector 30 provided with a housing 32 , which is usefully formed of aluminum and is joined to tube housing 12 , such as at an end thereof . fig2 further shows hv cable 28 comprising electric conductor or conductors 34 positioned along the center of the cable , and a layer of hv insulation 36 surrounding conductors 34 . as stated above , there may be a single solid conductor 34 or a number of conductors , as shown in fig2 . conductors 34 usefully comprise copper , and insulator 36 usefully comprises a material such as ep rubber . such material provides hv cable 28 with flexibility , and at the same time provides sufficient insulation for the high voltage electric power carried thereby . referring further to fig2 there is shown cable 28 inserted into hv connector 30 , through an aperture in connector housing 32 . conductors 34 extend beyond the end of insulation layer 36 , and as shown by fig1 are directed through tube housing 12 and mated with an electric coupling element 38 , joined to cathode 14 . coupling element 38 and cathode 14 are supported in place by insulating structure 40 , inserted into the end of tube 10 and formed of ceramic material or the like . in order to insulate the exposed end portion of conductors 34 , that is , the portion extending between the end of epr insulator 36 and ceramic insert 40 within tube 10 , fig2 shows hv connector housing 32 filled with electrical insulating material such as epoxy 42 . however , as is well known in the art , substantial amounts of heat are generated by operation of x - ray tube 10 . some of this heat is directed toward insert 40 and hv connector 30 , as illustrated by the leftward - directed arrows of fig2 . while ceramic insert 40 is a comparatively good thermal conductor , the epoxy insulation 42 of connector 30 is a very poor thermal conductor . accordingly , the epoxy 42 acts as a thermal barrier . in order to dissipate heat projected toward connector 30 from within the tube 10 , and to prevent such heat from raising the temperature of connector 30 to an unacceptable level , fig2 and 3 show an elongated heat transfer device 44 placed within cable 28 and connector 30 . the heat transfer device 44 comprises a heat pipe or like device of extremely high thermal conductivity , as described hereinafter in further detail in connection with fig4 . fig2 and 3 show heat transfer device 44 positioned in closely spaced relationship with conductors 34 , and extending along a portion of the length thereof . more particularly , fig2 shows transfer device 44 having an end 44 a positioned close to insert 40 , and thus close to the heat received therethrough , and further shows the opposing end 44 b of device 44 extending outward from connector housing 32 . if a location along the transfer device 44 is at a different temperature than another location , the device 44 will operate to rapidly transfer heat from the location of higher temperature to the location of lower temperature . thus , device 44 readily serves to transfer excessive heat from regions proximate to its end 44 a , close to insert 40 , to its opposing end 44 b . even though opposing end 44 b is within insulating layer 36 , it lies outside the epoxy layer 42 of connector 30 , so that heat can readily be dissipated therefrom into housing 32 , and radiated by the housing into the surrounding air . the transfer of heat by device 44 is passive . thus , the heat transfer device 44 of connector 30 provides simple and effective cooling , while maintaining essential electrical characteristics required for the connector . to illustrate operation of a heat transfer device , fig4 shows a heat transfer device 46 comprising a length of copper tubing or conduit , which is tightly closed or sealed at its ends to form a vacuum tight vessel . device 46 is similar or identical to heat transfer device 44 of fig2 except that device 44 is provided with an angled bend along its length whereas device 46 has a linear configuration . the vacuum tight vessel of heat transfer device 46 is evacuated and partially filled with a working fluid 52 , such as water , and is usefully of circular cross section . fig4 further shows a porous metal wicking structure 50 , which is joined to the inner wall or surface 48 a of copper conduit 48 . wicking structure 50 is usefully formed of a porous material , such as a material comprising small copper pellets or beads which are sintered together . wick structure 50 is configured to surround or define a passage 54 which extends along the length of transfer device 46 . by providing a heat transfer device with the construction shown in fig4 such device is enabled to transfer heat by respective evaporation and condensation of working fluid 52 . more particularly , if point 46 a along device 46 is at a higher temperature than a location 46 b spaced apart therefrom , heat is inputted through conduit 48 into the interior thereof , proximate to location 46 a . as a result , fluid 52 is vaporized in passage 54 proximate to location 46 a . this creates a pressure gradient in passage 54 , between a region proximate to location 46 a and a cooler region proximate to location 46 b . this pressure gradient forces the vaporized fluid to flow along passage 54 to the cooler region , where it condenses to a liquid and gives up its latent heat of vaporization . the working fluid 52 , now in liquid form , then flows in the opposite direction along device 46 , back toward location 46 a , through the porous wick structure 50 . such fluid motion is caused by capillary action in the wick structure , or by gravity if device 46 is oriented to decline downwardly from location 46 b to location 46 a . usefully , a heat transfer device 44 or 46 comprises a device which is similar to a product sold by thermacore inc . and referred to commercially thereby as a heat pipe . devices of such type may have an effective thermal conductivity which exceeds the thermal conductivity of copper by more than 10 3 times . referring to fig5 there is shown an alternative embodiment of the invention , comprising an hv connector 56 , which for reasons set forth hereinafter significantly reduces the electric field , in comparison with the previously described embodiment . the embodiment of fig5 also enhances uniformity of the electric field , that is , causes the field to be less non - uniform . connector 56 , in like manner with connector 30 , is provided with an aluminum housing 32 filled with a layer of epoxy 42 , and cable 28 is passed through connector 56 , from a location outside the connector into x - ray tube 10 . connector 56 is also provided with a heat transfer device 60 extending along a portion of the cable 28 . as best shown by fig6 and 7 , transfer device 60 comprises a sealed copper conduit 58 of circular cross - section and a porous wick structure 62 joined thereto , similar to conduit 48 and wick structure 50 , respectively , of heat transfer device 46 described above . wick structure 62 defines a passage 64 along transfer device 60 which contains water or other working fluid 66 . however , the diameter of heat transfer device 60 is substantially greater than the diameter of transfer device 44 , whereby device 60 can be positioned around cable conductors 34 rather than placed alongside them . more particularly , conduit 58 of device 60 , as shown by fig6 and 7 , is positioned in coaxial relationship with cable 28 , so that cable conductors 34 extend through the center of conduit 58 , proximate to the axis thereof . referring further to fig6 and 7 , there is shown heat transfer device 60 provided with a cylindrical sleeve 68 , formed of copper or the like , which extends along conduit 58 in coaxial relationship . sleeve 68 is placed around conductors 34 in closely spaced relationship , and its ends ( not shown ) are seably joined to corresponding ends ( not shown ) of conduit 58 . accordingly , passage 64 through transfer device 60 comprises a sealed interior space which is separated from conductors 34 by the sleeve 68 . fig6 and 7 further show the space between conductors 34 and the inner surface of sleeve 68 filled with a material 70 . in one embodiment , material 70 comprises metal powder filled epoxy or other conductive material . in such embodiment sleeve 68 and conduit 58 of heat transfer device 60 are electrically connected to the cable conductors 34 , and are thus at the same voltage u , such as 100 kv . as is known by those of skill in the art , the electric field of a conductive cylinder is inversely proportional to the cylinder radius r . accordingly , by electrically connecting conduit 58 to conductors 34 , the electric field around transfer device 60 will be determined by the radius of conduit 58 rather than the radius of conductors 34 . since the radius of conduit 58 is substantially greater , the electric field will be significantly reduced . moreover , the circular cross - section of conduit 58 provides a much more uniform e - field than the generally elliptical or irregular shaped cross - section of the cable conductors 34 and heat transfer device 44 . in an alternative embodiment , the material 70 shown in fig6 and 7 comprises an epoxy which principally serves as an insulator , but is also selected to have a conductivity which is slightly greater than the conductivity of insulation layer 36 surrounding heat transfer device 60 , as shown in fig5 and 6 . as a result , there will be a first voltage potential between cable conductors 34 and conduit 58 of device 60 , and a second voltage potential between conduit 58 and the outer surface of insulating layer 36 . for example , by judicious selection of the conductivity of material 70 , the first voltage potential could be on the order of 20 kv , and the second voltage potential could be on the order of 80 kv . such configuration provides a graded insulating system , from conductors 34 through device 60 to the outer edge of insulating layer 36 , to optimize the overall electric field distribution inside connector 56 . referring further to fig5 there is shown an end of heat transfer device 60 proximate to aluminum housing 32 , rather than extending outward therethrough . this arrangement enables device 60 to readily transfer heat from the interior of connector 56 to connector housing 32 , which effectively dissipates heat into the surrounding air . proper termination of the end , and maintenance of a sufficient high voltage clearance between the end of device 60 and housing 32 , are necessary to provide an acceptable design margin . in another arrangement , the bend or elbow in device 60 may be eliminated . referring to fig8 there is shown an alternative construction for heat transfer device 60 . instead of a wick structure 62 surrounding a passage 64 , a wick structure 72 is provided which extends from conduit 58 to sleeve 68 . a number of passages 74 are formed through the wick structure , equally spaced around the sleeve 68 , to carry vaporized working fluid as described above . referring to fig9 there is shown a heat transfer arrangement 76 , which may be used in connector 56 instead of the heat transfer device 60 described above . transfer arrangement 76 comprises a sleeve 78 , formed of copper or other conductive material , which is positioned around and extends along the conductors 34 within connector 56 , in coaxial relationship therewith . a number of heat transfer devices 80 , each similar to transfer device 44 , are equally spaced around the inner surface of sleeve 78 . while not shown , each of the transfer devices 80 is bended or angled as necessary to extend along sleeve 78 , in generally parallel relationship with the axis thereof . fig9 further shows notches 82 formed in sleeve 78 , to accommodate respective transfer devices 80 . by placing the transfer devices 80 around conductors 34 in the symmetrical arrangement shown in fig9 desirable electric field effects are achieved , similar to those described above in connection with transfer device 60 . however , the configuration of fig9 should have significantly less cost . referring further to fig9 there is shown the space between conductors 34 and sleeve 78 filled with material 70 as described above . obviously , many other modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the disclosed concept , the invention may be practiced otherwise than as has been specifically described .	5
before entering into a detailed description , the basic principle of the present invention will be referred to : when the images appearing on the tv screen are to be hard - copied , the copying speed is normally slower than the scanning speed of the video signals . as a result , it is necessary to convert the video signals into any suitable signals corresponding thereto , and store them in a memory temporarily . finally , the stored signals are read out for print - out . with this concept in mind the present invention has been made , and will be described in greater detail : referring to fig1 there is provided an a / d ( analog / digital ) converter i which receives video signals v in analog form in a tv receiver at its input , and outputs digital gradation density signals in response to the input video signals v , wherein the gradation density signals are divided into a predetermined number of levels against the density of the video signals v ; a memory ii , which stores the gradation density signals from the a / d converter ; a read - out control circuit iii which reads out the gradation density signals stored in the memory ; and a printer iv which prints out the signals read out by the read - out control circuit . the a / d converter can be any type if it can output 16 gradation density signals , such as &# 34 ; 0000 &# 34 ;, &# 34 ; 0001 &# 34 ;, . . . , &# 34 ; 1101 &# 34 ;, . . . , &# 34 ; 1111 &# 34 ; so as to represent 16 - gradated densities in response to the video signals . a / d converters available in the market are effectively applicable . for the memory ii a random - access - memory ( ram ) can be effectively used . first , reference will be made to a first method of writing the gradation density signals in the memory ii under the above - mentioned system : the gradation density signals from the a / d converter are stored in a shift register , and each of a plurality of picture elements , such as 4 elements , is written in its corresponding ram of 4 sets of rams . under this method , if the sampling is performed in one scanning line at 167 nsec . the picture elements in the scanning line will amount to 280 . there are 234 scanning lines in one video field . as a result , four rams each having 16 kbits are required . in addition , each of the picture elements has 16 - gradated densities . accordingly , four sets of rams are provided , and as a whole sixteen rams constitute the memory ii . a second method of writing in the memory ii is performed by a page - mode access method . according to this method , at first a row address strobe signal ( hereinafter referred to as ras signal ) is made &# 34 ; 1 &# 34 ;, thereby providing a row address signal , and for the row address a column address strobe signal ( hereinafter referred to as cas signal ) is periodically made &# 34 ; 1 &# 34 ;. each time when it is made &# 34 ; 1 &# 34 ;, the column address signal is given , thereby effecting the column addressing . this page - mode address method is advantageous in that after a row address signal has been given , it is no longer necessary to repeat it , and it has only to give column address signals . this facilitates real - time writing . according to this method , it is possible to store gradation density signals for one video field in the four 64 - kbit rams , thereby reducing the required number of rams . advantageously , four rams are effectively sufficient , which leads to simplicity and economy in production , particularly in comparison with the first - mentioned method under which each four picture elements are written in four rams at the same time . however , under the page - mode access method a period of time for which the ras signal is &# 34 ; 0 &# 34 ; is 10 μsec at maximum . furthermore , the 64 - kbit ram has a disadvantage that if the column addresses exceed 256 addresses , it becomes necessary to give new address signals because of the change in the column address . as a result , it is required to change the ras signals into &# 34 ; 1 &# 34 ; several times within one scanning line , and while it is &# 34 ; 1 &# 34 ;, no data can be written in . the mere employment of the page - mode access method cannot solve this problem . in this case , it is likely that the pictures are void of the picture elements correspond to the unwritten data , which resulting in the abnormal images . a third method of writing in the memory ii is achieved as follows : the gradation density signals obtained from the video signals are temporarily stored in the ram under the page - mode access method , and the stored signals are read out for print - out , wherein the gradation density signals are input to a shift register , and wherein an output signal from the shift register which is delayed relative to the previous output therefrom by a period of time for which the ras signal is selected for input to the ram after each row address signal is generated in one scanning line of the video signals . according to this method the images of the tv receiver are automatically printed out with the use of a small number of rams . in addition , the images on the print are very normal . this third method of writing in the memory ii will be more particularly described with reference to fig2 and 3 : the reference numerals 1a to 1d each designate serial writing data , which is each bit of 4 - bit gradation density signals . as described above , these gradation density signals are those which are obtained by converting video signals into digital signals by the a / d converter , and consist of sixteen signals of &# 34 ; 0000 &# 34 ;, . . . , &# 34 ; 1111 &# 34 ; so as to represent 16 - gradated densities corresponding to the video signals . the reference numeral 2 designates a clock pulse generater which generates clock signals having a period of 167 nsec . the reference numeral 3 designates a counter which counts the clock signals for a period of time when the count - enable signal a is input thereto , an example of which is illustrated in fig3 . in fig3 the reference symbols cg7 to cg15 designate logic gates , and the reference symbols cf6 to cf8 designate flip - flops , respectively . there are provided four shift registers 4 , to each of which the writing data 1a to 1d are input at timings of its own clock signals . the data 1a to 1d are output from the output qa of each shift register 4 , whereas from each of the outputs qb to qf the data 1a to 1d are output with a delay of a predetermined time . an example of the shift register 4 is illustrated in fig4 . in fig4 showing a 6 - bit shift register , the reference symbols sg20 to sg22 designate logic gates , and the reference symbols sf1 to sf3 designate flip - flops , respectively . the reference numeral 5 designates multiplexers located in opposition to the outputs qa to qf of the shift registers 4 , the multiplexers selectively outputting signals from the outputs qa to qf in accordance with the values counted by the counter 3 , an example of which is illustrated in fig5 . in fig5 showing a 6 - bit multiplexer , the reference symbols sg8 to sg14 designate logic gates , and the reference symbols st10 to st11 designate logical circuits , respectively . in the fig2 the shift registers and the multiplexers to which the data 1c and 1d are to be input are omitted for simplicity . there is provided a video memory 6 , which stores gradation density signals to be printed out . the outputs from the multiplexers 5 are input to the video memory 6 , which consists of four 64 - kbit rams . the reference numeral 7 designates a ras / cas control circuit , which delivers to the video memory 6 ras signals ( row address strobe signals ) and cas signals ( column address strobe signals ), and generates address switching signal b . the reference numeral 8 designates an address counter , which counts up clock signals and generates an 8 - bit row address signal as the upper address as well as an 8 - bit column address signal as the lower address , an example of which is illustrated in fig6 . in fig6 the reference symbols jg1 to jg53 designate logic gates , the reference symbols ko9 to ko17 designate logical circuits , and the reference symbols kf9 to kf19 designate flip - flops , respectively . the reference numeral 9 designates an address switching circuit , which delivers to the video memory 6 either the row address signal or the column address signal in accordance with an address switching signal b from the ras / cas control circuit 7 , wherein the row or the column address signal is delivered from the address counter 8 . an example of the address switching circuit 9 is illustrated in fig7 . in fig7 the reference symbols sg6 and sg7 designate logic gates , the reference symbols st2 to st9 designate flip - flops , respectively . the reference numeral 10 designates an address decoder , to which the column address signal is input , and which outputs the signal &# 34 ; 1 &# 34 ; each time when thirty - two column addresses are output therefrom . the address decoder 10 is constituted by a nor circuit . the reference numeral 11 designates a flip - flop , which outputs the signal &# 34 ; 1 &# 34 ; in synchronism with the next clock from the clock pulse generator 2 in response to the signal &# 34 ; 1 &# 34 ; output by the address decoder 10 . the signal &# 34 ; 1 &# 34 ; of the flip - flop 11 becomes a count - disenable signal c and a control signal d directed to the ras / cas control circuit 7 . in fig1 the frame defined by dotted lines 12 is an writing address control circuit . this circuit 12 is designed to deliver row address signals to the video memory 6 , at each beginning of the row and subsequently at time - intervals not exceeding 10 μsec for the same row , and also to count up and deliver column address signals except when it delivers the row address signals . the reference numeral 13 designates a read - out control circuit which reads out the gradation density signals stored in the video memory 6 , which includes a memory section in which such a time table as shown in fig8 is stored , a cpu including a counter capable of counting up the counts corresponding to the transfer time shown in fig8 stored in the memory section , wherein one count is 5 . 5 μs , and a head drive circuit operating on the output from the cpu . for example , when a &# 34 ; 0100 &# 34 ; signal whose gradation density is 4 is output from the video memory 6 , the 1st to 4th gradation density patterns ( hereinafter referred to as gdp1 to gdp4 ) are represented by signal &# 34 ; 1 &# 34 ;, whereas 5th to 15th gradation density patterns ( gdp5 to gdp15 ) are represented by signal &# 34 ; 0 &# 34 ; in the cpu , and the output &# 34 ; 1 &# 34 ; is output from the counter in the cpu for a period of time which corresponds to the sum of the transfer times for gradation density patterns for which the signal is made &# 34 ; 1 &# 34 ;, that is , the patterns from gdp1 to gdp4 in this case , with which output &# 34 ; 1 &# 34 ; the head drive circuit is driven . fig1 shows a flow chart of the operation in sequence of the read - out control circuit 13 . the reference numeral 14 designates a printer which prints out the signals read out by the read - out control circuit 13 . the printer can be a thermal printer with a thermal head . the paper on which data is printed is susceptible to temperature , and changes its color density as shown in fig1 . the temperature of the thermal head is proportional to the applied voltage squared and also to the time for which an electric current passes through the thermal head . when the applied voltage is constant , it is exclusively proportional to the current passing time . the relationship between the color density on the paper and the current passing time is as shown in fig1 . as a result , the thermal head is energized for a period of time based on the gradation density signals input from the read - out control circuit 13 with the relation shown in the time table , wherein the thermal head is constructed of thermal thyristor . in this way the characters are printed on the paper with density depending on the gradation density signals or in other words , the video signals . referring to fig1 , which shows a timing diagram of the input and output signal in each element , the operation of the system will be described : when the copy key ( not shown ) is turned on , the writing data 1a to 1d in the first scanning line are input to the shift registers 4 at timings of clock pulses from the clock pulse generator 2 . the multiplexer 5 selects the qa output of the shift register 4 , and the non - delayed 4 - bit data 1a to 1d from the qa output are output to the video memory 6 in such timing as shown in fig1 ( c ). in the writing address control circuit 12 the ras signal is delivered to the video memory 6 from the ras / cas control circuit 7 as shown in fig1 ( a ). in response to the address switching signal b from the ras / cas control circuit 7 the address switching circuit 9 selects the row address bus 15 , and the row address signal from the address counter 8 is delivered to the video memory 6 in synchronism with the falling of the ras signal . in response to the delivery of the row address signal the cas signal is delivered to the video memory 6 from the ras / cas control circuit 7 as shown in fig1 ( b ). at the same time the address switching circuit 9 selects the column address bus 16 in accordance with the address switching signal b from the ras / cas control circuit 7 , and the column address signal from the address counter 8 which counts up the clock signals is delivered to the video memory 6 in synchronism with the falling of the cas signal . when the column address is established ( refer to a in fig1 ( b )), the non - delayed data 1a to 1d from the multiplexer 5 are written in the video memory 6 . the column address signal from the address counter 8 is also input to the address decoder 10 , and when the 32nd column address signal is delivered to the video memory 6 , thereby allowing the 32nd data 1a to 1d to be written in the video memory 6 , the signal of the address decoder 10 becomes &# 34 ; 1 &# 34 ; at the reception of the 32nd column address signal as shown in fig1 ( c ). the signal &# 34 ; 1 &# 34 ; is input to the flip - flop 11 , and at the same time , it is added to the counter 3 as the count - enable signal a , thereby causing the counter 3 to count the clock signals , and the multiplexer 5 selects the 1 - bit delayed qb output of the shift register 4 in accordance with the value counted by the counter 3 , and in such timing as shown in fig1 ( d ) the 1 - bit delayed data 1a to 1d are written in the video memory 6 ( fig1 ( g )). at this time the writing address control circuit 12 , as shown in fig1 ( f ), allows the flip - flop 11 to output the signal &# 34 ; 1 &# 34 ; in synchronism with the next clock signal in response to the signal &# 34 ; 1 &# 34 ; generated by the address decoder 10 . the signal &# 34 ; 1 &# 34 ; is added as the count - disenable signal c to the address counter 8 , which stops its operation after having counted the clock signal . at the same time the signal &# 34 ; 1 &# 34 ; of the flip - flop 11 is added as the control signal d to the ras / cas control circuit 7 , from which the ras signal is added to the video memory 6 . in addition , in accordance with the address switching signal b from the ras / cas control circuit 7 the address switching circuit 9 selects the row address bus 15 , thereby delivering the same row address signal as the initial one , to the video memory 6 . then , the cas signal and the column address signal are delivered to the video memory 6 in the same manner . in this way the 1 - bit delayed data 1a to 1d are written in the video memory 6 , wherein the 1 - bit delay corresponds to the period of time for which the row address signal is added to the video memory in the above - mentioned manner . each time when the thirty - two data 1a to 1d are written in the video memory 6 , the ras signal becomes &# 34 ; 1 &# 34 ;, and the row address signals in this particular row are delivered , and afterwards a 1 - bit delayed data 1a to 1d are written in . when the data 1a to 1d are written in the last address &# 34 ; 255 &# 34 ; among the 0 - to - 255 addresses in the first row of the video memory , the address signal for the last address &# 34 ; 255 &# 34 ; ( which is the 256th address , amounting to the integral multiplication of 32 ) allows the signal of the address decoder 10 to become &# 34 ; 1 &# 34 ;. at the next clock pulse the signal of the flip - flop 11 becomes &# 34 ; 1 &# 34 ;, and the address counter 8 counts 256 and stops its operation . immediately upon the stoppage of the counting , the ras signal is added to the video memory 6 . simultaneously , the row address signals of the second row are delivered thereto , and the remaining data 1a to 1d of the first scanning line are also written in these addresses of the second row . if the scanning lines to be written vary , the output selected by the multiplexer 5 returns to the qa output of the shift register 4 , and the data 1a to 1d of the varied scanning lines are written in the video memory 6 in the same manner as described above . when the data 1a to 1d of one field are completely written in the video memory 6 , the read - out control circuit 13 starts to read the data 1a to 1d in this field one after another , and based on each data , outputs the data so as to control the time for which the thermal head is energized . in this way the printer 14 prints out the data in one field , thereby allowing each image to be hard - copied . as evident from the foregoing description , according to the present invention it is easy to make hard - copies of the pictures on a t . v . screen , which provides a great facility for t . v . viewers . each time when the row address signal is generated , that output of the shift register which is delayed by a period of time for a row address strobe signal to deliver this particular row address signal , is selected and written in the video memory 6 . this ensures that all the gradation density signals can be stored in sequence and at exact positions , thereby creating a normal clear picture . in addition , real - time writing is possible , and therefore , the number of rams used is considerably reduced , thereby resulting in economical production costs . in this regard the present invention is more advantageous than the conventional method in which the picture elements are converted into parallel data and written in the video memory . the present invention is not limited to the embodiment described above , but as referred to in the beginning , various changes and modifications within the spirit and scope of the invention are possible : for example , the time for the ras signal being &# 34 ; 1 &# 34 ; is not limited to a time for 1 bit , but may be a time for multiple bits . the gradation number of gradation densities is not limited to 16 , but may be other gradation number . in general , when the gradation number is 2 n , the video memory can be constructed with n pieces of rams .	7
referring to fig1 , the centrifugal cytology system is identified generally by numeral 10 . the centrifugal cytology system includes a rotor 12 that holds a plurality of individual , removable chamber block assemblies 14 , arranged in the form of an array at the circumference of rotor 12 and is driven by a motor 16 ( shown in dashed lines ), of which the shaft 18 is shown . the rotor 12 is precisely indexed by the motor 16 and a control unit 20 . the combination of the motor 16 and a control unit 20 provide both precise indexing and a rotational speed to develop 50 × gravity or more . in the preferred embodiment , the motor 16 is equipped with an optical encoder or other means that will provide position information . the motor 16 can be a servomotor or in an alternative embodiment a multipole stepper motor , with or without micro - stepping . one or more cylindrical holes 22 provides for drainage of waste fluids from the bottom of the rotor . the same or different treating agents can be delivered to each of the chamber block assemblies 14 . one or more batch dispensers 24 delivers the same treating agent to each of the chamber block assemblies 14 ; and zero or more optional individual treating agent dispensers 26 can provide random access capability by delivering a treating agent to an individual chamber block . a chamber block assembly 14 is shown in fig2 and as thin sliced top views in fig3 a , b , c , and d . in contradistinction to the original centrifugal cytology swinging buckets u . s . pat . no . 4 , 250 , 830 ( ref . 4 ), the chamber block assemblies 14 are maintained in a fixed position by the rotor . each chamber block assembly comprises a cavity 28 , a chamber block 15 , and a receiving surface member or slide 32 ; on to which is to be deposited the materials such as cells or particles present in the sample . the chamber block 15 can be fabricated out of a solvent resistant plastic , such as polymethylpentene , mitsui chemicals america , inc ., purchase , n . y . the centrifugal cytology system 10 causes the cells to be deposited as one or more monolayers 30 , 30 in a fixed orientation on the receiving surface member or slide 32 ( see fig4 c ); and also has the capability to add and remove treating agent fluids from each chamber block assembly 14 . a sample inlet 34 is located at the top of the chamber block 15 towards the center of the rotor 12 . a separate treating agent inlet 36 is located at the upfield side , near or at the top of the chamber block . fig3 a is a top view along line a - a of fig2 , which shows both the location of the sample inlet 34 , and the treating agent inlet 36 and the full cavity 28 . the chamber block 15 preferably includes a means to produce two or more different concentrations of a material , such as cells or other particles , on a slide or receiving surface member 32 . as is shown in fig3 b , a view along line b - b of fig2 , a reduced volume cavity 29 results when the chamber block 15 includes a volume reducing element 40 , which shortens the distance between the upfield side of the cavity 42 and the cell or particle receiving surface 38 of the receiving surface member 32 . this reduction in cavity 28 significantly decreases the volume of fluid per unit area of the cell or particle receiving surface 38 of the receiving surface member or slide 32 . as is shown in fig3 c , a view along line c - c of fig2 , absence of the reducing element 40 maximizes the volume of cavity 28 and concurrently the volume of fluid per unit area of the cell or particle receiving surface 38 of the receiving surface member or slide 32 . as is shown in fig3 d , a view along line d - d of fig2 , the bottom 47 of the chamber block 15 seals against the cell or particle receiving side 38 of the receiving surface member 32 , which closes the bottom of the chamber block assembly . a cylindrical channel 44 conveys the sample from the sample inlet 34 of fig2 through the volume reducing element 40 of fig3 b into the cavity 28 to a protuberance 46 , which is part of the bottom 47 of the chamber block 15 . this protuberance 46 contains a plug 48 , fit into an output port 50 that faces in the downfield direction . this plug 48 is to be removed by the action of the centrifugal field , as is shown in fig4 b . the receiving surface member 32 and the chamber block 15 , when joined together , serve as a liquid containing module , the chamber block assembly 14 . the receiving surface member and chamber block are bonded in such a manner that they can be separated easily . this bond could be : a weak adhesive , such as employed in 3m post - it ®, st . paul , minn . ; a silastic or other adhesive that can be cut or preferentially bind to one surface ; a grease such as plews multi - purpose grease , plews / edelman division , stant corporation , dixon , ill . 61021 ; or a material , such as a wax , that can be melted at moderate temperatures . u . s . pat . no . 5 , 784 , 193 ( ref . 50 ), which is incorporated herein by reference , teaches the use of a microscope slide to which is bonded a removable layer with one or more openings for cells or other materials . another approach to producing a bond between the receiving surface member 32 and the chamber block 15 is to employ a two - pour mold to manufacture the chamber block 15 . the first pour can consist of a thin ( 0 . 1 to 2 mm ) film of an elastomer ; and the second pour can be the rest of the chamber block 15 . both the durability and ease of breaking this bond are critical . the chamber block assembly 14 must not leak ; yet , the chamber block 15 and the receiving surface member 32 must be separated after they leave the centrifugal cytology system , so that the material , such as cells or particles , on the surface 38 can be analyzed and / or the receiving surface member 32 stored . fig4 a depicts the transfer of the material , such as a cell or particle containing sample , into the chamber block assembly 14 . a sample injector 53 is lowered into the sample inlet 34 of the chamber block 15 . a volume of sample suspension is injected through sample inlet 34 and the cylindrical channel 44 into the cavity 28 , also shown in fig2 . after the sample injector is elevated to remove it from the chamber block 15 , the rotor 12 is accelerated to produce a centrifugal field sufficient to form a monolayer of sedimented cells onto the receiving surface 38 of receiving surface member 32 , and to propel the plug 48 out of the port 50 , as shown in fig4 b . while the centrifugal field is applied , the bulk if not all of the sample suspension 54 remains in the chamber block assembly 14 . after sufficient time has elapsed to sediment the materials , such as cells or other particles , onto the material receiving side 38 of the receiving surface member 32 , the rotor 12 is decelerated and stopped . the sample suspension fluid drains from the port 50 during deceleration and while the rotor is at rest , leaving the cavity 28 empty , except for a monolayer of material and accompanying thin layer of suspension fluid that has attached to the material receiving side 38 of the receiving surface member 32 . this returns the chamber block assembly 14 to the same condition as in fig2 , except that plug 48 has been removed and the attachment of the material to the surface of the slide or receiving surface member . the concentration of the sedimented material is proportional to the sedimentation path length . this path length can be decreased by the use of a volume decreasing spacer 40 , which extends the upfield side 43 of the cavity 28 of the chamber block 15 in the downfield direction . the distance 56 between the downfield side 42 of the volume decreasing spacer 40 and the area 41 of the opposing receiving side 38 of the receiving surface member 32 is less than the distance 57 between the upfield side 43 of the sample suspension 54 and the area 51 of the opposing receiving side 38 . fig4 c is a view along line c - c of fig4 b . since the concentration of material 30 and 30 on the receiving side 38 of the receiving surface member 32 ( fig4 c ) is proportional to the effective width of the cavity 28 , i . e . the sedimentation path length , the concentration in area 41 is less than that in area 51 . this creation of two different concentrations of material 30 , 30 increases the probability that an area with an optimal material concentration will be produced . use of multiple volume / path decreasing means will permit multiple concentrations of a material , such as cells or particles , to be created on opposing portions of the surface 38 of receiving surface member 32 . also , as shown in fig4 b and 4c , the receiving surface member 32 can include a barcode 39 or other means to identify the source of the material . individual types of synthetic boundary valves 52 can be designed for a specific centrifugal force . the design of a specific type of valve can be specified to open at a specific centrifugal force . the present , preferred embodiment of the valve 52 ( fig4 a ) is a simple drill hole or port 50 ( fig4 b ) that is filled with grease forming the plug 48 . the position , diameter , length of the drill hole 50 can be modified to increase or decrease the field necessary to open the valve 52 . the viscosity of the grease and its adhesion to the walls of the drill hole both increase the force necessary to dislodge it from the drill hole to thereby open the valve . the temperature of the centrifuge can also be increased , which will decrease the viscosity of the grease or even melt the grease , and thus facilitate its removal . it should be noted that the operation of the centrifugal cytology system 10 is substantially independent of the centrifugal field necessary to open the synthetic boundary valve 52 because the bulk of the fluid only escapes after the rotor has been decelerated and is approaching rest . for most practical purposes , a releasing field of between 5 and 500 times gravity is acceptable . however , there can be specific applications were a very low field , between 2 and 5 times gravity , would be necessary , because the product of the centrifugal force and time is being minimized to decrease the relative concentration of small particles on the receiving side 38 of the receiving surface member 32 . the production of monolayer dispersions of small particles , such as viruses or bacteria or chromosomes , is facilitated by employing centrifugal forces that are greater than that presently used for cells ( 100 to 1 , 000 × gravity ). centrifugal cytology system rotors 12 which operate at these higher centrifugal fields can employ synthetic boundary valves which open at higher centrifugal forces . it also should be noted that there is a possible advantage of employing the centrifugal field of this invention to deliberately flatten the cells . if this can be accomplished without distorting the internal morphology of the cells , then the quality of the diagnostic images should be improved . increasing the area of the individual cells and decreasing the out - of - focus material , by decreasing the thickness of the cells , should both improve the image . the initial centrifugation of the material onto the material receiving side 38 of the receiving surface member 32 encompasses two aspects . the first aspect is to sediment the material on to the receiving side 38 of the receiving surface member , and the second is to cause the material to bind or adhere to this surface 38 . this binding of the material to the surface 38 depends upon the chemistry of the receiving surface member and / or its surface . positively charged species or physically binding agents have been demonstrated to increase the adherence of cells to conventional microscope slides ( ref . 6 , ref . 51 ). in the case of fixation or staining , the time for performing each step is based on the chemistry of the step . the centrifugal cytology system 10 can have two types of dispensing systems , batch and random access . the batch dispensing system dispenses to all of the chamber blocks 15 of the chamber block assemblies 14 common solutions , such as : fixatives , wash solutions , alcohols , stains , mounting media , etc . fig5 a - d are partial side views , which show in progression the transfer of treating agents from the batch dispenser 24 of fig1 and the individual dispenser 26 of fig1 to a treating agent trough 58 . fig5 a shows an area of the rotor 12 directly upfield from the chamber block 15 . going in the direction upfield to downfield , the top 60 of the rotor 12 is configured to produce a treating agent ring 62 , followed by the treating agent trough 58 , which is at a greater depth in the rotor . the downfield upper edge of the treating agent trough has a lip 64 which meets the upfield front wall 66 of the chamber block 15 . fig5 b shows part of the upfield wall 66 and part of the top 68 of a chamber block 15 , which has been inserted in the rotor 12 of fig1 . the treating agent inlet 36 is located near and downfield from the treating agent trough 58 . the sample inlet 34 , which is not involved in this portion of the total process , is shown in the upfield part of the top 68 . as is shown in fig5 c , the tip 70 of the batch dispenser 24 is in position to deliver a treating agent fluid into the treating agent ring 62 . the individual dispensers 26 of fig1 and 5 d are for treating agents that are to be used for one or more , but conventionally not all of the chamber block assemblies 14 arrayed at the circumference of the rotor 12 . these individual dispensers can consist of an arm capable of vertical motion ( not shown ) and will be equipped with a treating agent dispensing means . the technology of random access delivery of treating agents is well developed . the mechanism for treating agent transfer to the chamber block assemblies 14 could be in a manner similar to that employed for the coulter r dacos r chemistry analyzer ( u . s . pat . no . 4 , 234 , 539 ref . 52 ). u . s . pat . no . 4 , 234 , 539 described a treating agent supply area that had separate treating agent containers located in a treating agent disc . treating agent dispensers added “ appropriate reagents to specific cuvettes as those cuvettes advance around the path of movement of the annular array .” ( col . 5 , lines 25 - 27 ) the control unit 20 shown in fig1 could index the rotor 12 to place a chamber block assembly 14 underneath an individual treating agent dispenser 26 of fig1 , which has previously been filled with a treating agent from a separate treating agent container . as described in hoskins et al . ( u . s . pat . no . 3 , 883 , 305 ref . 53 ), the aliquot and diluent transfer mechanism , as well as the treating agent dispensers , can be of the type and operate as disclosed with reference to fig1 c and 16 of u . s . pat . no . 3 , 883 , 305 , which is incorporated herein by reference . an alternative design for liquid transfer has been described by kelln et al ., ( u . s . pat . no . 5 , 334 , 349 , ref . 54 ), which is incorporated herein by reference . such transfer dispensers would swing arcuately between the source of the sample or treating agent and a chamber block assembly 14 . both , when receiving and dispensing fluid , the probe of the dispensers can move down into the treating agent containers ( not shown ), a material suspension ( not shown ), a treating agent ring 62 or treating agent trough 58 ( fig5 ), but would be elevated to be able to swing free thereof in an arcuate path . in an alternative embodiment , each individual treating agent dispenser 26 could included a prefilled individual container , which if necessary could be kept at constant temperature . the individual dispensers 26 are located around the rotor 12 above a stopping position for a chamber block assembly 14 . since the rotor 12 can index any chamber block assembly 14 to any dispenser location , random access is provided for : special solvents , special stains , monoclonal antibodies , nucleic acid probes , liquid coversliping material and other treating agents . fig5 d shows the rotor at rest . an individual dispenser tip 74 has been lowered into a treating agent trough 58 and the liquid treating agent 72 , after being pumped through the individual dispenser tip 74 , is located at the bottom of that treating agent trough 58 . the pool of the treating agent fluid 72 produced by this random access process in the treating agent trough 58 is approximately the same volume and at the same location as that delivered by the batch dispenser 24 for batch treating agents . if the same treating agent were delivered by one or more individual dispensers 26 , the system could function in batch mode . fig6 a - d show the movement of the treating agent fluid 72 in the chamber block assembly 14 . after the treating agent is in the treating agent trough 58 of fig5 and the rotor 12 is accelerated to produce a centrifugal field sufficient to transfer the treating agent 72 from the treating agent trough 58 through the treating agent inlet 36 and then , as shown in fig6 a , into an upper channel 78 in the cavity 28 . as is shown in fig6 b , under the influence of the centrifugal field , a thin layer 80 of the treating agent 72 is formed on the material receiving side 38 of the receiving surface member 32 . fig6 c is an enlargement of a portion of fig6 b , showing the layering 80 of the treating agent 72 on the material receiving side 38 of the receiving surface member 32 . after the treating agent has had sufficient time to interact with the monolayers of material , such as 30 , 30 shown in fig4 c , which are present on the receiving side 38 of the receiving surface member 32 , rotor 12 is decelerated and brought to rest . as shown in fig6 d , this results in the treating agent fluid 72 flowing to the bottom of the chamber block 15 and exiting through a bottom channel 82 and then through the output port 50 . liquid coverslips are an example of a treating agent which does not need to exit the chamber block assembly 14 . instead , they harden into a thin refractive index matching coating under the influence of a centrifugal force . this hardening can be accelerated by the application of vacuum and / or heat . three examples of liquid coverslips that could be used with the present invention are a commercially available mounting medium , such as clearium ® surgipath medical industries inc ., richmond ill ., an aqueous polyvinyl - pyrrolidone solution ( ref . 46 ) and a transparent plastic with a high refractive dissolved in an organic solvent , such as zeonor ® 1020r , zeon chemicals l . p ., louiseville , ky . fig7 shows part of a sector 84 of a rotor 12 with an included chamber block assembly 14 . the assembly 14 receives the treating agent fluid 72 from a treating agent trough 58 that is integral with the rotor 12 . the treating agent fluid 72 is delivered by the tip 70 of the batch dispenser 24 into the treating agent ring 62 of fig5 c . this delivery can be accomplished quickly by simultaneously rotating the rotor 12 to produce approximately one times gravity or less and pumping the treating agent through the batch dispenser tip 70 of fig5 c . when the treating agent pumping rate and the velocity of the rotor are appropriately adjusted , the treating agent fluid will be continuously and evenly delivered to the treating agent ring 62 . the treating agent fluid in the treating agent ring 62 then is directed by the combination of gravity and centrifugal field into each treating agent trough 58 . the pool of the treating agent fluid 72 produced by this batch process in the treating agent trough 58 is approximately the same volume and at the same location as that delivered by the individual dispenser 26 of fig1 , for random access treating agents . if necessary , the precision of this delivery of the same treating agent to more than one chamber block assembly 14 can be improved by employing the technology described in u . s . pat . no . 4 , 431 , 606 ( ref . 49 ). the use by many cytochemical and histochemical procedures and staining protocols of mixtures of varying ratios of solvents , such as ethanol and water or ethanol and xylene , has required that each of these mixtures be stored in its own container . this creation and storage of these mixtures is expensive in terms of both time and space . these mixtures can be formed by mixing the output of two or more pumps as the solvents are delivered . the delivery rates of each pump can proportional to the final concentration of its solvent in the final solution . for instance , two small motor driven gear pumps operated at equal rates will provide a 50 percent solution . if the ethanol pump is on and the water pump is off , pure ethanol will eventually result . the ethanol and xylene pumps can then deliver solvent at the same rate and produce a 50 percent mixture , which can be followed by pure xylene . if necessary , the output of the pumps can be mixed by a helix , which is well known in the art . fig8 shows an alternative chamber block assembly 14 design , with the treating agent trough 58 being an integral part of the chamber block 15 . fig8 a and 8b are respectively side and top views . the sample inlet 34 is located at the top and at approximately the center of the chamber block 15 . the treating agent trough 58 is located at the upfield side , at the top of the chamber block . as previously described , while the rotor is at rest , a treating agent is dispensed into the treating agent trough ; then , while the rotor is rotating , the treating agent is first transferred by the centrifugal field into the treating agent inlet 36 and subsequently to the receiving side 38 of the receiving surface member 32 ; and finally , while the rotor is decelerating or finally at rest , the treating agent exits through channel 82 and then through the output port 50 . the sample inlet 34 is not part of this process , but has been included for purposes of orientation . an alternative embodiment of the system 10 is possible . each of the treating agent dispensers 26 could be located in a fixed horizontal position and be movable in the vertical direction . the treating agent dispenser remains sufficiently above the rotor to provide clearance , except during a filling cycle , when the appropriate chamber block assembly 14 is indexed to be in its position . the treating agent dispenser then would be lowered from its rest position and deliver a measured amount of treating agent to the treating agent trough 58 . as stated above , a treating agent dispenser 26 could include its own prefilled individual container . two or more pipeters also could be employed to dispense individual treating agents in batch mode . in that case , there is up to one syringe and / or pipettor for each chamber block assembly . these pipeters can be driven by a common actuator . peristaltic pumps also can be employed to dispense the individual solutions . standard robotic equipment and procedures can be employed to insert and remove the array of chamber block assemblies 14 and / or one or more of the of the chamber block assemblies 14 into and from the rotor 12 ; as can manual handling . subsequently , the receiving surface member 32 can be separated from the chamber block assembly so that the monolayer then can be analyzed and / or the member 32 be stored . the processing of the centrifugal cytology system can be accelerated by the treatment of the treating agents overlaying the materials with microwave energy ref . 55 ; or the combination of microwave energy and pressure ref . 56 . the hereinabove provided specification , along with the figures , are believed to be more than sufficient to enable one skilled in the art to practice the invention , including modifications , adaptions and enhancements , without departing from the spirit and scope of the hereinafter presented claims and any subsequent amendments thereto .	8
the following description of the preferred embodiment ( s ) is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . an embodiment of a gauge according to the present invention is shown in fig1 - 4 , generally at 10 . the gauge 10 includes a housing 12 having an outer sidewall 14 . formed as part of the sidewall 14 is a ledge portion 16 , and mounted on the ledge portion 16 is a printed circuit board ( pcb ) 18 . mounted on the pcb 18 is various circuitry necessary for the operation of the gauge 10 , as well as an actuator , shown generally at 20 , which in this embodiment is a stepper motor . however , it is within the scope of the invention that other types of actuators may be used . the stepper motor 20 includes various components which are used for rotating a shaft 22 , and the shaft 22 protrudes outwardly away from the stepper motor housing 24 . mounted on an end 26 of the shaft 22 is a tube portion 28 , and connected to the tube portion 28 is a light directing device , which in this embodiment is a prism 30 . the prism 30 is rotated by the shaft 22 , and the stepper motor 20 rotates the shaft 22 . the prism 30 is located in proximity to a dial 32 , and the dial 32 has various graphics , or icons , 34 which provide an indication of various ranges of operating conditions , as shown in fig3 . the housing 12 also includes an inner step portion 36 , and the dial 32 is mounted on the inner step portion 36 , as shown in fig1 . the lens 38 is positioned in the housing 12 on top of the dial 32 such that light projecting from the prism 30 penetrates through the dial 32 and the lens 38 . the lens 38 and the dial 32 are secured to the inner step portion 36 by a bezel , shown generally at 40 . the bezel 40 has a first flange portion 42 integrally formed with a body portion 44 , and a second flange portion 46 , which is also integrally formed with the body portion 44 . during assembly , the first flange portion 42 and second flange portion 46 are deformed , or “ crimped ,” to the shape shown in fig1 , to attach the bezel 40 to the housing 12 . formed as part of the housing 12 is an outer lip portion 48 , and the second flange portion 46 is deformed such that the diameter 50 of the outer lip portion 48 is larger than the innermost diameter 52 of the second flange portion 46 . the deformation of the flange portions 42 , 46 and the difference in size between the two diameters 50 , 52 provides for a secure connection between the bezel 40 and the housing 12 , and prevents the bezel 40 from becoming detached from the housing 12 . the secure connection between the bezel 40 and the housing 12 also secures the location of the dial 32 and the lens 38 . in the embodiment shown in fig1 - 4 , the prism 30 and the tube portion 28 are integrally formed as a single component . however , it is within the scope of the invention that the prism 30 and tube portion 28 may be formed separately , and connected together during assembly . the prism 30 protrudes outwardly away from the tube portion 28 towards the outer diameter 54 of the dial 32 . the end 26 of the shaft 22 partially extends into the tube portion 28 . disposed on the pcb 18 is a light source , which in this embodiment is a light emitting diode ( led ) 56 . a lower end 58 of the shaft 22 receives light from the led 56 , and the light is transferred through the shaft 22 towards the prism 30 . the light passing out of the shaft 22 enters the tube portion 28 , where a portion of the light passes out of the tube portion 28 towards the dial 32 , and a portion of the light passes through the prism 30 . the prism 30 directs light outwardly towards the dial 32 . the portion of the dial 32 that is illuminated by the light projecting from the prism 30 varies , depending upon the position of the prism 30 . referring to fig2 a and 2b , different portions of the dial 32 are shown as being illuminated . in fig2 a , a first graphic , shown generally at 60 , is shown illuminated , along with a center graphic or icon , shown generally at 62 , and the remaining portions of the dial 32 are dark , essentially having a “ dead front ” appearance . in fig2 , a second graphic , shown generally at 64 , is shown illuminated , along with the center graphic 62 . the first graphic 60 is illuminated as shown in fig2 a when the prism 30 is positioned behind the area of the dial 32 where the first graphic 60 is located , and the second graphic 62 is illuminated as shown in fig2 b when the prism 30 is positioned behind the area of the dial 32 where the second graphic 62 is located . when the prism 30 is aligned with one of the graphics 60 , 64 , that graphic 60 , 64 is illuminated . there are also other various graphics which are located on the dial 32 that allow light to project through , which are illuminated when the prism 30 is in proper alignment with that particular graphic . additionally , the center graphic 62 is constantly illuminated when the led 56 is illuminated . this is a result of the light from the led 56 passing through the shaft 22 and through the tube portion 28 to illuminate the center graphic 62 . the center graphic 62 remains in constant illumination because the area of the tube portion 28 being in alignment with the center graphic 62 . the area of the tube portion 28 which projects light remains in alignment with the center graphic 62 regardless of how the prism 30 is rotated by the shaft 22 . this results in the center graphic 62 remaining in constant illumination regardless of the position of the prism 30 or which area of the dial 32 is being illuminated . the gauge 10 of the present invention allows for viewing a correct reading at almost any viewing angle relative to the lens 38 . the illumination of only one of the graphics 60 , 64 , and the alignment of the prism 30 behind the dial 32 ensures that only one reading is taken from the gauge 10 , and there is no confusion when looking at the gauge 10 from different angles . the addition of the center graphic or icon 62 also provides for the gauge 10 to have additional functionality . the center graphic 62 is used as an indicator of what type parameter the gauge 10 provides , such as temperature or pressure . however , the center graphic 62 of the gauge 10 could also be used for other purposes , such as a warning indicator . referring again to fig2 b , the second graphic 64 also includes warning graphics 66 , which are also illuminated to provide an indication that the reading provided by the gauge 10 indicates that an operating parameter has reached an undesired or unsafe operating condition . for example , the second graphic 64 shown in fig2 b indicates that exhaust temperature has reached an undesirable level . in various other embodiments , the dial 32 may be changed to have different graphics 60 , 64 , such that the gauge 10 may be used to provide a reading for other operating conditions . in the embodiment shown in fig1 - 4 , the stepper motor 20 is shown as being mounted on a top surface 68 of the pcb 18 , such that the stepper motor 20 is located between the pcb and the dial 32 . an alternate embodiment of the invention is shown in fig5 - 6 , with like numbers referring to like elements . in this embodiment , the stepper motor 20 is shown mounted on a bottom surface 70 of the pcb 18 , such that the stepper motor 20 is located between the bottom surface 70 and a lower wall 72 of the housing 12 . in the embodiment shown in fig5 , the led 56 is still located on the top surface 68 of the pcb 18 , but the led 56 in this embodiment is round and includes an aperture 82 , and the shaft 22 extends through the aperture 82 , as shown in fig6 . also included in this embodiment is a reflector , shown generally at 74 , mounted to top surface 68 of the pcb 18 . the reflector 74 includes a reflective surface 76 and a cylindrical portion 78 . the cylindrical portion 78 is hollow , and has an inner diameter 80 which is larger than the diameter of the tube portion 28 . the inside surface 84 of the cylindrical portion 78 is also reflective , and directs light from the led 56 towards the tube portion 28 and the prism 30 , such that the prism 30 and tube portion 28 direct light outwardly through the dial 32 and the lens 38 . the description of the invention is merely exemplary in nature and , thus , variations that do not depart from the gist of the invention are intended to be within the scope of the invention . such variations are not to be regarded as a departure from the spirit and scope of the invention .	6
in the following description of fig1 through 5 , identical reference numbers are used for identical or corresponding elements . fig1 shows a sectional view of a first exemplary embodiment of a mount for an aircraft according to the present invention . as may be inferred from fig1 , the mount is positioned in a hole or bore of a frame or former 6 . a support structure 16 of the frame 6 is shown in the background . as may be inferred from fig1 , the mount has a first cable mount section 2 and a second cable mount section 4 . according to one exemplary embodiment of the present invention , the first and the second cable mount sections 2 and 4 are essentially implemented from a plastic material . the first and the second cable mount sections 2 , 4 may be manufactured using an injection molding method , for example . the first cable mount section 2 has an essentially l - shaped structure in section . the second cable mount section 4 also has an essentially l - shaped structure in section . the first cable mount section 2 has a part having dimensions such that it may be inserted through a recess 22 in an insulation material 10 . the first cable mount section 2 has an essentially flat surface on a first end to be placed on the frame 6 . a plate - shaped element 12 is provided on the part , wherein the dimensions of the plate - shaped element 12 are larger than the dimensions of the recess or the hole 22 in the insulation material . cable receiver sections 24 , in which the cable may be laid to support it , are provided on a region opposing the first end of the first cable mount section 2 . the cables or line routes may then be attached using cable binders , for example . line routes may have a diameter from 5 to 60 mm , for example . the mount may be implemented for “ heavy ” line routes having a diameter of approximately 15 - 60 mm , particularly for routes of 25 mm diameter . like the first cable mount section 2 , the second cable mount section 4 has two cable receiving regions 24 for receiving two line routes . furthermore , the second cable mount section 4 has an end region opposite the cable receiving regions 24 , which has an essentially flat surface to be placed on the frame 6 . the first cable mount section 2 and the second cable mount section 4 are connected using a connecting element 18 , 28 . the connecting element has a screw 28 , which is supported in the first cable mount section 2 . in particular , the head of the screw may be supported in the first cable mount section 2 . the nut 18 is supported in the second cable mount section 4 . the screw 28 may thus be inserted through the eyelet ( the hole ) 8 in the frame and the screw 28 may be screwed together with the nut 18 in the second cable mount section 4 , so that the first and the second cable mount sections 2 , 4 are clamped on the frame 6 . a further plate - shaped element 14 , which has larger dimensions than a recess or hole 20 in the insulation material 10 , is provided on the second cable mount section 4 . as may be inferred from fig1 , because of the positioning of the plate - shaped elements 12 and 14 , which may be implemented using metal disks , for example , the insulation material 10 may be prevented from falling down , i . e ., the insulation material 10 may be prevented from slipping off the mount even in the event of great heat , as in case of fire , for example , since the plate - shaped elements are supported by the connecting element having the screw 28 and the nut 18 . for this purpose , the nut 18 has dimensions which are larger than a recess 52 in the plate - shaped element 14 . in addition , the head of the screw 28 has dimensions which are larger than a recess 50 in the plate - shaped element 12 . in this way , for example , all of the plastic of the mount may melt without the securing of the insulation material 10 by the connecting element , comprising the screw 28 , the nut 18 , and the plate - shaped elements 12 and 14 , being endangered , since these elements may be implemented from a very heat - resistant or fire - resistant material . the screw 28 , the nut 18 , and the plate - shaped elements 14 and 12 may be implemented from metal . the plate - shaped elements 12 and 14 may , for example , be incorporated into the plastic of the first cable mount section 2 and the second cable mount section 4 . for example , the plate - shaped elements 12 and 14 may be heated and pushed onto the plastic . welding on through frictional welding is also possible . the plate - shaped elements 12 and 14 may be implemented in one piece with the first and second cable mount sections using an injection molding method , however . instead of the connecting element having the screw 28 and the nut 18 , a screw - lock system may also be provided , for example . an arbor having a barb , which is inserted into a corresponding support device in the other cable mount section and thus ensures a secure connection , may also be provided instead of the screw 28 . the screw 28 and the nut 18 may each be pushed through openings provided laterally in the first cable mount section and the second cable mount section . however , it is also possible to cast the nut 18 and the screw 28 in one piece with the first cable mount section and the second cable mount section . the plate - shaped elements 12 , 14 may be implemented as inmolded metal washers . fig2 shows a perspective view of a first exemplary embodiment of the cable mount section according to the present invention . as may be inferred from fig2 , this cable mount section 4 has two receivers 24 for line routes . as may be inferred from fig2 , this cable mount section is a cable mount section into which a screw of the corresponding other cable mount section is to be inserted . the nut 18 may be inserted into a side region of the cable mount 4 through a recess 42 , for example . the plate - shaped element 14 is implemented in fig2 as an essentially ellipsoidal metal washer , which is cast into the plastic of the cable mount section 4 . fig3 shows a perspective view of a cable mount section according to one exemplary embodiment of the present invention . as may be inferred from fig3 , a screw 28 is provided in this cable mount section , which may be pushed into the cable mount section of fig2 , for example , and then screwed together with the corresponding nut . the screw 28 may , for example , be cast into the cable mount section 2 of fig3 . however , it is also possible to insert a threaded rod from the front into a corresponding hole of the cable mount section and then attach this threaded rod in the cable mount section 2 using a fastener , which may be inserted laterally into a recess 40 . as may be inferred from fig3 , the cable mount section 2 also has two cable receiving regions 24 . as in the cable mount from fig1 , the plate - shaped element 12 is implemented using an essentially ellipsoidal metal washer which is cast into the plastic of the cable mount 2 . instead of the metal washer or blank , manifold shaped elements may be used , as long as it is ensured that the eyelet in the insulation material may not slip over the shaped element . fig4 shows a sectional view of the cable mount from fig2 . as may be inferred from fig4 , a cable 46 , which may be attached using a cable binder , for example , may be received in the cable mount section 24 . it may be inferred from the sectional view of fig4 that a hole 64 is provided in the cable mount section 4 , into which the screw 28 of the corresponding other cable mount section 2 may be inserted . this hole 64 is bored into the face of the area or surface 60 of the cable mount section 4 , which is implemented to be placed on the frame 6 . furthermore , a space 62 for positioning the nut 18 is provided in the hole 64 . the nut , as already noted , may be inserted into the space 62 through a recess 42 , for example . as may be inferred from fig4 , the nut 18 has dimensions that are larger than the recess 50 in the plate - shaped element 12 , which may be implemented using the ellipsoidal metal washer 14 , for example . fig5 shows a top view of an exemplary embodiment of the plate - shaped element 12 . the hatched middle region of the plate - shaped element 12 is the region which is cast with the plastic of the corresponding cable mount section . a hole 44 for inserting the screw 28 through is provided in the middle of the plate - shaped element 12 . a cable mount is provided according to the present invention , which additionally assumes the function of securing insulation material , such as insulation mats , as are used for protecting frames in the aircraft against the effect of heat , for example . if the plastic melted in case of strong heating , for example , the insulation would still be supported between the metal blanks , whose diameter is larger than the eyes of the insulation mat , and thus offer more security . it should be noted that the term “ comprising ” does not exclude other elements or steps and the “ a ” or “ an ” does not exclude a plurality . also elements described in association with different embodiments may be combined . it should also be noted that reference signs in the claims shall not be construed as limiting the scope of the claims .	8
fig1 and 2 , are top and side schematic views , respectively , of a device 10 of one embodiment of the invention . it has a smart card portion 12 with smart card contacts ( shown schematically ) 14 . the integrated circuit cards or smart cards of this type have physical characteristics and dimensions and locations of the contacts which are adopted to and follow the international standards organizations , and ansi ( american national standard institute ) standard iso / dis 7816 - 2 . 2 , distributed in the united states by the american national standards institute , 11 west 42nd street , new york , n . y . 10036 . the full dimension of such cards is approximately 8 . 5 centimeters by 5 . 5 centimeters by 1 . 0 millimeter and have a contact area of approximately 2 millimeters by 1 . 7 millimeters . the contact area contains eight contacts , arranged two by four , each approximately 2 millimeters by 1 . 7 millimeter and separated one - from - another by approximately 0 . 84 millimeter . further details of the exact location of the contacts and their positions on the card is set forth in the iso standard 7816 , entitled &# 34 ; identification cards -- integrated circuit cards with contact -- parts 1 and 2 &# 34 ; available from ansi . several hundreds of millions of such cards are produced each year and used throughout the world . one of the manufacturers of the card is the assignee of applicant &# 39 ; s invention , gemplus card international , avenue du pic de bertagne -- parc d &# 39 ; activites de la plaine de jouques , 13420 gemenos , france . when a card is inserted into a card reader of a reader / writer terminal , the card is either completely inside , or approximately 1 . 5 centimeter of the card extends outward from the reader slot . in fig1 and 2 , the smart card portion 12 fits into a card slot of a smart card reader / writer terminal , and make electrical contact with the connections in said card slot . the reader / writer terminal for use with the present invention can be a stand alone terminal , i . e . one that is not in communication with a remote computer . examples are parking meters , vending machines . a user of the terminal would have a prepaid smart card with tokens or value , or credit . the prepaid card is entered into the off line terminal and &# 34 ; buys &# 34 ; time on the parking meter or , a pack of cigarettes , or whatever other item is dispensed by the vending machine . the smart card might have prepaid money value which would then be subtracted from the card , or might be of a credit card type , which would record that the value of the parking time or the item being sold is to be charged to the card owner &# 39 ; s account . it is expected that this type of stand alone read / write terminal would probably operate mostly with prepaid cards , but it is not limited for use with prepaid cards . the transaction would be recorded in the read / write terminal , but because the terminal is not connected to the operator &# 39 ; s computer , the data must be transferred on a periodic basis to the computer to record the use of the machine , inventory control , and if a charge is to be made to the card owner &# 39 ; s account . additionally , from time to time , data or programs may be entered into the read / write terminal , e . g . change in the cost of using the parking meter or change in price of the goods being sold from the vending machine , or to include lists of cards , which have been stolen or should not be accepted . one end 16 of the card portion 12 is inserted into the card slot of the read / write terminal and the card 12 would slide into the slot . extending from the opposite end 18 of the card portion 12 is a housing 20 having a slot therein 22 with electrical contacts 24 at one end 26 to receive a pcmcia card 30 shown schematically with an arrow pointing to be inserted into the slot 22 . contacts 34 on the pcmcia card 30 are made with the contacts 24 on the housing 20 . the slot 22 inside the housing is provided with the mechanical size and slots to accept and securely hold the card 30 in the housing 20 . the standards for pcmcia cards both electrical and mechanical are defined by the personal computer memory card international association , 1030 east duane avenue , sunneyvale , calif . 94086 . pcmcia standard release 1 . 0 - 2 . 1 lists three types of pcmcia cards type i , type ii , and type iii . all of the cards use the same electrical interface , although type i card is 3 . 3 mm thick , type ii card is 5 . 0 mm thick , and type iii card is 10 . 5 mm thick . at the present time , it is the type ii and the type iii cards are used for i / o features , although the invention is not limited to any particular type of pcmcia card . approximately 215 companies supply the various pcmcia cards and accessories including memory cards , modem cards , wireless modem cards . lists of these companies are in the publications from the association . fig3 is a block diagram showing electrical connections between the contacts 14 on the smart card portion 12 and the contacts 24 on the pcmcia slot 20 . the smart card contacts 14 are eight in number , which include ground , power , input / out serial , clock from the read / write terminal and reset . the remaining three terminals are presently not used in the current standards . data flows serially through the input / out contact . in operation , the reset terminal is normally high . when it goes low , a signal goes from the card to the read / write terminal which initiates operation . in fig3 the smart card contacts are shown schematically as 14 and are connected to a microcontroller 40 , which is connected to a dual port memory 42 , which outputs to a pcmcia interface 44 and then outputs to the pcmcia connector electric contacts 24 . the contacts 24 make contact with the contacts 32 and pcmcia card 30 . the microcontroller 40 is any convenient or conventional microcontroller such as the model 8051 manufactured by sgs - thomson microelectronics or the 6805 family manufactured by motorola . the microcontroller typically would cause an interrogation of the read / write terminal , initiated by a signal on the reset contact , e . g . with an answer to &# 34 ; reset i &# 34 ; to get data . this would permit interrogation of the read / write terminal and the passage of data serially on the smart card serial interface 14 . serial data flows into the microcontroller 40 where it is converted to parallel , e . g . 8 - bit word , and passed to a dual ported memory 42 . the dual ported memory passes the data received in parallel between its input from the microcontroller 40 to an output connected to the pcmcia interface 44 . the interface configures the data received , from 8 bits to the standard 68 - pins to the contact on the pcmcia connector 24 . the microcontroller , dual - ported memory , and the control for interrogating a read / write terminal may by of any convenient or conventional type . one such system for going from serial to parallel is in equipment sold by applicant &# 39 ; s assignee , gemplus card international . electrical power for operating the device 10 may come from either the device itself , as shown schematically from a power supply 50 mounted in the housing . power would typically be in the device when the stand alone read / write terminal is one having little power , such as a parking meter which is supplied with a solar cell or a vending machine in a location that also has a trickle power source . if the read / write terminal has a conventional power supply , then the power for operating the device 10 could come from the read / write terminal . there are three additional contacts in the contact area 14 , which can be used for power . the device may also be used for downloading information . here , the pcmcia card would supply programs or data to be entered into the read / write terminal . upon inserting the smart card portion 12 into the slot of the read / write terminal a signal would be on the set contact to which the answer would be , e . g . reset ii , i . e . to download data . the read / write terminal would then acknowledge receipt of this signal and there would be a downloading into the appropriate portion of the read / write memory terminal . the pcmcia card 30 may be a memory card , or a communications card such as a modem or a wireless modem card . if a wireless modem card is used , there would be a particular advantageous feature in the invention . when the card is inserted into the read / write terminal , a wireless , e . g . cellular telephone connection may be established with the host computer . the computer can then communicate directly with the read / write terminal . the time , at which read / write terminal is being interrogated would be provided in real time to the host computer , which could then keep track of the progress of the data collection from the different terminals . also , uploading of new programs and other features into the terminals could be achieved . alternatively , the modem could be connected through a conventional telephone line and could then be plugged in . if a memory terminal is used , the data would be batch collected and then transferred by removing and connecting the pcmcia card directly or through a modem to the host computer . with the device 10 , a range of off the shelf pcmcia cards could interface to a smart card reader / writer for data transfer . if the data transfer need not be too secure , a standard pcmcia card could be plugged into this device . then , as the delivery person returns to the operator &# 39 ; s central site , he could turn in the pcmcia card which could easily be read by the operator &# 39 ; s main computer . if the data transfer required a secure format , a secure pcmcia memory card with an onboard smart card could be used to store the data securely in its memory . such a security pcmcia card is the subject of applicant &# 39 ; s assignee &# 39 ; s copending u . s . patent application no . 07 / 997 , 501 filed on dec . 28 , 1992 . if immediate data transfer is required , a pcmcia data modem can be inserted which communicates directly with the operator &# 39 ; s main computer via , e . g . the cellular phone network . this type of data transfer method has two main advantages . one , it allows the operator to track the progress of the operator as work is completed during the day . two , it solves the authentication problem between the off line data transfer device and the smart card reader / writer , since now the authentication is occurring between the operator &# 39 ; s central computer and the smart card reader / writer . alternatively , a terminal , e . g . an off line point - of - sale terminal could be connected to the central computer by using the device shown with a pcmcia modem card via a telephone line . fig4 is a schematic perspective view showing the device 10 to be inserted into a slot 62 of a stand alone read / write terminal which in this figure is a parking meter 60 . the smart card portion 12 with the smart card contacts 14 is to have its end 16 introduced into the slot 62 and the card portion will fit into the slot 62 and make contact with contacts ( not shown ) in the slot 62 . the pcmcia card 30 is to be inserted into the slot in the housing 20 as shown in fig4 . at the far end of the housing 20 is a hinged door 28 . once the pcmcia card 30 is inserted into the slot 22 the door 28 is shut and a hook or latch 29 or other fastener holds the door closed , keeping the pcmcia card securely in the slot . the door 28 may be provided with an opening or window ( not shown ) for the passage of a telephone line where the card is a wired modem , or for an antenna if a wireless moden . as shown in fig4 the device is a unitary assembly and is of the size and shape for the housing 20 to fit easily into the hand of an operator . the device preferably is not only compact , self - contained , but ruggardized . the latch 29 may be a secure latch such as a mechanical lock to prevent accidental or mischievous opening and tampering with the pcmcia card . various modifications of the invention can be made without departing from the scope or spirit of the invention .	6
fig2 is a cross - sectional view of an nmos 1t / fb dram cell 200 in accordance with one embodiment of the present invention . although the present embodiment describes a 1t / fb dram cell that uses an nmos transistor , it is understood that either nmos or pmos transistors can be used to form 1t / fb dram cells in accordance with the present invention . when a pmos transistor is used to implement the 1t / fb dram cell , the conductivity types of the various elements are reversed . dram cell 200 includes p − type silicon substrate 201 , n − type buried region ( or back - gate ) 202 , depletion regions 203 - 204 , shallow trench isolation ( sti ) regions 205 , heavily - doped n ++ type source and drain regions 206 and 207 , lightly - doped n + type source and drain regions 208 and 209 , p type floating body region 210 , gate oxide layer 211 , gate electrode 215 and sidewall spacers 221 - 222 . n ++ type source region and n + type source region combine to form n - type source region 211 . similarly , n ++ type drain region and n + type drain region combine to form n - type drain region 212 . n − type buried region 202 is formed below the transistor as a back - gate node . under proper bias conditions , depletion region 204 completely isolates the floating body region 210 of 1t / fb dram cell 200 . fig3 is a circuit diagram of the 1t / fb dram cell 200 . gate electrode 215 of dram cell 200 is connected to a word line wl , drain 212 is connected to a bit line bl and source 211 is connected to a source line sl . the p - type floating body region 210 underneath the channel region is capacitively coupled to the n - type source region 211 through the parasitic capacitance pc 1 of the corresponding pn junction . similarly , floating body region 210 is capacitively coupled to n - type drain region 212 through the parasitic capacitance pc 2 of the corresponding pn junction . finally , floating body region 210 is capacitively coupled to buried back - gate region 202 through the parasitic capacitance pc 3 of the corresponding pn junction . 1t / fb dram cell 200 operates as follows . source region 211 is maintained at a ground voltage level ( 0 volts ). buried back - gate region 202 is biased at a voltage around the mid - point of a high drain voltage ( v cc , or 1 . 2 volts ) and a low drain voltage (− 1 . 0 volts ) to minimize leakage current from parasitic bipolar actions . in a particular embodiment , buried back - gate region 202 is biased at a ground voltage level ( 0 volts ). the bias level of buried back - gate region 202 can be adjusted to ensure the junction depletion region 204 beneath source 211 and drain 212 completely isolates floating body region 210 , without creating a direct leakage current path from source 211 or drain 212 to back - gate region 202 . a logic “ 1 ” data bit is written into dram cell 200 by biasing n - type drain region 212 at a logic high voltage of about 1 . 2 volts , and gate electrode 215 at a mid - level voltage of about 0 . 6 volts , thereby inducing hot - carrier injection ( hci ). under these conditions , hot - holes are injected into p - type floating body region 210 , thereby raising the voltage level of floating body region 210 , and lowering the threshold voltage ( v t ) of dram cell 200 . conversely , a logic “ 0 ” data bit is written into dram cell 200 by biasing n - type drain region 212 to a negative voltage of about − 1 . 0 volts , while gate electrode 215 is biased at a mid - level voltage of about 0 . 6 volts . under these conditions the pn junction from p - type floating body region 210 to n - type drain region 212 is forward biased , thereby removing holes from floating body region 210 . after a logic “ 0 ” data bit has been written , dram cell 200 exhibits a relatively high threshold voltage ( v t ). a read operation is performed by applying a mid - level voltage of about 0 . 6 volts to both drain region 212 and gate electrode 215 ( while source region 211 and back - gate region 202 remain grounded ). under these conditions , a relatively large drain - to - source current will flow if dram cell 200 stores a logic “ 0 ” data bit , and a relatively small drain - to source current will flow if dram cell 200 stores a logic “ 1 ” data bit . the level of the drain - to - source current is compared with the current through a reference cell to determine the difference between a logic “ 0 ” and a logic “ 1 ” data bit . non - selected cells in the same array as 1t / fb dram cell 200 have their gate electrodes biased to a negative voltage to minimize leakage currents and disturbances from read and write operations . fig4 a - 4d are cross sectional views illustrating the manner in which 1t / fb dram cell 200 can be fabricated using a process compatible with a bulk cmos process . as illustrated in fig4 a , an n - type well region 401 is formed in a p - type monocrystalline silicon substrate 201 . n - well 401 is formed in accordance with conventional cmos processing steps . for example , n - well 401 can be fabricated by ion implantation . various crystal orientations and concentrations can be used in various embodiments of the invention . in addition , the conductivity types of the various regions can be reversed in other embodiments with similar results . in the described embodiment , sti regions 205 are formed using shallow trench isolation ( sti ) techniques . in sti techniques , trenches are etched in silicon substrate 201 , and these trenches are then filled with silicon oxide . the upper surface of the resulting structure is then planarized , such that the upper surfaces of sti regions 205 are substantially co - planar with the upper surface of substrate 201 . in the described , sti regions 205 have a depth of about 4000 angstroms . it is understood that this depth is used for purposes of description , and is not intended to limit the invention to this particular depth . substrate 201 includes p - type region 402 located between sti regions 205 as illustrated . p - type region 402 can be a region of substrate 201 , or a conventional p - well region . as illustrated in fig4 b , a photoresist mask 405 is formed over the upper surface of substrate 201 at locations where 1t / fb dram cells are not to be formed . for example , photoresist mask 405 is formed over locations ( not shown ) where conventional cmos transistors are to be formed in substrate 201 . such conventional cmos transistors can include transistors used for controlling the accessing of the 1t / fb dram cells . a high - energy n - type ion implantation is performed through photoresist mask 405 into the cell array area to form n - type buried region 202 ( fig4 b ). in the described example , n - type buried region 202 extends into n - well region 401 . the depth of n - type buried region 202 is chosen so that the bottom interface of this region 202 is below the depth of sti regions 205 , and the top interface of this region 202 is at or above the depth of sti regions 205 and below the depth of the subsequently formed source and drain junctions 211 - 212 . in the described embodiment , the bottom interface of region 202 is located about 6000 to 8000 angstroms below the upper surface of substrate 201 , and the top interface of region 202 is located about 3000 to 4000 angstroms below the upper surface of substrate 201 . thus , the bottom interface of region 202 is about 2000 to 4000 angstroms below the depth of sti regions 205 , and the top interface of region 202 is about 0 to 1000 angstroms above the depth of sti regions 205 . in an alternate embodiment , the top interface of buried region 202 can be located below the depth of sti regions 205 , as long as the associated depletion region 204 is located above the depth of sti regions 205 . the formation of n - type buried region 202 results in the presence of adjacent depletion regions 203 and 406 , as illustrated . ( note that the formation of n - well 401 also contributes to the presence of depletion region 203 .) after n - type buried region 202 has been implanted , an additional ion implantation step can be performed through photoresist mask 405 to adjust the threshold voltage of dram cell 200 , without introducing additional process complexity or cost . the process steps illustrated in fig4 c - 4d are conventional cmos processing steps . as illustrated in fig4 c , gate dielectric layer 211 is formed over the upper surface of the resulting structure . in the described embodiment , gate dielectric layer 211 has an equivalent silicon oxide thickness in the range of about 2 to 4 nm . however , this thickness can vary depending on the process being used . a layer of gate material , such as polycrystalline silicon , is deposited over the resulting structure . this layer of gate material is then patterned to form gate electrode 215 . an n + implant mask ( not shown ) is then formed to define the locations of the desired n + ldd regions on the chip . an n + implant step is then performed through the n + implant mask . the implantation is self - aligned with the edges of polysilicon gate electrode 215 . the n + implant step forms n + source region 208 , n + drain region 209 and n + contact region 409 . note that n + source and drain regions 208 - 209 result in an adjacent depletion region . the depletion region between n + source and drain regions 208 - 209 and n − buried region 202 is labeled as element 407 in fig4 c . as illustrated in fig4 d , dielectric sidewall spacers 221 - 222 are formed adjacent to gate electrode 215 using conventional processing steps . for example , sidewall spacers 221 - 222 can be formed by depositing one or more layers of silicon oxide and / or silicon nitride over the resulting structure and then performing an anistotropic etch - back step . after sidewall spacers 221 - 222 have been formed , an n ++ photoresist mask ( not shown ) is formed to define the locations of the desired n ++ regions on the chip . an n ++ type ion implant is then performed , thereby forming n ++ source region 206 , n ++ drain region 207 and n ++ contact region 410 . n ++ source and drain regions 206 - 207 are aligned with the edges of sidewall spacers 221 - 222 , respectively . note that the formation of n ++ source and drain regions 206 - 207 result in the formation of source and drain regions 211 - 212 and depletion region 204 . p - type floating body region 210 remains in substrate 201 as illustrated in fig4 d . the back - gate bias voltage v bg is applied to buried back - gate region 202 via n ++ contact region 410 and n - well 401 . in an alternate embodiment , a process compatible with a conventional triple - well cmos process is used to fabricate 1t / fb dram cell 200 . fig5 illustrates a triple - well embodiment , wherein similar elements in fig4 d and 5 are labeled with similar reference numbers . fig5 shows a deep n - well region 501 , which is formed beneath buried back - gate region 202 . dram cell 200 is formed inside a p - well above the deep n - well region 501 . buried back - gate region 202 is formed so that the bottom interface of this region 202 is in contact with deep n - well region 501 , and the top interface of region 202 is above the depth of sti regions 205 . fig6 is a layout diagram of a repeatable array 600 of 1t / fb dram cells , including 1t / fb dram cell 200 . fig7 a is a cross - sectional view of dram cell 200 along section line a — a of fig6 . fig7 b is a cross - sectional view of dram cell 200 along section line b — b of fig6 . similar elements in fig2 , 6 , 7 a and 7 b are labeled with similar reference numbers . thus , the reference number 215 is used to identify gate electrodes in fig2 , 6 , 7 a and 7 b . note that drain contacts 209 are illustrated in fig6 and 7a . as illustrated in fig6 and 7a , drain regions of adjacent dram cells are formed as continuous regions . a single drain contact 209 is used to provide connections to adjacent drain regions in array 600 , advantageously reducing the required layout area of array 600 . by biasing buried back - gate region 202 in the manner described above , depletion region 204 provides adequate isolation between the adjacent dram cells sharing the same drain region 212 . because sti regions are not required between these adjacent dram cells , the layout area of the array 600 can be made relatively small . although the invention has been described in connection with several embodiments , it is understood that this invention is not limited to the embodiments disclosed , but is capable of various modifications , which would be apparent to a person skilled in the art . thus , the invention is limited only by the following claims .	7
fig2 shows a cable of tubes 1 terminating in connector 2 , and second cable of tubes 1 ′ terminating in connector 2 ′. connecting part 3 links the two connectors thereby joining the cables . fig3 illustrates the separated components of the connector , and the connecting part . the connector comprises a first part for receiving and clamping onto a cable of tubes ( comprising gland body 4 a and cable adapter 4 b ), a spreader 5 , and a connecting part 3 . cable gripping gland 4 clamps onto a cable of tubes 1 ( as shown in fig3 a ). the tubes are then separated by spreader 5 ( as shown in fig3 b ). spreader 5 guides each tube into a channel to align with a particular channel in tube seating body 6 a . the separated tubes then pass through individual channels in tube seating body 6 a . the channels of the tube seating body 6 a decrease in diameter at a point such that a shoulder is formed on which the terminal ends of the tubes sit . tube seating body 6 a and male plug 6 b interface with connecting part 3 . this arrangement ensures that each tube is connected sealingly to the next inline tube via tube seating body 6 a and connecting part 3 . a sealing means 8 is provided between the spreader 5 and tube seating body 6 a , and between male plug 6 b and connecting part 3 . the connecting part 3 links one connector to another , or to a device . the connection is made secure by connector locking ring 7 . once assembled , connector shell 10 houses spreader 5 , sealing means 8 , tube seating body 6 a , male plug 6 b , and sealing means 9 . as illustrated in fig3 a , cable gripping gland 4 comprises gland body 4 a and cable adapter 4 b . in operation , gland body 4 a is pushed over cable of tubes 1 , cable adapter 4 b is pushed over the exposed tubes 1 a and onto the sheath up to cable sheath butt 11 , gland body 4 a is then moved over cable adapter 4 b until a tight fit is achieved . a significant advantage provided by the design of cable gripping gland 4 is that the greater the pulling force on cable of tubes 1 in a direction towards cable adapter 4 b , the tighter the grip between cable adapter 4 b and cable of tubes 1 ( up to a point of failure ). the spreader 5 is shown in greater detail in fig3 b . this figure illustrates a three part spreader to be used for a thirty - one tube cable comprising four layers of tubes . one tube of each layer is illustrated in the figure ( tube 15 for the outer tube layer , tube 16 for the intermediate tube layer , tube 17 for the inner tube layer , and single tube 18 central to cable 1 constituting the central layer ). each of the spreader parts is provided with guideways to urge each tube towards a particular hole . as illustrated by fig3 b , the guideways are formed by a number of continuous walls provided on the spreader , the space between two walls defining a channel slightly wider than an individual tube . once the sheath of cable 1 has been stripped to reveal individual tubes , outer spreader part 5 a is inserted between the outer tube layer 15 and intermediate tube layer 16 . the twelve individual tubes of the outer layer are guided along the guideways into the twelve equidistant holes in outer spreader part 5 a . outer spreader part 5 a is pushed down the tubes to a set distance from the multi - tube cable sheath butt 11 . a keyway 12 can be provided to align outer spreader part 5 a with gland body 4 a if necessary . intermediate spreader part 5 b is then inserted between intermediate tube layer 16 and inner tube layer 17 . the twelve individual tubes of the intermediate layer are guided along the guideways into the twelve equidistant holes in the intermediate spreader part 5 b . intermediate spreader part 5 b is then pushed down the tubes and into outer spreader part 5 a . a keyway 13 is provided for alignment of intermediate spreader part 5 b into outer spreader part 5 a . central tube 18 of the multi - tube cable is then inserted into the hole at the centre of inner spreader part 5 c . the six individual tubes of the inner layer are guided along the guideways into the remaining six equidistant holes in inner spreader part 5 c . inner spreader part 5 c is then pushed down the tubes and into intermediate spreader part 5 b . a keyway 14 is provided for alignment of inner spreader part 5 c into intermediate spreader part 5 b . the stepping of the insertion of tubes allows for easier insertion as compared with the alignment device of fig1 . the alignment device requires all tubes to be entered simultaneously , whereas the spreader allows for the tubes to be entered layer by layer . if required , the spreader can be used to enable improved gas blocking . the tubes are presented such that when a gas blocking material is inserted , it is able to spread evenly through the tube interstices to ensure an effective gas block . although the example in fig3 b comprises three spreader parts , the number of spreader parts required would depend upon the number of tube layers , which would be determined by the tube count of the cable . different sizes of spreader , providing different degrees of splaying , could be used dependant upon the use required . for example , if the spreader is required to be used only as a gas block , a smaller size , which fits into the gland body , could be used ( as illustrated in figs . b 6 a - c of the second embodiment , discussed below ). however , if the spreader is to connect with a patch tube interface , a greater degree of splaying , and therefore a larger spreader , may be required . fig4 shows the route of a single tube through the system . cable gripping gland 4 and spreader 5 are formed such that all tubes except the central tube assume an ‘ s ’ bend , which ensures that the end of a tube is parallel to the same tube when in the bundle clamped by cable gripping gland 4 . fig4 a provides a formulaic representation of shape required to be formed by the tube to allow an optical fibre to be installed by the blown fibre method . the formula provides the displacement of the tube from its original position , and the subsequent distance between the beginning and end of the bend in the connector , using the centre line of the tube as a reference point . it may be possible for substitution of the connecting part 3 for to occur after installation of the tubes and prior to blown installation of the fibre . the connecting part 3 may also be formed in a particular configuration to provide a certain function , such as a spacer . fig5 shows the connector part formed into an elbow , and illustrates the path of a single tube through the connector . this configuration can be used when it is necessary to change the direction of the optical fibre cables , for example , to turn a corner . to prevent tube kink or tube collapse , a minimum bend radius must be maintained for multi - tube cables on changing direction . the minimum bend radius for multi - tube cables is approximately ten times the diameter of the cable , e . g . a multi - tube cable comprising seven 5 mm tubes and having an overall diameter of 20 mm should not be subjected to a bend of less than 200 mm . however , by stripping the sheath from the cable and essentially treating each single 5 mm tube as a separate entity , the minimum bend radius is reduced to 50 mm . the elbow contains pre - configured routes for the tubes at the correct radii , and provides a patch tube interface which allows a fibre optic multi - tube gland and multi - tube cable to be connected to either end . therefore the space required to achieve the 90 ° bend is reduced compared with bending the cable as a whole . the gland system will now be described in accordance with the accompanying figs . b 1 to b 10 . fig . b 1 shows a cable of tubes 1 connected with single tubes 19 via fibre multi - tube gland system 20 . as illustrated , bare tubes are exposed between the component parts of the optical fibre multi - tube gland system . as illustrated in figs . b 2 and b 3 , the optical fibre multi - tube gland system comprises cable gripping gland 4 , enclosure interface 21 , spreader 5 , and patch tube interface assembly 22 . ( the cable gripping gland and spreader are of the same type disclosed above for the first embodiment .) cable 1 is split into individual tubes within cable gripping gland 4 and enclosure interface 21 , with sealing means 8 provided between cable gripping gland 4 and enclosure interface 21 . the tubes are splayed by spreader 5 and then pass through patch tube interface assembly 22 . the connection is completed by tubes 19 which are connecting patch tubes , or tubes from a second optical fibre multi - tube gland system . the cross section a - a of fig . b 4 shows the route of a single tube through the optical fibre multi - tube gland system . as illustrated , the enclosure interface 21 and spreader 5 act so as to form an ‘ s ’ bend in the tubes , as described for the first embodiment . fig . b 5 provides detail of patch tube interface assembly 22 . deformable ‘ v ’ rings 23 are provided at one interface and conventional ‘ o ’ rings 24 at the second interface . ‘ v ’ rings 23 allow relatively easy manual insertion of multiple individual tubes simultaneously into patch tube interface assembly 22 . ( due to the force required to introduce a tube into an ‘ o ’ ring , manual simultaneous insertion of multiple tubes would be difficult without the use of a specialist tool .) after insertion of the tubes into the patch tube interface assembly 22 , screw cap 25 is tightened to compress each of the ‘ v ’ rings 23 onto the individual tubes to form a seal . conventional ‘ o ’ rings 24 are used to form a seal around the individual tubes on the second interface . the action of tightening screw cap 25 also ensures that the ends of the tubes remain butted against the main body of patch tube interface assembly 22 by forcing collets 26 away from patch tube interface assembly 22 thereby stopping movement of the individual tubes . fig . b 5 shows patch tube interface assembly 22 in both an open position , i . e . when the ‘ v ’ rings 23 are in a relaxed state , and a closed position , i . e . after the screw cap 25 has been tightened . collets 26 may be fitted with coloured ‘ c ’ clips to provide a colour key for alignment of tubes . fig . b 5 a shows a patch tube interface assembly 22 with deformable ‘ v ’ rings 23 at both interfaces , thus allowing for simultaneous manual insertion of multiple tube inputs or single tube inputs ( e . g . one tube at a time ) from both directions prior to tightening screw cap 25 . figure c shows a patch tube interface assembly 22 with conventional ‘ o ’ rings 24 at both interfaces . the functionality of screw cap 25 of figs . b 5 and b 5 a may not be required for this version . the choice of configuration of seal types ( i . e . as in fig . b 5 a or b 5 b or a combination thereof ) would be determined by the intended purpose which the patch tube interface assembly . fig . b 6 shows the optical fibre multi - tube gland system being used to terminate a multi - tube cable at an interface 27 using gland body 4 a , cable adapter 4 b , spreader 5 . interface 27 could be , for example , a bulkhead , an enclosure , or a metal plate . spreader 5 splays the tubes in the same way as the spreader in fig3 b of the first embodiment , thus enabling gas blocking material to be inserted around the interstices . in this embodiment , the spreader is small enough to fit into gland body 4 a such that a gas blocking material 28 , such as resin , can be inserted so as to cover the spreader , as illustrated in figs . b 6 b and b 6 c . as illustrated in figs . b 7 to b 10 , the system may also include a chassis for supporting a plurality of system components , allowing the termination of a plurality of multi - tube cables without the need to remove the original multi - tube cables from the chassis , thereby protecting any ‘ live ’ path between the multi - tube cables . the ability to fully remove the enclosure from the chassis allows access to the tubes between the multi - tube cables , without taking valuable space when closed . fig . b 7 shows the optical fibre multi - tube gland system being used as a simple in - line join between two multi - tube cables , 1 and 1 ′. this join would provide limited opportunity for future upgrade or tube reconfiguration . a chassis 29 , of for example a metallic material , is used to support the components . the optical fibre multi - tube gland system 20 of fig . b 7 uses the individual tubes from the second multi - tube cable 1 ′ to complete the connection . once configuration is complete a two - part enclosure 30 ( illustrated by a dotted line ) is provided to protect the components . simple removal of the two - part enclosure 30 allows access to the individual tubes . fig . b 8 shows an in - line joint which has been further enhanced to provide an easily upgradeable and reconfigurable multi - tube cable joint by using a pair of optical fibre multi - tube gland systems 20 and 20 ′, and patch tube interface assemblies 22 and 22 ′. this allows reconfigurable single patch tubes to be used to form the path between the two multi - tube cables . the components are supported by chassis 29 , and enclosed by two - part enclosure 30 . the original two - part enclosure can be replaced with different versions designed to accept the additional multi - tube cables . fig . b 9 shows an in - line joint upgraded to a t configuration . once the two - parts of the enclosure have been removed to gain access to the joint , the components remaining fixed to the chassis , it is possible to adapt the joint to a different configuration . once a chassis extension piece 31 is added to the existing chassis 29 , a further optical fibre multi - tube gland system using a further patch tube interface assembly can be added to the chassis extension piece 31 . the required empty patch tubes ( prior to optical fibre installation ) can now be removed and re - routed to the new multi - tube cable . fig . b 10 a is an example of the tube routing for a t configuration , with a two - part ‘ t ’ enclosure 32 ( illustrated by a dotted line ) provided to protect the contents of the joint . figs . b 10 b and b 10 c illustrate tube routing for a joints with three and four multi - tube cables respectively , creating ‘ y ’ and ‘ h ’ configurations . in each case , an in - line joint has been reconfigured to accept further multi - tube cables by the addition of chassis extension 31 and appropriate alternative two - part enclosures ( 33 and 34 respectively , illustrated by dotted lines ). the combination of chassis and enclosure allows 360 ° access to the joint when required . as the enclosure is close - fitting , it will take up less space than previous multi - tube joint enclosures .	6
fig1 a shows schematically a typical rfid system with an rfid reader . the rfid reader system comprises at least one rfid device 110 , an rfid reader device 120 , and a host computer 122 . the rfid device 110 may be an rfid tag , or it may be a product comprising an rfid tag or an inlay . in both cases , the rfid device comprises an rfid inlay 100 . the rfid reader device 120 comprises an antenna 121 . with the antenna 121 the rfid reader device 120 generates an rf field 123 . in response to the rf field 123 , the rfid device 110 scatters the rf field back to the antenna or modifies the inductive load seen by the reader device . in both cases the backscattered signal thus sent from the rfid device 110 can be read by the reader device 120 . the signal typically contains at least information indicative of the rfid device , e . g . an identity number of the rfid device 110 and possibly further product information related to the tagged item . the reader device 120 may be coupled to a host computer 122 to obtain other information regarding the rfid device of this particular identity number and / or to supply tag / product information to further remote systems . fig1 b - 1 d show some typical layouts for rfid inlays 100 used in the art . the rfid inlays comprise an integrated circuit ( ic ) chip 101 , wiring 103 , and a substrate 104 . the wiring comprises an impedance matching section 102 and an electromagnetic radiator section , either an antenna ( typical for far field rfid ) or a coil ( typical for near field rfid ). the substrate may be e . g . polyvinyl chloride ( pvc ), polyethylene terephthalate ( pet ), or paper . the wiring may be made of conductive material , such as copper , aluminum , silver , gold or a conductive ink comprising any of these metals or other conducting material . the chip 101 is bonded to the substrate such that input / output ( i / o ) pads of the chip 101 are connected to wiring 103 . known bonding techniques include adhesive joining with either electrically conductive adhesive ( isotropically conducting adhesive ica , or anisotropically conducting adhesive , aca ), or a non - conductive adhesive , nca . these adhesives can be supplied in film form , when the adhesives are known as icf , acf , or ncf , where the last letter stands for film . for these bonding techniques , the i / o pads of the chip 101 have to be bumped e . g . with gold bumps . in case of rfid inlays , the chips 101 are small , typically a square with the side length 0 . 5 mm . as discussed above , the size of wiring has to be relatively large . typically the length of the uhf rfid antenna ( wiring ) has to be λ / 4 , which in typical uhf application ( 900 mhz ) is about 8 cm . in addition to frequency , the permittivity of the substrate also affects the wavelength , and therefore the size of the antenna . as for the near field rfid inlays , the area enclosed by inlay wiring may be for example around 1 cm 2 and upwards for inductive coupling . it is also noted that the coupling depends on the number of wiring turns enclosing the area . in addition , antenna structures comprising properties of both far field and near field wirings have been used . fig1 b shows an example of a far field rfid inlay , where the wiring 103 comprises an antenna , arranged to meander on the substrate 104 . fig1 c shows a near field rfid inlay , where the wiring 103 forms a coil , wherein in the case of fig1 c the coil has four turns . fig1 d shows an rfid inlay of which structure comprises properties of both a typical far field inlay and a typical near field inlay . it should be noted that the fig1 b - 1 d are given here as examples only describing some possible rfid structures . other structures are also possible and known to a person skilled in the art . the rfid tag ( or the rfid inlay ) may be attached to the article or to the package of the article . fig2 a shows , as an example , a front view of an article 200 in a package 201 . the package 201 is designed to be placed to hanger in a store . thus , the package 201 may comprise a standardized mounting hole 202 for the hanger . fig2 b is a side view of a typical hanger 203 in a store , wherein the hanger 203 contains packages 201 , and in this case three packages . a hanger is typically relatively long , thin , and rigid . also , as depicted in fig2 b , the hanger may be perpendicular to a plane of a surface of the package . fig2 c shows examples of some standardized mounting holes . the reference number 202 a shows a euroslot type hanger hole , 202 b an inverted t type hanger hole , 202 c an osha type hanger hole , and 202 d an oval hanger hole . a special type of the oval hanger hole is the circular hanger hole , where the width w h equals the heights h c and h h . moreover , depending on the roundness of the corners of the oval mounting hole , the hole can also be a square . thus , the oval hole allows for more flexibility in the measures . typical measures for these mounting holes are given in table 1 . the sizes are standardized in inches , and given in the table with the accuracy of two numbers . fig3 a shows a rear view of the package 201 . an rfid inlay 100 is attached to the ( large ) package . however , in case the package is small , as depicted in fig3 b , the rfid inlay 100 does not fit on the package 201 . according to an example embodiment of the invention , the suspendible package may be equipped with an rfid inlay in such a way that the mounting hole for the hanger is at least partly encircled by the wiring of the rfid inlay 100 . one embodiment of the invention is shown in fig3 c , where the package 201 and the inlay 100 comprise the same mounting hole 202 . fig3 d shows another embodiment of the invention for packages 201 that do not fit the rfid inlay 100 . in such a case , the inlay may be partly attached to the package 201 , and the mounting hole may be made to the inlay 100 only . in both cases the mounting hole 202 extends through at least the rfid inlay 100 . as depicted in fig3 b - 3 c , the cross - sectional area of the package 201 may be of the same order as the area of the rfid inlay 100 . moreover , as shown in fig3 d , the rfid inlay may be larger than the package , or , as will be shown later , the package may be larger than the rfid inlay . thus the mounting hole 202 may be arranged to extend through the package 201 and the rfid inlay 100 . the size of an rfid transponder can vary a lot and depends e . g . on the operating distance of the rfid transponder . the far field rfid transponders have typically a size ranging from e . g . 1 . 5 × 7 cm to about 15 × 15 cm . the near field rfid transponders may be smaller . it should be noted that the arrangement of the rfid inlay or tag into a small sized package according to this invention is not limited by the purpose of the use of the rfid . the rfid inlay or tag can be used for normal epc coding and logistics but according to some advantageous embodiments of the invention also for eas purposes . the use of the invention for eas purposes is described in more detail later in this text . fig4 a and 4 b show two examples of ways to produce a package according to an example embodiment . in fig4 a , an ordinary , unpunched , rfid inlay 100 is attached to the unpunched package 201 during the manufacturing of the package . at a later stage of the package manufacturing process , both the rfid inlay and the package are punched to form the mounting hole 202 . in this case , the mounting hole 202 is arranged to the rfid inlay 100 and the package 201 at essentially the same time . alternatively , in case the rfid inlay cannot be attached during the manufacturing of the package , an rfid inlay ( or rfid tag ) may be punched to form a punched rfid inlay 101 shown in fig4 b . thereafter the punched rfid inlay may be attached to the package containing the mounting hole 202 . in case the rfid inlay can be attached to the package already during the package manufacturing process , punching both the inlay 100 and the package 201 provides a more economical way to produce the package avoiding , for example , the need to separately line up the holes in the package and the rfid inlay . in addition to punching , other methods known in the art , such as various cutting methods may be used to produce the mounting hole . moreover , only a preform for the mounting hole can be made , such that the mounting hole is opened by penetrating an object through the preform . a preform may be made e . g . by perforating or partly cutting the edge of the area defining the mounting hole . the inlay can be attached to the rear side of the package , as depicted in fig3 c , or it can be attached to the front of the package . moreover , it is possible to laminate the rfid inlay 100 between the front and rear surfaces of the package whereas the rfid inlay remains invisible from the outside of the package . it is noted that some products , e . g . various types of cards , are not sold in a package . in these cases an rfid inlay can be attached directly to the product . moreover , it is noted , that the package itself is an example of a product that is not further packaged . it is further noted that a package , an article , and a product that comprises an rfid inlay is an rfid device . fig5 a shows another type of an rfid inlay , designed for a suspendible product ( cf . fig1 c ). in this case the wiring 103 of the rfid inlay 100 encircles the mounting hole 202 for the hanger . the center of the mounting hole is marked by the reference number 205 . this may be the case , when the wiring of the rfid device forms a coil , i . e . in near field rfid devices . in some other cases , the wiring 103 of the rfid device may only partly encircle the mounting hole . this was the case in fig3 c and 4 , and shown in more detail in fig5 b . as the wiring 103 of the rfid device does not form a coil , it only partly encircles the mounting hole . in this case , the angle of view of the wiring α , as seen from the center 205 of the mounting hole 202 , is less than 360 degrees . fig5 c shows an alternative wiring , where the angle of view α of the wiring is 180 degrees , and fig5 d shows still another example , where the angle of view is slightly less than 180 degrees . possibly more space is saved , when the angle of view α is increased . in many cases the hanger 203 is made of some metal or other electrically conductive material . in these cases the performance of the rfid device is altered when an electrically conductive object is penetrated through the mounting hole . as an example , for one case , in which the maximum reading range of the rfid device not penetrated by a metallic hanger is at 990 mhz , experiments show that the maximum reading range is obtained with the frequency 820 mhz , when the rfid device is penetrated by a metallic hanger . in addition to reading distance and operating frequency , the presence of the metallic hanger affects the radiation pattern of the rfid device . i . e . an electrically conductive object electro - magnetically couples to the wiring of rfid device , and forms a part of the antenna of the rfid device . therefore , an rfid device having an essentially two - dimensional wiring in its inlay , may be specifically designed to operate also with an extended , possible three - dimensional , antenna , i . e . when an electrically conductive object is located such that the wiring of the device at least partly encircles the electrically conductive object . such an rfid device may have two operating modes : a stand - alone mode and an extended mode . in the stand - alone mode , the wiring of the inlay comprises the antenna of the rfid device , while in the extended mode the antenna is extended with an electrically conductive object . the extended mode is enabled e . g . when the rfid device is located such that its wiring partly encircles an electrically conductive object . for example , the extended mode may be enabled , when a package with an rfid inlay , of which wiring is arranged such that the wiring of the rfid inlay at least partly encircles the mounting hole , is inserted to a hanger in a store . the difference between these operating modes is the different operating frequency and different reading distance and possibly also different orientation sensitivity / radiation pattern . in particular , the electrically conductive object can form an antenna extension , which enables a longer reading distance for the rfid device in the extended mode , than in the stand - alone mode . in order to enable the extended mode , the wiring of the rfid device should at least partly encircle a mounting hole for the electrically conductive object . the angle of view of the wiring α , as seen from the center of the mounting hole may be preferably more than approximately 90 degrees . in case the package comprises a preform for the mounting hole , the wiring of the rfid transponder can be arranged such that part of the wiring is located in or on the preform , while other parts of the wiring partly encircle the preform . opening the mounting hole by removing the preform with an object by penetrating the object through the mounting hole , could alter the rf properties of the rfid transponder , since modifying the antenna section of the wiring also modifies the rf properties of the transponder . therefore , the transponder may have different rf properties , e . g . operating frequency , reading distance , or radiation pattern , depending on whether the preform has been removed or not , and whether there is an electrically conductive object in the mounting hole or not . fig6 a shows a rear and a side view of an rfid device 201 , the device being an article in a package 201 comprising an rfid inlay 100 . the device 201 of fig6 a operates in the stand - alone mode . fig6 b shows the rfid device of fig6 a operating in the extended mode , where the extended mode is enabled by an electrically conductive object 203 , which has been penetrated through the mounting hole 202 of the rfid device 201 . the operating frequency of the rfid device may also be modified as the hanger 203 is penetrated through the mounting hole 202 . as depicted in fig6 c , it is also possible that the electrically conductive object 203 works as an antenna extension for several suspendible rfid packages 201 . as discussed , the rf properties of the rfid devices that can operate in the stand - alone mode and in the extended mode may be different in different operating modes . this property can be used to configure rfid reader devices to read only rfid tags that are operating in the extended mode or only devices that are operating in the stand - alone mode . furthermore , the reader devices can be designed to read rfid tags both in the stand - alone mode and in the extended mode . this also enables a designer to design rfid systems with different reading distances for rfid devices in the stand - alone mode and rfid devices in the extended mode , e . g . for objects that are not hanging from a metallic hanger and objects that are hanging . depending on the design , either of these reading distances can be longer than the other , or the reading distances can be equal . accordingly , when relying on the standard reading frequencies it is possible to design the rfid tag in a manner that reading is not possible while the suspendible item is suspended in a hanger but only after the item is removed from the hanger . or , if required by the end application , also vice versa : the rfid tag is unreadable until it is suspended in a hanger . one further example is to design an rfid reader device such that the electrically conductive object that is partly encircled by the wiring of the rfid device is a part of the rfid reader device , e . g . an antenna of the reader device . this example is depicted in fig6 d . in the figure , an electrically conductive object , denoted by “ 121 / 203 ”, can work both as the hanger 203 for the packages 201 and as the antenna 121 of the reader device 120 . as previously , the reader device 120 may be connected to a host computer 122 . when the rfid device 201 so designed has a short reading distance , the reader device 120 can be use to make online inventory of the hanging articles . the rfid reader device 120 simply counts the number of packages 201 seen by the reader device 120 . it is noted that even if the hanger 203 is used as the antenna 121 of the reader device 120 , the hanger 203 also couples to the wirings of the packages 201 . therefore , the packages 201 , as rfid devices , are operating in the extended mode . fig6 e shows another embodiment of an rfid system . this system comprises a handheld rfid reader device 600 . the handheld reader device 600 has an electric contact point 601 that provides the reader device 600 with a position for an external reader antenna 602 . in the left part of the figure , the electric contact point 601 of the reader device 600 is not in contact with an external antenna 602 . the reader device may thus be used to read e . g . rfid tags in the stand - alone mode or in the extended mode . furthermore , the reader device itself may operate in two modes : the internal mode , when the device is not coupled to an external antenna 602 , and an external mode , when an external antenna 602 is coupled to the rfid reader . the internal mode operation is illustrated in the left part of fig6 e , while the external mode operation is illustrated in the right part of the figure . the external mode for the reader is enabled , when the electric contact point 601 forms an electrical contact with an external antenna 602 , e . g . a conductive hanger 203 . the hanger 203 may thus also work as the external antenna 602 , and therefore the number “ 602 / 203 ” is used in the figure . in this way , online inventory can also be made with a handheld rfid reader device 600 . the package or the mounting hole may have various shapes . fig7 a - 7 c show another type of a suspendible package , where the mounting hole is arranged by using a hook . fig7 a shows the rear view of the package 201 . the package has been sealed with a seal 700 , and the lower part of the seal is shown in the rear view . the mounting hole 202 is arranged to the package by arranging a hook 710 in the top of the package . the hook 710 thus at least partly encircles the mounting hole 202 . in this case the mounting hole is arranged for a round hanger , and the round mounting hole is a special case of the oval mounting hole , as discussed in the context of fig2 c . fig7 b shows the side view of the package , where thickness of the seal 700 is exaggerated . fig7 c shows the top view of the package , in which the upper part of the seal is visible . in this kind of package , the rfid device may be integrated into the seal , e . g . the seal may comprise the rfid inlay . as an example , the rear view of the package of fig7 a , in which the seal comprises an rfid inlay is shown in fig7 d . in this configuration , the angle of view a of the rfid device wiring , as seen from the centre of the mounting hole 202 , becomes almost 180 degrees . therefore , the package 201 is an rfid device that can be operated in the two modes : the stand - alone mode , where the rfid inlay is not coupled to an electrically conductive object , and in the extended mode , which is enabled by penetrating an electrically conductive object through the mounting hole 202 . for some other package shapes , the rfid inlays are not necessarily arranged perpendicular to the hanger . some examples of possible arrangements are shown in fig8 a and 8 b . the figures show a side view of packages 201 comprising an rfid inlay 100 . in the figures , the rfid inlay 100 is arranged to the rear side of the package 201 , and the plane of the rear side is not perpendicular to the direction 800 of the hanger . the plane of rfid inlay thus forms an angle β less than 90 degrees with the direction of the hanger , as depicted in the figures . it is noted that the extended mode can be enabled even for rfid inlays having an angle β equal to 0 degrees with respect to the direction of the electrically conductive object . fig8 c and 8 d show examples , where the inlay is curved and arranged on top of a package . in this case all the tangent planes of the curved plane formed by the inlay comprise the direction on the electrically conductive object , making the angle β equal to 0 . in these examples , the planar rfid inlay is also curved to increase the angle of view α . in case of fig8 c , the rfid inlay is arranged underneath the mounting hole and the angle of view is less than 180 degrees . in contrast , in fig8 d the rfid inlay is arranged above the mounting hole and the angle of view is greater than 180 degrees . it is also noted that the mounting hole 202 of fig8 c has a slightly different form than the mounting hole previously presented . moreover , in fig8 d , the mounting hole for the hanger is formed by attaching the ends of the rfid inlay 100 to the package 201 , and the space in between these objects form the mounting hole 202 . the suspendible rfid package may also be arranged such that the angle β between the tangent plane of the rfid inlay and the electrically conductive object is greater than zero , and the inlay is curved . fig8 e illustrates a package 201 that has a concave surface , onto which an rfid inlay 100 ( or a tag comprising the inlay ) has been attached . fig8 f illustrates a convex surface comprising the inlay . one further advantage of the dual - mode rfid operation is that it can be used to achieve a tamper - evident or a tamper - proof rfid package . fig9 a - 9 c show tamper - evident rfid packages 201 . they are characterized in that a perforation 901 is arranged into the package such that the perforation 901 overlaps the wiring 103 of the rfid inlay 100 . furthermore , the perforation is arranged from the mounting hole to an edge of the package . it is noted that the perforation 901 may not alter the rf properties of the rfid inlay , and therefore , the wiring 103 may not be punched in the perforation process . preferably , the perforations 901 are arranged to the package 201 before the inlay 100 is attached to the package 201 . also preferably , the mounting hole 202 for the hanger is punched to the perforated package 201 after the rfid inlay 100 has been attached to it . fig9 a shows an example of a tamper - evident rfid device , where a perforation 901 has been arranged to overlap the wiring 103 . the package is not symmetric , because the angle of view is less than 360 degrees , the perforation 901 may overlap the wiring 103 , and the gap in the wiring ( not shown , on top of the mounting hole ) is on the symmetry axis . another perforation could be arranged to make the package symmetric , if desired e . g . for a symmetric appearance . when the package breaks through the perforation 901 , the rf properties of the inlay 101 may be detuned . fig9 b shows another tamper - evident rfid device of which wiring has an angle of view α of 360 degrees . in this case the perforation 901 can be arranged to the symmetry axis . it is noted , that the perforation 901 need not to be on the symmetry axis . in this case , breaking the inlay through the perforation 901 also breaks the rfid device 201 , as the inductive coil breaks , and power supply of the rfid device breaks . as depicted in fig9 c , a perforation 901 may also be arranged to overlap the impedance matching section 102 of the chip 101 . breaking this type of package results also in the breaking of the rfid device , not just detuning its rf properties as was the case with the device shown in fig9 a . fig9 d shows a hanger 203 designed to be used with tamper - evident rfid packages . one end of the hanger 203 is attached to a wall 903 and a locking mechanism 902 is arranged in the other end of the hanger 203 . the locking mechanism 902 makes it impossible to take away a package 201 from the hanger 203 without either breaking the package 201 or opening the locking mechanism 902 . if a package 201 is taken from the hanger 203 by force , the package 201 will be ripped off through the perforation ( s ) 901 . this breaks the rfid package 201 , which helps to identify stolen products . the embodiment shown in the fig9 d can also be used for tamper - proof rfid packages . namely , an rfid reader device can be arranged to detect the number of packages 201 suspending from the hanger 203 . if the locking mechanism 902 is locked , a package 201 may not be taken from the hanger 203 without ripping it off . if someone removes the package 201 from the hanger 203 by ripping it off , the rfid transponder arranged around the hanger hole will become destroyed or detuned . this will deactivate the rfid transponder , which could be detected by the reader device . this detection can be made e . g . by using rfid reader polling for the items on regular basis . the polling would be engaged , for example when the locking mechanism is locked , and the initial number of the packages 201 in the hanger 203 could be read by the rfid reader device . polling would then compare the number of packages in the hanger to the previously known number of packages 201 in the hanger 203 . opening the locking mechanism would suspend the polling procedure , since this corresponds to the normal buying process , where the seller opens the locking mechanism 902 and hands the package to the customer . essentially the reading distance of the reader device must extend at least the size of the hanger 203 . this embodiment does not necessarily need the perforated packages of fig9 a - 9 c , since in case the wiring of the transponder encircles the mounting hole , ripping the package from the hanger will destroy the transponder unit . moreover , in case the angle of view is large , it may be extremely hard to rip the package from the hanger without destroying or detuning the transponder . another embodiment of a tamper - proof rfid system is depicted in fig9 e . in the figure , the hanger 203 , arranged for tamper - evident packages 201 , with the locking mechanism 902 , also works as the antenna 121 of an rfid reader device 120 . due to the locking mechanism , a package can be taken from the hanger 203 only by force , if the locking mechanism 902 is locked . if a tamper - evident package 201 is taken from the hanger 203 by force , the package 201 will be ripped off through the perforation ( s ) 901 and the rfid inlay 100 will not function . in this case , the rfid reader device 120 detects one package fewer in the hanger 203 . the host computer 122 may react to this event by raising an alarm or calling a security guard . as discussed in the context of fig9 d and 9 e , the hanger 203 may or may not be part of the reader device 120 . in both cases , the reading distance of the reader device 120 must extend at least the size of the hanger 203 . it is also noted that this type of tamper - proof rfid system needs not tamper - evident rfid packages . in case the rfid inlay is located such that the angle of view is somewhat less that 180 degrees , as in case of fig7 - 8 , taking a package 201 by force from the hanger 203 does not break the wiring of the rfid inlay . however , if the reading distance of the rfid reader device 120 is relatively short ( especially for a device operating in the stand - alone mode ), the rfid reader 120 still detects the decreasing number of products in the hanger 203 , and may raise an alarm if the locking mechanism 902 is locked . the foregoing descriptions of the preferred embodiments of the invention have been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . many modifications and variations are possible in light of the above teaching . it is intended that the scope of the invention be limited not by this detailed description , but rather by the claims appended hereto .	6
the present invention will now be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided so that this application will be thorough and complete , and will fully convey the true scope of the invention to those skilled in the art . like numbers refer to like elements throughout , and prime and double prime notations are used to indicate similar elements in alternate embodiments . referring initially to fig1 and 2 , a batten strip 10 having a generally elongated body 12 with parallel sides 13 , 14 and parallel ends 15 , 16 is illustrated in accordance with the present invention . a plurality of spaced , inverted channels 21 are located along an underside 17 of the body . a partial , inverted channel 23 are at each respective end 15 , 16 of the batten strip . in addition , a plurality of spaced lands 25 are located interspersed between the plurality of channels 21 . each land 25 has a generally planar bottom surface 26 . each bottom surface is supported by a roof surface ( not shown ). the batten strip 10 preferably has a length 22 of approximately thirty inches , a width 24 of approximately one and one - half inches , and a thickness 28 of approximately three - quarters of an inch , and such dimensions are substantially the same as the batten strips commercially available to the roof tile contractors and installers . the channels 21 and lands 17 have a three - inch length with the end channels 23 being one and one - half inches in length . the depth 29 of the channels is preferably five - sixteenths of one inch . other dimensions are readily achievable by one of ordinary skill in the art without deviating from the scope or spirit of the invention . for example , the batten strip may include a plurality of channels , wherein the channels and / or the lands have different dimensions . the dimensions may be varied to adapt to the severity of the debris and / or normal weather conditions to which the batten strips and tile roof are exposed . a batten strip installed around many trees or in a severe climate may require larger channels than a batten strip installed in an area that has less trees and / or milder climates . a plurality of spaced recesses 18 are predrilled along the topside 19 of the batten strip . the recesses 18 are generally located equidistant from the sides 13 , 14 of the batten strip and above the lands 25 . fastening members 27 are preset into the recesses 18 , which will later be tapped through the batten strip into the roof surface for securing the batten strip . the fastening members 27 may include nails , screws or other similar fasteners known to the art . referring now to fig3 - 5 , two adjacent and separate batten strips 10 are illustrated in an end - to - end relationship and each has a generally elongated shape with opposite ends 15 , 16 abutting each other . each end 15 , 16 of each batten strip defines a partial or reduced channel 23 with the partial channels 23 forming a complete channel 21 ′, just like the other channels 21 of batten strip 10 . the lands 25 form the contact surface for attaching the batten strip to a moisture barrier ( not shown ) attached to and above the wood roof surface ( not shown ). each land 25 preferably has the same length dimension as each channel 21 , 21 ′. however , the lands 25 may vary in size as necessary for their structural integrity and the application of the batten strip . by providing recesses 18 containing partial pre - drilled holes , fastening members 27 may be inserted into the recesses and affixed therein to simplify the installation process for an installer . therefore , to install a batten strip 10 , an installer simply needs a hammer ( not shown ) to drive the fastening members 27 into the roof surface . the necessity for carrying nails / screws and / or and an air gun having an attached hose is accordingly eliminated . the batten strip is formed from a wood - filled plastic composite , referred to in the industry as plastic wood . plastic wood is non - corrosive and non - rotting . accordingly , plastic wood is durable and can sustain extreme temperatures without compromising its strength . the risk of bowing , bending , cracking , breaking , etc . is therefore minimized . plastic wood is composed of recycled wood and plastic particles . advantageously , plastic wood helps to preserve the rain forests and prevents the unnecessary deposits of plastics in the environment . in addition , a plastic wood batten strip may be readily shortened to the dimensions of the roof by simply breaking off any unnecessary portion with a hammer . the 6 th international conference on woodfiber - plastic composites , may 15 , 2001 , is hereby incorporated by reference for a more thorough discussion of the beneficial characteristics of plastic wood . by placing the batten strip on an edge of a surface , with the unwanted portion hanging over the edge or on another batten strip prior to nailing , and the unwanted portion may be broken off by striking it with a hammer . because the batten strips are made from plastic wood , the risk of forming burrs or jagged edges are substantially decreased . advantageously , a manual or power saw is not needed and such elimination will not require the installer to carry , locate or use multiple tools , thereby simplifying the installation process , saving time and reducing labor costs . now referring to fig6 - 9 , an alternate embodiment of the batten strips 10 ′ are illustrated with the batten strips 10 ′ each having a first section 35 , respectively , and a downwardly stepped second section 37 , respectively , along their length . the first and second sections 35 , 37 are preferably equal and symmetrical , but may vary in dimension without departing from the spirit and scope of the present invention . the first section 35 has a thickness at the lands 25 ′ equal to the largest thickness of the batten strip 10 ′. the second section 37 has a thickness at the lands 25 ′ that is less than the thickness of the first section 35 . not only does this cross - section 50 ′ of the stepped embodiment reduce the amount of plastic wood used in each batten strip and thus reduce the cost to produce and ship , but the batten strip is more easily broken by a hammer blow . by reducing the cross - section 50 ′ of the second section 37 , the reduced weight also makes it easier to handle and install . it may be seen that the preformed recesses 18 ′ may be provided in the first section 35 , as best shown in fig8 or alternatively may be located in the second section 37 , as best shown in fig9 . the fastening members 27 ′ may then be partially inserted into the preformed recesses 18 ′ and ready for the installer to hammer them through the batten strip and moisture barrier into the roof surface for attaching the batten strip thereto . if the fastening members 27 ″ are located in the second section as seen in fig9 the length of the necessary fastening members 27 ″ may be shortened by about the step reduction illustrated between the first and second sections 35 , 37 . if the embodiments of fig6 - 9 are used , the thicker first section 35 would be installed on the higher elevation of a sloped roof so that the tiles ( not shown ) affixed thereto would have the greatest structural support , it being understood that the second section 37 would not be engaged by the tiles even if the second section was as thick as the first section 35 , i . e ., like the embodiments of fig1 - 5 . while the invention has been described with respect to certain specific embodiments , it will be appreciated that many modifications and changes may be made by those skilled in the art without departing from the spirit of the invention . it is intended , therefore , by the appended claims to cover all such modifications and changes as fall within the true spirit and scope of the invention .	4
turning now to the drawing in which like numerals represent like components throughout the several figures , the preferred embodiment of the present invention will be described . fig1 is a block diagram of the preferred embodiment of the present invention in its preferred environment . an isdn compatible device 10 , such as a terminal equipment (&# 34 ; te &# 34 ;) isdn device , is communicating with an isdn network termination (&# 34 ; nt &# 34 ;) device or an isdn switch 24 through a telephone switch 16 and analog telephone lines 15 and 17 . telephone switch 16 may be an analog switch or a digital switch . both devices 10 and 24 transmit and receive digital signals on isdn buses 11 and 23 , respectively , and , it will be appreciated , cannot directly link up because of the analog lines 15 and 17 and , if it is an analog switch , switch 16 . te interface 12 and modem 14 , which are connected between isdn device 10 and analog telephone line 15 convert the digital signals from isdn device 10 into analog signals suitable for transmission through analog switch 16 and over analog telephone line 15 . similarly , nt interface 22 and modem 20 , which are connected between isdn device / switch 24 and analog telephone line 17 , convert the digital signals from isdn device / switch 24 into analog signals for provision to switch 16 over analog telephone line 17 . devices 12 , 14 , 20 and 22 are bidirectional and also convert analog signals on telephone lines 15 and 17 into digital signals on lines 11 and 23 , respectively , for use by isdn devices 10 and 24 , respectively . in the preferred embodiment , modems 14 and 20 convert analog signals into digital signals , and vice versa . interfaces 12 and 22 convert the digital signals into isdn d channel data , and vice versa . in the preferred embodiment , modems 14 and 20 are 9600 bps synchronous modems . it will be appreciated that other modem speeds can be used but , since the d channel data rate is 16 kbps , a lower speed modem would severely underutilize the data carrying capabilities of the d channel . fig2 is a block diagram of te interface 12 or , as shown in the numerals in parenthesis , of nt interface 22 . the general operation of interfaces 12 and 22 is identical and , therefore , only the operation of interface 12 will be described . the signal to be transmitted , coming from isdn device 10 via isdn bus 11 is provided to the isdn interface circuit 31 which extracts the d channel data from the composite 192 kbps ( 2b + d ) data signal . this circuit 31 also provides a 16 kbps clock signal for the d channel data . this data is passed to the data transmission detector circuit 40 which passes the data to the first - in first - out ( fifo ) ( 37 ) at the 16 kbps rate . this is then fed to the modem from fifo 37 according to the rxclk clock provided by the modem on line 13c . the signal on line 13c is the received data which is provided to modem 14 for conversion into an analog signal for placing on analog line 15 . components 37 and 40 therefore perform the function of taking the 192 kbps ( 2 b + d ) isdn signal from device 10 , extracting the d channel data and clock , and providing the d channel data to the modem 14 . note that the d channel data is received from isdn device 10 at the rate of 16 kbps but that this data is provided to modem 14 at the rate of 9 . 6 kbps or less . fifo 37 provides a buffer between these two different data transfer speeds . fifo 37 is prevented from overflowing by the packetizing of data and the use of flow control protocols between the te device and the nt device which pass transparently through the modems and interface devices 12 and 22 . the packetizing of data causes large non - data spaces to occur on the data line thereby greatly reducing the average data rate . the te and nt devices do not buffer the non - data spaces so the fifos have time to empty while these non - data spaces are occurring . data coming from the modem on line 13a is fed to data transmission detector circuit 35 which then passes it to another fifo 36 . the data is then clocked out of fifo 36 at the 16 kbps rate ( derived from the isdn interface circuit 31 ) into the isdn interface circuit 31 and is then placed on isdn bus 11 to isdn device 10 . fifo 36 accumulates the data from modem 14 at the slower rate and provides the data ( in complete packets only ) at a 16 kbps data rate to the isdn interface circuit 31 . data is not clocked out of fifo 36 until a complete packet is available in fifo 36 . therefore , there is no disruption of data in the middle of a packet . turn now to fig3 a through 3d , which are a schematic diagram of interface circuits 12 and 22 . fig3 a is a schematic of the circuitry which interfaces with the modems 14 and 20 . a db - 25 connector 60 is connected to the appropriate rs - 232 lines 13 or 21 . transmit data ( txd ) from the modem appears on pin 3 , is inverted by rs232 receiver 61 , and applied to the serial input ( sin ) input of a serial input / parallel output register , such as the 74ls595 . the parallel outputs , qa - qh of register 62 are connected to dbus 67 . register 62 is clocked by the transmit data clock ( txclk ) on pin 17 of connector 60 . note that the txclk signal is inverted by rs232 receiver 63 before application to register 62 and counter 70 . the negated read signal on conductor 65 and the negated 9 . 6krec signal on conductor 66 are applied to the inputs of a two input or gate 64 . the output of gate 64 is connected to the negated output enable input of register 62 . the contents of register 62 are therefore placed onto dbus 67 when the signals on both conductors 65 and 66 are a logic 0 . the negated txclk signal on conductor 68 is also applied to the clock input of a programmable binary counter , such as the 74hct163 . the preset inputs ( p0 - p3 ) of counter 70 cause counter 70 to begin counting at 0001 . the q3 output of register 70 is connected to the input of an inverter 71 . the output of inverter 71 is connected by negated int1 conductor 72 to the negated load input of register 70 . after 8 txd bits have been received , which corresponds to 8 positive going transitions of the negated txclk signal on conductor 68 , the q3 output of register 70 will become a logic 1 . the output of inverter 71 will be a logic 0 , which places counter 70 in the load state and which generates an interrupt . the interrupt indicates that register 62 is full and its contents should be read . this causes the processor to place a low on conductors 65 and 66 which allows register 62 to place its contents on dbus 67 so that the processor can read the incoming data . the negated write signal on conductor 82 and the negated 9 . 6ksend signal on conductor 83 are connected to the inputs of a two input or gate 81 . the output of gate 81 is connected to the clock input of an 8 bit buffer 80 , such as the 74hct374 . dbus 67 is connected to the data inputs ( d0 - d7 ) of register 80 . the outputs ( q0 - q7 ) of register 80 are connected by bus 77 to the data inputs ( da - dh ) of a parallel in , serial out register , such as the 74hct166 . the qh output of register 76 is connected to the input of rs232 inverter / transmitter 75 . the output of transmitter 75 is the rxd signal on pin 2 of connector 60 . the receive data clock ( rxclk ) on pin 15 is connected to the input of rs232 inverter / receiver 84 . the output of receiver 84 is connected by conductor 88 to the clock input of register 76 and counter 85 . negative going transitions of the rxclk signal on pin 15 cause the data contained in register 76 to be shifted out , in serial fashion , to the rxd pin . counter 85 , like counter 70 , may be a type 74hct163 . the preset inputs ( p0 - p3 ) of counter 85 are also connected to load the value 0001 . the q3 output of counter 85 is connected to the input of inverter 86 . the output of inverter 86 is the negated int2 interrupt signal on conductor 87 and is connected to the negated load input of register 76 and of counter 85 . therefore , after 8 bits have been read from register 76 counter 85 causes register 76 to load the data appearing on the q0 - q7 outputs of buffer 80 . the negated int2 signal on conductor 87 also signals the processor to write the next 8 bits of rxd data into buffer 80 . therefore , each time the 8 bits in register 76 have read out , register 76 is loaded with the next 8 bits of rxd data . dtr pin 20 of connector 60 is selectably connected by switch 73 to plus 10 volts ( off ) or minus 10 volts ( on ). switch 73 controls the data terminal ready ( dtr ) line of the modem 14 ( 20 ) and is used to switch from a telephone used for dialing ( not shown ) to the originating modem after the remote modem has answered the call . it is also used to signal an auto dialing modem to dial the far end modem for a more automated setup . the switch is generally used only from the originating end . at the answering end switch 73 is generally left in the off position . data carrier detect ( dcd ) pin 8 of connector 60 is connected to the input of rs232 receiver 90 . the output of receiver 90 is connected to the buffered data carrier detect ( dcdb ) conductor 96 through switch 91 and a 56 ohm current limiting resistor 92 . conductor 96 is connected to the plus 5 volt supply through a 10k ohm pull - up resistor 93 . conductor 96 is connected to one end of a 10 microfarad capacitor 94 . the other end of capacitor 94 is connected to circuit ground . conductor 96 may also be selectably connected to ground via reset switch 95 . switch 91 , when in the on position , allows the modem 14 ( 20 ) to use its dcd line to reset the interface 12 ( 22 ). this allows an interface to be remotely reset by simply dropping the carrier . switch 91 is generally left in the on position so that a remote reset may be accomplished if necessary . fig3 b1 and 3b2 are a schematic diagram of the processor section of interfaces 12 and 22 . in the preferred embodiment , microprocessor 150 is a type 80c188 microprocessor and memory 166 comprises both a type tc55257 - 12 ram and a type 27c64 eprom . the ucs and lcs output of processor 150 are connected by conductors 165 and 164 , respectively , to the ucs and lcs inputs , respectively , of memory 166 . in the preferred embodiment , the ucs signal selects the eprom and the lcs signal selects the ram . the negated read and negated write outputs of processor 150 are connected by conductors 65 and 82 , respectively , to memory 166 and other circuits in fig3 . processor 150 has an 8 bit combined address / data port ( ad0 - ad7 ) which is connected by adbus 157 to the a port ( a0 - a7 ) of bidirectional buffer 156 and to the d0 - d7 inputs of address latch 161 . in the preferred embodiment , buffer 156 is a type 74hct245 and latch 161 is a type 74hct373 . the address latch enable ( ale ) output of processor 150 is connected by conductor 160 to the negated latch input of latch 161 . the q0 - q7 outputs of latch 161 and the a8 - a14 address outputs of processor 150 are connected by buses 162 and 163 , respectively , to the address inputs of memory 166 . the data input / output port of memory 166 is connected to dbus 67 which is also connected to the b port ( b0 - b7 ) of bidirectional buffer 156 . the data enable ( den ) output of processor 150 is connected by conductor 155 to the negated output enable input of buffer 156 . the data transfer ( dtrans ) output of processor 150 is connected by conductor 153 to one input of or gate 154 . the output of gate 154 is connected to the direction ( dir ) input of buffer 156 . processor 150 provides several clock outputs ( pcs0 - pcs5 ) on conductors 110 ( negated 16ksend ), 140 ( negated 16krec ), 83 ( negated 16ksend ), 66 ( negated 16krec ), and 152 ( negated deccs ), respectively . also , the pcs4 clock is connected by conductor 152 to a negated input of gate 154 . it will be appreciated that address latch 161 and bidirectional buffer 156 are used in a conventional manner to compensate for the combined address / data characteristics of the ad0 - ad7 inputs / outputs of processor 150 . the dcdb signal on conductor 96 is connected to the negated reset input of processor 150 and , via switch 95 , or via switch 91 and the dcd input on connector 60 , can be used to reset processor 150 . processor 150 has four interrupts ( int0 - int3 ). the int1 input is used to interrupt processor 150 when the txd data has filled register 62 ( fig3 a ). likewise , the int2 input is used to interrupt processor 150 whenever all the rxd data has been read out of register 76 ( fig3 a ). the int0 input is used to interrupt processor 150 every time 8 bits have been transmitted or received on the isdn d channel . the decint signal on conductor 144 is connected to the input of inverter 146 . conductor 144 is also connected to the + 5 volt supply through a 10k pullup resistor 145 . the output of inverter 146 is connected by conductor 147 to the int3 input of processor 150 . the int3 input is used to notify processor 150 that the dec ( fig3 c ) requires servicing . processor 150 is programmed to detect a rising edge on interrupt inputs int0 - int2 , and a logic 1 on interrupt int3 . data to be placed upon the isdn d channel is placed on dbus 67 by processor 150 . processor 150 then causes the negated write and negated 16ksend signals to go low . the negated write and negated 16ksend signals on conductors 82 and 110 , respectively , are connected to the inputs of or gate 111 . the output of gate 111 is connected to the clock input of a type 74hct374 octal buffer 112 . dbus 67 is connected to the data inputs ( d0 - d7 ) of buffer 112 . the outputs ( q0 - q7 ) of buffer 112 are connected by bus 113 to the data inputs ( da - dh ) of a type 74hct166 parallel in / serial out register 114 . the output qh of register 114 is connected by conductor 115 to one input of a two input or gate 116 . the output of gate 116 is connected to one input of a two input and gate 122 . the output of gate 122 is the ssdi signal on conductor 123 . signal dgate on conductor 117 is connected to the other input of or gate 116 and is also connected to circuit ground through a 1k pulldown resistor 121 . signal sdigate on conductor 120 is connected to the other input of and gate 122 and to + 5 volts through a 10k pullup resistor 124 . the purpose of the pullup and pulldown resistors is explained below . conductor 126 is connected to the input of inverter 127 and the clock inputs of a type 74hct163 presettable counter 135 and a type 74hct595 serial in / parallel out register 142 . the preset inputs of counter 135 are set to load counter 135 with the initial value 0001 . the q3 output of counter 135 is connected to the input of inverter 136 . the output of inverter 136 is connected by negated int0 conductor 137 to the negated load input of counter 135 and the negated load input of register 114 . the operation of counter 135 is similar to that of counters 70 and 85 of fig3 a . that is , after eight transitions of the clock signal on conductor 126 , which indicates that the data in register 114 has been shifted out , counter 135 will generate an interrupt which causes processor 150 to load additional data into buffer 112 . the signal on conductor 137 also causes register 114 to load the data present at the output of register 112 on bus 113 . note that an interrupt occurs every 8 bits . the negated 16krec signal on conductor 140 and the negated read signal on conductor 65 are connected to the inputs of two input or gate 141 . the output of gate 141 is connected to the negated output enable input of register 142 . the ssdo signal on conductor 143 is connected to the serial input ( sin ) of register 142 . the outputs ( qa - qh ) of register 142 are connected to dbus 67 . data which has been received on the d channel is provided by conductor 143 to the serial input of register 142 and this data is shifted into register 142 by the clock on conductor 126 . note that the clock on conductor 126 simultaneously controls the shifting of registers 114 and 142 and the incrementing of the count in counter 135 . counter 135 causes an interrupt to be generated and causes registers 112 and 142 to be serviced every 8 bits ( clock transitions on conductor 126 ). when the interrupt is generated , processor 150 , in addition to causing data to be loaded into register 112 , causes conductors 65 and 140 to go low , thereby allowing register 142 to place its contents on dbus 67 so that processor 150 may read the incoming d channel data . the clock signal on conductor 126 may come from either one of two sources . one source is the 16khzclk signal on conductor 125 . this signal is used when the interface is operated as an &# 34 ; nt &# 34 ; type isdn device . the other clock source is the output of and gate 131 on conductor 132 . the pclk signal on conductor 130 is connected to one input of gate 131 . the negated tscb signal on conductor 133 is connected to the input of inverter 134 . the output of inverter 134 is connected to the other input of gate 131 . the output of gate 131 is used whenever the interface device is used as a &# 34 ; te &# 34 ; type isdn device . for clarity , selection of either the clock signal on conductor 125 or the clock signal on conductor 132 is shown as being accomplished by means of switch 128 . however , in the preferred embodiment conductors 125 , 126 and 132 are connected together and a switch 128 is not used but , instead , if the nt mode is desired , gate 131 is physically removed from the circuit board and , if te operation is desired , the device generating the 16khzclk clock signal on conductor 125 is physically removed from the circuit board . the purpose of constructing the preferred embodiment of the present invention in this manner is so that a single device can be used as either a te device or a nt device by simply inserting or removing certain integrated circuit packages from the circuit board . of course , it will be appreciated that selection of nt or te operation can also be accomplished by a multi - pole , doublethrow switch , part of which is shown as switch 128 . another option is to use a switch and gates to selectively enable or disable selected outputs . when configured to operate in the te mode , the devices which generate the signals on sdigate conductor 120 and dgate conductor 117 will not be present . therefore , resistors 121 and 124 properly bias gates 116 and 123 , respectively , for normal operation . similarly , if the device is configured for nt mode operation then the device which generates the decint signal on conductor 144 will be missing . therefore , resistor 145 causes inverter 146 to place a logic 0 onto conductor 147 so that the int3 input of processor 150 does not cause an unnecessary interrupt . the x1 and x2 clock terminals of processor 150 are connected by conductors 170 and 171 to a 16 mhz crystal 170 and to a series combination of 10 picofarad capacitors 172 and 173 . the junction of capacitors 172 and 173 is connected to circuit ground . turn now to fig3 c which is a schematic diagram of the additional circuitry used when an interface is configured for the te mode of operation . this circuitry is not used when the interface is configured for the nt mode of operation . an isdn line 11 is connected to rj - 45 8 pin connector 180 . the negative txd line ( pin 4 ) is connected by conductor 181 to one end of line balancing resistor 183 and one end of a first winding of isolation transformer 184 . the positive txd line ( pin 5 ) is connected by conductor 182 to the other end of resistor 183 and the other end of the first winding of transformer 184 . the second winding of transformer 184 is connected by conductors 185 and 186 to the lout1 and lout2 outputs , respectively , of an advanced micro devices type 79c31a digital exchange controller ( dec ) 187 . other isdn interface devices from other manufactures could also be used . dec 187 causes an isdn signal to be placed onto conductors 181 and 182 via transformer 184 . the negative receive data line ( pin 3 ) is connected by conductor 190 to one end of line balancing resistor 192 and one end of the first winding of isolation transformer 193 . the positive receive data line ( pin 6 ) is connected by conductor 191 to the other end of resistor 192 and the other end of the first winding of transformer 193 . the second winding of transformer 193 is connected by conductors 194 and 195 to the lin1 and lin2 inputs , respectively , of dec 187 . dec 187 therefore receives the isdn signal present on conductors 190 and 191 . dec 187 accepts the serial data input ( ssdi ) on conductor 123 via its drb input , configures this data into the isdn format and places the resulting isdn signal on its lout1 and lout2 outputs . when receiving data via its lin1 and lin2 inputs dec 187 will extract the d channel data from the isdn signal and provide , via its dxb output , the d channel data onto ssdo conductor 143 . conductor 143 is also connected to the + 5 volt supply through a 10k ohm pullup resistor 206 . the negated interrupt output of dec 187 is connected to decint conductor 144 . a low on conductor 144 informs processor 150 that dec 187 requires servicing . adbus 157 is connected to the address / data input / output port ( ad0 - ad7 ) of dec 187 . this allows processor 150 to program dec 187 and exchange information with dec 187 other than through the d channel terminals ( drb and dxb ). ale conductor 160 is connected to the address latch enable input of dec 187 for latching in the address of the register for which data is to be transferred . the negated read signal on conductor 65 is connected to one input of a two input and gate 196 . the output of gate 196 is connected by conductor 197 to the negated read input of dec 187 . dcdb conductor 96 is connected to the other input of gate 196 and to one input of a two input and gate 200 . the output of gate 200 is connected by conductor 201 to the negated write input of dec 187 . negated write conductor 82 is connected to the other input of gate 200 . the negated read and write signals allow processor 150 to write data to or read data from dec 187 . note that when the dcdb signal on conductor 96 is low , such as during a reset , both the read and write inputs of dec 187 are brought low which causes a hard reset to dec 187 . the negated deccs signal on conductor 152 is connected to the negated chip select ( cs ) input of dec 187 and is used to select dec 187 for read or write operations . the negated tscb ( time slot control ) output of dec 187 is connected to conductor 133 . conductor 133 is also connected to the + 5 volt supply through a 10k ohm pullup resistor 205 . the negated tscb signal is used in conjunction with the plck signal on conductor 130 to generate the clock signal on conductor 126 used for clocking data into and out of registers 114 and 142 ( fig3 b ). the negated tscb signal is low when data is present on the dxb output of dec 187 . clock generator 202 generates the clocks necessary for the operation of dec 187 . three clocks are provided . a 12 . 288 mhz clock on conductor 203 , which is connected to the mclk input of dec 187 . a 1 . 024 mhz clock on plck conductor 130 , which is connected to the pclk input of dec 187 . the framing clock ( fc ) on conductor 204 is connected to the fs ( frame synchronization ) input of dec 187 . the fc clock on conductor 204 is a 1 . 95 microsecond pulse repeated at 8 kbps . turn now to fig3 d which is a schematic diagram of the additional circuitry used when an interface is configured for the nt mode of operation . this circuitry is not used when the interface is configured for the te mode of operation . an 8 pin rj45 telephone connector 180 &# 39 ; provides the connection to isdn line 23 ( fig1 ). in the preferred embodiment , two connectors 180 and 180 &# 39 ; are used and are labeled as the te connection and the nt connection , respectively . two connectors were used as a matter of convenience . however , since connectors 180 and 180 &# 39 ; are connected in parallel a single connector 180 could be used if desired . on connector 180 &# 39 ;, pin 4 and pin 5 are the negative rxd and positive rxd signal points , respectively . likewise , pin 3 and pin 6 are the negative txd and positive txd signal points , respectively . pin 4 , pin 5 , pin 3 and pin 6 of connector 180 &# 39 ; are connected to conductors 181 , 182 , 190 , and 191 , respectively . the connection of resistors 183 and 192 and transformers 184 and 193 has been previously described in conjunction with fig3 c . conductors 185 and 186 are connected to the sy1 and sy2 inputs of an s bus interface circuit , such as the siemens peb2080 . isdn interface from other manufacturers could also be used . the siemens peb2080 requires that a 0 . 01 microfarad capacitor 188 be connected between the sy1 input and circuit ground . the device 220 is configured to perform as an nt type device . the sy1 and sy2 terminals of device 220 are the isdn signal inputs for device 220 . conductors 194 and 195 are connected to the sx1 and sx2 outputs of device 220 . outputs sx1 and sx2 are the isdn signal outputs of device 220 . referring briefly to fig3 c , it will be seen that a te interface transmits on pins 4 and 5 and receives on pins on 3 and 6 of connector 180 . an nt interface transmits on pins 3 and 6 and receives on pins 4 and 5 . dcdb conductor 96 is connected to the negated reset input of device 220 . the rref input of device 220 is connected to circuit ground through a 2 . 2k ohm , 1 percent resistor 221 . the outgoing serial data on ssdi conductor 123 is connected to the sdi input of device 220 . device 220 then places this data , in isdn format , onto conductors 194 and 195 via its sx1 and sx2 outputs . likewise , incoming isdn data , received via the sy1 and sy2 inputs of device 220 , is placed on ssdo conductor 143 by device 220 via its sdo output . the xtal1 and xtal2 terminals of device 220 are connected by conductors 227 and 230 to a 7 . 68 mhz crystal 231 and to the series combination of two 10 picofarad capacitors 232 and 233 . the junction of capacitors 232 and 233 is connected to circuit ground . device 220 provides four clock outputs , 3 . 84 mhz , 1 . 536 mhz , 512 khz , and 8 khz on conductors 222 , 223 , 224 and 225 , respectively , to clock extractor circuit 226 . clock extractor circuit 226 generates the sdigate signal on conductor 120 , the dgate signal on conductor 117 , and the 16khzclk signal on conductor 125 . the sdigate signal is an approximately 11 . 72 microsecond logic 0 pulse which is delayed about 39 . 2 microseconds from the rising edge of the 8 khz clock on conductor 225 . the dgate signal on conductor 117 is an approximately 7 . 81 microsecond logic 0 pulse which is delayed about 27 . 5 microseconds from the rising edge of the 8 khz clock on conductor 225 . the 16khzclk signal on conductor 25 comprises two 3 . 9 microsecond logic 0 pulses which begin approximately 0 . 33 microseconds after the falling edge of the dgate signal . the two logic 0 pulses are separated by a logic 1 pulse having a width of approximately 3 . 9 microseconds . as was discussed with respect to fig3 b , the sdigate and dgate signals are used to enable gating of data into the sdi input of device 220 via ssdi conductor 123 . the 16khzclk signal on conductor 125 is used for the actual shifting of the data into device 220 and also serves to increment a counter 135 which generates an interrupt to processor 150 each time that 8 bits have been transferred to or from the isdn d channel . device 220 and clock extractor 226 are only used when the device is configured to act as a nt interface . therefore , when the device is configured to act as a te interface the integrated circuits for device 220 and clock extractor 226 are physically removed from the board . alternatively , if desired , a multi - pole double throw switch and / or logic gating could be used to selectively enable or disable certain integrated circuits so that selection of the nt or te mode could be accomplished by a switch rather than by physically inserting or removing integrated circuits . turn now to fig4 a through 4d which are a flow chart of the operation of processor 150 . after being initialized 240 processor 150 determines 241 whether the 16krec flag has been set . if not , processor 150 proceeds to decision 247 . if so , then processor 150 reads 242 the byte from bufa . bufa is a designated portion of the ram in memory 166 used to temporarily store data incoming on the isdn line . processor 150 then determines 243 whether the byte contains one or more zeros ( i . e ., contains data ). if not , then this byte corresponds to an idle line and is deleted ( i . e ., not placed in the 16kxmit queue and not sent to the modem ); processor 150 proceeds to decision 247 . if so , then the byte contains data so processor 150 then 244 places the byte in the 9 . 6kxmit queue and increments the 9 . 6khead counter . processor 150 then determines 245 whether the 9 . 6khead count is at its maximum allowed value . in the preferred embodiment , the maximum count is 8192 . if not , processor 150 proceeds to decision 247 . if so , then processor 150 sets the head value to the beginning of the buffer and then proceeds to decision 247 . in other words , the 9 . 6kxmit queue and its associated pointer ( contained in the 9 . 6khead counter ) form a circular queue that is being used as a software fifo ( 37 ). in decision 247 processor 150 determines whether the 9 . 6krec flag has been set . if not , processor 150 proceeds to decision 260 ( fig4 b ). if so , then processor 150 reads 250 the byte from bufb . bufb corresponds to a section in the memory 166 used to temporarily store data received from the modem on the rs - 232 line . processor 150 then determines 251 whether the byte contains data ( one or more zeros ). if the byte does not contain data ( byte equals ffh ), processor 150 determines 252 whether the receive zero ( recz ) flag has been set . if not , processor 150 proceeds to decision 260 . if so , then in step 253 processor 150 clears the receive zero flag , stores 5 bytes of ffh in the 16kxmit queue in order to separate the packets in the fifo , adds 4 to the workinghead pointer , and sets the 16khead pointer equal to the workinghead pointer . processor 150 then increments the workinghead pointer . processor 150 then compares 257 workinghead to its maximum allowed value . if less , processor 150 proceeds to decision 260 . if equal , processor 150 sets 259 workinghead to its minimum value and then proceeds to decision 260 . if greater , processor 150 sets 258 the workinghead pointer and the 16khead pointer to their rollaround values by substracting their max values . processor 150 then proceeds to decision 260 . if , at decision 251 , the byte contains data ( one or more zeros ), processor 150 then 254 places the byte in the 16kxmit queue , sets the receive zero flag , and increments the workinghead . processor 150 then determines 255 whether the workinghead is at its maximum allowed value . if not , processor 150 proceeds to decision 260 . if so , then processor 150 sets the workinghead pointer to its minimum value . in the preferred embodiment , the maximum allowed value for the workinghead is 8192 . the workinghead pointer and the 16kxmit queue form a circular queue being used as a software fifo ( 36 ). in decision 260 processor 150 determines whether the 16kxmitbyte flag has been set . if not , processor 150 proceeds to decision 264 . if so , processor 150 then 261 gets the byte from the 16 kxmit queue , writes the byte to register 112 of fig3 b ( the 16kxmit port ), clears the 16kxmitbyte flag , and increments the 16ktail counter . processor 150 then determines 262 whether 16ktail counter is at its maximum allowed value . if not , processor 150 proceeds to decision 264 . if so , then processor 150 sets the 16ktail counter to its starting value . in the preferred embodiment , the maximum allowed value of 16ktail is 8192 . in decision 264 processor 150 determines whether the 9 . 6kxmitbyte flag has been set . if not , processor 150 returns to decision 241 . if so , then processor 150 determines 265 whether the 9 . 6khead count is equal to the 9 . 6ktail count . if so , then processor 150 writes the value ffh to the 9 . 6kxmit port and again returns to decision 241 . if not processor 150 then 266 writes the byte to register 80 of fig3 a ( the 9 . 6kxmit port ). and increments the 9 . 6ktail count . processor 150 then determines whether the 9 . 6ktail count is at its maximum allowed value . if not , processor 150 returns to decision 241 . if not , then processor 150 sets the 9 . 6ktail counter to its starting value . in the preferred embodiment , the maximum allowed value for the 9 . 6ktail count is 8192 . if an int0 interrupt occurs 280 then processor 150 will 281 read in the byte from register 142 ( the 16krec port ), put the byte in bufa , and set the 16krec flag . processor 150 then determines 282 whether 16khead is equal to 16ktail . if not , processor 150 returns 284 . if so , processor 150 then sets 283 the 16kxmitbyte flag and then returns 284 . when an int1 interrupt occurs 290 , processor 150 then 291 reads in the byte from register 62 of fig3 a , ( the 9 . 6krec port ) places the byte in bufb , and sets the 9 . 6krec flag . processor 150 then returns 292 . when an int2 interrupt occurs 300 , processor 150 sets 302 the 9 . 6kxmitbyte flag and returns 303 . when an int3 interrupt occurs ( not shown ), processor 150 reads the status register in the dec to determine the state of the isdn interface ( i . e ., active or not active ) and reports this to the user via an led ( not shown ). the handling of an int3 interrupt is conventional and is not concerned with the transfer of data . briefly summarized , int0 is concerned with reading and writing isdn data . int1 is concerned with reading the data received from the modem . int2 is concerned with writing the data to the modem . steps 241 through 246 are concerned with detecting data on the isdn line and placing it in the fifo ( 37 ) and with deleting idle signals received from the isdn device . steps 247 through 259 are concerned with detecting data from the modem and placing it in the fifo ( 36 ) and with inserting idle signals into the data stream to the isdn device . steps 260 - 263 are concerned with reading the data from the fifo ( 36 ) and placing the data onto the isdn line . steps 264 through 270 are concerned with reading the data from the fifo ( 37 ) and writing data out onto the rs - 232 line . the preferred embodiment of the present invention discloses an isdn / rs - 232 interface device which can be selectably configured to operate in either the te or the nt mode . the present invention allows the development and testing of hardware and / or software for devices which are intended to be isdn compatible by allowing communication with an isdn telephone switching system or network by using analog telephone lines . the present invention also allows communication between isdn devices over a standard analog telephone network so that isdn devices can be used even in areas where the local telephone company does not provide isdn facilities . although the preferred embodiment of the present invention has been described with particularity , it will be understood that numerous modifications and variations are possible . for example , the present invention may also be implemented using only hardware instead of a combination of hardware and software . also , the present invention is not limited to communications on the d channel but could also transfer data on a b channel . accordingly , the scope of the present invention is to be limited only by the claims below .	7
in a first embodiment , a description is made of a composite type dynamic amount sensor 1 by employing fig1 a to fig8 b and fig3 . fig1 a is a plan view of the composite type dynamic amount sensor 1 ; fig1 b is a sectional view of the sensor 1 taken along a line ib - ib of fig1 a ; and fig1 c is a sectional view thereof taken along a line ic - ic of fig1 a . fig2 is a sectional view for showing the sensor 1 taken along a line ii - ii of fig1 b and fig1 c . as indicated in fig1 a to fig1 c and fig2 , the composite type dynamic amount sensor 1 is constructed in such a way that a piezoelectric type pressure sensor 30 has been stacked on an n type silicon substrate 21 where a capacitance type acceleration sensor 20 has been formed in such a manner that the capacitance type acceleration sensor 20 is sealed . also , the composite type dynamic amount sensor 1 has been mounted in the same package 50 for packaging a processing circuit 40 which processes an output of the composite type dynamic amount sensor 1 . a first description is made of the piezoelectric type pressure sensor 30 with reference to fig1 a to fig1 c . the piezoelectric type pressure sensor 30 is constituted by a diaphragm 31 having a concave shape , 4 pieces of piezoelectric resistors 32 in total , 4 pieces of pressure sensor - purpose wiring lines 33 , 4 pieces of pressure sensor - purpose pads 34 , and a surface protection film 35 for protecting surfaces of the pressure sensor - purpose wiring lines 33 . the diaphragm 31 has been formed by etching an n type silicon substrate 31 c . the piezoelectric resistors 32 are provided in a deforming portion 31 a of the diaphragm 31 , and detect deformation of the deforming portion 31 a along a direction perpendicular to an elongation direction of the deforming portion 31 a so as to output the detected deformation . the pressure sensor - purpose wiring lines 33 transfer the outputs of the respective piezoelectric resistors 32 . the pressure sensor - purpose pads 34 have been connected to the respective pressure sensor - purpose wiring lines 33 . this deforming portion 31 a constitutes a concave button plane of the diaphragm 31 , and if pressure is applied to the deforming portion 31 a , then the deforming portion 31 a is deformed . while the deforming portion 31 a has a structure surrounded by a ground frame 31 b , the diaphragm 31 has been constructed of the deforming portion 31 a and the ground frame 31 b . four pieces of the piezoelectric resistors 32 are internally provided on a plane located opposite to the concave bottom plane of the deforming portion 31 a . although not shown in the drawings , these piezoelectric resistors 32 have constituted a bridge circuit . the pressure sensor - purpose wiring lines 33 , the pressure sensor - purpose pads 34 , and the surface protection film 35 have been set on the plane on the side where the piezoelectric resistors 32 are internally provided . then , the respective pressure sensor - purpose pads 34 are electrically connected to the respective processing circuit - purpose pads 41 coupled to the processing circuit 40 by employing a wire bonding . it should be understood that the diaphragm 31 has such a dimension capable of sealing the capacitance type acceleration sensor 20 within a sealing space formed by the diaphragm 31 and an outer frame 22 ( will be explained later ). then , the above - described sealing space constitutes a reference pressure chamber 37 of the pressure sensor . next , the capacitance type acceleration sensor 20 will now be described with reference to fig1 b , fig1 c , and fig2 . it should be understood that although the diagrams shown in fig1 b , fig1 c and fig2 exemplify a basic idea of the capacitance type acceleration sensor 20 , namely , a cantilever , a double camber beam and a multiple camber beam may be alternatively employed . one example of actual concrete structures is indicated in fig3 . the capacitance type acceleration sensor 20 has been formed by a movable portion 23 and a fixed portion 24 , while an entire circumference of the capacitance type acceleration sensor 20 has been surrounded by an outer frame 22 by separating a gap . as will be described later with reference to fig5 a , fig5 b , fig6 a and fig6 b , the outer frame 22 , the movable portion 23 , and the fixed portion 24 have been formed by etching the n type silicon substrate 21 . as shown in fig2 , the movable portion 23 has been constituted by 2 pieces of movable electrodes 23 a , a weight 23 b which joins these movable electrodes 23 a , a pillar 23 d to which a movable portion - purpose wiring line 23 c is connected , and a beam 23 e which joins the weight 23 b and the pillar 23 d . as indicated in fig1 b , the movable electrode 23 a has a gap between a supporting substrate 25 and the own movable electrode 23 a . similarly to the movable electrode 23 a , the weight 23 b and the beam 23 e have a gap between the supporting substrate 25 and the weight 23 b and the beam 23 e although not shown in the figure . on the other hand , the pillar 23 d has been fixed on an insulating film 26 stacked on the supporting substrate 25 . since the capacitance type acceleration sensor 20 is equipped with such a structure , the beam 23 e causes the pillar 23 d to be distorted along a direction “ iic ” of fig2 , so that both the weight 23 b and the movable electrode 23 a are displaced along the direction “ iic .” also , the movable portion - purpose wiring line 23 c connected to the pillar 23 d has joined the movable portion - purpose pad 23 f provided on the outer frame 22 to the pillar 23 d under bridging condition . then , while a predetermined voltage ( or predetermined current ) is applied to the movable portion - purpose pad 23 f , the same voltage ( or same current ) as that of the movable portion - purpose pad 23 f is applied also to the movable electrode 23 a via the movable portion - purpose wiring line 23 c . on the other hand , as shown in fig2 , the fixed portion 24 is made of 2 pieces of fixed electrodes 24 a , a coupling portion 24 b , and a fixed portion - purpose wiring line 24 c . these two fixed electrodes 24 a are located opposite to the above - described respective movable electrodes 23 a . the coupling portion 24 b joins these fixed electrodes 24 a . the two fixed electrodes 24 a and the coupling portion 24 b have been constructed on the insulating film 26 . the fixed portion - purpose wiring line 24 c has joined the fixed portion - purpose pad 24 d provided on the outer frame 22 to the coupling portion 24 b under bridging condition . then , while a predetermined voltage ( or predetermined current ) is applied to the fixed portion - purpose pad 24 d , the same voltage ( or same current ) as that of the fixed portion - purpose pad 24 d is applied also to the fixed electrode 24 a via the fixed portion - purpose wiring line 24 c . since such a structure is provided , if acceleration is applied to the capacitance type acceleration sensor 20 along the direction “ iic ”, then the movable electrode 23 a is displaced along the direction “ iic ” to approach the fixed electrode 24 a , while the pillar 23 d of the movable portion 23 is set to a fulcrum . at this time , an electrostatic capacitance between the movable electrode 23 a and the fixed electrode 24 a is changed with respect to an electrostatic capacitance of such a condition that acceleration is not applied . concretely speaking , in such a case where acceleration is applied along a direction “ iic 1 ” of fig2 , the fixed electrode 24 a is separated from the movable electrode 23 a , so that the electrostatic capacitance is decreased . conversely , in such a case where acceleration is applied along a direction “ iic 2 ” of fig2 , the fixed electrode 24 a approaches to the movable electrode 23 a , so that the electrostatic capacitance is increased . in other words , magnitudes of the applied acceleration may correspond to the increase / decrease of the electrostatic capacitances . then , a change in the electrostatic capacitances is detected by comparing a voltage ( or current ) transferred to the movable portion - purpose pad 23 f via the movable portion - purpose wiring line 23 c which joins the movable portion 23 and the outer frame 22 with another voltage ( or current ) transferred to the fixed portion - purpose pad 24 d via the fixed portion - purpose wiring line 24 c which joins the fixed portion 24 and the outer frame 22 by the processing circuit 40 . concretely speaking , as shown in fig1 a , fig1 c , and fig2 , while the movable portion - purpose pad 23 f and the fixed portion - purpose 24 d are connected to the corresponding processing circuit - purpose pads 41 by the wire bonding manner , the voltages ( currents ) which are inputted from the respective processing circuit - purpose pads 41 are compared with each other by the processing circuit 40 so as to detect the applied acceleration . also , a frame “ iid ” indicated in fig2 shows an outer fence of the ground frame 31 b of the diaphragm 31 in such a case where the piezoelectric type pressure sensor 30 is stacked on the outer frame 22 which surrounds the capacitance type acceleration sensor 20 . as represented in fig2 , both the movable portion 23 and the fixed portion 24 have been sealed inside a sealing space which is formed by the outer frame 22 and the diaphragm 31 . it should be noted that in order to prevent from being short - circuited between the movable portion - purpose wiring line 23 c and the fixed portion - purpose wiring line 24 c , the movable portion - purpose wiring line 23 c and the fixed portion - purpose wiring line 24 c have been set via an sin film 27 on the outer frame 22 , and have been covered by the surface protection film 28 except for such portions which will constitute the movable portion - purpose pad 23 f and the fixed portion - purpose pad 24 d . referring now to fig3 a to fig3 h , a description is made of steps for manufacturing the piezoelectric type pressure sensor 30 . in the beginning , as indicated in fig3 a , an n type silicon substrate 31 c is prepared , and then , an insulating film ( sio 2 ) 31 d is formed on both planes of this n type silicon substrate 31 c . it is desirable that a thickness of the n type silicon substrate 31 c is approximately 400 μm . next , a photo - resist mask is formed on the insulating film ( sio 2 ) 31 d of fig3 a , and an etching process is further carried out so as to remove a portion of the insulating film 31 d . then , in the n type silicon substrate 31 c , an impurity is diffused from a vapor phase in a portion from which the insulating film 31 d has been removed and which has been exposed . alternatively , ions of p type boron may be implanted so as to form a p type region containing the piezoelectric resistors 32 as indicated in fig3 b , while a depth of this p type region is made in approximately 0 . 5 μm to 1 . 0 μm . next , after the photo - resist mask and the insulating film 31 d formed on the plane of the n type silicon substrate 31 c on the piezoelectric resistor forming side are once removed , an insulating film 36 is once formed on one plane , and both a photo - resist mask is formed and an etching process is carried out so as to form a contact hole 31 e as an oxide film , as shown in fig3 c . this contact hole 31 e is provided at such a position that this contact hole 31 e becomes the ground frame 31 b when the piezoelectric type pressure sensor 30 is accomplished . then , as shown in fig3 d , both a pressure sensor - purpose wiring line 33 and a pressure sensor - purpose pad 34 are provided in and on the contact hole 31 e and the insulating film 36 by vapor - depositing either aluminum or poly - silicon . next , as shown in fig3 e , an sin film which constitutes the surface protection film 35 is provided on the side where the pressure sensor - purpose wiring line 33 and the pressure sensor - purpose pad 34 of fig3 d have been provided . then , as shown in fig3 f , the surface protection film 35 of such a portion is removed which constitutes the pressure sensor - purpose pad 34 when the piezoelectric type pressure sensor 30 is accomplished , in order that either aluminum or poly - silicon of the under layer is exposed . next , as shown in fig3 g , in the n type silicon substrate 31 c , a portion of the insulating film 36 is removed which has been formed on the plane located opposite to the plane on the piezoelectric resistor forming side . the region of the insulating film 36 to be removed corresponds to such a portion which becomes a concave portion when a diaphragm is completed , namely a portion which constitutes the deforming portion 31 a . finally , as indicated in fig3 h , since the region from which the insulating film 31 d has been removed in fig3 g is etched , a portion of the n type silicon substrate 31 is removed so as to form the concave portion . since the above - described manufacturing steps are carried out , the piezoelectric type pressure sensor 30 is accomplished . next , a description is made of steps for manufacturing the capacitance type acceleration sensor 20 with reference to fig4 a to fig4 d , fig5 a to fig5 b , and fig6 a to fig6 b . referring now to fig4 a to fig4 d , a description is made of steps for manufacturing the fixed portion - purpose wiring line 24 c . in the beginning , a high concentration n type silicon substrate 21 is prepared , the resistivity of which is 0 . 1 to 0 . 001 ω · cm , and then , an insulating film 26 is formed on one plane of the n type silicon substrate 21 by executing a thermal oxidation . then , another silicon substrate ( supporting substrate 25 ) is directly joined to the n type silicon substrate 21 where the insulating film 26 has been formed on one plane thereof in a furnace whose temperature is approximately 1000 ° c ., so that a structure shown in fig4 a is obtained . further , a sin film 27 ( insulating film ) is formed on the structure of fig4 a , and a photo - resist etching process is carried out so as to form a contact hole 27 a in a portion of this sin film 27 . it should also be noted that this contact hole 27 a is formed in such a portion which will become a fixed portion 24 when the capacitance type acceleration sensor 20 is accomplished , and to which the fixed portion - purpose wiring line 24 c is connected . then , an ion implantation is carried out via the contact hole 27 a so as to form an n + region 24 e , so that such a structure as indicated in fig4 b is obtained . it should also be understood that when concentration of a high concentration n type silicon substrate is sufficiently high , an ion implantation may be omitted . next , either aluminum or poly - silicon is vapor - deposited on the contact hole 27 a and the sin film 27 of fig4 b in order to set either a fixed portion - purpose wiring line 24 c or a fixed portion - purpose pad 24 d as indicated in fig4 c . at this time , the n + region 24 e is being ohmic - contacted to the fixed portion - purpose wiring line 24 c . next , an sin film which will constitute the surface protection film 28 is formed on the side where the fixed portion - purpose wiring line 24 c and the fixed portion - purpose pad 24 d have been formed , and as shown in fig4 d , the surface protection film 28 of such a portion which will constitute the fixed portion - purpose pad 24 d when the fixed portion - purpose wiring line 24 c is accomplished is removed . since the above - described manufacturing steps are carried out , the fixed portion - purpose wiring line 24 c is completed . it should also be noted that since the movable portion - purpose wiring line 23 c may be manufactured by the substantially same steps as those of the fixed portion - purpose wiring line 24 c , an explanation thereof is omitted . subsequently , a method for manufacturing a fixed portion 24 and a movable portion 23 will now be described with reference to fig5 a , fig5 b , and fig6 a , fig6 b . it should also be noted that fig5 a and fig5 b correspond to fig1 b before these fixed and movable portions 24 and 23 are manufactured , and also , fig6 a and fig6 b correspond to fig1 c before these fixed and movable portions 24 and 23 are manufactured . firstly , the n type silicon substrate 21 on which the fixed portion - purpose wiring line 24 c of fig4 d has been accomplished is prepared , and then , as indicated in fig5 a and fig6 a , a portion of the surface protection films 27 , and 28 of the side where the fixed portion - purpose wiring line 24 c has been formed is removed . the portion of the surface protection films to be removed corresponds to such a portion which will not constitute the outer frame 22 , the movable portion 23 , and fixed portion 24 when the fixed and movable portions 24 and 23 are completed . next , as shown in fig5 b and fig6 b , the n type silicon substrate 21 at such a portion from which the surface protection films 27 and 28 have been removed is etched in a sacrifice layer etching manner , while the insulating film 26 is employed as a sacrifice layer , in order to form the fixed portion 24 , the movable portion 23 , and the outer frame 22 . the fixed portion 24 has been fixed on the insulating film 26 . only the pillar 23 d of the movable portion 23 has been fixed on the insulating film 26 . the outer frame 22 surrounds the movable portion 23 and the fixed portion 24 . as a result , such a capacitance type acceleration sensor 20 shown in fig2 is accomplished . referring now to fig7 a , fig7 b , fig8 a , and fig8 b , a description is made of steps for stacking the piezoelectric type pressure sensor 30 on the outer frame 22 which surrounds the capacitance type acceleration sensor 20 . it should be understood that fig7 a and fig7 b correspond to fig1 b before the manufacture thereof , and fig8 a and fig8 b correspond to fig1 c before the manufacture thereof . as represented in fig7 a and fig8 a , low melting point glass 60 having an insulating characteristic and which constitutes an adhesive agent is coated on an edge plane of the deforming portion 31 a of the ground frame 31 b , which is located on the side of the elongation direction . next , as shown in fig7 b and fig8 b , the low melting point glass 60 coated on the ground frame 31 b is adhered to the outer frame 22 so as to be fixed thereon under vacuum condition . as a result , a sealing space ( namely , reference pressure chamber 37 ) is produced by the diaphragm 31 of the piezoelectric type pressure sensor 30 , the outer frame 22 , and the insulating film 26 , so that both the fixed portion 24 and the movable portion 23 are sealed with this sealing space . as previously described , the steps for manufacturing the piezoelectric type pressure sensor 30 shown in fig3 a to fig3 h ; the steps for manufacturing the capacitance type acceleration sensor 20 represented in fig4 a to fig4 d , fig5 a to fig5 b , and fig6 a to fig6 b ; and also the stacking steps shown in fig7 a to fig7 b and fig8 a to fig8 b are sequentially carried out , so that the composite type dynamic amount sensor 1 shown in fig1 a to fig1 c and fig2 may be constructed . subsequently , a description is made of effects of the above - described composite type dynamic amount sensor 1 . as to a first effect , since the capacitance type acceleration sensor 20 is stacked on the piezoelectric type pressure sensor 30 , the occupied area of the sensors 20 and the 30 can be reduced , as compared with the conventional structure that the capacitance type acceleration sensor 20 and the piezoelectric type pressure sensor 30 are separately provided . a description is made of a second effect . in the conventional capacitance type acceleration sensor , in order to avoid that contaminations ( particles etc .) are entered to the movable portion , the cap made of glass and the like have been employed so as to seal the movable portion . however , in the case of the composite type dynamic amount sensor 1 of the first embodiment , the movable portion 23 is sealed by the diaphragm 31 of the piezoelectric type pressure sensor 30 . as previously explained , the movable portion 23 can be sealed without separately employing the cap . a third effect is described . as previously described , the capacitance type acceleration sensor 20 and the piezoelectric type pressure sensor 30 have been separately manufactured , and have been stacked on each other , as indicated in fig7 a , fig7 b , fig8 a , and fig8 b . as a result , the capacitance type acceleration sensor 20 and the piezoelectric pressure sensor 30 may be employed which are substantially identical to the conventional acceleration and pressure sensors . in other words , the conventional detecting performance can be maintained and these acceleration and pressure sensors 20 and 30 can be stacked on each other , so that the structure thereof need not be made complex , as compared with the conventional sensors . also , since the joining portion constitutes the joining portion between the ground frame 31 b of the diaphragm 31 and the outer frame 22 , the air tight characteristic of the joining portion is high . also , in the first embodiment , such a case that the reference pressure chamber 37 becomes vacuum has been exemplified . in the case where the reference pressure chamber 37 is not vacuum , such an effect capable of suppressing air dumping may be achieved . concretely speaking , since the deformation direction of the deforming portion 31 a of the diaphragm 31 is directed along such a direction perpendicular to the movable direction of the movable portion 23 , even in such a case where the deforming portion 31 a is deformed and thus the internal pressure of the reference pressure chamber 37 is increased , the movable portion 23 can be hardly depressed against the fixed portion 24 by receiving this internal pressure . in other words , the internal pressure can hardly give an adverse influence to the distance between the movable portion 23 and the fixed portion 24 . as a result , the acceleration can be detected in higher precision . it should also be noted that it is desirable that in order to suppress the air dumping , the deformation direction of the deforming portion 31 a is located perpendicular to the movable direction of the movable portion 23 . however , even when the deformation direction is made coincident with the movable direction , it is possible to suppress the air dumping , although the detection precision is slightly lowered . referring now to fig9 a to fig9 c , a description is made of a composite type dynamic amount sensor 1 according to a second embodiment . this embodiment is different from the above - described first embodiment as to the following technical point : that is , a piezoelectric type pressure sensor 30 is adhered to a capacitance type acceleration sensor 20 by employing solder 91 and 92 , and an air tight characteristic of a reference pressure chamber 37 is secured by an air tight annular ring 93 . it should also be noted that the same reference numerals shown in the first embodiment will be employed as those for denoting the same , or similar structures indicated in the second embodiment , and explanations in this embodiment are omitted . fig9 a is a sectional view for indicating the composite type dynamic amount sensor 1 according to the second embodiment , namely such a sectional view , taken along a line ixa - ixa of fig9 b and fig9 c . also , fig9 b corresponds to fig1 b in the first embodiment , and fig9 c corresponds to fig1 c in the first embodiment . as shown in fig9 b and fig9 c , the capacitance type acceleration sensor 20 has been fixed to the piezoelectric type pressure sensor 30 via conducting - purpose solder 91 , coupling - purpose solder 92 , and the air tight annular ring 93 . the air tight annular ring 93 is made of rubber ( namely , elastic member ) having an annular shape , and is provided in a region “ ixe ” of fig9 a . alternatively , the air tight annular ring 93 may be formed by solder similar to the above - described conducting - purpose solder 91 and coupling - purpose solder 92 . since air tight connecting and sealing of these sensor 20 and 30 are realized by the solder , the resulting air tight characteristic may be further improved . then , lumps of the conducting - purpose solder 91 and the coupling - purpose solder 92 are present within the annular shape of this air tight annular ring 93 . both the conducting - purpose solder 91 and the coupling - purpose solder 92 may couple the capacitance type acceleration sensor 20 to the piezoelectric type pressure sensor 30 , and also , may depress the air tight annular ring 93 between the capacitance type acceleration sensor 20 and the piezoelectric type pressure sensor 30 so as to sandwich the air tight annular ring 93 so as to maintain the air tight characteristic of the reference pressure chamber 37 . also , in the first embodiment , the fixed portion - purpose wiring line 24 c and the movable portion - purpose wiring line 23 c have been provided by employing aluminum , and the like . in this embodiment , as represented in fig9 a to fig9 c , a portion of the outer frame 22 is insulating - processed so as to form the fixed portion - purpose wiring line 24 c , the movable portion - purpose wiring line 23 c , and a pressure sensor - purpose wiring line 94 . concretely speaking , as indicated in fig9 a , the pressure sensor - purpose wiring line 94 provided at a portion of the outer frame 22 in order to transfer an output signal of the piezoelectric type pressure sensor 30 has been insulated from the outer frame 22 by employing an insulating film 95 such as sio 2 . furthermore , as indicated in fig9 b , this pressure sensor - purpose wiring line 94 is electrically conducted via the conducting - purpose solder 91 to the pressure sensor - purpose wiring line 33 provided inside the piezoelectric type pressure sensor 30 . in other words , the conducting - purpose solder 91 may achieve two actions : that is , the piezoelectric type pressure sensor 30 is coupled to the capacitance type acceleration sensor 20 under a condition that the air tight annual ring 93 is pushed into ; and the output signals of the piezoelectric resistors 32 are transferred to the pressure sensor - purpose wiring line 94 . in the pressure sensor - purpose wiring line 94 , a terminal portion thereof on the side where the conducting - purpose solder 91 is not set becomes a pressure sensor - purpose pad 34 which is wire - bonded to the processing circuit - purpose pad 41 of the processing circuit 40 . on the other hand , as shown in fig9 a , the fixed portion - purpose wiring line 24 c constitutes a portion of a coupling portion 24 b of the fixed portion 24 , and has been electrically insulated from the outer frame 22 by employing the insulating film 95 such as sio 2 . it should also be understood that as indicated in fig9 a and fig9 c , an insulating film 27 has been provided on an entire plane of the fixed portion - purpose wiring line 24 c except for a terminal portion of the edge plane on the side of the piezoelectric type pressure sensor 30 . then , in the terminal portion of the fixed portion - purpose wiring line 24 c , such a portion where the insulating film 27 is not provided constitutes the fixed portion - purpose pad 24 d , while this fixed portion - purpose pad 24 d has been connected to the processing circuit purpose pad 41 by a wire bonding manner . also , as indicated in fig9 a , the movable portion - purpose wiring line 23 c elongated to the pillar 23 d in an integral body has a substantially same structure as that of the fixed portion - purpose wiring line 24 c . under such a condition that this movable portion - purpose wiring line 23 c is insulated from the outer frame 22 , a terminal portion of the movable portion - purpose wiring line 23 c is exposed and constitutes the movable portion - purpose pad 23 f . as previously described , both the fixed portion - purpose wiring line 24 c and the movable portion - purpose wiring line 23 c have been electrically insulated from the outer frame 22 and the piezoelectric type pressure sensor 30 , and the pressure sensor - purpose wiring line 94 has been electrically insulated from the capacitance type acceleration sensor 20 . although not shown in the drawing , the coupling - purpose solder 92 has coupled a coupling pad provided in the piezoelectric type pressure sensor 30 to another coupling - purpose pad provided on the outer frame 22 . the first - mentioned coupling - purpose pad has been provided in order not to give an adverse influence to an output signal of the piezoelectric type pressure sensor 30 , whereas the last - mentioned coupling - purpose pad has been provided in order not to give an adverse influence to an output result obtained from the capacitance type acceleration sensor 20 . since the above - described structure is employed , the pressure sensor - purpose pad 34 , the fixed portion - purpose pad 24 d , and the movable portion - purpose pad 23 f may be provided to be closed to each other . furthermore , similar to the first embodiment , the piezoelectric resistors 32 and the pressure sensor - purpose wiring line 33 are sealed in the sealing space of the reference pressure chamber 37 , so that both the piezoelectric resistor 32 and the pressure sensor - purpose wiring line 33 can be protected from particles , and the like . in this embodiment , although the conducting - purpose solder 91 and the coupling - purpose solder 92 are set within the annular shape of the air tight ring 93 , the setting places of the conducting - purpose solder 91 and the coupling - purpose solder 92 may be alternatively located outside the annular shape of the air tight ring 93 . furthermore , a total setting number as to the conducting - purpose solder 91 and the coupling - purpose solder 92 may not be alternatively selected to be 6 portions as indicated in fig9 a . it is desirable as the setting places of the solder 91 and 92 , the setting intervals of the solder become equal to each other , and / or the solder 91 and 92 is set in the vicinity of the corners of the air tight ring 93 . however , if the air tight ring 93 can seal the reference pressure chamber 37 constituted by the diaphragm 31 and the outer frame 22 , then there is no limitation in the setting numbers and the setting places of the solder . also , since the shape of the air tight ring 93 may be merely made in an annular shape , such a substantially rectangular shape as shown in fig9 a need not be employed as this shape of the air tight ring 93 . alternatively , a toroidal shape may be employed . referring now to fig1 a to fig1 c , a description is made of a composite type dynamic amount sensor 1 according to a third embodiment . this embodiment is different from the above - described second embodiment as to the following technical point : that is , the air tight characteristic of the reference pressure chamber 37 is secured by employing an ncf ( non - conductive film ) 101 . it should also be noted that the same reference numerals shown in the first embodiment , or the second embodiment will be employed as those for denoting the same , or similar structures indicated in the third embodiment , and explanations in this embodiment are omitted . fig1 a is a sectional view for indicating the composite type dynamic amount sensor 1 according to the third embodiment , namely such a sectional view , taken along a line xa - xa of fig1 b and fig1 c . also , fig1 b corresponds to fig1 b in the first embodiment , and fig1 c corresponds to fig1 c in the first embodiment . as shown in fig1 b and fig1 c , the capacitance type acceleration sensor 20 has been fixed to the piezoelectric type pressure sensor 30 via the conducting - purpose solder 91 , the coupling - purpose solder 92 , and the ncf 101 . this ncf 101 is made of a resin film having a non - conductive characteristic , and the ncf 101 may be joined by way of a crimping manner , a thermal crimping manner , or an adhesive manner . alternatively , the ncf 101 may be manufactured by a screen printing method , or an ink jet printing method . since the material of the ncf 101 is made of a resin having an electric insulating characteristic , for example , an epoxy resin , or a polyimide resin , this resin material is softened by receiving heat . then , heat is continuously applied to this resin material under softened condition , so that the softened resin material may be hardened . as indicated in a region “ xf ” of fig1 a , this ncf 101 has an annular shape which is located in the vicinity of an inner diameter of the outer frame 22 , and which surrounds a region containing a terminal portion of the pressure sensor - purpose wiring line 94 on the side of the reference pressure chamber 37 . then , lumps of the conducting - purpose solder 91 and the coupling - purpose solder 92 are present within the ncf 101 . next , a description is made of steps for stacking the capacitance type acceleration sensor 20 on the piezoelectric type pressure sensor 30 via the ncf 101 . at a time instant when the piezoelectric type pressure sensor 30 is completed , for example , in fig3 h , the above - described conducting - purpose solder 91 is provided as a bump on an exposed portion ( namely , pressure sensor - purpose pad in the first embodiment ) of the pressure sensor - purpose wiring line 33 . if the pressure sensor - purpose wiring line 33 is made of an aluminum material , ti , ni , au are stacked in this order on the pressure sensor - purpose wiring line 33 , and then , the conducting - purpose solder 91 is provided on this au . similarly , the coupling - purpose solder 92 is provided within the region “ xf ” ( namely , setting scheduled region of ncf 101 ). thereafter , the ncf 101 is set by employing a crimping method , or a printing method within the region “ xf ” in such a manner that the ncf 101 seals the conducting - purpose solder 91 and the coupling - purpose solder 92 . on the other hand , after the fixed portion 24 and the movable portion 23 which constitute the capacitance type acceleration sensor 20 , the fixed portion - purpose wiring line 24 c and the movable portion - purpose wiring line 23 c which have been insulated by the insulating film 95 such as sio 2 from the outer frame 22 , and also , the pressure sensor - purpose wiring line 94 have been completed , the conducting - purpose solder 91 is provided as a bump on the pressure sensor - purpose pad 34 . similarly , the coupling - purpose solder 92 is set within the region “ xf ” ( setting scheduled region of ncf 101 ). as previously explained , after the ncf 101 , the conducting - purpose solder 91 , and also the coupling - purpose solder 92 have been set to both the piezoelectric type pressure sensor 30 and the capacitance type acceleration sensor 20 , the piezoelectric type pressure sensor 30 is located opposite to the capacitance type acceleration sensor 20 , and the ncf 101 is heated at a temperature of approximately 150 ° c . a positioning operation is carried out in such a manner that the conducting - purpose solder 91 and the coupling - purpose solder 92 of the piezoelectric type pressure sensor 30 are located opposite to the corresponding conducting - purpose solder 91 and the corresponding coupling - purpose solder 92 of the capacitance type acceleration sensor 20 , and then , the piezoelectric type pressure sensor 30 is depressed against the capacitance type acceleration sensor 20 . as a result , the ncf 101 is broken through by the conducting - purpose solder 91 and the coupling - purpose solder 92 on the side of the capacitance type acceleration sensor 20 , so that the both the conducting - purpose solder 91 and the coupling - purpose solder 92 on the side of the capacitance type acceleration sensor 20 are contacted to the corresponding conducting - purpose solder 91 and the corresponding coupling - purpose solder 92 of the piezoelectric type pressure sensor 30 . after these solders contact , ultrasonic joining is performed with respect to the respective conducting - purpose solder 91 and the respective coupling - purpose solder 92 so as to be electrically connected to each other . with employment of the above - described structure , similar operation and effects to those of the second embodiment can be achieved in the third embodiment . referring now to fig1 , a description is made of a composite type dynamic amount sensor 1 according to a fourth embodiment . the fourth embodiment has the below - mentioned technical different points from those of the first embodiment . that is , in this embodiment , while a penetration electrode 111 is provided on a diaphragm 31 , a signal of a capacitance type acceleration sensor 20 can be derived from the diaphragm 31 through the penetration electrode 111 . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the fourth embodiment , and descriptions thereof are omitted . fig1 is a sectional view for showing the composite type dynamic amount sensor 1 according to the fourth embodiment , and corresponds to fig1 c in the first embodiment . as indicated in fig1 , the penetration electrode 111 and an insulating film 112 have been formed on the ground frame 31 b of the diaphragm 31 . the penetration electrode 111 is located parallel to the deforming direction of the deforming portion 31 a . the insulating film 112 insulates the penetration electrode 111 from the diaphragm 31 . it should also be noted that the place where the penetration electrode 111 is provided is such a place that when the capacitance type acceleration sensor 20 is adhered to the piezoelectric type pressure sensor 30 , this place is located opposite to both the exposed portion ( namely , fixed portion - purpose pad of the first embodiment ) of the fixed portion - purpose wiring line 24 c , and the exposed portion ( namely , movable portion - purpose pad of the first embodiment ) of the movable portion - purpose wiring line 23 c . then , the penetration electrode 111 has been connected to the exposed portion of the fixed portion - purpose wiring line 24 c , or the exposed portion of the movable portion - purpose wiring line 23 c by the conducting - purpose solder 91 . furthermore , in addition to the above - described conducting - purpose solder 91 , the coupling - purpose solder 92 employed in the above - explained third embodiment has been provided at such a portion between the capacitance type acceleration sensor 20 and the piezoelectric type pressure sensor 30 , which gives a less electrically adverse influence . also , similar to the third embodiment , the ncf 101 having the annular shape has been provided between the capacitance type acceleration sensor 20 and the piezoelectric type pressure sensor 30 so as to maintain the air tight characteristic of the reference pressure chamber 37 . alternatively , as shown in the second embodiment , a ring for the air tight sealing may be formed by a ring of solder on either the outer side or the inner side of the penetration electrode 111 . a terminal edge of the penetration electrode 111 , which is not connected to either the fixed portion - purpose wiring line 24 c or the movable portion - purpose wiring line 23 c , has been constituted as either the fixed portion - purpose pad 24 d or the movable portion - purpose pad 23 f , which is wire - bonded to the processing circuit - purpose pad 41 of the processing circuit 40 . it should also be noted that these pads 23 f and 24 d may also function as the terminal portion of the penetration electrode 111 as shown in fig1 , or may be formed as an enlarged portion which is manufactured by vapor - depositing aluminum on the terminal portion in order to be easily wire - bonded . in this case , a step for forming this penetration electrode 111 is constructed of the following 3 forming steps , a step in which while the ground frame 31 b is masked , a reactive ion etching process is carried out so as to form a penetration hole ; a step in which this penetration hole is further thermally oxidized in order to form an insulating film 112 ; and a step in which poly - silicon is grown on the penetration hole reduced by the thermal oxidation , so that the penetration electrode 111 is accomplished . alternatively , instead of this poly - silicon , such a metal as tungsten , copper , aluminum may be employed . it should also be understood that the structure of the piezoelectric type pressure sensor 30 is manufactured in such a manner that 2 pieces of the penetration electrodes 111 , and the insulating film 112 for insulating these penetration electrodes 111 are additionally provided in the piezoelectric type pressure sensor 30 of the first embodiment , whereas positions of the pressure sensor - purpose wiring line 33 and the pressure sensor - purpose pad 34 are similar to those of the first embodiment . as previously described , while the penetration electrodes 111 are provided on the diaphragm 31 , the penetration electrodes 111 , the fixed portion - purpose wiring line 24 c , and the movable portion - purpose wiring line 23 c are electrically connected to each other . as a result , as represented in fig1 , the setting positions as to the fixed portion - purpose pad 24 d , and the movable portion - purpose pad ( not shown ) can be located on the diaphragm 31 . as a consequently , while the operation and effects similar to those of the first embodiment may be achieved , the pressure sensor - purpose pad 34 , the fixed portion - purpose pad 24 d , and the movable portion - purpose pad can be formed on the diaphragm 31 . in addition , if gold balls , solder balls , and the like are formed on the pad portions over this pressure sensor , then connection pads for so - called “ ball bonding ” may be alternatively formed . referring now to fig1 , a description is made of a composite type dynamic amount sensor 1 according to a fifth embodiment . the fifth embodiment has the below - mentioned technical different points from those of the fourth embodiment . that is , in this embodiment , while a fixed portion - purpose wiring line 24 c and a movable portion - purpose wiring line 23 c have been provided on an insulating film 26 , the fixed portion - purpose wiring line 24 c and the movable portion - purpose wiring line 23 c have been connected via a poly - silicon film 121 to the penetration electrodes 111 . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the fifth embodiment , and descriptions thereof are omitted . fig1 is a sectional view for showing the composite type dynamic amount sensor 1 according to the fifth embodiment , and corresponds to fig1 c in the first embodiment . as indicated in fig1 , the coupling portion 24 b of the fixed portion 24 has been connected to the fixed portion - purpose wiring line 24 c on the side of the supporting substrate 25 . then , a surface except for the coupling portion 24 b of the fixed portion 24 has been covered by the insulating film 27 such as sio 2 . also , the fixed portion - purpose wiring line 24 c has been electrically connected to the poly - silicon film 121 provided on the outer frame 22 , and has been insulated from the outer frame 22 and the movable portion 23 by an insulating film 122 . also , this poly - silicon film 121 has been insulated from the outer frame 22 by the insulating film 122 . similar to the above - described fourth embodiment , the poly - silicon film 121 has been connected by the conducting - purpose solder 91 to the penetration electrodes 111 formed on the ground frame 31 b of the diaphragm 31 . the fixed portion - purpose pad 24 d has been provided on a terminal portion of this penetration electrode 111 , which is not connected to the poly - silicon film 121 . then , this fixed portion - purpose pad 24 d is connected to the processing circuit - purpose pad 41 of the processing circuit 40 by a wire bonding . also , with respect to a movable portion ( not shown ), a supporting substrate side of the pillar has been connected to the movable portion - purpose wiring line 23 c , and furthermore , this movable portion - purpose wiring line 23 c has been electrically connected to the poly - silicon film 121 formed on the outer frame 22 . this movable portion - purpose wiring line 23 c has been insulated from the outer frame 22 and the fixed portion 24 by the insulating film 122 . further , the poly - silicon film 121 has been connected by the conducting - purpose solder 91 to the penetration electrodes 111 formed on the ground frame 31 b of the diaphragm 31 . the movable portion - purpose pad has been provided on a terminal portion of this penetration electrode 111 . then , this movable portion - purpose pad is connected to the processing circuit - purpose pad 41 of the processing circuit 40 by a wire bonding . also , the movable electrode , the beam , and the weight have gaps with respect to the insulating film 26 , and can be displaced along the elongation direction of the supporting substrate 25 similar to the first embodiment . it should also be noted that as to a step for forming both the fixed portion - purpose wiring line 24 c and the movable portion - purpose wiring line 23 c between the fixed portion 24 and the movable portion 23 , and the supporting substrate 25 , the manufacturing method described in jp - a - 5 - 304303 may be employed . with employment of the above - described structure , similar operation and effects to those of the fourth embodiment may be achieved . in addition , since a penetration electrode is formed on the supporting substrate 25 of the acceleration sensor 20 by the same method as that described above , an electrode may be derived from the lower portion of the supporting substrate 25 of the acceleration sensor 20 . referring now to fig1 , a description is made of a composite type dynamic amount sensor 1 according to a sixth embodiment . the sixth embodiment has the below - mentioned technical different points from those of the third embodiment . that is , in this embodiment , a capacitance type pressure sensor 130 is stacked on the capacitance type acceleration sensor 20 . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the sixth embodiment , and descriptions thereof are omitted . fig1 is a sectional view for showing the composite type dynamic amount sensor 1 according to the sixth embodiment , and corresponds to fig1 b in the first embodiment . as represented in fig1 , the capacitance type pressure sensor 130 is constituted by a base portion 131 , a lower electrode 132 , an insulating film 134 , and a lower electrode pierced wiring line 136 . the base portion 131 is provided with an opening portion having a tapered form at a center . the lower electrode 132 corresponds to a circular - shaped diaphragm 31 which is deformed when pressure is applied , while the lower electrode 132 covers the opening portion of the base portion 131 . the insulating film 134 insulates the lower electrode 132 from the base portion 131 . the lower electrode pierced wiring line 136 is pierced in the base portion 131 and is connected to the lower electrode 132 . although not shown in the drawing , the lower electrode pierced wiring line 136 has been insulated from the base portion 131 . also , a switch circuit for switching an applied signal ( voltage , or current ) has been connected to the lower electrode 132 and the movable portion 23 and the fixed portion 24 of the capacitance type acceleration sensor 20 . since this switch current is employed , a first time and a second time are set in a periodic manner . in the first time , signals different from each other are inputted to the movable portion 23 and the fixed portion 24 , whereas no signal is inputted to the lower electrode 132 . in the second time , the same signals are inputted to the movable portion 23 and the fixed portion 24 , and a signal is inputted to the lower electrode 132 . in synchronism with this time period , an a / d converting circuit ( not shown ) switches input ports so as to acquire a potential difference ( current difference ) between the movable portion 23 and the fixed portion 24 in the first time , and also to acquire a potential difference ( current difference ) between the lower electrode 132 , and both the movable portion 23 and the fixed portion 24 in the second time . generally speaking , since an a / d converter and a d / a converter are operated in response to the same timer pulse , an input port for acquiring an output signal is synchronized with an output port for outputting an applied signal , so that the input port and the output port may be switched . since such a structure is equipped with the composite type dynamic amount sensor 1 , acceleration may be calculated based upon a change in electrostatic capacitances between the movable portion 23 and the fixed portion 24 in the first time . on the other hand , pressure applied to the lower electrode 132 may be calculated based upon an electrostatic capacitance between the movable portion 23 and the fixed portion 24 , and the lower electrode 132 in the second time . referring now to fig1 , a description is made of a composite type dynamic amount sensor 1 according to a seventh embodiment . the seventh embodiment has the below - mentioned technical different points from those of the sixth embodiment . that is , in this embodiment , the capacitance type pressure sensor 130 is equipped with an upper electrode . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the seventh embodiment , and descriptions thereof are omitted . fig1 is a sectional view for showing the composite type dynamic amount sensor 1 according to the seventh embodiment , and corresponds to fig1 b in the first embodiment . as represented in fig1 , the capacitance type pressure sensor 130 is constituted by a base portion 131 , a lower electrode 132 , an upper electrode 133 , an insulating film 134 , an upper electrode pierced wiring line 135 , and also a lower electrode pieced wiring line 136 . the base portion 131 is provided with an opening portion having a tapered form at a center . the lower electrode 132 corresponds to a circular - shaped diaphragm 31 which is deformed when pressure is applied , while the lower electrode 132 covers the opening portion of the base portion 131 . the upper electrode 133 has an annular shape which is not deformed by pressure , and is provided within the base portion 131 in such a manner that this upper electrode 133 is located opposite to the lower electrode 132 . the insulating film 134 insulates both the upper electrode 133 and the lower electrode 132 . the upper electrode pierced wiring line 135 is pierced in the base portion 131 , and is connected to the upper electrode 133 . the lower electrode pierced wiring line 136 is pierced in the base portion 131 , and is connected to the lower electrode 132 . it should also be noted that although not shown , the lower electrode 132 and the lower electrode pierced wiring line 136 have been insulated from the base portion 131 , the upper electrode 133 and the upper electrode pierced wiring line 135 connected to the upper electrode 133 . the lower electrode pierced wiring line 136 is connected to the lower electrode 132 . also , the respective pierced wiring lines 135 and 136 have been connected via the conducting - purpose solder 91 to the pressure sensor - purpose wiring lines 94 respectively provided on a portion of the outer frame 22 . also , similar to the structure of the third embodiment in which the ncf 101 has been sandwiched between the ground frame 31 and the outer frame 22 , the ncf 101 has been sandwiched between the base portion 131 and the outer frame 22 even in this embodiment . next , a description is made of effects achieved in the seventh embodiment . when positive pressure is applied to the opening portion of the base portion 131 , the lower electrode 132 corresponding to the diaphragm 31 is deformed , so that a distance between the lower electrode 132 and the upper electrode 133 is separated . at this time , since either the voltage or the current is applied between the upper electrode 133 and the lower electrode 132 , the distance between the upper and lower electrodes 133 and 132 is separated , so that the electrostatic capacitance between these lower and upper electrodes 132 and 133 is decreased . also , at this time , since such a sealing space has been formed by the lower electrode 132 , the capacitance type acceleration sensor 20 ( concretely speaking , both outer frame 22 and insulating film 134 ), and the ncf 101 , this sealing space may constitute the reference pressure chamber 37 so as to improve the detection precision of the capacitance type pressure sensor 130 . as previously explained , even in such a case that the capacitance type pressure sensor 130 is employed , similar operation and effects to those of the third embodiment may be achieved . referring now to fig1 a and fig1 b , a description is made of a composite type dynamic amount sensor 1 according to an eighth embodiment . the eighth embodiment has the below - mentioned technical different points from those of the respective embodiments described above . that is , in this embodiment , a pressure sensor processing circuit 40 a of a piezoelectric type pressure sensor 30 has been provided on a pressure sensor substrate 151 of the piezoelectric type pressure sensor 30 ; and an acceleration sensor processing circuit 40 b has been provided on an outer frame of a capacitance type acceleration sensor 20 . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the eighth embodiment , and descriptions thereof are omitted . fig1 a is a sectional view for showing the composite type dynamic amount sensor 1 according to the eighth embodiment , and corresponds to fig1 b in the first embodiment ; and fig1 b corresponds to fig1 c in the first embodiment . the piezoelectric type pressure sensor 30 will now be described with reference to fig1 a . the piezoelectric type pressure sensor 30 is constituted by a diaphragm 31 , a piezoelectric resistor 32 , a pressure sensor - purpose wiring line 33 , a pressure sensor processing circuit 40 a , and a penetration electrode 111 . the diaphragm 31 has been formed by removing a portion of a pressure sensor substrate 151 . the piezoelectric resistor 32 has been provided on the diaphragm 31 . the pressure sensor - purpose wiring line 33 is connected to the piezoelectric resistor 32 and the pressure sensor processing circuit 40 a . the pressure sensor processing circuit 40 a has been formed within the pressure sensor substrate 151 and processes a signal of the pressure sensor - purpose wiring line 33 . the penetration electrode 111 transfers a processed signal of the pressure sensor processing circuit 40 a over the pressure sensor substrate 151 . it should also be noted that the pressure sensor processing circuit 40 a has been formed on an opposite plane of the diaphragm 31 on the opening side in the pressure sensor substrate 151 . the pressure sensor - purpose wiring line 33 has been connected to an input terminal of the pressure sensor processing circuit 40 a . also , an output terminal of the pressure sensor processing circuit 40 a has been connected to the penetration electrode 111 . it should also be understood that this penetration electrode 111 has been insulated from the pressure sensor substrate 151 by the insulating film 112 . referring now to fig1 a and fig1 b , the capacitance type acceleration sensor 20 will be described . when the piezoelectric type pressure sensor 30 is stacked on the capacitance type acceleration sensor 20 , in the outer frame 22 , the acceleration sensor processing circuit 40 b has been formed at a place located opposite to the diaphragm 31 . also , both the fixed portion - purpose wiring line 24 c and the movable portion - purpose wiring line 23 c have been connected to an input terminal of the acceleration sensor processing circuit 40 b , whereas an acceleration sensor output wiring line 152 has been connected to an output terminal thereof . this acceleration sensor output wiring line 152 implies such a wiring line which outputs a result obtained by the acceleration sensor processing circuit 40 b for processing signals entered from the fixed portion - purpose wiring line 24 c and the movable portion - purpose wiring line 23 c . as this acceleration sensor output wiring line 152 , such a portion which is not covered by the pressure sensor substrate 151 is exposed from the oxide film 28 to become a pad . also , as shown in fig1 a and fig1 b , the piezoelectric type pressure sensor 30 has been coupled to the capacitance type acceleration sensor 20 by the coupling - purpose solder 92 under such a condition that these sensors 30 and 20 depress a first air tight ring 93 a and a second air tight ring 93 b so as to sandwich therebetween these rings 93 a and 93 b . in other words , both the movable portion 23 and the fixed portion 24 are sealed within the sealing space by the first air tight ring 93 a . furthermore , the reference pressure chamber 37 is formed by the second air tight ring 93 b , the diaphragm 31 , and the insulating film 28 . since the above - explained structure is employed in the composite type dynamic amount sensor 1 , while similar operation and effects to these of the first embodiment may be achieved , the processing circuits 40 a and 40 b can be sealed , so that processing circuits 40 a and 40 b can be protected . referring now to fig1 , a description is made of a composite type dynamic amount sensor 1 according to a ninth embodiment . the ninth embodiment has the below - mentioned technical different points from those of the eighth embodiment . that is , in this embodiment , a sensor which senses pressure corresponds to a capacitance type pressure sensor . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the ninth embodiment , and descriptions thereof are omitted . fig1 is a sectional view for showing the composite type dynamic amount sensor 1 according to the ninth embodiment , and corresponds to fig1 b in the eighth embodiment . as indicated in fig1 , the capacitance type pressure sensor is constituted by an upper electrode 133 provided on a diaphragm 35 , and a lower electrode 132 which is located opposite to the upper electrode 133 and is upwardly formed on a supporting substrate via an insulating film 26 . then , an output signal of the upper electrode 133 and an output signal of the lower electrode 132 are inputted to the processing circuit 40 via wiring lines ( not shown , for example , penetration electrodes ). the processing circuit 40 compares the output signal of the upper electrode 133 with the output signal of the lower electrode 132 so as to detect an electrostatic capacitance between the upper electrode 133 and the lower electrode 132 , and then , calculates pressure applied to the diaphragm 35 based upon a change amount of the detected electrostatic capacitances . it should also be noted that as the lower electrode 132 of this embodiment , this lower electrode 132 is not formed by being substituted by the movable portion 23 and the fixed portion 24 as shown in fig1 , but a single silicon member having a rectangular shape may be employed . on the other hand , the capacitance type acceleration sensor 20 is made of a substantially same structure as that of the above - described capacitance type acceleration sensor 20 of fig1 . however , although the penetration electrode 111 which transfers the output signal of the capacitance type acceleration sensor 20 has been provided on the diaphragm 31 in fig1 , the penetration electrode 111 has been provided on a place of the pressure sensor substrate 151 , which is not the diaphragm 35 in this embodiment . then , in the pressure sensor substrate 151 , the processing circuit 40 has been provided on an edge plane of this substrate 151 , which is located opposite to the side of the supporting substrate . as indicated in fig1 , an output signal of the fixed portion 24 is entered via the penetration electrode 111 and the wiring line 161 to the processing circuit 40 , and furthermore , an output signal of a movable portion ( not shown ), and also output signals of the lower electrode 132 and the upper electrode 133 are entered to this processing circuit 40 . the processing circuit 40 further executes an amplifying process and a calculating process based upon these input signals in order to output calculation results by employing an acceleration sensor output wiring line 152 and another wiring line ( not shown ). as shown in the acceleration sensor output wiring line 152 of fig1 , pads have been provided on edge portions of these wiring lines . since the above - described structure is constructed in the composite type dynamic amount sensor 1 , even when such a capacitance type pressure sensor is employed , similar operation and effects as those of the above - described eighth embodiment can be achieved . it should also be understood that although the lower electrode 132 is made of the electrode having the plate - shaped member in the ninth embodiment , such a structure may be alternatively employed instead of the lower electrode 132 that both the fixed portion and the movable portion of fig1 are located opposite to the upper electrode 133 . in this alternative case , it is so assumed that while the capacitance type acceleration sensor 20 located opposite to the processing circuit 40 is defined as a first acceleration sensor , and both the fixed portion and the movable portion are defined as a second acceleration sensor , which are located opposite to the upper electrode 133 and are substituted as the lower electrode ; and both a detecting direction ( displace direction of movable portion ) of the first accelerator sensor and a detecting direction of the second acceleration sensor are made different from each other ( for instance , orthogonal direction ). at this time , similar to the sixth embodiment , timing ( first time ) for detecting acceleration and timing ( second time ) for detecting pressure are set to both the fixed portion and the movable portion of the second acceleration sensor in a periodic manner . as a result , acceleration may be detected by the second acceleration sensor in the first time , whereas pressure may be detected by the second acceleration sensor and the upper electrode 133 in the second time . since the above - described alternative structure is constructed , the acceleration of the 2 axes may be detected by the first acceleration sensor and the second acceleration sensor , and further , the pressure may be detected by employing the fixed portion and the movable portion of the second acceleration sensor , and the upper electrode 133 . referring now to fig1 and fig1 , a description is made of a composite type dynamic amount sensor 1 according to a tenth embodiment . this embodiment is such an embodiment that a plurality of the above - explained composite type dynamic amount sensors 1 of the first embodiment are manufactured at the same time by employing a semiconductor process . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the tenth embodiment , and descriptions thereof are omitted . fig1 is a bird &# 39 ; s eye view for representing a wafer substrate 171 in which a plurality of the above - described composite type dynamic amount sensors 1 of the first embodiment shown in fig1 a to fig1 c have been integrated . furthermore , fig1 is an enlarged sectional view of the wafer substrate 171 , taken along a line xviii - xviii in fig1 . as represented in fig1 , the piezoelectric type pressure sensors 30 of fig1 a to fig1 c are stacked on each other in order to correspond to the respective capacitance type acceleration sensors 20 of the acceleration sensor - sided wafer substrate where the plural pieces of capacitance type acceleration sensor 20 of fig1 a to fig1 c are stacked . as a result , such a wafer substrate 171 that the plural pieces of composite type dynamic amount sensors 1 shown in fig1 have been stacked is formed . then , this wafer substrate 171 is dicing - cut along dot lines shown in fig1 and fig1 , so that a plurality of the composite type dynamic amount sensors 1 of fig1 a to fig1 c can be obtained . under such a condition that the piezoelectric type pressure sensors 30 have been stacked on the capacitance type acceleration sensors 20 , the fixed portion - purpose pads 24 d and the movable portion - purpose pads 23 f of the capacitance type acceleration sensors 20 are exposed , so that an energizing test may be carried out before the wafer substrate 171 is dicing - cut . alternatively , a wafer substrate 1 where a plurality of acceleration sensors have been formed , and another wafer substrate 2 where a plurality of pressure sensors have been formed may be stacked each other under wafer statuses , and thereafter , the stacked wafer substrates may be dicing - cut . in this alternative case , either a penetration groove or a penetration hole has been formed in the wafer substrate 2 on which the pressure sensors of the upper area portion have been formed , which are wired - bonded with the acceleration sensors in order to be equivalent to , for example , fig1 , and thereafter , the wafer substrates are stacked on each other . referring now to fig1 a and fig2 a to fig2 c , a description is made of a composite type dynamic amount sensor 1 according to an eleventh embodiment . the eleventh embodiment has the below - mentioned technical different points from those of the above - described tenth embodiment . that is , in this embodiment , a piezoelectric type pressure sensor 30 which is stacked on an acceleration sensor - sided wafer substrate 171 is stacked under a condition of a pressure sensor - sided wafer substrate 172 . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the eleventh embodiment , and descriptions thereof are omitted . fig1 is a sectional view for showing the composite type dynamic amount sensor 1 according to the eleventh embodiment . as a structure of the composite type dynamic amount sensor 1 , with respect to fig1 of the fourth embodiment , a side plane ( namely , plane of direction perpendicular to pressure applied direction ) of the ground frame 31 b of the piezoelectric type pressure sensor 30 is made coincident with a side plane ( namely , plane of acceleration applied direction ) of the capacitance type acceleration sensor 20 . next , a description is made of a method for manufacturing the composite type dynamic amount sensor 1 of the eleventh embodiment with reference to fig2 a to fig2 c . firstly , as shown in fig2 a , such a pressure sensor - sided wafer substrate 172 is prepared in which a plurality of the above - explained piezoelectric type pressure sensors 30 shown in fig1 have been stacked . this pressure sensor - sided wafer substrate 172 is such a pressure sensor - sided wafer substrate into which the piezoelectric resistor 32 and the penetration electrode 111 ( which are not shown ) have been processed in the above - described forming step in the fourth embodiment and then have already been formed . in a step of fig2 b subsequent to the step of fig2 a , after the conducting - purpose solder 91 is set to an exposed portion of the penetration electrode 111 of the pressure sensor - sided wafer substrate 172 , and the ncf 101 is set to a predetermined portion , the pressure sensor - sided wafer substrate 172 is stacked with respect to the acceleration sensor - sided wafer substrate 171 . in a step of fig2 c subsequent to the step of fig2 b , the stacked substrate manufactured in fig2 b is dicing - cut along dot lines , so that such a composite type dynamic amount sensor 1 of fig1 can be obtained . in the eleventh embodiment , after the pressure sensor - sided wafer substrate 172 and the acceleration sensor - sided wafer substrate 171 have been stacked to each other , the stacked wafer substrate is dicing - cut . as a result , in accordance with the manufacturing method of the eleventh embodiment , total numbers of the dicing - cut process and of the stacking process are smaller than those of the below - mentioned case : that is , the pressure sensor - sided wafer substrate 172 is dicing - cut to form the piezoelectric type pressure sensor 30 , and further , the acceleration sensor - sided wafer substrate 171 is dicing - cut to form the capacitance type acceleration sensor 1 , and then , these sensors 172 and 171 are separately stacked to each other . on the other hand , in the present embodiment , the composite type dynamic amount sensor 1 having the substantially same structure as that of the above - described fourth embodiment shown in fig1 has been manufactured by stacking the pressure sensor - sided wafer substrate 172 on the acceleration sensor - sided wafer substrate 171 . however , a structure of a composite type dynamic amount sensor manufactured by a stacking manner is not limited only to that shown in fig1 . for example , as represented in fig1 a to fig1 c of the first embodiment , even when the piezoelectric type pressure sensor 30 is employed which has the pressure sensor - purpose pad 34 on the plane of the ground frame 31 b of the deforming portion 31 a , which is located opposite to the concave bottom plane , such a pressure sensor - sided wafer substrate on which the above - described piezoelectric type pressure sensor 30 has been integrated is prepared . then , this pressure sensor - sided wafer substrate may be stacked on an acceleration sensor - sided wafer substrate . in this alternative case , it is preferable to form a penetration hole in the pressure sensor - sided wafer substrate before the piezoelectric type pressure sensor 30 is stacked in order that the fixed portion - purpose pad is not covered by the ground frame 31 b of the piezoelectric type pressure sensor 30 . in addition to the structure shown in fig1 a to fig1 c , even in the structure of fig9 a to fig9 c , the structure of fig1 a to fig1 c , the structure of fig1 , and the structure of fig1 , the pressure sensor - sided wafer substrates may be stacked on the acceleration sensor - sided wafer substrates , and then , the stacked wafer substrates may be dicing - cut . also , in the structure of fig3 , the first acceleration sensor - sided wafer substrate may be stacked on the second acceleration sensor - sided wafer substrate , and then , the stacked wafer substrate may be dicing - cut . referring now to fig2 , fig2 a to fig2 b , and fig2 a to fig2 f , a description is made of a stacked layer type dynamic amount sensor 201 according to a twelfth embodiment . the twelfth embodiment has the below - mentioned technical different points from those of the first embodiment . that is , in this embodiment , a piezoelectric type pressure sensor 30 has been stacked on a circuit board 240 . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the twelfth embodiment , and descriptions thereof are omitted . fig2 is a plan view for showing the stacked layer type dynamic amount sensor 201 according to the twelfth embodiment . in fig2 , although piezoelectric resistors 32 are not exposed from a surface of the stacked layer type dynamic amount sensor 201 , setting positions are indicated by using dot lines , for the sake of explanations . the penetration electrodes 111 exposed in fig2 are employed so as to supply electric power for driving the processing circuit 40 and the piezoelectric type pressure sensor 30 , and are used as the ground , and also are employed to derive output signals from the processing circuit 40 and the piezoelectric type pressure sensor 30 . a sectional view , taken along a line xxiia - xxiia of fig2 is shown in fig2 a , and another sectional view , taken along a line xxiib - xxiib of fig2 is indicated in fig2 b . as indicated in fig2 a , the stacked layer type dynamic amount sensor 201 has such a structure that the piezoelectric type pressure sensor 30 has been stacked on the circuit board 240 . an output signal of the piezoelectric type pressure sensor 30 is entered via the penetration electrode 111 and a wiring line 161 to the processing circuit 40 of the circuit board 24 , and thus , is processed in this processing circuit 40 . then , a signal processed result of the processing circuit 40 is derived from a surface of the diaphragm 31 by the processing circuit 40 and the penetration electrode 111 which penetrates the surface of the diaphragm 31 . also , the reference pressure chamber 37 of the piezoelectric type pressure sensor 30 is realized by diverting a space which is formed between a surface protection film 241 of the circuit board 240 and the diaphragm 31 . also , as indicated in fig2 b , another penetration electrode 111 for supply the drive power to the processing circuit 40 has been provided . referring now to fig2 a to fig2 f , a description is made of a method for manufacturing the stacked layer type dynamic amount sensor 201 according to this embodiment . firstly , as shown in fig2 a , the diaphragm 31 into which the piezoelectric resistors 32 have been internally formed , and the circuit board 240 are prepared , and then are adhered to each other . in the circuit board 240 , the processing circuit 40 and the wiring line 161 made of aluminum are provided on a silicon substrate . as one example as to the adhering methods , both the diaphragm 31 and the circuit board 240 may be surface - processed in a vacuum atmosphere , and may be joined to each other by a surface activating method ( direct joining at room temperature ). if the direct joining method at the room temperature is conducted , then the following merit may be obtained : that is , the diaphragm 31 can be joined to the circuit board 240 at a temperature lower than a melting point of aluminum which constitutes the wiring line 161 . alternatively , an anode joining method and a glass joining method using low melting point glass may be employed . in a step of fig2 b subsequent to fig2 a , a photo - resist mask forming operation and a reactive ion etching process ( will be referred to as “ rie ” process hereinafter ) are carried out with respect to the insulating film 36 formed on the piezoelectric resistors 32 of the diaphragm 31 so as to form a contact hole 243 in the ground frame 31 b . this rie process is performed until the wiring line 161 of the circuit board 240 is exposed . in other words , since the wiring line 161 is made of aluminum , this wiring line 161 may function as a stopper when the rie process is performed . in a step of fig2 c subsequent to fig2 b , an oxide film ( sio 2 ) 242 is deposited by way of a cvd ( chemical vapor deposition ) method on the wall plane of the contact hole 243 . at this time , the oxide film 242 is also deposited even on the wiring line 161 on the bottom plane of the contact hole 243 . in a step of fig2 d subsequent to fig2 c , the rie process is further performed so as to expose the wiring line 161 , and also to form a contact hole 31 e in a portion of the insulating film 36 which covers the piezoelectric resistors 32 . in a step of fig2 e subsequent to fig2 d , aluminum is deposited by the cvd method on the contact hole 243 and the contact hole 31 e formed in the oxide film 36 which covers the piezoelectric resistors 32 . at this time , aluminum is also deposited on a space between a portion of the contact hole 243 and the contact hole 31 e formed in the oxide film 36 in order to electrically connect these contact holes 243 and 31 e to each other , so that a pressure sensor - purpose wiring line 33 is formed . it should also be noted that a substance to be deposited is not limited only to aluminum , but may be selected from other metals such as tungsten , and poly - silicon . in a step of fig2 f subsequent to fig2 e , the surface protection film 35 is deposited in such a manner that this surface protection film 35 covers the pressure sensor - purpose wiring line 33 formed in the preceding step of fig2 e . thereafter , the rie process is carried out in order to provide a contact hole in the surface protection film 35 , so that such a stacked layer type dynamic amount sensor 201 as shown in fig2 and fig2 a to fig2 b is accomplished . this contact hole is formed in order to derive a signal of the processing circuit 40 outside this sensor 201 . next , a description is made of effects achieved by the stacked layer type dynamic amount sensor 201 of the twelfth embodiment . as a first effect , since the piezoelectric type pressure sensor 30 is stacked on the circuit board 240 , the area occupied by the sensor can be reduced , as compared with such a structure that a piezoelectric type pressure sensor and a circuit board are separately provided . also , as a second effect , the penetration electrodes 111 are provided on the ground frame 31 b for supporting the diaphragm 31 so as to connect the piezoelectric resistors 32 to the processing circuit 40 , so that higher reliability can be achieved , as compared with such a structure that the piezoelectric resistor 32 and the processing circuit 40 are not stacked , but are electrically connected to each other by using wires . as a third effect , the processing circuit 40 is arranged behind the diaphragm 31 with respect to the pressure applied direction , namely arranged via the reference pressure chamber 37 . as a result , the processing circuit 40 can be protected . more specifically , since transistor elements which construct the processing circuit 40 may be readily and adversely influenced by contaminations ( for example , contaminations caused by fluid and gas , whose pressure should be detected ), it is desirable to arrange that the processing circuit 40 is separated apart from the diaphragm 31 having risks of such contaminations . it should also be noted that the stacking layer steps need not be carried out in the chip unit as represented in fig2 a to fig2 f . that is , as explained in the above tenth embodiment , one structural component ( for example , piezoelectric type pressure sensor 30 ) may be subdivided in the chip unit , and thereafter , the divided sensor may be stacked on the other structural component ( circuit board 240 ) under wafer substrate condition . also , as described in the above eleventh embodiment , both the structural components ( namely , piezoelectric type pressure sensor 30 and circuit board 240 ) may be alternatively stacked to each other under wafer substrate condition . referring now to fig2 , a description is made of a stacked layer type dynamic amount sensor 201 according to a thirteenth embodiment . the thirteenth embodiment has the below - mentioned technical different points from those of the twelfth embodiment . that is , in this embodiment a concave portion of a diaphragm 31 of a piezoelectric type pressure sensor 30 is present on the side of a pressure application . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the thirteenth embodiment , and descriptions thereof are omitted . fig2 is a sectional view for showing the stacked layer type dynamic amount sensor 201 according to the thirteenth embodiment . as indicated in fig2 , the concave portion of the diaphragm 31 of the piezoelectric type pressure sensor 30 is present on the pressure application side . then , the piezoelectric resistors 32 have been arranged via a silicon layer which constitutes the diaphragm 31 on an inner side of a bottom plane of the concave portion . also , a concave 244 has been formed in a place of the circuit board 240 , which is located opposite to the deforming portion 31 a of the diaphragm 31 in order to become the reference pressure chamber 37 when the piezoelectric type pressure sensor 30 is stacked on the circuit board 240 . this concave 244 is formed in such a plane of the silicon substrate , which is located opposite to a plane thereof into which the processing circuit 40 has been formed . concretely speaking , after the processing circuit 40 has been formed in the silicon substrate , a portion of the oxide film 242 provided on the plane of this silicon substrate is removed , which is located opposite to the plane thereof where the processing circuit 40 has been formed . furthermore , while the oxide film 242 which has not been removed is employed as a mask , the silicon substrate is etched so as to form the concave 244 . then , with respect to the circuit board 240 under such a condition that the concave 244 has been formed , such a piezoelectric type pressure sensor 30 is stacked by the direct joining process . in this piezoelectric type pressure sensor 30 , the piezoelectric resistors 32 , the pressure sensor - purpose wiring 33 , and the deforming portion 31 a have been formed in the silicon substrate . after the direct joining process , the processing circuit 40 is electrically connected to the piezoelectric resistors 32 by utilizing the above - described method for forming the penetration electrodes 111 with reference to fig2 a to fig2 f , and furthermore , the protection film 241 for protecting the circuit board 240 is provided on the side of the processing circuit 40 . also , a signal deriving electrode 245 may be formed on the protection film 241 for protecting the processing circuit 40 , and this signal driving electrode 245 may be connected by a bump , so that the stacked layer type dynamic amount sensor 201 may be formed as a flip chip . effects of this embodiment will now be described . as a first effect , since the sensor 201 is formed in the flip chip , a total number of wiring lines exposed at portions which are exposed to the open air can be decreased ( in particular , total number should be preferably decreased to zero ). as a second effect , while the concave 244 is formed at the rear plane of the processing circuit 40 where no element is formed , this concave 244 is utilized as the reference pressure chamber 37 , so that the capacity of the reference pressure chamber 37 can be secured . as a consequence , in order to secure the capacity of the reference pressure chamber 37 , either a spacer or an insulating film is no longer provided between the piezoelectric type pressure sensor 30 and the circuit board 240 ( otherwise , may be provided ). referring now to fig2 a to fig2 b , a description is made of a stacked layer type dynamic amount sensor 201 according to a fourteenth embodiment . this embodiment is different from the above - described twelfth embodiment as to the following technical point : that is , the processing circuit 40 has been formed on such a side of the circuit board 240 , which is located opposite to the reference pressure chamber 37 . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the fourteenth embodiment , and descriptions thereof are omitted . fig2 a and fig2 b are sectional views for indicating the stacked layer type dynamic amount sensor 201 according to the fourteenth embodiment . also , fig2 a corresponds to fig2 a in the twelfth embodiment , and fig2 b corresponds to fig2 b in the twelfth embodiment . as shown in fig2 a and fig2 b , the processing circuit 40 has been formed on a plane of the circuit board 240 , which is located opposite to the reference pressure chamber 37 , namely , has been formed on the plane of this circuit board 240 along a direction opposite to the pressure applied direction of the diaphragm 31 . firstly , a detailed description is made of fig2 a . the pressure sensor - purpose wiring line 33 has been provided within the surface protection film 35 provided on the pressure applied side of the diaphragm 31 . the pressure sensor - purpose wiring line 33 electrically connects the piezoelectric resistors 32 to the penetration electrodes 111 within the ground frame 31 b . furthermore , the penetration electrodes 111 have been electrically connected to wiring lines 161 formed inside the protection film 241 which is provided on the surface of the circuit board 240 where the processing circuit 40 is present . since the wiring lines 161 are set in the above - described manner , the piezoelectric resistors 32 have been electrically connected to the processing circuit 40 . next , a description is made of fig2 b . in fig2 b , one wiring line 161 is partially exposed from the protection film 241 , and constitutes a processing circuit - purpose pad 41 for a bonding process . this wiring line 161 is different from the wiring line of fig2 a , and passes through the inner portion of the protection film 241 provided on the surface of the circuit board 240 . also , the other wiring line 161 which passes through the protection film 241 has been electrically connected to a penetration electrode 111 which is different from that of fig2 a and has been provided in the ground frame 31 b . then , an edge portion of this penetration electrode 111 is exposed from the surface protection film 35 provided on the pressure applied side of the diaphragm 31 , and then constitutes the processing circuit - purpose pad 41 . since the above - described structure is employed , in accordance with the stacked layer type dynamic amount sensor 201 of the fourteenth embodiment , the output signals of the processing circuit 40 may be derived not only from the edge plane of the diaphragm 31 on the pressure applied side , but also from the edge plane of the circuit board 240 , which is located opposite side from the pressure applied side . it should be noted that in this embodiment , the stacked layer type dynamic amount sensor 201 has been made of such a structure that the piezoelectric pressure sensor 30 is stacked on the circuit board 240 , and the signals are derived from both planes of the stacked elements . however , this structure is merely one example . for instance , in the structure of fig1 a to fig1 c , if such a penetration electrode which penetrates both the n type silicon substrate 21 and the insulating film 26 is provided on the supporting substrate 25 of the capacitance type acceleration sensor 20 , then signals may be inputted and outputted from both the planes of the composite type dynamic amount sensor 1 as explained in this embodiment . in other words , the gist of this embodiment is given as follows : while the penetration electrode is provided , the signals are inputted and outputted from both the planes of either the composite type dynamic amount sensor 1 or the stacked layer type dynamic amount sensor 201 . as a consequence , the structure of the sensor 1 , or 201 is not limited only to the structures shown in fig2 a and fig2 b . referring now to fig2 , a description is made of a stacked layer type dynamic amount sensor 201 according to a fifteenth embodiment . the fifteenth embodiment has the below - mentioned technical different points from those of the above - described embodiments . that is , in this embodiment , a pressure sensor - purpose wiring line 33 has been formed by an impurity diffusion layer . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the fifteenth embodiment , and descriptions thereof are omitted . fig2 is a sectional view for showing the stacked layer type dynamic amount sensor 201 according to the fifteenth embodiment . as shown in fig2 , the piezoelectric resistors 32 have been formed on such a plane of the diaphragm 31 , which is located opposite to the side thereof to which pressure is applied . furthermore , an impurity diffusion layer formed by diffusing an impurity into the silicon substrate is located adjacent to the diaphragm 31 in such a manner that this impurity diffusion layer is electrically connected to these piezoelectric registers 32 . then , the pressure sensor - purpose wiring line 33 made of this impurity diffusion layer has been electrically connected via the penetration electrode 111 provided on the circuit board 240 to this circuit board 240 . also , as shown in fig2 , the plane of the circuit board 240 , in which the processing circuit 40 has been formed , is faced to the reference pressure chamber 37 . although not shown in the drawing , a method for manufacturing the above - described stacked layer type dynamic amount sensor 201 will now be described . as a first step , such a piezoelectric type pressure sensor 30 is prepared on which the diaphragm 31 , the piezoelectric resistors 32 , and the pressure sensor - purpose wiring line 33 made of the impurity diffusion layer have been formed . also , such a circuit board 240 is prepared which contains the processing circuit 40 , the protection film 241 for protecting the processing circuit 40 , and the wiring line 161 which is provided within this protection film 241 and is electrically connected to the processing circuit 40 . as a second step , an edge plane of the diaphragm 31 on the side where the pressure sensor - purpose wiring line 33 made of the impurity diffusion layer is present is directly joined to such a plane of the circuit board 240 on the side where the processing circuit 40 is present . as a third step , a contact hole is formed in such a plane of the circuit board 240 on the side where the processing circuit 40 is not present , while this contact hole is connected to the pressure sensor - purpose wiring line 33 made of the impurity diffusion layer . furthermore , another contact hole which is connected to the wiring line 161 is formed in the above - described plane of the circuit board 240 . as a fourth step , poly - silicon , or the like is deposited by the cvd method in such a manner that the contact holes formed in the third step are electrically connected to each other . with executions of the above - described steps , the stacked layer type dynamic amount sensor 201 of fig2 can be manufactured . as an effect achieved by the stacked layer type dynamic amount sensor 201 of the fifteenth embodiment , since not only the processing circuit 40 but also the piezoelectric resistors 32 are present on the side of the reference pressure chamber 27 , these processing circuit 40 and piezoelectric resistors 32 can be hardly contacted to the open air . in other words , the environmental resistance characteristic of this stacked layer type dynamic amount sensor 201 can be increased , as compared with such a case that these processing circuit 40 and piezoelectric resistors 32 are exposed to the open air . referring now to fig2 and fig2 a to fig2 e , a description is made of a stacked layer type dynamic amount sensor 201 according to a sixteenth embodiment . the sixteenth embodiment has the below - mentioned technical different points from those of the above - described twelfth embodiment . that is , in this embodiment , the circuit board 240 has been stacked on the capacitance type acceleration sensor 20 . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the sixteenth embodiment , and descriptions thereof are omitted . fig2 is a sectional view for showing the stacked layer type dynamic amount sensor 201 according to the sixteenth embodiment . as indicated in fig2 , a plane of the circuit board 240 on the side thereof where the processing circuit 40 is present is stacked with respect to such plane of the capacitance type acceleration sensor 20 on the side thereof where the fixed portion 24 and the movable portion 23 are present . also , an output signal of the fixed portion 24 is once derived via one penetration electrode 111 provided on the circuit board 240 to another plane of the circuit board 240 on the side thereof where the processing circuit 40 is not present . furthermore , this derived output signal is electrically connected via another penetration electrode 111 to the wiring line 161 present on the plane of the circuit board 240 on the side thereof where the processing circuit 40 is not present . then , this wiring line 161 has been connected to the input terminal of the processing circuit 40 . as another feature , as represented in fig2 , the sin film 27 is not present on at least the movable portion 23 , or the thickness of this sin film 27 is made thinner , as compared with thickness of the sin films 27 of the outer frame 22 and the fixed portion 24 . as a consequence , the movable portion 23 has a clearance with respect to the circuit board 240 , and such a structure which is movable along the same direction as the elongation direction of the supporting substrate 25 . on the other hand , in order that the circuit board 240 can be stacked under stable condition , the sin films 27 are present on either portions or entire portions of the fixed portion 24 and the outer frame 22 . in the case shown in fig2 , in order to simplify the step for removing the sin films 27 , while the sin film 27 is provided on the outer frame 22 , the clearance between the movable portion 23 and the circuit board 240 may be secured by this sin film 27 . referring now to fig2 a to fig2 e , a method for manufacturing the above - described stacked layer type dynamic amount sensor 201 will now be described . as a first step , such a circuit board 240 is prepared which contains the processing circuit 40 , the protection film 241 for protecting the processing circuit 40 , and the wiring line 161 which is provided within this protection film 241 and is electrically connected to the processing circuit 40 . also , the capacitance type acceleration sensor 20 is prepared which has been formed in the above - described steps of fig5 and fig6 . as a second step shown in fig2 a , the sin films 27 formed on the movable portion 23 and the fixed portion 24 of the capacitance type acceleration sensor 20 of fig5 b are made thin , or are removed . it should be understood that although the sin film 27 formed on the fixed portion 24 is not always made thin , or not always removed , since there are many possibilities that the movable portion 23 is located close to the fixed portion 24 , if all of these sin films 27 are removed , then the film removing process can be carried out in a higher efficiency . as a third step shown in fig2 b , the sin film 27 of the capacitance type acceleration sensor 20 is directly joined to the plane of the circuit board 240 on the side thereof where the processing circuit 40 is present at the room temperature . as a fourth step of fig2 c , similar to each of the respective embodiments , contact holes 243 are provided by the rie process . concretely speaking , one contact hole 243 is formed which passes through the circuit board 240 and is reached to the silicon layer of the fixed portion 24 ( and / or movable portion 23 ) of the capacitance type acceleration sensor 20 , and another contact hole 243 is formed which is reached to the wiring line 161 within the circuit board 240 . as a fifth step shown in fig2 d , an oxide film 242 is deposited on a surface of the contact hole 243 by the cvd method . as a sixth step shown in fig2 e , after the oxide film 242 is removed which is deposited on the surface of the silicon layer whose potential is equal to that of either the wiring line 161 or the fixed portion 24 ( and / or movable portion 23 ) of the capacitance type acceleration sensor 20 , aluminum is deposited on a region which couples the contact hole 243 to the contact hole 243 . as a result , either the fixed portion - purpose wiring line 24 c ( and / or movable portion - purpose wiring line 23 c ) or the fixed portion 24 ( and / or movable portion 23 ) of the capacitance type acceleration sensor 20 is electrically connected to the processing circuit 40 , and also , the output signal of the processing circuit 40 can be derived from the plane of the circuit board 240 on the side thereof where the processing circuit 40 is not formed . deriving of this output signal of the processing circuit 40 may be carried out by a wire bonding , or by a flip - chip connection . furthermore , the substance to be deposited is not limited only to aluminum , but also may be made of other metals such as tungsten , or poly - silicon . with employment of the above - described structure , in accordance with the stacked layer type dynamic amount sensor 201 of the sixteenth embodiment , both the movable portion 23 and the fixed portion 24 can be sealed in the sealing space 246 which is formed by the circuit board 240 and the capacitance type acceleration sensor 20 . as a result , such a cap is no longer required which is employed so as to protect both a movable portion and a fixed portion of a capacitance type acceleration sensor , which is not a stacked layer type acceleration sensor . also , since the processing circuit 40 is similarly present on the side of the above - described sealing space 246 , the stacked layer type dynamic amount sensor 201 can have a not - easily - broken structure , and also have such a structure which can be hardly and adversely influenced by contaminations from external environments . referring now to fig2 , a description is made of a stacked layer type dynamic amount sensor 201 according to a seventeenth embodiment . the seventeenth embodiment has the below - mentioned technical different points from those of the sixteenth embodiment . that is , in this embodiment , a plane of the circuit board 240 , on which the processing circuit 40 has been formed , is largely different from the opposite side of the above - described sixteenth embodiment . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the seventeenth embodiment , and descriptions thereof are omitted . fig2 is a sectional view for showing the stacked layer type dynamic amount sensor 201 according to the seventeenth embodiment . as indicated in fig2 , the processing circuit 40 has been formed on a plane of the circuit board 240 , which is located opposite to another plane thereof on which the movable portion 23 and the fixed portion 24 of the capacitance type acceleration sensor are present . in other words , the processing circuit 40 has been formed on such a plane which is located opposite to the stacked plane which stacks the capacitance type acceleration sensor on the circuit board 240 . as previously explained , since the processing circuit 40 is provided on the plane opposite to the stacked plane , a total number of the penetration electrodes 111 can be reduced and the sensor structure can be made simpler , as compared with the sensor structure shown in fig2 . concretely speaking , in such a case where the processing circuit 40 is present on the side of the capacitance type acceleration sensor and the capacitance type acceleration sensor is electrically connected to the processing circuit 40 , a signal must be once derived by the penetration electrode 111 to the surface of the circuit board 240 , and furthermore , the signal must be inputted to the processing circuit 40 of the circuit board 240 on the side of the sealing space by employing another penetration electrode 111 . however , in accordance with the sensor structure of this embodiment , when the capacitance type acceleration sensor is electrically connected to the processing circuit 40 , the signal is once derived by the penetration electrode 111 to the surface of the circuit board 240 , and may be directly conducted to the processing circuit 40 . referring now to fig3 , a description is made of a stacked layer type dynamic amount sensor 201 according to an eighteenth embodiment . the eighteenth embodiment has the below - mentioned technical different points from those of the respective embodiments . that is , in this embodiment , piezoelectric type pressure sensor 30 , a capacitance type acceleration sensor 20 , and a circuit board 240 have been stacked with each other . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the eighteenth embodiment , and descriptions thereof are omitted . fig3 is a sectional view for showing the stacked layer type dynamic amount sensor 201 according to the eighteenth embodiment . as indicated in fig3 , the capacitance type acceleration sensor 20 has been stacked on the circuit board 240 , and furthermore , the piezoelectric type pressure sensor 30 has been stacked on the capacitance type acceleration sensor 20 . it should also be understood that structures as to the circuit board 240 , the capacitance type acceleration sensor 20 , and the piezoelectric type pressure sensor 30 are substantially identical to the structures employed in the above - explained respective embodiments . subsequently , a method for manufacturing the above - described stacked layer type dynamic amount sensor 201 will now be described . as a first step , such a circuit board 240 is prepared which contains the processing circuit 40 , the protection film 241 for protecting the processing circuit 40 , and the wiring line 161 which is provided within this protection film 241 and is electrically connected to the processing circuit 40 . also , a capacitance type acceleration sensor 20 is prepared . in a second step subsequent to the first step , the supporting substrate side of the capacitance type acceleration sensor 20 is directly joined to the protection film 241 on the circuit board 240 on the side thereof where the processing circuit 40 is present at the room temperature . it should also be noted that this joining process may be replaced by a glass adhesive method , or an anode joining process . in a third step subsequent to the second step , similar to the above - described respective embodiments , a contact hole is formed until the silicon layer of the movable portion 23 ( and fixed portion 24 ) present under the insulating film 27 ( sin film etc .) of the capacitance type acceleration sensor 20 is exposed by employing the rie process . also , another contact hole is similarly formed until the input wiring line 247 of the circuit board 240 is exposed . in a fourth step subsequent to the third step , aluminum is deposited so as to embed the contact holes formed in the above - described third step , and also , in order that the contact holes are electrically connected to each other by the cvd method , so that the fixed portion - purpose wiring line 24 c is produced . it should be noted that the substance to be deposited is not limited only to aluminum , but may be selected from other metals such as tungsten , and poly - silicon . in a fifth step subsequent to the fourth step , a surface protection film 28 is formed in such a manner that the sin film 27 of the capacitance type acceleration sensor 20 and the fixed portion - purpose wiring line 24 c formed in the third step are covered . thereafter , both the movable portion and the fixed portion shown in fig5 and fig6 are formed . in a sixth step subsequent to the fifth step , the diaphragm 31 in which the piezoelectric resistors 32 have been internally provided is prepared , and the ground frame 31 b is directly joined to the surface protection film 28 of the capacitance type acceleration sensor 20 . in a seventh step subsequent to the sixth step , a photo - resist mask forming process and a reactive ion etching process ( will be referred to as “ rie ” process hereinafter ) are carried out with respect to the insulating film 36 formed on the piezoelectric resistors 32 of the diaphragm 31 so that a plurality of contact holes are formed in the ground frame 31 b . this rie process is carried out until both an input wiring line 247 and an output wiring line 248 of the circuit board 240 are exposed . in other words , the contact holes correspond to such holes which pass through the ground frame 31 b , the surface protection film 28 of the capacitance type acceleration sensor 20 , the sin film 27 of the capacitance type acceleration sensor 20 , the n type silicon substrate 21 of the capacitance type acceleration sensor 20 , the insulating film 26 of the capacitance type acceleration sensor 20 , and the supporting substrate 25 of the capacitance type acceleration sensor 20 , and then , are reached to the input wiring line 247 of the circuit board 240 . in an eighth step subsequent to the seventh step , aluminum is deposited in such a manner that the plural contact holes formed in the seventh step are embedded and are electrically connected to each other by executing the cvd process . at this time , the contact hole communicated with the input wiring line 247 of the processing circuit 40 is electrically connected to the contact holes communicated with the piezoelectric resistors 32 by aluminum . also , poly - silicon is simply deposited in the contact hole communicated with the output wiring line 248 , which constitutes the penetration electrodes 111 . in a ninth step subsequent to the eighth step , a surface protection film 35 is provided in such a manner that the surface protection film 35 covers the aluminum and the insulating film 36 on the diaphragm 31 formed in the eighth step . furthermore , an opening portion is formed in this surface protection film 35 so as to expose an edge portion of the penetration electrode 111 communicated with the output wiring line 248 , so that such a pad 249 used to derive an output signal of the processing circuit 40 is formed . it should be noted that the substances to be deposited in the eighth step and the ninth step are not limited only to aluminum , but may be selected from other metals such as tungsten , and poly - silicon . subsequently , a description is made of effects achieved by the stacked layer type dynamic amount sensor 201 of the eighteenth embodiment . as a first effect , since the piezoelectric type pressure sensor 30 , the capacitance type acceleration sensor 20 , and the circuit board 240 are stacked with each other , an area occupied by the sensors can be reduced , as compared with a sensor occupied area of such a structure that a piezoelectric type pressure sensor , a capacitance type acceleration sensor , and a circuit board are separately provided . also , as a second effect , under such a condition before the piezoelectric type pressure sensor 30 is adhered to the capacitance type acceleration sensor 20 , namely under such a condition that the capacitance type acceleration sensor 20 has been adhered to the circuit board 240 , the penetration electrodes 111 are provided , and the output of the capacitance type acceleration sensor 20 can be entered to the processing circuit 40 . as a result , the simple structure can be made . concretely speaking , the structure of this embodiment can reduce a total number of the penetration electrodes 111 , as compared with the below - mentioned structure : that is , an output of a capacitance type acceleration sensor is derived up to a diaphragm by a first penetration electrode , and furthermore , the output of the capacitance type acceleration sensor derived up to the diaphragm is entered to a processing circuit by a second penetration electrode which electrically connects the first penetration electrode to the processing circuit . referring now to fig3 , a description is made of a stacked layer type dynamic amount sensor 201 according to an nineteenth embodiment . the nineteenth embodiment has the below - mentioned technical different points from those of the eighteenth embodiment . that is , in this embodiment , after the piezoelectric type pressure sensor 30 , the capacitance type acceleration sensor 20 , and the circuit board 240 have been stacked with each other , all of the penetration electrodes 111 are formed . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the nineteenth embodiment , and descriptions thereof are omitted . fig3 is a sectional view for showing the stacked layer type dynamic amount sensor 201 according to the nineteenth embodiment . as indicated in fig3 , the capacitance type acceleration sensor 20 has been stacked on the circuit board 240 , and further , the piezoelectric type pressure sensor 30 has been stacked on the capacitance acceleration sensor 20 . it should also be noted that the circuit board 240 , the capacitance type acceleration sensor 20 , and the piezoelectric type pressure sensor 30 have the substantially same structures as those of these structural members employed in the above - described respective embodiments . a technical different point between the above - described eighteenth embodiment shown in fig3 and the present embodiment is given as follows : that is , the plurality of penetration electrodes 111 formed on the diaphragm 31 , and the fixed portion wiring line 24 c for electrically connecting these penetration electrodes 111 are present . precisely speaking , one penetration electrode 111 passes through the ground frame 31 b from the n type silicon substrate 21 of the capacitance type acceleration sensor 20 , and is communicated to the upper portion of the diaphragm 31 . the other penetration electrode 111 penetrates the ground frame 31 b and the capacitance acceleration sensor 20 from the upper portion of the diaphragm 31 , and is communicated to the input wiring line 247 of the processing circuit 40 . next , a method for manufacturing the above - described stacked layer type dynamic amount sensor 201 of the nineteenth embodiment will now be described . as a first step , such a circuit board 240 is prepared which contains the processing circuit 40 , the protection film 241 for protecting the processing circuit 40 , and wiring lines 247 and 248 which are provided within this protection film 241 and are electrically connected to the processing circuit 40 . also , the capacitance type acceleration sensor 20 is prepared which has been formed in the above - described steps of fig5 and fig6 , and further , the diaphragm 31 is prepared into which the piezoelectric resistors 32 have been internally provided . then , these circuit board 240 , the capacitance type acceleration sensor 20 , and diaphragm 31 are adhered to each other by executing the direct joining process at the room temperature . in a second step subsequent to the first step , a photo - resist mask forming process and a reactive ion etching process ( will be referred to as “ rie ” process hereinafter ) are carried out with respect to the oxide film 36 formed on the piezo electric resistors 32 of the diaphragm 31 so that a plurality of contact holes are formed in the ground frame 31 b . this rie process is carried out until a silicon substrate plane which is electrically connected to the fixed portion 24 of the capacitance type acceleration sensor 20 is exposed , and also another silicon substrate plane which is electrically connected to the movable portion 23 thereof is exposed . in a third step subsequent to the second step , a photo - resist mask forming process and a reactive ion etching process ( will be referred to as “ rie ” process hereinafter ) are carried out with respect to the oxide film 36 formed on the piezoelectric resistors 32 of the diaphragm 31 so that a plurality of contact holes are formed in the ground frame 31 b . this rie process is carried out until both the input wiring line 247 and the output wiring line 248 of the circuit board 240 are exposed . in other words , the contact holes correspond to such holes which pass through the ground frame 31 b , the surface protection film 28 of the capacitance type acceleration sensor 20 , the sin film 27 of the capacitance type acceleration sensor 20 , the n type silicon substrate 21 of the capacitance type acceleration sensor 20 , the insulating film 26 of the capacitance type acceleration sensor 20 , and the supporting substrate 25 of the capacitance type acceleration sensor 20 , and then , are reached to the input and output wiring liens 247 and 248 of the circuit board 240 . in a fourth step subsequent to the third step , aluminum is deposited in such a manner that the plural contact holes formed in the second step and the third step are embedded and are electrically connected to each other by executing the cvd process . at this time , the contact hole communicated with the input wiring lien 247 of the processing circuit 40 is electrically connected to the contact holes communicated with the piezoelectric resistors 32 by aluminum so as to constitute the pressure sensor - purpose wiring line 33 . similarly , the contact hole communicated with the input wiring line 247 of the processing circuit 40 is electrically connected to the contact hole communicated with such a silicon layer whose potential is equal to that of the movable portion 23 ( and fixed portion 24 ) of the capacitance type acceleration sensor 20 by aluminum so as to constitute the fixed portion - purpose wiring line 24 c . also , poly - silicon is merely deposited on the contact hole communicated with the output wiring line 248 of the processing circuit 40 so as to constitute the penetration electrode 111 . it should also be noted that the substance to be deposited is not limited only to aluminum , but may be selected from other metals such as tungsten , and poly - silicon . in a fifth step subsequent to the fourth step , the surface protection film 35 is provided in such a manner that the surface protection film 35 covers the poly - silicon and the oxide film 36 on the diaphragm 31 formed in the fourth step . furthermore , an opening portion is formed in this surface protection film 35 so as to expose the edge portion of the penetration electrode 111 communicated with the output wiring line 248 , so that such a pad 249 used to derive an output signal of the processing circuit 40 is formed . as a result , the stacked layer type dynamic amount sensor 201 of fig3 can be manufactured . since the above - described structure is provided and the manufacturing method is carried out , the stacked layer type dynamic amount sensor 201 of this embodiment can have the below - mentioned effects : that is , as a first effect , the piezoelectric type pressure sensor 30 , the capacitance type acceleration sensor 20 , and the circuit board 240 are stacked with each other , and all of the penetration electrodes 111 are formed under such a condition that the movable portion 23 has been sealed in the reference pressure chamber 37 . as a result , there is no risk that particles and cleaning water produced when the penetration electrodes 111 are formed enter spaces between the movable portion 23 and the fixed portion 24 , which may cause the sticking phenomenon . as a second effect , the output signal of the capacitance type acceleration sensor 20 is once derived above the diaphragm 31 . in this case , for example , if a portion of the surface protection film 35 covered on the diaphragm 31 is removed so as to expose the pressure sensor - purpose wiring line 33 which connects the penetration electrode 111 to the penetration electrode 111 , then the capacitance type acceleration sensor 20 can be checked . referring now to fig3 , a description is made of a stacked layer type dynamic amount sensor 201 according to a twentieth embodiment . the twentieth embodiment has the below - mentioned technical different points from those of the eighteenth embodiment . that is , in this embodiment , a ceramic chip 250 where a wiring line 251 has been provided is sandwiched between the capacitance type acceleration sensor 20 and the circuit board 240 . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the twentieth embodiment , and descriptions thereof are omitted . fig3 is a sectional view for showing the stacked layer type dynamic amount sensor 201 according to the twentieth embodiment . as indicated in fig3 , the ceramic chip 250 where the wiring line 251 has been provided is sandwiched between the capacitance type acceleration sensor 20 and the circuit board 240 . while this ceramic chip 250 contains such a structure manufactured by combining an oxide film with the wiring line 251 , a peripheral edge portion of the wiring line 251 has been exposed from a predetermined portion ( namely , place where wiring line 251 is contacted with below - mentioned penetration electrodes 111 ). then , as an entire structure of the stacked layer type dynamic amount sensor 201 , the piezoelectric type pressure sensor 30 , the capacitance type acceleration sensor 20 , the ceramic chip 250 , and the circuit board 240 have been sequentially stacked with each other in this order from the pressure application side . next , a description is made of a method for manufacturing the stacked layer type dynamic amount sensor 201 of the twentieth embodiment . firstly , as a first step , such a circuit board 240 , the capacitance type acceleration sensor 20 manufactured by the steps shown in fig5 a to 6 b described above and the ceramic chip 250 are prepared . the circuit board 240 contains the processing circuit 40 and the protection film 241 which protects the processing unit 40 . in the ceramic chip 250 , the peripheral edge portion of the wiring line 251 has been exposed at the predetermined portion ( place where wiring line 251 is contacted with below - mentioned penetration electrode 111 ). these circuit board 240 , the sensor 20 and ceramic chip 250 are joined to each other by the direct joining process at the room temperature . at this time , the wiring line 251 is electrically connected to the processing circuit 40 . it should also be noted that as the substance which constitutes the wiring line 251 , metals such as aluminum , copper and tungsten may be employed . in a second step subsequent to the first step , one penetration electrode 111 is formed in such a manner that the peripheral edge portion of the wiring line 251 is electrically connected to the fixed portion 24 ( otherwise , movable portion 23 ) of the capacitance type acceleration sensor 20 . the wiring line 251 has been connected to such a place which is used to process an output signal of the capacitance type acceleration sensor 20 in the processing circuit 40 . in a third step subsequent to the second step , the piezoelectric type pressure sensor 30 is directly joined to the capacitance type acceleration sensor 20 . in a fourth step subsequent to the third step , another penetration electrode 111 is formed in such a manner that the peripheral edge portion of the wiring line 251 is connected to the piezoelectric resistors 32 . the wiring line 251 has been connected to such a place which is used to process an output signal of the piezoelectric type pressure sensor 30 in the processing circuit 40 . also , another penetration electrode 111 is formed which is communicated with the peripheral edge portion of the wiring line 251 connected to an output place of an output signal in the processing circuit 40 , and drives this output signal above the diaphragm 31 . these penetration electrodes 111 have passed through the capacitance type acceleration sensor 20 so as to be connected to the wiring line 251 of the ceramic chip 250 . since the stacked layer type dynamic amount sensor 201 of this embodiment , which has such a structure , employs the above - described ceramic chip 250 , the following effect may be achieved . that is , there is a high freedom degree when the wiring lines are routed . it should also be noted that the present embodiment has exemplified the stacked layer type dynamic amount sensor 201 in the unit of chip . alternatively , while a plurality of such stacked layer type dynamic amount sensors 201 are integrated on a wafer , these stacked layer type dynamic amount sensors 201 may be manufactured under wafer condition . referring now to fig3 a to fig3 b and fig3 , a description is made of a stacked layer type dynamic amount sensor 201 according to a twenty - first embodiment . the twenty - first embodiment has the below - mentioned technical different points from those of the above - described twentieth embodiment . that is , in this embodiment , a deriving electrode 245 has been provided on a side plane of the ceramic chip 250 . it should be understood that the same reference numerals shown in the above - described respective embodiments will be employed as those for denoting the same , or similar structural elements in the twenty - first embodiment , and descriptions thereof are omitted . fig3 a is a sectional view for showing the stacked layer type dynamic amount sensor 201 according to the twenty - first embodiment . fig3 b is a sectional view of the sensor 201 , taken along a line xxxiiib - xxxiiib of fig3 a . as shown in fig3 a , the deriving electrode 245 has been provided on the side plane of the ceramic chip 250 , namely , along a direction perpendicular to a stacking direction of the capacitance type acceleration sensor 20 and the piezoelectric type pressure sensor 30 . this deriving electrode 245 has been connected to the wiring line 251 which connects the capacitance type acceleration sensor 20 to the processing circuit 40 . in other words , an output signal of the capacitance type acceleration sensor 20 may be derived from this deriving electrode 245 . as represented in fig3 b , a plurality of such deriving electrodes 245 have been formed on the side plane of the ceramic chip 250 . concretely speaking , various sorts of output signals from the movable portion 23 , the fixed portion 24 , the piezoelectric resistors 32 , and the processing circuit 40 are derived from these deriving electrodes 245 formed on the side plane of the ceramic chip 250 . as shown in fig3 a , these deriving electrodes 245 have been fixed by a bump joining 252 with respect to lead frames of the package 253 , and have been electrically connected thereto . also , these deriving electrodes 245 have been alternately arranged with respect to the stacking direction . the substance for constructing the wiring line 251 may be selected from metals such as aluminum , copper , and tungsten . in such a case that a plurality of stacked layer type dynamic amount sensors 201 of this embodiment are manufactured in an integral manner , as represented in fig3 , if one deriving electrode 245 and the other deriving electrode 245 are formed by being faced with each other , then the formed deriving electrodes 245 are dicing - cut along a dot line , and thus , one deriving electrode 245 may be divided from the other deriving electrode 245 . as other methods than the above - described dicing - cut method , after the structure of fig3 has been formed , the deriving electrodes 245 may be formed by employing the cvd process , or the like . alternatively , as shown in fig3 a , a spacer 254 having a height substantially equal to the height of the bump join 252 is set among the insulating film 26 , the sin film 27 , and the package 253 , so that the stacked layer type dynamic amount sensor 201 is horizontally supported with respect to the package 253 . next , a description is made of effects achieved by the stacked layer type dynamic amount sensor 201 of the twenty - first embodiment . as a first effect , the output signals of the respective sensors can be derived from the deriving electrodes 245 formed on the side plane of the ceramic chip 250 , so that the stacked layer type dynamic amount sensor 201 can be vertically installed with respect to the bottom plane of the package 253 . also , as a second effect , in addition to the above - described merit that the output signals of the respective sensors can be derived from the deriving electrodes 245 formed on the side plane of the ceramic chip 250 , similar to the above - described twentieth embodiment , the output signal of the processing circuit 40 may be derived from the upper portion of the diaphragm 31 . in other words , the output signals may be derived from at least 2 planes which have no parallel relationship with each other . in the above - described first to tenth embodiments , either the piezoelectric type pressure sensor or the capacitance type pressure sensor has been stacked with respect to the capacitance type acceleration sensor . however , combinations of these sensors to be stacked are not limited only to the above examples . for example , a capacitance type acceleration sensor may be stacked with respect to a capacitance type angular velocity ( yaw rate ) sensor , or a pressure sensor may be alternatively be stacked on the capacitance type angular velocity sensor . also , a piezoelectric resistor type pressure sensor may be alternatively stacked on a piezoelectric resistor type acceleration sensor . furthermore , acceleration sensors whose detection directions are different from each other may be alternatively stacked with each other in such a manner that these acceleration sensors are located opposite to each other . also , acceleration sensors for 3 axes may be alternatively formed in such a way that the acceleration sensors for x - axis and y - axis directions are formed on one substrate , whereas the acceleration sensor for a z - axis direction is formed on another substrate . moreover , although the detecting directions are equal to each other , as represented in fig1 , acceleration sensors whose sensitivities are different from each other may be alternatively stacked with each other . in the above - described eleventh to seventeenth embodiments , either the capacitance type acceleration sensor or the piezoelectric type pressure sensor has been stacked on the circuit board . however , combinations of these sensors to be stacked are not limited only to the above example . for instance , a capacitance type angular velocity ( yaw rate ) sensor may be alternatively stacked on a circuit board , or a capacitance type pressure sensor may be alternatively stacked on the circuit board . the composite type dynamic amount sensor 1 shown in the above - explained embodiments first to ninth , and the stacked layer type dynamic amount sensor 201 indicated in the twelfth to twenty - first embodiments may be alternatively manufactured in accordance with such a manufacturing method that semiconductor wafer substrates are stacked with each other , and thereafter , the stacked semiconductor wafer substrate may be dicing - cut to obtain the respective chips . also , as to stacking methods for semiconductor wafer substrates with each other , when no ncf is interposed between the substrates , a direct joining method at the room temperature , a direct joining method at a high temperature , a glass adhering method , and an anode joining method may be arbitrarily selected . while the invention has been described with reference to preferred embodiments thereof , it is to be understood that the invention is not limited to the preferred embodiments and constructions . the invention is intended to cover various modification and equivalent arrangements . in addition , while the various combinations and configurations , which are preferred , other combinations and configurations , including more , less or only a single element , are also within the spirit and scope of the invention .	7
the figure shows an exemplary embodiment of the inventive method and an exemplary embodiment of the inventive arrangement in a schematic manner , referred to below for simplicity as an exemplary embodiment or example . a scenario is hereby assumed , which occurs typically an a communication network , namely that a first subscriber t a wishes to set up a connection to a second subscriber t b , with the first subscriber a being shown as a telephone , while the second subscriber t b is embodied as a mobile element in the example shown . however this does not mean that the exemplary embodiment is restricted to these types of devices . rather all known communication devices , including purely software - based applications providing a telephone function , such as so - called voice over ip clients , which use the inventive method , can be deployed as claimed in the invention . according to the exemplary embodiment of the invention illustrated the inventive method comes into effect as a result of a call initiated at a first time t 1 by the first subscriber t a , for which it should be assumed for the application of the invention that the second subscriber t b cannot be reached . alternatively or additionally the first subscriber a can overwrite the hitherto standard settings for the current call by so - called suffix dialing within a defined time period from time t 1 , for example as long as the incoming call is signaled , in other words it is ringing at the second subscriber t b . as shown , the call initiated at the first time t 1 triggers a check at a first switching facility switch a , which is assigned to the first subscriber t a , to determine whether a profile table stored in the first switching center switch a contains standard values for cost acceptance , as should be signaled to the second subscriber t b in the event of a callback . if such an entry for cost acceptance for the first subscriber facility t a is stored at the first switching center switch a , at a second time t 2 the information “ cost acceptance yes ” is added for example as an attribute of call signaling for transmission and is transmitted to a second switching facility switch b , which is assigned to the second subscriber t b . other signalings , such as the setting of at least one specific bit , in other words a so - called flag , or combinations of such are possible . the second switching facility switch b can then store this additional attribute as assigned to the first subscriber a in a call list , which has flagged the call from the first subscriber t a , so that when a caller list showing missed calls is displayed the second subscriber t b receives and sees this information as well . as shown in the diagram this is indicated to the second subscriber t b by a check next to the identifier of the first subscriber t a . at a fourth time t 4 the second subscriber can then select the missed call from the first subscriber t a and initiate the desired callback . the second switching facility switch b hereby in turn determines from the attribute “ yes ” assigned to the first subscriber t a and stored that cost acceptance has been agreed on the part of the first subscriber t a and at a fifth time t 5 initiates a connection , which is set up as a collect call , as soon as the first subscriber t a accepts the call . at a later sixth time t 6 according to the invention the callback list entries can also be deleted again . this can be done for example as soon as a callback has been carried out successfully or in the event of a next successful call from the second subscriber t b to the first subscriber t a , if for example the first subscriber t a could not accept the callback in a first callback attempt . optionally , in other words alternatively or additionally , such deletion can also be timer - controlled so that the entry in the second switching center switch b can be deleted for example after 24 hours , with this also having to be signaled to the second terminal t b according to the invention , so that it can update its call list accordingly . alternatively or additionally to the example illustrated and described , it is also possible for callbacks from the second terminal t b to the first terminal t a generally to be set up as collect calls . in a further alternative or addition to an embodiment or variant provision can be made for the possibility to be implemented on the part of the first terminal t a that the acceptance of costs for an expected callback from the second terminal tb to the first terminal t a is approved or rejected on the part of the first terminal , it being possible for this decision to be made in particular at an earlier time , in other words to take place alternatively or additionally to the above - mentioned suffix - dialing . depending on whether protocol influences are also tolerated or desired on the part of the first terminal t a , this can be implemented alternatively or additionally according to the invention , with analog terminals being excepted from implementation . with this alternative in particular provision can be made for the profile of the first terminal t a to be stored in the first terminal t a or in the first switching facility switch a . a development that is advantageous for analog terminals consists of operating without influences on signaling , whereby the invention is realized with the “ traditional ” suffix dialing that is present in analog terminals generally , for example the inputting of a “*”, which according to the invention is evaluated as “ charge accepted ” or the inputting of “#”, which is evaluated as “ charge not accepted ”.	7
steps in a method which is an embodiment of the invention are now described . the starting point of the method is a radiological image such as the mri image shown in fig1 . the mri image is assumed to be oriented according to the radiological convention i . e . with the subject &# 39 ; s nose pointing left and his or her neck towards bottom of the image . the mri image is an msp image , meaning that it represents data lying in an estimated mid - sagittal plane . the equation of the msp can be obtained according to any known estimation algorithm , such as the one described in wo 03 / 60827 ( based on pct / sg02 / 00006 ). however , the invention is not limited to this method of obtaining the msp . a first step of the method is to use progressive thresholding to binarise the image . this is illustrated in fig2 to 3 . the method is carried out by the following steps , which are illustrated in fig5 : a ) a window of size 11 × 11 is moved over the entire image of fig1 in an overlapping manner and the mean value of the pixels in the window at every location is recorded . b ) the maximum among the means derived in step ( a ) recorded is computed . c ) an initial threshold is fixed as 80 % of the maximum mean ( step 1 in fig5 ). d ) a binary image is derived from fig1 in which each pixel above the initial threshold is set to white , and each pixel below the threshold is set to black ( this is step 2 in fig5 , and the result is shown in fig2 ). in the binary image , an attempt is made ( step 3 ) to identify the corpus callosum ( cc ) as the structure having the following properties ( based on the observations and validation of data ): a ) the length of the cc ( from the genu to the splenium , i . e . along the major axis ) is about 7 to 9 cm . b ) the width of the cc ( from the superior point of body or trunk to the inferior point of the genu , i . e . the minor axis ) is about 2 to 4 cm . c ) the orientation of the cc ( angle of major axis with respect to horizontal axis ) is from 5 to 40 degrees . d ) the area of the cc in the binarised image is about 600 to 1000 mm 2 . if such a structure is not identified , then it is determined whether the threshold is less than 40 % of the initial value , and if not the threshold is reduced by 10 % of its current value ( step 4 ), and steps 2 and 3 are repeated . steps 2 to 4 are repeated until the cc is detected or the threshold value is less than 40 % of the initial value . if the threshold value is less than 40 % of initial value and cc is not found , the program quits , stating that cc is not found . for example , if the starting image is fig1 , then a cc will be identified by this procedure . it is shown in fig3 . the major axis is marked ( as the line la - ra ), as is the minor axis . the points marked rb and lb are the right bottom and left bottom parts . more generally , if the cc is found , the method proceeds to step 5 in which a check is carried out to determine whether the cc and fornix are attached : a ) define a subregion ( s 1 ) around cc . fig4 shows this area for the case that the initial msp image is as in fig1 . the height of the sub - region is selected in such a way that the brainstem ( bs ) and fornix are included . specifically , the width of the region s 1 is selected to be equal to the major axis , and the height was set to 2 . 5 times the minor axis . b ) for each column in the binary image of s 1 , the horizontal projection of the columns ( i . e . for each row , the sum of the values in that row ) is calculated . fig6 and 7 show two cases . fig6 ( a ) and 7 ( a ) show the binary image of the region s 1 for two different initial mri images , and fig6 ( b ) and 7 ( b ) show the corresponding projections . if there are 3 peaks , or if the centre point of the projection is higher than the mean of the two end points , as in the case of fig7 ( b ), then the fornix and cc are attached together . if the fornix is separated from the cc , the method passes to the set of steps shown in fig1 . otherwise , prior to doing this , a step 6 is carried out in which the cc and fornix are separated by boundary tracing and morphological operations . in a first of the steps of fig1 ( step 7 ) the fornix is identified as follows . a ) within the sub - region s 1 , a region of interest ( roi ) for fornix detection is defined . fig8 shows the sub - region s 1 , with the parts of s 1 which are not within the roi shown as black . the roi is defined as the region between 20 % and 80 % of cc &# 39 ; s major axis . the cc structure is subtracted from the roi . b ) the roi region is binarised using a progressive thresholding algorithm , resembling the one used above . in this case , pixels are set to white or black according to whether the corresponding value of the mri image is above or below an initial threshold , and the threshold gradually reduced until a fornix structure can identified in the image . the fornix is identified as a structure in the roi having the following properties . ii ) it is located in between the two ends of cc . the entire fornix structure may be not be seen by thresholding , hence to get the complete structure of fornix we do region growing . the intensity values of pixels which are expected to be in the identified fornix structure region are collected and their mean value is computed . from this mean value , two thresholds for region growing of the fornix are calculated . this process involves defining a parameter m f which is the mean of the pixel intensities in the possible fornix region , and a second parameter σ which is the standard deviation of the intensity values in the same region . then a lower threshold l f is defined as m f − 2σ , and an upper threshold u f is defined as m f + 2σ . using these thresholds the full fornix region is obtained by “ region growing ” as shown in fig8 . in this process the pixel values of all regions between the thresholds are assumed to be part of the fornix . the inferior most tip of the fornix is identified as a first estimate of position of the ac ( step 8 ). once fornix region , is identified , cc and fornix structures are subtracted from the subregion s 1 . the result is the region of s 1 which is not black in fig9 the brainstem ( bs ) is identified in this region using anatomical information , that bs is located inferio - posteriorly to cc . the bs is composed of grey and white matter pixels , having higher variance in intensity values than in cc and fornix . similar to fornix identification , we initially detect the possible bs region using thresholding and perform region growing to extract complete structure . the bs region is characterized by the location of a centroid , intensity variation and width of the region . the lower and upper limits for region growing using 8 - neighborhood were calculated as by defining a first parameter mbs which is the mean of the pixel intensities in the possible bs region , and a second parameter σ which is the standard deviation of the pixel intensities in the possible bs region σ . using these two parameters , we set a lower threshold l bs which is mbs − 3σ , and an upper threshold u bs which is mbs + 2σ . all pixels for which the values of the mri image are between these thresholds are assumed to be part of the bs . the values of the thresholds given above are proposed based on the composition of grey and white matter pixels in bs . our observation from the data showed a larger deviation of grey values to the lower side of the mean than to the upper side . for the mri image of fig1 , this gives the estimate for the bs as the points shown in white in fig9 ( step 9 ). the upper right most point of bs is defined as our initial estimate of the pc point ( step 10 ). a next step is to obtain an improved estimate of the positions of the ac and pc . to do this , we generate two sub - images of the initial mri image ( step 11 ). for the mri image of fig1 , these sub - images are shown in fig1 and 11 respectively . the sub - images are selected as rois respectively around the initial estimates of the positions of the ac and pc . the ac sub - image ( fig1 ) is centered at the initial estimate of the position of the ac , and has a size large enough ( e . g . 12 × 12 mm , which are values which selected based on the observations and anatomy ) to include surrounding structures for processing . the construction of pc sub - image is based on variability information that the pc is situated at a distance of 17 - 42 mm posterior to the ac . the initial estimate of the pc derived above was checked , to see it obeys the above condition , and if so an area large enough ( eg . 16 × 16 mm ) to include this point and surrounding structures was defined as pc image . if the condition is not met , the bs region growing is carried out with new thresholds and a re - estimate the initial position of the pc . for all the cases for which we have tested our algorithm , the initial position of the pc obeyed the condition . the position of the ac is below the inferior tip of fornix , but due to partial volume or imaging artifacts the ac is indistinguishable from the inferior tip of fornix . the ac will usually be manifested as a bright point in the ac image , which can be located by binarising the image and region growing the foreground pixels . an improved estimate of the position of the ac is the inferior - most point of the largest region in the ac sub - image . around this initial position of the ac we check to see if there are any points with a higher intensity . if such a point is found , it is considered as an improved estimate of the position of the ac . otherwise , the previous estimate of the ac point itself is retained ( step 12 ). an improved estimate of position of the pc is obtained by performing a horizontal projection of the pc image ( step 13 ). in other words , for each row of the pc sub - image we find the respective sum of the corresponding mri intensities . the resultant plot is shown in fig1 ( b ). the pc image contains a part of the brainstem and the superior colliculus . the point where , the slope changes significantly indicates the row of pc image containing the position of the pc , at least for cases where the superior colliculus is well separated from bs . this row is designated as an initial estimate of the pc row of the pc sub - image . in cases where the superior colliculus is not separated , the slope change is not significant . hence , two adjacent rows of the identified pc_row , in the pc image are also considered for final refinement . the pc is identified as the point having the maximum change in grey value with the neighbour pixels in the identified pc_row and its adjacent rows . after identifying the pc row , the intensity profile along the rows is taken , as shown in fig1 ( a ), and the column number of the pc in the image is found using fig1 ( a ), as the maximum intensity along the pc row . the final coordinates of the positions of the ac and pc are mapped back to the volume data using the msp equation . the corresponding axial slices where the ac and pc are manifested are identified using the msp equation , voxel size and the volume dimensions . fig1 shows the steps of an optional technique for improving the estimates of the estimates of the positions of the ac and pc derived above by processing axial slices . in a first step ( step 14 ), the axial slices containing the positions of the ac and pc estimated above are found by using the coordinates of the estimated positions of the ac and pc in the midsagittal plane and msp equation . these two axial slices are termed “ reference slices ”. in a second step ( step 15 ), for each of these ac and pc axial slices , five further slices are defined : two slices above each of the ac and pc axial slices , and two slices below each of the ac and pc axial slices . the resultant five slices derived from the ac reference slice are shown in fig1 . in a third step ( step 16 ), for the ac reference slice and each of the four slices derived from it , we form a mean ventricular line ( mvl ) passing through the third ventricle , by using the horizontal and vertical projections of the corresponding slice . this is shown in fig1 , where a slice ( shown in fig1 ( a )) is used to produce a horizontal projection ( shown in fig1 ( c )) and a binary version of the slice ( shown in fig1 ( b )) is used to produce a vertical projection ( shown in fig1 ( d )). the binary version of the slice is produced using a threshold which is selected to be 70 % of the region of the mean intensity of the region - of - interest , and pixels below this threshold are shown in fig1 ( b ) as white , and pixels above the threshold as black . using the mvl profile , a set of evaluations is performed checking : 1 . whether massa intermedia is present or the third ventricle is complete , and 2 . whether there is a cistern before the ac or the slice has gray matter . to evaluate the first condition , check along the mvl for continuity of white pixels in the binary image . if the continuity or the length of white pixels is at least 85 % of the distance between ac and pc then there is no massa intermedia present . if the continuity is broken then massa intermedia is present . the distance between the ac and pc is found by the initial estimates of the positions of the ac and pc . the second condition is evaluated by checking the mvl profile before an initial position of the ac . if there are csf intensity pixels , it is assumed that a cistern is present ; else if the pixel intensity is of gray matter then a gray matter is present . these conditions are necessary to decide on what will be the nature of a profile along the mvl and it is used as a reference while searching for the ac and pc . in a fourth step , we examine the profile plot of image values along the mvl ( shown in fig1 ). that is , starting from the midpoint of the profile ( i . e . a point in the third ventricle or on the massa intermedia ) we move leftwards to locate a wm ( white matter ) peak . this peak is the one end point of the ac . following the peak , we use the second derivative of the profile to identify the starting point of the ac . similarly we find the start and end points in all the 5 other slices considered for processing . the ac is assumed to have a width of about 3 mm . using , these starting and end points and the value of intensity in between these points , region growing is carried out to extract the complete structure of ac ( step 17 ). to form an improved estimate of the position of the pc ( step 18 ), we use the mvl profile plot for the pc reference slice , and the four axial slices around the pc reference slice . this is shown , for one of those five axial slices , in fig1 . fig1 ( a ) shows one of the axial slices , fig1 ( c ) shows a horizontal projection of it ( i . e . summing the values in respective rows ), fig1 ( b ) shows a binarised version of it ( produced in the same way as fig1 ( b ) described above ), and fig1 ( d ) shows a vertical projection of the binarised version ( i . e . summing the values in respective columns ). this is performed in the same manner as how the mvl is obtained for ac slices . fig1 shows the intensity profile along the mvl . starting from the middle of the profile and moving towards the right side of the plot , we trace the pc . since the third ventricle has a cerebro spinal fluid ( csf ) which manifests itself as dark matter , the wm peak is identified as the pc location . as in ac identification , the pc too is identified using region growing , as a structure which is cylindrical in shape and having radius of about 1 mm . fig2 shows the steps of a corresponding technique for improving the estimates of the positions of the ac and pc derived above by processing coronal slices . from the coordinates of the structures ( ac & amp ; pc ) the corresponding coronal reference slices are identified ( step 20 ). for each of the ac and pc coronal reference slices , two further slices in the anterior direction and two further slices in the posterior direction are defined . thus , there are a total of 5 slices for the ac , and 5 slices for pc ( step 21 ). the five slices for the ac are shown in fig2 , and the five slices for the pc are shown in fig2 . for all the five slices selected a region of interest is selected , consisting of cc , lateral ventricle and ac is selected using the msp equation . a binarised version of each slice is formed , and the binarised rois are used to locate the symmetrical line this is the white line on fig2 . the ac and pc are assumed to be on this symmetrical line . using the intensity information of cc , a rough estimate of intensity of the ac is obtained as both cc and ac are white matter structures and cc is more homogeneous structure . the intensity value along the symmetry line ( shown in fig2 ) is scanned ( step 22 ) to obtain a white matter peak in the opposite direction of cc . this point is considered as a good estimate for the position of the ac if it has intensity close to white matter intensity and third ventricle can be identified after the ac ( low gray value due to csf ). the further slices around ac reference slice are checked for the above condition . the slices which meet the above conditions are considered to have the ac and from this the radius of the ac is found out ( step 23 ). from the pc slices , the roi around the msp line is extracted to find the symmetrical line passing through the roi ( the white line on fig2 ). the pc is assumed to be on the symmetry line . the location of the cc is known from earlier processing , and hence can be used as a reference to locate white matter structures . the symmetry line ( shown in fig2 ) is scanned ( step 24 ) to locate the cc and find its intensity value . the intensity value of cc is used as a reference to locate the pc as follows . a scan is done along the symmetry line away from cc position . the csf region separates the cc and pc . hence the intensity values will be low in this region . after the csf region , a small region of pixels of white matter and gray matter mix can be located . after this point , a few pixels of low intensity corresponding to csf are located which represents the aqueduct . the pc is the region between the csf matter and the aqueduct . the above conditions are checked in the pc coronal slices considered for processing . the slices which satisfy the conditions are marked as possessing pc . from the number of slices having the pc the dimensions of the pc structure is found out ( step 25 ). the final positions of the ac and pc are found using the information obtained from all the three orientations . this is the best position estimate found above in each of the three directions . using the final positions of ac and pc , 3 d extraction of the ac and pc is carried out . the pc is assumed to be cylindrical with diameter of about 2 mm . the ac is assumed to be a bent cylinder with diameter about 3 mm . this is based on anatomical knowledge . primarily we are interested in determining the width of the ac and pc , rather than their height ( i . e . length in axial slices ). although only a single embodiment of the invention has been described in detail , many variations are possible within the scope of the invention as will be clear to a skilled reader .	6
referring to fig1 , a first embodiment of a pre - corneal humidity chamber 10 is depicted . this embodiment generally includes a sleep mask 12 , moisture reservoir 14 , seal 16 and retaining member 18 . sleep mask 12 is preferably made of a moisture impermeable and flexible material . sleep mask 12 is shaped and sized appropriately to conform to the area surrounding the eyes and orbit in a comfortable fashion . sleep mask 12 is preferably shaped so that the perimeter 20 thereof fits snuggly against the skin of the face . moisture reservoir 14 may include any type of device adapted to contain and release a material subject to evaporation or sublimation . examples include an absorbent fibrous substance , a chamber for holding a material subject to vaporization and a chemical mixture that releases as a vapor desired substance . seal 16 generally conforms to perimeter 20 of sleep mask 12 . sleep mask 12 may also be configured without seal 16 so long as sleep mask 16 is generally closely fitting to the area surrounding the eyes . seal 16 is preferably made from a soft , conforming , hypoallergenic material . the cross - section of seal 16 is preferably rounded as depicted in fig2 so as to provide a comfortable junction between seal 16 and the skin of the user . seal 16 may be made from such materials as closed or open cell foam , silicon or moisture impermeable fabric . retaining member 18 preferably comprises an elastic strap as depicted in fig1 and 2 . retaining member 18 may however , be constructed of elastic straps , velcro , temples as used on eyeglasses or any other structure that would appropriately retain sleep mask 12 in a comfortable position in apposition to the face of the user . moisture reservoir 14 is preferably made from an absorbent material , which readily allows for evaporation of water or other evaporative liquids . a sublimating solid may be employed as well . moisture reservoir 14 may include two layers , an inner layer 24 and a moisture layer 26 . inner layer 24 is preferably a lint free material with antibacterial , antifungal and wicking properties . moisture layer 26 is preferably made up of an absorbent material . the absorbent material may include super absorbent particles or a jellified water product . moisture reservoir 14 is preferably removably attachable to sleep mask 12 . attachment between moisture reservoir 14 and sleep mask 12 may be achieved by pressure sensitive adhesive backing , velcro or any other attachment mechanism known to the removable attachment arts . moisture reservoir 14 may be provided in the dry state and moistened at the time of desired use . moisture reservoir 14 may also be provided pre - moistened in a sealed container . moisture reservoir 14 may be moistened with , for example , purified water , ringer &# 39 ; s solution , or a buffered purified formulation of an appropriate ionic and electrolytic composition to mimic human tears . referring to fig3 and 4 , another embodiment of the invention is depicted . this embodiment of the pre - corneal humidity chamber 10 generally includes a frame front 28 and temples 30 . frame front 28 and temples 30 may be structured in a fashion generally similar to conventional eyeglasses or in a fashion generally similar to a goggle . this description will be most appropriate for an embodiment of the pre - corneal humidity chamber 10 structured similarly to a conventional pair of eyeglasses , however , this should not be considered limiting . one skilled in the art will readily realize that the general principal can be adapted to any sort of eyewear construction . frame front 28 generally includes eye wire 32 , bridge 34 , end piece 36 and seal 38 . each eye wire 32 encloses and supports lens 40 . lens 40 may be a prescription or nonprescription lens . lens 40 may also be a colorless transparent lens or a tinted lens . frame front 28 is constructed to conform generally to the contours of the user &# 39 ; s face . seal 38 preferably runs around the perimeter 42 of frame front 28 . seal 38 can be constructed of any soft pliable , moisture impermeable material and serves to seal the juncture between frame front 28 and the face of the user . referring particularly to fig4 , temples 30 generally include hinge 44 , moisture reservoir 46 , earpiece 48 , and a portion of seal 38 . seal 38 preferably continues from frame front 28 to enclose moisture reservoir 46 within the same space that the user &# 39 ; s eyes are enclosed in . temples 30 are mirror images of one another and join frame front 28 at hinge 44 . hinge 44 is made of two halves one connected to end piece 36 and one connected to temple 30 . moisture reservoir 46 is similar in structure to moisture reservoir 14 of the previous embodiment . moisture reservoir 46 conveniently may be attached to temples 30 but may be incorporated into any part of the pre - corneal humidity chamber 10 that allows evaporation in to the enclosure including the eyes . it will be apparent to one skilled in the art that the embodiment depicted in fig3 and 4 can readily be modified to treat only one eye as can the embodiment depicted in fig1 and 2 . referring to fig5 and 6 , another embodiment of pre - corneal humidity chamber 10 is depicted . this embodiment of the invention generally includes hat 50 , brim 52 , transparent enclosure 54 and moisture reservoir 56 . hat 50 is preferably a baseball style cap but may include any hat or visor having a brim . brim 52 may be of any shape or size so long as it protrudes forward of the brow on the front of the hat 50 . transparent enclosure 54 is preferably an optically clear material . transparent enclosure 54 extends downward from brim 52 and is configured to fit closely to the face and temples of the user . transparent enclosure 54 is preferably made from an optically clear transparent material such as polycarbonate or acrylic . moisture reservoir 56 is preferably secured to the under side 58 of brim 52 . moisture reservoir 56 may also be incorporated anywhere within transparent enclosure 54 . moisture reservoir 56 may also be secured to transparent enclosure 54 . in addition , moisture reservoir 56 may be an integral part of brim 52 or hat 50 . moisture reservoir 56 may be constructed of a fibrous absorbent polymer , which absorbs water . moisture reservoir 56 may also be made up of super absorbent particles or a jellified water product as indicated in the embodiments above . in operation , the pre - corneal humidity chamber 10 is worn by the user so as to enclose the user &# 39 ; s eyes . prior to wearing , the user applies a moisturizing compound such as water , ringer &# 39 ; s solution or an artificial tear solution to moisture reservoir 14 , moisture reservoir 46 or moisture reservoir 56 . any of moisture reservoirs 14 , 46 or 56 may be supplied in a dry state and moistened at the time of use or may be supplied in a pre - moistened state sealed in a package and applied at the time of desired use . referring to fig1 and 2 , sleep mask 12 is applied over the eyes prior to going to sleep . the evaporation of moisture from moisture reservoir 14 provides a high humidity ambient environment around the eyes , thus , reducing evaporation of the watery portion of the tears , thus enhancing the ability of the patient &# 39 ; s tears to provide a comfortable environment for the eyes . in addition , sleep mask 12 may be provided with a moisture reservoir 14 capable of holding a large volume of liquid in order to provide a long - term warm moist soak for the eyes . this approach may be used as an adjunct to the treatment of blepharitis . referring to fig3 and 4 , this embodiment of the pre - corneal humidity chamber 10 is worn in a fashion similar to eyeglasses or conventional goggles . prior to wearing , moisture reservoir 46 is replaced if pre - moistened or moistened . moisture reservoir 46 then evaporates moisture to provide a high humidity environment for the eyes within the pre - corneal humidity chamber 10 . in addition , the pre - corneal humidity chamber 10 of this embodiment provides protection of evaporation caused by air movement . in addition , pre - corneal humidity chamber 10 of this embodiment tends to exclude atmospheric irritants and other air quality irritants that may irritate the eye . referring to fig5 and 6 , prior to wearing this embodiment of the pre - corneal humidity chamber 10 , moisture reservoir 56 is moistened or inserted if pre - moistened . this embodiment of the pre - corneal humidity chamber 10 also tends to protect from increased evaporation due to air movement as well as tending to exclude irritants in the ambient air . in testing an exemplary reservoir was placed in a sealed plastic bag . the humidity within the bag rose to in excess of 90 % and remained at that level for over eight hours . this is long enough to provide comfort during a normal sleep cycle . a test subject reported dramatically improved comfort during sleep using an embodiment of the invention . the present invention may be embodied in other specific forms without departing from the spirit of any of the essential attributes thereof ; therefore , the illustrated embodiments should be considered in all respects as illustrative and not restrictive , reference being made to the appended claims rather than to the foregoing description to indicate the scope of the invention .	0
the present invention is now described with reference to the drawings , wherein like reference numerals are used to refer to like elements throughout . in the following description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the present invention . it may be evident , however , to one skilled in the art that the present invention may be practiced without these specific details . in other instances , well - known structures and devices are shown in block diagram form in order to facilitate description of the present invention . as used in this application the phrase “ relevant training cases ” for a split node s ( rtc ( s )) denotes the set of instances in the training data with values consistent with the split values on the path from the root to the split node s . for example , in prior art fig1 rtc ( node 14 ) denotes the set of training cases for which age & lt ; 30 . note that the relevant training cases for a root node is the set of all training cases . as used in this application , the term “ component ” is intended to refer to a computer - related entity , either hardware , a combination of hardware and software , software , or software in execution . for example , a component may be , but is not limited to being , a process running on a processor , a processor , an object , an executable , a thread of execution , a program and a computer . by way of illustration , both an application running on a server and the server can be components . fig3 is a schematic block diagram illustrating a system 30 for extracting predictions from a decision tree 32 . the decision tree 32 is constructed by a learning algorithm 34 that examines a set of training data 36 , which is a subset of the possible data 38 . it is to be understood by one skilled in the art that any of the well - known learning algorithms for constructing decision trees may be utilized to construct the decision tree 32 . the system 30 extracts predictions from the decision tree 32 and may include a tracking component 40 . the tracking component 40 monitors data from the training data 36 as it is transmitted to the learning algorithm 34 , and may keep a list of splits made in constructing the decision tree 32 . in addition , the tracking component 40 may keep a list , for each split , of predictor values not encountered at least a certain number of times within the relevant training cases for that split . thus , the tracking component 40 compiles information that mitigates the inadequate data problem described above . the list of predictor values not encountered at least a certain number of times in the relevant training cases for a split may be stored in the split nodes , as will be described in fig4 . the tracking component may contain a threshold value k , which may be zero , for each predictor value , such that the list of predictor values will contain values that do no occur in at least k cases . if the predictor value does not occur in at least k cases , it is treated as though it did not occur in the data for the split . the system 30 may also include a statistics component 42 that monitors the learning algorithm 34 processes that determine the probabilities for the leaf nodes in the decision tree 32 . when the learning algorithm 34 completes the decision tree 32 , the statistics component 42 may store in the leaf nodes of the decision tree 32 the information and statistics used in generating the probabilities stored in the leaf nodes . for example , for a binary target attribute ( e . g . salary ), the learning algorithm may count the number of occurrences of both states of that attribute . for example , in fig1 component 42 would store , for each leaf the corresponding number of cases where salary = high and salary = low ). it is to be understood by one skilled in the art that different types of leaf distributions for the target attribute ( e . g . binomial distributions for binary attributes , gaussian distributions for continuous attributes ) may have other statistics for determining the probabilities stored in the leaf nodes . an aggregating component 46 may also be included in the system 30 to generate approximate probabilities for conditional probability queries . for example , as noted in the discussion of prior art fig1 a possible query for the decision tree 10 ( fig1 ) may be to predict the conditional probability of a high salary given age & lt ; thirty and job = lawyer . but , as noted above , if there were no lawyers under the age of thirty in rtc ( node 14 ), then the resulting conditional probability may be inaccurate and / or irrelevant . the aggregating component 46 may collect statistics and perform calculations to produce an approximation ( examples of which are discussed below ) to mitigate the inadequate data problem as described above , as well as the other two problems discussed . the aggregating component 46 may access the statistics generated by the statistics component 42 when performing the aggregating function . representative examples of the operation of the aggregating component 46 will be described in more detail below . a detecting component 48 may be included to determine when the aggregating component 46 should perform its aggregating function and when the requested conditional probability may be retrieved from a leaf in the decision tree 32 . the detecting component 48 thus may determine that any combination of the ( 1 ) missing predictor , ( 2 ) inadequate training data , and ( 3 ) new value problems described above are present for a query presented to the decision tree 32 . for example , one method the detecting component 48 may employ in detecting the inadequate data problem may be to examine the information generated by the tracking component 40 that was tracking predictor values for split nodes in the decision tree 32 that did not occur in the relevant training data for each of those split nodes . when a query arrives requesting the conditional probability based on a predictor whose value did not appear in the training data , the detecting component 48 may trigger the aggregating functionality of the aggregating component 46 . examples of such detection and the resulting aggregation are provided below . fig4 a is a tree diagram illustrating a decision tree 61 annotated in accordance with an aspect of the present invention . while the decision tree 61 may have similar splits and probabilities as the decision tree 60 illustrated in fig2 the decision tree 61 provides additional data stored in each of the nodes 63 , 65 , 67 , 69 , and 71 . for example , statistics used in generating the probabilities stored in the nodes 63 , 65 , 67 , 69 , and 71 may be stored in those nodes respectively . the decision tree 61 may include a root node 63 , upon which a split on attribute a was made . the root node 63 may include a list of predictor values not encountered at least k times for the attribute a in the training data ( illustrated as a bracketed list ( a 2 , a 3 ) inside the root node 63 ). the list of predictor values not encountered in the training data at least k times may have been produced by the tracking component 40 ( fig3 ) as the training data 36 was transmitted to the learning algorithm 34 . the list of predictor values not encountered at least k times in the training data may be utilized by the detecting component 48 ( fig3 ) to determine when the aggregating component 46 should produce an approximation . the left child 65 of the root node 63 may indicate that a split on attribute b was made during the learning process . the left child 65 may include a list of predictor values not encountered in rtc ( node 65 ) during training ( e . g . b 2 ). the right child 67 of the root node 63 may include , in addition to the probability that x will be in a certain state , statistics for determining how the probability was computed . similarly , the left child 69 and the right child 71 of split node 65 may contain both probabilities and statistics to determine how probabilities were computed . a query 73 may seek a conditional probability for x given a and b . unlike the conventional decision tree 60 in fig2 the decision tree 61 may produce an approximate probability based on the additional information stored in the leaf nodes 69 and 71 . for example , when the detection component 48 ( fig3 ) determines that the query 73 may not be processed by reading a probability from a leaf node , it may trigger ( e . g . set a flag , send a signal , generate an interrupt ) the aggregating component 46 ( fig3 ) to perform its aggregating function . the aggregating component 46 ( fig3 ) may then determine the approximate probability that x will be in state x = 1 by , for example , performing an aggregating function utilizing stored counts of x = 1 and x = 2 from multiple leaf nodes in the tree , thereby mitigating the three problems described above . fig4 b is a tree diagram illustrating a decision tree 80 annotated in accordance with an aspect of the present invention . while the decision tree 80 may have similar splits and probabilities as the decision tree 60 illustrated in fig2 the decision tree 80 provides additional data stored in each of the nodes 82 , 84 , 86 , 88 and 90 . for example , statistics used in generating the probabilities stored in the nodes 86 , 88 and 90 may be stored in those nodes respectively . the decision tree 80 may include a root node 82 , which includes a list of predictor values that are not encountered at least a threshold number of times in the training data ( illustrated as a bracketed list ( 1 , 3 ) inside the root node 82 ). the list of predictor values not encountered at least a threshold number of times in the training data may have been produced by the tracking component 40 ( fig3 ) as the training data 36 was transmitted to the learning algorithm 34 . the list of predictor values not encountered at least a threshold number of times in the training data may be utilized by the detecting component 48 ( fig3 ) to determine when the aggregating component 46 should produce an approximation . for example , the detecting component 48 ( fig3 ) may determine that an inadequate training data problem exists or that a missing predictor data problem exists by comparing the predictor values provided in a query against the list of sparse predictor values and / or stored splits . the detecting component 48 may determine that a new value problem exists if a provided predictor value matches neither ( 1 ) the values corresponding to the child nodes nor ( 2 ) the set of predictor values that had no data . alternatively , the detecting component 48 may keep an external list of the known states for each predictor , and will recognize when a new value is provided by comparing to the list . the left child 84 of the root node 82 may include a list of predictor values not encountered at least a threshold number of times within rtc ( node 84 ) during training ( e . g . 2 ). the right child 86 of the root node 82 may include , in addition to the probability that x will be in a certain state , statistics for determining how the probability was computed . for example , in leaf 86 , the probability that x = 1 may be computed to be 0 . 1 , determined by dividing 10 by 100 , wherein 10 was the number of times x = 1 and 100 is the sum of 10 + 90 , the counts of when x = 1 and x = 2 respectively , as encountered in the training data . it is to be appreciated by one skilled in the art that there are alternative ways of determining probabilities from the counts in this example , and that for probability distributions other than the binomial distribution , other statistics may be employed to compute these probability distributions . similarly , the left child 88 and the right child 90 of split node 84 may contain both probabilities and statistics to determine how probabilities were computed . a query 92 seeks a similar conditional probability as the query 74 ( fig2 ). unlike the conventional decision tree 60 in fig2 the decision tree 80 may produce an approximate probability based on the additional information stored in the leaf nodes 88 and 90 . for example , when the detection component 48 ( fig3 ) determines that the query 92 may not be processed by reading a probability from a leaf node , it may trigger ( e . g . set a flag , send a signal , generate an interrupt ) the aggregating component 46 ( fig3 ) to perform its aggregating function . the aggregating component 46 may then determine the approximate probability that x will be in state x = 1 by , for example , summing occurrences of x = 1 for children of the split node 84 and dividing that sum by the sum of all occurrences of x . similarly the conditional probability that x will be in state x = 2 given predictor a = 2 and predictor b = 2 may be approximated as illustrated by query and computation 94 , thereby mitigating the missing predictor problem described above . it is to be appreciated by those skilled in the art that such summing and division is but one example of the functionality of the aggregating component 46 and that other aggregation techniques may be utilized for other probability distributions and trees of different orders . fig5 is a tree diagram illustrating a decision tree 100 annotated in accordance with an aspect of the present invention and a computation of a conditional probability triggered by an inadequate training data problem . the decision tree 100 may contain a root node 102 wherein a split was made upon predictor a , with predictor values two and four encountered at least a threshold number of times in the training data , and predictor values one and three not encountered at least a threshold number of times in the training data . thus , the tracking component 40 produced the list ( 1 , 3 ) associated with the root node 102 . split node 104 may be similarly annotated with a list of predictor values not encountered at least a threshold number of times within rtc ( node 104 ) during training ( 2 ) by the tracking component 40 . the leaf nodes 106 and 108 may contain both probabilities and statistics for determining how probabilities stored in the leaf nodes 106 and 108 were computed . the split node 110 similarly contains a list of predictor values not encountered at least a threshold number of times ( illustrated as bracketed numbers ( 2 , 3 ) in the node 110 ) within rtc ( node 110 ), wherein the leaf nodes 112 and 114 contain probabilities and statistics . when a query 116 is presented to the decision tree 100 , the detecting component 48 determines that the predictor b = 2 was not encountered at least a threshold number of times during training by examining the list ( 2 ) in node 104 and thus the aggregating component 46 may perform its aggregating function to produce an approximate conditional probability . one such possible aggregation may involve summing the occurrences of x in a certain state and dividing that sum by the sum of all occurrences of x , as illustrated in the computations associated with the query 116 . since the predictor value had inadequate training data at split node 104 , nodes reachable from split node 104 ( e . g . 108 , 112 , and 114 ) may be aggregated by the aggregating component 46 to produce the approximation as illustrated in the computations associated with the query 116 . thus , an approximation for the probability that x is in state 1 may be computed as shown in query 116 and similarly , an approximation for the probability that x is in state 2 may be computed as shown in query 118 , for example , thereby mitigating the inadequate training data problem . fig6 is a tree diagram illustrating a decision tree 130 annotated in accordance with an aspect of the present invention and one exemplary computation of a conditional probability in both a missing predictor and an inadequate data situation utilizing the consistent look - ahead aggregation technique described above . the root node 132 and its immediate descendants 134 and 136 may include a list of predictor values not encountered at least a threshold number of times within rtc ( node 134 ) and rtc ( node 136 ), respectively , during training by the tracking component 40 ( fig3 ). the leaf nodes 138 , 140 , 142 and 144 contain probabilities that x will be in a certain state and the statistics for computing the probabilities . for example , a query 146 seeks the conditional probability of x given predictor z = 3 and predictor w = 1 . since the predictor value z = 3 was not seen during training , using the consistent look - ahead aggregation technique , both the left and right descendants of the root 132 may be traversed by the aggregating component 46 ( fig3 ) when aggregating . but on the left child 134 of the root node 132 , information may restrict the aggregation to leaf 138 , since the predictor value w = 1 was encountered . that is , the leaf node 140 , corresponding to w = 3 , is inconsistent with the known predictor value from the query . since similar information may be unavailable for the right child 136 ( e . g . no predictor for y ), both leaves 142 and 144 may be aggregated . thus , an approximate probability for x given z = 3 and w = 1 may be generated further mitigating missing predictor problems . fig7 is a tree diagram illustrating a decision tree 160 annotated in accordance with an aspect of the present invention and the computation of a conditional probability in a missing predictor situation utilizing an aggregation technique . the root node 162 and its descendant split nodes 164 , 166 , and 174 have been annotated similarly to the trees described above . similarly , the leaf nodes 168 , 170 , 172 , 176 and 178 have been annotated with the statistics for computing the stored probabilities . a query 180 seeks the conditional probability that x is in a certain state given that predictor a = 3 , predictor c = 2 and predictor d = 1 . at the root node 162 there is a path for a = 3 , so the right side of root node 162 may be analyzed . but at split node 166 , inadequate instances where c = 2 were encountered within rtc ( node 166 ) during training and thus both sides of split 166 will be analyzed . looking ahead at split node 174 reveals that there were occurrences for predictor d = 1 , and thus , using the consistent look - ahead aggregation method , the left child 176 of split 174 will be analyzed . thus , the approximation for the conditional probability sought in the query 180 may be computed by aggregating the statistics in leaf nodes 172 and 176 , as illustrated in the computations accompanying queries 180 and 182 . fig8 is a tree diagram illustrating a decision tree 190 annotated in accordance with an aspect of the present invention and the computation of a conditional probability in both an inadequate training data and a missing predictor situation utilizing the consistent look - ahead aggregation technique . the root node 192 and its descendant split nodes 194 , 196 and 204 have been annotated similarly to the trees described above in accordance with the present invention . similarly , the leaf nodes 198 , 200 , 202 , 206 and 208 have been annotated with statistics for computing the probabilities stored for the leaf nodes , in accordance with the present invention . a query 210 presents the decision tree with a missing predictor problem and an inadequate training data problem as described above . the query 210 seeks the conditional probability of x given predictor c = 2 and predictor d = 1 , but the query may contain assignments for predictors a and b . conventionally , a decision tree may not yield an accurate conditional probability in response to this query because no predictor value for a was provided . but the present invention provides aggregation techniques for mitigating these problems . the consistent look - ahead aggregation method handles these problems as follows . by way of illustration , since no predictor value is provided for the split on the node 192 , the split attribute being a , both paths from the root node 192 may be examined . on the left side of the root node 192 , again there is a missing predictor problem , since no predictor value is provided for the split on node 194 , the split attribute being b . thus both leaf nodes 198 and 200 below node 194 will be included in the aggregation . on the right side of the root node 192 , there is a predictor value provided for the split on the attribute c at node 196 . but the predictor value provided triggers an inadequate training data problem since the provided predictor value is in the list of predictor values for which inadequate training data was provided . consequently , the leaf node 202 will be included in the aggregation . because the consistent look - ahead aggregation method is being used , and the value of d is 1 , the leaf node 206 is included in the aggregation and the leaf node 208 is excluded from the aggregation . it is to be appreciated by those skilled in the art that the consistent look - ahead aggregation technique is but one possible look - ahead aggregation technique and that other such techniques may be utilized for other trees and other probability distributions . fig9 is a tree diagram illustrating the annotated tree 190 of fig8 and an alternative method for computing a conditional probability in an inadequate training data situation that does not utilize the consistent look - ahead aggregation method , but rather an alternative aggregation method , the simple aggregation method . in fig9 the simple aggregation technique is employed for query 214 and thus the statistics from leaf nodes 198 , 200 , 202 , 204 , 206 and 208 are aggregated , despite the fact that node 208 is inconsistent with the assignment d = 1 from the query , and despite the fact that node 202 is inconsistent with the assignment c = 2 from the query , using the method as illustrated in the computations associated with query 214 . thus fig8 and 9 illustrate alternative aggregation techniques that mitigate the inadequate training data problem described above . fig1 is a flow chart illustrating a method for extracting predictions from a decision tree . at step 300 , predictor values are tracked to determine which predictor values for split nodes were encountered . tracking the predictor values facilitates triggering an aggregation technique used to approximate a conditional probability . at step 302 , the predictor values tracked at step 300 are stored to facilitate triggering aggregation . at step 304 , statistics for computing probabilities are generated . it is to be appreciated by one skilled in the art that different statistics may be generated for a plurality of tree orders and aggregation techniques . the statistics may be utilized in the aggregation technique to approximate a conditional probability , thus mitigating the missing predictor , inadequate training data and new value problems described above . at step 306 , the statistics generated at step 304 are stored to facilitate aggregation . at step 308 a query to retrieve a conditional probability is received . at step 310 a determination is made concerning whether the query will produce a missing predictor situation . for example , supplied predictor values may be compared to split values and known missing predictor values . if the determination at step 310 is yes , then at step 312 an approximate conditional probability may be generated utilizing an aggregation technique that accesses the statistics stored at step 306 . if the determination at step 310 is no , then at step 314 a determination may be made concerning whether the query received at step 308 generates an inadequate training data situation . for example , supplied predictor values may be compared to split values and known missing predictor values . if the determination at step 314 is yes , then at step 312 an approximate conditional probability may be generated utilizing an aggregation technique accessing the statistics stored at step 306 . if the determination at step 314 is no then at step 316 , a determination is made concerning whether the query received at step 308 generates a new value situation . if the determination at step 314 is yes , then at step 312 an approximate conditional probability may be generated utilizing an aggregation technique accessing the statistics stored at step 306 . if the determination at step 316 is yes , then at step 312 an approximate conditional probability may be generated utilizing an aggregation technique accessing the statistics stored at step 306 . if the determination at step 316 is no , that at step 3 18 the requested probability may be retrieved from a leaf in a decision tree . fig1 is a segment of pseudocode 400 for one exemplary recursive implementation of the consistent look - ahead aggregation algorithm utilized to retrieve statistics for producing an approximate conditional probability . it is to be understood by one skilled in the art that the algorithm described in fig1 is but one possible method for traversing a decision tree and returning the stored statistics and thus the described method is not intended to limit the present invention . with reference to fig1 , an exemplary environment 710 for implementing various aspects of the invention includes a computer 712 , including a processing unit 714 , a system memory 716 , and a system bus 718 that couples various system components including the system memory to the processing unit 714 . the processing unit 714 may be any of various commercially available processors . dual microprocessors and other multi - processor architectures also can be used as the processing unit 714 . the system bus 718 may be any of several types of bus structure including a memory bus or memory controller , a peripheral bus , and a local bus using any of a variety of commercially available bus architectures . the computer 712 memory includes read only memory ( rom ) 720 and random access memory ( ram ) 722 . a basic input / output system ( bios ), containing the basic routines that help to transfer information between elements within the computer 712 , such as during start - up , is stored in rom 720 . the computer 712 further includes a hard disk drive 724 , a magnetic disk drive 726 , e . g ., to read from or write to a removable disk 728 , and an optical disk drive 730 , e . g ., for reading a cd - rom disk 732 or to read from or write to other optical media . the hard disk drive 724 , magnetic disk drive 726 , and optical disk drive 730 are connected to the system bus 718 by a hard disk drive interface 734 , a magnetic disk drive interface 736 , and an optical drive interface 738 , respectively . the drives and their associated computer - readable media provide nonvolatile storage of data , data structures , computer - executable instructions , etc . for the computer 712 , including for the storage of broadcast programming in a suitable digital format . although the description of computer - readable media above refers to a hard disk , a removable magnetic disk and a cd , it should be appreciated by those skilled in the art that other types of media which are readable by a computer , such as zip drives , magnetic cassettes , flash memory cards , digital video disks , bernoulli cartridges , and the like , may also be used in the exemplary operating environment , and further that any such media may contain computer - executable instructions for performing the methods of the present invention . a number of program modules may be stored in the drives and ram 722 , including an operating system 740 , one or more application programs 742 , other program modules 744 , and program data 746 . the operating system 740 can be any of a variety of commercially available operating systems . a user may enter commands and information into the computer 712 through a keyboard 748 and a pointing device , such as a mouse 750 . other input devices ( not shown ) may include a microphone , an ir remote control , a joystick , a game pad , a satellite dish , a scanner , or the like . these and other input devices are often connected to the processing unit 714 through a serial port interface 752 that is coupled to the system bus 718 , but may be connected by other interfaces , such as a parallel port , a game port , a universal serial bus (“ usb ”), an ir interface , etc . a monitor 754 or other type of display device is also connected to the system bus 718 via an interface , such as a video adapter 756 . in addition to the monitor , a computer typically includes other peripheral output devices ( not shown ), such as speakers , printers etc . the computer 712 may operate in a networked environment using logical connections to one or more remote computers , such as a remote computer ( s ) 758 . the remote computer ( s ) 758 may be a workstation , a server computer , a router , a personal computer , microprocessor based entertainment appliance ( e . g ., a webtv ® client system ), a peer device or other common network node , and typically includes many or all of the elements described relative to the computer 712 , although , for purposes of brevity , only a memory storage device 760 is illustrated . the logical connections depicted include a local area network ( lan ) 762 and a wide area network ( wan ) 764 . such networking environments are commonplace in offices , enterprise - wide computer networks , intranets and the internet . when used in a lan networking environment , the computer 712 is connected to the local network 762 through a network interface or adapter 766 . when used in a wan networking environment , the computer 712 typically includes a modem 768 , or is connected to a communications server on the lan , or has other means for establishing communications over the wan 764 , such as the internet . the modem 768 , which may be internal or external , is connected to the system bus 718 via the serial port interface 752 . in a networked environment , program modules depicted relative to the computer 712 , or portions thereof , may be stored in the remote memory storage device 760 . it will be appreciated that the network connections shown are exemplary and other means of establishing a communications link between the computers may be used . what has been described above includes examples of the present invention . it is , of course , not possible to describe every conceivable combination of components or methodologies for purposes of describing the present invention , but one of ordinary skill in the art may recognize that many further combinations and permutations of the present invention are possible . accordingly , the present invention is intended to embrace all such alterations , modifications and variations that fall within the spirit and scope of the appended claims . furthermore , to the extent that the term “ includes ” is used in either the detailed description or the claims , such term is intended to be inclusive in a manner similar to the term “ comprising ” as that term is interpreted when employed as a transitional word in a claim .	6
fig1 shows a first embodiment of the present invention , and fig2 shows a second embodiment . components having like functions are indicated by like reference numbers . the method shown in fig1 is suitable for measurement of low impedances and the method in fig2 is suitable for measurement of high impedances . as shown in fig1 and fig2 the measuring apparatus of the present invention comprises a main body 1 of the measuring apparatus , an interface portion 2 , a measurement terminal portion 3 , and cables for connecting them . these embodiments differ from each other in the presence or absence of resistors 10 and 12 , the characteristic impedances of cables 13 and 14 and cables 15 and 16 , and the connection points between the cables 13 and 15 and between the cables 14 and 16 . therefore , fig1 will be fully described and fig2 will be described only where differences exist . an element to be measured 19 is placed in a position which is physically apart from the main body 1 of the measuring apparatus and is connected to measurement terminals 17 and 18 at the measurement terminal portion 3 . cables 7 , 8 and 9 , connecting the main body 1 of the measuring apparatus and the interface portion 2 , are normal coaxial cables whose characteristic impedance is ro . a signal source 5 in the main body of the measuring apparatus has an output impedance of ro and is impedance - matched to the cable 8 . voltmeters 4 and 6 are high frequency complex ( or vector ) voltmeters having an input impedance of ro and are respectively impedance - matched to the cables 7 and 9 . the voltmeters 4 and 6 measure the voltage and current , respectively , of the element to be measured , and the ratio between the values thus measured is calculated to obtain the impedance value . the measurement terminal portion 3 and the interface portion 2 are connected by the cables 13 and 15 . the characteristic impedance of cable 13 is the sum of the characteristic impedance of cable 7 and resistor 10 , i . e ., 2ro . 15 designates a triaxial cable having a structure wherein an intermediate conductor is provided between a central conductor and an outer conductor of a coaxial cable . characteristic impedance is ro for both a coaxial cable consisting of the central conductor and the intermediate conductor and a coaxial cable consisting of the intermediate conductor and the outer conductor . therefore , the ratio of the characteristic impedance of the coaxial cable 13 to that of the coaxial cable inside the cable 15 is 2 to 1 . although voltmeter 6 for measuring current is grounded , the current flowing through the element to be measured can be measured in a floating state by installing a balun 11 on the cable 9 . in fig2 the characteristic impedance of cable 14 is ro , which is equal to that of cable 7 . the triaxial cable 16 has an apparent structure which is the same as that indicated by 15 in fig1 . however , the characteristic impedance of the coaxial cable consisting of the central conductor and the intermediate conductor is ro / 2 which is equal to the parallel resistance value of the characteristic impedance of the cable 9 and the resistor 12 . the characteristic impedance of the coaxial cable consisting of the intermediate conductor and the outer conductor of the triaxial cable is ro . therefore , the ratio of the characteristic impedance of the coaxial cable 14 to that of the coaxial cable inside the cable 16 is 2 to 1 . an exemplary application of the present invention is measurement of the temperature characteristics of an element to be measured which is placed in a chamber . in this exemplary application , the measurement terminal portion 3 is placed in the chamber . this measurement terminal portion 3 does not include circuit elements such as a balun . the characteristics of cables 13 and 15 ( fig1 ) change under changes in temperature and mechanical stresses such as bending caused by the arrangement of the cables between the inside and outside of the chamber . however , there is no influence of the changes in the characteristics of the cables because the v - i method is employed . as described above , the present invention is suitable for remote measurement such as tests of temperature characteristics , because the measurement terminal portion does not include circuit elements such as a balun and the v - i method employed is free from the effect of changes in characteristics of the cables . the principles of measurement will now be described . fig1 and fig2 may be converted into equivalent circuits according to the v - i method which have lumped element circuits as shown in fig3 and fig4 respectively . although changes in phases during signal transfer on the cables are neglected in these equivalent circuits , it creates no problem in describing the principles of operation . fig3 shows a circuit which is appropriate for an element to be measured having a low impedance . specifically , however low the impedance of the element to be measured , the voltage across the element is measured with high sensitivity by voltmeter 4 as proportionate to the impedance value . on the other hand , fig4 shows a circuit which is appropriate for an element to be measured having a high impedance . specifically , however high the impedance of the element to be measured , the current thereof is measured with high sensitivity by the voltmeter 6 as proportionate to the admittance value . in fig3 signal source 5 and voltmeter 6 for current measurement are connected in series and provide a resistance of 2ro . in order to set the impedance of the measuring apparatus , as viewed from the element to be measured , at ro , the resistor 10 is inserted in series with the voltmeter 4 . in fig4 resistor 10 is not provided because signal source 5 and voltmeter 4 are connected in parallel , and resistor 12 is connected to voltmeter 6 for current measurement in parallel to set the impedance of the measuring apparatus at ro , as viewed from the element to be measured . the present embodiment is characterized in that the impedance of the measuring apparatus is ro for both low and high impedances . in an environment where such a feature is not necessary , it is apparent that the resistors 10 and 12 ( for impedance matching ) can be eliminated and the characteristic impedance of the coaxial cables inside the cables 13 and 16 may be ro . the process of conversion from fig1 to fig3 will now be described . the input impedance and amplitude transfer characteristics of a cable which has been impedance - matched are the characteristic impedance of the cable and 1 , respectively , regardless of the length of the cable . therefore , the cables 7 , 8 , and 9 can be neglected and fig1 can be converted to fig5 . the part of voltmeter 6 for current measurement can be converted as shown in fig6 based on that fact that the input impedance and amplitude transfer characteristics of a cable which has been impedance - matched are the characteristic impedance of the cable and 1 , respectively , regardless of the length of the cable , and based on the floating effect provided by the balun . as shown in fig7 the intermediate conductor of the triaxial cable may be divided into two virtual conductors 20 and 21 , and the triaxial cable may be constituted by a coaxial cable consisting of the central conductor and the virtual conductor 20 and a coaxial cable constituted by the virtual conductor 21 and the outer conductor . the inner coaxial cable can be freely extended or shortened inside the cylindrical conductor 21 without interfering with a signal transmitted on the outer coaxial cable . further , since the inner coaxial cable is matched to and terminated by the voltmeter 6 for current measurement , it can be freely extended or shortened without causing any change in the impedance and amplitude characteristics , as viewed from the other end . this is shortened to the extremity as shown in fig8 . in fig8 since the left ends of cables 13 and 15 are impedance matched and terminated , the cables can be freely extended or shortened as in the previous case to the extremity as shown in fig3 . fig4 can be obtained from fig2 through the same process . as described above , in a cable which can be properly matched and terminated , the input impedance and amplitude transfer characteristics thereof do not change even if the length of the cable is changed . fig1 and fig2 are equivalent to fig3 and fig4 respectively , except for phases . it is apparent that characteristics that are purely resistive can be maintained and no variation occurs in the voltage at the measurement terminal or as a result of resonance of the cable , even if the cable is extended . at high frequencies , grounded ( unbalanced ) measurement is advantageous in view of traceability , practicality and applicability . in this case , however , an ammeter which has a floating potential is indispensable for the v - i method . the present invention is characterized in that an ammeter which is floated by a balun is connected by a triaxial cable to a measurement terminal portion . the characteristics of the present invention are , in summary , that extension of cables can be achieved without losing the characteristics of two basic circuits in accordance with the v - i method suitable for both high and low impedance . since the measurement terminal portion does not include a transformer , a balun , a resistor and the like , heat resistivity depends on only the material of the cables . therefore , if teflon is used as the insulator for the cables , measurement at temperatures of up to 200 ° is possible . the impedance of the measuring apparatus viewed from the measurement terminal can be pure resistance ( e . g ., 50 ohms ). in addition , the circuit configuration which is impedance - matched as a whole provides flat frequency characteristics for the exciting voltage , measured voltage , and measured current of an element to be measured regardless of the lengths of the cables , eliminating restriction on the lengths of the cables . these features make it possible to put the present invention in use at frequency bands from 1 mhz to 1 ghz or more the present invention allows remote measurement with good heat resistivity and frequency characteristics and a wide impedance measurement range in high frequencies , and is advantageous especially in applications in the field of temperature - characteristics evaluation of high frequency components and materials . it should be understood that the foregoing description is only illustrative of the invention . various alternatives and modifications can be devised by those skilled in the art without departing from the invention . accordingly , the present invention is intended to embrace all such alternatives , modifications and variances which fall within the scope of the appended claims .	6
fig1 shows a typical use of the present invention in a ship 10 . ship 10 is shown in side view and having a support structure 11 therein with shock isolators located in the support structure 11 to dampingly support sensitive control equipment located thereon . fig2 shows a front view of a support structure 11 which is supporting sensitive equipment 12 in a condition which isolates equipment 12 from shock n three different axis . a first six degree - of - freedom shock isolator 15 and a second six degree - of - freedom shock isolator 16 are located in a spaced position above equipment 12 and support equipment 12 in structure 11 . shock isolator 15 and 16 each have one end fixedly secured to structure 11 and the opposite end secured to equipment 12 to suspend the equipment 12 in a spaced condition from structure 11 . the shock isolators 115 and 16 greatly attenuated any shocks to the structure 11 to thereby reduce the chances of the equipment 12 being damaged . fig3 shows a cross sectional view of shock isolator 15 of the present invention . shock isolator 15 includes a member 17 for fixedly securing a cup - shaped , cylindrical shaped , rigid housing 18 to support structure 11 . preferably housing 18 is made of metal or the like and maintains its rigid condition . located within the cylindrical housing 18 is a bell shaped elastomer 19 . bell shaped elastomer 19 has an annular base 20 that is preferably adhesively secured to an inner surface 18 a of housing 18 . the width of the zone or band of adhesive securement of the elastomer to the housing 18 is identified as z a . bell shaped elastomer 19 also include an apex region 21 having an internal 360 degree apex support surface 22 which is preferably adhesively secured to a first end 23 a of a rigid connector 23 to enable the elastomer to form a contilevered connection between housing 18 and connector 23 . connector 23 is located internally to bell shape elastomer 19 . connector 23 includes a second end 23 b to support equipment therefrom . the width of the band or the zone of attachment of the apex support surface 22 to the end 23 a of connector 23 is identified by z b . a central axis x extends vertically upward and is identified by reference numeral 28 . the zone of attachment z a and the zone of attachment z b are axially offset from on another along axis 28 so as not to compressively surround connector 23 a and thereby compressively limit the displacement of connector 23 . fig3 shows isolator 15 in the relaxed condition with the connector in a central position in elastomer 19 . in the embodiment shown , the connector 23 is sufficiently stiff to supporting equipment from connector end 23 b . it is noted that the zones of adhesion z b and z a are axially offset from one another so that displacement of connector 22 with respect to housing 18 places elastomer 19 in shear . that is , in the embodiment shown in fig3 the elastomer housing 18 provides 360 degree contilevered support between the housing 18 and connector end 23 a . by providing a 360 degree cantilever support the elastomer can be responsive to shocks in any directions by elongation rather than compression of the elastomer . fig3 shows that housing 18 and the elastomer 23 from a closed chamber 35 that prevents external objects from inhibiting displacement of elastomer 19 . that is , normally housing 18 is suspended along a vertical axis 28 with the housing 18 preventing object from accidentally falling into the chamber 35 from the top and elastomer 19 preventing objects from accidentally entering chamber 35 from the bottom . as the bottom of elastomer 19 faces downward objects can not normally be retained therein . consequently , when isolator 15 is placed in the vertical condition the isolator will remain operable and unaffected by any objects that might accidentally come into contact with isolator 15 . in order to appreciate the operation of the invention reference should be made to fig5 which shows shock isolator 15 with housing 18 angularly displaced with respect to vertical axis 28 . note , the only connection between connector 23 and housing 18 is through elastomer 19 . furthermore , the forces between connector 23 and housing 18 are transmitted through the two zones of attachment z a and a b . the result is that the elastomer 19 is placed in a substantial shear condition so as to be responsive to shocks to the system . by substantial shear condition it is meant that while there may be some compressive action occurring within elastomer 19 the compressive action is minimized so that the shear or tension response of the elastomer predominates . while the connector is shown being angularly displaced form the x - axis it is apparent that 260 degree contilever support provided by the bell shaped elastomer 19 places the elastomer in a substantial shear condition to effectively damp shocks from any direction . by having the two zones of attachment a a and a b axially offset from one another one assures that displacement of the connector 23 with respect to the housing 18 places the elastomer 23 in a shear condition or substantial shear condition that effectively dissipates or attenuates shocks between objects connected thereto in the three major axis . while angular displacement of connector 22 places elastomer 19 in the shear condition any axially displacement of connector 22 along x - axis 28 also places elastomer 19 in a substantial shear or tension condition . consequently , while connector 22 is free to move in any direction it is tensionally restrained from moving by the contilever support between connector 22 and housing 18 . however , since motion in any direction produces a substantial shear condition the bell shaped elastomer provides effective damping between two objects .	1
fig1 illustrates an example device disclosed in the present application in its resting state . in some embodiments , the exercise device includes a pair of the bands 102 and 104 , which are tied together at the juncture 103 . the elastic band 102 is formed from surgical tubing ( typically made of latex rubber ) or other material with similar elastic characteristics . a preferred length for the band 102 is between 52 inches and 92 inches , although the actual length can be any desired value . a preferred girth of the band 102 is between 1 . 5 and 2 inches though the user may choose tubing of different thickness as needed ( with wider tubing generally providing greater resistance ). the juncture 103 divides the band 102 into two halves 102 a and 102 b , each attaching to a looped handle 101 at the other end . the looped handle 101 , which includes two or more loops , can wrap around a hand or a foot of the user or may be gripped by a hand of the user . the looped handle 101 can be formed from the same surgical tubing as the band 102 , or other material with similar elastic characteristics as surgical tubing . in other embodiments , the handle has a webbed structure that allows a hand or a foot to be threaded around and thus securely engaged without having to grab onto the device . the covering 107 , which can be made of adhesive silicone or similar protective material that offers a permanent air - tight , water - tight seal , wraps around the base of the handle 101 and reinforces its attachment to the band 102 . in some embodiments , the band 104 is formed from non - elastic rope , such as braided polyester or cotton with a synthetic core , or other rope of non - elastic material . a preferred length for the band 104 is 26 inches to 46 inches , although the actual length can be any desired value . the preferred girth of the band 104 is 0 . 75 inches though the thickness may vary depending on how or where the device is to be fixated . each end of the band 104 is processed to avoid breakage , such as by creating a knot 105 . if desired , the resistance modulator 106 rests around the band 102 . it should be appreciated by someone of ordinary skill in the art that the device can include more than two bands , some of which can be bundled together to be applied to the same limb or otherwise used for the same purpose . fig2 illustrates an example looped handle . in some embodiments , the looped handle 208 comprises five pieces : the band 205 , the ring 206 , the segment 202 , the tie 203 , and the covering 204 . the band 205 is the same piece as the band 102 described in fig1 . one end of each of the band 205 is folded back to form a single loop 207 . the ring 206 is an unbroken elastic ring of the same or similar material as the band 205 , preferably 12 to 14 inches in circumference , which can be juxtaposed with the loop 207 to form dual loops . it should be appreciated by someone of ordinary skill in the art that the device may contain multiple such loops . the segment 202 is piece of the same or similar tubing as the band 205 with a preferred length of 6 - to 8 - inches , threaded around the loop 207 and the ring 206 . the tie 203 , consisting of wax thread or similar binding material with a preferred length of 48 to 60 inches , wraps around the bundle of cords formed from folding back both the band 205 and the segment 202 , and holds the band 205 , the ring 206 , and the segment 202 in place . the covering 204 ( also the covering 107 described in fig1 ), which can be formed from an adhesive silicone material or other similar material , wraps around the base of the looped handles as tightly as possible , covering both ends of the segment 202 , the folded - back end of the band 205 , and the binding tie 203 . together , these components comprise the connector 201 . each looped handle can be made of fewer components . in one embodiment , the band 205 is folded back on itself multiple times to form multiple loops . the base of these folds is bound together by the tie 203 and wrapped by the covering 204 . in another embodiment , a separate elastic tubing segment is folded multiple times to create multiple loops . these loops are bound to each end of the band 205 by the tie 203 and wrapped by the covering 204 . fig3 illustrates an example resistance modulator . in some embodiments , the resistance modulator 301 at the position 306 includes a strap of made of nylon , polyester , rubber , or other material with a hook and loop fastener , which enables fast tightening and loosening . the strap has a preferred length of 4 to 6 inches and a preferred width of 0 . 75 to 1 . 25 inches . in one embodiment , one end of the strap forms a closed loop around one segment of the band 302 , while the other end of the strap remains free . it should be appreciated by someone of ordinary skill in the art that the strap can also be removable from the device . the diameter of the loop is to be slightly wider than the diameter of the segment , such as quarter an inch wider , so that it can be moved up and down the segment . a user can then wrap the other end of the strap around both segments of the band 302 as tightly as possible and ultimately fasten the strap to form a significant damper on the band 302 at that position , such as the position 305 . while the fastening does not completely cut off the elasticity of the band 302 , it has a similar effect as breaking the band 302 at that position . therefore , the position of the strap determines an effective length of the elastic portion from the handle and thus the resistance felt by the user . the user can then loosen the strap , slide it to another position , and fasten it again to obtain a desired level of resistance . the farther away the user places the resistance modulator to the juncture 303 , the shorter the elastic portion between the handle and the strap , the less flexibility , and thus the greater the resistance afforded to the user . therefore , for example , position 305 provides more resistance than does position 304 . in general , the user can disengage the resistance modulator by leaving the non - looped end free , thereby keeping both segments of the band 302 detached from one another and maintaining the full range of motion and minimum resistance of the band 302 , while keeping the resistance modulator attached to the device for ease of access . in another embodiment , the resistance modulator 307 can be completely standalone , with neither end wrapping around any portion of the band 302 in the loosened state . the user can keep the resistance modulator 307 attached to the device by securing the strap of the modulator around one segment of the band 302 . the user can then move the resistance modulator along that segment , detach the two ends from each other , and fasten them around both segments of the band 302 . alternatively , the user can adjust the resistance modulator by unfastening the strap of the modulator , removing it from the exercise device ( rather than sliding it along the bands ), and securing it at the desired location on both segments of the band 302 . fig4 illustrates an example process of assembling the device . in step 401 , the user forms the two elastic segments of the exercise device by folding approximately in half an elastic band approximately 26 to 46 inches in length . in step 402 , the user forms the two non - elastic segments used to affix the device by folding a non - elastic band approximately in half in step 403 , the user attaches the elastic and non - elastic bands together by tying them together , ideally around their mid - points . there are many ways to attach the elastic and non - elastic bands to each other , for example by tying the elastic and non - elastic bands together using various knotting techniques , or using a separate thread to join the bands . in step 404 , the user begins the formation of one looped handle by folding one end of the elastic band backwards to form a loop . in another embodiment , the user folds this end of the elastic band over multiple times to form multiple loops ( as described above in fig2 ). in step 405 , the user forms the dual loop of the handle by placing a closed ring of the same of similar material as the elastic band next to the loop formed by folding back the elastic band in step 404 . in another embodiment , the closed elastic ring is superfluous — for example , when the elastic band itself forms multiple loops , as previously described . in step 406 , the user threads a short segment of the same or similar elastic tubing through the loop formed in step 404 and the closed ring of step 405 , to secure both loops in place . this step forms the bundle of cords that comprises the base of the looped handle . in another embodiment , this short elastic segment is also superfluous , as there is no separate piece ( i . e ., a closed elastic ring ) to secure to the multiple loops formed by the elastic band itself , folded multiple times . in step 407 , the user wraps a wax thread or similar binding material around the bundle of cords gathered at the base of the looped handle , as formed in step 406 . in another embodiment , the user wraps the binding thread around the base of multiple loops formed by folding back the end of the elastic band multiple times to secure those loops in place . in step 408 , the user protects the base and structural integrity of the looped handle by wrapping a protective covering , made from adhesive silicone or similar material , around the exterior of the base as tightly as possible , forming the connector of the handle . in step 409 , the user repeats steps 404 - 408 to form the second looped handle attached to the other end of the elastic band . in step 410 , the user attaches the resistance modulator by wrapping the hook and loop strap around one or both segments of the elastic band at a desired location . the strap secures in place around the exterior of the elastic band by wrapping around and adhering to itself via its hook and loop fastening properties . in another embodiment , the user can forgo step 410 if no resistance modulator is desired and leave the resistance of the device unadjusted . fig5 illustrates an example application of the device to a user &# 39 ; s legs during horizontal or vertical exercises . in this embodiment , the non - elastic band 505 is affixed to a high attachment point 504 and the two looped handles 502 wrap around the user &# 39 ; s feet and ankles . one way to attach the looped handles to the user &# 39 ; s feet is to intertwine the looped handles and slip the user &# 39 ; s heel between one of the slots created by the intertwined loops of the handle directly opposite the base of the handle , as shown in fig5 , while the user &# 39 ; s foot points through both intertwined loops and toward the base of the handle . in another embodiment , the user can add additional bands attaching to the same limbs , which is another mechanism for increasing resistance . the resistance of the bands 501 adjusts with the placement of the resistance modulator 503 . as the user slides the resistance modulator 503 down the bands 501 away from the juncture 506 , the resistance will increase . it should be appreciated by someone of ordinary skill in the art that the resistance modulator 503 can rest in a fastened or unfastened position around just one segment of the band 501 , or around one or both segments of the band 505 , or be entirely removed from the exercise device , should the user wish not to engage the resistance modulator . fig6 illustrates an example application of the device , where two such devices are combined to engage the user &# 39 ; s hands and feet simultaneously in a standing exercise . the devices 601 and 602 are separately affixed to a high attachment point 605 , or alternatively , are tied to each other and attached together to an attachment point . in this embodiment , the attachment point 605 is created by draping the non - elastic bands 606 of the device across the top of a door and shutting the door , thereby affixing the device between the top of the door and the door frame . the non - elastic bands can also be attached around a beam or other secure points after , for example , tying the ends of the non - elastic bands together using a double loop slipknot reinforced tightly with additional tie . the looped handles 603 are wrapped around the users hands . one way to attach the looped handles to the user &# 39 ; s hand is to intertwine the looped handles and slip the user &# 39 ; s fingers between one of the slots created by the intertwined loops of the handle directly opposite the base of the handle , while inserting the thumb into an adjacent slot created by the intertwined loops , as depicted in fig6 . the looped handles 604 are wrapped around the user &# 39 ; s feet . in some embodiments , the user can slip one or more fingers into one or more of the slots and leave the other fingers free . the user can also wrap the multiple looped handles around the hands , wrists , feet , ankles , elbows , or knees in various ways , as the elasticity and number of the multiple looped handle enables numerous possibilities for creating gentle traction for the joints both at suspended rest or during exercise . this includes interlacing the fingers while the looped handles are attached to the wrists , with the user &# 39 ; s hands supporting the back of the head , which can create a gentle therapeutic traction and elongation of the connective tissue of the neck vertebra . as shown by the illustration , the combination of a pair of these exercise devices provides the appropriate amount of resistance to allow the user to stretch into backwards - bending positions not otherwise possible without the support of light - resistance bands . it should be appreciated by someone of ordinary skill in the art that the user can also employ the device to stretch the limbs backwards and in other directions , while the user is facing away from the attachment point of one or multiple exercise devices or otherwise not directly facing the exercise device itself . fig7 illustrates another example application of the device , where two such devices are combined to engage the user &# 39 ; s hands and feet simultaneously in a seated exercise . similar to the application illustrated in fig6 , the two devices can be separately affixed to a high attachment point . here , the looped handles 701 wrap around the user &# 39 ; s hands . the looped handles 702 wrap around the user &# 39 ; s feet . while seated , the user may suspend and stretch her limbs by relying on the resistance of the bands . it should be appreciated that the pose illustrated in this figure can be intermediate in a full routine where the body transitions through different positions , such as standing up , rolling down to the floor , and returning to the standing position . it should also be appreciated by someone of ordinary skill in the art that with hands and / or feet engaged , the user may involve additional exercise devices such as an exercise ball or roller , padded stool or chair , through the chest , the back , or other portions of the body , while lying down , standing , or seated at various heights . in some embodiments , the exercise device can cause the psoas muscle to open and lengthen with the aid of vocalization . a body configuration where a user sits on a surface , such as the floor or an exercise roller , while the limbs are suspended by the bands , as illustrated in fig7 , is conducive to stretching the psoas muscle and producing resonant vocal sounds . in this position , the user &# 39 ; s tailbone area is in contact with the floor or other surface while the lower back is suspended off of the floor or other surface and the limbs are gently pulled . the exercise band , which maintains a buoyant quality similar to the psoas muscle , allows the lengthening of joints and connective tissue , and thus , the psoas muscle is free to expand in all directions . therefore , the gentle pulling of the exercise band creates a pathway for the psoas muscle to lengthen in opposition to this gentle pull , without constriction . this pulling can take place as the user moves from a vertical to a horizontal position and returns or gently rocks as each vertebra comes into contact with the ground or other surface , for example . in some embodiments , while operating the exercise device , the user can continuously produce vocalizations as an indication of how the psoas muscle is being engaged . the psoas muscle and the diaphragm are positioned in such a way that through gently pulling the limbs and releasing the psoas muscle , the exercise device ultimately pulls the diaphragm downwards and opens other muscles between the ribs . when this gentle pulling and opening of the diaphragm occurs , the user can achieve a desired breathing balance , which permits a vibrating sensation in the upper palate of the mouth and a distinct resonant sound . therefore , by listening to the change of the vocal sounds , the user can continuously adjust the operation of the exercise device until he or she hears the resonant sound , which indicates that the psoas muscle is being properly engaged . for example , the user can adjust the position of the pelvis in relation to the pulling of the exercise device or recalibrate the resistance level of the exercise device , to achieve the desired resonant sound . since the psoas is the only muscle to connect the spine to the legs , the user can also combine the stretching of the arms by the band 701 with simple movements , such as bicycle kicking of the legs , to enhance the production of vocal sound and strengthen the psoas muscle . fig8 illustrates an example process by which a user would employ the device in one of its embodiments . in step 801 , the user attaches the device to a stationary point . the point of attachment can be the top of a doorway . alternatively , the device can be strung across a ceiling beam or a lower point of attachment as desired . the device can also be affixed by tying the non - elastic portion of the device to the attachment point . in step 802 , the user prepares the device for the desired exercises by adjusting the resistance of the elastic bands via the resistance modulator . in one embodiment , the resistance modulator rests on the device by being fastened to just one segment of the elastic band . to engage the resistance modulator , the user unfastens the strap of the modulator and slides the strap to the desired fixation point along the elastic bands , which allows the user to control the level of resistance . once the strap is at the desired location , the user secures it in place by tightly wrapping the strap around both segments of the elastic band and around itself , adhering by way of its hook and loop fastening properties . in another embodiment , the user adjusts the resistance modulator by unfastening the strap , removing it from the device , and replacing it at the desired fixation point , rather than sliding the strap along the various bands of the device . in another embodiment , the user who desires no resistance adjustment can remove the resistance modulator entirely , or secure the strap around just one segment of the elastic band or around one or both segments of the non - elastic bands . in step 803 , the user begins to engage the device by pulling the looped handles away from the attachment point and toward the user . the user then attaches both looped handles to her hands and wrists without the need to grasp the handles themselves . it should be appreciated by someone of ordinary skill in the art that there are multiple ways the user can engage the looped handles . in one embodiment , the user intertwines the multiple loops of each handle , forming multiple slots in which the user can insert fingers , palm , or wrist , to attach the handle without the need for gripping . the twisting slots created by intertwining the multiple loops of the handle act to secure the hand in place without the user gripping the handle . in another embodiment , the user attaches just one looped handle and grasps the other ; or the user grasps both looped handles ; or the user attaches or grasps one looped handle and keeps the other hand free to engage in other actions . in another embodiment , the user attaches one or both looped handles around the ankles and feet . in another embodiment , the user combines multiple devices in the same exercise — with two devices , for example , the user attaches the looped handles to each hand and each foot for a full - body exercise . in step 804 , the user is ready to perform a variety of stretching , strengthening , and flexibility exercises as desired . in addition to the above mentioned examples , various other modifications and alterations of the invention may be made without departing from the invention . accordingly , the above disclosure is not to be considered as limiting , and the appended claims are to be interpreted as encompassing the true spirit and the entire scope of the invention . although various features of the invention may be described in the context of a single embodiment , the features may also be provided separately or in any suitable combination . conversely , although the invention may be described herein in the context of separate embodiments for clarity , the invention may also be implemented in a single embodiment . reference in the specification to “ some embodiments ”, “ an embodiment ”, “ one embodiment ” or “ other embodiments ” means that a particular feature , structure , or characteristic described in connection with the embodiments is included in at least some embodiments , but not necessarily all embodiments , of the inventions . it is to be understood that the phraseology and terminology employed herein is not to be construed as limiting and are for descriptive purpose only . it is to be understood that the details set forth herein do not construe a limitation to an application of the invention . furthermore , it is to be understood that the invention can be carried out or practiced in various ways and that the invention can be implemented in embodiments other than the ones outlined in the description above . it is to be understood that the terms “ including ”, “ comprising ”, “ consisting ” and grammatical variants thereof do not preclude the addition of one or more components , features , steps , or integers or groups thereof and that the terms are to be construed as specifying components , features , steps or integers .	0
the solution which we propose is enabled based on a detailed analysis of the results of laboratory and practical tests of cosmetic products based on patent cz 302 297 b6 [ 34 ] specified above , whose detailed formulation was optimized for products , for example with regard to helping the elimination of symptoms of opportunistic infections in the oral cavity chytrá houba ® pythie ® bioplus , in the area of non - healing wounds biomycosin , on the surface of the membranes of the urogenital tract feelfresh , and with regard to eliminating the agents of fungal infections of the skin chytrá houba ® pythie ® biodeur ® nail and the veterinary product chytrá houba ® ecosin . all these preparations , containing only pythium oligandrum as an active substance underwent toxicological and safety tests according to the principles of european notification of cosmetic products with optimized formulation , or , in the case of the veterinary preparation , were approved by the institute for state control of veterinary biologicals and medicines ( úlstav pro státní kontrolu biopreparát a lé iv brno ), whereby evaluations of the safety of preparations are available from the cpnp european notification portal . individual preparations formulated in this way were then tested in clinical trials under conditions corresponding to stage ii of the clinical trials required for the development of medications . the preparation chytrá houba ® pythie ® bioplus , in the form of effervescent tablets was tested in a multicentric study incorporating three stomatological clinics , and one clinical microbiology department . groups of participants in the study suffering from a periodontal disease ( penodontitis ) were gathered at three dental clinics in prague and kladno in the czech republic , and in ko { hacek over ( s )} ice in the slovak republic . the group in prague consisted of 7 participants , the group in kladno of 15 participants , and the group in ko { hacek over ( s )} ice of 22 participants . the overall number of participants in the study was , therefore , 44 . a control group was treated in parallel using the same method , receiving not a biological , but the classic chemical preparation chlorhexidine gel . the participants in the study were regularly monitored with measurements of pbi ( papilla bleeding index ), which reflects the immediate condition of the inflammation in the gums , and of cpitn ( community periodontal index of treatment needs ), which is a gauge of the long - term condition of the teeth and a predictor of needs from the perspective of their treatment . the study proceeded using the double - blind method , in which envelopes with the preparations were prepared and numbered by an administration worker not actually involved in the course of the study . after carrying out dental hygiene and signing informed consent , the individual patients were instructed how to conduct their evening dental hygiene and apply the preparations . application was undertaken in the form of rinsing every evening after completing oral hygiene for five consecutive days . a dental check - up was conducted at the beginning of the study , after 2 months and after 6 months , whereby the condition of the teeth was checked , and , at the end of the study after six months , the colonization of the microbe of the healthy oral microbiome evaluated based on a genetic test . it was ascertained in a statistical evaluation of the results that the effect of the chemical disinfectant chlorhexidine was only short - term , since there was a statistically significant reduction of the pbi with p ≦ 0 . 05 only after 2 months of monitoring , and not at the end of the study 4 months later . by contrast , the long - term results in the group using the biological preparation were excellent . a statistically significant reduction of the pbi ( p ≦ 0 . 05 ) was achieved in the short - term evaluation , and a statistically highly significant reduction of pbi ( p ≦ 5 0 . 01 ) was achieved in the long - term evaluation . further , stabilization of the condition of the teeth after the period of 6 months , for which the participants in the study were monitored , was observed . however , the results were heterogeneous in the largest group of participants at the dental clinic in ko { hacek over ( s )} ice , and the expected curative effects were not achieved after statistical evaluation , in contrast to the two groups specified above . in order to clarify this situation , details of the clinical records were used , and the complete microbial profile of the oral microflora was monitored in this group of participants using a genetic test before applying the preparation . a mutual correlation of clinical and laboratory results made it possible to state that this heterogeneous group consists of three sub - groups , indicated as low - risk , medium - risk and high - risk groups . the striking feature of the high - risk group is the low content of physiological oral bacteria , the so - called green protective complex bacteria , incorporating the analyzed strains eikenella corrodens and capnocytophaga sputigena . the results are shown in fig1 a , 1b and ic . fig1 a shows the values of the pbi ( papilla bleeding index ) for , on the one hand , patients indicated in the graph as “ unresponsive patients ” under conditions corresponding to application of a preparation with pythium oligandrum , and , on the other , patients indicated in the graph as “ responsive patients ” under conditions corresponding to the application of the dual microbial preparation , all these before application , 2 months after application and 6 months after application . at the beginning of the study , before application ( black column ), there was no significant statistical difference between the groups . the “ unresponsive patients ” had a pbi value of 38 . 8 ± 5 . 8 and the “ responsive patients ” had a pbi value of 44 . 6 ± 4 . 7 . the probability value of the dissimilarity of both groups was p = 0 . 121 ; meaning that both groups of patients were not therefore significantly statistically different . at the end of the study , after 6 months , the “ unresponsive patients ”, under conditions corresponding to the application of pythium oligandrum , showed pbi values that were statistically higher than the “ responsive patients ”, under conditions corresponding to the application of the dual microbial preparation according to the invention . the calculated bleeding index values were after 6 months 39 . 4 ± 10 . 8 for patients under conditions corresponding to the application of pythium oligandrum alone , whereas the values under conditions corresponding to the application of the dual microbial preparation according to the invention were 10 . 6 ± 2 . 4 . the value of the probability of dissimilarity for both groups was p = 0 . 0003 . the results to concern the cpitn ( community periodontal index of treatment needs ) were similar ; however , this is a less immediate indicator given its slower reaction to the condition of the oral cavity , and therefore rather reflects long - term trends . fig1 b shows the dependency of the intensity of hybridization of genetic probes which detect individual groups of oral microorganisms pertaining to the green , orange or red complex . fig1 b shows the results of a genetic analysis of the presence of selected microbes of the green oral complex ( light - gray column ), the orange oral complex ( dark - gray column ) and red oral complex ( black column ) specified in units , corresponding to the number of disintegration per minute of radioactively labeled dna probes . participants in the control group , under conditions corresponding to the application of chytrá houba ® pythie ® bioplus ( on the right of fig1 b ), and in the experimental group , under conditions corresponding to the application of the dual microbial preparation ( on the left of fig1 b ), have a high content of microbes of the orange and red complex , which supports their diagnosis of serious periodontal disease . no statistically significant differences were observed between the two groups . evident in the experimental group of “ responsive patients ”, however , is the statistically significantly higher content of bacteria of the green complex : 14908 ± 1489 ru as opposed to 2750 ± 1171 ru , p & lt ; 0 . 001 , in particular the capnocytophaga bacterium , as is shown in fig1 c ( dark column ). these results confirm that the dual microbial preparation according to the invention for use in the oral cavity shows statistically significantly better results in comparison with the standard preparation . based on these results , we considered and looked for a solution for the effective and long - term effect of the pythium oligandrum oomycete in eliminating the symptoms of periodontitis and gingivitis , and tested and developed experiments to prove the cooperation of this microorganism , pythium oligandrum , with the microbial components of the healthy oral microbiome , in particular with the capnocytophaga sputigena bacterium . a total of three versions of the dual microbial preparation were prepared for use in the oral cavity and the stability of such preparations was proven , clinical tests also being carried out in patients with periodontal disease . a detailed description of the results obtained is presented hereunder in more detail in this exemplary embodiment of this invention . altogether , the results of this testing proved that when applying the dual microbial preparation according to the invention in the form of effervescent tablets for oral rinsing , which is the form preferred by most users of the mono - component preparations , there was no negative influence on the stability of any of the components during storage in dry state . after the application of the dual preparation in the form of rinsing of the oral cavity , a simple process for users , there was effective colonization and strengthening of the components of the normal oral microbiome , which led to a significant increase in the success rate of eliminating the symptoms of the person under evaluation according to standard indexes . 1 . the preparation , control and testing of the effectiveness of a dual microbial preparation suitable for eliminating the symptoms of gingivitis and periodontal disease in oral cavity . 1 . 1 protocol for the preparation of a dual microbial preparation for use in the oral cavity . 1 . 1 . 1 preparation of the technical preparation pythium oligandrum m1 atcc 38472 . the inoculum for the cultivation of the microscopic oomycete pythium oligandrum , strain m1 atcc 38472 , is prepared using the “ master cell bank ”-“ working cell bank ” corporate system . the proprietary strain pythium oligandrum m1 atcc 38472 is stored in the master cell bank by way of long - term freeze drying . a limited quantity of aliquots is produced from the master cell bank , according to the protocol , for the working cell bank so that the number of reproductive generations does not exceed a total of 50 . this ensures the genetic stability of the proprietary strain . the cultivation of the inoculum proceeds on a reciprocating shaker with swing of 10 . 5 cm and 96 swings per a minute for a period of 48 hours at a temperature of 28 ° c . in the meantime , we prepare a millet substrate for the solid cultivation of pythium oligandrum m1 : 500 g of hulled panicum miliaceum millet is long - term freezing in the liquid nitrogen during − 150 ° c . in 200 ml distilled water are then dissolved : 50 mg znso 4 , 150 mg kh 2 po 4 , 50 mg mgso 4 and 250 mg cacl 2 . the solution is then heated to boiling point and poured on the washed millet . after boiling , the vessel holding the millet is covered and left to stand for 30 minutes . a thin layer of millet is then spread out on filter paper and left to cool and dry . thirty grams of the millet prepared in this was is then added to a 500 ml erlenmeyer flask , and sterilization proceeds in a steam autoclave at a temperature of 120 ° c . for a period of 40 minutes . sterilization is repeated after 24 hours and the millet is shaken slightly after each cycle of sterilization . we inoculate the sterilized millet with 4 ml of inoculum prepared using the procedure presented above . after inoculation , the millet is shaken thoroughly with the inoculum and finally evened - out into a uniform layer with a light tap . solid cultivation on the millet substrate is conducted in a thermal regulator at a temperature of 28 ° c . and a relative humidity of 70 % for a period of 14 days . the fermented substrate , with pythium oligandrum culture growth , is then dried at 30 ° c . in a drier for a period of 48 hours until reaching a final humidity of 5 %. the fermented substrate obtained in this way is ground using a ball mill into particles of less than 0 . 6 mm in size . the number of oospores per 1 g of preparation and viability are then determined in the preparation of technical quality prepared in this way according to the procedures presented below . around 1 g of the prepared technical preparation of pythium oligandrum is weighed precisely on analytical scales and mixed for 1 minute in a mixer in distilled water so that a concentration of exactly 2 g per liter is maintained . then around 1 ml of the suspension is transferred to a sedgewick - rafter counting chamber and the individual characteristic oospores and the oospores in clusters are counted under a microscope so that a minimum of 100 oospores is counted in total . the entire measurement is repeated three times , whereby the suspension of oospores is carefully mixed before each sample is taken to the chamber . finally , the number of oospores per 1 g of preparation is calculated using the formula n =( a · c )/( b · d · e ), where a is the number of oospores identified ; b is the volume of one square in the chamber ( 1 × 1 × 0 . 1 mm = 1 × 10 − 4 ml ); c is the volume of distilled water used to prepare the sample in ml ( 500 ml ); d is the weight of the sample in g ( 1 g ), and ; e is the number of squares in the chamber in which the identified number of oospores was actually counted . the germination ( viability ) of the technical preparation pythium oligandrum is determined by precisely weighing approximately 10 mg of the technical preparation on analytical scales , and mixing it in water with a vortex mixer at a concentration of 1 mg per ml . we prepare three subsequent tenfold dilutions using the suspension prepared in this way , and then plated 100 μl of each dilution on a mea ( melt extract agar ) medium . we take readings of germination after 8 hours and 16 hours of cultivation in a drier at 28 ° c ., and then take readings of the final number of colonies after 7 days of cultivation . the number of oospores obtained ranges from 0 . 8 to 1 . 4 × 10 6 per gram of preparation according to this invention depending on the batch used . germination ( viability ) usually ranges from 2 to 10 %. the batch used in example of implementation 1 had 1 . 0 × 10 6 oospores per g and germination of 13 . 1 %, meaning that it contained 0 . 131 × 10 6 colony forming units ( cfu ) per 1 g . the original capnocytophaga sputigena ccm3712 culture is stored at a temperature of − 70 ° c . after delivery from the collection of microorganisms . for cultivation , a small amount of the culture is first transferred to a dish with “ chocolate agar ”, containing trypticase soy agar with 0 . 1 % yeast extract and 5 % defibrinated horse blood . the dishes were cultivated in 5 % co 2 at 37 ° c . overnight . the next day , the colonies were transferred to a liquid culture containing trypticase soy substrate comprising 0 . 1 % yeast extract , 0 . 002 % equine hemine iii , 0 . 0001 % menadione and 0 . 1 % sodium bicarbonate . the culture was shaken in an atmosphere of 5 % co 2 in an orbital shaker at 200 revolutions per minute . as soon as the culture reached the middle of the logarithmic phase of 10 ° cells per ml , the bacteria were sedimented with centrifugation 10000 × g av for a period of 20 minutes and then washed three times in 0 . 1 m trisodium citrate buffer solution , ph 6 . 0 . after the final wash , the bacteria sediment was carefully separated from the remainder of the buffer solution and dried using freeze drying ( lyophilization ). one gram of lyophilized bacteria containing 10 9 cfu per one milligram of powder was obtained from one liter of the culture using this procedure . 1 . 1 . 3 preparation of the final formula of the dual preparation for use in the oral cavity . three different version of the preparation were used to prepare the final formula , differing from each other in terms of their relative content of capnocytophaga sputigena ccm3712 bacterium . these three versions were marked with the abbreviated names plaquea , plaqueb and plaquec . the preparations were prepared for pressing into effervescent tablets of a total weight of 3 g for one application and for this reason individual formulae are converted to this weight . the components of individual preparations are shown in table 1 . the pythium oligandrum component is contained in the dual microbial preparation plaquea , plaqueb and plaquec in a quantity of 0 . 6663 × 10 4 cfu per 1 g . the capnocytophaga sputigena ccm3712 component is contained in dual microbial preparation plaquea in a quantity of 0 . 333 × 10 8 cfu per 1 gram ; in the plaqueb preparation in a quantity of 0 . 333 cfu × 10 9 per 1 gram ; and in the plaquec preparation in a quantity of 3 . 333 × 10 10 cfu per 1 gram . the test of the stability of the dual microbial preparation for use in the oral cavity must ascertain whether both microbial components have acted negatively on each other during the period of storage of the prepared preparation , at the very least for the period of conducting an in vitro and in vivo effectiveness test . one tablet with the plaquea , plaqueb or plaquec preparation is dissolved in 100 ml of lukewarm water at a temperature of around 35 ° c . after it has dissolved completely , 1 ml is taken to determine the germination of pythium and 0 . 1 ml to determine the cfu of capnocytophaga . in order to determine cfu in capnocytophaga , we diluted the sample using a series of samples with tenfold serial dilution . in order to determine cfu , we use the third dilution for plaquea , for example dilution of 10 3 ×, the fourth dilution of plaqueb , for example dilution of 10 4 ×, and the fifth dilution for plaquec , for example dilution of 10 5 ×. the stability test is conducted immediately after the preparation has been made and again after 1 , 2 , 3 , 4 , 5 and 6 months . the results of a typical stability test are shown in fig2 , which depicts the dependency of the number of colonies on the months of storage . it can be concluded from the result that the emergence of pythium during six months of storage and subsequent use of the preparation firstly declined somewhat and then stabilized at a value corresponding to approximately 75 % of the originally - declared nominal value . by contrast , for capnocytophaga there were no significant changes in viability during the test period , viability remaining at the originally declared value . the result shown in fig2 relates to the preparation termed plaqueb . the results obtained with the plaquea and plaquec preparations were essentially identical and therefore are not shown in the graph ( to ensure that the graph is clearer ). it can be stated , therefore , that neither pressing the original active components into an effervescent tablet nor its activation before use of the dual microbial preparation according to this invention reduced in any significant way the viability of any component of the dual preparation for use in the oral cavity . 1 . 3 effectiveness test of prepared mixtures with the use of an in vitro test . the aim of in vitro effectiveness tests is to prove that the combination of the pythium oligandrum m1 atcc38472 oomycete and the bacterium of the green oral complex capnocytophaga sputigena ccm3712 will act synergistically , meaning that there will be an increase in certain measurable in vitro activity of the pythium oligandrum oomycete . from this perspective , a standard laboratory test was chosen of suppressing the growth of candida albicans pathogenic yeasts of three different hypha - forming strains obtained from clinical isolates at the hospital in pardubice , the czech republic , and transferred for further experiments to the institute of microbiology at the czech academy of sciences ( laboratory of dr . kola { hacek over ( r )} rík ). the actual conducting of the test consisted of the use of a standard application record that is invariably commenced by dissolving a tablet with a content of pythium alone ( the chytrá houba ® pythie ® bioplus product ) or one of the test tablets specified above , termed plaquea , plaqueb and plaquec . the tablets were dissolved in 100 ml of lukewarm water at a temperature of approximately 35 ° c . a quantity of 12 . 5 ml of this suspension was then mixed directly with 12 . 5 ml double - concentrate mixture for the preparation of cda ( czapek dox agar ) agar plates . 10 5 candida albicans pathogenic yeasts were then evenly applied to the plates prepared in this way after cooling . the results of this test are shown below in table 2 . the results show that whereas pythium oligandrum alone had a significant influence on suppressing the growth of yeasts in the experiment dishes , its combination with capnocytophaga produced a further strengthening of the effect in the case of all three pathogenic yeasts obtained from clinical isolates . after a week of cultivation at 28 ° c ., a reading was taken of the number of colonies formed in comparison with the control dish , whereby the reduction in the number of colonies in contrast to the control is a gauge of the effectiveness of pythium . the most effective preparation among the yeast strains under in vitro conditions was preparation plaqueb , with the preparations termed plaquea and plaquec achieving approximately 80 % of this effectiveness . with regard to the demanding nature of clinical trials conducted with a large quantity of dual microbial preparation according to this invention , plaqueb , as the most effective preparation , was chosen as the preparation for preclinical and clinical trials . the cosmetic preparation biomycosin , with active substance pythium oligandrum , was tested on two groups of patients , diabetic and non - diabetic , with microbially inflamed non - healing wounds at the request of the regional hospital in pardubice . the participants in the study were not randomized , but their diabetic status was monitored , which made it possible to divided data into a diabetic and a non - diabetic group at the end of the study . as far as the non - diabetic patients are concerned , their average age was 63 . 7 ± 13 . 1 years , whereby the patients were within an age range of 37 - 79 years . the total number of monitored patients was 19 , 14 women and 5 men , because the incidence of inflamed varicose ulcers is higher in women than in men . the application of biomycosin was conducted at the hospital under the supervision of medical staff . out - patients were hospitalized for the period of application of the preparation . one pack of biomycosin was used for three ( eight hours each ) wet applications , whereby the applications were made over a total of four consecutive days . samples were taken three days after the final application for microbiological examination and out - patients were discharged . regular monthly controls were then conducted in out - patients and hospitalized patients for a period of 6 months following application . the results unambiguously showed a significant reduction in the microbial burden , in particular in g - rods , anaerobic microorganisms and pathogenic yeasts . a negative correlation between a reduction in the microbial burden of g9 + cocci and an improvement in the condition of the clinical infection in non - diabetic patients was clearly proven in a correlative analysis of the results obtained for such patients . this negative correlation was particularly striking for the category of “ other staphylococci ”, of which the staphylococcus epidermidis bacterium in particular is of fundamental importance to the skin . the negative correlation ( y ) for other staphylococci was characterized by the equation y =− 0 . 56x + 85 . 8 , with a correlation coefficient of r 2 = 0 . 87 . with respect to the dependency of the course of treatment in this illness on age and sex , because women are more susceptible , patients first had to be divided into two groups and randomized depending on age and sex . the average age of the patients in the control group corresponding to the conditions of treatment with a preparation containing only p . oligandrum was 77 . 6 ± 9 . 8 years . this parameter was 78 . 0 ± 10 . 3 years in the experimental group corresponding to treatment with a dual preparation . therefore , there was no statistically significant difference between the ages of the patients in both groups . three women and 2 men were included in both groups and the percentage of women in both groups was therefore identical at 67 %: the results obtained after both methods of application are shown in fig3 . the reciprocal relationship between the quantity of removed staphylococci and the reduced improvement of clinical symptoms of infection is absolutely clear from the results obtained . a high content of maintained staphylococci during treatment with the preparation having a content of the p . oligandrum oomycete is absolutely clear for the clinically responsive patients shown in fig3 , on the left - hand side , and a significant improvement in the clinical signs of infection , mostly 20 % to 50 % of the original condition , is also clear . by contrast , the group of clinically unresponsive patients , whose results are shown on the right - hand side of fig3 , show a very distinctive reduction in the number of staphylococci identified by cultivation ( including the staphylococcus epidermidis strain ); however , progress in removing the clinical symptoms of infection was very low in these patients . based on these results , we considered and verified the hypothesis that suppressing certain g + cocci was not desirable since it affected the physiological microflora representative . we tested this working hypothesis by preparing a total of three versions of the dual microbial preparation according to this invention for use in the long - term elimination of the symptoms of clinical infection in non - healing wounds . the stability of such preparations was proven and their effectiveness was monitored using the relevant laboratory test . a detailed description of the results obtained is presented hereunder in more detail in this example . altogether , the results of this testing proved that there was no negative influence on any of the components of the dual preparation when storing the form of a dry preparation . in comparison with the one - component preparation used so far , with a pythium oligandrum base , there was a statistically significant reduction in the microbial yeast load and an improvement in the development of clinical infection when using the microbial dual preparation . 2 . the preparation , control and testing of the effectiveness of a dual microbial preparation suitable for eliminating the symptoms of clinical infection in non - healing wounds in non - diabetics . 2 . 1 protocol for the preparation of a dual microbial preparation for use on non - healing wounds in non - diabetics . 2 . 1 . 1 preparation of the technical preparation pythium oligandrum m1 atcc 38472 . the procedure used for this preparation is identical to the procedure described in section 1 . 1 . 1 . the batch used in exemplary embodiment 2 had 1 . 1 × 10 6 oospores per g and germination of 14 . 3 %, meaning that it contained 0 . 157 × 10 6 colony forming units ( cfu ) per 1 g . the original staphylococcus epidermidis ccm2124 culture is stored at a temperature of − 70 ° c . after delivery from the collection of microorganisms . for cultivation , a small amount of the culture is first transferred to a dish with the tryptone soya agar cm131 oxoid . the dishes were cultivated at a temperature of 37 ° c . overnight . ten well - separated colonies were transferred to a 2 liter erlenmeyer flask containing 500 ml of medium comprising 30 g per liter peptone , 10 g per liter yeast autolysate , 5 g / l nacl , 0 . 1 g cacl 2 . 2h 2 o and 1 ml trybutyrin ; the ph of the medium was regulated at 8 . 0 . the bacteria were cultivated to the middle of the logarithmic phase , sedimented with centrifugation 10000 × g av for a period of 20 minutes and then washed three times in 0 . 1 m trisodium citrate buffer solution , ph 6 . 0 . after the final wash , the bacteria sediment was carefully separated from the remainder of the buffer solution and dried using freeze drying ( lyophilization ). approximately 0 . 6 g of lyophilized bacteria containing 10 8 cfu per one milligram of powder was obtained from one liter of the culture . 2 . 1 . 3 preparation of the final formula of a dual microbial preparation for use on non - healing wounds in non - diabetics . three different versions of the preparation were used in order to prepare the final formula , differing in terms of their relative content of the staphylococcus epidermidis ccm2124 bacterium ; these three versions were designated using the abbreviated working titles of nonheala , nonhealb and nonhealc . the preparations were prepared for use in one package containing 10 g of loose preparation for one application . the components of the individual preparations are presented below in table 3 on the next page . the pythium oligandrum component is contained in the dual microbial preparation nonheala and nonhealb in a quantity of 7 . 85 × 10 3 cfu per 1 g and in nonhealc in a quantity of 7 . 85 × 10 3 cfu per 1 g . the staphylococcus epidermidis ccm2124 component is contained in the dual microbial preparation nonheala in a quantity of 1 × 10 6 cfu per 1 g ; in the nonhealb preparation in a quantity of 1 × 10 t cfu per 1 g ; and in the nonhealc preparation in a quantity of 1 × 10 8 cfu per 1 g . 2 . 2 stability test of dual microbial preparation for use on non - healing wounds in non - diabetics . the test of the stability of the dual microbial preparation for use on non - healing wounds must ascertain whether both microbial components have acted negatively on each other during the period of storage of the prepared preparation , at the very least for the period of conducting in vitro and in vivo effectiveness tests . one package , 10 g of the nonheala , nonhealb or nonhealc preparation , is re - suspended in 250 ml of lukewarm physiological solution 9 g / l nacl at a temperature of around 35 ° c . after complete resuspension , 1 ml is taken to determine the germination of pythium and 0 . 1 ml to determine cfu of staphylococcus . in order to determine cfu for staphylococcus , we further dilute the sample using tenfold serial dilutions , and to determine cfu we use 1 × dilution for nonheala , for example dilution of 10 ×, 2 × dilution for nonhealb , for example dilution of 10 2 ×, and 3 × dilution for nonhealc , for example dilution of 10 3 ×. the stability test is conducted immediately after the preparation has been made and again after 1 , 2 , 3 , 4 , 5 and 6 months . the results of a typical stability test are shown in fig4 . it can be concluded from the result that the viability of pythium during six months of storage and subsequent use of the preparation firstly declined somewhat and then stabilized at a value corresponding to approximately 75 % of the originally - declared nominal value . by contrast , for staphylococcus there were no significant changes in viability during the test period , viability remaining et almost the originally declared value . the result shown in fig4 relates to the preparation termed nonhealb . the results obtained with the nonheala and nonhealc preparations were very similar and therefore are not shown in the graph ( to ensure that the graph is clearer ). it can therefore be stated that the viability of any of the components of the dual microbial preparation for use on non - healing wounds was not reduced by drying the original active components and storing them in the presence of silica gel without activation before the use of the preparation according to this invention . 2 . 3 effectiveness test of prepared mixtures of dual microbial preparation using an in vitro test . the aim of in vitro effectiveness tests is to prove that the combination of the pythium oligandrum m1 atcc38472 oomycete and the bacterium of the normal skin microbiome staphylococcus epidermidis ccm2124 will act synergically , meaning that there will be an increase in certain measurable in vitro activity of the pythium oligandrum oomycete . from this perspective , a standard laboratory test was chosen of suppressing the growth of candida albicans pathogenic yeasts of three different hypha - forming strains obtained from clinical isolates at the hospital in pardubice , the czech republic , and transferred for further experiments to the institute of microbiology at the czech academy of sciences . the actual conducting of the test consisted of the use of a standard application protocol , which was invariably commenced by re - suspending a dry preparation containing only pythium ( the biomycosin preparation ) or one of the above - mentioned test preparations designated as nonheal a , b or c . preparations were re - suspended in 250 ml of lukewarm physiological solution at a temperature of around 35 ° c . a quantity of 12 . 5 ml of this suspension was then mixed directly with 12 . 5 ml double - concentrate mixture for the preparation of cda ( czapek dox agar ) agar plates . 10 5 candida albicans pathogenic yeasts obtained from clinical isolates was then evenly applied to the plates prepared in this way after cooling . after a week of cultivation at 28 ° c ., a reading was taken of the number of colonies in comparison with the control dish , whereby the reduction in the number of colonies in contrast to the control is a gauge of the effectiveness of pythium . the results of this test are shown below in table 4 . the results show that whereas pythium alone had a significant influence on suppressing the growth of yeasts in the experiment dishes , its combination with staphylococcus produced a further strengthening of the effect . the most effective preparation among the three pathogenic yeast strains under in vitro conditions was preparation nonhealb , with the preparations termed nonheala and nonhealc achieving approximately 50 % of this effectiveness . with regard to the demanding nature of clinical trials conducted with a large quantity of dual microbial preparation according to this invention , the most effective preparation , nonhealb , was proposed as the starting preparation for preclinical and clinical trials . the example shown is not limited to the use of the dual microbial preparation specified in this exemplary embodiment for non - healing wounds on skin . there are naturally other possible uses not specified here ; for example use in different cases of opportunistic microbial infections accompanied by dysbiosis on the skin , such as atopic eczema and psoriasis . convincing evidence was taken from clinical observations in the area of care for oral cavity health , non - healing wounds and suppressing yeasts in vaginal candidiasis that pythium oligandrum suppresses and kills pathogenic yeasts of the candida and malassezia strains . this conclusion was then independently confirmed by a laboratory cultivation test at the institute of microbiology of the czech academy of sciences in prague . a total of 4 clinical strains of the pathogenic yeast candida albicans , isolated at pardubice hospital , were tested in a laboratory competition test , in that this ascertained their ability to pass to hyphal growth , which acts as evidence of the clinical aggression of these strains . the strains involved were candida albicans 2508 , 2548 , 2558 and 2944 . pythium oligandrum fully outgrew all four tested strains in the competition test in the case of using mea ( malt extract agar ) as the medium and pda ( potato dextrose agar ) as the medium . after 10 days of the experiment , meaning once the experiment had come to an end , the remains of the yeast strains overgrown with pythium were transferred to a medium of cda ( czapek - dox agar ). yeasts grow in this medium , but not pythium oligandrum . nonetheless , there was no growth of yeasts in this test medium , which shows that pythium oligandrum not only overgrew the pathogenic yeast cells , but killed them . therefore , following on from the results of these laboratory test results , systematic studies were conducted in cooperation with doctors at gynecological surgeries in prague , rychnov nad kn { hacek over ( e )}{ hacek over ( z )} nou , vysoké mýto , klá { hacek over ( s )} terec nad oh { hacek over ( r )} í , pilsen and uhlísk6 janovice comparing the effects of the chemical antimycotic clotrimazol and the feelfresh preparation among women with recurring incidence of vaginal candidiasis . a clinical evaluation of the women was conducted by a doctor at the beginning of testing on a six - point scale that considered discomfort , the presence of vaginal discharge , irritation , pain , burning and reddening . an initial microbiological examination was conducted to identify the presence of pathogenic yeasts of the candida strain and of lactobacilli , which are the dominant microorganisms in the normal vaginal microbiome . application was made for a period of 5 consecutive days , either clotrimazol being applied or a hip bath with the feelfresh preparation being used . a microbiological control was then conducted after 10 days and 1 month . a final clinical study and a microbiological control were then carried out three months following application . the intensity of clinical symptoms in the control group with the clotrimazol application and in the experimental groups with the feelfresh application was comparable at the beginning of the study . after 3 months , however , the results of assessing clinical symptoms ( the number of clinical symptoms identified ) were statistically better for the group applying feelfresh in comparison with the chemical antimycotic clotrimazol : 2 . 57 ± 0 . 53 and 1 . 00 ± 1 . 52 , p = 0 . 035 . it was possible to monitor the intensity of yeast infection by way of cultivation after 10 days , 1 month and 3 months , meaning more frequently than the clinical picture . the results were also very interesting in this regard since they showed a rapid and statistically significant reduction in the incidence of pathogenic yeasts for clotrimazol after 10 days , when the initial values in arbitrary units were 3 . 71 ± 0 . 75 and 3 . 71 ± 0 . 48 for the application with clotrimazol and feelfresh . after 10 days , however , the corresponding values in arbitrary units were 1 . 28 ± 0 . 48 and 1 . 85 ± 0 . 38 , p = 0 . 04 . nonetheless , after 1 month , or even 3 months , the situation had reversed completely and the reduced level of pathogenic yeasts was stabilized only among patients using feelfresh , when the values after 1 month for control and application in arbitrary units of feelfresh were 2 . 42 ± 0 . 53 and 1 . 28 ± 0 . 48 , p = 0 . 008 . the values in arbitrary units after 3 months were 3 . 14 ± 0 . 69 and 1 . 42 ± 0 . 78 , p = 0 . 007 . the positive correlation between improvement in clinical condition and the concentration of lactobacilli on the one hand and between the elimination of yeast infection and the concentration of lactobacilli on the other was also very interesting . these results clearly show , as with the previous examples presented , that the curative effect of the pythium oligandrum microorganism contained in the feelfresh preparation is significantly potentiated by the presence of healthy microflora , in this case lactobacilli . a working hypothesis could be drawn from these results that the presence of lactobacilli significantly increases the effectiveness of suppressing yeasts through the pythium oligandrum oomycete . a study to prove the role of lactobacilli proceeded using the double - blind method , in which envelopes with the preparations were prepared and numbered by an administration worker not actually involved in the course of the study . after confirming the clinical diagnosis in the first microbiology sample , the patients signed informed consent and were instructed how to apply the preparations . the application was made in the form of a rinse over five consecutive days using a provided vaginal applicator . a gynecologist undertook a professional examination at the beginning of the study and again after 3 months , in that the level of yeast infection and the level of colonization of the vaginal membrane with lactobacilli were invariably checked . the results of the clinical study are clearly presented in graphic format in fig5 a , 5b and 5c . from the perspective of clinical evaluation at the beginning and at the end of the study , the control group , applying the classic preparation containing only pythium oligandrum , is variable : there was effective elimination of symptoms among certain women , but not in other patients , as is clear from fig5 a . for this reason patients were divided into two groups of clinically responsive patients on the left - hand side of fig5 and clinically unresponsive patients on the right - hand side of the figure . there was a significant reduction in the incidence of the candida albicans yeast among clinically responsive patients after three months in all cases , whereas there was no such reduction among unresponsive patients ( one patient actually experienced an increase — fig5 b ). nonetheless , it is still interesting that the incidence of lactobacilli was far higher among responsive patients in all cases , increasing to physiologically high values during the study ( fig5 c ), whereas the incidence of yeast was considerably lower among unresponsive patients , accompanied in two cases by further reduction . these results confirm that the dual microbial preparation for use in suppressing and eliminating pathogenic yeasts shows statistically significantly better results in comparison with a standard preparation in all parameters . we therefore verified and tested this hypothesis : a total of three versions of the dual microbial preparation according to this invention were prepared for use for vaginal candidiasis , cavity and the stability of such preparations was proven , clinical tests also being carried out in patients with such a diagnosis . a detailed description of the results obtained is presented in example 3 for this invention below . the aggregate results of this testing showed that the effective microbiological components had no negative influence on each other during drying and storage under dry conditions . the results of laboratory tests show the greatest effectiveness in the dual preparation vaginalb . 3 . preparation , control and testing of the effectiveness of the dual microbial preparation according to this invention for application on skin and membrane which is susceptible to the incidence of pathogenic yeasts . 3 . 1 protocol for the preparation of the dual microbial preparation for application on skin and membrane which is susceptible to the incidence of yeasts . 3 . 1 . 1 preparation of the technical preparation pythium oligandrum m1 atcc 38472 . the procedure used for this preparation is identical to the procedure described in section 1 . 1 . 1 . the batch used in exemplary embodiment 3 had 0 . 8 × 10 6 oospores per g and germination of 12 . 8 %, meaning that it contained 0 . 102 × 10 6 colony forming units ( cfu ) per 1 g of preparation . the original lactobacillus crispatus ccm7010 culture is stored at a temperature of − 70 ° c . after delivery from the collection of microorganisms . for cultivation , a small amount of the culture is first transferred to an agar dish with medium for the cultivation of lactobacilli , containing 5 g per liter yeast autolysate , 10 g per liter bovine extract , 10 g per liter peptone , 20 g per liter glucose , 5 ml per liter tween 80 , 2 g per liter k 2 hpo 4 , 5 g per liter sodium acetate , 2 g per liter diamonium citrate , 0 . 2 g per liter mgso4 . 7h 2 o and 0 . 05 g per liter mnso 4 . 7h 2 o . we regulate the ph after adding all components at a value of ph 6 . 2 - 6 . 6 . the dishes were cultivated at a temperature of 37 ° c . overnight . ten well - separated colonies were transferred to a 2 - liter erlenmeyer flask containing 500 ml of medium 6 , having the components specified above . the bacteria were cultivated to the middle of the logarithmic phase , sedimented with centrifugation 10000 × g , for a period of 20 minutes and then washed three times in 0 . 1 m trisodium citrate buffer solution , ph 6 . 0 . after the final wash , the bacteria sediment was carefully separated from the remainder of the buffer solution and dried using freeze drying ( lyophilization ). approximately 0 . 8 g of lyophilized bacteria containing 10 9 cfu per one mg of powder was obtained from one liter of the culture . 3 . 1 . 3 preparation of the final formula of the dual microbial preparation for application on skin and membrane which is susceptible to the incidence of yeasts . three different versions of the preparation were used in order to prepare the final formulation , differing in terms of their relative content of the lactobacillus crispatus ccm7010 bacterium ; these three versions were designated using the abbreviated titles of vaginala , vaginalb and vaginalc . the preparations were prepared for use in one package containing 2 g of loose preparation for one application . the components of the individual preparations are presented below in table 5 on the next page . the active components in the preparation are pythium and lactobacillus . silica gel is added as a drying agent in order to preserve the original properties and the emergence of both active components . a small amount of added sodium chloride aids better activation of the biological agent , chamomile aroma acts as perfume . the pythium oligandrum component is contained in the dual microbial preparation vaginala and vaginal b in a quantity of 19 . 2 × 10 3 cfu per 1 g and in vaginalc in a quantity of 19 . 2 × 10 3 cfu per 1 g . the lactobacillus crispatus ccm7010 component is contained in the dual microbial preparation vaginala in a quantity of 0 . 5 × 10 8 cfu , in the vaginalb preparation in a quantity of 0 . 5 × 10 9 cfu per 1 g and in the vaginalc preparation in a quantity of 0 . 5 × 10 10 cfu per 1 g . 3 . 2 stability test of dual preparation for use on skin and membrane which is susceptible to the incidence of yeasts . the test of the stability of the dual microbial preparation for use on skin and membrane which is susceptible to the incidence of yeasts must ascertain whether both microbial components have acted negatively on each other during the period of storage of the prepared preparation , at the very least for the period of conducting in vitro and in vivo effectiveness tests . one pack of 2 g of the vaginala , vaginalb or vaginalc preparation is re - suspended in 500 ml of lukewarm water at a temperature of around 35 ° c . after complete resuspension , 1 ml is taken to determine the germination of pythium oligandrum and 0 . 1 ml to determine the cfu of lactobacillus units . in order to determine cfu for lactobacillus , we further dilute the sample using tenfold serial dilutions , and to determine cfu we use 1 × dilution for vaginala — dilution of 100 ×- 2 × dilution for vaginalb — dilution of 10 ×- and 3 × dilution for vaginalc — dilution of 10 4 ×. the stability test is conducted immediately after the preparation has been mixed and again after 1 , 2 , 3 , 4 , 5 and 6 months . the results of a typical stability test are shown in fig6 . it can be concluded from the result that the viability of pythium during six months of storage and subsequent use of the preparation firstly declined somewhat and then stabilized at a value corresponding to approximately 80 % of the originally - declared nominal value . by contrast , there was only a slight reduction in viability of around 10 % for lactobacillus during the test period . the result shown in fig6 relates to the preparation termed vaginalb . the results obtained with the vaginala and vaginalc preparations were very similar and therefore are not shown in the graph ( to ensure that the graph is clearer ). it can therefore be stated that the emergence of any of the components of the dual microbial preparation for use in the oral cavity was not significantly reduced by drying the original active components and storing them in the presence of silica gel or its activation before the use of the preparation according to this invention . 3 . 3 . effectiveness test of prepared mixtures with the use of an in vitro test . the aim of in vitro effectiveness tests is to prove that the combination of the pythium oligandrum m1 atcc38472 and healthy bacterium of the normal vaginal microbiome lactobacillus crispatus ccm7010 will act synergically , meaning that there will be an increase in certain measurable in vitro activity of the pythium oligandrum oomycete . from this perspective , a standard laboratory test was chosen of suppressing the growth of candida albicans pathogenic yeasts of three different hypha - forming strains obtained from clinical isolates at the hospital in pardubice , the czech republic , and transferred for further experiments to the institute of microbiology at the czech academy of sciences ( laboratory of dr . kola { hacek over ( r )} ik ). the actual conducting of the test consisted of the use of a standard application protocol , which was invariably commenced by re - suspending a dry preparation containing only pythium oligandrum ( the feelfresh preparation ) or one of the above - mentioned test preparations designated as vaginala , vaginalb or vaginalc . preparations were re - suspended in 500 ml of lukewarm water of a temperature of around 35 ° c . and 12 . 5 ml of this suspension was then mixed directly with 12 . 5 ml of double - concentrate mixture , cooled to a temperature of 45 ° c ., for the preparation of cda ( czapek dox agar ) agar plates . 10 5 candida albicans pathogenic yeasts obtained from clinical isolates were then evenly applied to the plates prepared in this way after cooling . after a week of cultivation at 28 ° c ., a reading was taken of the number of grown colonies in comparison with the control dish , whereby the reduction in the number of colonies in contrast to the control is a gauge of the effectiveness of pythium oligandrum . the results of this test are shown below in table 6 . the results show that whereas pythium oligandrum alone had a significant influence on suppressing the growth of yeasts in the experiment dishes , its combination with lactobacillus produced a further strengthening of the effect . the most effective preparation among the three pathogenic yeast strains under in vitro conditions was the vaginalb preparation , with the preparations termed vaginala and vaginalc achieving approximately 50 % of this effectiveness . with regard to the demanding nature of clinical trials conducted with a large quantity of preparation , vaginalb , as the most effective dual microbial preparation , was chosen for preclinical and clinical trials . the significant positive correlation between the presence of yeasts and improvement in the clinical condition of infection in non - healing wounds was seen in the same way for diabetic and non - diabetic patients . the relevant correlation coefficients were 0 . 4 and 1 . 0 . this correlation led to consideration of whether the presence of yeasts or their components might cause activation of the pythium oligandrum microorganism . with respect to the fact that biological tests concurrently containing three different microorganisms are very complicated from the perspective of their execution and evaluation , alternatives were chosen including dead saccharomyces cerevisiae baker &# 39 ; s yeasts in the form of so - called yeast autolysate , which is commonly commercially available . a standard plate test on an agar mea was used . its components were as follows : 20 g per liter malt extract , 20 g per liter glucose , 1 g per liter peptone and 20 g per liter agar . interaction was monitored of the pythium oligandrum oomycete and the dermatophytes trichophyton interdigitale dmf2477 and microsporum fulvum p245 , for which previously tests were conducted to show that they suppress the growth of these dermatophytes to around 50 % uninhibited growth . however , pythium was activated after adding yeast extract in a concentrate of 1 g per liter to the agar carrier and there was an increase in growth inhibition to 75 % for trichophyton and 80 % for microsporum . therefore , this result also showed how the result of the biological abilities of pythium to suppress certain dermatophytes is dependent on its physiological state , in that its biological ability could be significantly enhanced by the presence of even inactivated target organisms or another form of their processed components and extracts , in this case commercial yeast autolysate . a working hypothesis could be drawn from these results that even inactivated yeasts have an influence on increasing the effectiveness of the pythium oligandrum oomycete . the optimum dual preparation to eliminate the agents of mycosis ( dermaphytosis ) was tested in patients with mycotic diseases of the feet incorporating dermatophytic infection on the soles , between the toes and under the nails — onychomycosis . the curative effect was clinically evaluated by dermatologists and microbiological tests were also carried out at the beginning and the end of the period under consideration . patients were randomized into two groups . in the first group , treatment was provided with a one - component preparation with pythium oligandrum oomycete content and in the second group a combined preparation with yeast autolysate content was administered . the results showed good clinical effectiveness for the preparation containing only pythium oligandrum , but the clinical effectiveness for the dual microbial preparation was even better ( control 3 . 0 ± 0 , experiment 3 . 6 t 0 . 5 , t - test , p = 0 . 01 ). the improvement in microbiology according to fig9 c was similar ( control 2 . 0 ± 0 , experiment 2 . 6 ± 0 . 5 , t - test , p = 0 . 01 ). these results confirm that the dual microbial preparation according to the invention for use on mycosis of the feet shows statistically significantly better results in comparison with the standard one - component preparation . a total of 25 cavia porcellus guinea pigs underwent a study to monitor the effects of a one - component preparation containing the pythium oligandrum oomycete . the effect of the preparation was evaluated by veterinarians and confirmed by taking microbiological samples at the beginning and at the end of the period under consideration , whereby all specimens were negative for the presence of dermatophytic funguses and yeasts at the end of the experiment . the overall score of the clinical evaluation of the effects of the preparation was 1 . 72 ± 0 . 87 , p & lt ; 0 . 05 , in that 1 = excellent effect and 4 = no effect . the zoonotic characteristic of dermatophytic infections which scientists frequently describe guarantees us that the mechanism of these infections in animals is identical to mycotic infections in humans . with respect to the demanding nature of clinical tests and the fact that the results obtained in evaluating the effectiveness of the one - component preparation corresponded to them in a comparison of tested human and animal groups , section 4 . 3 may be referred to for further verification of the effectiveness of the dual preparation . both series of the experiments carried out above showed the potentiating influence of yeasts or products of their metabolism on the effectiveness of preparations containing pythium oligandrum in eliminating the agents of dermatophytosis . this potentiating effect could be caused by the activation by live yeasts or the activation of their metabolites without the immediate requirement of the incidence of live yeasts . the final option showed itself to be more likely in systematic research and the hypothesis was therefore put forward that pythium oligandrum is stimulated in its abilities to eliminate dermatophytes by certain components relating to the yeast metabolism . this working hypothesis was therefore tested : a total of three versions of the dual microbial preparation according to this invention were prepared for use on mycosis of the feet and the stability of such preparations was proven , clinical tests also being carried out on patients having this disease . a detailed description of the results obtained is presented in example 4 for this invention . altogether , the results of this testing showed that , in comparison with the live version of dual microbial preparations , a relatively large quantity of the inactivated , dead partner microorganism or its components must be added , the addition of up to around 10 weight percent proving effective in the case of the yeast autolysate tested . there really was a statistically significant increase in effectiveness in the preparation prepared in this way against the classic one - component preparation . this increase was equivalent to the increase observed in the case that the yeast infection appeared endogenously as a result of naturally - occurring co - infection , which occurs in approximately 20 % of cases . 4 . the preparation , control and testing of the effectiveness of the dual microbial preparation according to this invention as suitable for application in the case of mycosis of the feet , including onychomycosis in people and dermatophytes in animals . 4 . 1 protocol for the preparation of a dual preparation for use on mycosis in humans and animals . 4 . 1 . 1 preparation of the technical preparation pythium oligandrum m1 atcc 38472 . the procedure used for this preparation is identical to the procedure described in section 1 . 1 . 1 . the batch used in exemplary embodiment 4 had 1 . 3 × 10 6 oospores per g and germination of 14 . 5 %, meaning that it contained 0 . 189 × 10 6 colony forming units ( cfu ) per 1 g of preparation . 4 . 1 . 2 yeast autolysate , the second component in the preparation , was bought from oxoid . 4 . 1 . 3 preparation of the final formula of the dual preparation for application on mycosis . three different version of the preparation were used to prepare the final formula , differing from each other in terms of their relative content of yeast autolysate . these three versions were given the abbreviated names of mycosina , mycosinb and mycosinc . the preparations were prepared for pressing into effervescent tablets of a total weight of 3 g and for this reason individual formulae are converted to this weight . the components of individual preparations are shown below in table 7 . the pythium oligandrum component is contained in the dual microbial preparation mycosina , mycosinb and mycosinc in a quantity of 12 . 6 × 10 3 cfu per 1 g . the content of yeast autotysate is contained in the mycosina dual microbial preparation in a quantity of 50 mg per 3 g tablet , meaning a quantity of 1 . 66 % weight for one tablet ; in the mycosinb preparation in a quantity of 100 mg per 3 g tablet , meaning a quantity of 3 . 33 % for one tablet ; and in the mycosinc preparation in a quantity of 150 mg per 3 g tablet , meaning a 5 % weight for one 3 g tablet . a stability test was not conducted for the preparation in question since it is well - known from literary sources that the presence of yeast autolysate in a dried preparation does not influence the properties of the pythium oligandrum oomycete . 4 . 3 effectiveness test of prepared mixtures with the use of an in vitro test . the aim of in vitro effectiveness tests is to prove that the combination of pythium oligandrum m1 atcc38472 oomycete and inactivated yeast components contained in yeast autolysate acts synergically , meaning that there is an increase in certain measurable in vitro activity of the pythium oligandrum oomycete . from this perspective , a standard laboratory test was chosen of suppressing the growth of four types of dermatophytes , for which it is proven that they are known agents of mycotic diseases of a zoonotic character . specifically , the tests were conducted with the use of four common dermatophytes , two different strains of each being used : trichophyton interdigitale ( ti ), trichophyton erinacei ( te ), microsporum fulvum ( mf ) and microsporum canis ( mc ). the results of determining the activities of individual preparations are presented in fig7 , in that the number of formed colonies of dermatophytes is related to the control without an active substance . the results shown in fig7 concern the mycosinb preparation , the results obtained with the mycosina and mycosinc preparations being qualitatively similar , but with resultant ability to suppress dermatophytes of only around 30 % of the increase on the control . the result in fig7 clearly shows that a simple preparation containing only pythium oligandrum as an active substance has the ability to suppress dermatophytes , suppression at a level of 50 - 60 % of the control growth being achieved . yeast autolysate itself had no ability to suppress the growth of dermatophytes in the test used , the results being at roughly the same level as the control experiment . a statistically significant increase in effectiveness was shown for the dual preparation at a level of approximately 10 % of infections in control samples . with regard to the demanding nature of clinical trials conducted with a large quantity of preparations according to this invention , the most effective preparation , mycosinb , was proposed as the starting preparation for preclinical and clinical trials . the activation of the other unique abilities of the microscopic oomycete pythium oligandrum by the components of healthy microflora is also worth noting . the unique ability of our technical substance , pythium oligandrum , to disrupt the biofilms formed by pathogenic bacteria populating non - healing wounds was proven in our previous studies . the results of the study were presented at the 12 th international “ interdisciplinary collaboration in the treatment of wounds and skin defects ” congress held on 23 and 24 january at the faculty of health studies at the university of pardubice . the measurements conducted showed that 129 of the 160 tested bacterial strains clinically isolated from non - healing wounds created biofilm . a 70 % reduction in the creation of biofilm was also proven in biofilm - positive strains after the addition of germs of the pythium oligandrum oomycete using the biomycosin preparation , in that the reduction of biofilm was very significant in 43 % of the tested strains , there occurring a reduction in the activity of biofilm creation of more than 50 %. no change in the intensity of creation of biofilm was recorded in 17 % of the strains examined in vitro , while no reproducible results were obtained in the remaining 13 % of the monitored strains . it was possible to influence the production of biofilms at least in vitro in the case of the observed stenotrophomonas maltophilia and pseudomonas aeruginosa strains . if , however , bacteria of the normal skin microbiome staphylococcus epidermidis were added to the incubation mixture in addition to germs of the oomycete , there was a reduction in the creation of biofilms of more than 50 % even in the two awkward strains already mentioned . this interesting phenomenon , together with the knowledge already published [ 32 ], shows that in addition to their metabolic regulatory functions , the components of the normal physiological microbiome might also play a part in reducing the intensity of biofilm created with the participation of pathogenic microorganisms . the aim of in vitro effectiveness tests is to prove that the combination of the pythium oligandrum m1 atcc38472 oomycete and the healthy bacterium of the normal skin microbiome will act synergically , meaning that there will be an increase in certain measurable in vitro activity of the pythium oligandrum oomycete . another extremely important factor which must be verified is the specificity of such action . components of the physiological microbiome were often applied in the previous experiments in probiotic preparations , without of course maintaining topological specificity . the effectiveness of preparations provided in this way was mostly very low , which correlates well with the differing microbial composition of physiological microbiomes in topologically different locations of the human body with different levels of exposure to the outside environment and different metabolic niches . a simple laboratory test of the creation of biofilms was therefore used to verify this hypothesis , as is described in this exemplary embodiment . the creation of biofilm was measured based on the absorption of blue microbial dye , depicting the intensity of the creation of biofilm , whereby each experiment was conducted three times independently in triplicate [ 38 ]. this viability was measured using a test of vital staining according to literature [ 39 ] in order to prove the influence of the viability of the microorganisms in biofilms . the results of these determinations , conducted with preparations containing only the microscopic oomycete p . oligandrum according to invention cz 302 297 b on the one hand and with the optimized dual microbial preparations described in exemplary embodiments 1 , 2 and 3 according to the invention submitted on the other , unambiguously showed that the optimum disruption of biofilms always occurred only in the case of dual preparations comprising the physiological microbial component contained in the microbiome of the relevant topology . biofilms of the oral cavity , therefore , were most effectively disrupted by a dual microbial preparation containing the dominant physiological microbe for this location , whereas the effect of other physiological components was minor . similar evidence of specificity was also shown in the case of the skin and vaginal microbiome . the results obtained in this way are very important because they show that there is no universal probiotic or dual microbial preparation which is suitable for long - term suppression of the symptoms of opportunistic microbial infections — only a preparation having a content of topologically relevant microbial components is invariably effective . in this test , simple laboratory tests were conducted on the creation and viability of biofilms using two oral cavity bacteria , streptococcus gordonii and fusobacterium nucleatum , as the monitored components . both these bacteria have a key role in the creation of microbial biofilms of the oral cavity : streptococcus is the only bacterium capable of directly catching on tooth enamel in the aggressive environment of the oral cavity , whereas the large ( in terms of dimensions ) bacterium of the fusobacterium genus creates important retaining centers for the colonization of bacteria of the orange and red complex in invasive pathogens of type aggregatibacter actinomycetemcommitans . the results of the laboratory test are shown in table 8 ( above ). the results clearly show that whereas the influence on biofilm was lesser for a simple preparation containing only the p . oligandrum oomycete , only the use of the plaqueb dual preparation led to very marked disruption and restriction of the viability of the oral biofilm . the somewhat more significant disruption of biofilm caused by the feelfresh preparation and vaginalb can be ascribed to the higher percentage content of pythium in this preparation . 5 . 2 the influence of dual microbial preparations on the disruption of biofilms containing bacteria in non - healing wounds in this test , simple laboratory tests were conducted on the creation and viability of biofilms using two bacteria creating biofilms in non - healing wounds , stenotrophomonas maltophilia and pseudomonas aeruginosa , as the monitored components . these bacteria were used for the reason that in previous tests conducted by dr . karel mencl at the department of clinical microbiology at pardubice hospital , these two strains were resistant to the disruption of biofilm using simple preparations having only the pythium oligandrum oomycete . the results shown in table 9 obviously clearly show that a dual microbial preparation intended for improving clinical infection in non - healing wounds and containing the normal skin microbiome component staphylococcus epidermidis was able to effectively overcome this shortcoming and ensure effective disruption of biofilm in these resistant types . a certain lesser influence was also recorded for the vaginalb preparation containing lactobacilli , for which such activity has been described [ 33 ]. in this test , simple laboratory tests were conducted on the creation and viability of biofilms using the candida albicans yeast as the monitored component . more effective disruption of this biofilm occurred with the use of the dual microbial preparation vaginalb , as is evident from the results shown in table 10 above . this knowledge could be of general significance , because the pathogenic yeast candida albicans frequently creates combined . in this experiment were used the simple laboratory tests and viability of the biofilm using as monitored component candida albicans . the most effective ruption of the biofilm occurred by using the dual microbial preparation vaginalb , as is evident from the results in table 10 the above . these knowledges may have a general significance , because the pathogenic yeast candida albicans often creates the combined microbial biofilms in combination with certain types of pathogenic bacteria . a major asset of the dual microbial preparations according to the submitted invention is the opportunity to use them for prevention , for which values of active components which are up to ten times lower can be used based on the possibility of effective colonization and long - term propagation at the point of application . the effective mycoparasitism of the p . oligandrum oomycete and the anti - fungal action of certain other microbial strains may obviously also be used to protect the living and working environment from molds . it is well described in medical literature that the molds occurring in the living and working environment can shoot harmful spores into their surroundings . if their average concentration in the air exceeds a value of 500 viable spores per 1 m 3 , harmful effects leading to allergies , respiratory illnesses and even depression could be manifested in full according to the standards set by the world health organization ( who ). the anti - mold product biorepel , containing p . oligandrum and used mainly to eliminate mold from walls , ceilings , floors and other areas of contaminated rooms , was developed and is successfully used based on invention cz 302 297 . other microbial preparations that are capable of eliminating mold based on the principle of antibiosis and that primarily use for such purposes the abundantly widespread bacillus amyloliquefaciens bacillus is also used for this purpose . the effectiveness of a dual preparation in eliminating molds and yeasts from the living environment based on a combination of the two above - mentioned microorganisms is tested in field experiments under the conditions of their actual use . the experimental object is , for example , a wall in a damp room with even incidence of the black mold aspergillus niger , in that we measure the concentration of spores in the rooms before application and 6 months after application and quantitatively evaluate the presence of mold directly in smears of material taken from walls in a standard way . for application , 3 g of the preparation is divided into two bags , bag a containing 1 g of the preparation and bag b containing 2 g of the preparation . bag a is re - suspended in 10 liters of lukewarm water and the whole of the affected area is rubbed with a sponge soaked in this preparation . after a gentle drying , the same area is rubbed with a sponge soaked in solution b , which is prepared by re - suspending bag b in 1 . 5 liters of lukewarm water . samples to ascertain effectiveness are taken after 1 month , 3 months and 6 months , at which time the field experiment is ended . a preparation is considered effective in the case in which the number of spores in the fall is reduced to less than 500 ( who standard ) and the presence of mold ascertained using a cultivation test is reduced to level 1 ( present sporadically only after cultivation ). the specific result of field experiments at two different locations is depicted in fig8 . it is clear that the required reduction in the concentration of spores in the atmosphere was reduced to a value of less than 500 in both locations observed only when using the dual preparation , even though both its components showed certain reduction against the control ( fig8 a ). similarly , only the dual preparation reduced the actual incidence of mold on the wall , proven by a smear test , to the target value of around 1 . 0 . in this case too , the effect of individual preparations was only partial and the target values were not achieved ( fig8 b ). these results confirm the hypothesis that the dual microbial preparation for the elimination of mold and yeasts from the living environment shows better results than a standard preparation . we further tested and verified this hypothesis . as part of this verification , we prepared , according to the procedures described in this exemplary embodiment , three different versions of the combined preparation and verified their effectiveness on the target mold under in vitro conditions . 6 . the preparation , control and testing of the effectiveness of a dual microbial preparation suitable for the elimination of mold and yeasts from the living environment . 6 . 1 protocol for the preparation of a dual microbial preparation for use in the elimination of mold and yeasts from the living environment 6 . 1 . 1 . preparation of the technical preparation pythium oligandrum m1 atcc 38472 . the procedure used for this preparation is identical to the procedure described in section 1 . 1 . 1 . the batch used in exemplary embodiment 6 had 1 . 0 × 10 6 oospores per g and germination of 12 . 6 %, meaning that it contained 0 . 126 × 10 6 colony forming units ( cfu ) per 1 g of preparation . the original bacillus amyloliquefaciens ccm1084 culture is stored at a temperature of − 70 ° c . after delivery from the collection of microorganisms . for cultivation , a small amount of the culture is first transferred to a dish with agar and medium 10 for the cultivation of bacilli comprising peptone , 5 g per liter , bovine extract , 3 g per liter , and mnso 4 . h 2 o , 0 . 01 g per liter ; the ph of the medium was regulated at 7 . 0 . the dishes were cultivated at a temperature of 37 ° c . overnight . ten well - separated colonies were transferred to a 2 - liter erlenmeyer flask containing 500 ml of medium 10 , having the components specified above . the bacteria were cultivated to the middle of the logarithmic phase , sedimented with centrifugation 10000 × g , for a period of 20 minutes and then washed three times in 0 . 1 m trisodium citrate buffer solution , ph 6 . 0 . after the final wash , the bacteria sediment was carefully separated from the remainder of the buffer solution and dried using freeze drying ( lyophilization ). approximately 0 . 6 g of lyophilized bacteria containing 10 8 cfu per one gram of powder was obtained from one liter of the culture . 6 . 1 . 3 . preparation of the final formula for a dual preparation for use in eliminating molds and yeasts from the living environment three different versions of the preparation were used in order to prepare the final formula , differing in terms of their relative content of the bacillus amyloliquefaciens ccm1084 bacterium ; these three versions were designated using the abbreviated titles of molda , moldb , and moldc . the preparations were prepared for use in one pack containing 3 g of loose preparation ( bag a containing 1 g and bag b containing 2 g of loose preparation ). the components of individual preparations are shown in table 11 below . the test of the stability of the dual preparation for use in eliminating mold and yeasts from the living environment must ascertain whether both microbial components have acted negatively on each other during the period of storage of the prepared preparation , at the very least for the period of conducting in vitro and in vivo effectiveness tests . one pack ( 3 g ) of the preparation molda , moldb or moldc is re - suspended in 10000 ml of lukewarm water ( temperature of around 35 ° c .). after complete resuspension , 10 ml is taken to determine the germination of pythium and 1 ml to determine the cfu of the bacillus . in order to determine the cfu in the bacillus , we further dilute the sample using tenfold serial dilutions , and to determine the cfu we use undiluted preparation for molda ( dilution of 1 ×), 1 × dilution for moldb ( diluted of 10 ×) and 2 × dilution for moldc ( dilution of 10 2 ×). the stability test is conducted immediately after the preparation has been made and again after 1 , 2 , 3 , 4 , 5 and 6 months . it can be concluded from the result that the viability of pythium during six months of storage and subsequent use of the preparation first declined somewhat and then stabilized at a value corresponding to approximately 75 % of the originally - declared nominal value . by contrast , for bacillus there were no significant changes in the viability during the test period , viability remaining et almost the originally declared value . it can therefore be concluded that the emergence of any of the components of the dual preparation is not significantly affected by drying the original active components and storing them in the presence of silica gel . 6 . 3 effectiveness test of prepared mixtures with the use of an in vitro test . the aim of in vitro effectiveness tests is to prove that the combination of the pythium oligandrum m1 atcc38472 oomycete and the bacterium of the environment bacillus amyloliquefaciens will act synergically , meaning that there will be an increase in certain measurable in vitro activity of the pythium oligandrum oomycete . from this perspective , a standard laboratory test was chosen of suppressing the growth of contaminating aspergillus niger mold on walls . the actual conducting of the test consisted of the use of a standard application protocol , which is invariably commenced by re - suspending a dry preparation containing only pythium ( the biorepel preparation ) or one of the above - mentioned test preparations designated as molda , b or c . preparations were re - suspended in 250 ml of physiological saline solution of a temperature of around 35 ° c . and 12 . 5 ml of this suspension was then mixed directly with 12 . 5 ml of double - concentrate mixture for the preparation of mea agar plates . 10 5 fungal microconidia aspergillus niger was then applied evenly to the plates prepared in this way after cooling . after a week of cultivation at 28 ° c ., a reading was taken of the number of colonies formed in comparison with the control dish , whereby the reduction in the number of colonies in contrast to the control is a gauge of the effectiveness of pythium . the results of this test are shown below in table 12 . the results show that whereas pythium alone had a significant influence on suppressing the growth of yeasts in the experiment dishes , its combination with staphylococcus produced a further strengthening of the effect . the most effective preparation among the three pathogenic yeast strains under in vitro conditions was the moldb preparation , with the preparations termed molda and moldc achieving approximately 50 % of this effectiveness . with respect to the demanding nature of field tests , the most effective preparation , moldb , is proposed for further field tests . the example shown , for the use of the dual microbial preparation specified in this exemplary embodiment , is not limited to the elimination of mold or yeasts from the surrounding environment . this type of dual microbial preparation can be positively used as prevention of the incidence of mold and yeasts in the living and working environment , which could be important to people suffering from opportunistic microbial infections . the solution is intended for application to ensure a healthy oral cavity , on non - healing wounds such as varicose ulcers , on the skin and to suppress yeasts occurring on the above - mentioned places and on the mucous membrane of the urogenital tract and for other places on the human body , in particular on skin affected by fungal or yeast infections . aas j a , paster b j , stokes l n et al ( 2005 ) j clin microbiol 43 , 5721 - 5732 . ainamo j , barmes d , baegric d ( 1982 ) int dent j 32 , 281 - 289 . arabatzis m et al ( 2007 ) br j dermatol 157 , 681 - 689 . berezov a b , darveau r p ( 2011 ) periodontol 2000 55 , 36 - 47 . burne r a , zeng l , ahn s j et al ( 2012 ) adv dent res 24 , 77 - 80 . calderone r a , fonzi w a ( 2001 ) trends microbiol 9 , 327 - 335 . u . s . pat . no . 5 , 190 , 746 a ( issued mar . 2 , 1993 ), cassels j f , london j . cutting k f , white r ( 2004 ) br j community nurs 9 : s6 - s15 . debernardis f , liu h , o &# 39 ; mahony r et al ( 2007 ) j infect dis 195 , 149 - 157 . dewhirst f e , chen t , izard j et al ( 2010 ) j bacteriol 192 , 5002 - 5017 . ewma patient outcome group ( 2010 ) j wound care 19 , 239 - 268 . findley k , oh j , yang j et al ( 2013 ) nature 498 , 367 - 370 . frandin c , kretschmar m , nichterlein t et al ( 2003 ) mol microbiol 47 , 1523 - 1543 . gottrup e , apelqvist j , bjansholt t et al ( 2013 ) j wound care 22 , s1 - s89 . gow n a r , hube b ( 2012 ) curr opin microbiol 15 , 406 - 412 . grice e a , segre j a ( 2012 ) annu rev genomics human genet 13 , 151 - 170 . hajishengalis g , liang s , payne m a et al ( 2011 ) cell host & amp ; microbe 10 , 497 - 506 . holt s c , ebersole j l ( 2005 ) periodontol 2000 38 , 72 - 122 . kostov g , angelev m , denkova z et al ( 2011 ) eng life sci 11 , 517 - 527 . lang n p , adler r , joss a et al ( 1990 ) j clin periodontol 17 , 714 - 721 . wo 2013 / 122 931 a2 ( publ . 22 aug . 2013 ), lanzalaco a c , charbonneau d l , howard b w . liu b , faller r r , klitgoró n et al ( 2012 ) plos one 7 , e37919 . nakagawa y , ohno n , mural t ( 2003 ) j infect dis 187 , 710 - 713 . okuda k , kato t , ishihara k ( 2004 ) oral dis 10 , 5 - 12 . ca 2374938 a1 ( publ . 30 nov . 2000 ) reid g , bruce a . wo2008 / 077251 ( publ . 3 jul . 2008 ), smoragiewicz w , karska - wysocki , bazo , ruiz liquet . stapleton a e et al ( 2011 ) clin infect dis 52 , 1212 - 1217 . cz 302 297 b6 ( publ . 29 dec . 2010 ). suchánek m , klime { hacek over ( s )} r . teughels w , durukan a , ozcelik o et al ( 2013 ) j clin periodontol 40 , 1025 - 1035 . cz 9883 u ( publ . 14 apr . 2000 ). veselý , d , veselÿ l . wounds uk ( 2010 ) aberdeen : wounds uk 2010 . best practice statement use of topical antiseptic / antimicrobial agents in wound management . moskowitz s m , foster j m , emerson j et al ( 2004 ) j clin microbiol 42 , 1915 - 1920 . bruzual i , riggler p , hadley s et al ( 2007 ) j antimicrob chemother 59 , 441 - 450 .	0
as used herein , “ a ” or “ an ” means one or more . unless otherwise indicated , the singular contains the plural and the plural contains the singular . where the disclosure refers to “ perforations ” it should be understood to mean “ one or more perforations ”. as used herein , “ surface ” refers to locations at or above the surface of body of waters surface . the body of water can be a sea , ocean , lake , or ice body . as used herein , “ proximal ” refers to the position closer to the surface of the sea . as used herein , “ distal ” refers to a position that is in the opposite direction of the proximal position . as used herein , “ spool ” refers to a structural body of a well having connection positions on the distal end and the proximal end and comprising at least one passage through said body . as used herein , a “ blow out preventer ” stack or bop refers to devices used to control the fluid flow from wells . bop systems encompasses many configurations and arrangements of closure devices including but not limited to annular bags , shear rams , pipe rams , and various hydraulic and electrical devices used to actuate and control the bop stack . as used herein , a “ back pressure valve ” refers to a device that allows fluid to flow in only one direction . this device when placed in a well casing is sometimes known in the oil and gas grouting and cementing business as a float collar or float shore , wherein said back pressure valve is inserted into a piece of casing having , normally fixed with a cured cement grout , having threads on either end of said casing and the inserted into and near the bottom of a well casing string as it is deployed in a well such that fluids can be pumed down the casing but fluids from outside the casing cannot flow into the casing . as used herein “ connected ” includes physical , whether direct or indirect , permanently affixed or adjustably mounted connections . thus , unless specified , “ connected ” is intended to embrace any operationally functional connection . referring to fig1 , presents a subsea well system that has had a subsea blow out . fig1 further presents a novel new multipath apparatus 109 being predisposed on a subsea well head 104 being at the seafloor 103 . well casing 110 is shown being below the sea floor 103 and proceeds to subterranean depths where reservoir fluids are erupting upward though the failed bop 101 . the subsea well system in fig1 shows a failure of the marine riser 102 , which is shown in fig1 as having fallen down from its normal surface proximal termination point on a drilling rig down into the sea . the first drilling blow out preventer , bop stack , 101 has failed to close in the subsea well fluid flows . a bop may have many combinations of various closure apparatus designed to stop fluid flow from wells such as annular bags , pipe rams , and shear rams and in subsea applications they are deployed with various connectors , actuators , and controllers . due to the difficulty of the environment of subsea wells and the great risk to the environment the current practices is to deploy a plurality of these closure devices subsea such that they form a stack formed by connecting one upon the other for redundancy . the current industry teaches toward stacking these closure devices in combinations , one on top of the other , in various sequences . fig1 depicts a new method of constructing a completely independent path to the wellhead 104 that avoids the damage of bop 101 and riser 102 . furthermore , this invention method teaches deploying a second bop system 106 with a riser 107 connected to the multipath apparatus 109 and disposing a drill pipe 105 through the riser 107 , bop 106 , multipath apparatus 109 , wellhead 104 and into the well . the drill pipe 105 then allows the pumping of a fluid from the surface form a drilling rig or service supply vessel into the well killing the well blow out by the addition of this fluids hydrostatic weight . this failure of the bop 101 shown in fig1 can be caused by a variety of reasons , including but not limited to mechanical failure , electrical failure , hydraulic failure of the various devices in the bop 101 system , failure in human procedures to construct the bop 101 , poor maintenance of bop 101 , and a previous casing disposed in the well moving up through the bop 101 , resulting in fluid flowing up the well casing 110 through the wellhead 104 . in all the failure modes the result is that the bop 101 does not have the ability to close in the well fluid flows . this embodiment allows the blow out well to be killed as the method teaches to predispose a multipath apparatus 109 on subsea wellhead 104 . the failure of the riser 102 depicted in fig1 can be caused by a variety of reasons , including but not limited to mechanical failures , ocean currents , storms , failure of riser latching systems , and human error . a method taught herein of predisposing at least one multipath apparatus for drill pipe 105 to be deployed below the damaged bops 101 and damaged riser 102 . this redundant path from the surface through riser 107 , bop 106 , and a multipath apparatus 109 to the wellhead 104 avoids obstructions of riser 102 or bop 101 , allows removal of any obstruction , allows the milling out of obstructions , and allows the pumping of fluids through a functional and redundant bop 106 in the well . the proximal end 108 of the multipath apparatus is attached to the bop and the well head through hydraulic seals 108 a such as elastomeric and / or metal to metal seals . using hydraulic seals in connections between the wellhead and the riser at the surface creates a fluid tight connection protecting the outside environment from fluid leakages whilst also building a passage for conduits , fluids , wireline , from the surface into the subsea well . referring to fig2 , a new subsea apparatus is depicted and referred to herein as a multipath apparatus that has at least two entry ports 203 at the proximal end having a common exit path at the distal end 204 . the invention teaches to predispose the multipath apparatus 202 on a subsea well head . the apparatus 202 can be connected to the wellhead directly or to a wellhead hydraulic connector apparatus disposed on top of the wellhead . in either case the method of predisposing the multipath apparatus 202 prior to disposing bop stacks is a new construction method thereby providing a heretofore never know redundant path bop system to the wellhead . the method then teaches to connect the multipath apparatus 202 shown in fig2 on the distal end to a wellhead and the entry ports 203 at a proximal end to subsea bop systems and the distal ends of these bop systems to riser that have their proximal end at the surface . redundant bops and redundant risers can be connected in advance of a blow out and failure of the primary bops and riser , or can be deployed after a blow out and failure of the primary bop and riser system using known rig and remote operated submersible vehicle methods . however , the multipath apparatus is predisposing prior to any bop system on to the subsea wellhead system . referring fig2 , the new subsea multipath apparatus 202 has at least two branches 201 that have an internal diameter sufficient to allow the passage of drill pipe , drill pipe down hole assemblies like drilling motors , drill collars , drilling bits , a various directional tools . fig2 depicts a multipath apparatus having three entry ports 203 at the proximal end . it is clear that the multipath apparatus can have many multipath apparatus ports and resulting branches 201 . fig3 illustrates another embodiment of the invention . fig3 , depicts subsea well penetrating the seafloor 301 having more than one subsea multipath apparatus 302 and 310 . apparatus 302 has a subsea gate valve 309 to allow for it to be opened and closed . those familiar with the art of subsea operations may well want to include a plurality of valves like 309 and the valves can be operated by many means known to those familiar with the art of subsea drilling including remotely operated vehicles . fig3 presents a method of changing the fluid characteristics of the returning well fluids by mixing fluid pumped from the surface down drill pipe 303 disposed in riser 305 with fluid being pumped down a second fluid conduit deployed from surface inside riser 308 . the hydrostatic force of the fluid column in the well casing 307 can be reduced by pumping riser 308 fluid that has a lower density than riser 305 fluid , and mixing the two fluids in the subsea multipath apparatus 302 and allowing the mixed fluids to rise through the bop 306 through the riser 305 to surface . the bop 304 can close the annulus fluid path between the conduit inside of it and riser 308 , thereby forcing the lighter fluid of rise 308 to mix with the well fluid being pumped from surface down the drill pipe 303 and the combined fluids flow up to surface through bop 306 through the riser 305 . referring to fig3 the viscosity and hence the riser fluid &# 39 ; s ability to carry solids and earth cuttings to the surface can be enhanced by injecting a viscosifying fluid as the second fluid down the continuous conduit 311 deployed from surface through riser 308 and mixing in the subsea multipath apparatus 310 with the first fluid coming from the well wherein the first fluid is being pumped from surface through drill pipe 303 and the mixed fluids rising through riser 305 . the ability to improve the fluid viscosity of the mixed fluid in riser 305 formed in the subsea multipath apparatus 310 allows for lower viscosity fluids to be pumped from surface down drill pipe 303 which reduces the surface friction pressure for the surface pumps , as the velocity and hence fluid capacity to carry cuttings from the well is higher is often times higher in the well casing 307 by drill pipe 303 annulus than it is in the riser 305 . fig4 shows a subsea well hydraulic system for grouting or drilling a subsea well bore . a method for grouting a subsea well bore may include deploying a well casing 407 comprising a back pressure valve assembly through the seafloor into a subsea well bore . then , deploying a continuous conduit 412 through at least one bop 414 . then , pumping a well fluid followed by a grout from the surface down said continuous conduit 412 into said well casing 407 and into the casing outer diameter in said subsea wellbore . then , displacing with fluids pumped from the surface said continuous conduit 412 inside said casing 407 . then , returning said fluids up the well bore by a casing annulus through said subsea multipath subsea apparatus 405 and riser to the surface . then , injecting from surface a second fluid down a second continuous conduit 402 having a proximal end at the surface and deployed through a second rise conduit 403 , through a second blow out preventer 404 , having the distal end of said conduit in or near the multi - path apparatus 405 . then , mixing subsea and returning said second fluid with said first fluid being injected from surface down first continuous conduit 412 up said casing outer diameter in subsea well bore casing wellhead multipath apparatus 405 and riser conduit to surface . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , subsea deployment means , subsea control systems , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skilled in the art will readily appreciate from the disclosure of the present invention , processes , devices , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , devices , manufacture , compositions of matter , means , methods , or steps .	4
the present invention is explained in further detail below with reference to the examples . using a reaction tube made of sus having an inside diameter of 50 mm and a length of 128 cm , 530 g of a catalyst containing pd supported on activated carbon ( the amount of pd supported : 0 . 1 % by weight ( the total amount of the carrier and pd is defined as 100 % by weight ) ( 0 . 1 wt % pd / c catalyst ) was placed in the area within the range of about 10 to 70 cm from the entrance of the reaction tube and 530 g of a catalyst containing pd supported on activated carbon ( the amount of pd supported : 0 . 25 % by weight ) ( 0 . 25 wt % pd / c catalyst ) was placed in the area within the range of about 70 to 120 cm from the entrance . the catalysts were dried at 150 ° c . and reduced by flowing hydrogen at 200 ° c . beforehand . after heating the reaction tube described above to about 260 ° c . using a heater , cf 3 cf 2 ch 2 cl ( hchc - 235 cb ) and hydrogen were supplied therein at a rate of 945 ml / min ( the flow rate at 0 ° c . and 0 . 1 mpa , the same applies to the following ) and 1 , 920 ml / min respectively . the exit gas from the reactor was analyzed by gas chromatography , with the result that the conversion of cf 3 cf 2 ch 2 cl ( hcfc - 235 cb ) was 94 . 5 % and the selectivity of cf 3 cf 2 ch 3 ( hfc - 245 cb ) was 96 . 9 %. the maximum temperature inside the reactor was 336 ° c . this method obtained the target product , i . e ., cf 3 cf 2 ch 3 ( hfc - 245 cb ), at a rate of 865 ml / min ( 0 . 82 ml / min / g - cat ). 1 , 059 g of catalyst containing pd supported on activated carbon ( the amount of pd : 0 . 25 % by weight ) ( 0 . 25 wt % pd / c catalyst ) was placed in a reaction tube made of sus having an inside diameter of 50 mm and a length of 128 cm . the catalyst was dried at 150 ° c . and reduced by flowing hydrogen at 200 ° c . beforehand . after heating the reaction tube described above to about 260 ° c . using a heater , cf 3 cf 2 ch 2 cl ( hcfc - 235 cb ) and hydrogen were supplied therein at a flow rate of 702 ml / min and 1 , 991 ml / min respectively . the exit gas from the reactor was analyzed by gas chromatography , with the result that the conversion of cf 3 cf 2 ch 2 cl ( hcfc - 235 cb ) was 95 . 5 % and the selectivity of cf 3 cf 2 ch 3 ( hfc - 245 cb ) was 96 . 7 %. the maximum temperature inside the reactor was 381 ° c . this method obtained the target product , i . e ., cf 3 cf 2 ch 3 ( hfc - 245 cb ), at a rate of 648 ml / min ( 0 . 61 ml / min / g - cat ). in example 1 and comparative example 1 , almost the same amounts of catalysts were used . however , in example 1 , the half amount thereof was a catalyst having low catalytic activity . comparing the results of example 1 to those of comparative example 1 , the conversion rate of the starting material and the selectivity of fluorine - containing alkane were almost the same ; however , the temperature rise in the reactor was suppressed in example 1 compared to comparative example 1 . as a result , in contrast to comparative example 1 wherein the introduction amount of the starting material could not be increased , the introduction amount of the starting material in example 1 could be increased , enhancing the production amount of the target product , i . e ., cf 3 cf 2 ch 3 ( hfc - 245 eb ) per unit time . using a reaction tube made of sus having an inside diameter of 25 mm and a length of 140 cm , 100 g of a catalyst containing pd supported on activated carbon ( the amount of pd supported : 0 . 2 % by weight ) ( 0 . 2 wt % pd / c catalyst ) was placed in the area within the range of about 10 to 50 cm from the entrance of the reaction tube , 100 g of catalyst containing pd supported on activated carbon ( the amount of pd supported : 0 . 3 % by weight ) ( 0 . 3 wt % pd / c catalyst ) was placed in the area within the range of about 50 to 90 cm from the entrance of the reaction tube , and 100 g of catalyst containing pd supported on activated carbon ( the amount of pd supported : 0 . 6 % by weight ) ( 0 . 6 wt % pd / c catalyst ) was placed in the area within the range of about 90 to 130 cm from the entrance of the reaction tube . the catalysts were dried at 150 ° c . and reduced by flowing hydrogen at 200 ° c . beforehand . from the entrance of the reaction tube where the 0 . 2 wt % pd / c catalyst was placed , hexafluoropropene ( cf 3 cf ═ cf 2 ) and hydrogen were flowed into the reaction apparatus described above at flow rates of 1 , 597 ml / min and 2 , 256 ml / min respectively . the internal temperature of the reaction tube when the hydrogen and hexafluoropropene were introduced was 25 ° c . the exit gas from the reactor was analyzed by gas chromatography , with the result that the conversion of hexafluoropropene was 98 . 9 % and the selectivity of cf 3 chfchf 2 ( hfc - 236 ea ) was 100 %. the maximum temperature inside the reactor was 268 ° c . this method made it possible to obtain the target product , i . e ., cf 3 chfchf 2 ( hfc - 236 ea ), at a rate of 1 , 578 ml / min ( 5 . 26 ml / min / g - cat ). 270 g of catalyst containing pd supported on activated carbon ( the amount of pd supported : 3 % by weight ) ( 3 wt % pd / c catalyst ) was placed in a reaction tube made of sus having an inside diameter of 25 mm and a length of 120 cm , followed by ice - cooling . the catalyst was dried at 150 ° c . and reduced by flowing hydrogen at 200 ° c . beforehand . into the reaction tube described above , hexafluoropropene and hydrogen were supplied at flow rates of 769 ml / min and 1 , 662 ml / min respectively . the internal temperature of the reaction tube when the hydrogen and hexafluoropropene were introduced was 0 ° c . the exit gas from the reactor was analyzed by gas chromatography , with the result that the conversion of hexafluoropropene was 100 % and the selectivity of cf 3 chfchf 2 ( hfc - 236 ea ) was 99 . 6 %. the maximum temperature inside the reactor was 293 ° c . this method made it possible to obtain the target product , i . e ., cf 3 chfchf 2 ( hfc - 236 ea ), at a rate of 764 ml / min ( 2 . 83 ml / min / g - cat ). in example 2 and comparative example 2 described above , reaction apparatuses having almost the same size were used and the amounts of catalyst used were also almost the same . the difference lies in that three types of catalysts having different activities were used in example 2 but a single catalyst having high activity was used in comparative example 2 . comparing the results of example 2 to those of comparative example 2 , the conversion rate and selectivity were almost the same level . however , in comparative example 2 , regardless of the use of an ice - cooled reaction tube , the temperature significantly rose during the reaction ; therefore , the introduction amount of the starting material could not be increased . in contrast , although no ice - cooling or like active cooling was performed , the temperature rise in the reaction tube was suppressed in example 2 . this allowed the introduction amount of the starting material to be increased , enhancing the production amount of the target product , i . e ., cf 3 chfchf 2 ( hfc - 236 ea ) per unit of time . using a reaction tube made of sus having an inside diameter of 25 mm and a length of 140 cm , 100 g of catalyst containing pd supported on activated carbon ( the amount of pd supported : 0 . 2 % by weight ) ( 0 . 2 wt % pd / c catalyst ) was placed in the area within the range of about 10 to 50 cm from the entrance of the reaction tube , 100 g of catalyst containing pd supported on activated carbon ( the amount of pd supported : 0 . 3 % by weight ) ( 0 . 3 wt % pd / c catalyst ) was placed in the area within the range of about 50 to 90 cm from the entrance of the reaction tube , and 100 g of catalyst containing pd supported on activated carbon ( the amount of pd supported : 0 . 6 % by weight ) ( 0 . 6 wt % pd / c catalyst ) was placed in the area within the range of about 90 to 130 cm from the entrance of the reaction tube . the catalysts were dried at 150 ° c . and reduced by flowing hydrogen at 200 ° c . beforehand . the reaction tube described above was heated to 150 ° c . using a heater , and cf 3 cf ═ chf ( hfc - 1225 ye ) and hydrogen were flowed at 1 , 032 ml / min and 2 , 515 ml / min respectively from the entrance of the reaction tube where 0 . 2 wt % pd / c catalyst was placed . the internal temperature of the reaction tube was 150 ° c . when the hydrogen and pentafluoropropene were introduced . the exit gas from the reactor was analyzed by gas chromatography , with the result that the conversion of cf 3 cf ═ chf ( hfc - 1225 ye ) was 98 . 0 % and the selectivity of cf 3 chfch 2 f ( hfc - 245 eb ) was 99 . 4 %. the maximum temperature inside the reactor was 292 ° c . this method made it possible to obtain the target product , i . e ., cf 3 chfch 2 f ( hfc - 245 eb ), at a rate of 1 , 005 ml / min . 38 g of catalyst containing pd supported on activated carbon ( the amount of pd supported : 3 % by weight ) ( 3 wt % pd / c catalyst ) was placed in a reaction tube made of sus having an inside diameter of 20 mm and a length of 68 cm . the catalyst was dried at 150 ° c . and reduced by flowing hydrogen at 200 ° c . beforehand . into the reaction tube described above , cf 3 cf ═ chf ( hfc - 1225 ye ) and hydrogen were flowed at flow rates of 267 ml / min and 1 , 065 ml / min respectively . the internal temperature of the reaction tube when hydrogen and pentafluoropropene were introduced was 25 ° c . the exit gas from the reactor was analyzed by gas chromatography , with the result that the conversion of cf 3 cf ═ chf ( hfc - 1225 ye ) was 99 . 5 % and the selectivity of cf 3 chfch 2 f ( hfc - 245 eb ) was 98 . 9 %. the maximum temperature inside the reactor was 245 ° c . this method made it possible to obtain the target product , i . e ., cf 3 chfch 2 f ( hfc - 245 eb ), at a rate of 262 ml / min . in example 3 and comparative example 3 described above , reaction apparatuses with different sizes were used . due to the large amount of heat generated , a larger reaction apparatus could not be used in comparative example 3 . as to the catalyst , three types of catalysts having different catalytic activities were used in example 3 , but a single catalyst having high activity was used in comparative example 3 . as a result , because a large amount of heat was generated by the reaction , the amount of catalyst used was limited in comparative example 3 . comparing the results of example 3 to those of comparative example 3 , they are similar in the conversion rate and selectivity , but due to the heat generated , the introduction amount of the starting material could not be increased in comparative example 3 . in contrast , in example 3 , the temperature rise in the reaction tube was suppressed ; therefore , the production amount of cf 3 chfchf 2 ( 236 ea ) per unit of time was increased .	2
referring to fig1 a , a memory cell in accordance with the invention comprises a first photodiode ( pin 1 ) referenced 10 and a second photodiode ( pin 2 ) referenced 12 , together with an optical switch 14 . the photodiode 10 is reverse biassed at its negative electrode from a biassing source 16 and is connected at its positive electrode to the negative electrode of the second photodiode 12 , which is connected to earth 18 at its positive electrode . the optical switch 14 is connected in parallel with the second photodiode 12 . the figure also shows the circuit paths which include the current generators 20 , 22 producing the dark current which flows at pin 1 and of the combined dark current of pin 2 and the reverse current of the optical switch in the absence of incident light , and in broken line at 24 , 26 . under the conditions shown in fig1 ( logical ` 0 ` ), a voltage of about 0 . 9u 1 exists across the first photodiode 10 and about 0 . 1u 1 across the second photodiode 12 , where u 1 is the voltage of the biassing source 16 . for completeness fig2 shows the equivalent electrical circuit diagram of the memory cell and which , in conjunction with fig1 a , 1b and 1c , will assist understanding of the manner of electrical operation of the device . in fig1 b and 1c , it is presumed that u 1 is equal to 1 volt . when light is applied to pin 1 , photocurrent begins to flow ( the current generator 31 in the equivalent circuit of fig2 where 30 , 32 indicate the dynamic resistances of the pins ). the magnitude of this current source is proportional to the radiant flux being detected by the photodiode . of course , if the photodiode has a small forward bias the photocurrent will not flow ( see current / voltage characteristic of fig3 a ). this photocurrent will start to charge capacitors c 1 , c 2 , c 0 ( 24 , 26 , 28 in fig1 a and 2 ) and therefore reverse bias across the first photodiode 10 will start to decrease while reverse bias across the second photodiode 12 will increase . from fig3 a it is apparent that the photocurrent will slightly change as reverse bias is decreasing , until the diode operates in the reverse bias region , the reason for this being the large but finite dynamic resistance of the photodiode . for completeness , fig3 b shows how the voltages across pin 1 and pin 2 are changing . from fig3 a it can be seen that the static operating point of pin 1 is moving on the i / u characteristic to the right ( towards u pin 1 = 0 ) while the static operating point of pin 2 is moving to the opposite side . this process will not end when pin 1 reaches zero bias , because it operates under small forward bias also but with the rapidly decreasing photocurrent , but at small forward bias , dependent on diode type , the forward dark current becomes equal to the small reverse photocurrent . c 2 is now charged and pin 2 ( 12 ) is operating under a condition of reverse bias , while pin 1 ( 10 ) is &# 34 ; off &# 34 ;, thus pin 2 can only be discharged by applying light to pin 2 . in this case an analogous operation occurs , except that the photocurrent flows in the opposite direction ( see fig2 second current generator 33 in dashed line is now operating ). it will be understood that the memory cell access time thus in part depends on the magnitude of the biassing source u 1 ( the position of the static operating point on the i / u characteristic ), the capacities of the pins and the optical switch , and the photocurrent ( i . e . the applied light radiation ). the presence or absence of charge on a capacitor ( c 1 or c 2 ) is interpreted as a logical ` 1 ` or ` 0 `. because of the natural tendency to distribute itself into a lower energy - state configuration , and the dark current of pin 2 ( which tends to discharge c 2 ), the memory cell requires periodic charge refreshing to maintain data storage . assuming that discharging of c pin2 is mainly due to the dark current of pin 2 then the frequency for refreshing is readily determinable . fig1 a shows the normal logical ` 0 ` condition , whilst fig1 b and 1c illustrate temporary logical ` 0 ` and normal logical ` 1 ` situations , as will be made clear in the following description of the manner of writing into and reading from the memory cell . when the memory cell is addressed , then two possibilities exist . one is that most of the voltage is on pin 1 ( logical ` 0 ` in which light cannot pass through the optical switch ) and the second is the opposite in which most of the voltage is on pin 2 and the optical switch ( logical ` 1 `, in which light can pass through the optical switch ). addressing a memory cell means that this particular cell is exposed to the incident light . the manner in which this is done is described later . given the situation shown in fig1 a , if pin 1 is exposed to incident light then the photocurrent will flow through it and after a very short time the situation will change to that shown in fig1 c ( logical ` 1 ` ). if the situation is that shown in fig1 c and light is applied to pin 1 then no action results because pin 1 is not operable ( see fig3 a and 3b ). considering the situation shown in fig1 c , but this time light being applied to pin 2 , which is operable , then it is apparent that the photocurrent will discharge both c 2 and c 0 . the situation is now as shown in fig1 b . thus , both fig1 a and 1b represent a condition in which the memory has a logical ` 0 ` condition . in fact , fig1 a and 1b represent two edge conditions of the same situation of logical ` 0 `. this situation must exist until it is changed from the outside ( by addressing / writing ). a logical ` 1 ` can be written in the memory cell by exposing pin 1 to the incident light . if logical ` 1 ` is written and it is wished to write a logical ` 0 ` instead , then the light is applied to pin 2 and after a very short time u c =- 0 . 1v ( see fig1 b ). after that 1 dark on pin 1 causes a very slow change of u c from u c =- 0 . 1v to u c =+ 0 . 1v ( fig1 a ) but data logical ` 0 ` remains . for reading , the optical switch of the memory cell is exposed to the incident light . the light can pass or not , depending upon a data stored in the cell . if light passes through the optical switch it is detected by a third photodiode pin 3 . existence of a pin 3 photocurrent represents a reading of logical ` 1 `. otherwise ( no photocurrent on pin 3 ) it is a logical ` 0 `. fig4 shows the complete circuit incororating pin 3 , referenced 40 . when photocurrent flows it causes the voltage drop across resistance r l , referenced 42 , the transistor 44 acting to amplify the signal . in fact , the transistor 44 acts as a preamplifier in a typical optoelectric receiver and it is followed by one or two amplifying stages . the receiver is not considered in detail because it is conventional in the art . the detector 40 is connected to all the photodiodes pin 3 appertaining to all memory cells in one column of a complete memory device . refreshing is necessary when a logical ` 1 ` is stored in the memory cell , and refreshing is equivalent to periodic reading of one row of cells . during refreshing , all the optical switches of one row of memory cells are exposed to the light and if a logical ` 1 ` is stored the light can pass through that optical switch and be absorbed in the corresponding photodiode pin 1 . this action is also diagrammatically indicated in fig4 . it is important to stress that refreshing does not interfere with reading the addressed memory cell . refreshing can occur at the same time as reading is performed . however , no additional circuitry , such as arbiter for instance , is required ( as in a conventional dram ). during refreshing , as above stated , if a logical ` 1 ` is stored light can pass through the optical switch and is absorbed in pin 1 causing a photocurrent . this photocurrent is weak , because just a small quantity of the light can pass through the optical switch . the refreshing cycle time is calculated as the time which elapses for the fully charged capacitance ( c 2 in parallel with c 0 ) to discharge , by leakage including dark current at pin 2 , to 90 percent of the full charge . if the refreshing cycle time ( time between two refreshing pulses ) is equal to the time that passes after a logical ` 1 ` is stored , then the photocurrent at pin 1 will charge c 2 + c 0 to full charge again ( fig4 ). if refreshing occurs just after logical ` 1 ` is stored then no refreshing is necessary and actually no refreshing will occur , because c 2 + c 0 is fully charged and pin 1 is under a small forward bias ( fig1 c ) and photocurrent cannot flow nor charge c 2 + c 0 . it is apparent that refreshing will always charge c 2 + c 0 to full charge but not more , because photocurrent causing the refresh operation stops when c 2 + c 0 is fully charged . parasitic photocurrent at the optical switch is readily compensated in calculation of the refresh cycle time . addressing the memory cell may be performed by an x , y addressable led array ( see fig5 a ). instead of pnp and npn bipolar transistors 70 fets may be used as drivers for the leds 72 . alternatively , an led array arranged as in fig5 b may be employed . moreover , although there are other possibilities for addressing the memory , such as by optoelectronic means , the arrangements of fig5 a and 5b are the simplest . fig5 c shows another possibility . leds 56 from one row are serially of pnp connected . impulses from the y address decoder 58 drive these leds 56 . the optical switches 60 from one column are connected in parallel . this possibility is acceptable only if high efficiency optical switches are employed ( integrated optics ). employing an x , y addressable array for addressing ( reading ) gives one major advantage over a conventional dram , because when addressing the memory cell the input capacitance of one transistor only has to be loaded ( see fig5 a ) while in conventional drams x capacitances have to be loaded . this advantage significantly improves the memory access time . refreshing is separated from addressing ( reading ). as can be seen from fig5 d , x leds ( or x led chains - each chain containing y serially connected leds , each led for one memory cell in one row ), each for one row , may be driven periodically with the refreshing generator pulses . ordinarily , refreshing periodically refreshes row by row ( or column by column ), due to refreshing pulses from a pulse generator ( which is completely independent of a microprocessor &# 39 ; s clock ) which may be integrated on the same chip as the memory , or alternatively refreshing pulses may be generated by a microprocessor . in the led array shown in fig5 a , the anode drivers are pnp transistors 70a and the cathode drivers 70b are npn transistors . the arrangement of fig5 b avoids the requirement for a low active input for the anode drivers of fig5 a . writing in the memory cell can be performed by using two additional x , y addressable led arrays . fig5 e shows a circuit which performs the act of writing logical ` 1 ` in an addressed cell . for writing a log . ` 0 `, the circuit is identical . the leds in an led array performing reading are optically coupled with the optical switches and photodetectors ( pin 3 ), as indicated diagrammatically in fig4 and leds for writing are optically coupled with the photodiodes ( pin 1 and pin 2 ), respectively . refreshing leds are optically coupled with the optical switches and with pin 1 photodiodes through these optical switches . in considering the memory cell the terms &# 34 ; leds &# 34 ;, &# 34 ; pins &# 34 ; and &# 34 ; optical switches &# 34 ; have been employed . in fact , any type of light emitter ( light emitting diodes , laser diodes ) and detectors ( photodiodes ) can be used in construction of the device . the only difference that arises , from the use of different elements , is in physical fabrication of the device . the optical switch is the key element in the memory cell structure . two types of optical switches , both in themselves known , may be employed . one is a ga - al - as pin junction light - waveguide modulator and the other is a silicon planar pn junction or mos structure . both are , in fact , optical modulators . light - waveguide electro - optical modulators are known for use in integrated optic structures , with wavelengths in the near infrared part of the light spectrum . pn junction modulators , based on free carrier absorption ( fca ), are commonly used as discrete elements , especially in the infrared part of the spectrum . realisation of the device using pn or mos optical switches is particularly preferred since silicon is used as a material ( as well as ga - as ) for construction of such a hybrid device . in describing the memory cell and its operation it was presumed that the optical switch is an ideal element , i . e . if it is under bias ( logical ` 1 `) light can pass through it and if it is not under bias ( logical ` 0 `) light cannot pass through it . however , it is difficult to obtain an ideal property in practice . a major advantage of the memory cell structure is that such a property ( ideal light switching ) is not necessary . this means that practically any type of light modulators can be used . thus , turning again to fig4 in the read operation , if logical ` 1 ` is stored in the memory cell , light can pass through the optical switch and it is then detected by pin 3 . if a logical ` 0 ` is stored , then light can also pass through but this time in a smaller quantity than if a logical ` 1 ` were stored . thus , the amount of photocurrent at pin 3 determines whether it is a logical ` 0 ` or ` 1 `. the write operation is performed directly between leds and pin 1s and pin 2s , and optical coupling is not performed through the optical switch . refreshing is performed through the optical switch , but in this case , when logical ` 1 ` is stored , light can pass through the optical switch and strike the surface of pin 1 causing the refreshing photocurrent . the problem that arises when a logical ` 0 ` is stored is that the voltage is across c 1 and the photocurrent from pin 1 tends to discharge it . thus , when a logical ` 0 ` is stored , a refreshing photocurrent is unwanted , and may change the stored data ( after few refreshing cycles ). this problem is easily overcome if part of the led diode performing refreshing is also optically coupled through the optical switch with pin 1 and part of it , directly , with pin 2 . if logical ` 0 ` is stored and refreshing occurs , the photocurrent of pin 1 will be compensated by the photocurrent of pin 2 . of course , it is necessary that the same or appropriate amounts of light strike the surfaces of both pin 1 and pin 2 . if logical ` 1 ` is stored , then the amount of light striking the surface of pin 2 is unchanged , but the amount of light passing through the optical switch and striking the surface of pin 1 is now larger , thus causing the photocurrent from pin 1 to be larger than the photocurrent from pin 2 . refreshing occurs as a result . various possibilities exist for physical fabrication of the above described memory device and apparatus . thus , such a memory can be made as a hybrid device in which the device consists of three or possibly two monolithically integrated parts . in one arrangement , all leds are integrated out of ga - as on the common substrate , whilst all photodiodes and transistors are integrated on the same silicon substrate . mos sos ( metal oxide semiconductor silicon on sapphire ) technology is alternatively possible , since mos absorbents can be integrated on the sapphire substrate . ga - as and silicon parts are electrically isolated and optically coupled , due to the thin silicon dioxide film grown on the silicon part . this construction is similar to known integrated opto - isolators where a ga - as part ( led ) and an si part ( integrated photodiode and amplifier ) are electrically isolated and optically coupled , with a transparent isolation medium . it may also prove possible to integrate all silicon parts ( absorbents and photodiodes ) on the same silicon substrate . this may possibly be done with homoepitaxial growth of high resistivity ( intrinsic ) silicon on the silicon substrate , already carrying integrated photodiodes . this high resistivity silicon would then act as an electrical isolator between active silicon layers . electrical connections between mos absorbents and photodiodes may be made after etching holes in the insulating ( intrinsic ) layer . in fact this technology is at least equally acceptable in the case of ga - as , since ga - as exhibits greater resistivities . alternatively , a wholly monolithic approach may be made , in which all the various components are generated in ga x al 1 - x as / gaas structure , which technique is well suited to mass production fabrication . with regard to the monolithic integration of leds , x , y addressable led arrays integrated on ga - as substrates are already in use for microprocessor controlled displays . heteroepitaxial growth of semiconductor films on oxide substrates is also rapidly developing technology , since there are no substrate capacitances between elements and the substrate , which acts as the insulator . this enables higher speed of responses and isolation between components is also better . technologies also exist for integration of ga - as active devices on oxide ( sapphire among other ) substrates . this technology has many advantages and it is therefore very attractive for application to the memory cell of this invention . yet again , the device may be quasimonolithically integrated in ga - as and si ( side by side ) on sapphire technology . in this case , planar optical switches ( mos absorbents ) are replaced with light - waveguide switches ( electro - optic modulators ) and leds are replaced with laser diodes . si photodiodes in this case detect light from the sides . this construction of device , although disadvantageous in some ways , has the major advantage of short memory access time . optical switches commonly used in integrated optics are very efficient and there is no need for an optoelectronic receiver ( which lengthens the device access ). also , laser diodes can be switched with higher frequencies than leds . if low efficiency optical switches ( mos absorbents , based on fca , for example ) are employed , reading the memory cell requires an optoelectronic receiver with high gain and high speed . optoelectronic receivers as are commonly used in various integrated opto - isolators and optical communication systems are suitable . all pin 3s from memory cells in one column are connected in parallel . thus , x optoelectronic receivers are needed when x is the number of columns in the memory . all receiver outputs are connected in parallel ( see fig4 ). thus , transistors &# 39 ; outputs are connected in parallel and , since the transistor output capacitance is much smaller than input capacitance , the total output capacitance is approximately equal to the input capacitance due to the miller effect and the photodiodes ( one column ) capacitance . this is important for determining the receiver input and output time constants which in turn determine the receivers participation in access time . regarding power dissipation , when the memory cell is addressed and the read operation is performed , two transistors ( x , y led drivers ), one led and x receivers are active , thus determining the power dissipation . it may be convenient to use silicon avalanche photodiodes ( apds ) instead of pin 3s . for the transistor amplifier , it is preferred to operate as a voltage than a current amplifier , subject to maintaining an adequate speed of response of the receiver . an access and cycle time of approx . 10 ns is preferred . in order to minimise power dissipation , it is possible to make only one receiver active . the addressing pulse ( determining the column ) may bias one receiver only ( besides the proper led driver ). there is also a possibility , when apds are used , to use a different approach , as will be understood from fig6 . in this case a receiver is not required . in the photodetector from fig4 r l is replaced by an led ( 80 ). photocurrent from apd 3 ( pin 3 ) flows through the led , causing a voltage drop across r led , through which c apd 3 · y ( y = number of rows ) is charged . the time constant is unimportant since there is no amplifier as a load , and the additional optoelectronic conversion does not affect the access time . the above embodiments of the invention have been given by way of example only and various modifications thereof are possible within the spirit and scope of the invention , as will be readily apparent to those skilled in the art . for example , fig7 shows an obvious modification of the basic memory cell clearly equivalent to that of fig1 a to 1c . fig8 is included to illustrate the manner of operation of the memory cell , when the cell is viewed in diagrammatic cross - section . fig9 shows the structure in more detail , in the case of a hybrid device consisting of a sandwich structure of three integrated ( two monolithically ) parts . optical coupling and optical isolation between logic functions are primarily achieved by virtue of the spatial arrangement . in this connection , it will be understood that the light pattern emanating from the gaas leds is of the lambertian type and only the correct photodiode ( pin ) will be energised . the relatively large surfaces of the photodiodes ( pins ) are also important . sio 2 is optically transparent , and sapphire ( al 2 o 3 ) is substantially transparent , whereby substantially all light absorption takes place in the optical switch ( mos fca ). possible refraction problems can be overcome by etching holes in the sio 2 and sapphire , for light transmission , if desired . in contrast , it will be appreciated that , in fully integrated electro - optics technology , the desired optical coupling and optical isolation are achieved in known manner by waveguiding between components disposed side by side . the only possible problem which arises is the use of the optical switch for both refreshing and reading , simultaneously . a solution to this problem is illustrated in fig1 , which employs two optical switches 51 , 52 which are physically and optically separated but electrically connected in parallel so that , as with the additional photodiode 10a , the manner of operation is unchanged from that previously described . fig1 is applicable to both integrated and hybrid structures of the device in accordance with the invention . when , as hereinbefore mentioned , the optical switch is constituted by an electro - optic modulator , then a modulation depth of 70 percent is possible in either of two ways , respectively illustrated in fig1 and 12 , of which the latter is preferred . the arrangement of fig1 utilises two different zener or avalanche breakdown diodes 54 of 5 . 4v breakdown voltage , each connected reversely in parallel with pin1 and pin2 , enabling the controlling voltage to be varied between desired limits , as compared to 0v and u 1 v in the arrangement of fig1 . in the aforedescribed examples , the use of a ph junction fca modulator as the optical switch has generally been assumed , but this is not an essential characteristic of the invention . pn fca optical switches are planar structures with light applied perpendicularly on the pn junction ( without waveguiding ) which , in this application , employ both interband absorption ( which is constant ) and free carrier absorption ( fca ) which is variable due to change in voltage applied on the pn junction and thus change in the depletion layer width . pn fca optical switch , in this application , has a very small efficiency but this is irrelevant in this application ( refreshing can be performed very frequently because it is independent of other operations and thus weak refreshing photocurrent is irrelevant ). mos fca structures are more desirable since there is no parasitic photocurrent ( which is due to interband absorption ), because of oxide between gate and a substrate .	6

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.